CN100516213C - Process for fast separating, screening microsatellite mark of sea shell kind - Google Patents

Abstract

The invention relates to a method used to quickly separate and screen seashell micro satellite sign. It includes the following steps: extracting seashell genome DNA; preserving in refrigerator at 4 centigrade degree; utilizing the extracted DNA to gain seashell genome DNA segment by existing AFLP method or restriction enzyme method and building enrichment library; crossing escherichia coli colony home position and confirming positive cloning; sequencing and design primer amplification genome DNA. The method has good reliability and repeatability. And its positive cloning efficiency can reach 100%. Once screening can gain hundreds sites. And a lot of effective technique method of micro satellite signs can be gained in one week.

Description

The method of sharp separation, screening microsatellite mark of sea shell kind

Technical field:

The invention belongs to shellfish dna molecular genetic marker technology, be specifically related to the technological method of a kind of sharp separation, screening microsatellite mark of sea shell kind.

Background technology:

The molecular marking technique of develop rapidly in recent years, especially based on the widespread use of the molecule marker of PCR, for the hereditary feature and the Genetic Constitution of Population equimolecular genetics research of individuality provides strong instrument, wherein representative Mk system---microsatellite marker is more and more favored.Little satellite (Microsatellite) also claims that (Simple Sequence Repeats SSRs), is meant that with a few Nucleotide (majority is 1～6) be the unit multiple dna sequence dna of repeatedly connecting to simple tandem repetitive sequence.Because microsatellite DNA extensively is present in the genome, and have polymorphism, stability is high, specificity is high, codominant inheritance, detection are quick, primer sequence is published, be easy to advantage such as shared between each laboratory, therefore be widely used for fields such as the location of structure, gene of diagnosis, the genetic linkage map of genetic diseases and clone, parental right analysis, population genetic diversity research, Idioplasm identification, evolutionary biology research.

The application of microsatellite marker generally need be through following four steps: 1) obtain microsatellite sequence, 2) design and optimization of micro-satellite primers, 3) the pcr amplification target DNA, 4) with suitable means detection amplified production.Wherein the first step is a rate-limiting step, simultaneously also is the most complicated, the step of time and effort consuming the most.Since 20th century, the mid-80 microsatellite marker began to be subjected to extensive concern, people adopted the small-sized DNA of traditional structure library mostly, utilize the method for SSR probe screening positive clone.But this method efficient is comparatively low, is not rich species very at little satellite content especially, this phenomenon performance particularly evident.Statistics shows that the positive colony rate of utilizing above-mentioned screening mode to obtain only is 0.1～6.4%, average 1.96% in shellfish.Therefore, traditional screening mode has caused man power and material's significant wastage.In recent years, development along with computer and information network, the screening microsatellite DNA becomes the mode of cheap and simple from the common data base reported sequence, but most of species, especially the research ocean and the aquatic living things of starting late, the sequence information in common data base are not enough to satisfy the needs of screening or at all without any sequence information.

Different screening modes with and efficient become the focus that scholars pay close attention to and study, different scholars different screening method also on probation and strategy are to improve screening efficiency, methods such as comprising screening by hybridization method (Hybridization Selection), FIASCO (Fast Isolation by AFLP of SequencesContaining Repeats) method and the little satellite probe of RAPD-Southern hybrid method has also been reported in different scholar and laboratories in succession both at home and abroad, but all exist the common shortcoming in shellfish is used: the positive colony rate is lower, and efficient is comparatively low.When using, the multiple shellfish of method of enriched library of the present invention-bacterium colony in situ hybridization sharp separation, screening microsatellite mark of sea shell kind finds, stability and repeatability are fabulous, and the positive colony rate can reach 100%, and once screening can obtain up to a hundred even a hundreds of site.

Summary of the invention:

The method that the purpose of this invention is to provide a kind of quick sharp separation, screening microsatellite mark of sea shell kind is to remedy the deficiency of prior art.

The present invention finishes according to following steps: 1) extract the genomic dna of shellfish, 4 ℃ of refrigerators are preserved standby; 2) utilize the DNA of said extracted, obtain shellfish genomic dna segment, and make up enriched library with existing AFLP method or restriction enzyme enzyme method; 3) containing in the enriched library inserted the in situ hybridization of pulsating intestinal bacteria bacterium colony, positive colony is determined in radioautograph then; 4) positive colony checks order and designs the primer amplification genomic dna according to little satellite flanking sequence.

