CN101824421B - Cotton somatic embryogenesis receptor kinase gene and application thereof - Google Patents

Abstract

The invention discloses new cotton somatic embryogenesis related receptor kinase GhSERK1, and a coding gene and application thereof. The amino acid sequence of the coding gene is expressed as SEQ ID NO: 3; genome sequences of the coding gene are expressed as SEQ ID NO: 1 respectively; the cDNA sequence of the coding gene is expressed as SEQ ID NO: 2; and an open reading frame sequence of the coding gene is expressed as SEQ ID NO: 4 in a sequence table. The invention also discloses a property of the gene (GhSERK1) playing an important role in cotton stamen growth. The gene provides a gene source for breeding male sterile plant varieties, and has significance for breeding male sterile lines of plants.

Description

Cotton somatic embryos generation acceptor class kinase gene and application thereof

Technical field

The present invention relates to the somatic embryo generation receptoroid kinases of a cotton, called after GhSERK1, and coding gene sequence.The invention still further relates to and contain this expression carrier, and the transfer-gen plant that utilizes this gene to cultivate.

Background technology

The category of plant embryos developmental biology comprises the formation of blossoming in a broad sense, the generation of female and male gametophytes, the formation of gamete; Fertilization and affinity; And fruit, structure and function relationship in the sporophyte forming processes such as seed, the physiology of morphogenesis and molecular basis; And the many aspects (Tang Xihua etc., 2001) of the space-time sequential scheduling reproductive development that represents of genetic information.

At present; In the cell tissue of the reproductive organ such as calyx, petal, flower pesticide, style and ovary of plant, some specific proteins have been detected; These protein are vegetable cell expression products at different reproductive development specific genes in period, be considered to each in period cell the morphogenesis of function or tissue closely related.Pollen development is the staggered process of a complicacy.Many reactions all reach maximum when pollen granule discharges.The two mutants that influences the different steps of pollen development has been studied much.Many pollen abortion two mutants of having reported all are because sporophyte sudden change, such as the endothecium or the tapetum of flower pesticide, because the mutual work between parietal cell and spore cell all plays an important role for sporule and pollen granule maturation in the flower pesticide.

Searching in Radix Dauci Sativae (Daucus carota) such as Schmidt can be monitored one section cDNA clone that the suspension cell culture somatocyte is found when marker gene that cells,primordial changes; Amino-acid sequence and kinases analyzed in vitro show; A kind of leucine of this genes encoding repeats acceptor class kinases LRR-RLK (Schmidt etc., 2001).Clone and the expression in various plants such as Arabidopis thaliana, paddy rice one after the other of the associated class of somatic embryo generation subsequently receptor protein kinase (SERK) gene, and be proved to be the structure conservative gene family that extensively exists in the vegitabilia.The SERK gene is not only expressed in embryonal connective tissue, also in non-embryonal connective tissue, expresses, and has participated in activities such as plant embryos growth, patrogenesis, disease defence and signal conduction.Discover SERK expression of gene participation processes at present: at first, SERK can be marked with the cell of embryo's generating ability: no matter be DcSERK, AtSERK or MtSERK, research shows that SERK is a good mark of embryogenesis cells.Compare with other mark such as monoclonal antibody JIM8, JIM13 and isozyme, esterase etc.; SERK seems to have uniqueness very under culture condition; Can show other mark the cell that is labeled that can not show become relation (Schmidt ED, 1997 between the embryo ability with cell; Thomas TL, 1993; Jianru Z, 2002).Secondly, (brassinosteroid, BR) signal transduction (Russinova E etc., 2004): BR has participated in comprising many physiological activities such as growth and development of plants, opposing adverse circumstance to the plain steroid of SERK participation rape.Identified at present the part component of BR signal transduction; Like BRI1 (BR insensitive 1), BAK1 (BRI1-associated receptor kinase 1), BIN2 (BR-insensitive2), BES1 (BRI1-EMS-suppressor 1protein; Be BIN2 substrate 1 albumen), BZR1 (brassinazoleresistant1 protein; Be BIN2 substrate 2 albumen) etc., the function of each component and relation are each other also known about.BAK1 is a kind of SERK albumen, is equal to AtSERK3.Heredity and biochemical test prove BAK1/BRI1 mixture inducing B R signal.The effect of AtSERK3 (BAK1) possibly be through changing the balance mediation BR signal (Rumyana K etc., 2006) of BRI1 in plasma membrane and the endosome.The 3rd, the defence of SERK involved in plant disease: the report of LRR-RLKs involved in plant disease resistance response is more, has participated in the rice bacterial blight resistance reaction like the Xa21 gene.OsSERK1 belongs to one of LRR-RLKs, can not only be infected abduction delivering by rice blast fungus, has also participated in the reaction of the anti-rice blast fungus of paddy rice.After paddy rice was infected by rice blast fungus, OsSERK1 was by abduction delivering, and the disease resistance of its expression amount and paddy rice has qualitative relationships (Song WY etc., 1995; Staskawicz BJ etc., 1995).At last, SERK participates in sporophyte and grows: at present, have report to claim that the single mutant of Arabidopis thaliana serk1 or serk2 can not cause any abnormal phenotype that sporophyte is grown, but the serk1serk2 double-mutant causes sporophyte ateliosis or male sterile.The sporogenous cell of serk1serk2 double-mutant produces microsporocyte can only carry out reduction division to tetrad period, and the maternal instinct vanished cell causes male sterile fully (Catherine A etc., 2005) subsequently.The okioplast that Tean etc. observe the sporogenous cell of serk1serk2 double-mutant can only develop into 3 confluent monolayer cells; The tapetal cell that lacks wild-type; Make sporophyte normal development not become mature pollen, this is similar with the tpd1 mutation type surface with ems1/exs.The sterility of serk1serk2 double-mutant can be passed through to recover with the wild-type pollen granule, and the seed that produces can normal development.Yet do not see the report of SERK gene in important cash crop cotton at present as yet.

Summary of the invention

An object of the present invention is to provide the genome sequence of cotton GhSERK1 gene, full length cDNA sequence and aminoacid sequence, they are respectively SEQ ID NO:1,2 in the sequence table, shown in 3.

Another object of the present invention provides the opening code-reading frame sequence of cotton GhSERK1 gene, in the sequence table shown in the SEQ ID NO:4.

A further object of the present invention provides cotton GhSERK1 expression carrier pK7GGS11683 (CGMCC No:3879), and the cDNA sequence that is contained on this expression vector, and it is for shown in the SEQ ID NO:5 in the sequence table.Simultaneously with any expression vector that can guide foreign gene in plant, to express.Contain this invention GhSERK1 expression carrier and clone, and the plant lines kind that contains this genoid is protection scope of the present invention.

A further object of the invention is that described expression vector can infect through using Agrobacterium; Pollen tube channel; Particle gun conversions etc. import vegetable cell; Can use method plant transformed host of the present invention to comprise monocotyledons and dicotyledons, for example: cotton, paddy rice, wheat, corn, rape, sugarcane, cucumber, clover etc.

Description of drawings

Fig. 1 representes to utilize the electrophorogram of the dna fragmentation of the GhSERK1 gene that degenerated primer amplification cotton genomic dna obtains.

Fig. 2 representes to contain the BAC clone cleavage map of GhSERK1 genomic dna.

Fig. 3 representes that it is template pcr amplification result's agarose electrophoresis figure with cDNA that sign indicating number is read in the opening of GhSERK1 encoding sox.

Fig. 4 is a GhSERK1 gene genome structure (transcription initiation site that comprises prediction).

Fig. 5 is GhSERK1 gene extron and intron structure synoptic diagram.

Fig. 6 is 5 ' UTR among the GhSERK1 full length gene cDNA, opening code-reading frame (CDS) and 3 ' UTR structural representation.

Fig. 7 is a GhSERK1 albumen membrane spaning domain prediction synoptic diagram.

Fig. 8 is a GhSERK1 protein structure domain synoptic diagram.

Fig. 9 is in male sterile line and fertile line and reproductive development related tissue, GhSERK1 expression of gene difference.

Figure 10 is for changeing the building process synoptic diagram of GhSERK1 expression vector (pK7GGS11683 and pK7GGS17016).

Figure 11 identifies for the PCR that changes expression vector pK7GGS17016 cotton.

