CN100457910C - Phasmid display carrier pCANTAB5L - Google Patents
Phasmid display carrier pCANTAB5L Download PDFInfo
- Publication number
- CN100457910C CN100457910C CNB021550255A CN02155025A CN100457910C CN 100457910 C CN100457910 C CN 100457910C CN B021550255 A CNB021550255 A CN B021550255A CN 02155025 A CN02155025 A CN 02155025A CN 100457910 C CN100457910 C CN 100457910C
- Authority
- CN
- China
- Prior art keywords
- phage
- protein
- pcantab5l
- gene
- phagemid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention is a new phage mid display vector pCANTAB5L, applied to the phage for displaying the exotic random polypeptide. It inserts the linker fragment Xba I-Stu I-Sal I-Kpn I-[G4S] 3-Not I between SfiI and NotI endonuclease cutting sites of pCANTAB5L to obtain the vector. The vector provides 5 common endonuclease cloning sites Sfi I, Xba I, Stu I, Sal I and Kpn I, which makes exotic gene oriented cloning convenient and improves the cloning efficiency, beneficial to enlarge the polypeptide library capacity displayed by the phage; the vector introduces flexible polypeptide linker gene [G4S] 3 composed of 15amino acids between the phage PIII protein gene and the exotic display protein gene, and properly uses Escherichia coli rare codon, so as to reduce the mutual interference of the displayed exotic and PIII proteins and maintain the function and activity of the displayed exotic and PIII proteins. It is applied to displaying various random peptide library, functional target protein, functional target protein variant library and large molecular-weight (>300 amino acids) functional protein.
Description
Technical field:
The present invention relates to technical field of bioengineering, is a kind of novel phagemid display carrier pCANTAB5L that is applied to phage display external source rondom polypeptide.
Background technology:
So-called display technique of bacteriophage is to utilize phage that allogenic polypeptide gene and phage structural protein gene fusion back are showed in allogenic polypeptide the technology of phage surface with it.Because that phage has is simple in structure, volume is little, the unit volume number is many, be easy to duplicate, can be suspended in characteristics such as liquid, display technique of bacteriophage has been widely used in the research of molecular interaction.Wherein mainly comprise and utilize avidity to select from the displayed polypeptide storehouse, to catch the target receptor sequence, carrying out epi-position identifies or epitope mimic, identify new acceptor and native ligand, select DNA conjugated protein, seek new medicine, provide the new way of vaccine development and medical diagnosis on disease, researchs such as optimized gene engineered antibody.
Filobactivirus is an elongated rod shape, is about 1000nm, the about 6nm of pipe diameter.Tube hub is the strand linear DNA of about 6400 Nucleotide.Long tube is arranged by about 2700 main coat protein (PVIII) molecular spiral and is formed, and the one end is respectively to be the less important coat protein PIII and the PVI of 5 copies, and the other end then is respectively to be the less important coat protein PVII and the PIX of 5 copies.Phage combines and bacterial infection with the F pili of bacterium by 200 amino acid of piii protein N end.1985, George Smith has at first carried out the research of phage display, he inserts restriction endonuclease EcoR I gene fragment at 5 ' end of bacteriophage coat protein III (PIII) gene of filobactivirus f1 coding, the N end that merged at coat protein PIII of restriction endonuclease EcoR I as a result, thus be illustrated in phage surface.The recombinant phage that produces not only still has infectivity, and can with EcoR I antibodies, EcoR I incision enzyme gene can also be carried out heredity and variation as the part of phage genome.At present, in the application of display technique of bacteriophage, allogenic polypeptide mainly is illustrated on PIII and two kinds of coat protein of PVIII, and the main mode of displaying has 3 types, 8 types, 33 types, 88 types, 3+3 type, 6 kinds of forms of 8+8 type, and wherein the 3+3 type is to be used maximum exhibition methods.Different with the exhibition method of Smith is, 3+3 type exhibition method is not that foreign gene is directly inserted in the PIII gene of phage, contain in the phagemid of phage PIII gene but earlier foreign gene is inserted, infect with the wild-type helper phage again and transform the bacterium that above-mentioned reorganization phagemid is arranged, so the recombinant phage of gained is enclosed with the reorganization phagemid, it had both contained part wild-type piii protein, had the N end of part piii protein to show that allogenic polypeptide is arranged simultaneously again.Owing to only have part and external source displayed polypeptides to merge in 5 piii protein molecules of recombinant phage, so reduced to the active influence of phage-infect.Reorganization that the more important thing is phagemid is carried out the gene recombination operation and is come simply than on phage genome, thereby is very easy to the gene clone operating process, has improved the efficient of allogenic polypeptide phage display greatly.
