CN100494376C - Recombinant human esoderma colyone adenovirus, and its preparing method and use - Google Patents
Recombinant human esoderma colyone adenovirus, and its preparing method and use Download PDFInfo
- Publication number
- CN100494376C CN100494376C CNB2005100217207A CN200510021720A CN100494376C CN 100494376 C CN100494376 C CN 100494376C CN B2005100217207 A CNB2005100217207 A CN B2005100217207A CN 200510021720 A CN200510021720 A CN 200510021720A CN 100494376 C CN100494376 C CN 100494376C
- Authority
- CN
- China
- Prior art keywords
- recombinant human
- adenovirus
- gene
- human endostatin
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active - Reinstated
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention supplies a new recombination endostatin gene that connects the 3' end of IL-2 gene signal peptide sequence with the 5' end of endostatin coding sequence, and the gene could be constructed into adenovirus and make anti-tumor injection. The injection would restrain the growth and transferring of tumor in body and keep entire bioactivity. It has the advantages of lowering medicine cost, improving life quality of patients and good market prospect.
Description
Technical field
The present invention relates to the genetically engineered field, particularly relate to a kind of adenovirus that contains the recombinant human endostatin gene and its production and use.
Background technology
1971, Folkman has proposed growth of tumor first and transfer has the dependent viewpoint of blood vessel.The research of nearly decades has constantly confirmed this viewpoint, and the generation of tumour, development and transfer and tumor-blood-vessel growth are closely related, and vasculogenesis is important control point (Skobe et al., 1997 of tumor growth and transfer; Dameron et al., 1994; Volpert et al., 1997; Bertolini et al., 2000; Holmgren et al., 1995).A new research direction of angiogenesis inhibitor treatment having become the oncotherapy of tumour.
Endostatin (endostatin) is the most famous endogenetic angiogenesis inhibitor that people such as O ' Reilly found in 1997, it is the C-terminal fragment (endostatin protein that derives from the people comprises 183 amino acid, and molecular weight is approximately 20kDa) of collagen XVIII.Studies show that endostatin protein can suppress the growth and the transfer of kinds of tumors model in vivo in the external growth and the migration that can suppress endotheliocyte effectively.The study on mechanism that suppresses vasculogenesis about its is also more, have now found that Endostatin can by following several approach suppress endothelial cell growths-with the plain V of integration
1(integrin V
1) in conjunction with (Hamano et al., 2003), suppress VEGF and acceptor combine (Kim et al., 2002), inhibition Cyclin D1 (Hanai et al., 2002) etc.
Think that at present there is many-sided limitation in this big proteinoid of Angiostatin in treatment: at first, because its pharmacokinetic characteristics, the protein molecular instability of vivoexpression, determined the albumen infusion be one for a long time, repeatedly, the process of capacity administration, big consumption and short-term repeatedly infusion have been brought very big inconvenience to patient; In addition, protein purification process complexity is time-consuming, output is lower, the cost height, and the clinical application restriction is bigger.
As first endogenic Angiostatin that enters clinical trial, EntreMed company has finished the I clinical trial phase in the U.S., is carrying out the II clinical trial phase.I phase clinical effectiveness shows that the human endostatin recombinant protein has good tolerability, maximum dosage (600mg/m
2/ day) do not show tangible toxicity yet, but vein effective blood concentration time length very of short duration (only being 10.7 hours) (Eder JP et al, 2002; Herbst RS et al., 2002; Thomas JP et al., 2003).How in clinical application, to keep the effective Plasma Concentration of Endostatin for a long time and be a major issue in its utilization.
Summary of the invention
One aspect of the present invention provides a kind of recombinant human endostatin (endostatin) gene, it is characterized in that: it is 3 ' end of IL-2 gene signal peptide sequence to be held with 5 ' of human endostatin encoding sequence be formed by connecting, and has the nucleotide sequence (seeing Table 1) of SEQID NO.1.