Present method reliability and repeatability are fabulous, and the positive colony rate can reach 100%, and once screening can obtain up to a hundred even a hundreds of site, can obtain the effective technical of a large amount of microsatellite markers within a week.

Description of drawings:

The flow process and the principle schematic of the technological method of Fig. 1 enriched library-bacterium colony in situ hybridization sharp separation, screening microsatellite mark of sea shell kind.

The in situ hybridization of Fig. 2 bacterium colony is diagrammatic sketch as a result.The marking that stays of the positive clone's radioautograph of black splotch wherein.

Embodiment:

1, extract the genomic dna of shellfish, method is as follows:

Get about 0.1 gram of closed shell flesh after the vivisection of shellfish sample, add 500 μ l STE lysis buffer (NaCl:100mM; EDTA:1mM, PH=8.0; Tris-HCl, 10mM PH=8.0), shreds, and adds 50 μ l SDS (10%) again, and the Proteinase K of 5 μ l (20mg/ml), and 56 ℃ of processing are clarified up to lysate.Add the saturated phenol of equal-volume (250 μ l), chloroform/primary isoamyl alcohol (24: 1) (250 μ l), extracting 3 times.Get supernatant liquor, add equal-volume chloroform/primary isoamyl alcohol (500 μ l) extracting 1 time.Get supernatant liquor, add 50 μ l NaAc (3M), slowly shake up, fill it up with the ice dehydrated alcohol, 12000 leave heart 10min.Nucleic acid is deposited in the pipe end.70% ethanol (1000 μ l) washing precipitation and drying are all volatilized up to ethanol.Add sterilized water and a small amount of RNase A of 100 μ l, 4 ℃ of refrigerators are preserved.

2, the structure of enriched library, method is as follows:

1) shellfish genomic dna segment obtains.When making up enriched library, the pulsating acquisition of shellfish genomic dna can be adopted following two kinds of methods respectively:

1. the pulsating acquisition of AFLP: aflp analysis is with reference to the method for (1995) such as Vos.Primer and joint are synthetic by Shanghai Sangon.Each the complete double digestion 300ng of unit genomic dna of EcoR I and Mse I, the T4 ligase enzyme connects joint with endonuclease bamhi.PCR reaction cumulative volume is 50 μ l, includes 5 μ l and connects product, the primer of 0.2mmol/L (E00, sequence is: 5 '-GACTGCGTACCAATTC-3 '; The M00 sequence is: 5 '-GATGAGTCCTGAGTAA-3 '), and the dNTPs of 200mmol/L, the Mg of 200mmol/L ²⁺, 1 * PCR reaction buffer, the Taq archaeal dna polymerase of 2.5U.The PCR reaction is 25 circulations, and each circulation comprises: 95 ℃ of sex change 30s, and 56 ℃ of annealing 30s, 72 ℃ are extended 1min; 72 ℃ are extended 5min again after the last loop ends.After PCR finished, 10 PCR reaction product mixed ethanols precipitations added the 20uL tri-distilled water, and 95 ℃ of sex change 5 minutes are stand-by.

Also available following mode obtains shellfish genomic dna segment, (with HaeIII is example in the i.e. 2. pulsating acquisition of restriction enzyme digestion, can select other four bases flush end restriction enzyme according to genome characteristics), concrete grammar is: get the total DNA of about 300ng chlamys farreri, the restriction enzyme HaeIII enzyme with 2 units in 20 μ l systems was cut 3 hours.Enzyme is cut back T4 ligase enzyme and is connected joint, ligation is 30 μ l, wherein contain enzyme and cut product 20 μ l, (joint consists of joint: 50ng 21-mer:5 '-CTCTTGCTTGAATTCGGACTA-3 ' and 25-mer:5 '-pTAGTCCGAATTCAAGCAAGAGCACA-3 '), 1 * T4 connects damping fluid, T4 ligase enzyme 2U is reflected at 16 ℃ and reacted 12 hours down.The DNA that is connected with joint obtains a plurality of copies through pcr amplification, and PCR reaction cumulative volume is 25 μ l, wherein contains the connection product 6 μ l of dna segment, the 21-mer primer of 1 μ M, the Mg of 200mmol/L ²⁺, 1 * PCR reaction buffer, the Taq archaeal dna polymerase of 1U.The PCR reaction is 25 circulations, and each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 45s, 72 ℃ are extended 1min; The preceding pre-sex change 3min of circulation first; 72 ℃ are extended 5min again after the last loop ends.After PCR finished, 10 reaction system mixed ethanols precipitations added 20 μ l tri-distilled waters, and 95 degree sex change 5 minutes are stand-by.