Figure 12 identifies for the PCR that changes expression vector pK7GGS11683 cotton.

Figure 13 is for changeing the floral organ phenotypic map of expression vector pK7GGS11683 cotton.

Figure 14 is for changeing the floral organ phenotypic map of expression vector pK7GGS17016 cotton.

Embodiment

The clone of embodiment 1 cotton GhSERK1 encoding sox

Materials and methods

1) cotton material: cotton material is selected free kind Y18R for use.

2) bacterial classification: intestinal bacteria E.coli DH5 α.

3) carrier: pMD18-T, pK7GWIWG2 (I).

4) toolenzyme and modifying enzyme: various restriction enzymes and modifying enzyme are available from TaKaRa company, NEB company and Fermentas company.

5) chemical reagent: pharmaceutical chemicals is domestic and international analytical pure.

6) primer is synthetic: synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

All methods are ordinary method if no special instructions among the following embodiment.

Embodiment 1, the clone of cotton GhSERK1 gene

(1) preparation of cotton gene group: adopt modified CTAB method to extract the genome at upland cotton kind Y18 blade position, be used for PCR;

1) extracting solution preparation

The 1L extracting solution contains: Tris-HCl (PH8.0) 0.1M

EDTA(PH8.0) 0.02M

NaCl 1.5M

PVP40(w/v) 2％

CTAB(w/v) 2％

Above solution dissolves the back separately to be mixed, and constant volume is to 1L; Face with before adding 2% beta-mercaptoethanol.

2) take by weighing the tender cotton leaf of 0.3g children and put in the 2mL centrifuge tube, add steel ball, behind the liquid nitrogen flash freezer, be positioned over the 30s that vibrates on the Genegrid beveller, add the 1mL preheating and extract damping fluid for 65 ℃.Put upside down mixing.

3) solution is placed 65 ℃ of water-baths 40 minutes; Add the equal-volume chloroform: primary isoamyl alcohol (24: 1, V/V) vibration mixing, centrifugal 10 minutes of 4 ℃ of whizzer 12000rpm transfer to supernatant in another centrifuge tube, use chloroform: Virahol (24: 1, V/V) again extracting once, centrifugal collection supernatant;

4) Virahol of the ice precooling of 0.6 times of volume of adding is slowly put upside down the centrifuge tube mixing, and room temperature leaves standstill 30min.With kapillary cotton-shaped DNA is chosen, centrifugal 10 minutes of perhaps direct room temperature 12000rpm, the alcohol washing with 70% 1-2 time is again with 100% alcohol washing 1 time, drying at room temperature DNA.

5) add 200 μ L TE (10mM Tris-HCl, 1mM EDTA, PH8.0) or pure water (ddH ₂O), room temperature was placed 1 hour, and perhaps 65 ℃ of water-baths are dissolved DNA fully;

6) add the RNA enzyme water (10mg/mL) that 20ul does not have the DNA enzyme, 37 ℃ are incubated 1 hour, use isopyknic phenol: chloroform: and primary isoamyl alcohol (25: 24: 1, V/V) extracting is 1～2 time, and supernatant is transferred in another centrifuge tube;

7) add the 3M NaAc (PH5.2) of 0.1 times of volume, the absolute ethyl alcohol of the ice precooling of 2 times of volumes was placed 5 minutes behind the mixing.Slowly level left core barrel 5 minutes, this moment will in form at the interface the transparent flocks of thickness with kapillary gently hook go out, transfer in the centrifuge tube of 1.5ml; Centrifugal 10 minutes of perhaps direct 12000rpm, deposit D NA.

8) add the alcohol washing precipitation of 1mL70%, centrifugal 10 minutes of 10000g removes supernatant, respectively washes deposition once with 70%, 100% alcohol again, in air, makes the nucleic acid deposition dry;

9) with the TE of 50ul dissolution precipitation again, in-20 ℃ or-70 ℃ of storages.

Obtain the conservative segment est sequence of SERK gene in conjunction with information biology: according to GenBank storehouse SERK gene structure characteristics, in conjunction with 2 degenerated primers of conserved domain sequences Design:

Upstream primer: 5 ' CAGTTTCARACHGARGTDGAG 3 '

Downstream primer: 5 ' ATGTTTGCWGCTTTYACRTC 3 '

(M：AorC；K：GorT；W：AorT；R：AorG；Y：CorT；S：CorG；D：AorGorT；H：AorCorT；N：AorCorGorT)

Amplification obtains a purpose amplification, and size be 1500bp, be connected with the pMD18-T carrier after reclaiming, 16 ℃ spend the night, transformation receptor bacterium DH5 α, bacterium liquid PCR and enzyme cut the correct bacterial strain of evaluation and send order-checking.(among Fig. 1, M:Marker, 1,, 2,3,4,5 is respectively that GhSERK1 obtains the 1.5Kb fragment with the cotton genomic dna for the template pcr amplification)

On the basis of known array, the design special primer:

Upstream primer: 5 ' CAGTTTCAGACAGAAGTAGAG3 '

Downstream primer: 5 ' ATGTTTGCTGCTTTCACATC3 '

Screening cotton Y18 genome BAC library; Obtain behind the positive colony (among Fig. 2; 1:Marker, 2: the positive BAC clone of arrow indication inserts clip size), order-checking obtains the full-length gene group sequence of GhSERK1; Be (the Fig. 4: obtain GhSERK1 gene genome structure for utilizing the Softberry software analysis, comprise that the GhSERK1 full length gene is 6920bp behind the prediction transcription initiation site of SEQ ID NO:1 in the sequence table; Wherein CDS representes exon, totally 11 exons, 10 introns; TSS representes the transcription initiation site predicted, and transcription initiation site TSS to ATG is 453bp; Fig. 5 is the position and the relative fragment length of exon in the GhSERK1 gene and intron, and wherein square frame is an exon, and straight line is an intron, altogether 6467bp; ).

3) acquisition of GhSERK1 full length cDNA sequence:

Adopt the method for 3 ' RACE and 5 ' RACE to obtain the GhSERK1 full length cDNA sequence, 3 ' RACE and 5 ' RACE press the 3 ' RACE and 5 ' the RACE test kit description operation of TaKaRa company.

Concrete grammar may further comprise the steps:

1, the extraction of total RNA:

1) 0.2g refrigerated material is put into the mortar of precooling, grind to form powdery, pour in the 2mL centrifuge tube, add the basic extracting solution that 1mL is preheated to 80 ℃, 10 μ l DTT stock solutions and 25 μ l Proteinase K stock solutions, mixing;

2) 42 ℃, 100rpm, gentleness was shaken 90 minutes;

3) every pipe adds 80 μ l 2mol/L KCl solution, adjusts the KCl final concentration to 160mmol/L, ice bath 1 hour;

4) 12, centrifugal 20 minutes of 000rpm gets 900 μ l supernatants, adds 300 μ l 8mol/L LiCl, mixing, the deposition of spending the night on ice;

5) 12, centrifugal 20 minutes of 000rpm abandons supernatant, and deposition is washed 2～3 times with 2mol/L LiCl (ice precooling), and is colourless until supernatant;

6) suspension LiCl-RNA is deposited in 400 μ l 10mmol/L Tris-Cl (pH7.5), mixing, and 12, centrifugal 10 minutes of 000rpm shifts supernatant to new centrifuge tube;

7) the 2mol/L KAc (pH5.5) of adding 1/10 volume, mixing, ice bath 15 minutes;

8) 12, centrifugal 10 minutes of 000rpm removes the insoluble substance that desalts, and gets supernatant;

9) spend the night or-70 ℃ of depositions 2～3 hours in-20 ℃ of depositions with the absolute ethyl alcohol of 2.5 times of volumes;

10) with 70% cold washing with alcohol RNA deposition, vacuum rapid drying is dissolved in the DEPC water;

11) add RNase-Free DNase, 37 ℃, 30 minutes;

12) add isopyknic chloroform: the primary isoamyl alcohol extracting;

13) spend the night or-70 ℃ of depositions 2～3 hours in-20 ℃ of depositions with the absolute ethyl alcohol of 2.5 times of volumes;

14) with 70% washing with alcohol deposition, drying;

15) be dissolved in the water that DEPC handles RNA subsequent use.

