CN100455667C

CN100455667C - Fusion gene vector construction and expression as well as uses

Info

Publication number: CN100455667C
Application number: CNB2006101552014A
Authority: CN
Inventors: 童向民; 金洁; 姚航平
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2006-12-14
Filing date: 2006-12-14
Publication date: 2009-01-28
Anticipated expiration: 2026-12-14
Also published as: CN1995356A

Abstract

The invention discloses a cell factor fusing protein of human terminal-enzyme reverse transcriptase (hTERT)/human leucocyte 18(hIL18), which is characterized by the following: targeting tumour cell to kill; improving immune effect for dendritic cell; expanding tumour-proof scale; reducing medical cost obviously; providing the base of treating vaccine for tumour.

Description

A kind of construction expression of fusion gene carrier and application

Technical field

The invention belongs to biotechnology, relate to a kind of construction expression and the application in preparation tumor biotherapy medicine of fusion gene carrier.

Background technology

Interleukin-18 (IL-18) is a kind of novel cytokine of nineteen ninety-five clone, claims the IFN-inducible factor again.Can stimulate the secretion of IFN-, strengthen the immune response of Th I type.The early stage research that induces IL-18 mainly concentrates on liver, has the investigator to obtain IL-18 cDNA with the scavenger cell of vitro culture through suitably inducing afterwards.This research directly amplifies the IL-18 gene through the RT-PCR method from the monocytic RNA of healthy human peripheral blood, illustrate under the physiological conditions, and monocyte just has the expression of IL-18 MRNA.On function, IL-18 more approaches IL-12, is considered to a kind of very potential antitumor, anti-infectious cytokine.In recent years the IL-18 that discovers can promote the maturation of DC, significantly improve the antigen presentation function of DC, and can attract II class DC and induce the immune response of Th I type, after the DC treatment of report such as domestic Chen Ji spring with mIL-18 genetic modification and 3LL Lewis lung cancer cell extract sensitization, the mouse lung metastatic carcinoma has obvious suppression, lung shifts tubercle to be reduced, and CTL, NK killing activity significantly strengthen, but this CTL effect is only at 3LL Lewis lung cancer cell, and other tumor cell lines are not almost had lethal effect.

Studies show that at present all there is high-caliber telomerase activation in most human malignancies, telomerase activation is considered to tumour cell and continues to grow necessary.And constitute the Telomerase mixture composition--human telomerase reverse transcriptase (hTERT) is the catalytic subunit of Telomerase, be the rate-limiting factor of Telomerase, in the generation of the activation of Telomerase and tumour, play a crucial role, also be the main factor of anti-apoptotic.Recently, it is model that Nair etc. report with the mouse on Natural Medicine, will produce antitumor action behind the hTERT mRNA transfection DC, and tumour is obviously dwindled, and prolong lifetime.Zhen Su etc. report on the CancerResearch that in 2002 the mRNA transfection DC of personnel selection reverse transcriptase of telomere (hTERT) coding has potential and induces CTL and antitumor immune function.Vonderheide etc. also have similar research, and the tumour cell of expressing at TERT all has lethal effect.

Continuous development along with molecular biology, immunological technique, add the introducing of computer technology, with function class like or 2 kinds of cytokines having complementary functions, obtain the achievement that attracts people's attention by the manual splice transformation and the research of constructing cell factor fusion protein with complex function.(when the biologic activity of this fusion rotein is two factor fit applications 10～30 times have entered the III clinical trial phase from constructing the IL-3/GM-CSF fusion rotein.) since, albumen produces in succession.Experiment shows that these fusion roteins have not only kept the function of each factor before the fusion, and may produce the biological effect of stronger renewal.

PCDNA3.1 (+)/hTERT-hIL18 that the present invention makes up all reaches 99.9% through restriction enzyme checking and dna sequencing and this gene fragment of homology comparative analysis and NCBI gene pool hIL-18 and hTERT gene C DS sequence homology, the research of recent xia etc. confirms that also IL-18 and the common bound energy of tumour antigen obviously strengthen the antitumor action of DC, and does not have the negative sense influence.Why the present invention is structured in formation fusion gene transfection on the together individual carrier with both, is because compare the efficient height of transfection with the transfection of two individual genes difference.The cotransfection of individual gene can not guarantee that two genes all are transfected into a cell, thereby can not bring into play TERT simultaneously to the hormesis of DC and the effect of the remarkable enhancement antigen submission of IL-18.

