CN100434524C - Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application - Google Patents
Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application Download PDFInfo
- Publication number
- CN100434524C CN100434524C CNB02138701XA CN02138701A CN100434524C CN 100434524 C CN100434524 C CN 100434524C CN B02138701X A CNB02138701X A CN B02138701XA CN 02138701 A CN02138701 A CN 02138701A CN 100434524 C CN100434524 C CN 100434524C
- Authority
- CN
- China
- Prior art keywords
- tobacco
- gene
- protein kinase
- calmodulin
- dependent protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention discloses a tobacco calmodulin dependent protein kinase gene, a protein, a preparation method thereof and application thereof. The preparation method is characterized in that tobacco mRNA is extracted firstly to establish a tobacco cDNA library, then MCK1 (a calmodulin dependent protein kinase gene separated from corns) is used as a probe for screening to obtain a positive cloning sequence, and a gene complete sequence is obtained. The gene is cloned to P<FAST>HTb donor plasmid, recombinant rod granule DNA is converted to sf9 cells, and recombinant viruses are obtained. After virus infected cells are fused for 72 hours, the cells are obtained at room temperature, and fusion proteins are purified. A transgenic plant displays the character of blossoming late and has an increased growing period, and the tobacco calmodulin dependent protein kinase gene can be applied to tobacco.
Description
Technical field
The invention belongs to biology field, specifically, the present invention relates to grow tobacco calmodulin dependent protein kinase gene and its encoded protein and this gene and a proteic preparation method.The invention still further relates to the purposes of this calmodulin dependent protein kinase gene in tobacco simultaneously.
Technical background
In the development of plants process, Ca
2+Play important effect, many plant Ca of two researchs by interacting with its target protein
2+Target protein is calcium dependent protein kinases (CDPKs) and calmodulin (CaM). multiple CDPKs has been carried out biochemistry and molecular biological analysis at present, and inquired into out its multiple function in plant physiology and growth course. the research to C aM also shows its involved in plant development and environment responsing reaction equally, yet the research of the conjugated protein function of CaM but seldom in the relevant plant, calmodulin dependent protein kinase particularly, the functional study that is called for short CaMKs still is that blank .Ca MKs is by Ca
2+Carry out dual regulation with CaM, being different from the studies show that CaMKs of CDPKs. in yeast and Mammals with its particular structure is the key component of the signal conduction of CaM mediation, CaMKs has obtained identifying and has been proved to be the many cellular activity processes of mediation that participate in these organisms, comprise gene transcription, cell cycle, neural memory, carbohydrate metabolism, cytoskeleton function etc.But before the present patent application, nobody discloses or delivered the purposes of plant calmodulin dependent protein kinase gene in plant.
Summary of the invention
The object of the present invention is to provide grow tobacco a calmodulin dependent protein kinase gene and an encoded protein matter thereof.This gene is separated from tobacco suspension cell at first, proves corn afterwards, and paddy rice all has the existence of this gene in the plants such as Arabidopis thaliana.It is characterized in that: this gene mainly has the nucleotide sequence in the kinase catalytic district of proteins encoded and the sequence of coding calmodulin land, and the gene total order classifies SEQ IDNO:1 as, and this protein amino acid sequence is SEQ ID NO:2.
Another object of the present invention has been to provide and has prepared this new calmodulin dependent protein kinase gene and the method for encoded protein matter thereof.
In fact, the application of tobacco calmodulin signal type protein kinase in tobacco.
In order to realize above-mentioned task, the present invention adopts following technical measures: preparation gene concrete steps: 1. extract tobacco mRNA, with the ZAP-cDNA Synthesis kit of Strategene company by the tobacco cDNA library that goes out manufacturer's suggestion foundation.2. utilize the calmodulin dependent kinases gene M CK1 that is separated to from corn to screen for probe, the positive colony order-checking obtains the partial sequence of gene.3. it is logical with the 5 ' end and 3 ' the end survey of gene to design special primer again, has so just obtained the complete sequence of gene.Preparation albumen concrete steps: the member of 1.Bac to Bac rhabdovirus expression vector, goal gene SEQ ID NO:1 is cloned into P
FASThe THTb donor plasmid.2. extract the reorganization bacmid dna with alkaline process, the reorganization bacmid dna transforms the Sf9 cell, the results recombinant virus.3. after merging virus infected cell 72h, room temperature harvested cell, purified fusion protein.
The present invention also provides a kind of carrier, and it comprises calmodulin dependent protein kinase gene or its varient, and a key character of expression vector is to contain suitable promotor and translation control piece.Multiple expression vector can obtain from commercial channels, and carrier commonly used includes but not limited to plasmid, phage, virus etc., but modal first-selected plasmid.
