CN101781636A - Proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene, construction method and application thereof - Google Patents

Proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene, construction method and application thereof Download PDF

Info

Publication number
CN101781636A
CN101781636A CN200910045514A CN200910045514A CN101781636A CN 101781636 A CN101781636 A CN 101781636A CN 200910045514 A CN200910045514 A CN 200910045514A CN 200910045514 A CN200910045514 A CN 200910045514A CN 101781636 A CN101781636 A CN 101781636A
Authority
CN
China
Prior art keywords
adenovirus
gene
type
sequence
proliferous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN200910045514A
Other languages
Chinese (zh)
Inventor
钱其军
苏长青
李琳芳
吴红平
吴孟超
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oriental Hepatobiliary Surgery Hospital Second Military Medical University Of Chinese Pla
Second Military Medical University SMMU
Original Assignee
Oriental Hepatobiliary Surgery Hospital Second Military Medical University Of Chinese Pla
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oriental Hepatobiliary Surgery Hospital Second Military Medical University Of Chinese Pla filed Critical Oriental Hepatobiliary Surgery Hospital Second Military Medical University Of Chinese Pla
Priority to CN200910045514A priority Critical patent/CN101781636A/en
Publication of CN101781636A publication Critical patent/CN101781636A/en
Pending legal-status Critical Current

Links

Images

Abstract

The invention relates to gene engineering and virology, in particular to a proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene of a human B subset, a construction method and application thereof. The oncolytic adenovirus can be 11 type adenovirus or heterozygous adenovirus constructed by utilizing the coding sequence of 11-type adenovirus cilia protein to replace the coding sequence of non-11 type adenovirus cilia protein. The adenovirus has selective multiplication capacity by carrying out effective control or mutation on genes essential to proliferation. As a conditional proliferous type combination virus with wider spectrum of infection and improved infectious ability, the recombination oncolytic adenovirus of the invention can be used for gene treatment, in particular to tumor gene treatment.