The phagemid carrier pCANTAB5X that is used for the rondom polypeptide phage display at present is a kind of application 3+3 type display carrier preferably, it obtains [Pan Wei etc. by commercial phage single-chain antibody display carrier pCANTAB5E phagemid having been carried out the restriction enzyme site transformation, the The 2nd Army Medical College journal, 1999,20 (10): 723], it has inserted restriction endonuclease Xba I commonly used site between the Sfi of pCANTAB5E I and Not I restriction enzyme site, help the 5 ' end that more DNA random fragment inserts the PIII coat protein gene, thereby increased the storage capacity of random peptide library.For example, utilize the pCANTAB5X carrier successfully to show the random peptide library of HCV and HGV core protein (Pan Wei etc., Chinese microbiology and Journal of Immunology, 2001,21 (4): 359; Wu Xiaolan etc., The 2nd Army Medical College journal, 2000,21 (9): 842).However, when carrying out the allogenic polypeptide displaying with pCANTAB5X carrier and other phagemid carrier, since the PIII coat protein of phage be demonstrated polypeptide and directly merge, piii protein can influence the normal folding and space conformation of foreign protein, is unfavorable for keeping being demonstrated proteic original activity and function; Equally, foreign protein also can exert an influence to the piii protein molecule, because 5 piii protein molecules flock together, although the PIII molecule of wild-type is arranged in 5 piii proteins, when showing the foreign protein of macromolecule, because the PIII molecule directly links to each other with foreign protein, it connects and lacks flexibility, can not rotate freely, and its huge space structure also can produce sterically hindered to the wild-type piii protein, thereby influence its infection activity, the output of recombinant phage is reduced; Moreover, pCANTAB5X only contains Sfi I, XbaI and 3 cloning sites of Not I, restriction enzyme site commonly used has only an Xba I, so it and other business-like phagemid carrier exist the cloning site few problem of restriction enzyme site quantity especially commonly used equally, this makes troubles to genetically engineered operation, has particularly limited storage capacity when making up at random the displayed polypeptide storehouse.
Summary of the invention:
The invention provides a kind of phage-infect activity that neither influences, can keep original activity of foreign protein and function again, and energy multidigit point clone's phagemid display carrier pCANTAB5L.
The present invention is a kind of improvement to phagemid carrier pCANTAB5X.One of improvement is to have increased restriction enzyme site commonly used, be increased to and contain Sfi I, Xba I, Stu I, Sal I, 5 sites of Kpn I by original Sfi I, Xba I and three sites of Not I of containing, for the clone of external source displayed polypeptides gene provides how selectable cloning site, this has not only made things convenient for the directed cloning of foreign gene, improve cloning efficiency, and helped enlarging the phage display peptide library storage capacity; It two is to have introduced peptide linker gene [G4S] 3, its polypeptide expressed is made up of 15 amino acid, between phage piii protein and foreign protein, and in peptide linker gene [G4S] 3, suitably used the intestinal bacteria rare codon, make foreign protein and the phage piii protein certain hour of in the protein translation process, being separated by, thereby make foreign protein before the phage piii protein that merges with it is translated, have the more time to form the space conformation of oneself, exactly because the also introducing of peptide linker gene [G4S] 3, make PHI albumen and foreign protein 15 amino acid whose polypeptide at interval, thereby further reduced the phase mutual interference in forming space structure picture between piii protein and the foreign protein.In addition, this peptide linker has the highly flexible space structure, both can freely swing, can rotate freely again, this just makes the allogenic polypeptide of displaying or foreign protein obtain bigger activity space, not only help the active maintenance of allogenic polypeptide or foreign protein, and because allogenic polypeptide or foreign protein can be free movable, even the foreign protein molecule is bigger, also be unlikely to always to shelter from piii protein, this just makes the infection activity of piii protein can not be subjected to the foreign protein too much influence, thereby can guarantee the random peptide library showed better, function target protein varient storehouse has good randomness and enough storage capacity, the titre of recombinant phage is unaffected when showing the macromolecule functional protein.
The pCANTAB5L phagemid is applicable to the functional protein of big (>300 amino acid) of display random peptide storehouse, functional protein, functional protein varient and molecular weight.Use the pCANTAB5L phagemid and successfully showed recombinant human lymphotoxin (being called for short rhLT) varient storehouse, staphylococcal protein A,SPA derivative (being called for short Mu-proteinA) and human interferon-alpha A-2b (being called for short hIFN α A-2b).
The structure of phagemid display carrier pCANTAB5L of the present invention is by the genetically engineered working method, inserts one and be connected that fragment realizes between the restriction enzyme site Sfi I of phagemid display carrier pCANTAB5X and Not I.This linking fragment had both comprised Xba I, Stu I, Sal I and Kpn I restriction enzyme site, also comprised [G4S] 3 peptide linker genes, and had suitably introduced the intestinal bacteria rare codon in [G4S] 3 genes.Behind this phagemid transform bacteria, infect the bacterium of this conversion again with the wild-type helper phage, just can obtain being enclosed with the phage of pCANTAB5L phagemid.This phagemid carrier just can be used as the platform of showing allogenic polypeptide or foreign protein.
The building process of pCANTAB5L is as follows:
One. preparation is connected fragment Xba I-Stu I-Sal I-Kpn I-[G4S] 3-Not I (being called for short Linker)
1. synthetic primer
(1) nucleotides sequence of forward primer Linker-U is classified as: contain 4 restriction enzyme sites in this primer of 5 '-TCTAGAGGCCTGTCGACGGTACCGGCGGTGGTGGATCTGGT-3 ', that is 4 multiple clone site Xba I have been introduced (TCTAGA-), Stu I (AGGCCT-), Sal I (GTCGAC-) and Kpn I (GGTACC-).