In another aspect of the present invention, a kind of host bacterium that can express in plant is provided, the present invention is preferential to be Agrobacterium, more preferably Agrobacterium LBA4404.The present invention also provides a kind of method with described carrier importing vegetable cell, as the particle gun injection, and the bacterium introductory technique.The preferred Agrobacterium introductory technique of the present invention is as Agrobacterium LBA4404 tobacco leaf disc introductory technique.
In the present invention, provide a kind of carrier plants transformed that contains calmodulin dependent kinases gene.In the present invention, above-mentioned plant is selected from tobacco.
In another aspect of the present invention, provide to produce and can express the method for calmodulin dependent kinases gene transformation tobacco, it is characterized in that:
This method comprises the following steps
1) but calmodulin dependent kinases gene is connected on the expression regulation sequence carrier that formation can transform or express;
2) change the carrier for preparing in the step 1) over to plant;
3) screening positive plant.
More specifically, the invention provides a kind of method that can express calmodulin dependent kinases gene transformation tobacco that produces, it is characterized in that: this method comprises the following steps
1) Ke Long calmodulin dependent kinases gene is connected on the plasmid PMD, the carrier that formation can transform or express;
2) change the carrier for preparing in the step 1) over to Agrobacterium, import plant again;
3) screening positive plant.
In the present invention, be that T6E5/T6F3 makes combination of primers 1. with two kinds of primers, as template DNA, the NtCaMK1 that synthesizes total length by the PCR mode is called for short NtCaMK1 with NtCaMK1
f. the dna fragmentation of restriction enzyme BamH1 digestion is cloned among the plasmid PMD, it inserts fragment and identifies the coding NtCaMK1 total length 599 amino acid whose sequences that .pNtCaMK1f contains through dna sequencing. 2. will contain the carrier transfection Agrobacterium LBA4404 of calmodulin dependent kinases gene, cultivate Agrobacterium in the YM liquid nutrient medium, and aseptic seedling is soaked in Agrobacterium bacterium liquid.3. adding the selection substratum screening positive clone of Kan.
Compared with prior art of the present invention, have the following advantages and effect: the application of this gene in tobacco prepares a kind of plant that can efficiently express the calmodulin dependent protein kinase.These transgenic plant show the proterties of blooming evening, and can prolong growth cycle.The plant aseptic seedling is selected from tobacco, screens the plant of calmodulin dependent kinases high expression level at last by selecting substratum, and plant shows the late proterties of blooming, and has prolonged the plant-growth cycle like this, the accumulation of favourable plant nutrient substance.
Used term " transgenic plant " is meant the gene that contains importing and can be stably or instantaneously express the gene that is imported and produce the plant with specific biological character among the present invention.
Among the present invention " vegetable cell " be meant the various last mature embryo of plant, or callus, or suspension cell, or protoplastis. these vegetable cells under suitable condition all can the regeneration plant.
The method of the calmodulin dependent protein kinase gene of clone described in the present invention is the method for the normal employing of institute in this area.Can utilize probe technique from the cDNA library of tobacco suspension cell, to filter out.The method of extracting mRNA also has multiple proven technique, and test kit can obtain from commercial channels, and the construction cDNA library also is the Protocols in Molecular Biology of using always.Make up the carrier described in the present invention and carrier is transfected into the method that plant also is the normal employing of institute in this area.Wherein related plasmid, transfection can obtain from commercial channels with medium and reagent.
Description of drawings
Fig. 1 plant expression vector
Kan, Str are respectively that resistance of card and streptomycin resistance, and 35S is a promotor, and gene NtCaMK is that clone gene is inserted in after the 35S promoter.
Fig. 2 Southern result
The 1-5 sample is a transfer-gen plant, and 6 are the wild plant of contrast, and the result shows transfer-gen plant gene introduction site difference.
Fig. 3 PCR result
The 1-9 sample is a transfer-gen plant, and 10 are the wild plant of contrast, and the result shows transfer- gen plant 1,4,5,6,9 successful quiding genes.
Fig. 4 Northern result
The 2-6 sample is a transfer-gen plant, and 1 is the wild plant of contrast, and the result shows that the transfer-gen plant gene expression amount is greater than wild plant.
Embodiment
Usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989), or Draper, people such as J (Blackwell Science Press, 1988) described condition, or the condition of advising according to manufacturer.
Embodiment 1 (clone of gene and order-checking)
Utilize MCK1 (the calmodulin dependent kinases gene that this laboratory is separated to from corn) for probe screening tobacco cDNA library, be separated to a MCK1 homologous sequence, obtain NtCaMK1. through order-checking
1 extracts tobacco mRNA.
