CN100556915C - Rice leaf curl-outward gene and application thereof - Google Patents

Abstract

The invention discloses a kind of rice leaf curl-outward gene RG and application thereof.Make rice leaf that the method that outer volume improves rice yield take place thereby the invention still further relates to.The invention still further relates to a kind of method that improves plant, adopt the inventive method can make rice leaf curl-outward, thus the straightness that increases blade increase the blade light-receiving area, make in lower leave can be subjected to more illumination.Under the dense planting state,, reduce the morbidity chance by making leaf curl-outward also can improve the ventilation and penetrating light of colony.Curl-outward gene of the present invention also can be used as the cue mark of true hybrid in gene transformation plant offspring's tracking mark and the hybrid seeding process.

Description

Rice leaf curl-outward gene and application thereof

Technical field

The present invention relates to the phytology field.More particularly, the present invention relates to new rice leaf curl-outward gene RG and application thereof.Make rice leaf that the method that outer volume improves rice yield take place thereby the invention still further relates to.The invention still further relates to a kind of method that improves plant.Curl-outward gene of the present invention also can be used as the cue mark of true hybrid in gene transformation plant offspring's tracking mark and the hybrid seeding process.

Background technology

Paddy rice is the staple food crop of China, and it is staple food with rice that there is the population more than 60% in the whole nation.For guaranteeing grain security, China started the super hybridization rice evolutionary operation(EVOP) in 1996.Obtain high yield, prerequisite is the quantity and weight that increases seed.Because blade is that paddy rice carries out photosynthetic major organs, its shape and angle directly have influence on the photosynthetic efficiency of individual and colony, to improving output and improving quality important effect are arranged.

Leaf roll is useful economical character, is the important component part of desirable strain shape, and leaf roll has direct effect to blade straight and upright.Axial blade, except that the front was subjected to light, the back side is the reflected light of ABSORPTION AND SCATTERING light and other blades also, and under light intensity and leaf area the same terms, upright blade helps improving photosynthetic efficiency; And, by improving the ventilation and penetrating light of colony, also can reduce the morbidity chance, therefore,, strengthen upright blade by selecting the leaf roll proterties, improve colony's light transmission, in breeding, extensively come into one's own.

Up-to-date high yield strain shape achievement in research proposes the viewpoint of leaf rolling about the description of blade characteristics: lift on the blade, curl, upright, specific leaf weight is big, the chlorophyll content height.There are some researches show the effect that leaf rolling has makes that blade is straight and upright, the phyllopodium angle is less, chlorophyll content increase, leaf area index increase, optical extinction coefficient reduction etc. help making full use of luminous energy.Therefore, this proterties receives many rice genetic breeding work persons' concern, and has carried out work widely, wishes this proterties is introduced in the rice varieties, constructs ideal strain shape, realizes the rice yield new breakthrough.

Therefore, press for a kind of ideal rice leaf roll of development research plant at present, improving the photosynthetic efficiency of paddy rice, thereby improve the output of paddy rice.

Summary of the invention

The object of the present invention is to provide a kind of new rice leaf curl-outward gene.

In a first aspect of the present invention, a kind of isolating RG albumen is provided, this albumen is selected from down group:

(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;

(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the leaf curl-outward function by (a) polypeptides derived.

In a second aspect of the present invention, a kind of isolating polynucleotide are provided, these polynucleotide are selected from down group:

(i) the proteic polynucleotide of the described RG of coding;

(ii) with (i) in polynucleotide complementary polynucleotide.

In a preference of the present invention, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.

In another preference, described polynucleotide also comprise the upstream promoter region sequence that drives this genetic expression.

In another preference, these polynucleotide are selected from down group:

(1) nucleotide sequence shown in the 1-909 position among the SEQ ID NO:1;

(2) nucleotide sequence shown in the 173-520 position among the SEQ ID NO:1; Or

(3) nucleotide sequence shown in the 1-1021 position among the SEQ ID NO:8.

In a third aspect of the present invention, a kind of carrier is provided, it contains the above-mentioned polynucleotide of the present invention.

In a fourth aspect of the present invention, a kind of genetically engineered host cell is provided, it contains the above-mentioned carrier of the present invention, or is integrated with described polynucleotide in the genome.

In a preference of the present invention, described host cell is a vegetable cell, as rice cell.

In a fifth aspect of the present invention, a kind of method that makes rice leaf that outer volume take place is provided, this method comprises increases RG gene or its homogenic expression in the described paddy rice.

In a preference of the present invention, thereby strengthen this RG gene or its homogenic expression by inserting the T-DNA sequence or driving with strong promoter.

In a sixth aspect of the present invention, a kind of method that improves paddy rice is provided, it comprises step:

(a) provide the Agrobacterium of carrying expression vector, described expression vector contains the proteic dna encoding sequence of the above-mentioned RG of the present invention (comprising cDNA sequence or genome sequence);

(b) rice cell or tissue or organ are contacted with Agrobacterium in the step (a), thereby make this RG protein D NA encoding sequence change rice cell over to, and be incorporated on the karyomit(e) of rice cell;

(c) select rice cell or the tissue that changes described RG protein D NA encoding sequence over to;

(d) vegetable cell or tissue regeneration in the step (c) are become rice plant.

In a seventh aspect of the present invention, a kind of purposes of dna molecular is provided, the albumen of described dna molecule encode sequence shown in SEQ ID NO:2, described dna molecular is used to prepare the paddy rice that promotes leaf curl-outward.

Description of drawings

Fig. 1 shown outer volume mutant (BY240) and in spend 11 blade photos.

Fig. 2 has shown the Southern hybridization of outer volume mutant (BY240).With the Ds fragment be after probe and HindIII enzyme are cut in spend 11, the total DNA of BY240 blade and pDsBar1300 plasmid DNA carry out Southern hybridization, there are the hybridization band in BY240 and pDsBar1300 plasmid, in spend 11 amixia bands.