Summary of the invention

The purpose of this invention is to provide human telomerase reverse transcriptase (hTERT)/human interleukin-18 (hIL18) fusion rotein carrier, SEQ ID NO:1 is the gene order of this fusion rotein.

Second purpose of the present invention provides the structure of human telomerase reverse transcriptase (hTERT)/human interleukin-18 (hIL18) fusion rotein carrier, realizes by following steps:

1.PCR primer: the design of primers of IL-18 gene clone adopts computer aided design (CAD) with reference to the Genebank login sequence, and synthetic by Shanghai Bo Ya company, sequence is as follows:

Primer 1:CTG GCTAGCATGGCTGCTGAACCAGTAGAAG (Nhe I site).

Primer 2: GGG AAGCTTGTCTTCGTTTTGAACCAGTGA (Hind III site).

The structure of (2.PCDNA3.1+)/hTERT-hIL18 plasmid

(1) sample of taking of sample is 10 milliliters of normal people's peripheral bloods, and lymphocyte separation medium separates mononuclearcell.

(2) RNA extracts and extracts total RNA (step is undertaken by its specification sheets) with the Trizol test kit, detects A260/A280＞1.8.

(3) the synthetic reverse transcription test kit that adopts Promega company of the synthetic and gene amplification hIL18 cDNA of hIL18 cDNA.The PCR method is adopted in gene amplification, and the PCR product detects through 2% agarose gel electrophoresis and has or not goal gene.

(4) structure of PCDNA3.1 (+)/hTERT-hIL18 plasmid: with IL-18PCR amplification, electrophoresis, recovery and purifying fragment, by T-A clone, subclone is in PCDNA 3.1 (+)/hTERT plasmid between Nhe I and the Hind III site after dna sequencing is identified.Insert straight chain amino acid two gene joining regions, after the connection, with calcium chloride precipitator method transformed into escherichia coli DH5 α, be inoculated in the agar plate that contains ammonia benzyl resistance, select positive bacterium colony, be inoculated in 2 milliliters of LB liquid nutrient mediums that contain the ammonia benzyl and spend the night the extracting plasmid.

The evaluation of (3.PCDNA3.1+)/hTERT-hIL18 fusion gene

(1) enzyme of PCDNA 3.1 (+)/hTERT+hIL-18 is cut evaluation

The a small amount of plasmid that extracts is respectively through Nhe I, Not I double digestion; Nhe I, Hind III double digestion and EcoR I, Not I double digestion, enzyme is cut product behind 1% agarose gel electrophoresis, has judged whether hIL-18 according to the size of molecular weight, hTERT and hTERT+hIL-18 fragment,

(2) dna sequence analysis of PCDNA 3.1 (+)/hTERT+hIL-18: male hTERT+hIL-18 fusion gene cloning, the analysis of dna sequence dna entrusts Shanghai Bo Ya Bioisystech Co., Ltd to finish.

Another object of the present invention provides the expression of human telomerase reverse transcriptase (hTERT)/human interleukin-18 (hIL18) fusion rotein carrier, realizes by step once:

1. transfecting eukaryotic cells

The 3T3 cell of cultivating is pressed 1 * 10 ⁵24 orifice plates are inoculated in/hole, cultivate 24h and reach 80%-85% to cell, then by reagent specification sheets step lipofectamine ^TM2000 respectively parcel need transfection plasmid to Opti-MEM I substratum (Invitrogen company) and mixing, dropwise adding has been changed in the 3T3 cell of serum free medium, changes the DMEM of 20% foetal calf serum after the transfection in 6 hours.

2. immunofluorescence dyeing

1 porocyte immunofluorescence dyeing behind the transfection 48h: the hTERT one that the fixing back of dehydrated alcohol added 1: 50 resists, room temperature 90m, and PBS washing back adds two fluorescently-labeled 1: 200 anti-(FITC) 30m, and PBS washs the back and observes under inverted fluorescence microscope.

