CN100557030C - A kind of B type grippal virus fluorescent augmentation detection kit and detection method - Google Patents
A kind of B type grippal virus fluorescent augmentation detection kit and detection method Download PDFInfo
- Publication number
- CN100557030C CN100557030C CNB2006100506733A CN200610050673A CN100557030C CN 100557030 C CN100557030 C CN 100557030C CN B2006100506733 A CNB2006100506733 A CN B2006100506733A CN 200610050673 A CN200610050673 A CN 200610050673A CN 100557030 C CN100557030 C CN 100557030C
- Authority
- CN
- China
- Prior art keywords
- virus
- influenza
- type
- detection kit
- grippal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of B type grippal virus fluorescent augmentation detection kit and utilize test kit to detect the method for Influenza B virus, test kit comprises Influenza B virus nucleoprotein gene standard substance, amplified fluorescence detection reagent and archaeal dna polymerase and reversed transcriptive enzyme, the amplified fluorescence detection reagent mainly comprises single stage method RT-PCR damping fluid, specificity amplification primer and specific probe, deoxidation nucleoside triphosphate mixture, Influenza B virus nucleoprotein gene standard substance partial sequence is 5 '-CCCACCAAGCAACAAACGAACCCGGAACCCATCCCCGGAAAGAGCAACTACAATCA GTGAAGCTGATGTCGGAAGG-3 ', the inventive method can directly detect pathogen nucleic acid, early stage in the influenza morbidity, just can detect and whether contain the Influenza B virus specific gene, for isolating early, make a definite diagnosis and treatment is provided convenience.
Description
(1) technical field
The present invention relates to a kind of B type grippal virus fluorescent augmentation detection kit and detection method.
(2) background technology
The clinical symptom of influenza (influenza) is easily obscured mutually with common cold, and finally the chamber method is made a definite diagnosis by experiment.In recent years, develop the influenza virus quick diagnosis reagent kit abroad, its principle has fluorescent method, enzyme linked immunosorbent assay, gold mark method or the like, though can reach the purpose of quick diagnosis, its susceptibility is far below isolation of virus, false negative is higher, adds to cost an arm and a leg, and in fact seldom uses in China.It is more responsive that the RT-PCR of influenza virus detects classical viral separation method, and 6～7h just can obtain a result, and detects easily pollution and the high shortcoming of false positive rate but there is.
The fluorescent quantitative PCR technique that grew up in recent years, it has utilized the efficient amplification of PCR to thymus nucleic acid (DNA), the high specific of probe technique and the susceptibility of spectroscopic techniques and quantitative characteristics, not only overcome the deficiency of conventional PCR qualitative detection, and have directly perceived, good reproducibility, high specificity, susceptibility is high and advantage such as easy to operate.
The fluorescent quantitative PCR technique principle: quantitative fluorescent PCR is to utilize the variation of the fluorescence luminous energy that fluorescence dye discharged under the effect of exciting light to come dynamically directly to reflect the variation of pcr amplification product amount.Because of the fluorescent signal variable is directly proportional with the amplified production amount, by enough sensitive automatization quantitative real time PCR Instruments just can by to the collection of fluorescent signal with analyze realize to original template quantitatively.
Fluorescence labeling method commonly used can simply be divided into two big classes: 1, non-special detection one double-stranded DNA interpolation type fluorescence dye; 2, the single-minded detection of extension increasing sequence-mainly refer to fluorescent probe and Auele Specific Primer, fluorescently-labeled probe has three classes: (1) molecular beacon probe; (2) the two probes of hybridization; (3) Taqman double-tagging probe.When adding a pair of primer, add a specific fluorescent probe when widely used TaqMan probe method is meant pcr amplification in addition, this probe only with template specificity combine, its binding site is between two primers.5 of probe ' end be marked with the fluorescence report group (Reporter, R), as FAM, VIC etc., 3 ' end be marked with the fluorescent quenching group (Quencher, Q), as TAMRA etc.When probe is complete, 5 ' end reporter group through the light source for instrument excited fluorescent just in time by in-plant 3 ' end fluorophor cancellation, instrument detecting less than 5 ' end reporter group institute excited fluorescent signal (emission wavelength of 5 ' end fluorophor just in time is the absorbing wavelength of 3 ' end fluorophor in other words, thus energy be absorbed be delivered to 3 ' end fluorophor and send other fluorescence).Carrying out along with PCR, the Taq enzyme runs in the chain extension process and template bonded probe, (this activity is a double-stranded specific to its 5 '-3 ' 5 prime excision enzyme activity, the free single-stranded probe is unaffected) will be with the cutting probe, discharging 5 ' end reporter group is free in the reaction system, away from 3 ' and the shielding of end fluorescent quenching group, 5 ' end reporter group institute's fluorescent signal emitted that is stimulated just can be detected by probe.That is to say DNA chain of every amplification, just have a fluorescence molecule to form, realized that the accumulation of fluorescent signal and PCR product form fully synchronously.From instrument detecting go out the minimum cycle number that fluorescent value goes out the peak (cycle threshold, Ct) with detect viral nucleic acid amount logarithmic value and be linear negative correlation.Just can calculate primary template amount according to the Ct value in the quantitative fluorescent PCR reaction.