Fig. 3 has shown the chromosome position that outer volume mutant (BY240) T-DNA inserts, and wherein, arrow represents that T-DNA inserts the site.

Fig. 4 has shown the RG expression of gene.Wherein, swimming lane 1:ZH11 climax leaves; The ripe leaf sheath of swimming lane 2:ZH11; Swimming lane 3:ZH11 children fringe; The ripe stem of swimming lane 4:ZH11; Swimming lane 5:BY240 climax leaves; The ripe leaf sheath of swimming lane 6:BY240; Swimming lane 7:BY240 children fringe; The ripe stem of swimming lane 8:BY240.

Fig. 5 has shown the correlation engineering plasmid pUN-RGCO of RG gene.Wherein, LB and RB are T-DNA left margin and right margin, and Hyg is the moisture resistance mycin resistant gene, and 35S and Ubi are 35S and Ubi promotor, and RGcDNA is the cDNA of RG gene, and Nos polyA is the Nos terminator.

Fig. 6 has shown the transfer-gen plant photo of RG gene.

Embodiment

The inventor has at first found to cause blade that the paddy rice mutant plant of outside turnup takes place by the T-DNA insertion through extensive and deep research; Cloned with blade the relevant gene (RG) of outer volume has taken place.Test confirms that the high expression level of RG gene can make rice leaf that outer volume takes place.Thereby the RG gene can be used as the outer volume that promotes blade in the molecular breeding of paddy rice.Finished the present invention on this basis.

Particularly, the inventor has found that by the method for T-DNA label the outwards mutant of volume takes place a blade in the transgenic progeny colony that T-DNA inserts; By spending the F2 population analysis of No. 11 hybridization in outer volume homozygous mutation body and the former kind, find outer volume sudden change and the T-DNA (containing anti-herbicide gene) that inserts exist be divided into from; The Southern hybridization analysis of outer volume mutant proves that the T-DNA of this mutant is inserted as single copy and inserts; Utilize round pcr, obtain T-DNA and inserted the other adjacent sequence of end about the site, and by inserting the Blast analysis of the other adjacent sequence in site, determine that this T-DNA is inserted in gene (called after RG gene among the present invention on No. 4 karyomit(e)s of paddy rice, the Chinese full name is: paddy rice leaf curl-outward gene, and English full name is: transcription initiation site upstream position Revolute Gene); The genome sequence total length of RG gene is 1021bp, and wherein 1-147 is first exon, and 148-259 is first intron, and 260-1021 is second exon.

The full-length cDNA of RG gene is 909bp (SEQ ID NO:1), and wherein ORF is positioned at the 173-520 position, 116 the amino acid whose protein of encoding.

The inventor also utilizes the RT-PCR technology, has compared the RG expression of gene, the RG gene of finding mutant with in spend 11 RG gene to compare on expressing, to have the phenomenon that greatly raises; Correlation engineering plasmid by making up the RG gene and Agrobacterium tumefaciens mediated transgenic method, in spend in No. 11 the transgenic progeny, obtained to have the transfer-gen plant of leaf curl-outward; Identify through PCR, roll up the associated clip that all there is RG genetically engineered plasmid in plant outward, in the part T2 offspring of plantation, observe and have revolute leaf and normal separating of leaf plant.These evidences, RG expression of gene can make rice leaf that outer volume takes place.

As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating RG albumen or polypeptide " is meant that RG albumen is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying RG albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.

Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises the proteic fragment of RG, derivative and analogue.As used herein, term " fragment ", " derivative " are meant biological function or the active polypeptide that keeps natural RG albumen of the present invention identical basically with " analogue ".Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying or fusion rotein).These fragments of definition, derivative and analogue according to this paper belong to the known scope of those skilled in the art.

In the present invention, term " RG albumen " refers to have the SEQ ID NO:2 polypeptide of sequence of RG protein-active.This term also comprises having and variant form RG albumen identical function, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8,1-5) amino acid whose disappearance, insertion and/or replacement, and at C-terminal and/or N-terminal interpolation one or several (being generally in 20, preferably is in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of RG and reactive derivative.

The variant form of polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with coded albumen of the DNA of RG protein D NA hybridization and polypeptide or the albumen that utilizes the proteic antiserum(antisera) of anti-RG to obtain.The present invention also provides other polypeptide, as comprises RG albumen or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the proteic soluble fragments of RG.Usually, this fragment have the RG protein sequence at least about 20 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analogue of RG albumen or polypeptide.These analogues and the proteic difference of natural RG can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps have both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modify and also comprise glycosylation.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " RG albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.

Table 1

Initial residue	Representational replacement	The preferred replacement
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala

Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The present invention also provides the polynucleotide sequence of code book invention RG albumen or its conservative property variation polypeptide.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in SEQ ID NO:1 or the SEQ IDNO:8 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:1 or the SEQID NO:8.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding RG.

Should understand, though RG gene of the present invention preferably derives from paddy rice, but that derive from other plant and other gene paddy rice RG gene height homology (as have more than 80%, as 85%, 90%, 95% even 98% sequence homogeny) are also within the scope that the present invention considers.The Method and kit for of aligned sequences homogeny also is that this area is known, for example BLAST.

RG pyrenoids thuja acid full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.

At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or RG albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.

Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the RG albumen of reorganization.In general following steps are arranged:

(1). with the proteic polynucleotide of coding RG of the present invention (or varient), or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;

(2). the host cell of in suitable medium, cultivating;

(3). separation, protein purification from substratum or cell.

Among the present invention, RG albumen polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus or other carriers.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.