2) enrichment of genomic fragment.1. the preparation of Hybond membrane: get probe that concentration is 100 μ M [with (GA)

(CA)

Being example] each 0.5 μ l point is about the Hybond N of 5mm at diameter ⁺On the Hybond membrane, dry 2 hours stationary probes of back 80 ℃ of bakings in the air.The Hybond N of probe will be fixed ⁺Film is placed in the hybridization solution [sodium phosphate (pH=7.0) of SDS, the 5 * SSC of the methane amide of 50% (V/V), 7% (W/V), 50mM] 37 ℃ of prehybridizations 72 hours.Then film is boiled in 1% SDS and bathe 10min, remove the probe that is not combined.2. hybridization: the genomic dna segment that sex change is good joins in the hybridization solution of 600 μ l, adds the good Hybond N of prehybridization ⁺Film was hybridized 1-2 days for 37 ℃.3. wash-out: wash film and adopt following rigorous degree: with 2 * SSC of 600 μ l, 1%SDS (W/V) elutriant wash-out 2 times under 60 ℃ of following water-baths, each 15 minutes; With 2 * SSC of 600uL, 1%SDS (W/V) elutriant was 62 ℃ of following water-baths 30 minutes; With 0.5 * SSC of 500 μ l, 1%SDS (W/V) elutriant is in 65 ℃ of following water-baths wash-out hybridization in 30 minutes segment.The 7.5M NH of 100 μ l will be added in the elutriant of 500 μ l ₄The Virahol of Ac and 600 μ l ,-20 ℃ freezing (perhaps spent the night) more than 2 hours, and 4 ℃ 12,000 left the heart 20 minutes, and precipitation is washed 2 times with 75% ethanol of-20 ℃ of precoolings, was dissolved in the tri-distilled water of 20 μ l.

3) clone of enriched product: get wash-out segment solution 2 μ l as the template of recovering PCR (Recovery PCR), reaction is 20 circulations, and last 72 ℃ were extended 30 minutes, and other PCR reacted constituent and condition are with 3.1) 1. with 3.1) 2..Reaction finishes the back ethanol sedimentation, the tri-distilled water dissolving.The pMD18-T support agent box that adopts Takara company falls in the pulsating gram of enrichment DNA, and ligation is with reference to the explanation of the pMD18-T of Takara company support agent box.The product that connects is converted in the escherichia coli DH5a bacterial strain, is applied on the solid LB flat board that contains X-gal.

3, the method for bacterium colony in situ hybridization screening positive clone is:

1) bacterium colony is reset and changeed film: the hickie after will transforming is provoked again, and orderly rearrangement is seeded on the new solid LB substratum, and 37 ℃ are cultured to suitable size.Cultivated bacterium colony and gone on the NC film that (Immobilon-NC TransferMembranes, Millipore), film was air drying 10 minutes then.The NC film is put into the middle sex change of sex change damping fluid (0.5M NaOH, 1.5M NaCl) 7 minutes, dry air 10 minutes then.Neutralization buffer (0.5M Tris-HCl, pH 7.2; 1.5M NaCl; 1mM EDTA,, pH 8.0) in and 2 times, each 5 minutes.With in put into fixedly plasmid of 80 ℃ of bakings 2 hours after the NC film dry air of becoming reconciled.

2) mark of probe: the mark of probe adopts Gene Images 3 '-OligolabellingModule test kit of Amersham company.Labeled reactant contains the probe 1 μ l of 100 μ M, Fluorescein-11-dUTP 5 μ l, 1 * damping fluid (Cacodylate Buffer), the terminal enzyme (DNA) of 32U (Terminal Transferase) 37 ℃ of following marks 70 minutes in the 80uL reaction system.It is standby that the probe that mark is good is put into-20 ℃ of refrigerators.

3) hybridization: crossing system adopts the Gene Images ECL Detection Kit test kit of Amersham company.Baked NC film is put into hybridization solution [5 * SSC, 0.1% (W/V) SDS dilutes 20 times liquid blockade (Liquid Block, test kit provides), 0.5% (W/V) molecular weight is 500000 poly T 500 (Dextran Sulphate, MW 500000)] in prehybridization 1 hour.Then hybridization solution is removed, added the hybridization solution and the good probe of mark of capacity, the amount that makes hybridization solution is 0.125-0.25mL/cm ², the concentration of probe is 5-10ng/mL, 37 degree vibration hybridization are spent the night.