Description

A kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, its construction process and uses thereof
Technical field
The present invention relates to genetic engineering and virusology, relate in particular to a kind of proliferous type recombination oncolytic adenovirus that contains human B subgroup 11 type adenovirus cilia protein genes, its construction process and uses thereof.This adenovirus can be 11 type adenovirus, also can be that aminoacid sequence with 11 type adenovirus cilium heads replaces the cilium head aminoacid sequence of non-11 type adenovirus and the heterozygosis adenovirus that constitutes.This adenovirus has the selective proliferative ability by effective control or the sudden change that its propagation must gene be carried out.As the recombinant virus of the condition proliferous type with wider pattern of infection and improvement infection ability, recombination oncolytic adenovirus of the present invention can be used for especially genetic treatment of tumor of gene therapy.
Background technology
Malignant tumour is a big class disease of serious threat human life health, and along with The development in society and economy, the primary hazard factor of tumour not only is not effectively controlled, and grows in intensity on the contrary, is that its M ﹠ M continues to rise.The conventional treatment of malignant tumour is difficult to receive that the therapeutic index of the curative effect of expection, particularly chemotherapeutics is low at present, and toxic side effect is big.In recent years, the complex therapy that comprises gene therapy became a part indispensable in the clinical tumor.The recombinant adenovirus p53 injection liquid " Ad-p53 " of China becomes gene therapy for cancer medicine (Wang X etc., the Mol Cancer Ther.2008Jun of first listing in the world in listing in 2004; 7:1598-1603).
Adenovirus is the most frequently used virus vector of therapy of tumor, and it is a kind of double-stranded DNA virus, and genome is about 36kb, and capsid (capsid) is 20 body structures of rule, the about 80-110nm of diameter.Capsid contains 240 six conjuncted (hexon), 12 5-linked bodies (penton) and 12 ciliums (fiber), in addition also has some other small protein, as VI, VIII, IX, III a and IV a2 etc.Six conjuncted be the major protein that forms 20 gores of viral capsid, 12 tops are 5 5-linked body subunits and 3 mixtures that cilia protein constitutes, 12 ciliums (Fiber) are that substrate is stretched out by the capsid surface with the 5-linked body protein, and the cilium top forms cephalomere district (knob).The cephalomere district of 5-linked body and cilium can combine with the virus receptor of cell surface, plays important effect (Gall JG etc., J Virol.1998 Dec in the virus infected cell process; 72:10260-10264; Sakurai F etc., Curr Gene Ther.2007Aug; 7:229-238).
There are 51 known serotypes in human adenovirus family, is divided into 6 subgenus (A-F).The people's that gene therapy is commonly used 2 types (Ad2) and 5 types (Ad5) adenovirus all belong to the C subgroup on serological classification, 95% homology is arranged on dna sequence dna.The process of adenovirus infection cell is that the specific receptors that the cephalomere district from the adenovirus cilium adheres to cell surface begins.The shared a kind of acceptor of C subgroup adenovirus major and CBV, therefore this acceptor be called as COxsackie/adenovirus receptor (coxsackie/adenovirus receptor, CAR).But, hematopoietic cell, embryonic stem cell, mescenchymal stem cell, some epidermic cell and tumour cell (as bladder cancer, cervical cancer, colorectal carcinoma, prostate cancer, lung cancer, mammary cancer, tumor of head and neck, melanoma, neurospongioma etc.) surface in human body, CAR is that low the expression even expressed.Since with the adenovirus be in the gene therapy of carrier the adenovirus of CAR mediation to enter target cell be rate-limiting step in the transgenosis, and transfection efficiency is relevant with cell surface CAR expression level.The CAR of low expression level restricts the major cause of adenovirus transduction efficiency beyond doubt, promptly shows resistance effect (Kim J etc., the J Virol.2002 of cell to C subgroup adenovirus carrier; 76:1892-1903; Cripe TP etc., Cancer Res.2001 Apr1; 61:2953-2960; Suzuki K etc., Clin Cancer Res.2001; 7:120-126; Wesseling JG etc., Gene Therapy.2001; 8:969-976; Bao Y etc., Prostate.2005 Sep 1; 64:401-407; Stoff-Khalili MA etc., Gene Ther.2005 Dec; 12:1696-1706).Be that the C subgroup adenovirus of acceptor also exists and can cause the very fast removing virus of the Ad5 type adenovirus neutralizing antibody that extensively exists in serious toxic side effect, the human body in vivo with CAR.These problems have limited the widespread use of Ad5 and Ad2.
B subgroup adenovirus comprises 3 types, 7 types, 11 types, 16 types, 35 types, 50 type adenovirus, and the cells infected of this group adenovirus serves as absorption acceptor (Fleischli C etc., J Gen Virol.2007 Nov with the CD46 molecule mainly not by the CAR acceptor; 88:2925-2934; Pache L etc., Virology.2008 Jun 5; 375:573-579; Pache L etc., J Virol.2008Aug; 82:7923-7931).CD46 is a kind of Complement Regulatory Protein of wide expression, and this albumen almost is expressed in except red corpuscle everyone peripheral blood cells, all kinds of stem cell and most of tumor cell surface.Therefore, utilize the adenovirus carrier of CD46 acceptor to be subjected to recently paying close attention to widely, people have proposed many strategies at the target sex modification problem of adenovirus carrier.Adenovirus Ad5/F35 carrier promptly is the hybrid vectors that a kind of shell is transformed, and its primary structure is on the basis of present Ad5 adenovirus carrier, and the cilium of its receptors bind position has been transformed into the cilium of 35 type adenovirus (Ad35).Therefore, the cell receptor of Ad5/F35 has become CD46 from the CAR of Ad5, the change of original infection absorption acceptor, improved its efficiency of infection to blood cell, stem cell, tumour cell, pattern of infection is wider than Ad5 commonly used now, and transduction efficiency is generally than Ad5 height (Stone D etc., Mol Ther.2007Dec; 15:2146-2153; Brouwer E etc., Cancer Gene Ther.2007Feb; 14:211-219).Experimental result confirms that the Ad5/F35 carrier obviously is better than 5 conventional type adenovirus carriers to the infection ability of the K562 cell in medullary system source, to the infection ability of bone-marrow-derived lymphocyte also a little more than the Ad5 carrier.The transformation of AD5/F35 has changed the infection characterization of carrier, but the toxic action of its pair cell not therefore increases, and the transformation carrier that confirms this mode has more wide application space in transduction such as stem cell, tumour cell and gene therapy research.
In addition, experiment confirm is arranged, may there be the special acceptor of another kind of cells infected in B subgroup adenovirus.Utilize Ad5/11-CMV-GFP and Ad5/35-CMV-GFP to infect the A549 and the Hela cell of CD46 positive expression respectively, the efficiency of infection of Ad5/11-CMV-GFP is all than Ad5/35-CMV-GFP height, and remove to infect the CHO-C2 cell of CD46 positive expression simultaneously with these two kinds of carriers, efficient (Stone D etc., J Virol.2005 about the same; 79:5090-5104).In addition, antiserum(antisera) experiment shows, the knob district of Ad11-Fiber can suppress combining of Ad35 and A549 cell fully, and the knob district of Ad35-Fiber can not suppress (MeiYF etc., the Virology.2002 of combining of Ad11 and A549 cell fully; 295:3043).Infect 11 kinds of esophageal cancer cells and 6 kinds of cancer cell of oral cavity with Ad5, Ad5/11 and Ad5/35 respectively, Ad5/11 and Ad5/35 are all high a lot of than Ad5 to the efficiency of infection of all tumour cells, and the efficiency of infection of Ad5/11 and Ad5/35 does not rely on expression level (the .Oncol Rep.2005 such as Ling Y of CD46; 14:831-835).Therefore infer that the acceptor that has other participates in regulating the infection of Ad11 and Ad35 pair cell.
Although with the adenovirus be carrier therapy of tumor experiment and clinical in obtained some curative effects, but, further improve adenovirus to the transduction efficiency of tumour cell, strengthen Antioncogene expression, make virus vector have more special target, thereby improving curative effect and security, is the emphasis direction of following therapy of tumor research.
People's 11 type adenovirus carriers are compared with traditional C group adenovirus carrier, and many advantages are arranged: the positive rate of neutralizing antibody is lower in the serum; And there is not cross-immune reaction between Ad5, the Ad35 yet; Cells infected does not rely on the CAR acceptor, and the many important cells that comprise hemopoietic stem cell, primary tumor cell, tumor stem cell are all had higher efficiency of infection; Hepatotoxicity is low, and immune side effect is little.Therefore, exploitation Ad11 carrier, most stem cells of efficient transfection and tumour cell, target is killed tumor stem cell, realizes thoroughly killing the purpose of tumour, and crucial meaning will be arranged.
The adenovirus carrier that adopts in the gene therapy scheme, most propagation defective adenovirals that do not have replication that adopt.Though the propagation defective adenoviral has shown certain security in vivo and in vitro, yet this type of adenovirus carrier of the great majority of using in clinical trial so far remains in that time of expression alien gene is short, immunogenicity is stronger, many shortcomings such as significant cytotoxicity are arranged during high titre, so clinical efficacy is not good.
Address the above problem, need a kind ofly can in tumour cell, have the proliferated specifically ability, can improve copy number of foreign gene and expression amount and can dissolve the condition replication competent adenovirus carrier of kill tumor cell, be i.e. the oncolytic adenovirus carrier.Both at home and abroad the oncolytic adenovirus development of projects is very fast, the H101 project of the three-dimensional company in domestic Shanghai go through for the end of the year 2005 listing (Yu W etc., Curr Cancer Drug Targets.2007 Mar; 7:141-148).More and more data proves that oncolytic adenovirus promises to be the anti-tumor medicine of a new generation.
Summary of the invention
Technical problem to be solved:
The adenovirus carrier that adopts in the gene therapy scheme, the human C subgroup 5 type adenovirus (Ad5) of most employings, the process of its cells infected depends on CAR.But, hematopoietic cell, embryonic stem cell, mescenchymal stem cell, some epidermic cell and tumor cell surface in human body, the low expression even of CAR expressed.Therefore, the CAR of low expression level becomes the major cause of restriction the type adenovirus transduction efficiency, promptly shows the resistance effect of cell to C subgroup adenovirus carrier.Be that the C subgroup adenovirus of acceptor also exists and can cause the very fast removing virus of the 5 type adenovirus neutralizing antibodies that extensively exist in serious toxic side effect, the human body in vivo with CAR.
The adenovirus carrier that adopts in the gene therapy scheme, most propagation defective adenovirals that do not have replication that adopt.Many shortcomings such as significant cytotoxicity are arranged during stronger, the high titre of short, immunogenicity of time of such adenovirus carrier ubiquity expression alien gene, influenced its clinical efficacy.
Therefore, further improve virus vector to the transduction efficiency of tumour cell, strengthen Antioncogene expression, make virus vector have more special target, thereby improve curative effect and security, be the emphasis direction of following therapy of tumor research.
The technical scheme that adopts:
The object of the present invention is to provide a kind of proliferous type recombination oncolytic adenovirus that can be used for multiple human body genetic treatment of tumor, this recombination oncolytic adenovirus can overcome current propagation defective adenoviral vector (as Ad-p53) transhipment and express the shortcoming of antioncogene inefficiency, no target, overcome with people Ad5 replication competent adenovirus carrier (as H101, ONYX-015) and only have single antitumor mechanism,, shortcoming such as security not good low the tumour cell infectivity, its antitumor curative effect is improved, and security is improved.
For achieving the above object, the invention provides a kind of proliferous type recombination oncolytic adenovirus of the B of containing subgroup 11 type adenovirus cilium head (knob) amino acid coding, it is characterized in that, the genome of this recombinant virus contains B subgroup 11 type adenovirus cilium head (knob) amino acid coding, described 11 type adenovirus cilia protein encoding sequences, both can be 11 type adenovirus, also can be that aminoacid sequence with human 11 type adenovirus cilium heads (knob) replaces the cilium head aminoacid sequence of non-11 type adenovirus and constitutes.
In an embodiment, the frame sequence of this proliferous type recombination oncolytic adenovirus is 5 type adenovirus (Ad5), and replacing the cilium head aminoacid sequence of 5 type adenovirus by the aminoacid sequence of 11 type adenovirus cilium heads, its cilia protein encoding sequence is shown in SEQ ID NO:1.Virus vector structure aspect, the improvement and the purposes of function that contains the proliferous type recombination oncolytic adenovirus of 11 type adenovirus cilia protein genes by two kinds of embodiment explanations, the one, adopt human telomerase reverse transcriptase (hTERT) promoter regulation E1a gene, hypoxia response elements (HRE) the regulation and control E1b district's gene (E1b-55kDa and E1b-19kDa gene) of choosing simultaneously, make up the proliferous type oncolytic adenovirus, the 2nd, E1b-55kDa is implemented sudden change, it is lost activity, thereby make the propagation of virus obtain tumour-specific.Aspect the external source gene Selection, the function and the purposes that contain the adenovirus mediated genetic expression of proliferous type recombination oncolytic of 11 type adenovirus cilia protein genes by two kinds of embodiment explanations, the one, carrier's chemokine CCL5 gene, the 2nd, carry green fluorescent protein reporter gene EGFP.
The proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes can be discerned CD46 membrane receptor and other special acceptors that may exist, thereby important cells such as the efficient infected person hemopoietic system cell of energy, mescenchymal stem cell, dendritic cell, tumor stem cell, primary tumor cell, and immunogenicity is lower, does not have cross-immune reaction with traditional C group adenovirus carrier; This adenoviral gene group makes it optionally in the tumour cell internal breeding, and does not breed substantially in normal cell by effective control of genetically deficient or generegulation; This adenovirus can be used as the carrier of transgenosis, inserts multiple antineoplaston gene in its genome simultaneously, and the oncotherapy gene is efficiently expressed with being replicated in the tumour cell of virus.By virus multiplication and antioncogene dual function, the specific killing tumour cell is used for the treatment of multiple human tumor.
Human adenovirus has A, B, C, D, 6 different subgenus of E, F, and they have nothing in common with each other to close preferendum, tumorigenicity and the history of disease of host cell.The present invention relates to adenovirus B subgroup 11 types.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, the cilia protein encoding sequence of adenoviral gene group is by people's 11 type adenovirus cilia protein genomic constitutions.Described 11 type adenovirus cilia protein genes both can be the cilia protein encoding sequences of complete wild-type 11 type adenovirus, also can be that the cilium head aminoacid sequence heterozygosis that aminoacid sequence by 11 type adenovirus cilium heads replaces non-11 type adenovirus forms.This virus can be discerned CD46 membrane receptor and other special acceptors that may exist, and be no longer dependent on the CAR acceptor, thereby make the pattern of infection of its infected person tumour cell wider, transduction efficiency is higher, has improved its efficiency of infection to important cells such as human hematopoietic system cell, mescenchymal stem cell, dendritic cell, tumor stem cell, primary tumor cells.In embodiments, 11 type cilia protein gene orders of described recombinant adenovirus are shown in SEQ ID NO:1, wherein: (1) 1-134 bit base: the tail albumen coded sequence of 5 type adenovirus ciliums; (2) 135-981 bit bases: the shaft of 11 type adenovirus ciliums, knob albumen coded sequence.