(2) nucleotides sequence of reverse primer Linker-D is classified as: the Not I restriction enzyme site that this primer of 5 '-AATGCGGCCGCACTGCCGCCGCCACCGGA-3 ' has kept the pCANTAB5X carrier (GCGGCCGC-).
2. being template with [G4S] 3/pGEM-T easy plasmid, is primer with Linker-U and Linker-D, and pcr amplification must contain the linking fragment Xba I-Stu I-Sal I-Kpn I-[G4S of 79bp] 3-Not I
Because the dna sequence dna GGC GGTGGT of peptide linker [G4S] 3 genes of [G4S] 3/pGEM-T easy plasmid
TCT GGT GGC GGT
Contain the intestinal bacteria rare codon among the TCC GGT GGC GGC GGC AGT
, the linking fragment of the gained that therefore increases contains the intestinal bacteria rare codon, and its encoded polypeptides joint is made up of 15 amino acid, and aminoacid sequence is Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser.
Two. structure contains and is connected segmental recombinant plasmid Linker/pMD-18T
Above-mentioned linking fragment Linker is directly cloned in pMD-18T carrier (TAKARA company) with the T4 dna ligase, obtain recombinant plasmid Linker/pMD-18T.Through sequencing, the linking fragment of the contained 79bp of this recombinant plasmid and design in full accord.
Three. make up pCANTAB5L reorganization phagemid
Reorganization phagemid pCANTAB5X and recombinant plasmid Linker/pMD-18T use restriction enzyme Xba I and Not I double digestion respectively, reclaim the pCANTAB5X carrier segments of 4.5Kb and the linking fragment of 79bp respectively, with the T4DNA ligase enzyme two kinds of fragments are connected, be pCANTAB5L reorganization phagemid.
Description of drawings:
Fig. 1 is the structure schema of phagemid display carrier pCANTAB5L of the present invention.
Fig. 2 is a linking fragment Linker pcr amplification product electrophorogram of the present invention.
Fig. 3 is the structural representation of phagemid display carrier pCANTAB5L of the present invention.
Fig. 4 is the endonuclease bamhi electrophorogram of phagemid display carrier pCANTAB5L of the present invention.
Embodiment:
The building process of pCANTAB5L, at first synthetic forward primer and the reverse primer that contains multiple clone site, obtain the linking fragment formed by multiple clone site and [G4S] 3 peptide linkers by pcr amplification with it again, should be connected segmental PCR product cloning in the T carrier, after the sequencing checking, to be connected fragment with Xba I and NotI double digestion and be cloned among the Xba I and Not I site of pCANTAB5X phagemid carrier, obtain new phagemid display carrier pCANTAB5L, and make up flow process and see Fig. 1.Now describe in further detail in conjunction with the accompanying drawings.
One: preparation linking fragment Linker (be Xba I-Stu I-Sal I-KpnI-[G4S] 3-Not I)
1. synthetic primer
(1) nucleotides sequence of forward primer Linker-U is classified as: contain 4 restriction enzyme sites in this primer of 5 '-TCTAGAGGCCTGTCGACGGTACCGGCGGTGGTGGATCTGGT-3 ', that is 4 multiple clone site Xba I have been introduced (TCTAGA-), Stu I (AGGCCT-), Sal I (GTCGAC-) and Kpn I (GGTACC-);
(2) nucleotides sequence of reverse primer Linker-D is classified as: the Not I restriction enzyme site that this primer of 5 '-AATGCGGCCGCACTGCCGCCGCCACCGGA-3 ' has kept the pCANTAB5X carrier (GCGGCCGC-).
2. be template with [G4S] 3/pGEM-T easy plasmid, pcr amplification is connected fragment Linker
The dna sequence dna that contains peptide linker Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser in the cloning site of this plasmid, its nucleotides sequence is classified GGC GGTGGT as
TCT GGT GGC GGT
TCC GGT GGC GGC GGC AGT, wherein
Be the intestinal bacteria rare codon.With Linker-U and Linker-D is primer, and amplification obtains dna fragmentation Xba I-StuI-Sal I-Kpn I-[G4S] 3-NotI, promptly be connected fragment Linker, form by 79bp.PCR reaction volume 50 μ l, the PCR reaction buffer is: Repone K 50mmol, magnesium chloride 1.5mmol, three (methylol) aminomethane hydrochloric acid 10mmol, pH8.3 (following all PCR damping fluids all herewith) adds [G4S] 3/pGEM-T easy plasmid 5ng, each 1 μ mol of Linker-U and Linker-D, dNTP 100 μ mol, 1 unit of Taq enzyme.Amplification condition be 94 ℃ 30 seconds; 65 ℃ 30 seconds; 72 ℃ 30 seconds; 35 circulations.The electrophoretogram of pcr amplification product is seen Fig. 2, and the linking fragment PCR products reclaims test kit purifying recovery (down together) with the glue of QIAGEN company.