3.Western-blot detection Expression of Fusion Protein

Collect 5 * 10 ⁶Individual cell is with whole-cell protein extraction agent box.After 40 μ g protein samples add that the sample damping fluid boils sex change, carry out 10%SDS-PAGE, and be transferred to pvdf membrane, skim-milk sealing with 5% 1 hour added anti-human il-18 (1: 1000, Santa Cruz), anti-people TERT respectively (1: 1000, Santa Cruz), in 4 ℃ of refrigerator overnight, wash film 3 times, add two of HRP mark and resist (1: 2000, SantaCruz), room temperature reaction 2 hours is done the ECL chemoluminescence, X sheet exposure imaging after washing film.Result and MARKER (Novagen 71047-3) be the molecular weight size of TERT/IL-18 relatively.

Another purpose of the present invention provides the application of this fusion gene carrier in preparation tumor biotherapy medicine.

The usefulness of invention is:

1. utilize genetic engineering technique, with function class like or 2 kinds of cytokines having complementary functions, by the manual splice transformation and construct cell factor fusion protein with complex function.

2.IL-18 with the TERT expressing fusion protein, make it might both have the characteristics strong, the immunological effect that can obviously improve the dendritic cell mediation arranged to the tumor cytotoxicity target.

3. established experiment basis for preparation ideal dendritic cell vaccine, further the vaccine of research is used to eliminate minimal residual disease, reaches the suitable curative effect of allogeneic bone marrow transplantation at patients with malignant hematological diseases.Estimate that every routine patients ' expenses reduces more than 200,000 yuan than allogeneic bone marrow transplantation, can obviously reduce medical expense.

4. the fusion gene of the present invention's structure confirms through immunofluorescence dyeing and Western bloting, can efficiently express fusion rotein in eukaryotic cell.Simultaneously, the IL-18 of this fusion gene can stimulate KG-1 emiocytosis IFN-, and TERT albumen can be brought into play the apoptosis-induced ability of anti-MTX, illustrates that IL-18 and the TERT in the fusion rotein can both bring into play biological function separately, and does not disturb mutually.

5. Expression of Fusion Protein of the present invention and biological function are measured, for later transfection DC establishes experiment basis, promptly can strengthen the immune response of dendritic cell mediation, enlarge the antitumor scope of dendritic cell mediation simultaneously, be the immune response of performance Dendritic Cells Induced, development tumor treatment vaccine provides the basis.

Description of drawings

Fig. 1 is the SDS-PAGE electrophorogram of the RT-PCR product of IL-18 cDNA;

Fig. 2 cuts the SDS-PAGE electrophorogram of after product for the fusion gene enzyme;

Fig. 3 is the sequencing figure of fusion gene carrier PCDNA 3.1 (+)/hTERT+hIL-18CDNA;

Fig. 4 is transfection hIL-18, and the DC inductive CTL of hTERT and hTERT+hIL-18 is to the comparison of K562 and A549 lethal effect;

Fig. 5 is the same visual field contrast figure for 3T3 cell expressing hTERT/IL-18 fusion rotein (green fluorescence) right side;

Fig. 6 is that 3T3 cell expressing hTERT/IL-18 fusion rotein Western bloting detects figure;

Fig. 7 stimulates KG-1 emiocytosis gamma-interferon figure for the hTERT/IL-18 fusion rotein;

Fig. 8 is apoptosis-induced the trying hard to of the anti-MTX of hTERT/IL-18 fusion rotein transfectional cell.

Embodiment

The present invention is further described in conjunction with the accompanying drawings and embodiments.

Embodiment one

1. material

1.1.1 bacterial strain and plasmid competent escherichia coli cell DH 5 α; Eukaryon expression plasmid PCDNA3.1 (+)/hTERT and PCDNA3.1 (+).