The extraction of RNA (TRIZOL TM Kit extracts RNA)
Liquid nitrogen grinding 100mg material.
A. add 1mlTRIZOL, room temperature is placed 5min.
B. add the 200ul chloroform, thermal agitation 30s, room temperature is placed 2min.
C.12000g, 15min, 4 degrees centigrade.Get supernatant to new pipe, add the 500ul Virahol, mixing, room temperature is placed 15min.
D.12000g, 15min, 4 degrees centigrade.Remove supernatant, add 1ml 70% ethanol.
E.7500g, 7min, 4 degrees centigrade. remove supernatant, dry air.
The F.DEPC-H2O dissolving.
The 2 ZAP-cDNA Synthesis kit of usefulness Strategene company set up tobacco cDNA library by going out manufacturer.
3 libraries are with containing the MCK1p550 screening, the positive colony order-checking.
4 obtain the partial sequence of gene, and it is logical with the 5 ' end and 3 ' the end survey of gene to design special primer again, have so just obtained the complete sequence of gene.
Embodiment 2 (support element)
Three kinds of primers are used in this experiment, are respectively: T6E5:CGGATCCTGAAGTGGAC TTTGACTGGCCG; T6F3:CGGATCCTTATCGATGATGTCTTGTGCTTGAAC; T6P3:CGGATCCTTATAAAACAGGATTTTCCGTCCTTAACC. respectively with T6E5/T6F3 and T6E5/T6P3 as combination of primers, with NtCaMK1 as template DNA. by PCR mode (94 degrees centigrade of 53min, 94 degrees centigrade of 1min, 65 degrees centigrade of 50s, 72 degrees centigrade of lmin30s, 30cycles, 72 degrees centigrade of 10min) total length (NtCaMK1) of synthetic NtCaMK1 and remove the NtCaMK1 (NtCaMK1t) of 3 ' end. the dna fragmentation that restriction enzyme BamH1 digests is cloned among the plasmid PMD, it inserts fragment and identifies the coding NtCaMK1 total length 599 amino acid whose sequences that .pNtCaMK1f contains through dna sequencing, only encode 443 amino-acid residues of N end of NtCaMK1 of the sequence of pNtCaMK1t.
(member of Bac to Bac rhabdovirus expression vector, goal gene is cloned into P to embodiment 3
FASTThe HTb donor plasmid)
1. extraction plasmid.(boiling method)
(1) 10000rpm centrifugal 45 seconds, collects bacterial cultures. and (culture was cultivated 20-24 hour down at 37 ℃, in the hope of obtaining enough DNA.)
(2) add 340ulSTET, resuspended bacterial precipitation vibrates.The N,O-Diacetylmuramidase that adds the 10mg/ml of 32ul again, mixing.
(3) Eppendorf tube is placed 100 ℃ of water 45-60 second (50 seconds), afterwards, place frozen water to cool off fast.At 4 ℃, 12000rpm, centrifugal 30 minutes.
(4) with toothpick precipitation is removed, added 170ul, 7.5M ammonium acetate and 550ul, the Virahol of-20 ℃ of precoolings.Carried out for the 5th step immediately behind the mixing.
(5) 4 ℃, 12000rpm, centrifugal 30 minutes.-20 ℃ of pre-cooled ethanol washing DNA precipitations with 70% 1-2 time.The DNA precipitation is resuspended in the 100ul water.Add 10mg/m RNase, make final concentration reach 10ug/ml, 37 ℃ of water-baths 30 minutes.-20 ℃ of preservations.
2. the linearizing of carrier.
(1) uses equal-volume phenol: chloroform extracting vector plasmid P
FASI HTb:10000rpm, under the condition centrifugal 5 minutes, is transferred to supernatant in another centrifuge tube by 4 ℃.
(2) get plasmid 20u l, add in the 0.5ul Eppendorf tube of existing 105ul water.
(3) add 15ulBufferNE (being added with BSA).
(4) add 10ulBammH1, mixing, centrifugal to managing the end.37 ℃, enzyme was cut 4-6 hour or was spent the night.
(5) adding 0.1M EDTA (PH80) 15ul is 10mM to final concentration, termination reaction.
(6) electrophoretic examinations.
(7) (3M pH7.0), adds 2.5 times of volume dehydrated alcohols again, and deposit D NA spends the night under-20 ℃ of conditions linearizing carrier 145ul to be added the sodium acetate of 1/10 volume.
3. the dephosphorylation of linearized vector.
(1) will spend the night and be deposited in 12000rpm, centrifugal 5 minutes.Be dissolved in after the drying at room temperature in the 75ul water.Electrophoretic examinations.
(2) get the linearizing carrier of 70ul, add 8ul 10 * Buffer, add 2ul bacterial alkaline phosphatase (CAP), incubation is 30 minutes under 37 ℃ of conditions.