Table 1 recombinant human endostatin gene (SEQ ID NO.1)
ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAA
TTCGGCCCACAGCCACCGCGACTTCCAGCCGGTGCTCCACCTGGTTGCGCTCAACAGC
CCCCTGTCAGGCGGCATGCGGGGCATCCGCGGGGCCGACTTCCAGTGCTTCCAGCAG
GCGCGGGCCGTGGGGCTGGCGGGCACCTTCCGCGCCTTCCTGTCCTCGCGCCTGCAG
GACCTGTACAGCATCGTGCGCCGTGCCGACCGCGCAGCCGTGCCCATCGTCAACCTCA
AGGACGAGCTGCTGTTTCCCAGCTGGGAGGCTCTGTTCTCAGGCTCTGAGGGTCCGC
TGAAGCCCGGGGCACGCATCTTCTCCTTTGACGGCAAGGACGTCCTGAGGCACCCCA
CCTGGCCCCAGAAGAGCGTGTGGCATGGCTCGGACCCCAACGGGCGCAGGCTGACCG
AGAGCTACTGTGAGACGTGGCGGACGGAGGCTCCCTCGGCCACGGGCCAGGCCTCCT
CGCTGCTGGGGGGCAGGCTCCTGGGGCAGAGTGCCGCGAGCTGCCATCACGCCTACA
TCGTGCTCTGCATTGAGAACAGCTTCATGACTGCCTCCAAGTAG
The present invention also provides a kind of method for preparing above-mentioned recombinant human endostatin gene, and this method may further comprise the steps:
A, synthetic following PCR primer:
5 ' bow thing (SEQ ID NO.2): 5 ' CGG ATC C
AT GTA CAG GAT GCA ACT CCT GTC TTG CAT TGC ACT AAG TCT TGC ACT TGT CAC GAA TTC GGC CCA CAGCCA CCG CGA CTT CCA GCC3 ', wherein underscore partly is an IL-2 gene signal peptide sequence;
3 ' primer (SEQ ID NO.3): 5 ' GCG GAT CCT ACT TGG AGG CAG TCA TGA AGC3 ';
B, human endostatin encoding sequence and cloning vector are built into recombinant vectors;
C, be template, contain the recombinant human endostatin gene of IL-2 gene signal peptide with step a synthetic PCR primer amplification with this recombinant vectors.
Second aspect of the present invention provided a kind of recombinant human endostatin polypeptide by above-mentioned recombinant human endostatin coded by said gene.
Further, above-mentioned recombinant human endostatin polypeptide is that recombinant human endostatin gene of the present invention is expressed in eukaryotic cell and obtained.
Simultaneously, the present invention also provides the application of above-mentioned recombinant human endostatin polypeptide in the preparation antineoplastic pharmaceutical compositions.
The 3rd aspect of the present invention provides a kind of recombinant vectors that contains above-mentioned recombinant human endostatin gene, these various carriers that can carry recombinant human endostatin gene of the present invention are known in the art, as: recombinant phage, plasmid and other the protokaryon and the eukaryotic vector that after processing, can contain recombinant human endostatin gene order of the present invention.
Preferably, described carrier is adenovirus, adeno-associated virus (AAV) or retrovirus.
Preferred, described adenovirus is a replication-defective adenoviral.
The present invention also provides the above-mentioned application of recombinant vectors in the preparation antineoplastic pharmaceutical compositions.
The 4th aspect of the present invention provided the host cell that contains above-mentioned recombinant human endostatin gene or above-mentioned recombinant vectors.Can be used for implementing host cell of the present invention can be eucaryon or prokaryotic cell prokaryocyte, for example bacterium, yeast or zooblast.
Further, above-mentioned host cell is an eukaryotic cell.
Further, above-mentioned described host cell is 293 cells.
The present invention simultaneously also provides above-mentioned host cell to contain application in the recombinant vectors of recombinant human endostatin gene in preparation.
The 5th aspect of the present invention provides a kind of antitumor injection, and this injection is to add pharmaceutically by above-mentioned recombinant human endostatin polypeptide that the complementary composition of acceptable is prepared from.
The 6th aspect of the present invention provides a kind of antitumor injection, and this injection is to add pharmaceutically by above-mentioned recombinant vectors that the complementary composition of acceptable is prepared from.
Further, above-mentioned antitumor injection is that above-mentioned recombinant human esoderma colyone adenovirus adds pharmaceutically that the complementary composition of acceptable is prepared from.
Further again, every milliliter above-mentioned antitumor injection contains 1 * 10
9-9 * 10
11IU recombinant human esoderma colyone adenovirus and 10-25mg sucrose, pH value are 7.5-8.5.
Further, above-mentioned recombinant human esoderma colyone adenovirus is the adenovirus of replication defect type.
According to a first aspect of the invention, with the RT-PCR method human endostatin cDNA that from total RNA of people's normal liver tissue, increases; Then human endostatin encoding sequence and cloning vector pUC18 are built into pUC18-endo; Composition sequence is the PCR primer of SEQ ID NO.2 and SEQ ID NO.3 respectively; With pUC18-endo is template, contains the recombinant human endostatin gene of IL-2 gene signal peptide with above-mentioned PCR primer amplification the present invention.
According to a second aspect of the invention, can go into various eucaryons commonly used and prokaryotic vector further to use with recombinant human endostatin provided by the invention is gene constructed.
According to a third aspect of the present invention, can prepare recombinant vectors of the present invention by following method: with the gene constructed pAdenoVator-CMV5 of the going into shuttle vectors of the recombinant human endostatin of being cloned into, again with the plasmid pAdenoVator Δ E1E3 cotransformation intestinal bacteria BJ5183 that comprises the adenoviral gene group, filter out recon, rotaring redyeing 293 cell filters out recombinant adenovirus again.