1.1.2 reagent restriction enzyme Hind III, Nhe I, EcoR I, Not I, T4DNA ligase enzyme, Taq archaeal dna polymerase, dNTPs, reverse transcription test kit, plasmid extraction test kits etc. are all available from U.S. Promega company; IL-18 and TERT antibody and gamma-interferon ELISA test kit are available from R﹠amp; D company, the total RNA extraction reagent box is an Invitrogene company product; The apoptosis detection kit is available from Bender company; MTX is available from Sigma company; Microbial culture such as yeast extract, Tryptones reagent is Britain Oxford product; It is Sangon company product that agarose, RNA enzyme, glue reclaim test kit; Calcium chloride, SDS, lymphocyte separation medium, sodium-acetate are domestic reagent.

1.1.3 the design of primers of PCR primer I L-18 gene clone with reference to the Genebank login sequence, adopts computer aided design (CAD), synthetic by Shanghai Bo Ya company, sequence is as follows:

Primer 1:CTG GCTAGCATGGCTGCTGAACCAGTAGAAG (Nhe I site).

Primer 2: GGG AAGCTTGTCTTCGTTTTGAACCAGTGA (Hind III site).

2. method

2.1 the structure of human telomerase reverse transcriptase (hTERT)/human interleukin-18 (hIL18) carrier

2.1.1 the structure of PCDNA3.1 (+)/hTERT-hIL18 plasmid

2.2 the evaluation of PCDNA3.1 (+)/hTERT-hIL18 fusion gene

2.2.1 the enzyme of PCDNA 3.1 (+)/hTERT+hIL-18 is cut evaluation

2.2.2 the dna sequence analysis of PCDNA 3.1 (+)/hTERT+hIL-18: male

The hTERT+hIL-18 fusion gene cloning, the analysis of dna sequence dna entrusts Shanghai Bo Ya Bioisystech Co., Ltd to finish.

2.2.3 the expression of human telomerase reverse transcriptase (hTERT)/human interleukin-18 (hIL18) carrier

(1) transfecting eukaryotic cells

(2) immunofluorescence dyeing

(3) Western-blot detects Expression of Fusion Protein

The biological function of embodiment two human telomerase reverse transcriptases (hTERT)/human interleukin-18 (hIL18) fusion gene detects

1. fusion gene stimulates the biological function of KG-1 emiocytosis gamma-interferon to detect

The detection of cell culture supernatant gamma-interferon content: take out the 3T3 cell culture supernatant 0.1ml of transfection fusion gene, from 1 * 10 ⁶Get 0.1ml to 96 orifice plate in the KG-1 cell of/ml, respectively with stoste, dilution in 1: 2, dilution in 1: 5, dilution in 1: 10, dilution in 1: 20, normal 3T3 cell culture supernatant (negative control), and standard I L-18 stimulation fluid (positive control) and blank (PBS).Each concentration is established 3 multiple holes.Adopt quantitative Enzyme-multiplied immune technique (ELISA method), undertaken by test kit specification sheets operation steps.Survey absorbancy (A value) at microplate reader 490nm wavelength place.Calculate according to the CurveExpert software analysis.

2. the Function detection of the anti-apoptosis of fusion gene

Listen (MTX) with known inducer of apoptosis first ammonia butterfly, respectively with different concns 0nm, 1nm, 10nm, 50nm, 100nm act on 5 * 10 of transfection ⁵/ ml 3T3 cell and normal 3T3 cell 24 hours.Operate with reference to Annexin V apoptosis test regent box specification sheets.Collecting cell, cold PBS washing 2 times, 1000rpm/min is centrifugal, and 4 ℃ of 7min abandon supernatant.Cell is resuspended in 1ml 1 * Bindingbuffer, get 100 μ l cells and place the special-purpose test tube of flow cytometer, add 5 μ l Annexin V FITC and 5 μ lPI, mixing gently, lucifuge room temperature reaction 15min, add 300 μ l, 1 * Binding buffer, detect Cellquest 1.2 analysis software results immediately with flow cytometer.

Embodiment three

1. fusion gene electrotransfection dendritic cell

(1) gets 2 * 10 ⁶Individual cell after the substratum of usefulness serum-free antibiotic-free washs 2 times, is suspended in the hypo-osmolar of 400 microlitres

Buffer (Eppendorf company product) electricity changes damping fluid.