(3) add 2ul CAP again, incubation is 30 minutes under 37 ℃ of conditions.
(4) add 4ul0.1ME EDTA (pH8.0), making final concentration is 5mM, 65 ℃ of incubations 1 hour, termination reaction.
(5) use phenol: the chloroform extracting
(6) add the sodium acetate (pH7.0) of 0.1 times of volume in the supernatant, fully mixing adds 2.5 times of volume of ethanol again, behind the mixing at-20 ℃ of deposit D NA that spend the night.
(7) 4 ℃, 12000rpm centrifugal 10 minutes, reclaims DNA.
(8) 70% washing with alcohol with precooling precipitates.
(9) with 15ul water dissolution DNA ,-20 ℃ of preservations.
4. the acquisition of goal gene.
(1) extracts from DH5 α with boiling method and have TIEF, TIEP, the pulsating pET32 plasmid of goal gene.Electrophoretic examinations.
(2) cut with the BamH1 enzyme.The reaction cumulative volume is 50ul
PET plasmid (having goal gene) 30ul
Water 11ul
1×NE?Buffer 5ul
BamH 4ul
37 ℃, spend the night.
(3) the electrophoretic examinations enzyme is cut the result.
(4) from glue, reclaim goal gene.
A. the plasmid after enzyme being cut all o'clock in 0.8% glue, electrophoresis.
The gel that b. will have goal gene downcuts with blade under long wave ultraviolet condition fast.Weighing.
C. the Buffer QX1 (100mg-100ul) that adds 3 times of volumes.
D.50 ℃ incubation is 10 minutes.Shook centrifuge tube in every during this time 2-3 minute, to promote dissolving of gel.
E. the Virahol that adds 1 times of volume again, mixing.
F. the QlAquick centrifuge tube is placed on the collection tube of 2ml, said mixture is added in the QIAquick centrifuge tube, centrifugal 1 minute.
G. remove the liquid in the collection tube, the QIAquick centrifuge tube is relay on collection tube.
H. add 0.75ml Buffer PE, centrifugal 1 minute.
I. remove the liquid in the collection tube, recentrifuge, 10000 * g (13000rpm), 1 minute.
J. the QIAquick centrifuge tube is placed on the 1.5ml centrifuge tube, add 12ul water, after static 1 minute, centrifugal 1 minute.
K. electrophoretic examinations recovering state.
5. goal gene is connected to P
FASI HTbOn.(total reaction volume is 12ul)
Water 3.3ul
10×Buffer 1.2ul
Linearizing carrier 1.5ul
T4DNA ligase enzyme 1ul
Mix the back and placed 20 minutes, place 15 ℃-16 ℃ then, spend the night in room temperature.
6.DH5 the preparation of α competent cell.
(1) with microbial culture to OD600 be 0.45-0.55, be placed on 2 hours on ice.
(2) 4 ℃, 3000rpm is in centrifugal 5 minutes.
(3) precipitation is resuspended among the ice-cold CaCl2 of 25ml 100mM, placed 30 minutes on ice.
(4) 4 ℃, 3000rpm, centrifugal 5 minutes.
(5) precipitation is resuspended in the ice-cold 0.1M CaCl2 of the 5ml solution. adding 1.6ml80% glycerine to final concentration is 20%.
(6) after the packing with liquid nitrogen freezing after solid-state ,-70 ℃ of preservations.
7. the product of ligation transforms DH5 α competent cell.
(1) competent cell is placed on ice.
(2) add ligation mixture 5ul, mixture is placed 30 packing on ice.
(3) 42 ℃, water-bath 45 seconds.
(4) placing 2 minutes on ice.
(5) add 800ul LB substratum on the super clean bench, 37 ℃, shaking table was cultivated 1 hour.
(6) culture is fallen on the LB culture plate that is added with Amp, on super clean bench, dry up, afterwards, 37 ℃, incubated overnight.
8. screening has the bacterium colony of the plasmid of goal gene.
(1) gets single bacterium colony 20-40, inoculate on the LB/Amp flat board and make marks .37 ℃, incubated overnight with the sterilization toothpick.
(2) use the toothpick picking colony, place 25ul water. add the solution of the new configuration of 25ul again. (100ulIN NaoH; 100ul 10%SDS; 20ul 500mM EDTA pH8.0; 200ul 0.2% bromjophenol blue; 100ul glycerine; 480u l water. every 1ml).
(3) mixing, room temperature was placed 5 minutes.
(4) on the gel with mixture point sample to 1%, electrophoresis.
The bacterium colony of the plasmid that has goal gene that (5) will screen is streak culture again.37 ℃, spend the night.