On the other hand, the invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, this adenoviral gene group is by the effective control of tumor-specific promoters to the propagation indispensable gene, make it optionally in the tumour cell internal breeding, and in normal cell, do not breed substantially, thereby make its target human tumor cells, guarantee adenovirus in tumour cell inner height propagation, the performance oncolysis.This tumor-specific promoters can be following any tumor-specific promoters or enhanser: (a) carcinomebryonic antigen promotor, enhanser and mutant sequence thereof; (b) afp promoter, enhanser and mutant sequence thereof; (c) receptor tyrosine kinase of Human epidermal growth factor receptor family (EGFRs) (comprising EGFR, Her-2, Her-3 and Her-4) promotor, enhanser and mutant sequence thereof; (d) breast cancer correlation antigen DF3/MUC1 promotor, enhanser and mutant sequence thereof; (e) promotor, enhanser and the mutant sequence thereof of vascular endothelial growth factor (VEGF) receptor KDR; (f) L-plastin promotor, enhanser and mutant sequence thereof; (g) member's of IAP family (IAP) promotor, enhanser and mutant sequence thereof; (h) promotor of prostaglandin(PG) specific antigens, enhanser and mutant sequence thereof; (i) the hypoxia response elements conserved sequence of HIF-1 (HIF-1) regulation and control; (j) transcription factor E2F promotor, enhanser and mutant sequence thereof; (k) human telomerase subunit promotor.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that at least one virus multiplication indispensable gene is controlled by a kind of tumor-specific promoters.This virus multiplication indispensable gene can be E1a.This oncolytic adenovirus can be expressed E1a duplicating in specifically inside tumor cell ground propagation, performance E1a antitumor action.E1a can be by activity, the lethal effect that improves immunocyte that suppresses Her-2/neu gene transcription, blocking-up NF-κ B, the number of ways such as expression that strengthen nm-23 nm23, inducing apoptosis of tumour cell, suppress tumor invasion and shift, improve the susceptibility of tumour cell chemotherapy, radiotherapy.This oncolytic adenovirus and chemotherapy and radiation share, and can strengthen the susceptibility of tumour cell to chemotherapy and radiation, further improve result of treatment.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that at least one virus multiplication indispensable gene is controlled by a kind of tumor-specific promoters.The virus multiplication indispensable gene of tumor-specific promoters control can also be E1b-55kDa, E1b-19kDa, E2 or E4, and this propagation indispensable gene can be a wild-type, also can be the genetic mutation of transforming through disappearance, sudden change etc.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, the forfeiture of its E1b-55kDa protein function, by the proteic gene order of coding E1b-55kDa is all lacked, point mutation, excalation, insertion sudden change or insert mode such as terminator codon.To be adenovirus duplicate essential and nonessential albumen when duplicating in tumour cell in normal cell propagation E1b-55kDa, the ability that the selectivity disappearance of E1b-55kDa encoding gene can make adenovirus keep propagation to duplicate in tumour cell, and in normal cell, lose replication.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, the forfeiture of its E1b-19kDa protein function by the proteic gene order of coding E1b-19kDa is all lacked, point mutation, excalation, insertion sudden change or insert mode such as terminator codon.Adenovirus E 1 b-19kDa gene and apoptosis suppressor Bc1-2 homology; the E1b-19kDa albumen of coding can suppress program or/and Bak starts the apoptosis in downstream in conjunction with Bax; E1b-19kDa can also destroy Fas mediated Apoptosis process, and the cell that protection is infected is avoided the alpha mediated lethal effect of TNF-.The E1b-19kDa gene inactivation, thereby should virus be improved in the specificity of tumour cell internal breeding, and the proliferation activity in normal cell is weakened.The forfeiture of E1b-19kDa protein function, not only can promote the recovery of apoptosis of tumor cells path, and help the quick removing of virus in normal cell and the snap-out release in tumour cell and send out, make the specificity of this oncolytic adenovirus treatment tumour better, usefulness is stronger.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, preset multiple clone site in its genome, can be used as the carrier of transgenosis.This site can be in E1a promotor upstream, also can be between E1a and E1b, or in the E3 district, various Antioncogene expression cassettes are easy to carry.Antioncogene is inserted this viral foreign gene multiple clone site, bring into play multiple antitumor usefulness.Along with the proliferated specifically of virus in tumour duplicates, the copy number and the expression amount of the Antioncogene that it carries are improved, thereby suppress growth of tumour cell or kill tumour cell.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, the selection of its Antioncogene can also be following any one: (a) Interferon, rabbit series immune-regulating factor gene; (b) interleukin-series immune-regulating factor gene; (c) colony-stimulating factor gene; (d) cancer suppressor gene; (e) proto-oncogene antisense sequences; (f) antibody gene of people's tumour Epidermal Growth Factor Receptor Family (EGFRs); (g) has the nucleotide sequence such as Endostatin, angiostatin and fragment thereof, plasminogen activating factors inhibitor, Canstatin, thrombospondin of angiogenesis inhibitor; (h) apoptosis inducing factor family gene; (i) vascular endothelial growth factor antibody gene; (j) medicine prerequisite transforming gene (claiming suicide gene again); (k) tumour necrosis factor gene.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, encoding sequence is subjected to the control of human cytomegalovirus (CMV) promotor in the Antioncogene expression cassette, this cis-acting elements inserts between the transcription initiation site and translation initiation site of Antioncogene sequence, guarantee that this gene protein efficiently expresses in the inside tumor of virus infection, the performance biologic activity.Antioncogene can also be controlled by following promotor: (a) carcinomebryonic antigen promotor, enhanser and mutant sequence thereof; (b) afp promoter, enhanser and mutant sequence thereof; (c) receptor tyrosine kinase of Human epidermal growth factor receptor family (EGFRs) (comprising EGFR, Her-2, Her-3 and Her-4) promotor, enhanser and mutant sequence thereof; (d) breast cancer correlation antigen DF3/MUC1 promotor, enhanser and mutant sequence thereof; (e) promotor, enhanser and the mutant sequence thereof of vascular endothelial growth factor (VEGF) receptor KDR; (f) L-plastin promotor, enhanser and mutant sequence thereof; (g) member's of IAP family (IAP) promotor, enhanser and mutant sequence thereof; (h) promotor of prostaglandin(PG) specific antigens, enhanser and mutant sequence thereof; (i) the hypoxia response elements conserved sequence of HIF-1 (HIF-1) regulation and control; (j) transcription factor E2F promotor, enhanser and mutant sequence thereof; (k) human telomerase subunit promotor.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that, the tailer sequence that adds of encoding sequence is SV40 Poly A in the Antioncogene expression cassette, and this cis-acting elements inserts after translation stop codon of gene nucleotide series.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that at least one virus multiplication indispensable gene is controlled by a kind of tumor-specific promoters.Can connect by polysome entry site (IRES) sequence between its a plurality of propagation indispensable genes, make it regulated and control by tumor-specific promoters, or regulate and control respectively by a plurality of tumor-specific promoters.Among the embodiment, control E1a and E1b gene respectively, human telomerase reverse transcriptase (hTERT) promotor control E1a gene, people's hypoxia response elements (HRE) regulation and control E1b district's gene (E1b-55kDa and E1b-19kDa gene) with double-promoter.
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that this virus mutant is operably connected by the cis-acting elements of human adenovirus carrier, tumor-specific promoters, human 11 type adenovirus cilia protein genes and Antioncogene expression cassette and forms.This proliferous type oncolytic adenovirus is produced by the reorganization of Cre-loxP recombinase diced system fixed point in 293 cells by skeleton plasmid that contains human 11 type adenovirus cilia protein genes and the adenovirus shuttle plasmid that carries Antioncogene.Its skeleton plasmid sequence that contains human 11 type adenovirus cilia protein genes is shown in SEQ ID NO:2, wherein: (1) 1-85 bit base: adenovirus ITR sequence; (2) 562-700 bit base: SV40 the AN sequence; (3) 1245-2294 bit bases: pSP13Cre sequence; (4) 2375-2716 bit base: HCMV the IE sequence; (5) 2962-3819 bit bases: amp encoding sequence; (6) 4901-4934 bit bases: LoxP sequence; (7) 31516-31649 bit bases: the tail encoding sequence of 5 type adenovirus cilia proteins; (8) 31649-32496 bit bases: shaft, the knob encoding sequence of 11 type adenovirus cilia protein genes; (8) 35554-35655 bit bases: adenovirus ITR sequence; (9) all the other: 5 type adenoviral gene group sequences, see the pBHGloxdeltaE1 of MicrobixBiosystems company, the 3Cre sequence.
The technique effect of realizing:
1. the invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, this adenovirus has the multiple clone site of foreign gene, can be used for making up the adenovirus product of multiple Antioncogene treatment, for genetic treatment of tumor is set up a kind of curative effect reliable technique platform.
2. oncolytic adenovirus provided by the invention has multiple antitumor mechanism and specificity advantage: 1) genome of this recombinant virus contains 11 type adenovirus cilia protein albumen coded sequences, make virus can discern the CD46 membrane receptor, thus important cells such as efficient infected person hemopoietic system cell, mescenchymal stem cell, dendritic cell, tumor stem cell, primary tumor cell; 2) with the necessary genetic expression of tumor-specific promoters regulating and controlling adenovirus propagation, make virus propagation and destruction tumour cell in the human tumor cell of most of types, its regulation and control have preciseness and security; 3) efficient and specific expressed E1a in tumour cell promotes virus multiplication, itself also has antitumor action simultaneously; 4) will the encode nucleotide sequence of Antioncogene inserts in this viral genome, and along with the proliferated specifically of virus in tumour duplicates, the copy number of the Antioncogene that it carries and expression amount increase, thereby suppress tumor growth.
3. oncolytic adenovirus provided by the invention has better broad spectrum and efficiency of infection than the domestic gene therapy product recombinant P 53 adenovirus injection liquid " Ad-p53 " that has gone on the market at present, and curative effect is improved; Have the security of better therapeutic and Geng Gao than the domestic replicative adenovirus product H101 that has gone on the market at present, be adapted to the treatment of human most type malignant tumours.
The accompanying drawing summary
Fig. 1 represents to contain the structure flow process of the adenovirus carrier pCLON9-F11 of 11 type adenovirus cilia protein gene coded sequences.
Fig. 2 represents the structure flow process of adenovirus packaging plasmid pPE3.
Fig. 3 represents that pPE3-F11 makes up flow process.
Fig. 4 represents the L02 normal liver cell, and MOI=10 infects Ad5-EGFP, and fluorocyte accounts for about 25%.
Fig. 5 represents the L02 normal liver cell, and MOI=10 infects SG511-EGFP, and fluorocyte accounts for about 85%.
Fig. 6 represents the SMMC-7721 liver cancer cell, and MOI=10 infects Ad5-EGFP, and fluorocyte accounts for about 35%.
Fig. 7 represents the SMMC-7721 liver cancer cell, and MOI=10 infects SG511-EGFP, and fluorocyte accounts for about 95%.
Fig. 8 CCL5 gene primer amplification 1-4 adenovirus clone that represents to choose all can amplify the 349bp band, and (P) is consistent with positive control, illustrates that the 1-4 adenovirus all contains the CCL5 gene.M1:100bp DNA Ladder wherein; N: negative control; P: positive control (pENTR12-CCL5); The 1-4:SG511-CCL5 virus clone
Fig. 9 represent SG511-CCL5 in liver cancer cell along with the time is how much multiples propagation, have good multiplication capacity, and the propagation multiple in normal cell strain BJ is very low.
Figure 10 represents that SG511-CCL5 treatment group compares with other control groups, demonstrate stronger inhibition tumor growth effect, gross tumor volume is significantly less than control group always, remarkable significant difference (p<0.05) is arranged, illustrate that chimeric replication competent adenovirus SG511-CCL5 has very strong antitumor action to liver cancer animal model, can obviously suppress the growth of tumor development.
Detailed Description Of The Invention
Set forth embodiments of the present invention below by embodiment; described embodiment only is used for the exemplary the present invention of demonstrating; it does not limit protection scope of the present invention, and those skilled in the art are included among the present invention by the technical scheme of equal modification and improvement according to the present invention.
In an embodiment, first scheme is controlled 5 type adenovirus E 1 a with human telomerase reverse transcriptase (hTERT) promotor, and personnel selection hypoxia response elements (HRE) regulation and control E1b district's genes (E1b-55kDa and E1b-19kDa gene) are example; Alternative plan is implemented sudden change to E1b-55kDa, and it is lost activity, thereby makes the propagation of virus obtain tumour-specific, makes up the oncolytic adenovirus carrier that contains 11 type adenovirus cilia protein genes.In the concrete enforcement of embodiment, be that example is set up two kinds of strategies with human chemokine CCL5 gene and green fluorescent protein reporter gene (EGFP), make up the adenovirus carrier that carries goal gene.
Embodiment:
Embodiment 1: the structure that contains the adenovirus carrier pCLON9-F11 of 11 type adenovirus cilia protein gene coded sequences
The first step: synthesize and contain 11 type adenovirus cilia protein gene coded sequences shown in SEQ ID NO:3, name Ad5F11, wherein: (1) 236-369 bit base: 5 type adenovirus cilium tail albumen coded sequences; (2) 367-1216 bit bases: 11 type adenovirus cilium shaft, knob albumen coded sequence; (3) all the other bases: 5 type adenoviral gene group sequences, see the pBHGloxdeltaE1 of Microbix Biosystems company, the 3Cre sequence.
Second step: synthetic VT176 sequence (SEQ ID NO:4) and VT177 sequence (SEQ IDNO:5) make up the pCLON9 carrier.The Ad5F11 sequence is cut through the PacI+HindIII enzyme, reclaims the 2656bp fragment, and the carrier of cutting with the pCLON9/PacI+HindIII enzyme is connected, is built into pCLON9-F11, cuts and checks order and identify affirmation through enzyme.Construction step as shown in Figure 1.
Homologous recombination in the embodiment 2:BJ5183 cell
The first step: pCLON9-F11 cuts through the HindIII+AatII enzyme, reclaims the 5913bp fragment.
Second step: synthetic ADP sequence (SEQ ID NO:6) as shown in Figure 2, makes up adenovirus packaging plasmid pPE3.
The 3rd step: the pPE3 carrier is cut through the PacI enzyme, reclaims linearized vector.PCLON9-F11/HindIII+AatII 4 microlitres, pPE3/PacI 2 microlitres, common transformed competence colibacillus intestinal bacteria BJ5183 (Qbiogene company).Bed board is cultivated, and the picking clone carries out enzyme and cuts evaluation, and correct person's called after pPE3-F11 extracts purifying through the full-page proof plasmid, is stored in the profound hypothermia refrigerator.PPE3-F11 makes up flow process as shown in Figure 3.
Embodiment 3: the adenovirus that contains Ad11 adenovirus cilia protein gene is in external infectivity experiment to culturing cell
The first step: control 5 type adenovirus E 1 a with human telomerase reverse transcriptase (hTERT) promotor, insert site NotI+SwaI, making up adenovirus carrier pQW-hTERT-Ep-HRE (sees: patent ZL028138198, virus of a kind of proliferated specifically inside tumor cell that efficiently expresses antioncogene and uses thereof; Now be renamed as pSG502).HTERT promoter regulation E1a gene wherein, hypoxia response elements (HRE) the regulation and control E1b district's gene (E1b-55kDa and E1b-19kDa gene) of choosing simultaneously.Described hTERT promotor core sequence is shown in SEQ ID NO:7, and hypoxia response elements HRE sequence is shown in SEQ ID NO:8.
Second step: EGFP gene (SEQ ID NO:9) is inserted pSG502, be built into pSG502-EGFP, it is EcoRI+SalI that EGFP inserts the site.
Second step: contain the adenoviral plasmid pSG502-EGFP of EGFP gene and skeleton plasmid pPE3-F11 cotransfection HEK293 cell and (purchase company in Canadian Microbix Biosystems, this cell is transformed by the 5 type adenovirus DNAs of shearing, contain 5 type adenovirus E 1 districts, adenovirus DNA has high transfection efficiency to it, produce adenovirus by reorganization in the cell with infectivity), carry out reorganization in the cell.Transfection concrete grammar step is referring to the LipoFectamine2000 test kit process specifications of Invitrogen company.Recombinant products is identified correct person's called after SG511-EGFP through PCR.EGFP gene PCR primer is: upstream primer 5 '-GCTCTAGAGAATTCACCATGGTGAGCAAGGGC-3 ' (SEQ ID NO:10), downstream primer 5 '-CGGGATCCGTCGACTTATTACCTAGATCCGGTGG-3 ' (SEQ ID NO:11), amplified fragments 793bp.
The 3rd step: with the EcoRI+SalI site among the EGFP gene insertion adenoviral plasmid pDC315 (MicrobixBiosystems company), be built into pDC315-EGFP, carry out recombinating in the cell with skeleton plasmid pPE3, recombinant products is identified correct person's called after Ad5-EGFP through PCR, in contrast virus.This contrast virus is for containing the virus vector of 5 type adenovirus cilia protein genes.
The 4th step: normal cell strain and tumor cell line are respectively by 5 * 10 5Cells/well is layered in 6 orifice plates, cultivates at 37 ℃ of incubator 5%CO2, changes serum-free liquid 1ml in second day, adds recombination oncolytic adenovirus SG511-EGFP and Ad5-EGFP respectively by MOI=10 then, and fluorescent microscope is observed down after 24 hours.
Observations: be the L02 normal liver cell among Fig. 4, MOI=10 infects Ad5-EGFP, and fluorocyte accounts for about 25%.Be the L02 normal liver cell among Fig. 5, MOI=10 infects SG511-EGFP, and fluorocyte accounts for about 85%.Be the SMMC-7721 liver cancer cell among Fig. 6, MOI=10 infects Ad5-EGFP, and fluorocyte accounts for about 35%.Be the SMMC-7721 liver cancer cell among Fig. 7, MOI=10 infects SG511-EGFP, and fluorocyte accounts for about 95%.Show that the SG511-EGFP infection ability obviously is better than Ad5-EGFP.
Embodiment 4: contain the reorganization of the oncolytic adenovirus of 11 type adenovirus cilia protein gene coded sequences, E1b-55kDa inactivation
Adenovirus carrier pXC-delE1b (the Qian Qijun etc. of the E1b-55kDa inactivation that successfully constructs in earlier stage with us, Chinese Medical Journal .2002,82:557-560) be the basis, with pPE3-F11 cotransfection HEK293 cell, reorganization contains the adenovirus SG211 of 11 type adenovirus cilia protein gene coded sequences, this virus E1b-55kDa inactivation, the ability of acquisition special propagation in tumour cell.
Embodiment 5: the construction of recombinant adenovirus containing of carrying Antioncogene
The invention provides a kind of recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, it is characterized in that,, make it optionally in the tumour cell internal breeding by effective control of genetically deficient or generegulation; Preset multiple clone site in its genome, various Antioncogene expression cassettes can be carried in this site.The oncolytic adenovirus carrier is controlled 5 type adenovirus E 1 a genes with human telomerase reverse transcriptase (hTERT) promotor, hypoxia response elements (HRE) the regulation and control E1b district genes (E1b-55kDa and E1b-19kDa gene) of choosing simultaneously are example, and Antioncogene is an example with human chemokine CCL5 gene.The adenovirus carrier that makes up non-propagation simultaneously is contrast virus.
The first step: control 5 type adenovirus E 1 a with human telomerase reverse transcriptase (hTERT) promotor, insert site NotI+SwaI, make up adenovirus carrier pSG502 and (see: patent ZL028138198).Wherein hTERT promotor core sequence is shown in SEQ ID NO:7.
Second step: the synthetic human chemokine CCL5 gene nucleotide series (SEQ IDNO:12) that contains, its 5 ' end and 3 ' end are introduced EcoRI and BamHI site respectively, after cutting, inserts the EcoRI+BamHI enzyme plasmid pENTR11 (Invitrogen LifeTechnology Inc.) and pDC315 multiple clone site district respectively, constitute pENTR12-CCL5 and pDC315-CCL5, recombinate with skeleton plasmid pPE3-F11 respectively, recombinant products is cut through enzyme and is identified correct person's called after pPE3-F11-CCL5 and Ad5F11-CCL5 again.