(2) get the aseptic apyrogenic fusion gene plasmid of 10 micrograms and be added in the above-mentioned cell suspension, behind the soft mixing, be transferred to (Electroporation cuvette) 2mm spacing in the electric revolving cup of 400 microlitres, the 400ul volume.

(3) electric revolving cup is placed electroporation (Multiporator Eppendorf), 300V/20us rush of current 2 times, during 1 minute at interval.

(4) cell after sucking-off electricity changes contains the substratum washed cell 2 times (800rpm * 5min) of serum with 10ml; And be incubated in the RPMI1640 substratum of 15%FCS.

2. the detection of the external evoked and killing activity of cytotoxic T lymphocyte (CTL)

Separate the T lymphocyte of normal people's peripheral blood, hatched jointly 5 days in containing the RPMI1640 perfect medium of IL-250U/ml 15%FCS with the DC after the fusion gene transfection, ratio is that T: DC is 30: 1, the 5th day collection viable cell action effect cell, ⁵¹The K562 cell of the hTERT high expression level of Cr mark 1h, is used with 100: 1,50: 1,25: 1 different effect target ratios as target cell ⁵¹Cr 4h method for releasing detects the activity of CTL, establishes maximum release group and natural release group simultaneously, simultaneously with the synovial cell that takes from normal people cell (no hTERT expression) in contrast.Calculate kill rate with following formula: kill rate=(experimental group cpm-nature release group cpm)/(maximum release group cpm-nature release group cpm) * 100%.

The result:

1. the preliminary evaluation of reorganization IL-18cDNA RT-PCR product

According to designed primer, estimate that the size of amplified fragments is about 510BP, the band that 2% agargel electrophoresis shows meets the dna fragmentation of expection substantially, referring to Fig. 1, wherein: 1 IL-18 cDNA (510bp); 2 negative controls.Illustrate that amplified production is an IL-18 CDNA fragment.Illustrate that amplified production is an IL-18 CDNA fragment.

2. the enzyme of plasmid PCDNA3.1 (+)/hTERT+hIL-18 is cut evaluation

To get the preliminary extracting plasmid of bacterium liquid after the positive colony amplification of picking out, respectively behind Nhe I/Not I, Nhe I/Hind III and three pairs of endonuclease digestions of EcoR I/Not I, 1% agargel electrophoresis shows three bands that molecular weight varies in size, referring to Fig. 2,1:PCDNA3.1 (+)/hTERT+IL-18 cuts through Nhe I/Hind III enzyme among the figure, 2:PCDNA3.1 (+)/hTERT+IL-18 cuts through EcoR I/NotI enzyme, 3:PCDNA3.1 (+)/hTERT+IL-18 cuts through Nhe I/Not I enzyme, 4:PCDNA3.1 (+) (5428bp).Nhe I/Hind III double digestion is seen the band (hIL-18) of molecular weight 510bp size, confirms the big or small consistent of the fragment inserted and pcr amplification product, and the clone who is screened contains the IL-18cDNA fragment.Behind the EcoR I/Not I double digestion, see the band (hTERT) of molecular weight 3.4Kb size, behind the Nhe I/Not I double digestion, can see the band (hTERT+hIL-18) about the about 3.9Kb of molecular weight, confirm the fusion gene of PCDNA3.1 (+)/hTERT+IL-18.

The sequencing of (3.PCDNA3.1+)/hTERT+IL-18 CDNA:

With plasmid PCDNA3.1 (+)/hTERT+IL-18DNA order-checking (referring to Fig. 3) and this gene fragment of homology comparative analysis and Http:// ncbi.nlm.nih.govGene database (AllGenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0,1 or2 HTGS sequences) relatively the previous section of fusion gene and the coincidence rate of hIL-18 gene are 570/574 (99%), the coincidence rate of the previous section of fusion gene and hTERT gene is 395/406 (97%), and with the coincidence rate of hTERT promoter gene be 221/222 (99%).The result shows that constructed cDNA fragment promptly is the encoding gene that people TERT and IL-18 merge.The enzyme point of contact of the dna sequence dna AAGCTT:IL-18Hind III of fusion gene carrier PCDNA 3.1 (+) among Fig. 3/hTERT+hIL-18 connection portion; The enzyme point of contact of GAATTC TERT EcoR I.