According to a fourth aspect of the present invention, recombinant vectors of the present invention can be changed over to host cell to increase this recombinant vectors or be used for a large amount of excreting and expressing recombinant human Endostatin polypeptide.
According to a fifth aspect of the present invention, can add recombinant human endostatin polypeptide provided by the invention pharmaceutically that the complementary composition of acceptable is prepared into injection, this injection can suppress growth of tumor and transfer.
According to a sixth aspect of the invention, recombinant vectors provided by the invention can be added pharmaceutically that the complementary composition of acceptable is prepared into injection, this injection can suppress growth of tumor and transfer.And this injection can prepare by the following method: get water for injection under the aseptic condition, add raw material recombinant human esoderma colyone adenovirus 1 * 10 again
9-9 * 10
11IU/ml and sucrose 10～25mg/ml mix under aseptic condition, regulate the sterile filtration to the 7.5-8.5 of pH value with damping fluid and are distributed into injection, cryopreservation.
Need to prove that especially the concrete technological method of more than producing and operate recombination disclosed by the invention, recombinant polypeptide, recombinant vectors and antitumor injection is well known by persons skilled in the art, and can finish according to the technology of having described.
Recombinant human endostatin gene of the present invention can be realized the secreting, expressing of recombinant human endostatin polypeptide, the recombinant adenovirus that contains this recombinant human endostatin gene can make its a large amount of stable highly active recombinant human endostatin polypeptide of secreting, expressing behind infection of eukaryotic cells, in the external growth and the migration that can suppress endotheliocyte effectively.By the antitumor injection that recombinant adenovirus of the present invention is prepared into, the biological activity that can make the high-caliber human endostatin of the long-time continuous expression of body and be kept perfectly behind the tumour cell is advanced in transfection in vivo, can effectively suppress the growth and the transfer of kinds of tumors.The antitumor injection of the present invention can remedy defectives such as the medicine costliness, body internal stability difference of albumen infusion, can increase administration time the interval, significantly reduce dosage, alleviate patient economy burden and improve patient's quality of life, have good market outlook.
Description of drawings
The electrophoretogram of Fig. 1 RT-PCR product (1% Agarose electrophoresis), wherein: M is 1kb DNA ladder (GBICO), and C represents negative control, and 1 expression adds the 1ul template ribonucleic acid, and 2 expressions add the 2ul template ribonucleic acid.
The electrophoretogram of Fig. 2 PCR product (1% Agarose electrophoresis), wherein: M is 100bp DNA ladder (GBICO), and 1:pUC18-endo is a template
The enzyme of Fig. 3 pAd-endo is cut qualification result (Pac I) (1%Agarose electrophoresis), and wherein M is a molecular weight standard; 1,3,4,6,10,11,15 is respectively the monoclonal numbering that filters out
Fig. 4 pcr amplification is identified recombinant adenovirus (P1+P2) (1% Agarose electrophoresis) wherein, and M is 100bp PCR MolecularRuler (Bio-Rad), the positive contrast of C (pAd-endo), and 1-6 represents the 1-6 plaque respectively.
Fig. 5 pcr amplification is identified recombinant adenovirus (P3+P4) (1% Agarose electrophoresis), and wherein: M represents 100bp PCRMolecular Ruler (Bio-Rad); C1 represents negative control (pAdenoVator-endo); C2 represents positive control (pAd-endo); 1-6 represents the 1-6 plaque respectively
The Western Blot qualification result of the different cell strains of Fig. 6, wherein: clone (cell line) A549 is that human lung carcinoma cell line A549, HeLa are that human cervical carcinoma cell strain HeLa, HepG2 are that human hepatoma cell strain HepG2, COS-7 are African green monkey kidney cell COS-7, and M is a molecular weight standard.
The external endotheliocyte of Fig. 7 (HU-VEC) suppresses experiment, and wherein NS is a control group, and ADE is a unloaded virus group (Ad-Null) for reorganization sample sets, ADC.
The inhibition curve of Fig. 8 (ordinate zou among the figure and X-coordinate should be Chinese) tumor growth, wherein: NS is the blank group, ADC is an adenovirus empty carrier group (Ad-Null) (1 * 10
9IU/ is only), ADE1 is recombinant human esoderma colyone adenovirus group (5 * 10
8IU/ is only): ADE2 is a recombinant human esoderma colyone adenovirus group (1 * 10
9IU/ is only), ADE3 is recombinant human esoderma colyone adenovirus group (5 * 10
9IU/ only).
Fig. 9 control group, empty carrier group and the tumor-bearing mice (A) of Ad-E2 group and tumour (B) photo that separates, wherein: a is a control group, and b is the empty carrier group, and c is: ADE2 (recombinant human esoderma colyone adenovirus group 1 * 10
9IU/ only).