(3) summary of the invention
The present invention is exactly according to above-mentioned principle, and design is fit to the Auele Specific Primer and the specific probe of Influenza B virus, and goal of the invention is to provide a kind of gene quick detection kit and detection method of Influenza B virus.
For reaching goal of the invention the technical solution used in the present invention be:
A kind of B type grippal virus fluorescent augmentation detection kit, comprise Influenza B virus nucleoprotein gene standard substance, amplified fluorescence detection reagent and archaeal dna polymerase and reversed transcriptive enzyme, described amplified fluorescence detection reagent mainly comprises single stage method RT-PCR damping fluid, specificity amplification primer and specific probe, deoxidation nucleoside triphosphate mixture, described Influenza B virus nucleoprotein gene standard substance partial sequence is 5 '-CCCACCAAGCAACAAACGAACCCGGAACCCATCCCCGGAAAGAGCAACTACAATCA GTGAAGCTGATGTCGGAAGG-3 ', described specificity amplification primer is: upstream primer sequence FluBNP (YG) F1:5 '-CCCACCRAGCAACAAAGG-3 ', downstream primer sequence FluBNP (YG) R1:5 '-CCTTCCGACATCAGCTTCACT-3 ', described specific probe sequence is FluBNP (YG) Pb1:5 '-FAM-CCCGGAACCCATCCCCGGA-TANRA-3 ', wherein FAM is the report fluorophor, and TANRA is the fluorescent quenching group.
Described amplified fluorescence detection reagent main component is as follows:
Single stage method RT-PCR damping fluid final concentration is 1 *
Specific amplification upstream primer 0.2～0.6 μ M
Specific amplification downstream primer 0.2～0.6 μ M
Specific probe 0.1～0.4 μ M
Deoxidation nucleoside triphosphate mixture 400～800 μ M
Surplus is a DEPC water.
Above concentration is the final concentration of each material in reaction system.Described DEPC water refers to that diethypyrocarbonate (diethylpyrocarbonate) handled and through the MiliQ of high temperature, autoclave sterilization level pure water.
Described single stage method RT-PCR damping fluid final concentration is 1 *, the meaning is that each concentration of component is identical with 1 * RT-PCR buffer in the damping fluid, represents that promptly each component final concentration in reaction solution is as follows in the damping fluid: KCl 50mM, Tris-HCl 10mM, TritonX-100 0.1%, MgCl
21.5mM.Selecting volume among the present invention for use is 2 * RT-PCR buffer of reaction solution cumulative volume 50%.
Usually, pollute for reducing RNA, also be added with the RNA enzyme inhibitors in the described amplified fluorescence detection reagent, the preferred final concentration of RNA enzyme inhibitors is the RNasin of 0.8 unit of activity/μ L among the present invention.The RNasin nucleic acid inhibitor is by the Promega research and development, and the RNA enzyme with wide spectrum suppresses vigor, is used to remove the RNA enzyme and pollutes.The RNasin nucleic acid inhibitor is the albumen of 1 50kD size, and it and RNA enzyme are pressed combination in 1: 1 with non covalent bond, and suppress the RNA enzyme activity, and binding constant is 10-14.The unit of activity of RNasin nucleic acid inhibitor is defined as and suppresses 5ngRNase A hydrolysis 2`, the amount of the inhibitor that 50% vigor of the single phosphoric acid cyclisation of 3`-cytidine is used.
Described deoxidation nucleoside triphosphate mixture is dATP, dTTP, dCTP, dGTP amount of substance 1: 1: 1: 1 mixture.