CTL cell the killing and wounding that embodiment four is vaccine-induced to leukemia and lung carcinoma cell

1. to expressing the leukemia of hTERT and killing and wounding of lung cancer cell line

With fusion gene (hTERT+hIL-18) and hTERT, the DC after the hIL-18 transfection stimulates to induce to form the CTL cell respectively, the action effect cell, ⁵¹The leukemia cell K562 of the hTERT high expression level of Cr mark 1h and lung cell A549 cell strain with above-mentioned different effect target ratio, detect the activity of CTL, according to the aforementioned calculation formula as target cell.

2. experiment in vitro shows, the DC of fusion gene transfection induces the CTL cell that stimulate to form that leukemia cell and the lung carcinoma cell of high expression level hTERT are all had stronger lethal effect.Under 25: 1,50: 1,100: the 1 different effect target ratios, the CTL cell that the DC of transfection fusion gene (hTERT+hIL-18) stimulates is respectively (18.1% to the kill rate of K562; 32.7%; 47.6%), the kill rate to A549 is (16.2%; 29.8%; 45.3%).The CTL cell that the DC of transfection hTERT stimulates is respectively (17.3% to the kill rate of K562; 28.6%; 40.9%), the kill rate to A549 is respectively (14.4%; 23.5%; 40.1%) the CTL cell of the DC of transfection hIL-18 stimulation is respectively (12.8% to the kill rate of K562; 18.8%; 26.7%), the kill rate to A549 is respectively (12.2%; 18.7%; 25.9%), referring to Fig. 4, under same experiment condition, the normal synovial cell that hTERT is not had an expression does not have lethal effect, and (kill rate is respectively 9.7%; 15.6%; 18.4%).This shows, the DC of transfection fusion gene stimulates inductive CTL that leukemia and the lung carcinoma cell of high expression level hTERT are all had lethal effect, though the DC inductive CTL effect of hTERT and hTERT+hIL-18 transfection does not have notable difference (p＞0.05), its lethal effect still has raising.And the DC inductive CTL effect of transfection hIL-18 only, owing to there is not the stimulation of tumour antigen, its CTL effect is lower (p＜0.05).So experiment in vitro has been verified our imagination, so also established experiment basis for preparation ideal dendritic cell vaccine.Fig. 4 A is the CTL lethal effect of K562, and Fig. 4 B is the CTL lethal effect of A549.

Embodiment five Expression of Fusion Protein are identified

1. the identified by immunofluorescence of expression product: immunofluorescence dyeing shows that the fusion rotein disperse is expressed in endochylema behind the 48h, referring to Fig. 5, for 3T3 cell expressing hTERT/IL-18 fusion rotein (green fluorescence) right side is the same visual field contrast.

2. the Western bloting of expression product identifies

Cell extraction whole protein after the collection transfection adds anti-human il-18 (referring to Fig. 6), anti-people TERT antibody (figure shows) respectively, and the destination gene expression product can combine with hTERT antibody and hIL-18 antibodies specific respectively.Can see behind the X sheet exposure imaging about the about 127KD of fusion protein molecule amount, consistent with expection.Confirmed hTERT/hIL-18 fusion gene successful expression in the 3T3 cell.Fig. 6 is that 3T3 cell expressing hTERT/IL-18 fusion rotein Western bloting detects.

The biological function of embodiment six hTERT/IL-18 fusion roteins detects

1. fusion rotein can obvious stimulation KG-1 emiocytosis gamma-interferon.The ability of normal 3T3 cell conditioned medium and blank group stimulation KG-1 emiocytosis gamma-interferon obviously a little less than, with the stoste group obvious significant difference (p＜0.05) is arranged.Stoste stimulates the ability similar to standard substance (p＞0.05) of KG-1 emiocytosis gamma-interferon.Along with the extension rate of supernatant increases, stimulate the ability of the KG-1 emiocytosis gamma-interferon (see figure 7) that progressively descends.