Embodiment 6: the interior reorganization of cell and the amplification purification that contain the oncolytic adenovirus of 11 type adenovirus cilia protein genes
The invention provides a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, tumour cell is had good infection ability and target.
The first step: the 5 type adenoviral plasmid pSG502 that will build, with the heterozygosis adenovirus carrier plasmid pPE3-F11-CCL5 that contains 11 type adenovirus cilia protein genes, by the common transfection HEK293 of LipoFectamine2000 cell.PPE3-F11-CCL5 contains 5 type adenovirus right arms, disappearance E1 district, and its recombinase system Cre/LoxP can guarantee the efficient reorganization of virus.9-14 behind the carrier cotransfection days, virus plaque appears successively, (concrete grammar is referring to GeneTransfer and Expression Protocols through three virus plaque purifying, Murray EJ chief editor, Humana Press, Clifton, New Jersey), reorganization obtains oncolytic adenovirus SG511-CCL5.
Second step: the evaluation of recombination oncolytic adenovirus, get rid of wild-type adenovirus with adenovirus E 1 a gene primer, identify with people CCL5 gene primer whether recombinant adenovirus contains the CCL5 sequence.Adenovirus E 1 a gene primer: upstream primer 5 '-cggaattcaccatgagacatattatc-3 ' (SEQ ID NO:13), downstream primer 5 '-gcgtcgacttatggcctggggcg-3 ' (SEQID NO:14), amplified fragments 1005bp.People CCL5 gene primer is: upstream primer 5 '-CGGAATTCACCATGAAGGTCTCCGCGGCAG-3 ' (SEQ ID NO:15), downstream primer 5 '-CGGGATCCCTATAACTGGAAGTCATCATCCATTG-3 ' (SEQ ID NO:16), amplified fragments 349bp.
As shown in Figure 8, with people CCL5 gene primer amplification 1-4 adenovirus clone, all can amplify the 349bp band, (P) is consistent with positive control, illustrates that the 1-4 adenovirus all contains the CCL5 gene.
The 3rd step: the recombination oncolytic adenovirus is amplification in a large number in the HEK293 cell, (concrete grammar is referring to GeneTransfer andExpression Protocols, and Murray EJ edits, Humana Press for the method purification of adenoviral of application caesium chloride density gradient centrifugation, Clifton, NewJersey).The titre that records recombination oncolytic adenovirus SG511-CCL5 with the TCID50 method reaches 2.79 * 10 10Pf μ/ml.
Embodiment 7: the tumour cell internal breeding experiment in vitro culture of recombination oncolytic adenovirus SG511-CCL5
Normal cell strain and tumor cell line are respectively by 5 * 10 5Cells/well is layered in 6 orifice plates, at 37 ℃ of incubator 5% CO 2Cultivate, changed serum-free liquid 1ml in second day, press MOI=5 then and add recombination oncolytic adenovirus SG511-CCL5, cultivate after 90 minutes, (PBS) washes twice with phosphate buffered saline buffer, with viral flush away, cultivate with the nutrient solution that adds 5% foetal calf serum, collected at 0 hour, 48 hours, 96 hours respectively, freeze thawing three times detects virus titer (method is referring to the AdEasyTM operational manual of U.S. Qbiogene company) with the TCID50 method.With 0 hour virus titer was reference, calculate virus at 48 hours, 96 hours propagation multiple, found that SG511-CCL5 in liver cancer cell along with the time is multiples propagation how much, have good multiplication capacity, and the propagation multiple in normal cell strain BJ is very low, specifically as shown in Figure 9.
Embodiment 8: recombination oncolytic adenovirus SG511-CCL5 experimentation on animals
The first step: 4~6 age in week 50 of BALB/C nude mices, weight in average 22~27g is provided by Shanghai Chinese Academy of Sciences laboratory animal cultivation center, cleaning level Animal Lab. is raised.
Second step: extracorporeal culture human liver cancer cell SMMC-7721, the adherent growth cell in vegetative period of taking the logarithm, 0.25% trysinization, resuspended behind centrifugal, the collecting cell with PBS liquid, centrifugal 2 minutes of 3000g room temperature, abandon supernatant, use the resuspended back of PBS liquid centrifugal collecting cell again, adjust concentration of cell suspension to 5 * 10 7Individual/ml.
The 3rd step: in the right ribbed back subcutaneous vaccination SMMC-7721 of portion of nude mice cell, 0.1ml/ only.After inoculating about three weeks, the subcutaneous grain of rice size that grows of visible inoculation position is hardened, and the transplanted tumor model builds up.Begin treatment when treating the growth in thickness of knurl body to 7-9mm.Select the SMMC-7721 transplanted tumor that 40 Subcutaneous tumors grow to 7-9mm and treat, nude mice is divided into 5 groups at random.Route of administration is a multi-point injection in the direct knurl.
The 4th step: observe animation and the periodic measurement tumor size of mouse every day, major diameter (A) and vertical diameter (B), the by formula (A * B of a tumour of periodic measurement 2Tumor size is calculated in)/2, observes the curative effect of various dose group.
Experiment be provided with band CCL5 gene non-proliferous type adenovirus Ad5F11-CCL5 and (its title is not adenovirus hominis 5/11 mosaic type SG511 with the replication competent adenovirus SG511 of CCL5 gene, preservation day is on January 9th, 2009, preserving number is CCTCC-V2000903, and the preservation place is Chinese typical culture collection center) for contrasting virus.Found that SG511-CCL5 treatment group compares with other control groups, demonstrate stronger inhibition tumor growth effect, gross tumor volume is significantly less than control group always, remarkable significant difference (p<0.05) is arranged, illustrate that heterozygosis replication competent adenovirus SG511-CCL5 has very strong antitumor action to liver cancer animal model, can obviously suppress growth of tumor development (see figure 10).SG511-CCL5 treatment group is compared with other control groups, demonstrate stronger inhibition tumor growth effect, gross tumor volume is significantly less than control group always, remarkable significant difference (p<0.05) is arranged, illustrate that chimeric replication competent adenovirus SG511-CCL5 has very strong antitumor action to liver cancer animal model, can obviously suppress the growth of tumor development.
Sequence table
<110〉The 2nd Army Medical College east hospital of liver and gall surgical department
<120〉a kind of proliferous type recombination oncolytic adenovirus that contains 11 type adenovirus cilia protein genes, its construction process and uses thereof
<130>IDC080XXX
<160>16
<170>PatentIn?version?3.2
<210>1
<211>981
<212>DNA
<213〉11 cilium sequences
<400>1
atgaagcgcg?caagaccgtc?tgaagatacc?ttcaaccccg?tgtatccata?tgacacggaa 60
accggtcctc?caactgtgcc?ttttcttact?cctccctttg?tatcccccaa?tgggtttcaa 120
gagagtcccc?ctggagttct?tactttaaaa?tgtttaaccc?cactaacaac?cacaggcgga 180
tctctacagc?taaaagtggg?agggggactt?acagtggatg?acaccaacgg?ttttttgaaa 240
gaaaacataa?gtgccaccac?accactcgtt?aagactggtc?actctatagg?tttaccacta 300
ggagccggat?tgggaacgaa?tgaaaataaa?ctttgtatca?aattaggaca?aggacttaca 360
ttcaattcaa?acaacatttg?cattgatgac?aatattaaca?ccttatggac?aggagtcaac 420
cccaccgaag?ccaactgtca?aatcatgaac?tccagtgaat?ctaatgattg?caaattaatt 480
ctaacactag?ttaaaactgg?agcactagtc?actgcatttg?tttatgttat?aggagtatct 540
aacaatttta?atatgctaac?tacacacaga?aatataaatt?ttactgcaga?gctgtttttc 600
gattctactg?gtaatttact?aactagactc?tcatccctca?aaactccact?taatcataaa 660
tcaggacaaa?acatggctac?tggtgccatt?actaatgcta?aaggtttcat?gcccagcacg 720
actgcctatc?ctttcaatga?taattctaga?gaaaaagaaa?actacattta?cggaacttgt 780
tactacacag?ctagtgatcg?cactgctttt?cccattgaca?tatctgtcat?gcttaaccga 840
agagcaataa?atgacgagac?atcatattgt?attcgtataa?cttggtcctg?gaacacagga 900
gatgccccag?aggtgcaaac?ctctgctaca?accctagtca?cctccccatt?taccttttac 960
tacatcagag?aagacgactg?a 981
<210>2
<211>35655
<212>DNA
<213〉Ad5/11 recombinant vectors sequence
<220>
<221>misc_feature
<222>(721)..(721)
<223〉n is a, c, g, or t
<220>
<221>misc_feature
<222>(849)..(849)
<223〉n is a, c, g, or t
<220>
<221>misc_feature
<222>(874)..(874)
<223〉n is a, c, g, or t
<220>
<221>misc_feature
<222>(1118)..(1118)
<223〉n is a, c, g, or t
<220>
<221>misc_feature
<222>(1197)..(1197)
<223〉n is a, c, g, or t
<220>
<221>misc_feature
<222>(2254)..(2254)
<223〉n is a, c, g, or t
<400>2
ttattttgga?ttgaagccaa?tatgataatg?agggggtgga?gtttgtgacg?tggcgcgggg 60
cgtgggaacg?gggcgggtga?cgtagtagtg?tggcggaagt?gtgatgttgc?aagtgtggcg 120
gaacacatgt?aagcgacgga?tgtggcaaaa?gtgacgtttt?tggtgtgcgc?cggatccaca 180
ggacgggtgt?ggtcgccatg?atcgcgtagt?cgatagtggc?tccaagtagc?gaagcgagca 240
ggactgggcg?gcggccaaag?cggtcggaca?gtgctccgag?aacgggtgcg?catagaaatt 300
gcatcaacgc?atatagcgct?agcagcacgc?catagtgact?ggcgatgctg?tcggaatgga 360
cgatatcccg?caagaggccc?ggcagtaccg?gcataaccaa?gcctatgcct?acagcatcca 420
gggtgacggt?gccgaggatg?acgatgagcg?cattgttaga?tttcatacac?ggtgcctgac 480
tgcgttagca?atttaactgt?gataaactac?cgcattaaag?cttatcgttc?gaaatttggg 540
ggatcttcga?tgctagacga?tccagacatg?ataagataca?ttgatgagtt?tggacaaacc 600
acaactagaa?tgcagtgaaa?aaaatgcttt?atttgtgaaa?tttgtgatgc?tattgcttta 660
tttgtaacca?ttataagctg?caataaacaa?gttgctcgaa?gtcgacgatc?cgaacaaacg 720
ncccaacacc?cgtgcgtttt?attctgtctt?tttattgccg?atcccctcag?aagaactcgt 780
caagaaggcg?atagaaggcg?atgcgctgcg?aatcgggagc?ggcgataccg?taaagcacga 840
ggaagcggnc?agcccattcg?ccgccatgtt?tttnagcaat?atcacgggta?gccaacgcta 900
tgtcctgata?gcggtccgcc?acacccagcc?tcgacaattc?caaccttacc?caagagttcg 960
ccaaactcag?acatcacttt?agcaaaaccg?cgccgtgctt?cttcctcggt?ggcattcatc 1020
acgaaatgtt?cagcactacg?catacttttg?gacaggaaac?gcaacggata?ttgagtcaat 1080
atcaggcatt?ctatcgctca?gctttacagt?gacaatgncg?gctggcgact?gaatattagt 1140
gcttacagac?agcactacat?attttccgtc?gatgttgaaa?tcctttctca?tatgtcncca 1200
taaatatcaa?ataattatag?caatcattta?cgcgttaatg?gctaatcgcc?atcttccagc 1260
aggcgcacca?ttgcccctgt?ttcactatcc?aggttacgga?tatagttcat?gacaatattt 1320
acattggtcc?agccaccagc?ttgcatgatc?tccggtattg?aaactccagc?gcgggccata 1380
tctcgcgcgg?ctccgacacg?ggcactgtgt?ccagaccagg?ccaggtatct?ctgaccagag 1440
tcatccttag?cgccgtaaat?caatcgatga?gttgcttcaa?aaatcccttc?cagggcgcga 1500
gttgatagct?ggctggtggc?agatggcgcg?gcaacaccat?tttttctgac?ccggcaaaac 1560
aggtagttat?tcggatcatc?agctacacca?gagacggaaa?tccatcgctc?gaccagttta 1620
gttaccccca?ggctaagtgc?cttctctaca?cctgcggtgc?taaccagcgt?tttcgttctg 1680
ccaatatgga?ttaacattct?cccaccgtca?gtacgtgaga?tatctttaac?cctgatcctg 1740
gcaatttcgg?ctatacgtaa?cagggtgtta?taagcaatcc?ccagaaatgc?cagattacgt 1800
atatcctggc?agcgatcgct?attttccatg?agtgaacgaa?cctggtcgaa?atcagtgcgt 1860
tcgaacgcta?gagcctgttt?tgcacgttca?ccggcatcaa?cgttttcttt?tcggatccgc 1920
cgcataacca?gtgaaacagc?attgctgtca?cttggtcgtg?gcagcccgga?ccgacgatga 1980
agcatgttta?gctggcccaa?atgttgctgg?atagttttta?ctgccagacc?gcgcgcctga 2040
agatatagaa?gataatcgcg?aacatcttca?ggttctgcgg?gaaaccattt?ccggttattc 2100
aacttgcacc?atgccgccca?cgaccggcaa?acggacagaa?gcattttcca?ggtatgctca 2160
gaaaacgcct?ggcgatccct?gaacatgtcc?atcaggttct?tgcgaacctc?atcactcgtt 2220
gcatcgaccg?gtaatgcagg?caaattttgg?tgtncggtca?gtaaattgga?caccttcctc 2280
ttcttcttgg?gcatggtcga?gtctagactc?gagggatcct?cgactcgaag?actgatcccc 2340
aggctggatc?ggtcccggtg?tcttctatgg?aggtcaaaac?agcgtggatg?gcgtctccag 2400
gcgatctgac?ggttcactaa?acgagctctg?cttatataga?cctcccaccg?tacacgccta 2460
ccgcccattt?gcgtcaatgg?ggcggagttg?ttacgacatt?ttggaaagtc?ccgttgattt 2520
tggtgccaaa?acaaactccc?attgacgtca?atggggtgga?gacttggaaa?tccccgtgag 2580
tcaaaccgct?atccacgccc?attgatgtac?tgccaaaacc?gcatcaccat?ggtaatagcg 2640
atgactaata?cgtagatgta?ctgccaagta?ggaaagtccc?ataaggtcat?gtactgggca 2700
taatgccagg?gaattagatc?cactagacga?tgataagctg?tcaaacatga?gaattcttga 2760
agacgaaagg?gcctcgtgat?acgcctattt?ttataggtta?atgtcatgat?aataatggtt 2820
tcttagacgt?caggtggcac?ttttcgggga?aatgtgcgcg?gaacccctat?ttgtttattt 2880
ttctaaatac?attcaaatat?gtatccgctc?atgagacaat?aaccctgata?aatgcttcaa 2940
taatattgaa?aaaggaagag?tatgagtatt?caacatttcc?gtgtcgccct?tattcccttt 3000
tttgcggcat?tttgccttcc?tgtttttgct?cacccagaaa?cgctggtgaa?agtaaaagat 3060
gctgaagatc?agttgggtgc?acgagtgggt?tacatcgaac?tggatctcaa?cagcggtaag 3120
atccttgaga?gttttcgccc?cgaagaacgt?tttccaatga?tgagcacttt?taaagttctg 3180
ctatgtggcg?cggtattatc?ccgtgttgac?gccgggcaag?agcaactcgg?tcgccgcata 3240
cactattctc?agaatgactt?ggttgagtac?tcaccagtca?cagaaaagca?tcttacggat 3300
ggcatgacag?taagagaatt?atgcagtgct?gccataacca?tgagtgataa?cactgcggcc 3360
aacttacttc?tgacaacgat?cggaggaccg?aaggagctaa?ccgctttttt?gcacaacatg 3420
ggggatcatg?taactcgcct?tgatcgttgg?gaaccggagc?tgaatgaagc?cataccaaac 3480
gacgagcgtg?acaccacgat?gcctgcagca?atggcaacaa?cgttgcgcaa?actattaact 3540
ggcgaactac?ttactctagc?ttcccggcaa?caattaatag?actggatgga?ggcggataaa 3600
gttgcaggac?cacttctgcg?ctcggccctt?ccggctggct?ggtttattgc?tgataaatct 3660
ggagccggtg?agcgtgggtc?tcgcggtatc?attgcagcac?tggggccaga?tggtaagccc 3720
tcccgtatcg?tagttatcta?cacgacgggg?agtcaggcaa?ctatggatga?acgaaataga 3780
cagatcgctg?agataggtgc?ctcactgatt?aagcattggt?aactgtcaga?ccaagtttac 3840
tcatatatac?tttagattga?tttaaaactt?catttttaat?ttaaaaggat?ctaggtgaag 3900
atcctttttg?ataatctcat?gaccaaaatc?ccttaacgtg?agttttcgtt?ccactgagcg 3960
tcagaccccg?tagaaaagat?caaaggatct?tcttgagatc?ctttttttct?gcgcgtaatc 4020
tgctgcttgc?aaacaaaaaa?accaccgcta?ccagcggtgg?tttgtttgcc?ggatcaagag 4080
ctaccaactc?tttttccgaa?ggtaactggc?ttcagcagag?cgcagatacc?aaatactgtc 4140
cttctagtgt?agccgtagtt?aggccaccac?ttcaagaact?ctgtagcacc?gcctacatac 4200
ctcgctctgc?taatcctgtt?accagtggct?gctgccagtg?gcgataagtc?gtgtcttacc 4260
gggttggact?caagacgata?gttaccggat?aaggcgcagc?ggtcgggctg?aacggggggt 4320
tcgtgcacac?agcccagctt?ggagcgaacg?acctacaccg?aactgagata?cctacagcgt 4380
gagcattgag?aaagcgccac?gcttcccgaa?gggagaaagg?cggacaggta?tccggtaagc 4440
ggcagggtcg?gaacaggaga?gcgcacgagg?gagcttccag?ggggaaacgc?ctggtatctt 4500
tatagtcctg?tcgggtttcg?ccacctctga?cttgagcgtc?gatttttgtg?atgctcgtca 4560
ggggggcgga?gcctatggaa?aaacgccagc?aacgcggcct?ttttacggtt?cctggccttt 4620
tgctggcctt?ttgctcacat?gttctttcct?gcgttatccc?ctgattctgt?ggataaccgt 4680
attaccgcct?ttgagtgagc?tgataccgct?cgccgcagcc?gaacgaccga?gcgcagcgag 4740
tcagtgagcg?aggaagcgga?agagcgcctg?atgcggtatt?ttctccttac?gcatctgtgc 4800
ggtatttcac?accgcatatg?gtgcactctc?agtacaatct?gctctgatgc?cgcatagtta 4860
agccagtaat?cgaattcaag?cttgtcgact?cgaagatcca?ataacttcgt?atagcataca 4920
ttatacgaag?ttataagtac?tgaattcgga?tctgggcgtg?gttaagggtg?ggaaagaata 4980
tataaggtgg?gggtcttatg?tagttttgta?tctgttttgc?agcagccgcc?gccgccatga 5040
gcaccaactc?gtttgatgga?agcattgtga?gctcatattt?gacaacgcgc?atgcccccat 5100
gggccggggt?gcgtcagaat?gtgatgggct?ccagcattga?tggtcgcccc?gtcctgcccg 5160
caaactctac?taccttgacc?tacgagaccg?tgtctggaac?gccgttggag?actgcagcct 5220
ccgccgccgc?ttcagccgct?gcagccaccg?cccgcgggat?tgtgactgac?tttgctttcc 5280
tgagcccgct?tgcaagcagt?gcagcttccc?gttcatccgc?ccgcgatgac?aagttgacgg 5340
ctcttttggc?acaattggat?tctttgaccc?gggaacttaa?tgtcgtttct?cagcagctgt 5400
tggatctgcg?ccagcaggtt?tctgccctga?aggcttcctc?ccctcccaat?gcggtttaaa 5460
acataaataa?aaaaccagac?tctgtttgga?tttggatcaa?gcaagtgtct?tgctgtcttt 5520
atttaggggt?tttgcgcgcg?cggtaggccc?gggaccagcg?gtctcggtcg?ttgagggtcc 5580
tgtgtatttt?ttccaggacg?tggtaaaggt?gactctggat?gttcagatac?atgggcataa 5640
gcccgtctct?ggggtggagg?tagcaccact?gcagagcttc?atgctgcggg?gtggtgttgt 5700
agatgatcca?gtcgtagcag?gagcgctggg?cgtggtgcct?aaaaatgtct?ttcagtagca 5760
agctgattgc?caggggcagg?cccttggtgt?aagtgtttac?aaagcggtta?agctgggatg 5820
ggtgcatacg?tggggatatg?agatgcatct?tggactgtat?ttttaggttg?gctatgttcc 5880
cagccatatc?cctccgggga?ttcatgttgt?gcagaaccac?cagcacagtg?tatccggtgc 5940
acttgggaaa?tttgtcatgt?agcttagaag?gaaatgcgtg?gaagaacttg?gagacgccct 6000
tgtgacctcc?aagattttcc?atgcattcgt?ccataatgat?ggcaatgggc?ccacgggcgg 6060
cggcctgggc?gaagatattt?ctgggatcac?taacgtcata?gttgtgttcc?aggatgagat 6120
cgtcataggc?catttttaca?aagcgcgggc?ggagggtgcc?agactgcggt?ataatggttc 6180
catccggccc?aggggcgtag?ttaccctcac?agatttgcat?ttcccacgct?ttgagttcag 6240
atggggggat?catgtctacc?tgcggggcga?tgaagaaaac?ggtttccggg?gtaggggaga 6300
tcagctggga?agaaagcagg?ttcctgagca?gctgcgactt?accgcagccg?gtgggcccgt 6360
aaatcacacc?tattaccggg?tgcaactggt?agttaagaga?gctgcagctg?ccgtcatccc 6420
tgagcagggg?ggccacttcg?ttaagcatgt?ccctgactcg?catgttttcc?ctgaccaaat 6480
ccgccagaag?gcgctcgccg?cccagcgata?gcagttcttg?caaggaagca?aagtttttca 6540
acggtttgag?accgtccgcc?gtaggcatgc?ttttgagcgt?ttgaccaagc?agttccaggc 6600
ggtcccacag?ctcggtcacc?tgctctacgg?catctcgatc?cagcatatct?cctcgtttcg 6660
cgggttgggg?cggctttcgc?tgtacggcag?tagtcggtgc?tcgtccagac?gggccagggt 6720
catgtctttc?cacgggcgca?gggtcctcgt?cagcgtagtc?tgggtcacgg?tgaaggggtg 6780
cgctccgggc?tgcgcgctgg?ccagggtgcg?cttgaggctg?gtcctgctgg?tgctgaagcg 6840
ctgccggtct?tcgccctgcg?cgtcggccag?gtagcatttg?accatggtgt?catagtccag 6900
cccctccgcg?gcgtggccct?tggcgcgcag?cttgcccttg?gaggaggcgc?cgcacgaggg 6960
gcagtgcaga?cttttgaggg?cgtagagctt?gggcgcgaga?aataccgatt?ccggggagta 7020
ggcatccgcg?ccgcaggccc?cgcagacggt?ctcgcattcc?acgagccagg?tgagctctgg 7080
ccgttcgggg?tcaaaaacca?ggtttccccc?atgctttttg?atgcgtttct?tacctctggt 7140
ttccatgagc?cggtgtccac?gctcggtgac?gaaaaggctg?tccgtgtccc?cgtatacaga 7200
cttgagaggc?ctgtcctcga?gcggtgttcc?gcggtcctcc?tcgtatagaa?actcggacca 7260
ctctgagaca?aaggctcgcg?tccaggccag?cacgaaggag?gctaagtggg?aggggtagcg 7320
gtcgttgtcc?actagggggt?ccactcgctc?cagggtgtga?agacacatgt?cgccctcttc 7380
ggcatcaagg?aaggtgattg?gtttgtaggt?gtaggccacg?tgaccgggtg?ttcctgaagg 7440
ggggctataa?aagggggtgg?gggcgcgttc?gtcctcactc?tcttccgcat?cgctgtctgc 7500
gagggccagc?tgttggggtg?agtactccct?ctgaaaagcg?ggcatgactt?ctgcgctaag 7560
attgtcagtt?tccaaaaacg?aggaggattt?gatattcacc?tggcccgcgg?tgatgccttt 7620
gagggtggcc?gcatccatct?ggtcagaaaa?gacaatcttt?ttgttgtcaa?gcttggtggc 7680
aaacgacccg?tagagggcgt?tggacagcaa?cttggcgatg?gagcgcaggg?tttggttttt 7740
gtcgcgatcg?gcgcgctcct?tggccgcgat?gtttagctgc?acgtattcgc?gcgcaacgca 7800
ccgccattcg?ggaaagacgg?tggtgcgctc?gtcgggcacc?aggtgcacgc?gccaaccgcg 7860
gttgtgcagg?gtgacaaggt?caacgctggt?ggctacctct?ccgcgtaggc?gctcgttggt 7920
ccagcagagg?cggccgccct?tgcgcgagca?gaatggcggt?agggggtcta?gctgcgtctc 7980
gtccgggggg?tctgcgtcca?cggtaaagac?cccgggcagc?aggcgcgcgt?cgaagtagtc 8040
tatcttgcat?ccttgcaagt?ctagcgcctg?ctgccatgcg?cgggcggcaa?gcgcgcgctc 8100
gtatgggttg?agtgggggac?cccatggcat?ggggtgggtg?agcgcggagg?cgtacatgcc 8160
gcaaatgtcg?taaacgtaga?ggggctctct?gagtattcca?agatatgtag?ggtagcatct 8220
tccaccgcgg?atgctggcgc?gcacgtaatc?gtatagttcg?tgcgagggag?cgaggaggtc 8280
gggaccgagg?ttgctacggg?cgggctgctc?tgctcggaag?actatctgcc?tgaagatggc 8340
atgtgagttg?gatgatatgg?ttggacgctg?gaagacgttg?aagctggcgt?ctgtgagacc 8400
taccgcgtca?cgcacgaagg?aggcgtagga?gtcgcgcagc?ttgttgacca?gctcggcggt 8460
gacctgcacg?tctagggcgc?agtagtccag?ggtttccttg?atgatgtcat?acttatcctg 8520
tccctttttt?ttccacagct?cgcggttgag?gacaaactct?tcgcggtctt?tccagtactc 8580
ttggatcgga?aacccgtcgg?cctccgaacg?gtaagagcct?agcatgtaga?actggttgac 8640
ggcctggtag?gcgcagcatc?ccttttctac?gggtagcgcg?tatgcctgcg?cggccttccg 8700
gagcgaggtg?tgggtgagcg?caaaggtgtc?cctgaccatg?actttgaggt?actggtattt 8760
gaagtcagtg?tcgtcgcatc?cgccctgctc?ccagagcaaa?aagtccgtgc?gctttttgga 8820
acgcggattt?ggcagggcga?aggtgacatc?gttgaagagt?atctttcccg?cgcgaggcat 8880
aaagttgcgt?gtgatgcgga?agggtcccgg?cacctcggaa?cggttgttaa?ttacctgggc 8940
ggcgagcacg?atctcgtcaa?agccgttgat?gttgtggccc?acaatgtaaa?gttccaagaa 9000
gcgcgggatg?cccttgatgg?aaggcaattt?tttaagttcc?tcgtaggtga?gctcttcagg 9060
ggagctgagc?ccgtgctctg?aaagggccca?gtctgcaaga?tgagggttgg?aagcgacgaa 9120
tgagctccac?aggtcacggg?ccattagcat?ttgcaggtgg?tcgcgaaagg?tcctaaactg 9180
gcgacctatg?gccatttttt?ctggggtgat?gcagtagaag?gtaagcgggt?cttgttccca 9240
gcggtcccat?ccaaggttcg?cggctaggtc?tcgcgcggca?gtcactagag?gctcatctcc 9300
gccgaacttc?atgaccagca?tgaagggcac?gagctgcttc?ccaaaggccc?ccatccaagt 9360
ataggtctct?acatcgtagg?tgacaaagag?acgctcggtg?cgaggatgcg?agccgatcgg 9420
gaagaactgg?atctcccgcc?accaattgga?ggagtggcta?ttgatgtggt?gaaagtagaa 9480