Described archaeal dna polymerase consumption is 0.5～5 enzyme activity unit/reaction, is selected from one of following: 1. Ampli TaqR archaeal dna polymerase; 2. rTth archaeal dna polymerase; 3. rTth archaeal dna polymerase XL.
Described reversed transcriptive enzyme consumption is 6～300 enzyme activity unit/reactions, is selected from one of following: 1. M-MuLV reversed transcriptive enzyme; 2. AMV reversed transcriptive enzyme.
Described amplified fluorescence detection reagent is composed as follows:
Single stage method RT-PCR buffer final concentration is 1 *
RNA enzyme inhibitors RNasin 0.8 unit of activity/μ L
Specific amplification upstream primer 0.4 μ M
Specific amplification downstream primer 0.4 μ M
Specific probe 0.2 μ M
Deoxidation nucleoside triphosphate mixture is:
DATP, dTTP, each 150 μ M of dCTP, dGTP
Surplus is a DEPC water.
A kind of B type grippal virus fluorescent augmentation detection method, described detection method is contrast with Influenza B virus nucleoprotein gene standard substance, and the gargarism that adopts patient to be measured is an analyzing samples, and described method steps is as follows:
(1) gets gargarism and extract viral RNA;
(2) fluorescent PCR augmentation detection: get amplified fluorescence detection reagent and reaction required archaeal dna polymerase and reversed transcriptive enzyme and be made into reaction solution, the RNA that adds reference substance and analyzing samples carries out amplified reaction respectively, and reaction tubes places the quantitative fluorescence PCR instrument to carry out fluoroscopic examination;
(3) interpretation of result: select fluoroscopic examination model F AM fluorescence, baseline adjustment is got 3～15 round-robin fluorescent signals; The threshold setting principle is with the vertex of threshold line just above normal negative control; The fluorescence growth curve surpasses threshold line, and is good logarithmic growth, is judged as the positive;
Described Influenza B virus nucleoprotein gene partial sequence is 5 '-CCCACCAAGCAACAAACGAACCCGGAACCCATCCCCGGAAAGAGCAACTACAATCA GTGAAGCTGATGTCGGAAGG-3 ', described amplified fluorescence detection reagent mainly comprises single stage method RT-PCR damping fluid, specificity amplification primer and specific probe, deoxidation nucleoside triphosphate mixture, described specificity amplification primer is: upstream primer sequence FluBNP (YG) F1:5 '-CCCACCRAGCAACAAAGG-3 ', downstream primer sequence FluBNP (YG) R1:5 '-CCTTCCGACATCAGCTTCACT-3 ', described specific probe sequence is FluBNP (YG) Pb1:5 '-FAM-CCCGGAACCCATCCCCGGA-TANRA-3 ', wherein FAM is the report fluorophor, and TAMRA is the fluorescent quenching group.
Concrete, described method is got quantitative fluorescence augmentation detection reagent preparation reaction solution, and per 25 μ L are composed as follows for reaction system:
2×RT-PCR?bufffer 12.5μL
RNA enzyme inhibitors RNasin 0.8 unit of activity/μ L
Specific amplification upstream primer 0.4 μ M
Specific amplification downstream primer 0.4 μ M
Specific probe 0.2 μ M
Deoxidation nucleoside triphosphate mixture is:
DATP, dTTP, each 150 μ M of dCTP, dGTP
2.5 enzyme activity unit/the reactions of Ampli TaqR archaeal dna polymerase
50 enzyme activity unit/the reactions of AMV reversed transcriptive enzyme
Analyzing samples viral RNA 5 μ L
DEPC water complements to 25 μ L;
The PCR cycling condition is set to 45 ℃ of 30min reverse transcriptions, 94 ℃ of sex change 2min, and with 95 ℃ of 15s, 40 circulations of 60 ℃ of annealing 30sec amplifications are carried out the single-point fluoroscopic examination at 60 ℃.The annealing temperature optimum range is 60～50 ℃, and the annealing time optimum range is 30sec～1min.
Beneficial effect of the present invention is mainly reflected in:
1, early diagnosis: PCR can directly detect pathogen nucleic acid, and is early stage in influenza morbidity, just can detect and whether contain the Influenza B virus specific gene, for isolating early, make a definite diagnosis and treatment being provided convenience.
2, sampling is simple and convenient: the desirable latent period or the early stage influenza patient respiratory road sample of falling ill detect.
3, compare with traditional gene amplification technology, detection method provided by the invention is time saving and energy saving, can finish detection in 2～3 hours.