Two: the nucleotide sequence of checking joining piece
1. prepare recombinant plasmid Linker/pMD-18T
With linking fragment PCR products behind the purifying and pMD-18T carrier (TAKARA company, catalog number (Cat.No.): D504CA) connect, ligation volume 10 μ l, connecting damping fluid is magnesium chloride 10mmol, DTT 10mmol, ATP1mmol, three (methylol) aminomethane hydrochloric acid 30mmol, PH7.8 (following all connection damping fluids are all herewith) adds and is connected fragment PCR products 100ng, pMD-18T carrier 50ng, 1 unit of T4DNA ligase enzyme.Condition of contact is 16 ℃ and spends the night.To connect product and transform DH5 α competence bacteria, conversion condition is for adding 100 μ lDH5 α competence bacteria liquid (OD in above-mentioned connection liquid
600=0.2), 30 minutes, 42 ℃ of ice baths 1 minute, ice bath 2 minutes, add 900 μ l LB substratum (1.0% Tryptoness, 0.5% yeast extract paste, 1.0% sodium-chlor) 37 ℃, 150 rev/mins activation culture are got 100 μ l and are cultivated the LB plate that the coating of bacterium liquid contains 100ng/ μ l penbritin, 37 ℃ of overnight incubation after 1 hour.Transforming 6 conversions of picking bacterium colony on the plate, cultivate a small amount of plasmid extraction test kit of using QIAGEN company in the back and extract the transformant plasmid.
2. the evaluation of recombinant plasmid
Because it is less to insert the fragment molecular weight, be that the transformant plasmid is identified in the primer PCR amplification therefore with above-mentioned Linker-U and Linker-D, the transformant that the result detects all inserts segmental Linker/pMD-18T positive colony for containing 79bp.Entrust Shanghai to give birth to worker's biotechnology Services Co., Ltd and PCR be accredited as male Linker/pMD-18T transformant clone carries out forward and reverse sequence is measured, sequencing primer be pMD-18T universal sequencing primer thing M13 (+)/-.The two measurement result shows that the linking sequence of insertion is in full accord with design.
Three: make up pCANTAB5L reorganization phagemid
1.pCANTAB5L the structure of reorganization phagemid
With recombinant plasmid Linker/pMD-18T Xba I and NotI double digestion, reclaim the linking fragment of 79bp.Same with Xba I and NotI double digestion pCANTAB5X reorganization phagemid, reclaim the pCANTAB5X carrier segments of 4.5Kb.Two fragments connect with the T4 dna ligase, and ligation volume 10 μ l add and are connected fragment 100ng, pCANTAB5X carrier segments 50ng, and damping fluid is the same, and 1 unit of T4 dna ligase, condition of contact are 16 ℃ and spend the night.Connect product with this and transform DH5 α competence bacteria, conversion condition is for adding 100 μ lDH5 α competence bacteria liquid (OD in above-mentioned connection liquid
600=0.2), 30 minutes, 42 ℃ of ice baths 1 minute, ice bath 2 minutes add 900 μ l LB substratum, and 37 ℃, 150 rev/mins activation culture are got 100 μ l and cultivated the LB plate that the coating of bacterium liquid contains 100ng/ μ l penbritin, 37 ℃ of overnight incubation after 1 hour.Transforming 6 conversions of picking bacterium colony on the plate, cultivate the back and extract the transformant plasmid.
2.pCANTAB5L the screening of reorganization phagemid
Carrying out pcr amplification with pCANTAB5E forward sequencing primer pCANTAB5-S1 (5 '-CAACGTGAAAAAATTATTATTCGC-3 ') and pCANTAB5E reverse sequencing primer pCANTAB5-S6 (5 '-GTAAATGAATTTTCTGTATGAGG-3 ') identifies, reaction volume 50 μ l, add transformant plasmid 5ng, each 1 μ mol of pCANTAB5-S1 and pCANTAB5-S6, dNTP 100 μ mol, damping fluid is the same, 1 unit of Taq enzyme.Amplification condition be 94 ℃ 30 seconds; 55 ℃ 30 seconds; 72 ℃ 30 seconds; 30 circulations.Determine that transformant inserts segmental Linker/pCANTAB5X positive colony for containing 79bp, recombinant plasmid called after pCANTAB5L, the structure of pCANTAB5L is seen Fig. 3, wherein Plac is the lac promotor; G3 signal is the signal peptide sequence of PIII gene; MCS is a multiple clone site, contains SfiI, Xba I, Stu I, Sal I, Kpn I restriction enzyme site; (G4S) 3Linker is [G4S] 3 peptide linkers; Amber Stop Codon is the succinic acid mutant terminator codon; Fdgene 3 is the gene order of filamentous phage coat protein PIII; M13 ori is that M13 duplicates Qi Shiqu; AMPr is an ampicillin resistance gene.
3.pCANTAB5L the evaluation of reorganization phagemid
Whether correct for multiple clone site and [G4S] 3 peptide linkers that the pCANTAB5L reorganization phagemid of verifying structure is introduced, the reorganization phagemid is carried out further enzyme cut evaluation and sequencing.
(1) enzyme is cut evaluation
Contain single endonuclease digestion site Xba I, Stu I, SalI, Kpn I in the linking sequence that pCANTAB5L reorganization phagemid inserts, also kept the Not I single endonuclease digestion site on the former pCANTAB5X behind [G4S] 3 peptide linkers, do the single endonuclease digestion analysis with these enzymes respectively, obtain the pCANTAB5L fragment of 4547bp linearity respectively, see among electrophoretogram Fig. 4 the 3rd, 4,5,6,7 swimming lanes; In addition, because an EcoR I single endonuclease digestion site is arranged in the former pCANTAB5X plasmid,, see Fig. 4 swimming lane 1 so produced 3.26Kb and two fragments of 1.27Kb through EcoR I and Not I double digestion, produce 3.19Kb and two fragments of 1.34Kb through EcoR I and Stu I double digestion, seen Fig. 4 swimming lane 2.Enzyme is cut the result and is shown that pCANTAB5L reorganization phagemid structure is correct, contains Xba I, Stu I, Sal I, Kpn I, Not I restriction enzyme site and [G4S] 3 peptide linkers really.