gtccctgcga?cgggccgaac?actcgtgctg?gcttttgtaa?aaacgtgcgc?agtactggca 9540
gcggtgcacg?ggctgtacat?cctgcacgag?gttgacctga?cgaccgcgca?caaggaagca 9600
gagtgggaat?ttgagcccct?cgcctggcgg?gtttggctgg?tggtcttcta?cttcggctgc 9660
ttgtccttga?ccgtctggct?gctcgagggg?agttacggtg?gatcggacca?ccacgccgcg 9720
cgagcccaaa?gtccagatgt?ccgcgcgcgg?cggtcggagc?ttgatgacaa?catcgcgcag 9780
atgggagctg?tccatggtct?ggagctcccg?cggcgtcagg?tcaggcggga?gctcctgcag 9840
gtttacctcg?catagacggg?tcagggcgcg?ggctagatcc?aggtgatacc?taatttccag 9900
gggctggttg?gtggcggcgt?cgatggcttg?caagaggccg?catccccgcg?gcgcgactac 9960
ggtaccgcgc?ggcgggcggt?gggccgcggg?ggtgtccttg?gatgatgcat?ctaaaagcgg 10020
tgacgcgggc?gagcccccgg?aggtaggggg?ggctccggac?ccgccgggag?agggggcagg 10080
ggcacgtcgg?cgccgcgcgc?gggcaggagc?tggtgctgcg?cgcgtaggtt?gctggcgaac 10140
gcgacgacgc?ggcggttgat?ctcctgaatc?tggcgcctct?gcgtgaagac?gacgggcccg 10200
gtgagcttga?gcctgaaaga?gagttcgaca?gaatcaattt?cggtgtcgtt?gacggcggcc 10260
tggcgcaaaa?tctcctgcac?gtctcctgag?ttgtcttgat?aggcgatctc?ggccatgaac 10320
tgctcgatct?cttcctcctg?gagatctccg?cgtccggctc?gctccacggt?ggcggcgagg 10380
tcgttggaaa?tgcgggccat?gagctgcgag?aaggcgttga?ggcctccctc?gttccagacg 10440
cggctgtaga?ccacgccccc?ttcggcatcg?cgggcgcgca?tgaccacctg?cgcgagattg 10500
agctccacgt?gccgggcgaa?gacggcgtag?tttcgcaggc?gctgaaagag?gtagttgagg 10560
gtggtggcgg?tgtgttctgc?cacgaagaag?tacataaccc?agcgtcgcaa?cgtggattcg 10620
ttgatatccc?ccaaggcctc?aaggcgctcc?atggcctcgt?agaagtccac?ggcgaagttg 10680
aaaaactggg?agttgcgcgc?cgacacggtt?aactcctcct?ccagaagacg?gatgagctcg 10740
gcgacagtgt?cgcgcacctc?gcgctcaaag?gctacagggg?cctcttcttc?ttcttcaatc 10800
tcctcttcca?taagggcctc?cccttcttct?tcttctggcg?gcggtggggg?aggggggaca 10860
cggcggcgac?gacggcgcac?cgggaggcgg?tcgacaaagc?gctcgatcat?ctccccgcgg 10920
cgacggcgca?tggtctcggt?gacggcgcgg?ccgttctcgc?gggggcgcag?ttggaagacg 10980
ccgcccgtca?tgtcccggtt?atgggttggc?ggggggctgc?catgcggcag?ggatacggcg 11040
ctaacgatgc?atctcaacaa?ttgttgtgta?ggtactccgc?cgccgaggga?cctgagcgag 11100
tccgcatcga?ccggatcgga?aaacctctcg?agaaaggcgt?ctaaccagtc?acagtcgcaa 11160
ggtaggctga?gcaccgtggc?gggcggcagc?gggcggcggt?cggggttgtt?tctggcggag 11220
gtgctgctga?tgatgtaatt?aaagtaggcg?gtcttgagac?ggcggatggt?cgacagaagc 11280
accatgtcct?tgggtccggc?ctgctgaatg?cgcaggcggt?cggccatgcc?ccaggcttcg 11340
ttttgacatc?ggcgcaggtc?tttgtagtag?tcttgcatga?gcctttctac?cggcacttct 11400
tcttctcctt?cctcttgtcc?tgcatctctt?gcatctatcg?ctgcggcggc?ggcggagttt 11460
ggccgtaggt?ggcgccctct?tcctcccatg?cgtgtgaccc?cgaagcccct?catcggctga 11520
agcagggcta?ggtcggcgac?aacgcgctcg?gctaatatgg?cctgctgcac?ctgcgtgagg 11580
gtagactgga?agtcatccat?gtccacaaag?cggtggtatg?cgcccgtgtt?gatggtgtaa 11640
gtgcagttgg?ccataacgga?ccagttaacg?gtctggtgac?ccggctgcga?gagctcggtg 11700
tacctgagac?gcgagtaagc?cctcgagtca?aatacgtagt?cgttgcaagt?ccgcaccagg 11760
tactggtatc?ccaccaaaaa?gtgcggcggc?ggctggcggt?agaggggcca?gcgtagggtg 11820
gccggggctc?cgggggcgag?atcttccaac?ataaggcgat?gatatccgta?gatgtacctg 11880
gacatccagg?tgatgccggc?ggcggtggtg?gaggcgcgcg?gaaagtcgcg?gacgcggttc 11940
cagatgttgc?gcagcggcaa?aaagtgctcc?atggtcggga?cgctctggcc?ggtcaggcgc 12000
gcgcaatcgt?tgacgctcta?ccgtgcaaaa?ggagagcctg?taagcgggca?ctcttccgtg 12060
gtctggtgga?taaattcgca?agggtatcat?ggcggacgac?cggggttcga?gccccgtatc 12120
cggccgtccg?ccgtgatcca?tgcggttacc?gcccgcgtgt?cgaacccagg?tgtgcgacgt 12180
cagacaacgg?gggagtgctc?cttttggctt?ccttccaggc?gcggcggctg?ctgcgctagc 12240
ttttttggcc?actggccgcg?cgcagcgtaa?gcggttaggc?tggaaagcga?aagcattaag 12300
tggctcgctc?cctgtagccg?gagggttatt?ttccaagggt?tgagtcgcgg?gacccccggt 12360
tcgagtctcg?gaccggccgg?actgcggcga?acgggggttt?gcctccccgt?catgcaagac 12420
cccgcttgca?aattcctccg?gaaacaggga?cgagcccctt?ttttgctttt?cccagatgca 12480
tccggtgctg?cggcagatgc?gcccccctcc?tcagcagcgg?caagagcaag?agcagcggca 12540
gacatgcagg?gcaccctccc?ctcctcctac?cgcgtcagga?ggggcgacat?ccgcggttga 12600
cgcggcagca?gatggtgatt?acgaaccccc?gcggcgccgg?gcccggcact?acctggactt 12660
ggaggagggc?gagggcctgg?cgcggctagg?agcgccctct?cctgagcggt?acccaagggt 12720
gcagctgaag?cgtgatacgc?gtgaggcgta?cgtgccgcgg?cagaacctgt?ttcgcgaccg 12780
cgagggagag?gagcccgagg?agatgcggga?tcgaaagttc?cacgcagggc?gcgagctgcg 12840
gcatggcctg?aatcgcgagc?ggttgctgcg?cgaggaggac?tttgagcccg?acgcgcgaac 12900
cgggattagt?cccgcgcgcg?cacacgtggc?ggccgccgac?ctggtaaccg?catacgagca 12960
gacggtgaac?caggagatta?actttcaaaa?aagctttaac?aaccacgtgc?gtacgcttgt 13020
ggcgcgcgag?gaggtggcta?taggactgat?gcatctgtgg?gactttgtaa?gcgcgctgga 13080
gcaaaaccca?aatagcaagc?cgctcatggc?gcagctgttc?cttatagtgc?agcacagcag 13140
ggacaacgag?gcattcaggg?atgcgctgct?aaacatagta?gagcccgagg?gccgctggct 13200
gctcgatttg?ataaacatcc?tgcagagcat?agtggtgcag?gagcgcagct?tgagcctggc 13260
tgacaaggtg?gccgccatca?actattccat?gcttagcctg?ggcaagtttt?acgcccgcaa 13320
gatataccat?accccttacg?ttcccataga?caaggaggta?aagatcgagg?ggttctacat 13380
gcgcatggcg?ctgaaggtgc?ttaccttgag?cgacgacctg?ggcgtttatc?gcaacgagcg 13440
catccacaag?gccgtgagcg?tgagccggcg?gcgcgagctc?agcgaccgcg?agctgatgca 13500
cagcctgcaa?agggccctgg?ctggcacggg?cagcggcgat?agagaggccg?agtcctactt 13560
tgacgcgggc?gctgacctgc?gctgggcccc?aagccgacgc?gccctggagg?cagctggggc 13620
cggacctggg?ctggcggtgg?cacccgcgcg?cgctggcaac?gtcggcggcg?tggaggaata 13680
tgacgaggac?gatgagtacg?agccagagga?cggcgagtac?taagcggtga?tgtttctgat 13740
cagatgatgc?aagacgcaac?ggacccggcg?gtgcgggcgg?cgctgcagag?ccagccgtcc 13800
ggccttaact?ccacggacga?ctggcgccag?gtcatggacc?gcatcatgtc?gctgactgcg 13860
cgcaatcctg?acgcgttccg?gcagcagccg?caggccaacc?ggctctccgc?aattctggaa 13920
gcggtggtcc?cggcgcgcgc?aaaccccacg?cacgagaagg?tgctggcgat?cgtaaacgcg 13980
ctggccgaaa?acagggccat?ccggcccgac?gaggccggcc?tggtctacga?cgcgctgctt 14040
cagcgcgtgg?ctcgttacaa?cagcggcaac?gtgcagacca?acctggaccg?gctggtgggg 14100
gatgtgcgcg?aggccgtggc?gcagcgtgag?cgcgcgcagc?agcagggcaa?cctgggctcc 14160
atggttgcac?taaacgcctt?cctgagtaca?cagcccgcca?acgtgccgcg?gggacaggag 14220
gactacacca?actttgtgag?cgcactgcgg?ctaatggtga?ctgagacacc?gcaaagtgag 14280
gtgtaccagt?ctgggccaga?ctattttttc?cagaccagta?gacaaggcct?gcagaccgta 14340
aacctgagcc?aggctttcaa?aaacttgcag?gggctgtggg?gggtgcgggc?tcccacaggc 14400
gaccgcgcga?ccgtgtctag?cttgctgacg?cccaactcgc?gcctgttgct?gctgctaata 14460
gcgcccttca?cggacagtgg?cagcgtgtcc?cgggacacat?acctaggtca?cttgctgaca 14520
ctgtaccgcg?aggccatagg?tcaggcgcat?gtggacgagc?atactttcca?ggagattaca 14580
agtgtcagcc?gcgcgctggg?gcaggaggac?acgggcagcc?tggaggcaac?cctaaactac 14640
ctgctgacca?accggcggca?gaagatcccc?tcgttgcaca?gtttaaacag?cgaggaggag 14700
cgcattttgc?gctacgtgca?gcagagcgtg?agccttaacc?tgatgcgcga?cggggtaacg 14760
cccagcgtgg?cgctggacat?gaccgcgcgc?aacatggaac?cgggcatgta?tgcctcaaac 14820
cggccgttta?tcaaccgcct?aatggactac?ttgcatcgcg?cggccgccgt?gaaccccgag 14880
tatttcacca?atgccatctt?gaacccgcac?tggctaccgc?cccctggttt?ctacaccggg 14940
ggattcgagg?tgcccgaggg?taacgatgga?ttcctctggg?acgacataga?cgacagcgtg 15000
ttttccccgc?aaccgcagac?cctgctagag?ttgcaacagc?gcgagcaggc?agaggcggcg 15060
ctgcgaaagg?aaagcttccg?caggccaagc?agcttgtccg?atctaggcgc?tgcggccccg 15120
cggtcagatg?ctagtagccc?atttccaagc?ttgatagggt?ctcttaccag?cactcgcacc 15180
acccgcccgc?gcctgctggg?cgaggaggag?tacctaaaca?actcgctgct?gcagccgcag 15240
cgcgaaaaaa?acctgcctcc?ggcatttccc?aacaacggga?tagagagcct?agtggacaag 15300
atgagtagat?ggaagacgta?cgcgcaggag?cacagggacg?tgccaggccc?gcgcccgccc 15360
acccgtcgtc?aaaggcacga?ccgtcagcgg?ggtctggtgt?gggaggacga?tgactcggca 15420
gacgacagca?gcgtcctgga?tttgggaggg?agtggcaacc?cgtttgcgca?ccttcgcccc 15480
aggctgggga?gaatgtttta?aaaaaaaaaa?agcatgatgc?aaaataaaaa?actcaccaag 15540
gccatggcac?cgagcgttgg?ttttcttgta?ttccccttag?tatgcggcgc?gcggcgatgt 15600
atgaggaagg?tcctcctccc?tcctacgaga?gtgtggtgag?cgcggcgcca?gtggcggcgg 15660
cgctgggttc?tcccttcgat?gctcccctgg?acccgccgtt?tgtgcctccg?cggtacctgc 15720
ggcctaccgg?ggggagaaac?agcatccgtt?actctgagtt?ggcaccccta?ttcgacacca 15780
cccgtgtgta?cctggtggac?aacaagtcaa?cggatgtggc?atccctgaac?taccagaacg 15840
accacagcaa?ctttctgacc?acggtcattc?aaaacaatga?ctacagcccg?ggggaggcaa 15900
gcacacagac?catcaatctt?gacgaccggt?cgcactgggg?cggcgacctg?aaaaccatcc 15960
tgcataccaa?catgccaaat?gtgaacgagt?tcatgtttac?caataagttt?aaggcgcggg 16020
tgatggtgtc?gcgcttgcct?actaaggaca?atcaggtgga?gctgaaatac?gagtgggtgg 16080
agttcacgct?gcccgagggc?aactactccg?agaccatgac?catagacctt?atgaacaacg 16140
cgatcgtgga?gcactacttg?aaagtgggca?gacagaacgg?ggttctggaa?agcgacatcg 16200
gggtaaagtt?tgacacccgc?aacttcagac?tggggtttga?ccccgtcact?ggtcttgtca 16260
tgcctggggt?atatacaaac?gaagccttcc?atccagacat?cattttgctg?ccaggatgcg 16320
gggtggactt?cacccacagc?cgcctgagca?acttgttggg?catccgcaag?cggcaaccct 16380
tccaggaggg?ctttaggatc?acctacgatg?atctggaggg?tggtaacatt?cccgcactgt 16440
tggatgtgga?cgcctaccag?gcgagcttga?aagatgacac?cgaacagggc?gggggtggcg 16500
caggcggcag?caacagcagt?ggcagcggcg?cggaagagaa?ctccaacgcg?gcagccgcgg 16560
caatgcagcc?ggtggaggac?atgaacgatc?atgccattcg?cggcgacacc?tttgccacac 16620
gggctgagga?gaagcgcgct?gaggccgaag?cagcggccga?agctgccgcc?cccgctgcgc 16680
aacccgaggt?cgagaagcct?cagaagaaac?cggtgatcaa?acccctgaca?gaggacagca 16740
agaaacgcag?ttacaaccta?ataagcaatg?acagcacctt?cacccagtac?cgcagctggt 16800
accttgcata?caactacggc?gaccctcaga?ccggaatccg?ctcatggacc?ctgctttgca 16860
ctcctgacgt?aacctgcggc?tcggagcagg?tctactggtc?gttgccagac?atgatgcaag 16920
accccgtgac?cttccgctcc?acgcgccaga?tcagcaactt?tccggtggtg?ggcgccgagc 16980
tgttgcccgt?gcactccaag?agcttctaca?acgaccaggc?cgtctactcc?caactcatcc 17040
gccagtttac?ctctctgacc?cacgtgttca?atcgctttcc?cgagaaccag?attttggcgc 17100
gcccgccagc?ccccaccatc?accaccgtca?gtgaaaacgt?tcctgctctc?acagatcacg 17160
ggacgctacc?gctgcgcaac?agcatcggag?gagtccagcg?agtgaccatt?actgacgcca 17220
gacgccgcac?ctgcccctac?gtttacaagg?ccctgggcat?agtctcgccg?cgcgtcctat 17280
cgagccgcac?tttttgagca?agcatgtcca?tccttatatc?gcccagcaat?aacacaggct 17340
ggggcctgcg?cttcccaagc?aagatgtttg?gcggggccaa?gaagcgctcc?gaccaacacc 17400
cagtgcgcgt?gcgcgggcac?taccgcgcgc?cctggggcgc?gcacaaacgc?ggccgcactg 17460
ggcgcaccac?cgtcgatgac?gccatcgacg?cggtggtgga?ggaggcgcgc?aactacacgc 17520
ccacgccgcc?accagtgtcc?acagtggacg?cggccattca?gaccgtggtg?cgcggagccc 17580
ggcgctatgc?taaaatgaag?agacggcgga?ggcgcgtagc?acgtcgccac?cgccgccgac 17640
ccggcactgc?cgcccaacgc?gcggcggcgg?ccctgcttaa?ccgcgcacgt?cgcaccggcc 17700
gacgggcggc?catgcgggcc?gctcgaaggc?tggccgcggg?tattgtcact?gtgcccccca 17760
ggtccaggcg?acgagcggcc?gccgcagcag?ccgcggccat?tagtgctatg?actcagggtc 17820
gcaggggcaa?cgtgtattgg?gtgcgcgact?cggttagcgg?cctgcgcgtg?cccgtgcgca 17880
cccgcccccc?gcgcaactag?attgcaagaa?aaaactactt?agactcgtac?tgttgtatgt 17940
atccagcggc?ggcggcgcgc?aacgaagcta?tgtccaagcg?caaaatcaaa?gaagagatgc 18000
tccaggtcat?cgcgccggag?atctatggcc?ccccgaagaa?ggaagagcag?gattacaagc 18060
cccgaaagct?aaagcgggtc?aaaaagaaaa?agaaagatga?tgatgatgaa?cttgacgacg 18120
aggtggaact?gctgcacgct?accgcgccca?ggcgacgggt?acagtggaaa?ggtcgacgcg 18180
taaaacgtgt?tttgcgaccc?ggcaccaccg?tagtctttac?gcccggtgag?cgctccaccc 18240
gcacctacaa?gcgcgtgtat?gatgaggtgt?acggcgacga?ggacctgctt?gagcaggcca 18300
acgagcgcct?cggggagttt?gcctacggaa?agcggcataa?ggacatgctg?gcgttgccgc 18360
tggacgaggg?caacccaaca?cctagcctaa?agcccgtaac?actgcagcag?gtgctgcccg 18420
cgcttgcacc?gtccgaagaa?aagcgcggcc?taaagcgcga?gtctggtgac?ttggcaccca 18480
ccgtgcagct?gatggtaccc?aagcgccagc?gactggaaga?tgtcttggaa?aaaatgaccg 18540
tggaacctgg?gctggagccc?gaggtccgcg?tgcggccaat?caagcaggtg?gcgccgggac 18600
tgggcgtgca?gaccgtggac?gttcagatac?ccactaccag?tagcaccagt?attgccaccg 18660
ccacagaggg?catggagaca?caaacgtccc?cggttgcctc?agcggtggcg?gatgccgcgg 18720
tgcaggcggt?cgctgcggcc?gcgtccaaga?cctctacgga?ggtgcaaacg?gacccgtgga 18780
tgtttcgcgt?ttcagccccc?cggcgcccgc?gcggttcgag?gaagtacggc?gccgccagcg 18840
cgctactgcc?cgaatatgcc?ctacatcctt?ccattgcgcc?tacccccggc?tatcgtggct 18900
acacctaccg?ccccagaaga?cgagcaacta?cccgacgccg?aaccaccact?ggaacccgcc 18960
gccgccgtcg?ccgtcgccag?cccgtgctgg?ccccgatttc?cgtgcgcagg?gtggctcgcg 19020
aaggaggcag?gaccctggtg?ctgccaacag?cgcgctacca?ccccagcatc?gtttaaaagc 19080
cggtctttgt?ggttcttgca?gatatggccc?tcacctgccg?cctccgtttc?ccggtgccgg 19140
gattccgagg?aagaatgcac?cgtaggaggg?gcatggccgg?ccacggcctg?acgggcggca 19200
tgcgtcgtgc?gcaccaccgg?cggcggcgcg?cgtcgcaccg?tcgcatgcgc?ggcggtatcc 19260
tgcccctcct?tattccactg?atcgccgcgg?cgattggcgc?cgtgcccgga?attgcatccg 19320
tggccttgca?ggcgcagaga?cactgattaa?aaacaagttg?catgtggaaa?aatcaaaata 19380
aaaagtctgg?actctcacgc?tcgcttggtc?ctgtaactat?tttgtagaat?ggaagacatc 19440
aactttgcgt?ctctggcccc?gcgacacggc?tcgcgcccgt?tcatgggaaa?ctggcaagat 19500
atcggcacca?gcaatatgag?cggtggcgcc?ttcagctggg?gctcgctgtg?gagcggcatt 19560
aaaaatttcg?gttccaccgt?taagaactat?ggcagcaagg?cctggaacag?cagcacaggc 19620
cagatgctga?gggataagtt?gaaagagcaa?aatttccaac?aaaaggtggt?agatggcctg 19680
gcctctggca?ttagcggggt?ggtggacctg?gccaaccagg?cagtgcaaaa?taagattaac 19740
agtaagcttg?atccccgccc?tcccgtagag?gagcctccac?cggccgtgga?gacagtgtct 19800
ccagaggggc?gtggcgaaaa?gcgtccgcgc?cccgacaggg?aagaaactct?ggtgacgcaa 19860
atagacgagc?ctccctcgtacgaggaggca?ctaaagcaag?gcctgcccac?cacccgtccc 19920
atcgcgccca?tggctaccgg?agtgctgggc?cagcacacac?ccgtaacgct?ggacctgcct 19980
ccccccgccg?acacccagca?gaaacctgtg?ctgccaggcc?cgaccgccgt?tgttgtaacc 20040
cgtcctagcc?gcgcgtccct?gcgccgcgcc?gccagcggtc?cgcgatcgtt?gcggcccgta 20100
gccagtggca?actggcaaag?cacactgaac?agcatcgtgg?gtctgggggt?gcaatccctg 20160
aagcgccgac?gatgcttctg?aatagctaac?gtgtcgtatg?tgtgtcatgt?atgcgtccat 20220
gtcgccgcca?gaggagctgc?tgagccgccg?cgcgcccgct?ttccaagatg?gctacccctt 20280
cgatgatgcc?gcagtggtct?tacatgcaca?tctcgggcca?ggacgcctcg?gagtacctga 20340
gccccgggct?ggtgcagttt?gcccgcgcca?ccgagacgta?cttcagcctg?aataacaagt 20400
ttagaaaccc?cacggtggcg?cctacgcacg?acgtgaccac?agaccggtcc?cagcgtttga 20460
cgctgcggtt?catccctgtg?gaccgtgagg?atactgcgta?ctcgtacaag?gcgcggttca 20520
ccctagctgt?gggtgataac?cgtgtgctgg?acatggcttc?cacgtacttt?gacatccgcg 20580
gcgtgctgga?caggggccct?acttttaagc?cctactctgg?cactgcctac?aacgccctgg 20640
ctcccaaggg?tgccccaaat?ccttgcgaat?gggatgaagc?tgctactgct?cttgaaataa 20700
acctagaaga?agaggacgat?gacaacgaag?acgaagtaga?cgagcaagct?gagcagcaaa 20760
aaactcacgt?atttgggcag?gcgccttatt?ctggtataaa?tattacaaag?gagggtattc 20820
aaataggtgt?cgaaggtcaa?acacctaaat?atgccgataa?aacatttcaa?cctgaacctc 20880
aaataggaga?atctcagtgg?tacgaaactg?aaattaatca?tgcagctggg?agagtcctta 20940
aaaagactac?cccaatgaaa?ccatgttacg?gttcatatgc?aaaacccaca?aatgaaaatg 21000
gagggcaagg?cattcttgta?aagcaacaaa?atggaaagct?agaaagtcaa?gtggaaatgc 21060
aatttttctc?aactactgag?gcgaccgcag?gcaatggtga?taacttgact?cctaaagtgg 21120
tattgtacag?tgaagatgta?gatatagaaa?ccccagacac?tcatatttct?tacatgccca 21180
ctattaagga?aggtaactca?cgagaactaa?tgggccaaca?atctatgccc?aacaggccta 21240
attacattgc?ttttagggac?aattttattg?gtctaatgta?ttacaacagc?acgggtaata 21300
tgggtgttct?ggcgggccaa?gcatcgcagt?tgaatgctgt?tgtagatttg?caagacagaa 21360
acacagagct?ttcataccag?cttttgcttg?attccattgg?tgatagaacc?aggtactttt 21420
ctatgtggaa?tcaggctgtt?gacagctatg?atccagatgt?tagaattatt?gaaaatcatg 21480
gaactgaaga?tgaacttcca?aattactgct?ttccactggg?aggtgtgatt?aatacagaga 21540
ctcttaccaa?ggtaaaacct?aaaacaggtc?aggaaaatgg?atgggaaaaa?gatgctacag 21600
aattttcaga?taaaaatgaa?ataagagttg?gaaataattt?tgccatggaa?atcaatctaa 21660
atgccaacct?gtggagaaat?ttcctgtact?ccaacatagc?gctgtatttg?cccgacaagc 21720
taaagtacag?tccttccaac?gtaaaaattt?ctgataaccc?aaacacctac?gactacatga 21780
acaagcgagt?ggtggctccc?gggttagtgg?actgctacat?taaccttgga?gcacgctggt 21840
cccttgacta?tatggacaac?gtcaacccat?ttaaccacca?ccgcaatgct?ggcctgcgct 21900
accgctcaat?gttgctgggc?aatggtcgct?atgtgccctt?ccacatccag?gtgcctcaga 21960
agttctttgc?cattaaaaac?ctccttctcc?tgccgggctc?atacacctac?gagtggaact 22020
tcaggaagga?tgttaacatg?gttctgcaga?gctccctagg?aaatgaccta?agggttgacg 22080
gagccagcat?taagtttgat?agcatttgcc?tttacgccac?cttcttcccc?atggcccaca 22140
acaccgcctc?cacgcttgag?gccatgctta?gaaacgacac?caacgaccag?tcctttaacg 22200
actatctctc?cgccgccaac?atgctctacc?ctatacccgc?caacgctacc?aacgtgccca 22260
tatccatccc?ctcccgcaac?tgggcggctt?tccgcggctg?ggccttcacg?cgccttaaga 22320
ctaaggaaac?cccatcactg?ggctcgggct?acgaccctta?ttacacctac?tctggctcta 22380
taccctacct?agatggaacc?ttttacctca?accacacctt?taagaaggtg?gccattacct 22440
ttgactcttc?tgtcagctgg?cctggcaatg?accgcctgct?tacccccaac?gagtttgaaa 22500
ttaagcgctc?agttgacggg?gagggttaca?acgttgccca?gtgtaacatg?accaaagact 22560
ggttcctggt?acaaatgcta?gctaactaca?acattggcta?ccagggcttc?tatatcccag 22620
agagctacaa?ggaccgcatg?tactccttct?ttagaaactt?ccagcccatg?agccgtcagg 22680
tggtggatga?tactaaatac?aaggactacc?aacaggtggg?catcctacac?caacacaaca 22740
actctggatt?tgttggctac?cttgccccca?ccatgcgcga?aggacaggcc?taccctgcta 22800
acttccccta?tccgcttata?ggcaagaccg?cagttgacag?cattacccag?aaaaagtttc 22860
tttgcgatcg?caccctttgg?cgcatcccat?tctccagtaa?ctttatgtcc?atgggcgcac 22920
tcacagacct?gggccaaaac?cttctctacg?ccaactccgc?ccacgcgcta?gacatgactt 22980
ttgaggtgga?tcccatggac?gagcccaccc?ttctttatgt?tttgtttgaa?gtctttgacg 23040
tggtccgtgt?gcaccggccg?caccgcggcg?tcatcgaaac?cgtgtacctg?cgcacgccct 23100
tctcggccgg?caacgccaca?acataaagaa?gcaagcaaca?tcaacaacag?ctgccgccat 23160
gggctccagt?gagcaggaac?tgaaagccat?tgtcaaagat?cttggttgtg?ggccatattt 23220
tttgggcacc?tatgacaagc?gctttccagg?ctttgtttct?ccacacaagc?tcgcctgcgc 23280
catagtcaat?acggccggtc?gcgagactgg?gggcgtacac?tggatggcct?ttgcctggaa 23340
cccgcactca?aaaacatgct?acctctttga?gccctttggc?ttttctgacc?agcgactcaa 23400
gcaggtttac?cagtttgagt?acgagtcact?cctgcgccgt?agcgccattg?cttcttcccc 23460
cgaccgctgt?ataacgctgg?aaaagtccac?ccaaagcgta?caggggccca?actcggccgc 23520
ctgtggacta?ttctgctgca?tgtttctcca?cgcctttgcc?aactggcccc?aaactcccat 23580
ggatcacaac?cccaccatga?accttattac?cggggtaccc?aactccatgc?tcaacagtcc 23640
ccaggtacag?cccaccctgc?gtcgcaacca?ggaacagctc?tacagcttcc?tggagcgcca 23700
ctcgccctac?ttccgcagcc?acagtgcgca?gattaggagc?gccacttctt?tttgtcactt 23760
gaaaaacatg?taaaaataat?gtactagaga?cactttcaat?aaaggcaaat?gcttttattt 23820
gtacactctc?gggtgattat?ttacccccac?ccttgccgtc?tgcgccgttt?aaaaatcaaa 23880
ggggttctgc?cgcgcatcgc?tatgcgccac?tggcagggac?acgttgcgat?actggtgttt 23940
agtgctccac?ttaaactcag?gcacaaccat?ccgcggcagc?tcggtgaagt?tttcactcca 24000
caggctgcgc?accatcacca?acgcgtttag?caggtcgggc?gccgatatct?tgaagtcgca 24060
gttggggcct?ccgccctgcg?cgcgcgagtt?gcgatacaca?gggttgcagc?actggaacac 24120
tatcagcgcc?gggtggtgca?cgctggccag?cacgctcttg?tcggagatca?gatccgcgtc 24180
caggtcctcc?gcgttgctca?gggcgaacgg?agtcaacttt?ggtagctgcc?ttcccaaaaa 24240
gggcgcgtgc?ccaggctttg?agttgcactc?gcaccgtagt?ggcatcaaaa?ggtgaccgtg 24300
cccggtctgg?gcgttaggat?acagcgcctg?cataaaagcc?ttgatctgct?taaaagccac 24360
ctgagccttt?gcgccttcag?agaagaacat?gccgcaagac?ttgccggaaa?actgattggc 24420
cggacaggcc?gcgtcgtgca?cgcagcacct?tgcgtcggtg?ttggagatct?gcaccacatt 24480
tcggccccac?cggttcttca?cgatcttggc?cttgctagac?tgctccttca?gcgcgcgctg 24540
cccgttttcg?ctcgtcacat?ccatttcaat?cacgtgctcc?ttatttatca?taatgcttcc 24600
gtgtagacac?ttaagctcgc?cttcgatctc?agcgcagcgg?tgcagccaca?acgcgcagcc 24660
cgtgggctcg?tgatgcttgt?aggtcacctc?tgcaaacgac?tgcaggtacg?cctgcaggaa 24720
tcgccccatc?atcgtcacaa?aggtcttgtt?gctggtgaag?gtcagctgca?acccgcggtg 24780
ctcctcgttc?agccaggtct?tgcatacggc?cgccagagct?tccacttggt?caggcagtag 24840
tttgaagttc?gcctttagat?cgttatccac?gtggtacttg?tccatcagcg?cgcgcgcagc 24900
ctccatgccc?ttctcccacg?cagacacgat?cggcacactc?agcgggttca?tcaccgtaat 24960
ttcactttcc?gcttcgctgg?gctcttcctc?ttcctcttgc?gtccgcatac?cacgcgccac 25020
tgggtcgtct?tcattcagcc?gccgcactgt?gcgcttacct?cctttgccat?gcttgattag 25080
caccggtggg?ttgctgaaac?ccaccatttg?tagcgccaca?tcttctcttt?cttcctcgct 25140
gtccacgatt?acctctggtg?atggcgggcg?ctcgggcttg?ggagaagggc?gcttcttttt 25200
cttcttgggc?gcaatggcca?aatccgccgc?cgaggtcgat?ggccgcgggc?tgggtgtgcg 25260
cggcaccagc?gcgtcttgtg?atgagtcttc?ctcgtcctcg?gactcgatac?gccgcctcat 25320
ccgctttttt?gggggcgccc?ggggaggcgg?cggcgacggg?gacggggacg?acacgtcctc 25380
catggttggg?ggacgtcgcg?ccgcaccgcg?tccgcgctcg?ggggtggttt?cgcgctgctc 25440
ctcttcccga?ctggccattt?ccttctccta?taggcagaaa?aagatcatgg?agtcagtcga 25500
gaagaaggac?agcctaaccg?ccccctctga?gttcgccacc?accgcctcca?ccgatgccgc 25560
caacgcgcct?accaccttcc?ccgtcgaggc?acccccgctt?gaggaggagg?aagtgattat 25620
cgagcaggac?ccaggttttg?taagcgaaga?cgacgaggac?cgctcagtac?caacagagga 25680