9. analyze with the Restriction Enzyme endonuclease digestion, screening has the plasmid of forward purpose of connecting gene.
Water 15ul
10×Buffer 2ul
Restriction endonuclease 1-2ul
Plasmid DNA 3ul
37 ℃, incubation 4 hours. electrophoretic examinations.
10. transform the DH10Bac competent cell, and transform bacterial strain with indigo plant/hickie method screening.
The preparation of A.DH10Bac competent cell.(method is identical with the preparation of DH5 α competent cell, slightly.)
B. extract the plasmid that has goal gene with boiling method, and transform the DH10Bac competent cell with it.
A. competent cell is placed on ice, add the 5ul recombinant plasmid, rap tube wall with mixing.
B. mixture was placed on ice 30 minutes.
C.42 ℃ water-bath placed frozen water 2 minutes after 45 seconds.
D. add the 800ulLB substratum, 37 ℃, shaking table is cultivated more than 4 hours.
E. with LB substratum dilution culture to 1/10,1/100,1/1000.Afterwards, respectively getting 200ul is inoculated on the Luria Agar culture plate (add required microbiotic in the LB substratum, be coated with IPTG and X-gal again).37 ℃, cultivate more than at least 24 hours.
F.4 ℃ place a few hours, blueness is fully manifested.
G. repeat E and two steps of F, verify indigo plant/hickie results of screening once more.
11. extract the reorganization bacmid dna with alkaline process
A. get the culture 1.5ml that cultivated 24 hours, 14000 * g, centrifugal 1 minute.
B. get the suction pipe suction with Bath and remove supernatant, precipitation is resuspended in the 0.3ml solution I.Add 0.3ml solution 11 again, gently mixing.Room temperature was placed 5 minutes.
C. slowly add the acetate clock (4 ℃) of 0.3ml 3M pH5.5, the limit edged shakes.Placed 5-10 minute on ice.Afterwards, 14000 * g is centrifugal 10 minutes.
D. carefully pipette supernatant in the centrifuge tube that the 800ul Virahol is housed.Mixing gently. placed 5-10 minute on ice.(perhaps spending the night) in-20 ℃
E.14000 * and g, under the room temperature condition centrifugal 15 minutes.
F. after abandoning supernatant, add 500ul 70% ethanol, washing precipitation .14000 * g, under the room temperature condition centrifugal 5 minutes.
G. remove supernatant (careful operation) as far as possible.Drying at room temperature 5-10 minute, be dissolved in 40ulTE, packing is kept at-20 ℃.
12. the reorganization bacmid dna transforms the Sf9 cell
A. cultured cells is grown to and is paved with about 80%.
B. prepare following solution:
Solution A: with insect cell substratum 100ul dilution 10ul (concrete volume is by the concentration decision of reorganization rod granule) the reorganization bacmid dna of serum-free.
Solution B: with the insect cell substratum dilution 6ulCELLFECTIN reagent of 100ul serum-free.
C. two kinds of solution being mixed the back room temperature placed 15-45 minute.(30 minutes)
D. after the substratum in the cell culture being siphoned away, do not contain the serum free medium washed cell of antibody with 2ml.
E. in the lipid-DNA transfection mixture, add the 0.8ml serum free medium. afterwards, it is covered on the cell culture.
F.27 ℃ culturing cell is 5 hours.
G. remove transfection mixture, and add 2ml serum free medium washed cell for several times, add Grace ' the s insect cell substratum 5ml that contains antibody and serum again.Cultivated 72-96 hour for 27 ℃.
13. results recombinant virus
72 hours cell culture medium of above-mentioned cultivation is transferred in the centrifuge tube, centrifugal 5 minutes of 500 * g, the supernatant liquor that will contain virus is transferred in another centrifuge tube.
4 ℃ of short-terms are preserved.
Embodiment 4 (Expression of Fusion Protein: after merging virus infected cell 72h, the room temperature harvested cell)
The purifying of fusion rotein:
1. preparation chromatography column.
A. chromatography column is fixed on the upholder.
B gets 1mlNi-NTA matrix in centrifuge tube, centrifugal 5 minutes of 1500g.
C. remove supernatant, and the wash buffer of 1 times of volume of adding (phosphate buffer D:50mM potassium acetate pH 6.0,300mM Kcl, the 10mM beta-mercaptoethanol, 10%glycerol).
D. mixture is poured in the post.
E. with the wash buffer of 5-10 times of volume under 4 ℃ of conditions, with the speed drip washing chromatography column of 0.5ml/min.
2. preparation cell extract.