2. the apoptosis-induced biological function of the anti-MTX of fusion rotein detects: Annexin V ^FITCAnd PI ^PEThe flow cytometer detected result shows after the double labeling cells, MTX 0-100nm effect 24h, normal 3T3 apoptosis (AnnexinV ^FITCPositive LR+UR quadrant) percentage ratio is respectively 0.71%; 2.46%; 4.19%; 6.68%; 10.81%, the groups of cells of transfection fusion gene is respectively 0.82%; 1.90%; 2.13%; 2.72%; 2.94% (Fig. 8); From above data as can be known, along with drug level rises, normal cell group apoptosis number increases; And the groups of cells apoptosis of transfection fusion gene not obvious (between above normal group of 10nm concentration and transfection group, significant difference being arranged).

3. purposes

Preliminary experiment shows; external evoked CTL cell has stronger lethal effect to the cell of high expression level hTERT; and the normal synovial cell that hTERT does not have an expression is not had lethal effect, verified the imagination of this experiment, for preparation ideal dendritic cell vaccine has been established experiment basis.

Need not further to elaborate, believe and adopt the disclosed content in front, those skilled in the art can use the present invention to greatest extent.Therefore, the embodiment of front is interpreted as only illustrating, but not limits the scope of the invention by any way.

The sequence that the present invention relates to

＜110〉Zhejiang University

＜120〉a kind of construction expression of fusion gene carrier and purposes

<160>3

<170>PatentIn?Version?2.1

<210>1

<211>1033

<212>DNA

＜213〉artificial sequence

<220>

<221>CDS

<222>(1)…(583) (619)…(624) (629)…(1033)

＜223〉n=a or g or c or t

<400>1

ATGgGCTGAC?CAGTAGAAGA?CAATTGCATC?AACTTTGTGG?CAATGAAATT?TATTGACAAT 60

aCGTTtTact?TTATAGCTGA?AGATGATGAA?AACCTGGAAT?CaGATTActT?TGGCAAGCTT 120

GAATCTAAAT?TATCAGTCAT?AAGAAATTTG?AATGACCAAG?TTCTCTTCAT?TGACCAAGGA 180

AATCGGCCTC?TATTTGAAGA?TATGACTGAT?TCTGACTGTA?GAGATAATGC?ACCCCGGACC 240

ATATTTATTA?TAAGTATGTA?TAAAGATAGC?CAGCCTAGAG?GTATGGCTGT?AACTATCTCT 300

GTGAAGTGTG?AGAAAATTTC?AACTCTCTCC?TGTGAGAACA?AAATTATTTC?CTTTAAGGAA 360

ATGAATCCTC?CTGATAACAT?CAAGGATACA?AAAAGTGACA?TCATATTCTT?TCAGAGAAGT 420

GTCCCAGGAC?ATGATAATAG?GATGCAATTT?GAATCTTCAT?CATACGAAGG?ATACTTTCTA 480

GCTTGTGAAA?AAGAGAGAGA?CCTTTTTAAA?CTCATTTTGA?AAAAAGAGGA?TGAATTGGGG 540

GATAGATCTA?TAATGTTCAC?TGGTTCAAAA?CGAAGACAAG?CTTGGTACCG?AGCTCGGATC 600

CACTAGTCCA?GTGTGGTGGA?ATTCCACCAT?GCCGCGCGCT?CCCCGCTGCC?GAGCCGTGCG 660

CTCCCTGCTG?CGCAGCCACT?ACCGCGAGGT?GCTGCCGCTG?GCCACGTTCG?TGCGGCGCCT 720

GGGGCCCCAG?GGCTGGCGGC?TGGTGCAGCG?CGGGGACCCG?GCGGCTTTCC?GCGCGCTGGT 780

GGCCCAGTGC?CTGGTGTGCG?TGCCCTGgGA?CGCACGGCCG?CCCCCCGCCG?CCCCTCCTTC 840

CGCCAGGTGT?CCTGCCTGAA?GGAGCTGGTG?GCCCGAGTGC?TGCAGAGGCT?GTGCGAGCGC 900

GGCGCGARAC?GTGCTGGCCT?TCGGCTTCSC?GCTGCTGGAC?GGGGCCGCGG?GGCCCCCCGA 960

GGTCTTCACC?ACAGCGTGCG?CAGCTACCTG?CCCAACACGG?TGACCGACGC?ACTGSCGGGG 1020

GAGCGGGCGT?GGG 1033

<210>2

<211>31

<212>DNA

＜213〉artificial sequence

<220>

<221>CDS

<222>(4)…(9)