taaaaagcaa?gaccaggaca?acgcagaggc?aaacgaggaa?caagtcgggc?ggggggacga 25740
aaggcatggc?gactacctag?atgtgggaga?cgacgtgctg?ttgaagcatc?tgcagcgcca 25800
gtgcgccatt?atctgcgacg?cgttgcaaga?gcgcagcgat?gtgcccctcg?ccatagcgga 25860
tgtcagcctt?gcctacgaac?gccacctatt?ctcaccgcgc?gtacccccca?aacgccaaga 25920
aaacggcaca?tgcgagccca?acccgcgcct?caacttctac?cccgtatttg?ccgtgccaga 25980
ggtgcttgcc?acctatcaca?tctttttcca?aaactgcaag?atacccctat?cctgccgtgc 26040
caaccgcagc?cgagcggaca?agcagctggc?cttgcggcag?ggcgctgtca?tacctgatat 26100
cgcctcgctc?aacgaagtgc?caaaaatctt?tgagggtctt?ggacgcgacg?agaagcgcgc 26160
ggcaaacgct?ctgcaacagg?aaaacagcga?aaatgaaagt?cactctggag?tgttggtgga 26220
actcgagggt?gacaacgcgc?gcctagccgt?actaaaacgc?agcatcgagg?tcacccactt 26280
tgcctacccg?gcacttaacc?taccccccaa?ggtcatgagc?acagtcatga?gtgagctgat 26340
cgtgcgccgt?gcgcagcccc?tggagaggga?tgcaaatttg?caagaacaaa?cagaggaggg 26400
cctacccgca?gttggcgacg?agcagctagc?gcgctggctt?caaacgcgcg?agcctgccga 26460
cttggaggag?cgacgcaaac?taatgatggc?cgcagtgctc?gttaccgtgg?agcttgagtg 26520
catgcagcgg?ttctttgctg?acccggagat?gcagcgcaag?ctagaggaaa?cattgcacta 26580
cacctttcga?cagggctacg?tacgccaggc?ctgcaagatc?tccaacgtgg?agctctgcaa 26640
cctggtctcc?taccttggaa?ttttgcacga?aaaccgcctt?gggcaaaacg?tgcttcattc 26700
cacgctcaag?ggcgaggcgc?gccgcgacta?cgtccgcgac?tgcgtttact?tatttctatg 26760
ctacacctgg?cagacggcca?tgggcgtttg?gcagcagtgc?ttggaggagt?gcaacctcaa 26820
ggagctgcag?aaactgctaa?agcaaaactt?gaaggaccta?tggacggcct?tcaacgagcg 26880
ctccgtggcc?gcgcacctgg?cggacatcat?tttccccgaa?cgcctgctta?aaaccctgca 26940
acagggtctg?ccagacttca?ccagtcaaag?catgttgcag?aactttagga?actttatcct 27000
agagcgctca?ggaatcttgc?ccgccacctg?ctgtgcactt?cctagcgact?ttgtgcccat 27060
taagtaccgc?gaatgccctc?cgccgctttg?gggccactgc?taccttctgc?agctagccaa 27120
ctaccttgcc?taccactctg?acataatgga?agacgtgagc?ggtgacggtc?tactggagtg 27180
tcactgtcgc?tgcaacctat?gcaccccgca?ccgctccctg?gtttgcaatt?cgcagctgct 27240
taacgaaagt?caaattatcg?gtacctttga?gctgcagggt?ccctcgcctg?acgaaaagtc 27300
cgcggctccg?gggttgaaac?tcactccggg?gctgtggacg?tcggcttacc?ttcgcaaatt 27360
tgtacctgag?gactaccacg?cccacgagat?taggttctac?gaagaccaat?cccgcccgcc 27420
aaatgcggag?cttaccgcct?gcgtcattac?ccagggccac?attcttggcc?aattgcaagc 27480
catcaacaaa?gcccgccaag?agtttctgct?acgaaaggga?cggggggttt?acttggaccc 27540
ccagtccggc?gaggagctca?acccaatccc?cccgccgccg?cagccctatc?agcagcagcc 27600
gcgggccctt?gcttcccagg?atggcaccca?aaaagaagct?gcagctgccg?ccgccaccca 27660
cggacgagga?ggaatactgg?gacagtcagg?cagaggaggt?tttggacgag?gaggaggagg 27720
acatgatgga?agactgggag?agcctagacg?aggaagcttc?cgaggtcgaa?gaggtgtcag 27780
acgaaacacc?gtcaccctcg?gtcgcattcc?cctcgccggc?gccccagaaa?tcggcaaccg 27840
gttccagcat?ggctacaacc?tccgctcctc?aggcgccgcc?ggcactgccc?gttcgccgac 27900
ccaaccgtag?atgggacacc?actggaacca?gggccggtaa?gtccaagcag?ccgccgccgt 27960
tagcccaaga?gcaacaacag?cgccaaggct?accgctcatg?gcgcgggcac?aagaacgcca 28020
tagttgcttg?cttgcaagac?tgtgggggca?acatctcctt?cgcccgccgc?tttcttctct 28080
accatcacgg?cgtggccttc?ccccgtaaca?tcctgcatta?ctaccgtcat?ctctacagcc 28140
catactgcac?cggcggcagc?ggcagcggca?gcaacagcag?cggccacaca?gaagcaaagg 28200
cgaccggata?gcaagactct?gacaaagccc?aagaaatcca?cagcggcggc?agcagcagga 28260
ggaggagcgc?tgcgtctggc?gcccaacgaa?cccgtatcga?cccgcgagct?tagaaacagg 28320
atttttccca?ctctgtatgc?tatatttcaa?cagagcaggg?gccaagaaca?agagctgaaa 28380
ataaaaaaca?ggtctctgcg?atccctcacc?cgcagctgcc?tgtatcacaa?aagcgaagat 28440
cagcttcggc?gcacgctgga?agacgcggag?gctctcttca?gtaaatactg?cgcgctgact 28500
cttaaggact?agtttcgcgc?cctttctcaa?atttaagcgc?gaaaactacg?tcatctccag 28560
cggccacacc?cggcgccagc?acctgtcgtc?agcgccatta?tgagcaagga?aattcccacg 28620
ccctacatgt?ggagttacca?gccacaaatg?ggacttgcgg?ctggagctgc?ccaagactac 28680
tcaacccgaa?taaactacat?gagcgcggga?ccccacatga?tatcccgggt?caacggaatc 28740
cgcgcccacc?gaaaccgaat?tctcttggaa?caggcggcta?ttaccaccac?acctcgtaat 28800
aaccttaatc?cccgtagttg?gcccgctgcc?ctggtgtacc?aggaaagtcc?cgctcccacc 28860
actgtggtac?ttcccagaga?cgcccaggcc?gaagttcaga?tgactaactc?aggggcgcag 28920
cttgcgggcg?gctttcgtca?cagggtgcgg?tcgcccgggc?agggtataac?tcacctgaca 28980
atcagagggc?gaggtattca?gctcaacgac?gagtcggtga?gctcctcgct?tggtctccgt 29040
ccggacggga?catttcagat?cggcggcgcc?ggccgtcctt?cattcacgcc?tcgtcaggca 29100
atcctaactc?tgcagacctc?gtcctctgag?ccgcgctctg?gaggcattgg?aactctgcaa 29160
tttattgagg?agtttgtgcc?atcggtctac?tttaacccct?tctcgggacc?tcccggccac 29220
tatccggatc?aatttattcc?taactttgac?gcggtaaagg?actcggcgga?cggctacgac 29280
tgaatgttaa?gtggagaggc?agagcaactg?cgcctgaaac?acctggtcca?ctgtcgccgc 29340
cacaagtgct?ttgcccgcga?ctccggtgag?ttttgctact?ttgaattgcc?cgaggatcat 29400
atcgagggcc?cggcgcacgg?cgtccggctt?accgcccagg?gagagcttgc?ccgtagcctg 29460
attcgggagt?ttacccagcg?ccccctgcta?gttgagcggg?acaggggacc?ctgtgttctc 29520
actgtgattt?gcaactgtcc?taaccttgga?ttacatcaag?atctttgttg?ccatctctgt 29580
gctgagtata?ataaatacag?aaattaaaat?atactggggc?tcctatcgcc?atcctgtaaa 29640
cgccaccgtc?ttcacccgcc?caagcaaacc?aaggcgaacc?ttacctggta?cttttaacat 29700
ctctccctct?gtgatttaca?acagtttcaa?cccagacgga?gtgagtctac?gagagaacct 29760
ctccgagctc?agctactcca?tcagaaaaaa?caccaccctc?cttacctgcc?gggaacgtac 29820
gagtgcgtca?ccggccgctg?caccacacct?accgcctgac?cgtaaaccag?actttttccg 29880
gacagacctc?aataactctg?tttaccagaa?caggaggtga?gcttagaaaa?cccttagggt 29940
attaggccaa?aggcgcagct?actgtggggt?ttatgaacaa?ttcaagcaac?tctacgggct 30000
attctaattc?aggtttctct?agaatcgggg?ttggggttat?tctctgtctt?gtgattctct 30060
ttattcttat?actaacgctt?ctctgcctaa?ggctcgccgc?ctgctgtgtg?cacatttgca 30120
tttattgtca?gctttttaaa?cgctggggtc?gccacccaag?atgattaggt?acataatcct 30180
aggtttactc?acccttgcgt?cagcccacgg?taccacccaa?aaggtggatt?ttaaggagcc 30240
agcctgtaat?gttacattcg?cagctgaagc?taatgagtgc?accactctta?taaaatgcac 30300
cacagaacat?gaaaagctgc?ttattcgcca?caaaaacaaa?attggcaagt?atgctgttta 30360
tgctatttgg?cagccaggtg?acactacaga?gtataatgtt?acagttttcc?agggtaaaag 30420
tcataaaact?tttatgtata?cttttccatt?ttatgaaatg?tgcgacatta?ccatgtacat 30480
gagcaaacag?tataagttgt?ggcccccaca?aaattgtgtg?gaaaacactg?gcactttctg 30540
ctgcactgct?atgctaatta?cagtgctcgc?tttggtctgt?accctactct?atattaaata 30600
caaaagcaga?cgcagcttta?ttgaggaaaa?gaaaatgcct?taatttacta?agttacaaag 30660
ctaatgtcac?cactaactgc?tttactcgct?gcttgcaaaa?caaattcaaa?aagttagcat 30720
tataattaga?ataggattta?aaccccccgg?tcatttcctg?ctcaatacca?ttcccctgaa 30780
caattgactc?tatgtgggat?atgctccagc?gctacaacct?tgaagtcagg?cttcctggat 30840
gtcagcatct?gactttggcc?agcacctgtc?ccgcggattt?gttccagtcc?aactacagcg 30900
acccacccta?acagagatga?ccaacacaac?caacgcggcc?gccgctaccg?gacttacatc 30960
taccacaaat?acaccccaag?tttctgcctt?tgtcaataac?tgggataact?tgggcatgtg 31020
gtggttctcc?atagcgctta?tgtttgtatg?ccttattatt?atgtggctca?tctgctgcct 31080
aaagcgcaaa?cgcgcccgac?cacccatcta?tagtcccatc?attgtgctac?acccaaacaa 31140
tgatggaatc?catagattgg?acggactgaa?acacatgttc?ttttctctta?cagtatgatt 31200
aaatgagaca?tgattcctcg?agtttttata?ttactgaccc?ttgttgcgct?tttttgtgcg 31260
tgctccacat?tggctaagta?atagttaatt?aagatcttat?tccctttaac?taataaaaaa 31320
aaataataaa?gcatcactta?cttaaaatca?gttagcaaat?ttctgtccag?tttattcagc 31380
agcacctcct?tgccctcctc?ccagctctgg?tattgcagct?tcctcctggc?tgcaaacttt 31440
ctccacaatc?taaatggaat?gtcagtttcc?tcctgttcct?gtccatccgc?acccactatc 31500
ttcatgttgt?tgcagatgaa?gcgcgcaaga?ccgtctgaag?ataccttcaa?ccccgtgtat 31560
ccatatgaca?cggaaaccgg?tcctccaact?gtgccttttc?ttactcctcc?ctttgtatcc 31620
cccaatgggt?ttcaagagag?tccccctgga?gttcttactt?taaaatgttt?aaccccacta 31680
acaaccacag?gcggatctct?acagctaaaa?gtgggagggg?gacttacagt?ggatgacacc 31740
aacggttttt?tgaaagaaaa?cataagtgcc?accacaccac?tcgttaagac?tggtcactct 31800
ataggtttac?cactaggagc?cggattggga?acgaatgaaa?ataaactttg?tatcaaatta 31860
ggacaaggac?ttacattcaa?ttcaaacaac?atttgcattg?atgacaatat?taacacctta 31920
tggacaggag?tcaaccccac?cgaagccaac?tgtcaaatca?tgaactccag?tgaatctaat 31980
gattgcaaat?taattctaac?actagttaaa?actggagcac?tagtcactgc?atttgtttat 32040
gttataggag?tatctaacaa?ttttaatatg?ctaactacac?acagaaatat?aaattttact 32100
gcagagctgt?ttttcgattc?tactggtaat?ttactaacta?gactctcatc?cctcaaaact 32160
ccacttaatc?ataaatcagg?acaaaacatg?gctactggtg?ccattactaa?tgctaaaggt 32220
ttcatgccca?gcacgactgc?ctatcctttc?aatgataatt?ctagagaaaa?agaaaactac 32280
atttacggaa?cttgttacta?cacagctagt?gatcgcactg?cttttcccat?tgacatatct 32340
gtcatgctta?accgaagagc?aataaatgac?gagacatcat?attgtattcg?tataacttgg 32400
tcctggaaca?caggagatgc?cccagaggtg?caaacctctg?ctacaaccct?agtcacctcc 32460
ccatttacct?tttactacat?cagagaagac?gactgagccc?aagaataaag?aatcgtttgt 32520
gttatgtttc?aacgtgttta?tttttcaatt?gcagaaaatt?tcaagtcatt?tttcattcag 32580
tagtatagcc?ccaccaccac?atagcttata?cagatcaccg?taccttaatc?aaactcacag 32640
aaccctagta?ttcaacctgc?cacctccctc?ccaacacaca?gagtacacag?tcctttctcc 32700
ccggctggcc?ttaaaaagca?tcatatcatg?ggtaacagac?atattcttag?gtgttatatt 32760
ccacacggtt?tcctgtcgag?ccaaacgctc?atcagtgata?ttaataaact?ccccgggcag 32820
ctcacttaag?ttcatgtcgc?tgtccagctg?ctgagccaca?ggctgctgtc?caacttgcgg 32880
ttgcttaacg?ggcggcgaag?gagaagtcca?cgcctacatg?ggggtagagt?cataatcgtg 32940
catcaggata?gggcggtggt?gctgcagcag?cgcgcgaata?aactgctgcc?gccgccgctc 33000
cgtcctgcag?gaatacaaca?tggcagtggt?ctcctcagcg?atgattcgca?ccgcccgcag 33060
cataaggcgc?cttgtcctcc?gggcacagca?gcgcaccctg?atctcactta?aatcagcaca 33120
gtaactgcag?cacagcacca?caatattgtt?caaaatccca?cagtgcaagg?cgctgtatcc 33180
aaagctcatg?gcggggacca?cagaacccac?gtggccatca?taccacaagc?gcaggtagat 33240
taagtggcga?cccctcataa?acacgctgga?cataaacatt?acctcttttg?gcatgttgta 33300
attcaccacc?tcccggtacc?atataaacct?ctgattaaac?atggcgccat?ccaccaccat 33360
cctaaaccag?ctggccaaaa?cctgcccgcc?ggctatacac?tgcagggaac?cgggactgga 33420
acaatgacag?tggagagccc?aggactcgta?accatggatc?atcatgctcg?tcatgatatc 33480
aatgttggca?caacacaggc?acacgtgcat?acacttcctc?aggattacaa?gctcctcccg 33540
cgttagaacc?atatcccagg?gaacaaccca?ttcctgaatc?agcgtaaatc?ccacactgca 33600
gggaagacct?cgcacgtaac?tcacgttgtg?cattgtcaaa?gtgttacatt?cgggcagcag 33660
cggatgatcc?tccagtatgg?tagcgcgggt?ttctgtctca?aaaggaggta?gacgatccct 33720
actgtacgga?gtgcgccgag?acaaccgaga?tcgtgttggt?cgtagtgtca?tgccaaatgg 33780
aacgccggac?gtagtcatat?ttcctgaagc?aaaaccaggt?gcgggcgtga?caaacagatc 33840
tgcgtctccg?gtctcgccgc?ttagatcgct?ctgtgtagta?gttgtagtat?atccactctc 33900
tcaaagcatc?caggcgcccc?ctggcttcgg?gttctatgta?aactccttca?tgcgccgctg 33960
ccctgataac?atccaccacc?gcagaataag?ccacacccag?ccaacctaca?cattcgttct 34020
gcgagtcaca?cacgggagga?gcgggaagag?ctggaagaac?catgtttttt?tttttattcc 34080
aaaagattat?ccaaaacctc?aaaatgaaga?tctattaagt?gaacgcgctc?ccctccggtg 34140
gcgtggtcaa?actctacagc?caaagaacag?ataatggcat?ttgtaagatg?ttgcacaatg 34200
gcttccaaaa?ggcaaacggc?cctcacgtcc?aagtggacgt?aaaggctaaa?cccttcaggg 34260
tgaatctcct?ctataaacat?tccagcacct?tcaaccatgc?ccaaataatt?ctcatctcgc 34320
caccttctca?atatatctct?aagcaaatcc?cgaatattaa?gtccggccat?tgtaaaaatc 34380
tgctccagag?cgccctccac?cttcagcctc?aagcagcgaa?tcatgattgc?aaaaattcag 34440
gttcctcaca?gacctgtata?agattcaaaa?gcggaacatt?aacaaaaata?ccgcgatccc 34500
gtaggtccct?tcgcagggcc?agctgaacat?aatcgtgcag?gtctgcacgg?accagcgcgg 34560
ccacttcccc?gccaggaacc?ttgacaaaag?aacccacact?gattatgaca?cgcatactcg 34620
gagctatgct?aaccagcgta?gccccgatgt?aagctttgtt?gcatgggcgg?cgatataaaa 34680
tgcaaggtgc?tgctcaaaaa?atcaggcaaa?gcctcgcgca?aaaaagaaag?cacatcgtag 34740
tcatgctcat?gcagataaag?gcaggtaagc?tccggaacca?ccacagaaaa?agacaccatt 34800
tttctctcaa?acatgtctgc?gggtttctgc?ataaacacaa?aataaaataa?caaaaaaaca 34860
tttaaacatt?agaagcctgt?cttacaacag?gaaaaacaac?ccttataagc?ataagacgga 34920
ctacggccat?gccggcgtga?ccgtaaaaaa?actggtcacc?gtgattaaaa?agcaccaccg 34980
acagctcctc?ggtcatgtcc?ggagtcataa?tgtaagactc?ggtaaacaca?tcaggttgat 35040
tcatcggtca?gtgctaaaaa?gcgaccgaaa?tagcccgggg?gaatacatac?ccgcaggcgt 35100
agagacaaca?ttacagcccc?cataggaggt?ataacaaaat?taataggaga?gaaaaacaca 35160
taaacacctg?aaaaaccctc?ctgcctaggc?aaaatagcac?cctcccgctc?cagaacaaca 35220
tacagcgctt?cacagcggca?gcctaacagt?cagccttacc?agtaaaaaag?aaaacctatt 35280
aaaaaaacac?cactcgacac?ggcaccagct?caatcagtca?cagtgtaaaa?aagggccaag 35340
tgcagagcga?gtatatatag?gactaaaaaa?tgacgtaacg?gttaaagtcc?acaaaaaaca 35400
cccagaaaac?cgcacgcgaa?cctacgccca?gaaacgaaag?ccaaaaaacc?cacaacttcc 35460
tcaaatcgtc?acttccgttt?tcccacgtta?cgtaacttcc?cattttaaga?aaactacaat 35520
tcccaacaca?tacaagttac?tccgccctaa?aacctacgtc?acccgccccg?ttcccacgcc 35580
ccgcgccacg?tcacaaactc?caccccctca?ttatcatatt?ggcttcaatc?caaaataagg 35640
tatattattg?atgat 35655
<210>3
<211>2673
<212>DNA
<213〉contain the chimeric sequences of 5 type adenovirus tail sequences and 11 type adenovirus shaft, knob sequence
<400>3
gccgttaatt?aagatcttat?tccctttaac?taataaaaaa?aaataataaa?gcatcactta 60
cttaaaatca?gttagcaaat?ttctgtccag?tttattcagc?agcacctcct?tgccctcctc 120
ccagctctgg?tattgcagct?tcctcctggc?tgcaaacttt?ctccacaatc?taaatggaat 180
gtcagtttcc?tcctgttcct?gtccatccgc?acccactatc?ttcatgttgt?tgcagatgaa 240
gcgcgcaaga?ccgtctgaag?ataccttcaa?ccccgtgtat?ccatatgaca?cggaaaccgg 300
tcctccaact?gtgccttttc?ttactcctcc?ctttgtatcc?cccaatgggt?ttcaagagag 360
tccccctgga?gttcttactt?taaaatgttt?aaccccacta?acaaccacag?gcggatctct 420
acagctaaaa?gtgggagggg?gacttacagt?ggatgacacc?aacggttttt?tgaaagaaaa 480
cataagtgcc?accacaccac?tcgttaagac?tggtcactct?ataggtttac?cactaggagc 540
cggattggga?acgaatgaaa?ataaactttg?tatcaaatta?ggacaaggac?ttacattcaa 600
ttcaaacaac?atttgcattg?atgacaatat?taacacctta?tggacaggag?tcaaccccac 660
cgaagccaac?tgtcaaatca?tgaactccag?tgaatctaat?gattgcaaat?taattctaac 720
actagttaaa?actggagcac?tagtcactgc?atttgtttat?gttataggag?tatctaacaa 780
ttttaatatg?ctaactacac?acagaaatat?aaattttact?gcagagctgt?ttttcgattc 840
tactggtaat?ttactaacta?gactctcatc?cctcaaaact?ccacttaatc?ataaatcagg 900
acaaaacatg?gctactggtg?ccattactaa?tgctaaaggt?ttcatgccca?gcacgactgc 960
ctatcctttc?aatgataatt?ctagagaaaa?agaaaactac?atttacggaa?cttgttacta 1020
cacagctagt?gatcgcactg?cttttcccat?tgacatatct?gtcatgctta?accgaagagc 1080
aataaatgac?gagacatcat?attgtattcg?tataacttgg?tcctggaaca?caggagatgc 1140
cccagaggtg?caaacctctg?ctacaaccct?agtcacctcc?ccatttacct?tttactacat 1200
cagagaagac?gactgagccc?aagaataaag?aatcgtttgt?gttatgtttc?aacgtgttta 1260
tttttcaatt?gcagaaaatt?tcaagtcatt?tttcattcag?tagtatagcc?ccaccaccac 1320
atagcttata?cagatcaccg?taccttaatc?aaactcacag?aaccctagta?ttcaacctgc 1380
cacctccctc?ccaacacaca?gagtacacag?tcctttctcc?ccggctggcc?ttaaaaagca 1440
tcatatcatg?ggtaacagac?atattcttag?gtgttatatt?ccacacggtt?tcctgtcgag 1500
ccaaacgctc?atcagtgata?ttaataaact?ccccgggcag?ctcacttaag?ttcatgtcgc 1560
tgtccagctg?ctgagccaca?ggctgctgtc?caacttgcgg?ttgcttaacg?ggcggcgaag 1620
gagaagtcca?cgcctacatg?ggggtagagt?cataatcgtg?catcaggata?gggcggtggt 1680
gctgcagcag?cgcgcgaata?aactgctgcc?gccgccgctc?cgtcctgcag?gaatacaaca 1740
tggcagtggt?ctcctcagcg?atgattcgca?ccgcccgcag?cataaggcgc?cttgtcctcc 1800
gggcacagca?gcgcaccctg?atctcactta?aatcagcaca?gtaactgcag?cacagcacca 1860
caatattgtt?caaaatccca?cagtgcaagg?cgctgtatcc?aaagctcatg?gcggggacca 1920
cagaacccac?gtggccatca?taccacaagc?gcaggtagat?taagtggcga?cccctcataa 1980
acacgctgga?cataaacatt?acctcttttg?gcatgttgta?attcaccacc?tcccggtacc 2040
atataaacct?ctgattaaac?atggcgccat?ccaccaccat?cctaaaccag?ctggccaaaa 2100
cctgcccgcc?ggctatacac?tgcagggaac?cgggactgga?acaatgacag?tggagagccc 2160
aggactcgta?accatggatc?atcatgctcg?tcatgatatc?aatgttggca?caacacaggc 2220
acacgtgcat?acacttcctc?aggattacaa?gctcctcccg?cgttagaacc?atatcccagg 2280
gaacaaccca?ttcctgaatc?agcgtaaatc?ccacactgca?gggaagacct?cgcacgtaac 2340
tcacgttgtg?cattgtcaaa?gtgttacatt?cgggcagcag?cggatgatcc?tccagtatgg 2400
tagcgcgggt?ttctgtctca?aaaggaggta?gacgatccct?actgtacgga?gtgcgccgag 2460
acaaccgaga?tcgtgttggt?cgtagtgtca?tgccaaatgg?aacgccggac?gtagtcatat 2520
ttcctgaagc?aaaaccaggt?gcgggcgtga?caaacagatc?tgcgtctccg?gtctcgccgc 2580
ttagatcgct?ctgtgtagta?gttgtagtat?atccactctc?tcaaagcatc?caggcgcccc 2640
ctggcttcgg?gttctatgta?aactaagctt?cgc 2673
<210>4
<211>51
<212>DNA
<213〉primer sequence
<400>4
aattgaccgg?tctcgagact?agtggatccg?cggccgcatc?tagattaatt?a 51
<210>5
<211>51
<212>DNA
<213〉primer sequence
<400>5
agcttaatta?atctagatgc?ggccgcggat?ccactagtct?cgagaccggt?c 51
<210>6
<211>1067
<212>DNA
<213〉5 type adenovirus ADP gene orders
<400>6
tgacacatgc?agctcccgga?gacggtcaca?gcttgtctgt?aagcggatgc?cgggagcaga 60
caagcccgtc?agggcgcgtc?agcgggtgtt?ggcgggtgtc?ggggctggct?taactatgcg 120
gcatcagagc?agattgtact?gagagtgcac?catatgcggt?gtgaaatacc?gcacagatgc 180
gtaaggagaa?aataccgcat?caggcgccat?tcgccattca?ggctgcgcaa?ctgttgggaa 240
gggcgatcgg?tgcgggcctc?ttcgctatta?cgccagctgg?cgaaaggggg?atgtgctgca 300
aggcgattaa?gttgggtaac?gccagggttt?tcccagtcac?gacgttgtaa?aacgacggcc 360
agtgaattga?ccggtctcga?gactagtgga?tccgcggccg?ccgctaccgg?acttacatct 420
accacaaata?caccccaagt?ttctgccttt?gtcaataact?gggataactt?gggcatgtgg 480
tggttctcca?tagcgcttat?gtttgtatgc?cttattatta?tgtggctcat?ctgctgccta 540
aagcgcaaac?gcgcccgacc?acccatctat?agtcccatca?ttgtgctaca?cccaaacaat 600
gatggaatcc?atagattgga?cggactgaaa?cacatgttct?tttctcttac?agtatgatta 660
aatgagacat?gattcctcga?gtttttatat?tactgaccct?tgttgcgctt?tttttgtgcg 720
tgctccacat?tggctaagta?atagttaatt?aagcttggcg?taatcatggt?catagctgtt 780
tcctgtgtga?aattgttatc?cgctcacaat?tccacacaac?atacgagccg?gaagcataaa 840
gtgtaaagcc?tggggtgcct?aatgagtgag?ctaactcaca?ttaattgcgt?tgcgctcact 900
gcccgctttc?cagtcgggaa?acctgtcgtg?ccagctgcat?taatgaatcg?gccaacgcgc 960
ggggaagagg?cggtttgcgt?attgggcgct?cttccgcttc?ctcgctcact?gactcgctgc 1020
gctcggtcgt?tcggctgcgg?cgagcggtat?cagctcactc?aaaggcg 1067
<210>7
<211>271
<212>DNA
<213〉hTERT promotor core sequence
<400>7
agatctcaca?gacgcccagg?accgcgcttc?ccacgtggcg?gagggactgg?ggacccgggc 60
acccgtcctg?ccccttcacc?ttccagctcc?gcctcctccg?cgcggacccc?gccccgtccc 120
gacccctccc?gggtccccgg?cccagccccc?tccgggccct?cccagcccct?ccccttcctt 180
tccgcggccc?cgccctctcc?tcgcggcgcg?agtttcaggc?agcgctgcgt?cctgctgcgc 240
acgtgggaag?ccctggcccc?ggccactcga?g 271
<210>8
<211>247
<212>DNA
<213〉HRE sequence
<400>8
actagtccac?agtgcatacg?tgggctccaa?caggtcctct?tccacagtgc?atacgtgggc 60
tccaacaggt?cctcttccac?agtgcatacg?tgggctccaa?caggtcctct?tccacagtgc 120
atacgtgggc?tccaacaggt?cctcttccac?agtgcatacg?tgggctccaa?caggtcctct 180
tggtaggcgt?gtacggtggg?aggtctatat?aagcagagct?cgtttagtga?accgtcagat 240
cactagt 247
<210>9
<211>747
<212>DNA
<213〉EGFP reporter gene sequence
<400>9
atggtgagca?agggcgagga?gctgttcacc?ggggtggtgc?ccatcctggt?cgagctggac 60
ggcgacgtaa?acggccacaa?gttcagcgtg?tccggcgagg?gcgagggcga?tgccacctac 120
ggcaagctga?ccctgaagtt?catctgcacc?accggcaagc?tgcccgtgcc?ctggcccacc 180
ctcgtgacca?ccctgaccta?cggcgtgcag?tgcttcagcc?gctaccccga?ccacatgaag 240
cagcacgact?tcttcaagtc?cgccatgccc?gaaggctacg?tccaggagcg?caccatcttc 300
ttcaaggacg?acggcaacta?caagacccgc?gccgaggtga?agttcgaggg?cgacaccctg 360
gtgaaccgca?tcgagctgaa?gggcatcgac?ttcaaggagg?acggcaacat?cctggggcac 420
aagctggagt?acaactacaa?cagccacaac?gtctatatca?tggccgacaa?gcagaagaac 480
ggcatcaagg?tgaacttcaa?gatccgccac?aacatcgagg?acggcagcgt?gcagctcgcc 540
gaccactacc?agcagaacac?ccccatcggc?gacggccccg?tgctgctgcc?cgacaaccac 600
tacctgagca?cccagtccgc?cctgagcaaa?gaccccaacg?agaagcgcga?tcacatggtc 660
ctgctggagt?tcgtgaccgc?cgccgggatc?actctcggca?tggacgagct?gtacaagtcc 720
ggactcagat?ccaccggatc?taggtaa 747
<210>10
<211>32
<212>DNA
<213〉primer sequence
<400>10
gctctagaga?attcaccatg?gtgagcaagg?gc 32
<210>11
<211>34
<212>DNA
<213〉primer sequence
<400>11
cgggatccgt?cgacttatta?cctagatccg?gtgg 34
<210>12
<211>345
<212>DNA
<213〉human chemokine CCL5 sequence
<400>12
gaattcacca?tgaaggtctc?cgcggcagcc?ctcgctgtca?tcctcattgc?tactgccctc 60
tgcgctcctg?catctgcctc?cccatattcc?tcggacacca?caccctgctg?ctttgcctac 120
attgcccgcc?cactgccccg?tgcccacatc?aaggagtatt?tctacaccag?tggcaagtgc 180
tccaacccag?cagtcgtctt?tgtcacccga?aagaaccgcc?aagtgtgtgc?caacccagag 240
aagaaatggg?ttcgggagta?catcaactct?ttggagatga?gcttagactt?ggagatgtta 300
gctccctata?tcccaatgga?tgatgacttc?cagttatagg?gatcc 345
<210>13
<211>26
<212>DNA
<213〉primer sequence
<400>13
cggaattcac?catgagacat?attatc 26
<210>14
<211>23
<212>DNA
<213〉primer sequence
<400>14
gcgtcgactt?atggcctggg?gcg 23
<210>15
<211>30
<212>DNA
<213〉primer sequence
<400>15
cggaattcac?catgaaggtc?tccgcggcag 30
<210>16
<211>34
<212>DNA
<213〉primer sequence
<400>16
cgggatccct?ataactggaa?gtcatcatcc?attg 34