4) wash-out: the NC film that hybridization is spent the night is placed on 5 * SSC, and room temperature vibration wash-out is 2 times in the elutriant of 0.5%SDS, each 5 minutes.Containing 1 * SSC then, 37 ℃ of vibration wash-outs 15 minutes contain 1 * SSC in the elutriant of 0.5%SDS, and 42 ℃ of vibration wash-outs are 15 minutes in the elutriant of 0.5%SDS.

5) antibody-antigen-reactive is in radioautograph: film is put into the liquid that contains 20 times of dilutions and blockaded at least 30 minutes in blockading, then film is put in the antibody liquid and reacted 30 minutes, antibody liquid contains the antibody (test kit provides) of 1000 times of dilutions, 0.5% (W/V) calf serum, 0.4M NaCl, 0.1M Tirs-HCl (pH=7.5).After handling the NC film, press the X-film in the darkroom, sensitization 1h carries out developing and fixing.

6) order-checking of the definite and positive colony of positive colony: according to original orientation of determining, X-film, nitrocellulose filter, dull and stereotyped three are contrasted, on identical position, choose positive colony, shake bacterium and send commercial company to check order with the M13 primer.

4, on the basis of order-checking, utilize the conservative property design Auele Specific Primer of the sequence of microsatellite DNA both sides, little satellite segment in this site that is used to increase.Design of primers adopts software Primer Premier 5.0 and Oligo 6.44, and design of primers adopts following rigorous degree: (1) primer length is 19-25mer; (2) GC content 40%-60%; (3) annealing temperature 45-65 degree; (4) expection PCR product length is 100-250bp.

Be that example is described in detail the present invention by embodiment below with the chlamys farreri:

1, the extraction of DNA

Get about 0.1 gram of chlamys farreri closed shell flesh, add 500 μ lSTE lysis buffer (NaCl:100mM; EDTA:1mM, PH=8.0; Tris-Cl, 10mM PH=8.0), shreds, and adds the SDS (10%) of 50 μ l 10% again, and the Proteinase K of 5 μ l 20mg/ml, and 56 degree are handled, and clarify up to lysate.Add the saturated phenol of equal-volume (250 μ l), chloroform/primary isoamyl alcohol (24: 1) (250 μ l), extracting 3 times.Get supernatant liquor, add equal-volume chloroform/primary isoamyl alcohol (500 μ l) extracting 1 time.Get supernatant liquor, add 50 μ l NaAc (3M), slowly shake up, fill it up with the ice dehydrated alcohol, 12000 left the heart 10 minutes.Nucleic acid is deposited in the pipe end.70% ethanol (1000 μ l) washing precipitation and drying are all volatilized up to ethanol.Add sterilized water and a small amount of RNase A of 100 μ l, 4 degree all dissolve up to DNA, and ultraviolet spectrophotometer is quantitatively standby.

2. the structure of enriched library

For the structure of enriched library, the present invention narrates 2 kinds of diverse ways: AFLP segment enriched library and Hae III restriction enzyme digestion segment enriched library.

(1) the pulsating acquisition of AFLP

Aflp analysis is with reference to the method for (1995) such as Vos.Primer and joint are synthetic by Shanghai Sangon.Each the complete double digestion 300ng of unit genomic dna of EcoR I and Mse I, the T4 ligase enzyme connects joint with endonuclease bamhi.PCR reaction cumulative volume is 50 μ l, includes 5 μ l and connects product, the primer of 0.2mmol/L (E00 and M00), the dNTPs of 200mmol/L, the Mg of 200mmol/L ²⁺, 1 * PCR reaction buffer, the Taq archaeal dna polymerase of 2.5U.The PCR reaction is 25 circulations, and each circulation comprises: 95 ℃ of sex change 30s, and 56 ℃ of annealing 30s, 72 ℃ are extended 1min; 72 ℃ are extended 5min again after the last loop ends.PCR finishes back 10 reaction system mixed ethanols precipitation, adds 20 μ l tri-distilled waters, and 95 ℃ of sex change 5 minutes are stand-by.