(2) order-checking is identified
Entrust Shanghai living worker's biotechnology Services Co., Ltd that enzyme is cut the reorganization phagemid that is accredited as positive colony and carry out forward and reverse sequence mensuration, the forward sequencing primer is above-described pCANTAB5-S1, reverse sequencing primer is pCANTAB5-S6, the two measurement result shows that the linking fragment sequence of insertion and design are in full accord, and insertion sequence and being connected of on every side pCANTAB5X dna sequence dna entirely true (see nucleotides sequence tabulate 1).
Four: the displaying of pCANTAB5L reorganization phagemid is used
Embodiment 1: use reorganization phagemid carrier pCANTAB5L and show recombinant human lymphotoxin (rhLT) random variation body storehouse
In order to confirm the correctly display function protein variants storehouse of phagemid carrier pCANTAB5L of recombinating, with be cloned in recombinant human lymphotoxin (rhLT) random variation body storehouse on the pGEM-T easy carrier with the two enzymic digestions of Xba I and Kpn I after directed cloning in the multiple clone site of pCANTAB5L, make up the recombinant phage storehouse of showing rhLT random variation body.Specific operation process is as follows:
(1) makes up the recombinant phage of showing rhLT random variation body storehouse
Contain recombinant human lymphotoxin (LT) derivative rhLT random variation body Ku Jiyin on the rhLT/pGEM-T easy plasmid, storage capacity is 1 * 10
6, the recombinant human lymphotoxin of this rhLT genetic expression is at 23 amino acid of N end disappearance, contains Xba I restriction enzyme site at 5 ' end of rhLT gene, 3 ' end contains Kpn I restriction enzyme site.RhLT/pGEM-T easy plasmid Xba I and Kpn I double digestion, the rhLT random variation body storehouse DNA of test kit (the same) recovery is connected with the pCANTAB5L reorganization phagemid fragment that reclaims with Xba I and Kpn I double digestion in advance, ligation volume 50 μ l, add rhLT random variation body storehouse DNA 400ng, pCANTAB5L carrier segments 200ng, damping fluid is the same, and 3 units of T4 dna ligase, condition of contact are 16 ℃ and spend the night.Connect product transformed into escherichia coli TG1, conversion condition is for adding 1ml TG1 competence bacteria liquid (OD in above-mentioned connection liquid
600=0.2), 30 minutes, 42 ℃ of ice baths 1 minute, ice bath 2 minutes.Conversion fluid is added 8ml 2 * YT substratum (1.6% Tryptones, 1% yeast extract paste, 0.5% sodium-chlor), and 37 ℃, 150 rev/mins activation culture add 1ml 4 * 10 after 1 hour
10M13KO7 helper phage (the containing kalamycin resistance) rescue of TU/ml, was cultivated 1 hour for 250 rev/mins by 37 ℃, centrifugal 10 minutes of 1000g, bacterial precipitation suspends with 10ml 2 * YT (containing penbritin 100ng/ μ l and kantlex 50ng/ μ l), and 37 ℃, 250 rev/mins of overnight incubation.The nutrient solution supernatant adds 2ml PEG (20%)/NaCl (2.5mol) post precipitation and is suspended in 10ml 2 * YT substratum, through 0.22 μ m membrane filtration, obtains to show the recombinant phage in rhLT random variation body storehouse.
(2) titre of mensuration rhLT recombinant phage
Get 10 times of serial dilutions of 1 μ l recombinant phage, infect the e. coli tg1 of logarithmic phase, cultivate after 1 hour for 37 ℃ and be coated with LB (containing penbritin 100ng/ μ l) flat board, put 37 ℃ of overnight incubation.Count the colony number on the different extent of dilution plates, the extension rate of growth colony number multiply by the 100 conversion unitss that are every milliliter of phage (transformation unit, TU).Detected result shows that the titre of the recombinant phage in rhLT random variation body storehouse is 2.2 * 10
13TU/ml is 3.1 * 10 with identical method in the titre of the M13KO7 wild type phage that contains count detection on the flat board of kalamycin resistance
13TU/ml, the titre of recombinant phage and the horizontal basically identical of the titre of wild type phage.
(3) randomness of showing rhLT varient storehouse is identified in order-checking:
Whether the rhLT varient of showing in order to verify has randomness, and 30 single bacterium colonies of picking on the counting plate are cultivated the back and extracted the transformant plasmid, identify with Xba I+Kpn I double digestion to be positive colony.10 positive colony plasmids of random choose are identified with pCANTAB5-S1 and the order-checking of pCANTAB5-S6 primer, sequencing result confirms relatively that through the DNASTAR software analysis sequence of inserting is a rhLT varient gene, 10 positive colony sequences are compared, find that 10 rhLT varient nucleotide sequences are all inequality, prove that constructed varient storehouse has good randomness.