Claims (12)

1. a proliferous type recombination oncolytic adenovirus is characterized in that this recombinant adenovirus contains the amino acid coding of B subgroup 11 type adenovirus cilium heads; And at least one virus multiplication indispensable gene of this viral genome is suddenlyd change or is lacked and lose function, or described virus operationally inserts cis-acting elements between the transcription initiation site of propagation indispensable gene sequence and translation initiation site ATG, and at least one virus multiplication indispensable gene transcribes in the described element controlling gene group.
2. the proliferous type recombination oncolytic adenovirus of claim 1, the aminoacid sequence that it is characterized in that this recombinant adenovirus cilium head is the aminoacid sequence of human B subgroup 11 type adenovirus cilium heads.
3. proliferous type recombination oncolytic adenovirus according to claim 1, it is characterized in that described virus between the transcription initiation site of propagation indispensable gene sequence and translation initiation site ATG operationally insertion be the cis-acting elements of tumor-specific promoters.
4. proliferous type recombination oncolytic adenovirus according to claim 3 is characterized in that described tumor-specific promoters is selected from:
(a) carcinomebryonic antigen promotor, enhanser and mutant sequence thereof;
(b) afp promoter, enhanser and mutant sequence thereof;
(c) receptor tyrosine kinase promotor, enhanser and the mutant sequence thereof of Human epidermal growth factor receptor family;
(d) breast cancer correlation antigen DF3/MUC1 promotor, enhanser and mutant sequence thereof;
(e) promotor of vascular endothelial growth factor receptor KDR, enhanser and mutant sequence thereof;
(f) L-plastin promotor, enhanser and mutant sequence thereof;
(g) IAP family member's promotor, enhanser and mutant sequence thereof;
(h) promotor of prostaglandin(PG) specific antigens, enhanser and mutant sequence thereof;
(i) the hypoxia response elements conserved sequence of HIF-1 regulation and control;
(j) transcription factor E2F promotor, enhanser and mutant sequence thereof; With
(k) human telomerase subunit promotor, enhanser and mutant sequence thereof
In at least a.
5. proliferous type recombination oncolytic adenovirus according to claim 1 is characterized in that described virus multiplication indispensable gene is the gene of coding E1a, E1b-55kDa, E1b-19kDa, E2 or E4 wild-type or the process sudden change.
6. proliferous type recombination oncolytic adenovirus according to claim 1 is characterized in that described virus multiplication indispensable gene is through point mutation, inserts sudden change, inserts terminator codon, lacks and the E1b-55kDa or the E1b-19kDa gene of inactivation wholly or in part.
7. proliferous type recombination oncolytic adenovirus according to claim 1 is characterized in that its exogenous gene expression box that also has been operably connected.
8. proliferous type recombination oncolytic adenovirus according to claim 7 is characterized in that described foreign gene is selected from:
(a) gene of interferons immune-regulating factor;
(b) gene of interleukin-para-immunity regulatory factor;
(c) gene of colony-stimulating factor;
(d) cancer suppressor gene;
(e) antisense sequences of proto-oncogene;
(f) antibody gene of people's tumour Epidermal Growth Factor Receptor Family;
(g) nucleotide sequence of Endostatin, angiostatin and the fragment thereof of coding anti-angiogenesis, plasminogen activating factors inhibitor, Canstatin, thrombospondin;
(h) gene of apoptosis inducing factor family;
(i) gene of vascular endothelial growth factor antibody;
(j) suicide gene; With
(k) gene of tumour necrosis factor
In at least a.
9. proliferous type recombination oncolytic adenovirus according to claim 1 is characterized in that described virus vector is to be selected from least a in 2 types of C subgroup or the 5 type adenovirus.
10. the proliferous type recombination oncolytic adenovirus of claim 1, its preservation day is on January 9th, 2009, and deposit number is CCTCC-V200903, and the preservation place is Chinese typical culture collection center.
11. make up the method for the described proliferous type recombination oncolytic of claim 2 adenovirus, it is characterized in that replacing with the aminoacid sequence of human B subgroup 11 type adenovirus cilium heads the cilium head aminoacid sequence of non-11 type adenovirus by gene engineering method; And at least one the propagation indispensable gene that makes described virus is suddenlyd change or is lacked and lose function, or making described virus between transcription initiation site of breeding the indispensable gene sequence and translation initiation site ATG, operationally insert cis-acting elements, at least one virus multiplication indispensable gene transcribes in the described element controlling gene group.
12. the described proliferous type recombination oncolytic of claim 1 adenovirus carrier, it is as the carrier of gene and be used to prepare gene therapy medicament.
CN200910045514A 2009-01-19 2009-01-19 Proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene, construction method and application thereof Pending CN101781636A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN200910045514A CN101781636A (en) 2009-01-19 2009-01-19 Proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene, construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN200910045514A CN101781636A (en) 2009-01-19 2009-01-19 Proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene, construction method and application thereof