Method well-known to those having ordinary skill in the art can be used to make up and contains RG encoding histone dna sequence dna and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary kantlex or amicillin resistance.

Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.

Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell such as yeast; Vegetable cell etc.

When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.

Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.

Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Another kind method is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.Transform plant and also can use methods such as Agrobacterium-mediated Transformation or particle gun conversion, for example leaf dish method, paddy rice rataria conversion method etc.Can use ordinary method regeneration plant for plant transformed cell, tissue or organ, thereby obtain the plant that blade shape changes.

The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The RG albumen or the polypeptide of reorganization are of use in many ways.For example be used to screen antibody, polypeptide or other part that promotes or resist the RG protein function.Can be used for seeking the valuable peptide molecule that can suppress or stimulate the RG protein function with the reorganization RG protein screening peptide library of expressing.

Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of RG albumen and also can detect the proteic transcription product of RG.

The invention still further relates to a kind of method that makes rice leaf that outer volume take place, this method comprises increases RG gene or its homogenic expression in the described plant.The method that increases the expression of RG gene or its homologous gene is that this area is known.For example.Thereby can drive by insertion T-DNA sequence or with strong promoter and strengthen this RG gene or its homogenic expression.Perhaps strengthen this RG expression of gene by enhanser (as paddy rice waxy gene first intron, Actin gene first intron etc.).The strong promoter that is applicable to the inventive method comprises Ubi promotor of 35s promotor, paddy rice, corn etc.

The invention still further relates to a kind of method that improves paddy rice, it comprises step:

(1) provide the Agrobacterium of carrying expression vector, described expression vector contains RG protein D NA encoding sequence;

(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make this RG protein D NA encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;

(3) select vegetable cell or the tissue that changes described RG protein D NA encoding sequence over to; With

(4) vegetable cell or tissue regeneration in the step (3) are become plant.

Wherein, can adopt any suitable conventional means, comprise that reagent, temperature, pressure condition wait to implement this method.

The present invention measures the leaf curl-outward proterties can use following index: " crimpness LRI ", " straightness LEI " and " degree of hanging down loosely DAL ", and they are calculated as follows respectively:

In flowering period, after the leaf natural curling (referring to outer volume), measure distance (Ln) between the widest part leaf margin, then mounted blade is measured its width (Lw); After blooming 20 days, blade generation natural torsion, measure pulvinus to the slant range (LNL) of blade tip and blade the length (LEL) when straight and upright, measure the blade and the angle (BAL) of stem after the leaf natural bending simultaneously, pulvinus arrives the line of blade tip and the angle (AL) of stem.

Leaf rolling degree (Leaf rolling index, LRI) (%)=(Lw-Ln)/Lw * 100

The blade straightness (erecting index, LEI)=LNL/LEL * 100

Leaf degree of hanging down loosely (drooping angle of leaf, DAL)=AL-BAL

In addition, the invention still further relates to and utilize the tracking mark of leaf curl-outward proterties as a kind of gene transformation plant offspring.In addition, also can utilize the cue mark of the leaf curl-outward characteristic of this gene as true hybrid in the hybrid seeding process.

Major advantage of the present invention is:

(1) separate first and obtain a kind of new rice leaf curl-outward gene, the high expression level of this gene makes rice leaf curl-outward, thereby thereby the straightness that increases blade increase the blade light-receiving area, make in lower leave can be subjected to more illumination.And, under the dense planting state,, reduce the morbidity chance by making leaf curl-outward also can improve the ventilation and penetrating light of colony.

(2) can utilize the tracking mark of leaf curl-outward proterties as a kind of gene transformation plant offspring.

(3) can utilize leaf curl-outward characteristic that gene of the present invention causes cue mark as true hybrid in the hybrid seeding process.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning experiment guide (second edition) (NewYork:Cold Spring Harbor Laboratory Press, 1995) or molecular biology of plants-laboratory manual (Plant Molecular Biology-A Laboratory Mannual, Melody S.Clark compiles, Springer-verlag Berlin Heidelberg, 1997) condition described in, or the condition of advising according to manufacturer.

I. general materials and methods

Use following material and method in the specific embodiment of the invention.

One. material

The present invention uses is that common japonica rice " in spend 11 " (Oryza sativa L.subsp.Japonica CVZhonghua No.11) is studied.But should be understood that and also can use other kind to study.

Two. the simple and easy extraction process of the total DNA of rice leaf

1. get the long paddy rice young leaflet tablet of 2cm, in the 1.5ml pipe, add 200 μ l TPS extracts, 1ml tip smashs blade to pieces.

2. the blade of smashing to pieces is put into 75 ℃ of water-bath temperature and is bathed 20min.

3.12000g * 5min is centrifugal.

4. get 120 μ l supernatants and add 120 μ l Virahol room temperature 5min in 0.5ml tube, 12000g * 10min is centrifugal.

5. remove supernatant, add 120 μ l-300 μ l, 70% washing with alcohol, 12000g * 5min is centrifugal.

6. remove supernatant, drying precipitated, add the dissolving of 30 μ l water (TE), get 0.8-1.0 μ l (10 μ l PCR system) during PCR and do template.

Reagent:

TPS：100mM Tris-Cl(pH＝8.0)

10mM EDTA(pH＝8.0)

1M KCl

Three .TAIL-PCR

TAIL-PCR is according to the method (seeing Plant Molec μ lar Biology Reporter 16:175-181,1998) of narrations such as Liu.T-DNA left end nested primers sequence is:

T-DNA-1：CAAAATCCAGTACTAAAATCCAGA；(SEQ ID NO：5)

T-DNA-3:ATTCGGCGTTAATTCAGTACA; (SEQ ID NO:6) and

T-DNA-5：GTGTTATTAAGTTGTCTAAGC(SEQ ID NO：7)。

These three primers respectively with 5 degenerated primer AD1-AD5 at random in the middle of a combinations of pairs carry out PCR, sequence is faced on the side of amplification T-DNA left end.TAIL-PCR product electrophoresis on 1.5% sepharose is analyzed.The product of TAIL-PCR directly send order-checking company to check order.