Figure 10 lung metastatic tumour count results, wherein: NS is the blank group, ADC is an adenovirus empty carrier group (Ad-Null) (1 * 10
9IU/ is only), ADE1 is recombinant human esoderma colyone adenovirus group (5 * 10
8IU/ is only), ADE2 is recombinant human esoderma colyone adenovirus group (1 * 10
9IU/ is only), ADE3 is recombinant human esoderma colyone adenovirus group (5 * 10
9IU/ only).
The invention will be further described below in conjunction with the description of accompanying drawing by embodiment, but this is not a limitation of the present invention, those skilled in the art are according to basic thought of the present invention, can make various modification or improvement, only otherwise break away from basic thought of the present invention, all within the scope of the present invention.
Embodiment
The preparation of embodiment 1 human endostatin gene
Present embodiment is with the RT-PCR method human endostatin cDNA fragment that increases from total RNA of people's liver.
Design and synthesize the RT-PCR primer according to the human endostatin gene order, in order the PCR product directly to be inserted cloning vector-pUC18 (available from Invitrogen company), all be designed into BamH I restriction enzyme site in 5 ' primer and 3 ' primer, primer sequence is as follows:
5 ' primer: 5 ' CGG GAT CCA CAG CCA CCG CGA CTT CCA GCC 3 '
3 ' primer: 5 ' GCG GAT CCTACT TGG AGG CAG TCA TGA AGC 3 '
The RT-PCR condition is as follows:
The RT-PCR reaction mixture, reacts by following condition after 30 minutes 50 ℃ of sex change:
Reverse transcription reaction: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 50 ℃; 68 ℃ were extended 1 minute.React 10 circulations.
PCR reaction: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 52 ℃; 68 ℃ were extended 1 minute.React 25 circulations.68 ℃ were extended 12 minutes more then.
After reaction was finished, 1% agarose gel electrophoresis detected the RT-PCR product, and the result shows and amplifies and the dna fragmentation (see figure 1) of expecting about the consistent 570bp of clip size.Through order-checking, show that the goal gene in the resultant recombinant plasmid is in full accord with the human endostatin gene order of delivering.
The cDNA sequence (GI:28178860) of reference men and women IL-2, it is as follows to design and synthesize the PCR primer:
5 ' primer: 5 ' CGG ATC CAT GTA CAG GAT GCA ACT CCT GTC TTG CAT TGCACT AAG TCT TGC ACT TGT CAC GAA TTC GGC CCA CAG CCA CCG CGA CTTCCA GCC 3 '
3 ' primer: 5 ' GCG GAT CCT ACT TGG AGG CAG TCA TGA AGC 3 '
In 5 ' primer and 3 ' primer, all be designed into BamH I restriction enzyme site, directly insert shuttle vectors pAdenovator-CMV5; Wherein the italicized item of 5 ' primer is human IL-2's a signal peptide sequence.
Be the human endostatin dna fragmentation that template amplification contains the IL-2 gene signal peptide with pUC18-endo then, the PCR condition is as follows:
94 ℃ of sex change 30 seconds; Annealed 30 seconds for 55 ℃; 72 ℃ were extended 30 seconds.React 30 circulations.72 ℃ were extended 12 minutes more then.
After reaction was finished, 1% agarose gel electrophoresis detected PCR product (the results are shown in Figure 2), had obtained estimating the dna fragmentation of size (about 630bp).Be inserted into shuttle plasmid pAdenoVator-CMV5 (available from Qbiogene company) by the product operation handbook, sequencing result shows the in full accord of the human endostatin dna fragmentation of the resultant IL-2 of containing gene signal peptide and expectation.
The structure and the screening of embodiment 3 recombinant adenovirus
1, behind the gene constructed pAdenoVator-CMV5 of the going into shuttle vectors of the human endostatin that comprises human IL-2's signal peptide that will be cloned into, again with comprise adenoviral gene group (E1, the E3 disappearance) the conventional electroporation method cotransformation intestinal bacteria BJ5183 (available from Qbiogene company) of cyclic plasmid pAdenoVator Δ E1E3 (available from Qbiogene company), screening recon-pAd-endo identifies.The result shows and has screened recon pAd-endo (1) and pAd-endo (3) (see figure 3) with two kinds of recombination sites respectively.Wherein the homologous recombination site is positioned at the fragment that cuts out 3.0kb of left arm, and the size that cuts out that recombination site is positioned at replicon is the fragment of 4.5kb.
2, use conventional cotransfection method with linearizing recombinant plasmid pAd-endo and liposome Lipofectamine (available from Invitrogen company) cotransfection 293 cells (available from ATCC), screening recombinant adenovirus Ad-E.After 14 days, 6 sharpness of border of picking are separated the plaque of opening with other plaque, increase.