2, the first chain cNDA's is synthetic: with ReverTra Ace-α-ThermoScript II test kit that company is spun by Japan, operate by the test kit specification sheets: reaction system:

RNA(1-5μg) 11.0μl

RNase?Inhibitor(10U/μl) 1.0μl

5×RT?buffer 4.0μl

dNTP?Mixture(10mmol/L?each) 2.0μl

AMV?Oligo(10pmol/μl) 1.0μl

ReverTra?Ace 1.0μl

total 20.0μl

Reaction conditions: 42 ℃, 20min; 99 ℃, 5min; 4 ℃, 5min; Moment is centrifugal ,-20 ℃ of preservations.

3, the design primer carries out 3 ' RACE and 5 ' RACE

Be used for 3 ' RACE primer:

3’Primer：5‘GCTGTCAACGATACGCTACGTAACG?3’

3’Nested?Primer：5‘CGCTACGTAACGGCATGACAGTG?3’

3’RACE?fp1：5′-CCTCCTTTTGTACCACCACCGCC-3′

3’RACE?fp2：5′-CGCCAATTTCTTCTCCAAGTGGG-3′

The special primer that is used for 5 ' RACE:

5’Primer：5′-CGACTGGAGCACGAGGACACTGA-3′

5’Nested?Primer：5′-GGACACTGACATGGACTGAAGGAGTA-3′

5’RACE?rp1：5′-GTCCAAGATGAACTTCTGGGTCCTC-3′

5’RACE?rp2：5′-AATTCTTGAGGTTTCCGCCGACGCC-3′

The dna fragmentation that amplifies is separated, reclaims and be connected to pMD18-T easy Vector with 1% agarose gel, and Transformed E .coli DH5 α, enzyme cut and identify and send China big gene sequencing after correct; Utilize biosoftware Vector9.0, Conting that the sequence that obtains is spliced; Obtain the full length cDNA sequence of gene, for SEQ IDNO:2 in the sequence table, according to the analytical results of BLAST; Because, so called after GHSERK1 the highest with the SERK1 gene similarity of Arabidopis thaliana.(Fig. 6 is a GhSERK1 full length gene cDNA structure, and wherein 5 ' UTR is 424bp, and opening code-reading frame (CDS) is 1884bp, and 3 ' UTR is 194bp; )

According to its opening code-reading frame of the sequences Design primer amplification cDNA sequence that obtains, 3 ' end primer is fp2, and 5 ' end primer is rp2, identifies for convenient, adds the HindIII restriction enzyme site at its 5 ' end primer, adds the SalI restriction enzyme site at its 3 ' end primer:

rp2：5′-CGCAAGCTTATGGAAGGAAGCAAAAAGG-3′

fp2：5′-CGCGTCGACCCTTGGACCGGATAACTCAAC-3′

The PCR reaction system:

cDNA 1.0μl

Reaction buffer (10X) 5.0 μ l

dNTP(2.5mmol/L?each) 4.0μl

fp2(10μM) 1.0μl

rp2(10μM) 1.0μl

Taq enzyme (2.5U/ μ l) 1.25 μ l

ddH ₂ O 36.75μl

total 50.0μl

Reaction conditions: 95 ℃, 5min; 95 ℃, 30 seconds; 55 ℃, 45 seconds; 72 ℃, 2min30s; 35 circulations; 72 ℃, 5min; 4 ℃, pause.After reaction finishes, the PCR product is carried out 0.8% agarose gel electrophoresis detect, detected result (swimming lane M is marker, and swimming lane 1 obtains the band that molecular weight is about 1.8kb for the GhSERK1RT-PCR product) as shown in Figure 3 conforms to expected results.Reclaim test kit (AXYGEN company) with sepharose and reclaim this fragment, should reclaim fragment then and be connected with pGEM-T Easy (Promega company) carrier.

Linked system:

PCR reclaims product 3.0 μ l

pMD18-T 1.0μl

T4DNA?Ligase 1.0μl

Reaction buffer (10X) 1.0 μ l

ddH ₂ O 4.0μl

total 10.0μl

16 ℃ of incubated overnight.

With above-mentioned connection product transformed into escherichia coli TOP10 competence.The reorganization system is added in the competent cell solution, and mixing was put 30 minutes on ice gently.Handled 90 seconds 42 ℃ of following heat shocks, put on ice ice bath 2 minutes immediately.Add 500 μ l LB liquid nutrient mediums, 37 ℃ of shaking table 180rpm cultivated 45 minutes; Be coated on then on the LB solid medium of penbritin (50mg/L); Be inverted cultivation and spend the night for 37 ℃, screening positive clone obtains recombinant plasmid called after pGEMTGS1CDS (CGMCC No:3878).With T7 on this carrier and SP6 promoter sequence is that primer carries out nucleotide sequencing to it.Obtain the opening code-reading frame sequence of GhSERK1 gene at last, be SEQ ID NO:3 in the sequence table, infer that according to the opening code-reading frame sequence its protein sequence is SEQ ID NO:4 in the sequence table.(Fig. 7: be the membrane spaning domain of predicting according to the aminoacid sequence of GhSERK1 gene, wherein ectodomain: the 1-241 amino acids; Membrane spaning domain: 242-264 amino acids; Born of the same parents' intracellular domain: 265-627 amino acids; Fig. 8 is a GhSERK1 protein structure domain synoptic diagram, wherein exons 1 coded signal peptide (signal peptide, SP); Exon 2 coding leucine zipper structure (leu zipper, ZIP); 5 rich leucine Tumor-necrosis factor glycoproteinss of exon 3～6 coding (leu-rich repeat, LRR), wherein except that exon 4 coding LRR2 and LRR3, LRR of other each exons codings; The exon 7 coding contains the rich proline(Pro) structural domain of SPP (Ser-Pro-Pro) motif; Exon 8 coding membrane spaning domains (transmembrane region, TM); Exon 9～11 coding intracellular kinase active structure domains.)

The expression characterization analysis of embodiment 2GhSERK1 gene in cotton

1, template preparation: adopt the hot borate method (preceding text are stated) of improvement, from the relevant tissue with reproductive development of two male-fertiles systems of cotton (Y18 and P30B) and a male sterile line (P30A): bud (6 developmental stage: 2-day-old, 5-day-old; 7-day-old, 11-day-old, 14-day-old; 18-day-old, with the bud of diameter 3mm as buddingging first day), calyx; Petal, flower pesticide extracts total RNA in the ovule; Wherein compare the phenotype gynoecium normal development of male sterile line P30A, and pollen stamen abortion with P30B with fertile line Y18.The RNA quality of extracting is by OD ₂₆₀/ OD ₂₈₀Ratio and 0.7% agarose gel electrophoresis are identified.With it is that template is carried out reverse transcription reaction by following scheme: in a PCR tubule, add total RNA of 2 μ g and 1 μ L Oligo (dT) ₁₀, 65 ℃ of incubation 10min place 2min on ice then rapidly; Add 5 * MMLV (RNase H free) Buffter, 5 μ L again, dNTP (25mmol/L) 5 μ L, Ribonuclease Inhibitor 20U; MMLV 200U is supplemented to TV 25 μ L, 42 ℃ of incubation 90min with Nuclease free water at last; 72 ℃ of 10min, 95 ℃ of water-bath 5min deactivation MMLV, the cDNA-20 that obtains ℃ of preservation is subsequent use.

2, the relative quantification of template cDNA and the design of interior label primer: according to the sequence information of cotton elongation factor gene EF1 α, the confidential reference items design of primers is following:

GhEF1αfp：5′-GCGATCTGGTAAGGAGCTTG?3′

GhEF1αrp：5′-GGAGAAGGTTTCCACAACC-3′

CDNA does template with cotton, carries out pcr amplification with this primer.

PCR reaction system: template 1 μ l, PCR Buffer 5 μ l, 10mMdNTP 3 μ l, GhEF1 α fp 1 μ l, GhEF1 α rp 1 μ l, Taq 1U, ddH ₂O 8 μ l.

The PCR condition: 94 ℃, 2min; 94 ℃, 30Sec; 55 ℃, 30Sec; 72 ℃, 30Sec; 30cycle; 72 ℃, 10min.