A. with cell under 500 * g condition centrifugal 5 minutes.
B. cell can be preserved under-80 ℃, perhaps directly carries out following step.
C. use the lysis buffer re-suspended cell (1g: 1 times of volume) (50mMTris-Hcl, pH8.0 of 5 times of volumes; The 10mM beta-mercaptoethanol; 1mm PMSF; 1%NP-4; 4 ℃)
D. turned upside down 1 minute.
E.10000 * and centrifugal 10 minutes of g, supernatant is moved in another centrifuge tube.
3. purification of protein.
A. supernatant is added on the chromatography column.
B. use Buffer A (the 20mM Tris-Hcl pH8.5 of 10 times of volumes; 500mM Kcl; 20mMimidazole; The 10mM beta-mercaptoethanol; 4 ℃ of 10% glycerine) drip washing chromatography column.
C. use Buffer B (the 20mM Tris-Hcl pH8.5 of 2 times of volumes; 1M Kcl; The 10mM beta-mercaptoethanol; 4 ℃ of 10% glycerine) drip washing chromatography column.
D. use the Buffer A drip washing chromatography column of 2 times of volumes.
E. with Buffer C (the 20mM Tria-HclpH8.5 of 5-10 times of volume; 100mm Kcl; 100mMimidazole; The 10mM beta-mercaptoethanol; 4 ℃ of 10% glycerine) elute protein.
F. collect protein.
If use phosphoric acid buffer:
A. go up sample.
B. use Buffer D (the 50mM potassium acetate pH6.0 of 10 times of volumes; 300mmKcl; 100mMimi dazole; The 10mM beta-mercaptoethanol; 10% glycerine) drip washing chromatography column.
C. with Buffer E (the 50mM potassium acetate pH6.0 of 5-10 times of volume; 300mM Kcl; 100mMimidazole; The 10mM beta-mercaptoethanol; 10% glycerine) elute protein.
D. collect.
Embodiment 5 (conversion of plant and screening)
The Agrobacterium-mediated Transformation of tobacco
A. the preparation of aseptic seedling: seed is through 70% ethanol 30sec, ddH
2O washes, and 5%NaClO soaks 30min, ddH
2After O washes 5 times, be tiled in MS in substratum (PH5.8), agar concentration 0.8%.The tobacco aseptic seedling is standby.
B. tobacco leaf disc transforms: inoculation LBA4404 (containing pBI121/NtCaMK1) is on solid medium YM, and picking list bacterium colony is cultivated in the 50mlYM liquid nutrient medium two days later.Get the aseptic seedling blade, arteries and veins in the reservation is cut into big or small leaf dish, soaks 10 in bacterium liquid.The leaf upper epidermis places on the common substratum down, and every ware 6-7 sheet was cultivated 2-3 days altogether.
C. after cultivating end altogether, wash blade twice, wash once with the liquid MS medium that adds Carb again with liquid MS medium.The leaf dish is transferred to be selected on the substratum.Every 15 days subcultures 1 time.
D. waiting regenerates wears and cuts budlet when growing to 1cm and move on the root media with the solid MS substratum that adds Carb and Kan and screen.
E. behind the seedling rooting, be transplanted into vermiculite.Transplant native alms bowl down after 10 days.
Embodiment 6 (foranalysis of nucleic acids of transformed plant-PCR identifies)
(1) is used for the extraction of the total DNA of transformed plant of PCR
A.70% ethanol is cleaned blade, takes by weighing about 100mg
B. add 600ul extraction buffer (25mMEDTA, 0.5%SDS, pH 7.5 for 0.2M Tris-Cl, 0.25MnaCl), room temperature is ground fast.
C.1.5ml Ependorff manages mesoscale eddies mixing 5 ~ 10s
D.12000rpm, 25min, room temperature.Get supernatant, add the equal-volume Virahol, mixing turns upside down.-20 degrees centigrade, precipitation is spent the night.
E.12000rpm, 15min, room temperature.Remove Virahol, be inverted on the paper handkerchief.Add 70% ethanol 200ul bubble and wash the DNA precipitation.
F.12000rpm, 15min, room temperature.Remove ethanol.Be inverted on the paper handkerchief, treat that the ethanol volatilization is clean.
G. add TE (pH 7.5) 100ul dissolving and slightly put forward the DNA precipitation.Estimate its concentration with spectrophotometric determination or electrophoresis.
H. be template with total DNA, carry out PCR.
(2) PCR program
The proportioning of PCR reaction mixture identifies that with plasmid PCR the time of reaction and temperature are done as follows:
94 degrees centigrade of 53min
94 degrees centigrade of 1min, 65 degrees centigrade of 50s, 72 degrees centigrade of 1min30s, 30cycles
72 degrees centigrade of 10min
Result such as Fig. 3 show
Embodiment 7 (foranalysis of nucleic acids of transformed plant-Northen hybridization)
(1) extraction of RNA (TRIZOL TM Kit extracts RNA)
Liquid nitrogen grinding 100mg material.