3, extracting adenovirus DNA identifies whether be recombinant adenovirus by pcr amplification human endostatin dna fragmentation, identifies the distinctive E2B of adenovirus district fragment simultaneously.
Wherein, the primer of amplification human endostatin dna fragmentation is:
5 ' primer (P1): 5 ' CGG GAT CCA TGT ACA GGA TGC AAC TCC TG 3 '
3 ' primer (P2): 5 ' GCG GAT CCT ACT TGG AGG CAG TCA TGA AGC 3 '
The primer in the specific E2B of amplification adenovirus district is:
5 ' primer (P3): 5 ' TCG TTT CTC AGC AGC TGT TG 3 '
3 ' primer (P4): 5 ' CAT CTG AAC TCA AAG GGT GG 3 '
Through identifying that the plaque of picking is all inserted human endostatin (band about 630bp is seen Fig. 4); The plaque of picking all amplifies the positive band (about 860bp, seeing Fig. 5) of adenovirus E2B.
4, with the virus infection A549 cell that screens, get the expression of culture supernatant with conventional ELISA method identifier Endostatin, expression of results sees Table 2.
The expression of each plaque Endostatin of table 2
It seems that from measurement result each clone's of pAd-endo (1) expression illustrates that all a little more than pAd-endo (3) the homologous recombination site is positioned at the expression that more helps endostatin gene of left arm.Select to express the highest plaque Ad-E (1)-6#, called after Ad-E.
The amplification and the purifying of embodiment 4 recombinant adenovirus
Ad-E virus seed liquor is increased step by step, finally infect 5 * 10
6Individual 293 cells are cultivated 48～72 hours until complete CPE, centrifugal collecting cell occurring, cell precipitation is resuspended in the DMEM substratum that 100ml contains 5%FBS (foetal calf serum) ,-20 ℃/37 ℃ multigelations three times, the centrifugal cell debris that goes, supernatant is employing virus cracking liquid, and is standby.
Adopt conventional two step CsCl density gradient ultracentrifuge method purifying Ad-E, the first step adopts discontinuous CsCl gradient to remove the virion of most cell debris and defective (virion that does not promptly possess infection activity), second step adopted continuous CsCl density gradient thoroughly will possess the virion of infection activity and the virion of defective distinguishes, pass through dialysis desalting at last again, remove CsCl, obtain recombinant human esoderma colyone adenovirus-Ad-E.
Respectively human lung carcinoma cell line A549, human cervical carcinoma cell strain HeLa, human hepatoma cell strain HepG2, African green monkey kidney cell COS-7 (available from ATCC) are inoculated in 6 orifice plates, with the recombinant human esoderma colyone adenovirus of embodiment 4 gained with different MOI values (multiplicity of infection, infection multiplicity): 0,5,10,20,40,80 infect, and cultivate after 48 hours, get the expression of supernatant liquor, the results are shown in Table 3 with test kit (available from Chemicon) detection Endostatin.
The expression of the Ad-E of the different amounts of the different cell infections of table 3
The result shows that recombinant adenovirus Ad-E can infect various kinds of cell types such as comprising lung cancer, liver cancer, carcinoma of endometrium, expresses the justacrine human endostatin, illustrates that Ad-E has than the infection scope of wide spectrum and higher expression activity.
Simultaneously with goat-anti human endostatin antibody (1:250) (available from R﹠amp; D Systems) is that one anti-, HRP-Protein A (available from Bio-Rad) is two anti-(1:3000), further identifies whether identical with expectation of expression product with conventional Western Blot method.
The result shows and the results are shown in Figure in 6, four kinds of different cell strains all expressing human endostatin protein specifically, consistent (about the 20kDa) of hybridization band and expectation.
The preparation of the antitumor injection of embodiment 6 recombinant human esoderma colyone adenovirus
Under aseptic condition, get 500ml water for injection, add the recombinant human esoderma colyone adenovirus Ad-E (1 * 10 of embodiment 4 gained
13IU), Tris0.484g, MgCl
20.076g, sucrose 16g, mix, add the injection water again to cumulative volume 1000ml, regulate pH value to 8.0 with HCl simultaneously.Be distributed into the recombinant adenovirus Ad-E injection that 1ml/ props up after the sterile filtration, in-20 ℃ of preservations.
Below by test the example mode beneficial effect of the present invention is further described, be limitation of the present invention but should not be construed as.
The active determination in vitro of experimental example 1 recombinant adenovirus Ad-E---suppress the propagation of vascular endothelial cell
1, experimental technique
Separation and Culture HU-VEC cell from fresh fetal umbilical cord (providing) by second hospital of Sichuan University, be inoculated in 96 orifice plates of gelatin bag quilt by 5000/hole, the clear liquid of infecing that adds the Ad-E of 20 μ l sesquialters dilutions and Ad-Null (unloaded adenovirus) respectively, adding 80 μ l M199 nutrient solutions (containing 5%FBS, 3ng/ml bFGF) again cultivates; Cultivate that every hole adds MTT to final concentration 0.5mg/ml after 72 hours, hatched 4 hours for 37 ℃; The sucking-off supernatant adds methyl-sulphoxide (DMSO) 100 μ l, and the room temperature jolting was read the A550nm value after 5-10 minute on microplate reader.