4, highly sensitive, owing to adopted specific gene amplification and specific gene probe hybridization bonded double technique, the sensitivity of diagnosis is higher.
5, adopt the computer real-time monitoring technology, in the experiment process, can judge whether to contain virogene, and the judgement of experimental result is accurately convenient.
6, can realize the quantitative analysis of viral nucleic acid.
(4) Figure of description
Fig. 1 is susceptibility and the accuracy of fluorescence quantitative RT-RCR to the Influenza B virus detection of nucleic acids; A:10000TCID
50/ pipe; B:1000TCID
50/ pipe; C:100TCID
50/ pipe; D:10TCID
50/ pipe; E:1TCID
50/ pipe; F:0.1TCID
50/ pipe; G:0.01TCID
50/ pipe, TCID
50For virus titer unit;
Fig. 2 is the detection of second type influenza virus fluorescence quantitative RT-RCR to doubtful influenza patient's part gargarism sample.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1:
The doubtful influenza of our province is broken out 19 parts of second type influenza virus patient gargarism of epidemic situation and the censorship of influenza monitoring hospital and used the TaqMan fluorescent quantitative RT-PCR method, conventional RT-PCR method and viral separation method detect, wherein virus is separated positive 7 parts (36.84%), positive 9 parts (47.37%) of RT-PCR, positive 11 parts (57.89%) of TaqMan RT-PCR, the positive patient that this three detects is unanimity as a result.Virus is separated negative case in order to get rid of the false-positive possibility of fluorescence RT-PCR result for fluorescence RT-PCR is positive, we fall ill early stage to the patient and decubation paired sera carry out hirst's hemagglutination and suppress antibody (HI) mensuration, all 〉=4 multiplication is long for Influenza B virus HI antibody as a result, and serology and TaqManRT-PCR result are in full accord.
TaqMan fluorescence quantitative RT-RCR reaction system is as follows:
2×RT-PCR?buffer 12.5μL
RNA enzyme inhibitors RNasin 0.8 unit of activity/μ L
Specific amplification upstream primer 0.4 μ M
Specific amplification downstream primer 0.4 μ M
Specific probe 0.2 μ M
Deoxidation nucleoside triphosphate mixture is:
DATP, dTTP, each 150 μ M of dCTP, dGTP
2.5 enzyme activity unit/the reactions of Ampli TaqR archaeal dna polymerase
50 enzyme activity unit/the reactions of AMV reversed transcriptive enzyme
Analyzing samples viral RNA (1.0 μ g/ μ L) 5 μ L
DEPC water complements to 25 μ L;
The PCR cycling condition is set to 45 ℃ of 30min reverse transcriptions, 94 ℃ of sex change 2min, and with 95 ℃ of 15s, 40 circulations of 60 ℃ of annealing 30sec amplifications are carried out the single-point fluoroscopic examination at 60 ℃.
The second type influenza virus fluorescence quantitative RT-RCR is seen Fig. 2 to the detected result of doubtful influenza patient's part gargarism sample.
Susceptibility and repeated experiment method: to 10 of known viruse titre
4TCID
50/ ml strains of influenza viruses second/Zhejiang/1/02 strain by 10 times of serial dilutions become 10000,1000,100,10,1,0.1,0.01TCID
507 gradients, each gradient are respectively got 200 μ L, extract viral RNA, carry out fluorescence quantitative RT-RCR (method is the same), to the sample of each concentration, all repeat 3 experiments, see Fig. 1.The result shows: the susceptibility of second type influenza virus fluorescence quantitative RT-RCR is 0.01TCID
50.
The repeatability of the Ct value variation coefficient (CV) evaluation method by estimating the experiment of each extent of dilution triplicate.See Table 1.The variation coefficient illustrates that all less than 3% this method repeatability is good.
Table 1: fluorescence quantitative RT-RCR detects the repeatability of Influenza B virus
To 10
4TCID
50/ ml strains of influenza viruses second/Zhejiang/1/02 strain becomes 100,10,1,0.1,0.01 TCID by 10 times of serial dilutions
50, extract viral RNA, carry out quantitative fluorescent PCR, and separate with virus with conventional RT-PCR and to compare, the results are shown in Table 2: the result shows that fluorescent quantitative RT-PCR method detects the susceptibility of Influenza B virus, is higher than classical isolation of virus and RT-PCR method.