The above-mentioned experimental result proof multiple clone site that pCANTAB5L provided can realize the directed cloning in foreign gene varient storehouse easily, simplified the genetic manipulation process, obtained the recombinant phage storehouse of high titre, and can satisfy the randomness and the diversity requirement in varient storehouse, so this carrier is very suitable for display function protein variants storehouse.
Embodiment 2: use reorganization phagemid carrier pCANTAB5L and show macromole polypeptide-staphylococcal protein A,SPA derivative (Mu-protein A):
In order to check pCANTAB5L can correctly show the macromole polypeptide, use Xba I and the two enzymic digestion rear clones of Kpn I to the multiple clone site of pCANTAB5L from pGEM-T easy carrier the gene of staphylococcal protein A,SPA derivative (Mu-protein A), make up the recombinant phage of showing Mu-protein A.Specific operation process is as follows:
(1) make up the recombinant phage of showing Mu-protein A:
Staphylococcal protein A,SPA (Mu-protein A) is made up of 360 amino acid, contains 5 antibodies structural domains.The clone has Mu-protein A gene on the Mu-protein A/pGEM-T easy plasmid, and its 5 ' end contains Xba I restriction enzyme site, 3 ' end contains Kpn I restriction enzyme site.Mu-protein A/pGEM-T easy plasmid reclaims with test kit (the same) with Xba I and Kpn I double digestion fragment, the Mu-protein A fragment of recovery is connected with the pCANTAB5L reorganization phagemid fragment that reclaims with Xba I and Kpn I double digestion in advance, ligation volume 10 μ l, add Mu-protein A fragment 200ng, pCANTAB5L carrier 100ng, damping fluid is the same, and 2 units of T4DNA ligase enzyme, condition of contact are 16 ℃ and spend the night.Connect liquid transformed into escherichia coli TG1 (OD
600=0.2), activation culture adds 1ml 4 * 10 after 1 hour
10The rescue of the M13KO7 helper phage of TU/ml, 37 ℃, 250 rev/mins of shaking culture 1 hour, centrifugal 10 minutes of 1000g, bacterial precipitation suspends with 10ml 2 * YT (containing penbritin 100ng/ μ l and kantlex 50ng/ μ l), and 37 ℃, 250 rev/mins of shaking culture are spent the night.The nutrient solution supernatant adds 2ml PEG/NaCl post precipitation and is suspended in 10ml 2 * YT substratum, through 0.22 μ m membrane filtration, obtains to show the recombinant phage of Mu-protein A.Extract the reorganization phagemid and identify that with pCANTAB5-S1 and the order-checking of pCANTAB5-S6 primer sequencing result confirms relatively that through the DNASTAR software analysis sequence of inserting is a Mu-protein A gene.
(2) titre of mensuration recombinant phage:
Get 10 times of serial dilutions of 1 μ l recombinant phage, detect the recombinant phage titre.The concrete operations step is with the recombinant phage titre detection method in above-mentioned displaying rhLT varient storehouse.As a result, the titre of the recombinant phage of displaying Mu-protein A is 5 * 10
12TU/ml, and the titre of the wild-type M13KO7 helper phage that detects simultaneously is 3.5 * 10
13TU/ml.The result shows that the titre and the wild type phage of the recombinant phage of having showed macromole polypeptide Mu-protein A differ less than 10 times, and both are in same level substantially.Illustrate that this carrier can effectively show the macromole allogenic polypeptide.
(3) mensuration is showed the antibody binding activity of the recombinant phage of Mu-protein A:
In order to measure the Mu-protein A that recombinant phage shows and the binding ability of antibody, recombinant phage is adjusted to identical titre (1.0 * 10 with the M13KO7 helper phage with 2 * YT substratum
12TU/ml) doubling dilution again after is got each dilution phage 100 μ l respectively and is added in the reacting hole of human IgG antibody's wrapper sheet, hatches 3 hours after scouring 50 times for 37 ℃.Reacted sample is divided into two groups, and every hole adds 100 μ l e. coli tg1 (OD in first group of sample hole after recombinant phage and M13KO7 and antibodies
600=0.2), 37 ℃ hatch 1 hour after, Mu-protein A recombinant phage infectious bacteria liquid is coated on the amicillin resistance plate and is counted, the M13KO7 helper phage infectious bacteria liquid of contrast is coated on the kalamycin resistance plate and is counted, be used to detect the quantity by the recombinant phage of the special absorption of human IgG, detected result sees Table 1.Every hole adds phage antibody HRP/Anti-M13 conjugate (Amersham pharmacia biotech company in second group of sample hole after recombinant phage and M13KO7 and antibodies, working concentration is the 1:5000 dilution), hatch for 37 ℃ and add the TMB colour developing after 45 minutes, survey OD
450The nm value is used to detect the quantity by the recombinant phage of the special absorption of human IgG, and detected result sees Table 1.