A. add 1mlTRIZOL, room temperature is placed 5min.
B. add the 200ul chloroform, thermal agitation 30s, room temperature is placed 2min.
C.12000g, 15min, 4 degrees centigrade.Get supernatant to new pipe, add the 500ul Virahol, mixing, room temperature is placed 15min.
D.12000g, 15min, 4 degrees centigrade.Remove supernatant, add 1ml 70% ethanol.
E.7500g, 7min, 4 degrees centigrade. remove supernatant, dry air.
The F.DEPC-H2O dissolving.
(2) RNA electrophoresis
1.2% agarose electrophoresis
(3) Norihen hybridization
The 32P mark of dna probe
A. application of sample preparation reaction mixture in the following order in first 1.5mlEP pipe:
10XPCR?Reaction?Buffer 2.0ul
MgCl2(25mM) 1.2ul
Primer?1(10uM) 0.2ul
Primer?2(10uM) 0.2ul
dNTP(dATP，dGTP，dTTP?each?1.5mM) 2.0ul
32P-dCTP(60u?Ci) 6.0ul
65 degrees centigrade of 3min place room temperature.
B. add dna profiling 3.0ul (128ng) and add 7.5ul in second pipe, mixing boils 3min, places on ice.
C. 2ul ice-cold dilution Taq DNA Polymerase (IU/ul) and dNTP and primer mixture are joined in the template DNA of sex change total reaction volume 21ul rapidly.
D. mixture is put 42 degrees centigrade of reaction 30min.
E. add 4ul0.5M EDTA (pH8.0) termination reaction in the probe reaction mixed solution.Radiolabeled probe is crossed purifying in the Sephades R-25M post.This pillar is used STE solution (980ul TE pH7.5+20ul 5.0M NaCl) balance in advance.Be in charge of the probe of collecting with the STE eluant solution, merge the highest elutriant of 2 pipe activity ratio activity as the hybridization probe.Before adding hybridization solution, boil 10min, place on ice immediately.
(4) prehybridization
The nylon membrane that contains RNA, moistening with 3XSSC (10XSSC:1.5M NaCl and 0.15M Trisodium Citrate, pH 7.0) earlier, film is faced up, place hybrid pipe.Salmon sperm dna (ssDNA) 100ul (10mg/ml) boils 5min, places 10min on ice, join the 10ml prehybridization solution (identical with the hybridization solution composition, be 0.5MNa2PO4pH 7.4,7%SDS) in, 65 degrees centigrade of prehybridizations 2 ~ 3 hours.
(5) hybridization
Probe is added in the 10ml hybridization solution that newly changes, and 65 degrees centigrade are spent the night.
(6) wash film
1XSSC, 0.1%SDS, 65 degrees centigrade, 15 ~ 30min, 2 times.
0.1XSSC, 0.1%SDS, 65 degrees centigrade, 15 ~ 30min, 2 times.
(7) radioautograph
Film with insurance film parcel, with the radioactive level on the Geiger tube detection film, is put the radioactive automatic developing that carries out the X-ray sheet in the darkroom.
Radioautograph result such as Fig. 4 of X-ray sheet show
Sequence table
＜110〉Wuhan University
＜120〉tobacco calcium is transferred rope dependent protein kinase gene, albumen and preparation method and application
<160>4
<210>1
<211>2530
<212>DNA
＜213〉tobacco
<400>
<210>2
<211>599
<212>PRT
＜213〉tobacco
<400>
Claims (5)
1. isolating nucleic acid, its sequence is a polynucleotide sequence shown in the SEQ ID NO:1.
2. isolating protein, its sequence is a peptide sequence shown in the SEQ ID NO:2.
3. preparation method who is used to realize the described tobacco calmodulin of claim 1 dependent protein kinase gene nucleic acid, step is: A. extracts tobacco mRNA, with the ZAP-cDNA Synthesiskit of Strategene company by the tobacco cDNA library that goes out manufacturer's suggestion foundation; B. utilize the calmodulin dependent kinases gene M CK1 that is separated to from corn to screen for probe, the positive colony order-checking obtains the partial sequence of gene; C. it is logical with the 5 ' end and 3 ' the end survey of gene to design special primer again, has so just obtained the complete sequence of gene.
4. one kind is used to realize the proteinic preparation method of the described tobacco calmodulin of claim 2 dependent protein kinase, and step is: the structure of A.Bac to Bac rhabdovirus expression vector, target gene sequences SEQ IDNO:1 is cloned into P
FASTThe HTb donor plasmid; B. extract the reorganization bacmid dna with alkaline process, the reorganization bacmid dna transforms the Sf9 cell, the results recombinant virus; C. after merging virus infected cell 72h, room temperature harvested cell, purified fusion protein.