Table 2: the susceptibility of fluorescence RT-PCR, conventional RT-PCR and viral separation detection Influenza B virus relatively
Sequence table .ST25
＜110〉Zhejiang Polytechnical University
＜120〉a kind of B type grippal virus fluorescent augmentation detection kit and detection method
<130>
<160>4
<170>PatentIn?version?3.2
<210>1
<211>79
<212>DNA
<213>Influenza?B?virus
<400>1
ccccaccaag?caacaaacga?acccggaacc?catccccgga?aagagcaact?acaatcagtg 60
aagctgatgt?gtcggaagg 79
<210>2
<211>18
<212>DNA
<213>Unknown
<220>
＜223〉artificial sequence
<400>2
cccaccragc?aacaaagg 18
<210>3
<211>21
<212>DNA
<213>Unknown
<220>
＜223〉artificial sequence
<400>3
ccttccgaca?tcagcttcac?t 21
<210>4
<211>19
<212>DNA
<213>Unknown
<220>
＜223〉artificial sequence
<400>4
cccggaaccc?atccccgga 19
Claims (8)
1. B type grippal virus fluorescent augmentation detection kit, comprise Influenza B virus nucleoprotein gene standard substance, amplified fluorescence detection reagent and archaeal dna polymerase and reversed transcriptive enzyme, described amplified fluorescence detection reagent mainly comprises single stage method RT-PCR damping fluid, specificity amplification primer and specific probe, deoxidation nucleoside triphosphate mixture, it is characterized in that: described Influenza B virus nucleoprotein gene standard substance partial sequence is 5 '-CCCACCAAGCAACAAACGAACCCGGAACCCATCCCCGGAAAGAGCAACTACAATCA GTGAAGCTGATGTCGGAAGG-3 ', described specificity amplification primer is: upstream primer sequence FluBNP (YG) F1:5 '-CCCACCRAGCAACAAAGG-3 ', downstream primer sequence FluBNP (YG) R1:5 '-CCTTCCGACATCAGCTTCACT-3 ', described specific probe sequence is FluBNP (YG) Pb1:5 '-FAM-CCCGGAACCCATCCCCGGA-TANRA-3 ', wherein FAM is the report fluorophor, and TANRA is the fluorescent quenching group.
2. B type grippal virus fluorescent augmentation detection kit as claimed in claim 1 is characterized in that described amplified fluorescence detection reagent main component is as follows:
Single stage method RT-PCR damping fluid final concentration is 1 *
Specific amplification upstream primer 0.2～0.6 μ M
Specific amplification downstream primer 0.2～0.6 μ M
Specific probe 0.1～0.4 μ M
Deoxidation nucleoside triphosphate mixture 400～800 μ M
Surplus is a DEPC water.
3. B type grippal virus fluorescent augmentation detection kit as claimed in claim 2 is characterized in that also being added with the RNA enzyme inhibitors in the described amplified fluorescence detection reagent.
4. B type grippal virus fluorescent augmentation detection kit as claimed in claim 3 is characterized in that described RNA enzyme inhibitors is that final concentration is the RNasin of 0.8 unit of activity/μ L.
5. B type grippal virus fluorescent augmentation detection kit as claimed in claim 1 is characterized in that described deoxidation nucleoside triphosphate mixture is dATP, dTTP, dCTP, dGTP amount of substance 1: 1: 1: 1 mixture.
6. B type grippal virus fluorescent augmentation detection kit as claimed in claim 1 is characterized in that described archaeal dna polymerase consumption is 0.5～5 enzyme activity unit/reaction, is selected from one of following: 1. Ampli TaqR archaeal dna polymerase; 2. rTth archaeal dna polymerase; 3. rTth archaeal dna polymerase XL.
7. B type grippal virus fluorescent augmentation detection kit as claimed in claim 1 is characterized in that described reversed transcriptive enzyme consumption is 6～300 enzyme activity unit/reactions, is selected from one of following: 1. M-MuLV reversed transcriptive enzyme; 2. AMV reversed transcriptive enzyme.