The human IgG antibody of table 1 Mu-protein A phage is in conjunction with test
Infect the colony number measurement result as seen from the e. coli tg1 of table 1, show Mu-protein A is arranged the phagocytosis physical efficiency by human IgG in conjunction with fixing, and be 1.0 * 10 dropping into phage titre
12~4.0 * 10
9There is obvious dose-effect relationship in the TU/ml scope.Even and contrast wild type phage M13KO7 when high investment titre, still detect less than with human IgG bonded phage.It is in full accord that the detected result and the above-mentioned e. coli tg1 infection colony number measurement result that develop the color are surveyed in the enzyme joint inspection.This presentation of results the macromole polypeptide that merges at the PIU albumen n end can keep its biologic activity and function.The successful displaying of Mu-protein A has confirmed that also [G4S] the 3 flexible peptide linkers between pCANTAB5L foreign protein that carrier is showed and the PHI albumen separate both effectively on room and time, guarantee to be demonstrated the freedom of movement of polypeptide, embodied the outstanding advantage of this carrier when showing large molecular weight protein.
Embodiment 3: use reorganization phagemid carrier pCANTAB5L and show human interferon (hIFN α A-2b):
For whether the reorganization phagemid carrier pCANTAB5L that relatively contains [G4S] 3 peptide linkers can keep its biologic activity than former pCANTAB5X phagemid when the display function albumen better, human interferon-alpha A-2b (hIFN α A-2b) is cloned in the multiple clone site of pCANTAB5L, make up the recombinant phage of showing hIFN α A-2b, with the recombinant phage [Wu Xiaolan etc. that utilize pCANTAB5X carrier displaying hIFN α A-2b, the The 2nd Army Medical College journal, 2000,23 (4): 403] carry out interferon activity relatively.Specific operation process is as follows:
(1) make up the recombinant phage of showing hIFN α A-2b:
Contain human interferon-alpha A-2b gene on the hIFN α A-2b/pGEM-T easy plasmid, the Interferon, rabbit of this genes encoding is made up of 166 amino acid.5 ' end at hIFN α A-2b gene contains Xba I restriction enzyme site, 3 ' end contains Kpn I restriction enzyme site.HIFN α A-2b/pGEM-T easy plasmid XbaI and Kpn I double digestion, be connected with the pCANTAB5L reorganization phagemid fragment that reclaims with Xba I and Kpn I double digestion in advance with the hIFN α A-2b fragment of test kit (the same) recovery, ligation volume 10 μ l, add hIFN α A-2b fragment 200ng, pCANTAB5L carrier segments 100ng, damping fluid is the same, and 2 units of T4DNA ligase enzyme, condition of contact are 16 ℃ and spend the night.Connect liquid transformed into escherichia coli TG1 (OD
600=0.2), activation culture adds 1ml 4 * 10 after 1 hour
10The rescue of the M13KO7 helper phage of TU/ml, 37 ℃, 250 rev/mins of shaking culture 1 hour, centrifugal 10 minutes of 1000g, bacterial precipitation suspends with 10ml 2 * YT (containing penbritin 100ng/ μ l and kantlex 50ng/ μ l), and 37 ℃, 250 rev/mins of shaking culture are spent the night.The nutrient solution supernatant adds 2ml PEG/NaCl post precipitation and is suspended in 10ml 2 * YT substratum, through 0.22 μ m membrane filtration, obtains to show the recombinant phage of hIFN α A-2b.Extract the reorganization phagemid and carry out two-way order-checking evaluation with pCANTAB5-S1 and pCANTAB5-S6 primer, sequencing result confirms relatively that through the DNASTAR software analysis sequence of inserting is a hIFN α A-2b gene.
(2) titre and the biologic activity of mensuration recombinant phage:
Get 10 times of serial dilutions of 1 μ l recombinant phage and detect the recombinant phage titre, the titre that detected result is showed in the hIFN α A-2b recombinant phage of pCANTAB5L carrier is 1.8 * 10
13TU/ml, the titre that detects the hIFN α A-2b recombinant phage that is showed in the pCANTAB5X carrier with identical detection method simultaneously is 1.2 * 10
13TU/ml, both titres are in same level substantially, and the former omits height.With 2 * YT substratum both are adjusted into identical phage titre, carry out serial doubling dilution again, (Wu Xiao orchid etc. is seen in concrete operations to measure biologic activity with conventional cytopathic-effect inhibition assay (CPE) respectively in the VSV-WISH system, the The 2nd Army Medical College journal, 2000,23 (4): 403), cytopathy result measures with conventional mtt assay, the detection wavelength is 570nm, and detected result sees Table 2.
The antiviral activity detected result of table 2 hIFN α A-2b phage
As seen from Table 2, the hIFN α A-2b recombinant phage antiviral activity of showing by pCANTAB5L exceeds 2-3 doubly than the hIFN α A-2b recombinant phage of showing by pCANTAB5X, and tangible dose-effect relationship is arranged.This presentation of results is illustrated in pCANTAB5L and goes up stronger than the hIFN α A-2b antiviral activity that is illustrated on the pCANTAB5X.This result has further confirmed the introducing of [G4S] 3 flexible peptide linkers and the use of intestinal bacteria rare codon, helps the formation of displayed polypeptides native conformation and keeping of active function.