Four. freeze-thaw method imports agrobacterium tumefaciens with plasmid (for example, pUN-RGCO plasmid)

1. agrobacterium tumefaciens YEB (composition is seen the molecular cloning experiment guide) (antibiotic-free) solid plate is chosen single bacterium colony.28 ℃ of 200rpm overnight incubation of 5ml YEB liquid nutrient medium.Change 50mlYEB (adding of 500 μ l bacterium liquid) over to by 1% inoculum size, 28 ℃ of 200rpm cultivate 3-4 hour to the bacterium logarithmic phase.

2.4 the centrifugal 10min of ℃ 5000g, precipitation is washed once with the TE (Ph7.5) of 5ml precooling, adds 5mlYEB liquid (containing 10～15% glycerine) and suspends again.Be distributed into 200 μ l, one pipe, behind the liquid nitrogen flash freezer, preserve in-70 degree.

3. get 200 μ l bacterium liquid+0.5-1.0ug plasmid (＜10 μ l) mixings, successively on ice, liquid nitrogen, 37 ℃ of water-baths respectively place 5min, be diluted to 1ml with YEB after, cultivate 2-4hr in 28 ℃ of joltings.

4. get 200 μ l bacterium liquid and coat and contain on the corresponding antibiotic YEB culture medium flat plate, 28 ℃ 2-3 days.

5. choose single bacterium colony, on corresponding antibiotic YEB culture medium flat plate, draw single bacterium colony twice again.

Five. the cultivation of rice material

A. callus induces

Get 12-15 days the paddy rice immature seed in pollination back through 70% alcohol immersion after 1 minute, in 2% NaClO solution, (add 2-3 and drip polysorbas20) sterilization more than 60 minutes, with aseptic water washing 4-5 time, then with scalper with take the photograph son and choose rataria and be inoculated in evoked callus on the N6D2 substratum, under 26 ± 1 ℃, lucifuge condition, cultivate, can be used for after 4 days transforming.

B. cultivation of Agrobacterium and suspension

Picking list bacterium colony Agrobacterium is inoculated into 3ml and contains the YEB liquid nutrient medium of 50mg/L kantlex (Km) in 28 ℃ of jolting overnight incubation from the YEB flat board, contained in the AB liquid nutrient medium of Km50mg/L by the 1% inoculum size 50ml that transfers in the 2nd day, when 200rpm continues jolting and is cultured to OD600 and is 0.8 left and right sides, fresh Agrobacterium bacterium liquid is centrifugal 5 minutes in 4 ℃ of 6000g, collect and be resuspended in the AAM liquid nutrient medium of 1/3 volume, promptly can be used for the various acceptor materials of rice transformation this moment.

C. infect and be total to cultivation

In the 6cm culture dish, various paddy rice acceptor materials are soaked in the fresh AAM Agrobacterium bacterium liquid and shake frequently, after 20 minutes rice material is shifted out, on aseptic filter paper, inhale and remove too much bacterium liquid, transfer to immediately on the N6D2C substratum, cultivated altogether 3 days in 26 ℃.Before converting material changes over to, in advance at N6D2C substratum upper berth one deck aseptic filter paper, and moistening with a small amount of fresh AAM liquid nutrient medium.After cultivating 3 days altogether, take out converting material, blot bacterium liquid and moisture, change over to then and select substratum to carry out screening and culturing with aseptic filter paper from being total to culture medium.

D. the screening of callus, differentiation and transplanting

After 4 days rataria of pre-cultivation and Agrobacterium are cultivated altogether, cutting plumule and changing over to selects substratum N6D2S1 to select to cultivate, the callus morsel that 2 week backs go out from rataria scultellum director forwards N6D2S2 to and selects substratum to continue 2 generations of screening (2 week/generation), and the eugonic resistant calli in 6 week backs is transferred to regeneration culture medium MSRCH and gone up and break up (12 hours illumination/skies); Regenerated seedling strong plantlets and rootage on 1/2MSENH moves into the cultivation of solarium or phytotron basin soil subsequently.

Reagent:

The a large amount of salts of each basic medium (20x): g/L

	AA	MS	N 6
				KH 2PO 4	3.4	3.4	8
KNO 3	--	38	56.6
				(NH4) 2SO 4	--	--	9.26
NH 4NO 3	--	33	--
				MgSO 4·7H 2O	7.4	7.4	3.7
*CaCl 2·2H 2O	8.8	8.8	3.32
				KCl	58.8	--	--

^*Add behind the independent dissolution.

Each basic medium trace salt (100x): mg/L

	AA	MS	N 6
				MnSO 4·H 2O	1690	1690	250
ZnSO 4·7H 2O	860	860	180
				H 3BO 3	620	620	160
CuSO 4·5H 2O	2.5	2.5	--
				Na 2MoO 4·2H 2O	25	25	--
CoCl 2·6H 2O	2.5	2.5	--
				KI	83	83	83

1.N6D2 substratum

1) a large amount of salts of 1X;

2) 1X trace salt

3) molysite: FeSO ₄7H ₂O27.8mg/L; Na ₂-EDTA 37.3mg/L;

4) VITAMIN: glycine 2mg/L; VITMAIN B1 (VB ₁) 1mg/L; Vitamin B6 (VB6) 0.5mg/L; Nicotinic acid 0.5mg/L; Inositol 100mg/L

5) 0.5g/L casein hydrolysate (LH), 30g/L sucrose, 2mg/L 2,4-D, 2.5g/L plant gel (phytagel, Sigma company), pH5.8.