Calculate the inhibiting rate of Endostatin by following formula to HU-VEC cell proliferation:
2, experimental result
The result shows and has the dosage compliance between (see figure 7) Endostatin concentration and the inhibiting rate that the endotheliocyte inhibiting rate reaches 50% (ED50) when the 1:8 weaker concn; Ad-Null (ADC) infects then unrestraint effect of supernatant.This Endostatin that Ad-E expression has been described is in the external propagation that can suppress vascular endothelial cell really significantly.
The activity in vivo of the antitumor injection of experimental example 2. recombinant adenovirus Ad-E is measured---suppress growth of tumor and transfer
1, experimental technique
This experiment adopts lung cancer model that the antitumor injection inhibition tumor growth of embodiment 6 preparations and the effect of transfer are measured.
Choose the female nude mice (6-8 week nude mice in age (16-20g) is available from Sichuan University's West China Experimental Animal Center) of 50 robust growth, every inoculation 8 * 10
6A549/100 μ l grows to 2～3mm in the oxter until diameter of tumor, is divided into 5 groups at random, is respectively blank group (NS), adenovirus empty carrier group (Ad-Null) (1 * 10
9IU/ is only), recombinant human esoderma colyone adenovirus group ADE-1 (5 * 10
8IU/ is only), ADE-2 (1 * 10
9IU/ is only), ADE-3 (5 * 10
9IU/ only).Every group respectively at multi-point injection Ad-E injection or contrast agents in the tumour, totally four times (treating the 0th, 5,10,15 day).Every 3 days with vernier caliper measurement tumour length and width, gross tumor volume calculates by the following method: volume (mm
3)=0.52 * length (length) * wide
2(width
2).Tumor growth suppresses to use variance analysis, and P＜0.05 item thinks that statistical significance is arranged.
After observing end in four months, get tumor tissues and organ, take by weighing tumor weight and lung weight in wet base, the counting lung shifts tubercle.
2, experimental result
A, each group of experimental session are not all observed tangible toxic side effects.Slow down even dwindle at two weeks internal therapy group Ad-E tumor growth, and Ad-Null and control group tumor growth are very fast, and do not have notable difference; Observe after four months in the treatment group tumor control rate all greater than 40% (P＜0.05) (see figure 8).Fig. 9 has shown three not on the same group---the tumor-bearing mice of control group, empty carrier group and Ad-E2 treatment group and the contrast of the situation of tumour.
B, simultaneously has lymph nodes of body as a whole and liver, spleen, lung to shift in the control group.Gross tumor volume there was no significant difference between the treatment group, but the control group lung rate of transform (〉 70%) apparently higher than treatment group (＜40%) (P＜0.05); Control group lung weight in wet base and lung metastatic nodules are more than treatment group (P＜0.05).Lung shifts number and therapeutic dose is negative correlation (Figure 10), and wherein lung transfer and metastatic nodules minimum (P＜0.05) take place the ADE3 group.
Above result shows that Ad-E can effectively suppress growth of tumor and transfer in people's lung cancer model.
To sum up, the recombinant adenovirus gene constructed by recombinant human endostatin of the present invention can infect kinds of tumor cells, and the highly active recombinant human endostatin polypeptide of secreting, expressing stably in a large number, in the external growth and the migration that can suppress endotheliocyte effectively.By the antitumor injection of recombinant adenovirus preparation of the present invention, can make body continue high-caliber expression and have complete bioactive recombinant human endostatin polypeptide, thereby can suppress growth of tumor and transfer in vivo.Injection in per 5 days once can both have good antitumous effect in above example, this increase administration time the interval, remedied the limitation that albumen infusion human endostatin medicine body internal stability is poor, the effective concentration time length is very of short duration (only being more than 10 hours), dosage be can significantly reduce, drug cost, relieve patient ' s burden reduced, also improve patient's quality of life simultaneously, had good market outlook.
Simultaneously by this area general knowledge as can be known, if different requirements is arranged, the consumption of recombinant adenovirus can change in a big way at one in the antitumor injection of the present invention.Those skilled in the art can be according to some known factors, such as the kind of disease, and the degree that is in a bad way, patient body weight, formulation, selected routes of administration etc. are determined at an easy rate.
Above more excellent embodiment is that the present invention is further illustrated, but be not limitation of the scope of the invention, those skilled in the art are according to basic thought of the present invention, can make various modification or improvement, only otherwise break away from basic thought of the present invention, all within the scope that spirit of the present invention and claims of being enclosed define.