8. B type grippal virus fluorescent augmentation detection kit as claimed in claim 3 is characterized in that described amplified fluorescence detection reagent is composed as follows:
Single stage method RT-PCR buffer final concentration is 1 *
RNA enzyme inhibitors RNasin 0.8 unit of activity/μ L
Specific amplification upstream primer 0.4 μ M
Specific amplification downstream primer 0.4 μ M
Specific probe 0.2 μ M
Deoxidation nucleoside triphosphate mixture is:
DATP, dTTP, each 150 μ M of dCTP, dGTP
Surplus is a DEPC water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100506733A CN100557030C (en) | 2006-05-10 | 2006-05-10 | A kind of B type grippal virus fluorescent augmentation detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100506733A CN100557030C (en) | 2006-05-10 | 2006-05-10 | A kind of B type grippal virus fluorescent augmentation detection kit and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1904067A CN1904067A (en) | 2007-01-31 |
| CN100557030C true CN100557030C (en) | 2009-11-04 |
Family
ID=37673430
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100506733A Expired - Fee Related CN100557030C (en) | 2006-05-10 | 2006-05-10 | A kind of B type grippal virus fluorescent augmentation detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100557030C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102337351B (en) * | 2010-07-16 | 2014-04-02 | 中山大学达安基因股份有限公司 | Typing detection kit for influenza virus |
| CN102230023B (en) * | 2011-06-04 | 2013-03-06 | 浙江省疾病预防控制中心 | Dual fluorescence quantification RT-PCR detection kit and application thereof |
| CN104388587A (en) * | 2014-11-03 | 2015-03-04 | 深圳市生科源技术有限公司 | One-step detection kit for influenza B virus and influenza B virus detection method |
-
2006
- 2006-05-10 CN CNB2006100506733A patent/CN100557030C/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| Rapid detection and simultaneous subtype differentiation ofinfluenza A virus by real time PCR. Stone B et al.J Virol. Methods,Vol.vol.117 No.no.2. 2004 * |
| 荧光定量RT-PCR快速检测乙型流感病毒核酸. 卢亦愚等.浙江预防医学，第17卷第3期. 2005 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1904067A (en) | 2007-01-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108676920B (en) | Primer and kit for rapidly detecting mouse norovirus and RT-RPA method thereof | |
| CN102140543B (en) | Multiple real-time quantitative PCR primer, probe and detection method for identifying viral pathogens relevant to fever with eruption syndrome as infection diseases | |
| CN103725798B (en) | For detecting primer, test kit, the detection method of hemorrhagic fever with renal syndrome virus with RT-LAMP method | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN1904068B (en) | H5N1 type poultry grippal virus fluorescent augmentation detection kit and detection method | |
| CN103614489A (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN104232798A (en) | Multi-fluorogenic quantitative PCR (polymerase chain reaction) method for detecting duck hepatitis A virus (DHAV) and identifying DHAV-A and DHAV-C and kit | |
| CN102605107A (en) | S-segment loop-mediated isothermal amplification rapid detection kit and method for server fever with thrombocytopenia syndrome bunyavirus | |
| CN102559935A (en) | M-gene based fluorescent RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection method of Nipah virus | |
| CN103397105A (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN101363063B (en) | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR | |
| CN1904069B (en) | Measles virus fluorescent augmentation detection kit and detection method | |
| CN100557030C (en) | A kind of B type grippal virus fluorescent augmentation detection kit and detection method | |
| CN102952896A (en) | Universal loop-mediated isothermal amplification kit for detecting influenza A virus and application of universal loop-mediated isothermal amplification kit | |
| CN105238880A (en) | Enterovirus real-time fluorescent quantitative detection kit | |
| CN1904070B (en) | Al type grippal virus fluorescent augmentation detection kit and detection method | |
| CN1948507B (en) | Parotiditis virus fluorencent amplification detection reagent box and detection method | |
| CN111206122A (en) | Novel coronavirus nucleic acid detection kit | |
| CN111424117A (en) | Real-time fluorescent RT-RAA detection kit for on-site rapid detection of novel bunyavirus nucleic acid | |
| CN101440400B (en) | Fluorescent detection kit and method for Streptococcus suis 2 type nucleic acid containing 89K pathogenicity island gene | |
| Kubar et al. | Rapid and quantitative detection of mumps virus RNA by one-step real-time RT-PCR | |
| CN105603091A (en) | Vibrio cholerae multiplex fluorescence PCR detection kit as well as preparation and application thereof | |
| CN102286644A (en) | Kit for genotyping hepatitis C virus (HCV) | |
| CN104745722A (en) | Primers, probe and kit used for detecting varicella zoster viruses (VZVs) | |
| CN102533967B (en) | Reagent kit and method for detecting multiple real-time fluorescent quantitative polymerase chain reaction (PCR) of vibrio cholerae toxin genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20091104 Termination date: 20120510 |