(2) the pulsating acquisition of restriction enzyme digestion

Get the total DNA of about 300ng chlamys farreri, the restriction enzyme HaeIII enzyme with 2 units in 20 μ l systems was cut 3 hours.Enzyme is cut back T4 ligase enzyme and is connected joint, ligation is 30 μ l, wherein contain enzyme and cut product 20 μ l, (joint consists of joint: 50ng the 25-mer:5 '-pTAGTCCGAATTCAAGCAAGAGCACA-3 ' of 21-mer:5 '-CTCTTGCTTGAATTCGGACTA-3 ' and 5 ' phosphorylation), 1 * T4 connects damping fluid, T4 ligase enzyme 2U is reflected at 16 ℃ and reacted 12 hours down.The DNA that is connected with joint obtains a plurality of copies through pcr amplification, and PCR reaction cumulative volume is 25 μ l, wherein contains the connection product 6 μ l of dna segment, the 21-mer primer of 1 μ M, the Mg of 200mmol/L ²⁺, 1 * PCR reaction buffer, the Taq archaeal dna polymerase of 1U.The PCR reaction is 25 circulations, and each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 45s, 72 ℃ are extended 1min; The preceding pre-sex change 3min of circulation first; 72 ℃ are extended 5min again after the last loop ends.After PCR finished, 10 reaction system mixed ethanols precipitations added 20 μ l tri-distilled waters, and 95 ℃ of sex change 5 minutes are stand-by.

(3) preparation of Hybond N+ film

Get the probe that concentration is 100 μ M (GA) ₂₀(CA) ₂₀Each 0.5 μ l point is about the Hybond N of 5mm at diameter ⁺On the Hybond membrane, dry 2 hours stationary probes of back 80 ℃ of bakings in the air.

(4) prehybridization

The Hybond N of probe will be fixed ⁺Film is placed in the hybridization solution [sodium phosphate (pH=7.0) of SDS, the 5 * SSC of the methane amide of 50% (V/V), 7% (W/V), 50mM] 37 ℃ of prehybridizations 3 days.Then film is boiled in 1% SDS and bathe 10min, remove the probe that is not combined.

(5) hybridize and wash film

The PCR product that sex change is good is added in the hybridization solution of 600 μ l, adds the good Hybond N+ film of prehybridization, hybridizes 1-2 days for 37 ℃.Wash film and adopt following rigorous degree: 1) with 2 * SSC of 600 μ l, 1%SDS (W/V) elutriant was 60 ℃ of following wash-outs 2 times, each 15 minutes; 2) with 2 * SSC of 600 μ l, 1%SDS (W/V) elutriant was 62 ℃ of following water-baths 30 minutes; 3) with 0.5 * SSC of 500 μ l, 1%SDS (W/V) elutriant is in 65 ℃ of following water-baths wash-out hybridization in 30 minutes segment.The 7.5M NH4Ac of 100 μ l and the Virahol of 600 μ l will be added in the elutriant of 500 μ l,-20 ℃ freezing (perhaps spent the night) more than 2 hours, and 4 ℃ 12,000 left the heart 20 minutes, precipitation is washed 2 times with 75% ethanol of-20 ℃ of precoolings, be dissolved in the tri-distilled water of 20 μ l.

(6) clone's enrichment sheet degree

Get wash-out segment solution 2 μ l as the template of recovering PCR (Recovery PCR), reaction is 20 circulations, and last 72 ℃ were extended 30 minutes.Reaction finishes the back ethanol sedimentation, the tri-distilled water dissolving.The pulsating clone of enrichment DNA adopts the pMD18-T support agent box of Takara company, and ligation is with reference to the explanation of the pMD18-T of Takara company support agent box.The product that connects is converted in the escherichia coli DH5a bacterial strain, is applied on the solid LB flat board that contains X-gal.

3 bacterium colony in situ hybridizations

(1) bacterium colony changes film

Hickie after transforming is provoked again, and orderly rearrangement is seeded on the new solid LB substratum, and 37 ℃ are cultured to suitable size.Cultivated bacterium colony and gone on the NC film that (Immobilon-NC Transfer Membranes, Millipore), film was air drying 10 minutes then.The NC film is put into the middle sex change of sex change damping fluid (0.5M NaOH, 1.5M NaCl) 7 minutes, dry air 10 minutes then.Neutralization buffer (0.5M Tris-HCl, pH 7.2; 1.5M NaCl:1mM EDTA,, pH 8.0) in and 2 times, each 5 minutes.With in put into fixedly plasmid of 80 ℃ of bakings 2 hours after the NC film dry air of becoming reconciled.