Electrophoresis result according to the PCR product is diluted template cDNA, the consumption of adjustment template cDNA, and the amount basically identical of the DNA band that goes out up to GhEF1 α fp and GhEF1 α rp primer amplification makes the content basically identical of template cDNA in every microlitre solution.

3) quantitative fluorescent PCR analysis

According to designed primer GhEF1 α fp of internal control gene EF1 α institute and GhEF1 α rp, and the special primer of GhSERK1 gene

SP1：5′-GTTGGCCGAGAGATGGGATG-3′

SP2：5′-ATGCGGACTGGGCTTACAGG?3′

With cotton two fertile lines (Y18 and P30B) and the above-mentioned tissue cDNA relevant with reproductive development of a sterile line (P30A) is the template pcr amplification, and each sample is provided with 3 repetitions.Real-time quantitative PCR amplification system reaction system is following: cDNA template 0.2 μ L, 10 μ L, 2 * SYBR Green I MIX, 10 μ mol L ^-1Forward primer 0.4 μ L, 10 μ mol L ^-1Reverse primer 0.4 μ L adds water to TV 20 μ L.PCR program: 94 ℃ of preparatory sex change 5min; 94 ℃ of 30s, 59 ℃ of 30s, 72 ℃ of 30s, 44 circulations; 72 ℃ of 5min, 4 ℃ of preservations.SYBR Green I dyestuff is bought the company in Toyobo, and the real-time fluorescence quantitative PCR appearance is selected the PTC-200 of MJ company for use, and the chromo4 software of BIO-RAD company is collected data.With reference to (2007) described methods such as Jiang with 2 ^{-Δ Δ CT}Method is handled GhPG2 gene relative expression's between each tissue CT value.(among Fig. 9, FB:Flower Bub (bud); Sepals (calyx); Petal (petal); Anther (flower pesticide); Ovule (ovule)) 3, in conjunction with the cotton development characteristics, fluorescent quantitation is the result show:

1) in first three period of flower bud development, the calyx of P30A and petal original hase normal differentiation, GhSERK1 genetic expression is identical with fertile line among the P30A at this moment, is to increase progressively trend;

2) fourth phase of flower bud development to the fifth phase, at a time when this differentiation of cotton stamen with grow.According to the cytology morphologic observation, tapetum heteroplasia in the P30A stamen, and GhSERK1 genetic expression this moment descends;

3) to the 6th phase, bud has got into gynoecium differentiation and etap, and this moment, GhSERK1 genetic expression was risen.

4) the GhSERK1 expression of gene is starkly lower than P30B in the P30A mature anther.Its ripe calyx, petal and ovule and P30B's is close.

Conclusion: GhSERK1 is relevant with the reproductive development of cotton, and possibly participate in the tapetum growth of pollen.

The structure of embodiment 3, cotton GhSERK1 plant expression vector

Utilize the GATEWAY system constructing plant expression vector of Invitrogen company, select two cDNA fragments among the GhSERK1, they are respectively SEQ IDNO:5,6 in the sequence table.Difference called after 1683 and 7016, wherein fragment 1683 and 7016 is two parts of SERK gene conserved domain.They are connected with pMD18-T respectively, and called after pMDGS11683 and pMDGS17016 carry out the BP recombining reaction with entry vector pDONR211 respectively, and they are recombinated on the pDONR211.

The BP system of recombinating:

pMDGS11683orpMDGS17016 1.0μl

(50～100ng)

pDONOR221(30～50ng) 0.5μl

BP?enzyme?Mix 1.0μl

ddH2O 2.5μl

total 5.0μl

25 ℃ are incubated 1 hour, add 1 μ l Proteinase K, and 37 ℃, the 10min termination reaction.

With recombinant products transformed into escherichia coli TOP10 competence, obtain positive colony through that screening of card, with recon called after pDONR211-1683 and pDONR211-7016.

Extract positive colony plasmid pDONR211-1683 and pDONR211-7016 (being referred to as pDONOR221-GhSERK), utilize the LR recombining reaction that they are recombinated respectively on the plant expression vector pK7GWIWG2 (I).

The LR system of recombinating:

PDONOR221-GhSERK plasmid (50～100ng) 1.0 μ l

pK7GWIWG2(I)(30～50ng) 0.5μl

LR?enzyme?Mix 0.5μl

ddH ₂ O 0.5μl

total 2.5μl

25 ℃ are incubated 1 hour, add 1 μ l Proteinase K, and 37 ℃, the 10min termination reaction.

With above-mentioned recombinant chou is transformed into escherichia coli TOP10 competence, obtains positive colony through the spectinomycin screening, with recon called after pK7GGS11683 (CGMCC No:3879) and pK7GGS17016.(Figure 10 Entry Clone (entry vector): pDONR211-1683, pDONR211-7016; Destination Vector (expression vector): pK7GWIWG2 (I); Two cDNA fragments among the Gene:GhSERK1, called after 1683 and 7016 respectively; Binary Vector (binary vector): pK7GGS11683, pK7GGS17016.)

The screening and the acquisition of embodiment 4, cotton GhSERK1 transgene cotton

1, cotton GhSERK1 plant expression vector converting cotton

Operate with gene pulser Xcell electroporation (U.S. Bio Rad company) and with reference to specification sheets; Plasmid pK7GGS11683 and pK7GGS17016 are transformed Agrobacterium LBA4404 with the electric shock conversion method; Screen through the resistant panel that contains Rifampin and spectinomycin and to obtain the Agrobacterium positive colony; Utilize again and spray agrobacterium co-cultivation, under the mediation of above-mentioned positive colony Agrobacterium with pK7GGS11683 and pK7GGS17016 converting cotton.

2, resistance screening transfer-gen plant

Spray the seed of receiving after agrobacterium co-cultivation transforms, be seeded in big Tanaka, cultivate seedling and grow 8-10 sheet true leaf and spray kantlex when more sturdy, the positive plant of coupling reaction can be taken place.The clip blade is carried genomic dna and is identified whether be transgenic line simultaneously, identifies that correct transgenic line is designated as T1 for transgenic line.

3, the PCR of transgene cotton identifies

1) extraction of cotton genomic dna

Preceding text detail.

2) PCR of transfer-gen plant identifies

With step 1 genomic dna is template,

Upstream primer

1683-sp：5’-GAATGCTGGAAGGTGATGGG-3’；

7016-sp：5’-TTGCGTTGGGATCTGCTAGG-3’；

Downstream primer: 5 '-CCATAGGGGTTTAGATGCAACTG-3 ';

Method with PCR identifies that to transfer-gen plant wherein upstream primer designs according to selected cotton SERK1 cDNA fragment sequence, and downstream primer is according to plant expression vector pK7GWIWG2 (I) carrier sequences Design.

The PCR reaction system:

Genomic dna 1.0 μ l

Reaction buffer (10X) 2.0 μ l

dNTP(2.5mmol/L?each) 1.6μl

Upstream primer (10 μ M) 0.5 μ l

Downstream primer (10 μ M) 0.5 μ l

Taq enzyme (2.5U/ μ l) 0.5 μ l

dd?H ₂ O 13.9μl

total 20.0μl

Reaction conditions: 95 ℃, 5min; 95 ℃, 30 seconds; 58 ℃, 45 seconds; 72 ℃, 2min30s; 35 circulations; 72 ℃, 5min; 4 ℃, pause.After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis detect, detected result such as Figure 11, shown in 12 (Figure 11: swimming lane 1-9 is the strain system of Pignus pignoris grain pK7GGS17016,10 positive plasmid pK7GGS17016, and 11 is wild-type, M is marker; Figure 12: swimming lane 1-8 is for changeing the strain system of pK7GGS11683; 9 positive plasmid pK7GGS11683, M is Marker, 10 is the wild-type plant; 11 are the contrast of no template) amplified band of all transgenic lines is big or small consistent with the positive plasmid amplified band; Conform to the expection size, wild-type does not then have amplified band, shows that goal gene successfully changes in the cotton.

4, change the floral organ phenotype of expression vector pK7GGS11683 and pK7GGS17016 cotton

The phenotype that contains the transgene cotton floral organ of interference carrier pK7GGS11683 and pK7GGS17016 respectively is: gynoecium is grown normal; But WUHUAFEN grain in the stamen; (Figure 13: the left side is the floral organ of wild-type, and the right side is for changeing the floral organ of expression vector pK7GGS11683 cotton the phenomenon of male stamen abortion promptly to occur; Figure 14: the left side is the floral organ of wild-type, and the right side is for changeing the floral organ of expression vector pK7GGS17016 cotton).