2.AB liquid nutrient medium

K ₂HPO ₄3g/L; Na ₂H ₂PO ₄1g/L; NH ₄Cl 1g/L; MgSO ₄7H ₂O 300mg/L; KCl150mg/L; CaCl ₂10mg/L; FeSO ₄7H ₂O 2.5mg/L; Glucose 5g/L, pH7.0.

3.AAM liquid nutrient medium

1) a large amount of salinities of 1X AA; 1X AA trace salinity;

2) amino acid: L-Gln 880mg/L; L-Asp 270mg/L; L-Arg 230mg/L; L-Gly 80mg/L

3) VITAMIN: glycine 2mg/L; VITMAIN B1 (VB ₁) 1mg/L; Vitamin B6 (VB6) 0.5mg/L; Nicotinic acid 0.5mg/L; Inositol 100mg/L

4) 0.5g/L casein hydrolysate (LH), 36g/L glucose, 68.5g/L sucrose, PH5.2

4.N6D2C

N6D2, glucose 10g/L, Syringylethanone 20mg/L (56 ℃ of addings).

5.N6D2S1

N6D2,25mg/L Totomycin (HYGROMYCIN), 300mg/L cephamycin.

6.N6D2S2

N6D2,50mg/L Totomycin (HYGROMYCIN), 300mg/L cephamycin.

7.MSRCH

1) a large amount of salinities of 1X MS, 1X MS trace salinity,

2) molysite: FeSO ₄7H ₂O 27.8mg/L; Na ₂-EDTA 37.3mg/L;

3) VITAMIN: glycine 2mg/L; VITMAIN B1 (VB ₁) 1mg/L; Vitamin B6 (VB6) 0.5mg/L; Nicotinic acid 0.5mg/L; Inositol 100mg/L

4) 6-benzylaminopurine (6BA) 2mg/L, naphthyl acid (NAA) 0.2mg/L, zeatin (Zeatin) 05mg/L, kinetin (KT) 0.5mg/L,

5) sucrose 30g/L, 50mg/L Totomycin (HYGROMYCIN), phytagel (Sigma company) 2.5g/L, pH5.8

8.1/2MSENH

1) a large amount of salinities of 1/2X MS; 1/2X MS trace salinity,

2) molysite: FeSO ₄7H ₂O 27.8mg/L; Na ₂-EDTA 37.3mg/L;

3) VITAMIN: glycine 2mg/L; VITMAIN B1 (VB ₁) 1mg/L; Vitamin B6 (VB6) 0.5mg/L; Nicotinic acid 0.5mg/L; Inositol 100mg/L

4) paclobutrazol (MET) 1mg/l; Naphthyl acid (NAA) 0.5mg/l

5) 30g/L sucrose, 50mg/L Totomycin (HYGROMYCIN), 2.0g/LPHYTAGEL (Sigma company), PH5.8

Six. plant tissue extracts RNA

1. earlier rice seedling is pulverized in liquid nitrogen.The powder branch is installed in the centrifuge tube, about every pipe packing 100mg.Every pipe adds 1ml TRIZOL reagent (Invitrigen company), mixing, and room temperature is placed 5min.Add chloroform 200 μ l, use forced oscillation 15sec, incubated at room 2～3min.

2.4 centrifugal under ℃ (12000 * g, 15min), mixture is divided into red phenol-chloroform phase (following phase), the intermediate phase of white and colourless upper strata water.RNA is at the upper strata aqueous phase.

3. shift upper strata water (500 μ l) in a new Eppendorf pipe, add the 1ml dehydrated alcohol, with precipitated rna.

4. more than the incubated at room 10min, centrifugal under 4 ℃ of conditions (12000 * g, 10min), the RNA of visible white precipitation is affixed on the pipe diapire.

5. inhale and abandon supernatant, the washing with alcohol RNA with 70% precipitates once, centrifugal under 4 ℃ of conditions (7500 * g, 5min)

6. inhale and abandon supernatant, seasoning in the air, with DEPC water dissolution precipitation ,-70 ℃ of preservations are standby.Measure RNA concentration and degree of depositing, A with ultraviolet spectrophotometer ₂₆₀/ A ₂₈₀＞1.8.

Seven .RT-PCR

The condition of being advised according to Promega manufacturer experimentizes.

Reagent: reverse transcription test kit Reverse Transcription System (Cat.#A3500) (Promega manufacturer), DNase (no RNase) (Promega manufacturer), DEPC (magnificent Shun's biotechnology company limited)

Eight .5 ' race and 3 ' race experiment

The condition of being advised according to Roche manufacturer experimentizes.

Reagent: RACE Kit (Cat.#3353621) (Roche manufacturer)

Nine .GUS dyeing

Reagent:

GUS dye liquor: 0.5mg/ml X-Gluc (Duchefa company), 50mM KHPO ₄(pH 7), 0.5mMK ₃F _e(CN) ₆, 0.5mM K ₄F _e(CN) ₆, 20% (v/v) methyl alcohol, 0.1% (v/v) Triton-X100 (magnificent Shun's biotechnology company limited).

Step:

1. change in the GUS dye liquor 500mmHg vacuum suction over to.

2.37 ℃ dyeing is spent the night.

Observe behind 3.95% ethanol decolorization.

In addition, Southern hybridization and plant total DNA extraction method (CTAB method) are all according to " molecular cloning experiment guide " (people such as Sambrook, second edition, New York:Cold Spring Harbor LaboratoryPress, 1995) described in method carry out.