A kind of recombinant human esoderma colyone adenovirus and its production and use .ST25.txt
SEQUENCE?LISTING
＜110〉Sichuan University
Chengdu grace is executed biotechnology company limited more
＜120〉a kind of recombinant human esoderma colyone adenovirus and its production and use
<130>3408
<160>3
<170>PatentIn?version?3.2
<210>1
<211>615
<212>DNA
<213>Artificial
<220>
＜223〉recombinant human endostatin gene
<400>1
<210>2
<211>93
<212>DNA
<213>Artificial
<220>
＜223〉5 ' primer
<400>2
<210>3
<211>30
<212>DNA
<213>Artificial
<220>
＜223〉3 ' primer
<400>3
Claims (18)
1, a kind of recombinant human endostatin gene is characterized in that: its nucleotides sequence is classified as shown in the SEQ ID NO.1.
2, a kind of reorganization Endostatin polypeptide is characterized in that: it is by the described recombinant human endostatin genes encoding of claim 1.
3, reorganization Endostatin polypeptide according to claim 2 is characterized in that: it is by the described recombinant human endostatin genes encoding of claim 1 and expresses in eukaryotic cell and obtain.
4, a kind of recombinant vectors is characterized in that containing recombinant human endostatin gene as claimed in claim 1.
5, recombinant vectors according to claim 4 is characterized in that described carrier is adenovirus, adeno-associated virus (AAV) or retrovirus.
6, recombinant vectors according to claim 5 is characterized in that described adenovirus is a replication-defective adenoviral.
7, a kind of host cell that contains the described recombinant human endostatin gene of claim 1.
8, a kind of host cell that contains each described recombinant vectors of claim 4 to 6.
9,, it is characterized in that described host cell is an eukaryotic cell according to claim 7 or 8 described host cells.
10, a kind of antitumor injection is characterized in that: it adds pharmaceutically by claim 2 or 3 described recombinant human endostatin polypeptide that the acceptable auxiliary material is prepared from.
11, a kind of antitumor injection is characterized in that: it is to add the injection that acceptable auxiliary material pharmaceutically is prepared from by each described recombinant vectors of claim 4 to 6.
12, antitumor injection according to claim 11, it is characterized in that: every milliliter contains 1 * 10
9-9 * 10
11IU recombinant human esoderma colyone adenovirus and 10-25mg sucrose, pH value are 7.5-8.5.
13, a kind of method for preparing the described recombinant human endostatin gene of claim 1 is characterized in that may further comprise the steps:
A, synthetic PCR primer shown in SEQ ID NO.2 and SEQ ID NO.3 respectively;
B, human endostatin encoding sequence and cloning vector pUC18 are built into pUC18-endo;
C, be template, contain the recombinant human endostatin gene of IL-2 gene signal peptide with step a synthetic PCR primer amplification with pUC18-endo.
14, a kind of method for preparing the described recombinant vectors of claim 6 is characterized in that may further comprise the steps:
A, go into the pAdenoVator-CMV5 shuttle vectors with the described recombinant human endostatin of claim 1 is gene constructed;
B, with step a gained carrier with comprise the plasmid pAdenoVator Δ E1E3 cotransformation intestinal bacteria of adenoviral gene group, filter out recon;
C, with b step gained recon rotaring redyeing 293 cell again, amplification preparation recombinant adenovirus.
15, a kind of method for preparing the described antitumor injection of claim 12 is characterized in that may further comprise the steps:
A, under aseptic condition, get water for injection, add raw material by following proportioning again: recombinant human esoderma colyone adenovirus 1 * 10
9-9 * 10
11IU/ml, sucrose 10～25mg/ml;
B, under aseptic condition, step a product is mixed, regulate the pH value to 7.5-8.5 with damping fluid;
C, will be distributed into injection, cryopreservation after the sterile filtration of step b product.
16, claim 2 or the 3 described recombinant human endostatin polypeptide application in the preparation antineoplastic pharmaceutical compositions.
17, the application of each described recombinant vectors of claim 4 to 6 in the preparation antineoplastic pharmaceutical compositions.