Result in conjunction with embodiment 2, explain: the GhSERK1 gene is relevant with the cotton reproductive development, and in stamen development, plays an important role.

Sequence table

< 110>Biological Technology institute, Chinese Academy of Agricultural Sciences

< 120>the full-length gene group sequence (promoter sequence that comprises prediction) of GhSERK1 gene

<160>1

<170>PatentIn?version?3.5

<210>1

<211>6920

<212>DNA

<213>G.hirsutum

<400>1

atataaaaat?ttatttttcc?cttttctctc?tcaaaatcac?tccatcactt?gacttacaaa 60

gagaaagttt?tgagaaacgc?aaaaaggaaa?gttcatttct?tttttatttt?gttttttaaa 120

acttgctaaa?agaaagggtt?taaaaaaaag?agtaattttt?ggcttggttt?ttttctgttc 180

tttttctttg?tatatatgtt?tttgttggct?gccttttttg?ggcgtgcttt?tgaatggagg 240

ggagtgggat?caaagggaag?gatttgattg?aggagatttt?tgggcggtaa?tggtgggatt 300

tgagagctag?ggtttttggt?tttttggttt?tttgctgtaa?tgttgtgctg?ttggggtttc 360

tgtattgttt?ggatctaagg?atatttagat?tgagagctta?aaaaaattta?aattaaaaag 420

ttgcagcttt?tagtttcccc?tttcttttgt?caaatggaag?gaagcaaaaa?ggttaaatct 480

ttggttttgg?tttgtttgat?ctcggtgcta?ctgcatccat?tctggcttat?ttctgctaat 540

gtggaaggtg?aacatgtctt?actttttttt?tctctaccgg?caactccttt?ttgttatttg 600

cattcaatta?tttttggagt?ttgatccctg?atatttgtaa?cttcgctgaa?tggggctttt 660

gatatttctt?cttataattt?ggttttgagt?ttgaaaatgt?gtgtgcttta?tacttgttta 720

ctgatggttg?gaagtttcat?tttttgtgtg?ttctgctttt?gggagattac?tctagaagtg 780

tttaatttga?ttgtacggat?tctgatcctt?gttgtcaatc?aaatgttagt?attatgcaat 840

atggttgtac?aatttgtgac?ttttgttata?ttgggtatct?tagaacatgt?ctcagaaaaa 900

tgctttttct?agaatggctt?tgtaataatt?tcagattgtg?acattttatt?gttcacagta 960

gttgcgtact?ttagacatta?aatgttggtg?atactgtaga?agtcatggct?tcatcgcaca 1020

attgaaattg?tttttcacac?cccttgctgg?tttgatagca?gatctattat?gctcatgagg 1080

tcattaaact?cgcgctgttt?aatattaaag?aattttgtat?tgcttctttt?ctgttggtta 1140

actactggtt?caatgtatgt?tatagttaca?tttgacttcc?agaactgcaa?aatttagaag 1200

attttgttgc?tgtaactgtt?gaagtatgat?agtactgttt?caaactgttt?aagcttcttc 1260

aagtagctgc?tttctgcttg?ttgatagacg?ttctaatgct?ttgtgagtgt?tgatgaatat 1320

gctttctaga?tatagttcgg?tagcaggttg?gctgtgctat?atatttttaa?catttgcatt 1380

gttttttagt?gctattctct?tacaatcttt?acttgcttct?tgaaacaggt?gatgcattgc 1440

acagcctaag?gaccaacttg?aatgatccta?acaatgtacc?gcagagttgg?gatcctaccc 1500

ttgttaaccc?ctgcacatgg?gttccacgtt?acatgtaaca?atgataatag?tgttattaga 1560

gtgtaaggtt?ttttgctctt?tgatgttttc?tgagtacatg?gttgcaactt?aagaaaattg 1620

tgctttactg?aattcgcgaa?gggttacttg?tgtaatgtct?acccctgcat?caatttttca 1680

gtgatcttgg?aaatgcagct?ttatctggtc?agcttgtacc?gcagcgtggc?ttgcttaaga 1740

atttgcagta?cttgtaagtc?atgcttcacc?ttaataattc?tagctgattg?atgtgattgt 1800

gtccgagtaa?aataggccat?tgcggacatt?ctttatattt?gtaacaggag?gaaatatttc 1860

acgacaatta?tttttgcatt?aactaagctt?ctttagccgc?atggccagtg?ggaagtagtt 1920

gagggtccca?cgtacttcat?tattttttat?caaactttta?catactcaat?tcatagttct 1980

gagaaaaggc?aaacctgtaa?ttcttctctt?catggttcag?tggcagtctt?tgccagtgga 2040

ataaagagta?tcaaatgtaa?aaaaaaaaaa?aaaaaaattc?tgttggcagt?ctggctgctg 2100

aaatccatct?atgaataact?gtaataagga?cctatttctt?tcatatagtg?ttggtcatgt 2160

tggccacgtc?tagattgagg?caccattttt?taatgaacta?aaatatctcc?tctcctgtta 2220

gaatctgatt?gctatgatct?tcatgtttat?ggtatggtaa?agttttttaa?gatgctttct 2280

taaacaaggg?tttacttcta?tatggaccat?catctaggaa?taaatatatg?tttactagga 2340

tcaggaaaca?catgttacta?actgcaacca?tcccttctct?aaatgtgtgg?tccatgttac 2400

gagatcctag?agatgaagat?gcatgaagga?attaataagc?attatggagc?tgccatacat 2460

tcattctttc?ataactagtc?cttgagctgg?tctttcagga?ctttgtggga?ggatggatgg 2520

tactatatat?tctattgtat?ttcttccttt?tacttatggt?ttgtttccct?tgaacatgac 2580

aagaggacat?ctttttccca?ttatatgatg?gcttacggga?cagttctttt?agacattgcg 2640

aacaatataa?taacccaaaa?cttttttttt?gagggtatta?taacccaaaa?cttagtattc 2700

agttgctagt?gcacagtttg?cttgccttag?tatttcatta?ctattatgcc?ttttgagacc 2760

tatcttttta?tgccagggaa?ctttacagta?ataacataag?tggaccaatt?cctagtgatc 2820

ttgggaatct?gactagcttg?gtgagcttgg?atctctattt?gaatagtttc?agtggtccta 2880

ttcctgaatc?tttggggagg?ctgtcgaaat?tgcgattcct?gtgagtatat?ttgttttgaa 2940

gctatccctg?cccccctctt?tatttttgtt?tattacatgt?tgagttgcat?gtaatgctga 3000

gatctaagtc?attacttttg?gaatcatgtt?attggtaaaa?cagaagtata?cttgatttga 3060

agttaacaaa?gaaacagaaa?taagttattt?attaaccagt?atttgtttta?ttaagataaa 3120

atcaagtata?agacatttcc?ccacccccac?cccaccccac?ctcattccac?ccacagatac 3180

acaagctttc?aacgtcatct?tcagtatcag?aaagaatact?ttcactaagt?atacaccatt 3240

agcatatgca?agttcacagc?attgaatttc?ttcatcaact?acaactgtct?ggtaaaattt 3300

tttatgcaag?ttgtttggtt?gattttttgt?ttactaaaaa?actccaggaa?tgattgaaac 3360

tttgacattt?aaaagctaaa?taaaatttaa?atggtttact?cccaccagta?aacatgagta 3420

agctggttct?gcattggtag?atgtcattca?ctcactcaca?tcaaccagga?ggatattgat 3480

tgggcatgaa?ccttaagaca?aagagctttt?ctaagtctga?ttgtttatgg?ctgttgtagg 3540

ttaaagtttg?cttgatataa?aatctcttga?ttcatttaga?tcttgaactt?ctaatgtttt 3600

gaaacttgtg?cgaggatagc?cggctcaaca?acaacacctt?gatgggtcct?atccctatgt 3660

cattaacgaa?tatcacatca?cttcaagtcc?tgtgagtgcc?aaacttatcg?tctcatttca 3720

agatctatca?ctcttttccc?ttttctgaga?tatgattata?tatccttaaa?ttgcactgtg 3780

taatgtaggg?atctatcaaa?taaccatctt?tctggggagg?ttccagataa?tggctccttc 3840

tcactattca?ctcctatcag?gttagttttc?tgcaatctgc?aatctgcttt?tcctgcctga 3900

caattttggg?tgccttaggt?ggttgttgtt?cctcatgcag?ttttgctaac?aacttagatc 3960

tatgtggccc?ggttactgga?cgcccatgcc?ccggatctcc?tcctttctct?cctcctcctc 4020

cttttgtacc?accaccgcca?atttcttctc?caagtaatat?tcttttgatg?tcttgtattt 4080

cagatctatt?gagttgcctt?tacagtatct?atgtgcagta?attttgctac?tcttgctgtc 4140

gattagactg?ttttagttta?atttaacatt?gtataatatg?ccaaacttat?cattttaacc 4200

ccctacattc?tggaaattgt?ggcatgcata?aatcatcagt?taacaaaagt?gatgcctctg 4260

cccttttccc?tgggtgagtc?tcatctcagt?ttgcacatcc?agtcctttag?ttctgtaact 4320

tcaaaagaac?tgtattattg?tgaacattga?ttgtggtgag?atgtaattaa?caatagtgcc 4380

ttctagtgaa?gggttgtgtt?tgtaagtttc?gtatgatgtg?atgcattatc?tcagttctag 4440

tgcagaagaa?gtggctgcta?tgttttgcat?tggatgttct?aaattctgat?cttatcacat 4500

tctaggtggg?aatagtgtca?ctggtgcaat?agctggagga?gttgcagcag?gtgctgcctt 4560