(II) specific embodiment

The acquisition of embodiment 1:RG mutant plant

T-DNA label isolated genes is one of most important means of plant function gene studies.T-DNA (transfer DNA) is the section of DNA that is positioned on agrobacterium tumefaciens (Agrobacterium tumefaciens) Ti (tumor inducing) plasmid or Agrobacterium rhizogenes (Agrobacterium rhizogenes) Ri (root inducing) plasmid, it can shift from Agrobacterium and stable being incorporated on the plant chromosome, therefore can be used as a class foreign gene carrier, foreign DNA is transferred to vegetable cell, and bear again can expression alien gene transgenic plant; The expression of inserting locus gene is affected, thereby produce the mutant phenotype that to screen, because the T-DNA sequence is known, in case genetic analysis determines that the label of mutant phenotype and insertion is chain, can obtain the flanking sequence at label two ends by IPCR or TAIL-PCR method, flanking sequence is compared with genome sequence obtains the information of mutator gene then.Because Agrobacterium-mediated Transformation heterologous host monocotyledon rice is very effective, utilizing T-DNA to set up all kinds of mutant libraries is to understand the method for extensive employing of paddy rice whole functional genome at present.Transform in the colony at the T-DNA that the inventor makes up, find the mutant that a rice leaf outwards curls.

Therefore, utilize the T-DNA labeling acts, inventor's separation has obtained the gene that this rice leaf outwards curls.

The morphological observation of embodiment 2:RG mutant plant BY240

Natural torsion all takes place in general blade in process of growth, but the mutant BY240 that the blade that the inventor finds outwards curls because leaf curl-outward causes that blade is straight and upright and do not hang down loosely, makes the plant type of whole plant upright.Spend in the contrast 11 and the blade concrete form of RG mutant plant see Fig. 1, it is flat can be observed and spending 11 blade in the contrast, and the blade of RG mutant plant BY240 is outwards to curl.

In addition, the growthhabit of whole RG mutant plant is seen Fig. 6, visible leaf curl-outward in process of growth, and big multiple-blade all can keep straight and upright state, and is sagging few.

Embodiment 3: Southern hybridization and the chromosome analysis of rolling up mutant (BY240) outward

Carry out the Southern hybridization of outer volume mutant (BY240).Hit with the HindIII enzyme and to spend 11, (pDsBar1300 plasmid construction method is seen Wang J for the total DNA of BY240 blade and pDsBar1300 plasmid, Deng, ActaPhytophydiologica Sinica (in Chinese), 2000,26:501) DNA, with the Ds fragment be after probe and HindIII enzyme are cut in spend 11, the total DNA of BY240 blade and pDsBar1300 plasmid DNA carry out Southern hybridization, there are the hybridization band in BY240 and pDsBar1300 plasmid, in spend 11 amixia bands.The Southern results of hybridization is seen Fig. 2.

By spending the F2 population analysis of No. 11 hybridization in outer volume homozygous mutation body and the former kind, find outer volume sudden change and the T-DNA (containing anti-herbicide gene) that inserts exist be divided into from; The Southern hybridization analysis of outer volume mutant proves that the T-DNA of this mutant is inserted as single copy and inserts.

Separating T-DNA with Tail-PCR inserts the adjacent sequence in side in site ((wherein the 1-21 position is the T-DNA sequence to the other adjacent sequence SEQ IDNO:3 of left end, 22-615 is the rice genome sequence) and the other adjacent sequence SEQ ID NO:4 of right-hand member (wherein the 1-491 position is the rice genome sequence, the 492-729 position is the rice genome sequence)) show, T-DNA is inserted on paddy rice the 4th karyomit(e), and be positioned at the promoter region of RG gene locus, ATG has 1798bp from initiator codon.On position is seen Fig. 3.

The clone of embodiment 4:RG gene

Utilize the extractive total RNA of paddy rice,, obtain the encoding sequence SEQ ID NO:1 of RG gene with mRNA fragment and the order-checking that the RG gene is isolated in the RT-PCR segmentation.According to the sub-encoding law of paddy rice universal code, the encoding sequence SEQ ID NO:1 that reaches the RG gene derives the proteic sequence of RG, and the proteic sequence of the RG of acquisition is SEQ ID NO:2.

Go into plasmid with RG is gene constructed, obtain to contain the proteic pUN-RGCO recombinant expression vector of expressed RG (Fig. 5) of T-DNA and RG cDNA.Concrete grammar is as follows: insert the Ubi promotor at pCAMBIA1300 (available from CAMBIA company) multiple clone site HindIII and BamH I place, insert the Nos terminator at Sac I and EcoR I place, obtain the pUN carrier.

PUN-RGCO inserts paddy rice RG full length gene cDNA structure to form between pUN carrier multiple clone site BamH I and Kpn I.

In addition, using similar approach, is template with oryza sativa genomic dna directly, obtains the genome sequence shown in the SEQ ID NO:8 by PCR reaction amplification.

Embodiment 5:RG Gene Sequence Analysis

Utilize in the http://www.ncbi.nlm.nih.gov/BLAST/ webpage " Align two sequences (b12seq) " and " Protein-protein BLAST (blastp) " analysis tool that the sequence of RG gene is analyzed.Analytical results is as follows:

The RG genome sequence is shown in SEQ ID NO:2, and promoter region is in the upstream of ATG 1.5K zone to about the 2K, and transcription initiation site is through confirming the position at ATG upstream 174bp, first exon is 147bp altogether, the first introne 1 12bp, the second exon 7 62bp, terminator TGA is apart from ATG351bp.

Embodiment 6: roll up RG gene overexpression in the rice plant outward

1. spend the comparison of 11 (ZH11) and BY240 plant in

With in spend 11 rice plants in contrast, relatively the BY240 mutant plant with in spend the RG expression conditions of 11 plant.

Utilize the RT-PCR technology, compared the RG expression of gene, the RG gene of finding the BY240 mutant with in spend 11 RG gene to compare on expressing, to have the phenomenon that greatly raises.