Nucleotides sequence tabulation 1.pCANTAB5L is connected fragment and sequence on every side thereof
Claims (2)
1. phagemid display carrier pCANTAB5L, form by the nucleotide fragments that inserts between phagemid pCANTAB5X and contained Sfi I and the Not I restriction enzyme site, it is characterized in that the nucleotide fragments of said insertion is respectively: the nucleotide fragments TCTAGAGGCCTGTCGACGGTACC that contains Xba I, StuI, Sal I and Kpn I restriction enzyme site; The flexible peptide linker gene [G4S] 3 that inserts between Kpn I and Not I restriction enzyme site, the nucleotides sequence of [G4S] 3 is classified GGC GGT GGT as
GGATCTGGT GGC GGT
GGATCC GGT GGC GGC GGC AGT, wherein
GGABe the intestinal bacteria rare codon of introducing.
2. the described phagemid display carrier of claim 1 is used to show the purposes of various random peptide libraries, function target protein, function target protein varient storehouse and macromolecule functional protein.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB021550255A CN100457910C (en) | 2002-12-19 | 2002-12-19 | Phasmid display carrier pCANTAB5L |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB021550255A CN100457910C (en) | 2002-12-19 | 2002-12-19 | Phasmid display carrier pCANTAB5L |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1508254A CN1508254A (en) | 2004-06-30 |
CN100457910C true CN100457910C (en) | 2009-02-04 |
Family
ID=34235659
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB021550255A Expired - Fee Related CN100457910C (en) | 2002-12-19 | 2002-12-19 | Phasmid display carrier pCANTAB5L |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN100457910C (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102676569A (en) * | 2012-05-08 | 2012-09-19 | 百泰生物药业有限公司 | Novel phagemid display vector pCANTAB5M |
CA3003911C (en) * | 2015-11-25 | 2021-05-04 | Eli Lilly And Company | Phage display vectors and methods of use |
CN110055594A (en) * | 2019-05-10 | 2019-07-26 | 艾柏森(江苏)生物科技有限公司 | A kind of phasmid display systems building polypeptide libraries method |
CN113528467B (en) * | 2021-06-24 | 2023-12-01 | 新乡学院 | Targeting double-display phage and preparation method and application thereof |
CN113403286B (en) * | 2021-06-24 | 2024-01-16 | 新乡学院 | Targeting three-display phage and preparation method and application thereof |
CN114672476A (en) * | 2022-01-14 | 2022-06-28 | 复旦大学附属中山医院 | Dominant conformation epitope of human PCSK9 protein and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE19646108A1 (en) * | 1996-11-08 | 1998-05-14 | Barth Stefan Dr Rer Nat | Vector for immuno-toxin expression |
-
2002
- 2002-12-19 CN CNB021550255A patent/CN100457910C/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE19646108A1 (en) * | 1996-11-08 | 1998-05-14 | Barth Stefan Dr Rer Nat | Vector for immuno-toxin expression |
Also Published As
Publication number | Publication date |
---|---|
CN1508254A (en) | 2004-06-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5844094A (en) | Target binding polypeptide | |
US5498538A (en) | Totally synthetic affinity reagents | |
Cortese et al. | Epitope discovery using peptide libraries displayed on phage | |
Hansson et al. | Design and production of recombinant subunit vaccines | |
Benhar | Biotechnological applications of phage and cell display | |
US7704953B2 (en) | Phage displayed cell binding peptides | |
JP4458844B2 (en) | pgsBCA, vector for surface expression having a gene encoding poly-γ-glutamate synthetase, and method for microbial surface expression of target protein using the same | |
US20040242517A1 (en) | Mutable Vaccines | |
Russel et al. | Filamentous phage | |
CN102365361A (en) | Protein having affinity for immunoglobulin, and immunoglobulin-binding affinity ligand | |
Perham et al. | Engineering a peptide epitope display system on filamentous bacteriophage | |
EP0584167A1 (en) | Recombinant dna coding for signal peptide, selective interacting polypeptide and membrane anchoring sequence | |
JP7170129B2 (en) | Simultaneous surface expression vector for two target proteins using two promoters derived from Lactobacillus casei, and method for microbial surface expression of proteins using the same | |
CN100457910C (en) | Phasmid display carrier pCANTAB5L | |
JP2011507521A (en) | Human non-antibody peptide or protein phage library | |
CN101151272A (en) | Recombinant icosahedral virus like particle production in pseudomonads | |
CN1972710B (en) | Methods and compositions comprising bacteriophage nanoparticles | |
Wang et al. | Immunogenicity of viral B-cell epitopes inserted into two surface loops of the Escherichia coli K12 LamB protein and expressed in an attenuated aroA strain of Salmonella typhimurium | |
US20030224410A1 (en) | Combined ligand and receptor display | |
Beckers et al. | Increasing the immunogenicity of protein antigens through the genetic insertion of VQGEESNDK sequence of human IL-1 beta into their sequence. | |
CN101348521A (en) | Aminoacid mimic epitope of human B lymphocyte stimulating factor receptor and use thereof | |
CN113527516A (en) | A-type seneca virus genetic engineering composite epitope protein, vaccine and application thereof | |
Kim et al. | Screening of peptides bound to anthrax protective antigen by phage display | |
Van Gerven et al. | Presentation of the functional receptor-binding domain of the bacterial adhesin F17a-G on bacteriophage M13 | |
KR20100072848A (en) | Method for cell surface display of target proteins using ompw of e. coli |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090204 Termination date: 20111219 |