actgtttgct?gctcctgcaa?ttgcatttgc?gtggtggcgt?cggcggaaac?ctcaagaatt 4620

tttctttgat?gtacctggtt?agtgccataa?atgaaaaatt?actgggttgg?agggttcaag 4680

atttggtgac?agttacaata?ttcttctgtt?tcratatttt?tgcagcggaa?gaggacccag 4740

aagttcatct?tggacagctg?aagaggtttt?cattacgaga?actacaagtt?gccactgaca 4800

gttttagcca?taaaaatatt?ctgggtagag?gtggatttgg?taaggtttac?aaaggaaggt 4860

tagctgacgg?ttcactggtg?gctgttaaaa?gattgaaaga?agagcgtaca?cctggtgggg 4920

agttacagtt?tcaaacagag?gtagagatga?tcagcatggc?tgttcatcga?aatctcctca 4980

ggctgcgtgg?gttttgtatg?acaccgactg?agcgattgct?tgtttacccc?tacatggcta 5040

atggaagtgt?tgcatcatgt?ctcagaggta?aagcggacaa?gcatttatgg?ttgaattccc 5100

ctgcgtgggt?ggagtttcat?aacttccatt?tgttgaaatt?gcaaccaatt?gacttttaat 5160

cagtgaacat?ttagccttgc?tttccatctg?gattacattt?tcttgttttc?ttgcattctt 5220

atagaacgcc?ctccgtcaca?acctccactt?gattggccaa?cacggaagag?aattgcgttg 5280

ggatctgcta?ggggtctttc?ttatttgcat?gatcactgtg?acccaaagat?cattcatcgt 5340

gatgtaaaag?ctgcaaacat?tttgttggat?gaggaatttg?aagctgttgt?tggtgacttt 5400

gggttggcta?aacttatgga?ctacaaggat?acccatgtaa?cractgctgt?acgtggcaca 5460

attggacata?ttgctcctga?gtatctctct?actggaaaat?cttcagagaa?aactgatgtt 5520

tttgggtatg?gtatcatgct?tttggagctt?ataactggac?agcgggcctt?tgatcttgct 5580

cgtcttgcaa?atgatgatga?tgtcatgttg?cttgattggg?tatgcatatg?ttcttttttt 5640

tttttttttc?ggatatctta?gtcttcactt?aattgatttg?cttactactg?gattgcttcc 5700

taratggctg?cctgattctc?attattacta?aacacccttt?taataaattt?gcttactact 5760

ctattctcgg?ttctctcatc?ttaaatgcta?atccacccac?agatcaattg?ctttcttgat 5820

aactgtcatt?agttatgatg?ccatgtagtg?acataaaaga?aactaggttg?tatcctatag 5880

aaattaatct?cagaaagaga?tgagaaagca?atgggagctt?tatgttgctt?gtgttacaat 5940

gcaccagcta?tggaaaggaa?gtgaagttgc?taaggatggc?aagaactagt?tctacctata 6000

gatgccaaaa?tgaagtgttg?attttggaga?aataatgcaa?ttagtggtct?gtttcacatt 6060

ggctgagtca?gtttgtcctt?tttctctttt?ccaggtcaaa?ggacttctga?aggagaagaa 6120

gctggaattg?ctagttgatc?ctgatctgca?aaccaattat?gtagaaactg?aggtagagca 6180

gttaatccag?gttgctctgc?tatgcacaca?aggttcccca?atggaccggc?caaagatgtc 6240

agaagtggtt?agaatgctgg?aaaggtgatg?ggtttggccg?agagatggga?tgagtggcag 6300

aaagttgaag?ttcracggca?gaggttgaac?ttgcccctca?tcctaattct?gatggattgt 6360

gactcaactg?acatctgcat?gctgtgagta?tccgtccaag?tgactacgca?taattacagt 6420

aaaggaaagt?ttttactagt?tattttttaa?ggtaactttt?ttttttgtta?atttgatgac 6480

catatcctga?tttatgtctc?ctcctgtaag?cccagtccgc?attgtattca?ttacattttg 6540

tgcatgttta?tgtgagtcag?cttcgttgag?gtgcaatttg?tgttgtatct?ttcccctgca 6600

gtttgattga?gccatgatgc?ttacatgtag?ctccagccgt?ggcaatcagt?ataaccccta 6660

tgcgcacttg?atcttctcct?agtttaattc?ttcttatacg?gtttgtgaaa?catgccaaat 6720

gccgtgcatg?gaatttttct?aggggatttt?taatcttttg?aatggcagta?caagtttata 6780

gcttccacgt?tttaaacttg?tgcactcttc?tgaaatcaca?agggctttcc?tttcgtactt 6840

agttgacatg?cgttaattca?aaagtcccga?acagcaaaat?tcagtgttta?ttcttttttc 6900

cccattattt?tcctcctaaa 6920

< 120>full length cDNA sequence of GhSERKI gene

<160>1

<170>PatentIn?version?3.5

<210>2

<211>2502

<212>DNA

<213>G.hirsutum

<400>1

gaaaaaaatc?actccatcac?ttgacttaca?aagagaaagt?tttgagaaac?gcaaaaagga 60

aagttcattt?cttttttatt?ttgtttttta?aaacttgcta?aaagaaaggg?tttaaaaaaa 120

gagtaatttt?tggcttggtt?tttttctgtt?ctttttcttt?gtatatatgt?ttttgttggc 180

tgcctttttt?gggcgtgctt?ttgaatggag?gggagtggga?tcaaagggaa?ggatttgatt 240

gaggagattt?ttgggcggta?atggtgggat?ttgagagcta?gggtttttgg?ttttttggtt 300

ttttgctgta?atgttgtgct?gttggggttt?ctgtattgtt?tggatctaag?gatatttaga 360

ttgagagctt?aaaaaaattt?aaattaaaaa?gttgcagctt?ttagtttccc?ctttcttttg 420

tcaaatggaa?ggaagcaaaa?aggttaaatc?tttggttttg?gtttgtttga?tctcggtgct 480

actgcatcca?ttctggctta?tttctgctaa?tgtggaaggt?gatgcattgc?acagcctaag 540

gaccaacttg?aatgatccta?acaatgtact?gcagagttgg?gatcctaccc?ttgttaaccc 600

ctgcacatgg?tttcacgtta?catgtaacaa?tgataatagt?gttattagag?ttgatcttgg 660

aaatgcagct?ttatctggtc?agcttgtacc?gcagcttggc?ttgcttaaga?atttgcagta 720

cttggaactt?tacagtaata?acataagtgg?accaattcct?agtgatcttg?ggaatctgac 780

tagcttggtg?agcttggatc?tctatttgaa?tagtttcagt?ggtcctattc?ctgaatcttt 840

ggggaggctg?tcgaaattgc?gattcctccg?gctcaacaac?aacaccttga?tgggtcctat 900

ccctatgtca?ttaacgaata?tcacatcact?tcaagtcctg?gatctatcaa?ataaccatct 960

ttctggggag?gttccagata?atggctcctt?ctcactattc?actcctatca?gttttgctaa 1020

caacttagat?ctatgtggcc?cggttactgg?acgcccatgc?cccggatctc?ctcctttctc 1080

tcctcctcct?cctttcgtac?caccaccgcc?aatttcttct?ccaagtggga?atagtgtcac 1140

tggtgcaata?gctggaggag?ttgcagcagg?tgctgcctta?ctgtttgctg?ctcctgcaat 1200

tgcatttgcg?tggtggcgtc?ggcggaaacc?tcaagaattt?ttcttggatg?tacctgcgga 1260

agaggaccca?gaagttcatc?ttggacagct?gaagaggttt?tcattacgag?aactacaagt 1320

tgccactgac?agttttagcc?ataaaaatat?tctgggtaga?ggtggatttg?gtaaggttta 1380

caaaggaagg?ttagctgacg?gttcactggt?ggctgttaaa?agattgaaag?aagagcgtac 1440

acctggtggg?gagttacagt?ttcaaacaga?ggtagagatg?atcagcatgg?ctgttcatcg 1500

aaatctcctc?aggctgcgtg?ggttttgtat?gacaccgact?gagcgattgc?ttgtttaccc 1560

ctacatggct?aatggaagtg?ttgcatcatg?tctcagagaa?cgccctccgt?cacaacctcc 1620

acttgattgg?ccaacacgga?agagaattgc?attgggatct?gctaggggtc?tttcttattt 1680

gcatgatcac?tgtgacccaa?agatcattca?tcgtgatgta?aaagctgcaa?acattttgtt 1740

ggatgaggag?tttgaagctg?ttgttggtga?ctttgggttg?gctaaactta?tggactacaa 1800

ggatacccat?gtaactactg?ctgtacgtgg?cacaattgga?catattgctc?ctgagtatct 1860

ctctactgga?aaatcttcag?agaaaactga?tgtttttggg?tatggtatca?tgcttttgga 1920

gcttataact?ggacagcggg?cctttgatct?tgctcgtctt?gcaaatgatg?atgatgtcat 1980

gttgcttgat?tgggtcaaag?gacttctgaa?ggagaagaag?ctggaattgc?tagttgatcc 2040

tgatctgcaa?accaattatg?tagaaactga?ggtagagcag?ttaatccagg?ttgctctgct 2100

atgcacacaa?ggttccccaa?tggaccggcc?aaagatgtcg?gaagtggtta?gaatgctgga 2160

aggtgatggg?ttggccgaga?gatgggatga?gtggcagaaa?gttgaagttc?tacggcagga 2220

ggttgaactt?gcccctcatc?ctaattctga?ttggatcgtg?gactcaactg?acaatctgca 2280

tgctgttgag?ttatccggtc?caaggtgact?acggcataat?tacagtaaag?gaaagttttt 2340

actagttatt?ttttaagatt?aacttctttt?ttttttgtta?atttgatgac?catatcctga 2400

tttatgtctc?ctcctgtaag?cccagtccgc?attgtattca?ttacattttg?tgcatgttta 2460

tgtgagtcag?cttcgttgag?gtgcaaaaaa?aaaaaaaaaa?aa 2502

 