(2) mark of probe

The mark of probe adopts Gene Images 3 '-Oligolabelling Module test kit of Amersham company.Labeled reactant contains the probe 1 μ l of 100 μ M, Fluorescein-11-dUTP 5 μ l, 1 * damping fluid (Cacodylate Buffer), the terminal enzyme (DNA) of 32U (Terminal Transferase) 37 ℃ of following marks 70 minutes in the 80 μ l reaction systems.It is standby that the probe that mark is good is put into-20 ℃ of refrigerators.

(3) hybridization

Crossing system adopts the Gene Images ECL Detection Kit test kit of Amersham company.Baked NC film is put into hybridization solution [5 * SSC, 0.1% (W/V) SDS, dilute 20 times liquid (the Liquid Block that blockades, test kit provides), 0.5% (W/V) molecular weight is 500,000 poly T 500 (Dextran Sulphate, MW 500,000)] in prehybridization 1 hour.Then hybridization solution is removed, added the hybridization solution and the good probe of mark of capacity, the amount that makes hybridization solution is 0.125-0.25mL/cm ², the concentration of probe is 5-10ng/mL, 37 degree vibration hybridization are spent the night.

(4) wash film

The NC film that hybridization is spent the night is placed on 5 * SSC, and room temperature vibration wash-out is 2 times in the elutriant of 0.5%SDS, each 5 minutes.Containing 1 * SSC then, 37 ℃ of vibration wash-outs 15 minutes contain 1 * SSC in the elutriant of 0.5%SDS, and 42 ℃ of vibration wash-outs are 15 minutes in the elutriant of 0.5%SDS.

(5) antibody antigen reaction and X-autoradiograph

Film put into contain 20 times liquid of dilution and blockaded at least 30 minutes in blockading, then film is put in the antibody liquid and reacted 30 minutes, antibody liquid contains the antibody (test kit provides) of 1000 times of dilutions, 0.5% (W/V) calf serum, 0.4M NaCl, 0.1M Tirs-HCl (pH=7.5).After handling the NC film, press the X-film in the darkroom, sensitization 1h carries out developing and fixing.

(6) positive colony selects

According to original orientation of determining, X-film, nitrocellulose filter, dull and stereotyped three are contrasted, on identical position, choose positive colony, shake bacterium and extract the plasmid order-checking.

4, positive colony order-checking

Send commercial company to measure sequence after positive colony shaken with liquid LB substratum with the M13 primer

5, design of primers

On the basis of order-checking, utilize the conservative property design Auele Specific Primer of the sequence of microsatellite DNA both sides, little satellite segment in this site that is used to increase.Design of primers adopts software Primer Premier 5.0 and Oligo 6.44, and design of primers adopts following rigorous degree: (1) primer length is 19-25mer; (2) GC content 40%-60%; (3) annealing temperature 45-65 degree; (4) expection PCR product length is 100-250bp.

By aforesaid method, once obtain 324 of the positive colonies of chlamys farreri altogether, sequencing result shows that whole 324 positive colonies all contain little satellite and repeat, wherein 286 clones can design primer.Therefore, fully verify present method energy sharp separation, screening microsatellite mark of sea shell kind, promptly can be implemented in the method fast and effectively that obtains a large amount of microsatellite markers in the short period of time.

Claims (1)

1. the method for sharp separation, screening microsatellite mark of sea shell kind, it is characterized in that operation steps: the 4 ℃ of refrigerators of genomic dna that 1) extract shellfish are preserved standby; 2) structure of enriched library; 3) bacterium colony in situ hybridization; 4) positive colony checks order and designs the primer amplification genomic dna according to little satellite flanking sequence; Wherein

1) genomic dna of extraction shellfish, step is: get closed shell flesh 0.1 gram after the vivisection of shellfish sample, add 500 μ l STE lysis buffers, described damping fluid is NaCl:100mM; EDTA:1mM, pH=8.0; Tris-HCl, 10mM, pH=8.0 shreds, and adds 50 μ l 10%SDS again, and the Proteinase K of the 20mg/ml of 5 μ l, and 56 ℃ of processing are clarified up to lysate; 24: 1 the chloroform/primary isoamyl alcohol that adds the saturated phenol of 250 μ l, 250 μ l, extracting 3 times; Get supernatant liquor, add 500 μ l chloroforms/primary isoamyl alcohol extracting 1 time; Get supernatant liquor, add 50 μ l 3M NaAc, slowly shake up, fill it up with the ice dehydrated alcohol, 12000 leave heart 10min; Nucleic acid is deposited in the pipe end; 1000 μ l, 70% washing with alcohol precipitation and drying are all volatilized up to ethanol; Add sterilized water and a small amount of RNase A of 100 μ l, 4 ℃ of refrigerators are preserved;