With the ZH11 rice plant in contrast, RG expression of gene situation in each position of comparison BY240 mutant plant and ZH11 plant.

The results are shown in Figure 4, wherein,

Swimming lane 1:ZH11 climax leaves swimming lane 5:BY240 climax leaves

The ripe leaf sheath of the ripe leaf sheath swimming lane of swimming lane 2:ZH11 6:BY240

Swimming lane 3:ZH11 children fringe swimming lane 7:BY240 children fringe

The ripe stem of the ripe stem swimming lane of swimming lane 4:ZH11 8:BY240

Can clearly observe from Fig. 4, the RG expression of gene is significantly higher than each corresponding position among the ZH11 in BY240 climax leaves, the ripe leaf sheath of BY240, BY240 children fringe, the ripe stem of BY240.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Crops Breeding Cultivating Inst., Shanghai Agriculture Science Academy

＜120〉rice leaf curl-outward gene and application thereof

<130>058806

<160>8

<170>PatentIn version 3.3

<210>1

<211>909

<212>DNA

＜213〉japonica rice (Oryza sativa L.)

<220>

<221>CDS

<222>(173)..(520)

<223>

<400>1

atccccctat aaatacttgc catctcttct ccgtccaacc acaccaccca gcaagaagac 60

cccgagcaat tctacccgct cggagctcct cccctttcat cgtctccaat caccatcatc 120

tgcacgtctc accggcccta cgcaacagca agtgggttac ctctcgatcg gg atg agc 178

Met Ser

1

cgc agc aac aag aag agc tct agg ggc atc gac ctg aag ctg aac ctc 226

Arg Ser Asn Lys Lys Ser Ser Arg Gly Ile Asp Leu Lys Leu Asn Leu

5 10 15

tcg ctg ccg gcg aga ggg gac tcg tcg tcc agg agg gcg atg gcc gcc 274

Ser Leu Pro Ala Arg Gly Asp Ser Ser Ser Arg Arg Ala Met Ala Ala

20 25 30

gac gag gag tcg tcg ccg agc tcg tgc ctg tcg tcg gag aac gag cac 322

Asp Glu Glu Ser Ser Pro Ser Ser Cys Leu Ser Ser Glu Asn Glu His

35 40 45 50

ggc ctg cag tgg tcc aac agc ccg gag gcg acg tcc atg gtg ctc gcc 370

Gly Leu Gln Trp Ser Asn Ser Pro Glu Ala Thr Ser Met Val Leu Ala

55 60 65

gcc tgc cct cgc tgc ttc atc tac gtc atg ctc ccg cag gat gat ccg 418

Ala Cys Pro Arg Cys Phe Ile Tyr Val Met Leu Pro Gln Asp Asp Pro

70 75 80

cgg tgc ccg cag tgc aag agc ccc gtg atc ctt gac ttc ctg cag cag 466

Arg Cys Pro Gln Cys Lys Ser Pro Val Ile Leu Asp Phe Leu Gln Gln

85 90 95

gac aac ggc aac aac aac gcc aac agc aat agc agc agg aag acc agg 514

Asp Asn Gly Asn Asn Asn Ala Asn Ser Asn Ser Ser Arg Lys Thr Arg

100 105 110

aga ggg tgaagttaaa caaaaggggg ggcaattctc cgtttggcag aagatcaaca 570

Arg Gly

115

tcaatcaaga aaaagaaaag cgtctatatg aagtcctagg tccagtaatt ctcttttgtt 630

ttgcctattc ccccagtgta accatgatat attccttact aaaattgtga gactagcatg 690

aaaatccatg tgctggtggc ataattttga tacatcatgg atacactggg gactatatcc 750

atccccctct cctggcttcc ttctttagtg gttctaaatg aagaagtttt gcttagacat 810

aggaccagac ttctcatctt tgttttgttt ttgtttcctt tccgagatga aaagaaaaca 870

tttaccctga aaatgttgag atgattattg ttctgaatc 909

<210>2

<211>116

<212>PRT

＜213〉japonica rice (0ryza sativa L.)

<400>2

Met Ser Arg Ser Asn Lys Lys Ser Ser Arg Gly Ile Asp Leu Lys Leu

1 5 10 15

Asn Leu Ser Leu Pro Ala Arg Gly Asp Ser Ser Ser Arg Arg Ala Met

20 25 30

Ala Ala Asp Glu Glu Ser Ser Pro Ser Ser Cys Leu Ser Ser Glu Asn

35 40 45

Glu His Gly Leu Gln Trp Ser Asn Ser Pro Glu Ala Thr Ser Met Val

50 55 60

Leu Ala Ala Cys Pro Arg Cys Phe Ile Tyr Val Met Leu Pro Gln Asp

65 70 75 80

Asp Pro Arg Cys Pro Gln Cys Lys Ser Pro Val Ile Leu Asp Phe Leu

85 90 95

Gln Gln Asp Asn Gly Asn Asn Asn Ala Asn Ser Asn Ser Ser Arg Lys

100 105 110

Thr Arg Arg Gly

115

<210>3

<211>615

<212>DNA

＜213〉japonica rice (Oryza sativa L.)

<400>3

cagaaccaca atatatcctg tgctcataac tgtgccacta ggttattgct tagtacagga 60

tatggtatat aaatgtatct ttgcacgtat atattgccat tagtcggtgt atgggggcca 120

aacccatgtg ctcttcttta attccatggt ggcatctaag gagcttaatt agagattatg 180

agtgaaaaat aatctccact gagttttctc gcgccttctt gttgtggttg caaaggcaat 240

gagctccaat gcaaaatagt tggatatatt gcgatttcgc ataaggtacc aagttattgg 300

caaaattcac aatttaatta ctttttaaac tccagctgct gttctagtgg actctcttgt 360

tgcttgtctt attttgaggt atgtattgat gaatactatg atagctcttt tggaacgcat 420

gaattttata ggaatttcgt gggagttagt tgaattcagt gaacgtcctg aaggaggccc 480

tgatatttgt gctactgata taatatttgt ggtgctgatg accagatgat gcttatatgc 540

ccactcgctt agtgaagact tgcgaggtgt cgcgctttag atgtttggaa ttggatagag 600

gtggatggaa gtatg 615

<210>4

<211>729

<212>DNA

＜213〉japonica rice (Oryza sativa L.)