< 120>aminoacid sequence of GhSERK1 gene

<160>1

<170>PatentIn?version?3.5

<210>3

<211>627

<212>Protein

<213>G.hirsutum

<400>1

Met?Glu?Gly?Ser?Lys?Lys?Val?Lys?Ser?Leu?Val?Leu?Val?Cys?Leu?15

Ile?Ser?Val?Leu?Leu?His?Pro?Phe?Trp?Leu?Ile?Ser?Ala?Asn?Val?30

Glu?Gly?Asp?Ala?Leu?His?Ser?Leu?Arg?Thr?Asn?Leu?Asn?Asp?Pro?45

Asn?Asn?Val?Leu?Gln?Ser?Trp?Asp?Pro?Thr?Leu?Val?Asn?Pro?Cys?60

Thr?Trp?Phe?His?Val?Thr?Cys?Asn?Asn?Asp?Asn?Ser?Val?Ile?Arg?75

Val?Asp?Leu?Gly?Asn?Ala?Ala?Leu?Ser?Gly?Gln?Leu?Val?Pro?Gln?90

Leu?Gly?Leu?Leu?Lys?Asn?Leu?Gln?Tyr?Leu?Glu?Leu?Tyr?Ser?Asn?105

Asn?Ile?Ser?Gly?Pro?Ile?Pro?Ser?Asp?Leu?Gly?Asn?Leu?Thr?Ser?120

Leu?Val?Ser?Leu?Asp?Leu?Tyr?Leu?Ash?Ser?Phe?Ser?Gly?Pro?lle?135

Pro?Glu?Ser?Leu?Gly?Arg?Leu?Ser?Lys?Leu?Arg?Phe?Leu?Arg?Leu?150

Ash?Asn?Asn?Thr?Leu?Met?Gly?Pro?Ile?Pro?Met?Ser?Leu?Thr?Asn?165

Ile?Thr?Ser?Leu?Gln?Val?Leu?Asp?Leu?Ser?Asn?Asn?His?Leu?Ser?180

Gly?Glu?Val?Pro?Asp?Asn?Gly?Ser?Phe?Ser?Leu?Phe?Thr?Pro?lle?195

Ser?Phe?Ala?Ash?Ash?Leu?Asp?Leu?Cys?Gly?Pro?Val?Thr?Gly?Arg?Pro?210

Cys?Pro?Gly?Ser?Pro?Pro?Phe?Ser?Pro?Pro?Pro?Pro?Phe?Val?Pro?Pro?225

Pro?Pro?Ile?Ser?Ser?Pro?Ser?Gly?Asn?Ser?Val?Thr?Gly?Ala?Ile?240

Ala?Gly?Gly?Val?Ala?Ala?Gly?Ala?Ala?Leu?Leu?Phe?Ala?Ala?Pro?255

Ala?Ile?Ala?Phe?Ala?Trp?Trp?Arg?Arg?Arg?Lys?Pro?Gln?Glu?Phe?270

Phe?Leu?Asp?Val?Pro?Ala?Glu?Glu?Asp?Pro?Glu?Val?His?Leu?Gly?285

Gln?Leu?Lys?Arg?Phe?Ser?Leu?Arg?Glu?Leu?Gln?Val?Ala?Thr?Asp?300

Ser?Phe?Ser?His?Lys?Asn?Ile?Leu?Gly?Arg?Gly?Gly?Phe?Gly?Lys?315

Val?Tyr?Lys?Gly?Arg?Leu?Ala?Asp?Gly?Ser?Leu?Val?Ala?Val?Lys?330

Arg?Leu?Lys?Glu?Glu?Arg?Thr?Pro?Gly?Gly?Glu?Leu?Gln?Phe?Gln?345

Thr?Glu?Val?Glu?Met?Ile?Ser?Met?Ala?Val?His?Arg?Asn?Leu?Leu?360

Arg?Leu?Arg?Gly?Phe?Cys?Met?Thr?Pro?Thr?Glu?Arg?Leu?Leu?Val?375

Tyr?Pro?Tyr?Met?Ala?Asn?Gly?Ser?Val?Ala?Set?Cys?Leu?Arg?Glu?390

Arg?Pro?Pro?Ser?Gln?Pro?Pro?Leu?Asp?Trp?Pro?Thr?Arg?Lys?Arg?405

Ile?Ala?Leu?Gly?Ser?Ala?Arg?Gly?Leu?Ser?Tyr?Leu?His?Asp?His?420

Cys?Asp?Pro?Lys?Ile?Ile?His?Arg?Asp?Val?Lys?Ala?Ala?Asn?Ile?435

Leu?Leu?Asp?Glu?Glu?Phe?Glu?Ala?Val?Val?Gly?Asp?Phe?Gly?Leu?450

Ala?Lys?Leu?Met?Asp?Tyr?Lys?Asp?Thr?His?Val?Thr?Thr?Ala?Val?465

Arg?Gly?Thr?Ile?Gly?His?Ile?Ala?Pro?Glu?Tyr?Leu?Ser?Thr?Gly?480

Lys?Ser?Ser?Glu?Lys?Thr?Asp?Val?Phe?Gly?Tyr?Gly?Ile?Met?Leu?495

Leu?Glu?Leu?Ile?Thr?Gly?Gln?Arg?Ala?Phe?Asp?Leu?Ala?Arg?Leu?510

Ala?Asn?Asp?Asp?Asp?Val?Met?Leu?Leu?Asp?Trp?Val?Lys?Gly?Leu?525

Leu?Lys?Glu?Lys?Lys?Leu?Glu?Leu?Leu?Val?Asp?Pro?Asp?Leu?Gln?540

Thr?Asn?Tyr?Val?Glu?Thr?Glu?Val?Glu?Gln?Leu?Ile?Gln?Val?Ala?555

Leu?Leu?Cys?Thr?Gln?Gly?Ser?Pro?Met?Asp?Arg?Pro?Lys?Met?Ser?570

Glu?Val?Val?Arg?Met?Leu?Glu?Gly?Asp?Gly?Leu?Ala?Glu?Arg?Trp?585

Asp?Glu?Trp?Gln?Lys?Val?Glu?Val?Leu?Arg?Gln?Glu?Val?Glu?Leu?600

Ala?Pro?His?Pro?Asn?Ser?Asp?Trp?Ile?Val?Asp?Ser?Thr?Asp?Ash?615

Leu?His?Ala?Val?Glu?Leu?Ser?Gly?Pro?Arg 627

 

< 120>the corresponding cDNA sequence of GhSERK1 gene opening code-reading frame

<160>1

<170>PatentIn?version?3.5

<210>4

<211>1884

<212>DNA

<213>G.hirsutum

<400>1

atggaaggaa?gcaaaaaggt?taaatctttg?gttttggttt?gtttgatctc?ggtgctactg 60

catccattct?ggcttatttc?tgctaatgtg?gaaggtgatg?cattgcacag?cctaaggacc 120

aacttgaatg?atcctaacaa?tgtactgcag?agttgggatc?ctacccttgt?taacccctgc 180

acatggtttc?acgttacatg?taacaatgat?aatagtgtta?ttagagttga?tcttggaaat 240

gcagctttat?ctggtcagct?tgtaccgcag?cttggcttgc?ttaagaattt?gcagtacttg 300

gaactttaca?gtaataacat?aagtggacca?attcctagtg?atcttgggaa?tctgactagc 360

ttggtgagct?tggatctcta?tttgaatagt?ttcagtggtc?ctattcctga?atctttgggg 420

aggctgtcga?aattgcgatt?cctccggctc?aacaacaaca?ccttgatggg?tcctatccct 480