18, claim 8 or 9 described host cells contain application in the recombinant vectors of recombinant human endostatin gene in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100217207A CN100494376C (en) | 2005-09-23 | 2005-09-23 | Recombinant human esoderma colyone adenovirus, and its preparing method and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100217207A CN100494376C (en) | 2005-09-23 | 2005-09-23 | Recombinant human esoderma colyone adenovirus, and its preparing method and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1935999A CN1935999A (en) | 2007-03-28 |
| CN100494376C true CN100494376C (en) | 2009-06-03 |
Family
ID=37953743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100217207A Active - Reinstated CN100494376C (en) | 2005-09-23 | 2005-09-23 | Recombinant human esoderma colyone adenovirus, and its preparing method and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100494376C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020026968A1 (en) * | 2018-07-30 | 2020-02-06 | 株式会社遺伝子治療研究所 | Method for enhancing gene expression by aav vector |
| CN115120744A (en) * | 2021-03-24 | 2022-09-30 | 四川大学 | Application of recombinant human endostatin adenovirus and anti-PD-1 antibody or anti-PD-L1 antibody in preparation of anti-tumor drugs |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1401785A (en) * | 2002-09-26 | 2003-03-12 | 山东大学 | Human recombinant secretor type endostatin protein, preparing process and use thereof |
-
2005
- 2005-09-23 CN CNB2005100217207A patent/CN100494376C/en active Active - Reinstated
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1401785A (en) * | 2002-09-26 | 2003-03-12 | 山东大学 | Human recombinant secretor type endostatin protein, preparing process and use thereof |
Non-Patent Citations (4)
| Title |
|---|
| Alteration in the IL-2 Signal Peptide Affects Secretion ofProteins in vitro and in vivo. Zhang.L et al.The Journal of Gene Medicine,Vol.7 No.3. 2005 |
| Alteration in the IL-2 Signal Peptide Affects Secretion ofProteins in vitro and in vivo. Zhang.L et al.The Journal of Gene Medicine,Vol.7 No.3. 2005 * |
| 重组人内皮抑素真核表达载体pCD-sEndo的构建和表达. 邵俊伟等.世界华人消化杂志，第13卷第14期. 2005 |
| 重组人内皮抑素真核表达载体pCD-sEndo的构建和表达. 邵俊伟等.世界华人消化杂志，第13卷第14期. 2005 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1935999A (en) | 2007-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4874247B2 (en) | Construction and use of oncolytic adenovirus recombinants, in particular recombinants expressing the immunomodulator GM-CSF in tumors | |
| US20230265452A1 (en) | Phagemid Vector | |
| JP3974894B2 (en) | Tumor-specific promoters and their uses | |
| NZ537631A (en) | Oncolytic virus replicating selectively in tumor cells | |
| CN100494376C (en) | Recombinant human esoderma colyone adenovirus, and its preparing method and use | |
| NAKAGAMA et al. | Identification of transforming genes as hst in DNA samples from two human hepatocellular carcinomas | |
| CN109419818B (en) | Echovirus for treating tumors | |
| CN101643749A (en) | Adeno-associated virus carrier, preparation method thereof and application | |
| CN112569358B (en) | Application of peinterferon and proto-oncogene product targeted inhibitor in synergistic inhibition of tumors | |
| US20220378879A1 (en) | Application of peg interferon and protooncogene product targeting inhibitor in synergistic treatment of renal carcinoma | |
| KR101374585B1 (en) | The shRNA downregulating HSP27 for treatment of tumor | |
| EP3783100A1 (en) | Coxsackie virus b for treating tumors | |
| CN101328475B (en) | Nucleic acid molecule NRN1SR11 and use thereof in anti-cancer medicine preparation | |
| CN101474413A (en) | Use of DRR1 gene in preparing anti-tumor medicament | |
| CN114854755B (en) | Lentiviral vector for inhibiting VSTM2L expression and application thereof | |
| CN112501176B (en) | Polynucleotide and application thereof | |
| CN102120764A (en) | Angiogenesis of triple mutant low-oxygen inducible factor 1 alpha induced by auxiliary activating factors and application thereof | |
| CN103221060A (en) | Tumor growth controlling method targeting galactosylceramide expression factor-1 | |
| CN114146178A (en) | Application of PYCR1 gene as target in preparation of esophageal cancer product and related product | |
| CN117402261A (en) | CAR-NK cell preparation method based on recombinant adenovirus and application thereof | |
| CN101302511A (en) | Nucleic acid molecule NRN1SR12 and use thereof in anti-cancer medicine preparation | |
| CN107868782A (en) | Nucleic acid molecules CTL4HSH3, its preparation method and application | |
| CN114632088A (en) | Application of cytarabine compound in preparation of medicine for treating glioma | |
| CN107868783A (en) | Nucleic acid molecules CTL4HSH2, its preparation method and application | |
| CN101380310A (en) | Composition of bFGF modified liposome and shRNA expression vector targeting human VEGF gene and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090603 Termination date: 20091023 |
|
| RR01 | Reinstatement of patent right |
Former decision: cessation of patent right due to non-payment of the annual fee Former decision publication date: 20101201 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20170203 Address after: 561000 Guizhou Province, Anshun City West Road, Anshun economic and Technological Development Zone Patentee after: Guizhou Bailing Group Pharmacy Co., Ltd. Address before: 610065 Sichuan, Chengdu, South Ring Road, No. 1, No. 24 Patentee before: Sichuan University Patentee before: Sichuan Enduoshi Bioengineering Technology Co., Ltd. |