2) construction step of enriched library is:

(1) shellfish genomic dna segment obtains or adopts 1.: when making up enriched library, the method that the AFLP segment obtains is: each the complete double digestion 300ng of unit genomic dna of EcoR I and Mse I, and the T4 ligase enzyme connects joint with endonuclease bamhi; PCR reaction cumulative volume is 50 μ l, includes 5 μ l and connects product, and the primer of 0.2mmol/L, i.e. E00, sequence is: GACTGCGTACCAATTC; The M00 sequence is: GATGAGTCCTGAGTAA, the dNTPs of 200mmol/L, the Mg of 200mmol/L ²⁺, 1 * PCR reaction buffer, the Taq archaeal dna polymerase of 2.5U; The PCR reaction is 25 circulations, and each circulation comprises: 95 ℃ of sex change 30s, and 56 ℃ of annealing 30s, 72 ℃ are extended 1min; 72 ℃ are extended 5min again after the last loop ends; After PCR reaction finished, 10 PCR reaction product mixed ethanols precipitations added 20 μ l tri-distilled waters, and 95 ℃ of sex change 5 minutes are stand-by;

Or adopting 2. shellfish genomic dna segment acquisition, the method for the pulsating acquisition of restriction enzyme digestion is: get the total DNA of 300ng chlamys farreri, the restriction enzyme HaeIII enzyme with 2 units in 20 μ l systems was cut 3 hours; Enzyme is cut back T4 ligase enzyme and is connected joint, ligation is 30 μ l, wherein contain enzyme and cut product 20 μ l, joint consists of: the joint 50ng of the 25-mer:5 '-pTAGTCCGAATTCAAGCAAGAGCACA of 21-mer:5 '-CTCTTGCTTGAATTCGGACTA and 5 ' phosphorylation, 1 * T4 connects damping fluid, T4 ligase enzyme 2U is reflected at 16 ℃ and reacted 12 hours down; The DNA that is connected with joint obtains a plurality of copies through pcr amplification, and PCR reaction cumulative volume is 25 μ l, wherein contains the connection product 6 μ l of dna segment, the 21-mer primer of 1mM, the Mg of 200mmol/L ²⁺, 1 * PCR reaction buffer, the Taq archaeal dna polymerase of 1U; The PCR reaction is 25 circulations, and each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 45s, 72 ℃ are extended 1min; The preceding pre-sex change 3min of circulation first; 72 ℃ are extended 5min again after the last loop ends; After PCR finished, 10 reaction system mixed ethanols precipitations added 20 μ l tri-distilled waters, and 95 degree sex change 5 minutes are stand-by; (2) enrichment of genomic fragment: the 1. preparation of Hybond membrane: get the probe that concentration is 100mM (GA) ₂₀(CA) ₂₀Each 0.5 μ l point is the Hybond N of 5mm at diameter ⁺On the Hybond membrane, dry 2 hours stationary probes of back 80 ℃ of bakings in the air; The Hybond N of probe will be fixed ⁺Film is placed in the hybridization solution 37 ℃ of prehybridizations 72 hours, and wherein hybridization solution is the methane amide of 50%V/V, SDS, the 5 * SSC of 7%W/V, the sodium phosphate of 50mM, pH=7.0; Then film is boiled in 1% SDS and bathed 10 minutes, remove the probe that is not combined; 2. hybridization: the genomic dna segment that sex change is good joins in the hybridization solution of 600 μ l, adds the good HybondN of prehybridization ⁺Film was hybridized 1-2 days for 37 ℃; 3. wash-out: wash film and adopt following rigorous degree: with 2 * SSC of 600 μ l, the SDS elutriant of 1%W/V wash-out 2 times under 60 ℃ of following water-baths, each 15 minutes; With 2 * SSC of 600 μ l, the SDS elutriant of 1%W/V was 62 ℃ of following water-baths 30 minutes; With 0.5 * SSC of 500 μ l, the SDS elutriant of 1%W/V is in 65 ℃ of following water-baths wash-out hybridization in 30 minutes segment; The 7.5M NH of 100 μ l will be added again in the elutriant of 500 μ l ₄The Virahol of Ac and 600 μ l ,-20 ℃ are freezing more than 2 hours, and 4 ℃ 12,000 left the heart 20 minutes, and precipitation is washed 2 times with 75% ethanol of-20 ℃ of precoolings, was dissolved in the tri-distilled water of 20 μ l;