5. the application of tobacco calmodulin dependent protein kinase nucleic acid according to claim 1 in tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB02138701XA CN100434524C (en) | 2002-06-21 | 2002-06-21 | Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB02138701XA CN100434524C (en) | 2002-06-21 | 2002-06-21 | Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1398971A CN1398971A (en) | 2003-02-26 |
| CN100434524C true CN100434524C (en) | 2008-11-19 |
Family
ID=4749642
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB02138701XA Expired - Fee Related CN100434524C (en) | 2002-06-21 | 2002-06-21 | Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100434524C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106244568B (en) * | 2016-08-26 | 2019-12-24 | 中国农业大学 | Calcium-dependent protein kinase CPK32 and coding gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001045492A2 (en) * | 1999-12-22 | 2001-06-28 | Basf Plant Science Gmbh | Protein kinase stress-related proteins and methods of use in plants |
| WO2001077356A2 (en) * | 2000-04-07 | 2001-10-18 | Basf Plant Science Gmbh | Protein kinase stress-related proteins and methods of use in plants |
| US6403352B1 (en) * | 1996-03-28 | 2002-06-11 | Washington State University Research Foundation | Compositions and methods for production of male-sterile plants |
-
2002
- 2002-06-21 CN CNB02138701XA patent/CN100434524C/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6403352B1 (en) * | 1996-03-28 | 2002-06-11 | Washington State University Research Foundation | Compositions and methods for production of male-sterile plants |
| WO2001045492A2 (en) * | 1999-12-22 | 2001-06-28 | Basf Plant Science Gmbh | Protein kinase stress-related proteins and methods of use in plants |
| WO2001077356A2 (en) * | 2000-04-07 | 2001-10-18 | Basf Plant Science Gmbh | Protein kinase stress-related proteins and methods of use in plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1398971A (en) | 2003-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2293649T3 (en) | METHOD THAT USES A SPECIFIC TISSUE PROMOTER. | |
| CN102329805B (en) | Coding sequence for OsMYB gene in rice and applications | |
| JPH0662870A (en) | Promoter region of soybean phosphoenolpyruvate carboxylase gene and 5'-nontranslating region | |
| CN102057868B (en) | Induction and culture method of Psammosilene tunicoides hairy root system | |
| CN102191254A (en) | CBF transcription factor capable of regulating plant stress resistance, and coded gene and application thereof | |
| CN110373413A (en) | The precursor-gene of smoothbark birch miR169a and its application in reduction plant Low nitrogen stress tolerance | |
| CN103360484B (en) | Upland cotton protein GhMADS22, and coding gene and application thereof | |
| CN102226184B (en) | Method for cultivating transgenic nitrogen-fixing plants | |
| CN100434524C (en) | Tobacco calmodulin dependent protein kinase gene, protein and its prepn and application | |
| CN109652424B (en) | A kind of methods and applications that somatic embryos directly occur | |
| CN101389762A (en) | Gene promoters that can be used in plants | |
| CN102965373B (en) | DNA (deoxyribose nucleic acid) fragment and application thereof in preparation of male sterile hot pepper | |
| CN104762305B (en) | The gene TaUreG related to Drought-resistance in Wheat and its application | |
| CN112538490A (en) | NLP gene for inducing necrosis and active oxygen accumulation in biocontrol pythium and expression vector and application thereof | |
| CN101824421B (en) | Cotton somatic embryogenesis receptor kinase gene and application thereof | |
| CN111440231A (en) | Application of protein GmFU L a in regulating and controlling plant type and yield of soybean | |
| CN101323854B (en) | Rice RDB1 drought resistant gene | |
| KR101648558B1 (en) | Genes Related to Salt or Drought Stress Resistances and Transformed Plants with the Same | |
| CN114807166B (en) | Liriodendron transcription factor LcbHLH02399 gene and expression protein and application thereof | |
| CN108424918A (en) | It is a kind of inhibit wheaten starch synthesis transcription factor WSR1 genes and its application | |
| CN116200401B (en) | Application of feather needle grass sugar transporter gene SpSWEET13 in promotion of plant root sticky soil | |
| CN109136218B (en) | Preparation method of paeonia rockii IKU2 gene | |
| Parveez et al. | Current status of genetic engineering in oil bearing crops | |
| CN108728455B (en) | WRKY transcription factor gene SsWRKY1 expressed by drought stress of sugarcane slender wild species | |
| CN108220296B (en) | Synthetic promoter ANDp and application thereof in drought resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20081119 |