<400>4

cgagatgctt actatcccac cttgattaat gatgatgaca tacaactcac ttaaagttgt 60

tttggtttgt gtgttgcatt gggtttggtc aatgctgcta ctcatcaagg ttaagagata 120

gccacctgta gagaaaataa tttgcctcag ttaggactaa ttctagcatt aatgctcccg 180

ttttgggcaa atagaagcag taatggatgg ttttgggatc cagagccaac gctatcggcc 240

tcgggatcaa aggtttgagt tcagtttacc tgattttata atatttcacc accattcatc 300

atgattcatc gatgatgcgt ctaaaattgc aggtaaagtc tcggagttga aggcaactat 360

gaaggcaagg ttgacccaac taggaaccgg tatttttgtt cggtaaaatc acacatgaaa 420

acatatattc aaaacttaaa aacaaatata aaaaattgta aacacaagtc ttaattaaac 480

atagataaaa tccatataaa tctggagcac acatagttta atgtagcaca taagtgataa 540

gtcttgggct cttggctaac ataagaagcc atataagtct actagcacac atgacacaat 600

ataaagttta aaacacatat tcataatcac ttgctcacat ctggatcact tagcatgcat 660

aaactaatta caaccaaggc tcatctgtca acaaacataa gaccattgct catggagagg 720

agccactgg 729

<210>5

<211>24

<212>DNA

＜213〉primer

<400>5

caaaatccag tactaaaatc caga 24

<210>6

<211>21

<212>DNA

＜213〉primer

<400>6

attcggcgtt aattcagtac a 21

<210>7

<211>21

<212>DNA

＜213〉primer

<400>7

gtgttattaa gttgtctaag c 21

<210>8

<211>1021

<212>DNA

＜213〉japonica rice (Oryza sativa L.)

<400>8

atccccctat aaatacttgc catctcttct ccgtccaacc acaccaccca gcaagaagac 60

cccgagcaat tctacccgct cggagctcct cccctttcat cgtctccaat caccatcatc 120

tgcacgtctc accggcccta cgcaacagta agttccttcg ccatcgccat gtcttctcct 180

acctctaagc ttcatatgac agtcgtgcaa aagtttccat ttgaccaacc ggctaacgaa 240

cgtttttatg ggggtgtagg caagtgggtt acctctcgat cgggatgagc cgcagcaaca 300

agaagagctc taggggcatc gacctgaagc tgaacctctc gctgccggcg agaggggact 360

cgtcgtccag gagggcgatg gccgccgacg aggagtcgtc gccgagctcg tgcctgtcgt 420

cggagaacga gcacggcctg cagtggtcca acagcccgga ggcgacgtcc atggtgctcg 480

ccgcctgccc tcgctgcttc atctacgtca tgctcccgca ggatgatccg cggtgcccgc 540

agtgcaagag ccccgtgatc cttgacttcc tgcagcagga caacggcaac aacaacgcca 600

acagcaatag cagcaggaag accaggagag ggtgaagtta aacaaaaggg ggggcaattc 660

tccgtttggc agaagatcaa catcaatcaa gaaaaagaaa agcgtctata tgaagtccta 720

ggtccagtaa ttctcttttg ttttgcctat tcccccagtg taaccatgat atattcctta 780

ctaaaattgt gagactagca tgaaaatcca tgtgctggtg gcataatttt gatacatcat 840

ggatacactg gggactatat ccatccccct ctcctggctt ccttctttag tggttctaaa 900

tgaagaagtt ttgcttagac ataggaccag acttctcatc tttgttttgt ttttgtttcc 960

tttccgagat gaaaagaaaa catttaccct gaaaatgttg agatgattat tgttctgaat 1020

c 1021

Claims (5)

1.. the purposes of a dna molecular, the albumen of described dna molecule encode sequence shown in SEQ ID NO:2 is characterized in that described dna molecular is used to prepare the paddy rice that promotes leaf curl-outward.

2. dna molecular as claimed in claim 1 is characterized in that, the polynucleotide of this dna molecular are selected from down group:

(1) nucleotide sequence shown in the 1-909 position among the SEQ ID NO:1;

(2) nucleotide sequence shown in the 173-520 position among the SEQ ID NO:1; Or

(3) nucleotide sequence shown in the 1-1021 position among the SEQ ID NO:8.

3. a method that makes rice leaf that outer volume take place is characterized in that, this method comprises increases RG expression of gene in the described paddy rice; The albumen of described RG genes encoding shown in SEQ ID NO:2.

4. method as claimed in claim 3 is characterized in that, thereby by inserting the T-DNA sequence or strengthening this RG expression of gene with the strong promoter driving.

5. method that improves paddy rice is characterized in that it comprises step:

(a) provide the Agrobacterium of carrying expression vector, described expression vector contains the proteic dna encoding sequence of RG; Described RG albumen is the polypeptide as SEQ ID NO:2 aminoacid sequence;

(b) rice cell or tissue or organ are contacted with Agrobacterium in the step (a), thereby make this RG protein D NA encoding sequence change rice cell over to, and be incorporated on the karyomit(e) of rice cell;

(c) select rice cell or the tissue that changes described RG protein D NA encoding sequence over to;

(d) vegetable cell or tissue regeneration in the step (c) are become rice plant.

Images