Publications (1)

Publication Number Publication Date
CN101781636A true CN101781636A (en) 2010-07-21

Family

ID=42521789

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200910045514A Pending CN101781636A (en) 2009-01-19 2009-01-19 Proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene, construction method and application thereof

Country Status (1)

Country Link
CN (1) CN101781636A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106471125A (en) * 2014-04-30 2017-03-01 贝尔韦什生物医学研究学会 Adenoviruss including albumin binding moieties
CN106591368A (en) * 2016-10-12 2017-04-26 郑州大学 B subgroup adenovirus 11 vector carrying IL-15R/IL-15 fusion genes and construction and application of the same
WO2021008267A1 (en) * 2019-07-16 2021-01-21 伍泽堂 Virus and tumor therapeutic drug for specifically killing tumor cells
CN113249342A (en) * 2021-05-25 2021-08-13 江苏万戎生物医药科技有限公司 Chimeric broad-spectrum oncolytic adenovirus for multi-mechanism synergistic immunotherapy and application thereof in tumor therapy
WO2022246646A1 (en) * 2021-05-25 2022-12-01 江苏万戎生物医药科技有限公司 Chimeric broad-spectrum oncolytic adenovirus with multiple mechanisms synergizing with and enhancing efficacy of immunotherapy, and application thereof in tumor treatment

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1254719A (en) * 1999-11-19 2000-05-31 钱其军 Defective adenovirus and its building-up method
CN1298947A (en) * 2000-12-01 2001-06-13 钱其军 Virus with specigic reproduction in tumor well and effective expression of tumor angiogenesis inhibitor and its construction method
CN1388248A (en) * 2001-05-25 2003-01-01 钱其军 Adenovirus proliferated specifically inside tumor cell to express interferon in high efficiency and its construction method
WO2003006640A1 (en) * 2001-07-12 2003-01-23 Qijun Qian A specific proliferation in tumour cell which can express antioncogene with high efficiency and the use of it
CN1886511A (en) * 2003-11-28 2006-12-27 浙江海正药业股份有限公司 Chimeric type 5/type 11 or type 35 adenovirus vector for preventing infection with antihuman immunodeficiency virus
CN1884556A (en) * 2006-06-22 2006-12-27 江苏舜唐生物工程有限公司 Tumour-dissolving adenovirus mutant possessing multiple specific anti-tumour mechanism
WO2007102326A1 (en) * 2006-03-07 2007-09-13 Yokohama City University Strong immune induction by using combination of adenovirus type-5/type-35 vector and vaccinia virus mva vector

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1254719A (en) * 1999-11-19 2000-05-31 钱其军 Defective adenovirus and its building-up method
CN1298947A (en) * 2000-12-01 2001-06-13 钱其军 Virus with specigic reproduction in tumor well and effective expression of tumor angiogenesis inhibitor and its construction method
CN1388248A (en) * 2001-05-25 2003-01-01 钱其军 Adenovirus proliferated specifically inside tumor cell to express interferon in high efficiency and its construction method
WO2003006640A1 (en) * 2001-07-12 2003-01-23 Qijun Qian A specific proliferation in tumour cell which can express antioncogene with high efficiency and the use of it
CN1886511A (en) * 2003-11-28 2006-12-27 浙江海正药业股份有限公司 Chimeric type 5/type 11 or type 35 adenovirus vector for preventing infection with antihuman immunodeficiency virus
WO2007102326A1 (en) * 2006-03-07 2007-09-13 Yokohama City University Strong immune induction by using combination of adenovirus type-5/type-35 vector and vaccinia virus mva vector
CN1884556A (en) * 2006-06-22 2006-12-27 江苏舜唐生物工程有限公司 Tumour-dissolving adenovirus mutant possessing multiple specific anti-tumour mechanism

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
陈东锋 等: "人35型及11型腺病毒的研究进展", 《中国肿瘤生物治疗杂志》 *
马炬明 等: "高感染力嵌合型腺病毒载体的构建及其感染力的流式细胞术测定", 《实用癌症杂志》 *
马蕾娜等: "携带5/35嵌合型fiber的溶瘤腺病毒对胃癌细胞的杀伤能力研究", 《浙江理工大学学报》 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106471125A (en) * 2014-04-30 2017-03-01 贝尔韦什生物医学研究学会 Adenoviruss including albumin binding moieties
US10604549B2 (en) 2014-04-30 2020-03-31 Fundació Institut D'investigació Biomèdica De Bellvitge (Idibell) Adenovirus comprising an albumin-binding moiety
CN106471125B (en) * 2014-04-30 2021-04-06 贝尔韦什生物医学研究学会 Adenoviruses comprising albumin binding moieties
US11578104B2 (en) 2014-04-30 2023-02-14 Fundació Institut D'lnvestigació Biomedica De Bellvitge (í DIBELL) Adenovirus comprising an albumin-binding moiety
CN106591368A (en) * 2016-10-12 2017-04-26 郑州大学 B subgroup adenovirus 11 vector carrying IL-15R/IL-15 fusion genes and construction and application of the same
WO2021008267A1 (en) * 2019-07-16 2021-01-21 伍泽堂 Virus and tumor therapeutic drug for specifically killing tumor cells
EP4001404A4 (en) * 2019-07-16 2022-11-02 Wu, Zetang Virus and tumor therapeutic drug for specifically killing tumor cells
CN113249342A (en) * 2021-05-25 2021-08-13 江苏万戎生物医药科技有限公司 Chimeric broad-spectrum oncolytic adenovirus for multi-mechanism synergistic immunotherapy and application thereof in tumor therapy
WO2022246646A1 (en) * 2021-05-25 2022-12-01 江苏万戎生物医药科技有限公司 Chimeric broad-spectrum oncolytic adenovirus with multiple mechanisms synergizing with and enhancing efficacy of immunotherapy, and application thereof in tumor treatment
CN113249342B (en) * 2021-05-25 2023-12-01 江苏万戎生物医药科技有限公司 Chimeric broad-spectrum oncolytic adenovirus with multiple mechanism synergistic and synergistic immunotherapy and application thereof in tumor treatment

Similar Documents

Publication Publication Date Title
JP3770333B2 (en) Recombinant DNA virus and method for producing the same
KR100379654B1 (en) Recombinant DNA Virus Vectors for Transfection of Animal Cells
RU2361611C2 (en) Designing of carcinolytic adenovirus recombinant, specifically expressing immunomodulatory factor gm-csf in tumoral cells and its application
KR101006594B1 (en) Stable adenoviral vectors and methods for propagation thereof
US5998174A (en) Multigene vectors
CN106978443B (en) Beta-globin recombinant lentiviral vector and application thereof
JP2005000172A (en) Minimal adenoviral vector
CN101781636A (en) Proliferous type recombination oncolytic adenovirus containing 11-type adenovirus cilia protein gene, construction method and application thereof
US6521426B1 (en) Preparation of recombinant adenovirus carrying a rep gene of adeno-associated virus
CZ294338B6 (en) Prokaryotic plasmid, prokaryotic cell comprising such plasmid, method for preparing recombinant adenovirus genomes and process for preparing recombinant adenoviruses
Kuroda et al. Flip-Flop HSV-BAC: bacterial artificial chromosome based system for rapid generation of recombinant herpes simplex virus vectors using two independent site-specific recombinases
KR0181976B1 (en) Method for modifying the cell, tissue or host tropism of a microorganisms; recombinant microorganisms obtained in this method
MXPA01010273A (en) Novel recombinant and mutant herpesviruses.
CN111902535A (en) Recombinant virus capable of stably expressing target protein
CN100500222C (en) Cancer targeted double gene-virus, its structure method and application thereof
CN110272917B (en) Rapid and accurate three-plasmid oncolytic adenovirus recombination packaging system Ad5MixPlus and application thereof
CN110684743A (en) Virus for specifically killing tumor cells and tumor therapeutic drug
US7371570B2 (en) Cell-specific adenovirus vector comprising EBV-specific promoter
CN116323955A (en) Rescue of recombinant adenoviruses by CRISPR/CAS mediated in vivo end resolution
JP4159620B2 (en) Method for producing recombinant adenovirus
JP4288259B2 (en) Recombinant DNA viral vector for animal cell infection
JP3713038B2 (en) Recombinant adenovirus
CN106868047B (en) Recombinant adenovirus vector and construction method and application thereof
AU752811B2 (en) Preparation of recombinant adenovirus carrying a rep gene of Adeno-Associated Virus
JP2008283921A (en) Animal vaccine

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20100721