(3) clone of enriched product: get wash-out segment solution 2 μ l as the template of recovering PCR, reaction is 20 circulations, and last 72 ℃ were extended 30 minutes; The PCR reaction finishes the back ethanol sedimentation, the tri-distilled water dissolving, and the pulsating clone of enrichment DNA adopts the pMD18-T support agent box of Takara company, and the product that connects is converted in the escherichia coli DH5a bacterial strain, is applied on the solid LB flat board that contains X-gal;

3) step of bacterium colony in situ hybridization screening positive clone is as follows:

(1) bacterium colony is reset and changeed film: the hickie after will transforming is provoked again, and orderly rearrangement is seeded on the new solid LB substratum, 37 ℃ of cultivations; Cultivated bacterium colony and gone on the nitrocellulose filter, film was air drying 10 minutes then; Nitrocellulose filter is put into 0.5M NaOH then, and sex change is 7 minutes in the 1.5M NaCl sex change damping fluid, dry air 10 minutes; 0.5M Tris-HCl, pH 7.2,1.5M NaCl, and 1mM EDTA,

In the neutralization buffer of pH 8.0 and 2 times, each 5 minutes; With in to put into 80 ℃ of bakings 2 hours after the nitrocellulose filter dry air of becoming reconciled fixing;

(2) mark of probe: the mark of probe adopts Gene the Images3 '-Oligolabelling Module test kit of Amersham company; Labeled reactant contains the probe 1 μ l of 100 μ M, Fluorescein-11-dUTP 5 μ l, 1 * damping fluid, the terminal enzyme (DNA) of 32U 37 ℃ of following marks 70 minutes in the 80 μ l reaction systems; It is standby that the probe that mark is good is put into-20 ℃ of refrigerators;

(3) hybridization: crossing system adopts the Gene Images ECL Detection Ki t test kit of Amersham company; Baked nitrocellulose filter was put into the hybridization solution prehybridization 1 hour, and this hybridization solution is 5 * SSC, and the SDS of 0.1%W/V dilutes 20 times the liquid of blockading, and the molecular weight of 0.5%W/V is 500000 poly T 500; Then hybridization solution is removed, added the hybridization solution and the good probe of mark of capacity, the amount that makes hybridization solution is 0.125-0.25mL/cm ², the concentration of probe is 5-10ng/mL, 37 degree vibration hybridization are spent the night;

(4) wash-out: the nitrocellulose filter that hybridization is spent the night is placed on 5 * SSC, and room temperature vibration wash-out is 2 times in the elutriant of 0.5%SDS, each 5 minutes; Containing 1 * SSC then, 37 ℃ of vibration wash-outs 15 minutes contain 1 * SSC in the elutriant of 0.5%SDS, and 42 ℃ of vibration wash-outs are 15 minutes in the elutriant of 0.5%SDS;

(5) antibody-antigen-reactive is in radioautograph: film is put into the liquid that contains 20 times of dilutions and blockaded at least 30 minutes in blockading, then film is put into and reacted after 30 minutes in the antibody liquid, antibody liquid contains the antibody of 1000 times of dilutions, the calf serum of 0.5%W/V, 0.4M NaCl, 0.1M, pH=7.5Tirs-HCl, handle the NC film after, press X-ray film in the darkroom, developing and fixing was carried out in sensitization in 1 hour;

(6) order-checking of the definite and positive colony of positive colony: according to original orientation of determining, X-film, nitrocellulose filter, dull and stereotyped three are contrasted, on identical position, choose positive colony, with the order-checking of M13 primer;

4) according to little satellite flanking sequence design primer amplification genomic dna: on the basis of order-checking, utilize the conservative property design Auele Specific Primer of the sequence of microsatellite DNA both sides, little satellite segment in this site that is used to increase; Design of primers adopts software Primer Premier 5.0 and Oligo 6.44, and design of primers is with following rigorous degree: (1) primer length is 19-25mer; (2) GC content 40%-60%;

(3) annealing temperature 45-65 degree; (4) expection PCR product length is 100-250bp.

Images