＜223〉n=a or g or c or t

<400>1

CTGGCTAGCATGGCTGCTGAACCAGTAGAAG 31

<210>3

<211>30

<212>DNA

＜213〉artificial sequence

<220>

<221>CDS

<222>(4)…(9)

＜223〉n=a or g or c or t

<400>1

GGGAAGCTTGTCTTCGTTTTGAACCAGTGA 30

Claims

1. carrier that contains the encoding sequence of human telomerase reverse transcriptase/human interleukin-18 fusion rotein, described encoding sequence is SEQ ID NO:1.

2. according to the described construction of carrier of claim 1, it is characterized in that realizing by following steps:

The structure of PCDNA3.1 (+)/hTERT-hIL18 plasmid: sample is 10 milliliters of normal people's peripheral bloods, lymphocyte separation medium separates mononuclearcell, extract total RNA with the Trizol test kit, detect A260/A280＞1.8, the synthetic reverse transcription test kit that adopts Promega company of hIL18cDNA, the PCR method is adopted in gene amplification, the PCR product detects through 2% agarose gel electrophoresis and has or not goal gene, IL-18PCR is increased, electrophoresis, reclaim and the purifying fragment, clone by T-A, subclone is in PCDNA 3.1 (+)/hTERT plasmid between Nhe I and the Hind III site after dna sequencing is identified, insert straight chain amino acid two gene joining regions, after the connection, with calcium chloride precipitator method transformed into escherichia coli DH5 α, be inoculated in the agar plate that contains ammonia benzyl resistance, select positive bacterium colony, be inoculated in 2 milliliters of LB liquid nutrient mediums that contain the ammonia benzyl and spend the night the extracting plasmid.

3. construction of carrier according to claim 2, it is characterized in that: used two kinds of primers in the described PCR method, PCR primer 1:CTGGCTAGCATGGCTGCTGAACCAGTAGAAG wherein, it has the NheI restriction enzyme site, primer 2: GGGAAGCTTGTCTTCGTTTTGAACCAGTGA, it has Hind III restriction enzyme site.

4. the expression method of carrier according to claim 1 is characterized in that: realize by following steps:

(1) transfecting eukaryotic cells

The 3T3 cell of cultivating is pressed 1 * 10 ⁵24 orifice plates are inoculated in/hole, cultivate 24h and reach 80%-85% to cell, then by reagent specification sheets step lipofectamine ^TM2000 respectively parcel need transfection plasmid to Opti-MEM I substratum and mixing, dropwise adding has been changed in the 3T3 cell of serum free medium, changes the DMEM of 20% foetal calf serum after the transfection in 6 hours;

(2) immunofluorescence dyeing

1 porocyte immunofluorescence dyeing behind the transfection 48h: the hTERT one that the fixing back of dehydrated alcohol added 1: 50 resists, room temperature 90 minutes, and PBS washing back added two fluorescently-labeled 1: 200 anti-FITC 30 minutes, observed under inverted fluorescence microscope after the PBS washing;

(3) Western-blot detects Expression of Fusion Protein

Collect 5 * 10 ⁶Individual cell, with whole-cell protein extraction agent box, after 40 μ g protein samples add that the sample damping fluid boils sex change, carry out 10%SDS-PAGE, and being transferred to pvdf membrane, the skim-milk sealing with 5% 1 hour added respectively 1: 1000, the anti-human il-18 of Santa Cruz and 1: 1000, the anti-people TERT of Santa Cruz in 4 ℃ of refrigerator overnight, washes film 3 times, add 1: 2000 of HRP mark, Santa Cruz's is two anti-, and room temperature reaction 2 hours is done the ECL chemoluminescence after washing film, X sheet exposure imaging, result and MARKER be the molecular weight size of TERT/IL-18 relatively.

5. the application of carrier according to claim 1 in preparation tumor biotherapy medicine.