atgtcattaa?cgaatatcac?atcacttcaa?gtcctggatc?tatcaaataa?ccatctttct 540

ggggaggttc?cagataatgg?ctccttctca?ctattcactc?ctatcagttt?tgctaacaac 600

ttagatctat?gtggcccggt?tactggacgc?ccatgccccg?gatctcctcc?tttctctcct 660

cctcctcctt?tcgtaccacc?accgccaatt?tcttctccaa?gtgggaatag?tgtcactggt 720

gcaatagctg?gaggagttgc?agcaggtgct?gccttactgt?ttgctgctcc?tgcaattgca 780

tttgcgtggt?ggcgtcggcg?gaaacctcaa?gaatttttct?tggatgtacc?tgcggaagag 840

gacccagaag?ttcatcttgg?acagctgaag?aggttttcat?tacgagaact?acaagttgcc 900

actgacagtt?ttagccataa?aaatattctg?ggtagaggtg?gatttggtaa?ggtttacaaa 960

ggaaggttag?ctgacggttc?actggtggct?gttaaaagat?tgaaagaaga?gcgtacacct 1020

ggtggggagt?tacagtttca?aacagaggta?gagatgatca?gcatggctgt?tcatcgaaat 1080

ctcctcaggc?tgcgtgggtt?ttgtatgaca?ccgactgagc?gattgcttgt?ttacccctac 1140

atggctaatg?gaagtgttgc?atcatgtctc?agagaacgcc?ctccgtcaca?acctccactt 1200

gattggccaa?cacggaagag?aattgcattg?ggatctgcta?ggggtctttc?ttatttgcat 1260

gatcactgtg?acccaaagat?cattcatcgt?gatgtaaaag?ctgcaaacat?tttgttggat 1320

gaggagtttg?aagctgttgt?tggtgacttt?gggttggcta?aacttatgga?ctacaaggat 1380

acccatgtaa?ctactgctgt?acgtggcaca?attggacata?ttgctcctga?gtatctctct 1440

actggaaaat?cttcagagaa?aactgatgtt?tttgggtatg?gtatcatgct?tttggagctt 1500

ataactggac?agcgggcctt?tgatcttgct?cgtcttgcaa?atgatgatga?tgtcatgttg 1560

cttgattggg?tcaaaggact?tctgaaggag?aagaagctgg?aattgctagt?tgatcctgat 1620

ctgcaaacca?attatgtaga?aactgaggta?gagcagttaa?tccaggttgc?tctgctatgc 1680

acacaaggtt?ccccaatgga?ccggccaaag?atgtcggaag?tggttagaat?gctggaaggt 1740

gatgggttgg?ccgagagatg?ggatgagtgg?cagaaagttg?aagttctacg?gcaggaggtt 1800

gaacttgccc?ctcatcctaa?ttctgattgg?atcgtggact?caactgacaa?tctgcatgct 1860

gttgagttat?ccggtccaag?gtga 1884

 

< 120>its interference carrier of GhSERK1 pK7GGS11683 goes up corresponding cDNA base sequence

<160>1

<170>PatentIn?version?3.5

<210>5

<211>169

<212>DNA

<213>G.hirsutum

<400>1

atgcagattg?tcagttgagt?ccacaatcca?atcagaatta?ggatgagggg?caagttcaac 60

ctcctgccgt?agaacttcaa?ctttctgcca?ctcatcccat?ctctcggcca?acccatcacc 120

ttccagcatt?ctaaccactt?ctgacatctt?tggccggtcc?attggggag 169

< 120>its interference carrier of GhSERK1 pK7GGS17016 goes up corresponding cDNA base sequence

<160>1

<170>PatentIn?version?3.5

<210>6

<211>403

<212>DNA

<213>G.hirsutum

<400>1

ggggacaagt?ttgtacaaaa?aagcaggctg?ccaacacgga?agagaattgc?gttgggatct 60

gctaggggtc?tttcttattt?gcatgatcac?tgtgacccaa?agatcattca?tcgtgatgta 120

aaagctgcaa?acattttgtt?ggatgaggaa?tttgaagctg?ttgttggtga?ctttgggttg 180

gctaaactta?tggactacaa?ggatacccat?gtaactactg?ctgtacgtgg?cacaattgga 240

catattgctc?ctgagtatct?ctctactgga?aaatcttcag?agaaaactga?tgtttttggg 300

tatggtatca?tgcttttgga?gcttataact?ggacagcggg?cctttgatct?tgctcgtctt 360

gcaaatgatg?atggacccag?ctttcttgta?caaagtggtc?ccc 403

Claims (6)

1. cotton somatic embryos generation associated class receptor protein kinase gene GhSERK1, its amino acid sequence coded is shown in SEQ ID NO:3.

2. cotton somatic embryos generation associated class receptor protein kinase gene GhSERK1, its genome base sequence is shown in SEQ ID NO:1.

3. cotton somatic embryos generation associated class receptor protein kinase gene GhSERK1, its full length cDNA sequence is shown in SEQ ID NO:2.

4. the interference expression vector of protein kinase gene GhSERK1: pK7GGS11683, CGMCC No:3879, the cDNA fragment sequence of the GhSERK1 that wherein contains is shown in SEQ ID NO:5.

5. the transgenic cell line that contains the said expression vector of claim 4.

6. a method of cultivating transgenic plant is characterized in that: the described interference expression vector of claim 4 is imported vegetable cell, obtain transgene cotton.

Images