CN100408695C - DNA chip for screening of peroxisome proliferator - Google Patents
DNA chip for screening of peroxisome proliferator Download PDFInfo
- Publication number
- CN100408695C CN100408695C CNB2004800150696A CN200480015069A CN100408695C CN 100408695 C CN100408695 C CN 100408695C CN B2004800150696 A CNB2004800150696 A CN B2004800150696A CN 200480015069 A CN200480015069 A CN 200480015069A CN 100408695 C CN100408695 C CN 100408695C
- Authority
- CN
- China
- Prior art keywords
- peroxisome proliferation
- probe
- dna chip
- screening
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a DNA chip which comprises a probe specifically hybridizable with a gene expressed when individuals are dosed with a peroxisome proliferator, a kit for screening peroxisome proliferator comprising the DNA chip, a process for preparing the kit, and, a method for screening of peroxisome proliferator by using the kit. The DNA chip for screening peroxisome proliferator of the present invention comprises: a probe consisting of 121bp to 587bp nucleotides, which binds specifically to a gene whose expression is induced by a peroxisome proliferator; a linker consisting of oligo(dT)15r (CH2)6- and amine group in a sequential order, whose 3'terminal of oligo(dT)15 can be bonded to 5'-terminal of the probe; and, a solid substrate whose surface is coated with aldehyde group, connecting with amine group of the linker via Schiff's base reaction. In accordance with the present invention, peroxisome proliferator inducing abnormal cellular response in body, can be easily screened by using a kit for screening of peroxisome proliferator, which makes possible its wide application in the field of safety test of various chemicals.
Description
Background technology
Technical field
The present invention relates to screen the DNA chip of peroxisome proliferation, more specifically, relate to a kind of DNA chip, it comprises a kind of probe, the gene specific hybridization that this probe can be taken medicine and express behind the peroxisome proliferation with individuality, and relate to the test kit that is used to screen peroxisome proliferation that comprises the DNA chip, prepare the method for this test kit and use this test kit to screen the method for peroxisome proliferation.
The description of prior art
As everyone knows, peroxisome proliferation produces excessive free radical in vivo to bring out the PPARs (peroxisome proliferator-activated acceptor) that unusual cell response and activation promote triglyceride level decomposition in the body.When the animal peroxisome proliferation of taking medicine, produce excessive free radical in the body, so peroxysome abnormality proliferation and remove the free radical of excessive generation in cell.The peroxidase bulk absorption of abnormality proliferation is also removed the most of free radicals that are present in cell, and allows a small amount of free radical to be retained in the cell.Therefore, described remaining free radical even they are quantitatively to be little, can cause the oxidation of cellular abnormality.In this respect, consider safety problem, verify that whether a kind of chemical of waiting to be administered into animal can be used as peroxisome proliferation is very important.
Up to now, for verifying whether a kind of chemical that is administered into animal body of waiting can be used as peroxisome proliferation, screening has the following method of the active chemical of peroxisome proliferation to be used in the art, and it comprises step: to the animals administer chemical; The tissue sample that is used for light microscopy from animal excision liver with acquisition; With with this tissue of light microscopy and relatively with its size and former state sample, with existing of the peroxysome of checking abnormality proliferation.
Yet ordinary method has shown for the active chemical of low peroxisome proliferation to have the long and low shortcoming of resolving power of time loss.That is to say, need be from the animal acquisition tissue sample that chemical is taken medicine above one day.Therefore in addition, it is not correlated with for the active chemical of low peroxisome proliferation, and generation may not cause the free radical of the relative a small amount of of over-drastic peroxisome proliferation, and to compare difference not obvious for the size of the peroxysome of propagation and former state.In order to overcome described problem, several different methods has been attempted in this area, yet does not also obtain the method that can replace.
Under this condition, the exploitation screening has the active chemical of peroxisome proliferation the intensive reason.
Summary of the invention
The inventor is devoted to set up screening and has the active method of peroxisome proliferation, and the screening of finding peroxisome proliferation can use the DNA chip that comprises specificity and the probe of individual gene recombination of expressing when taking medicine peroxisome proliferation, with use comprise fluorescently-labeled Nucleotide with mark from separating the test kit that is used to screen peroxisome proliferation from the RNA of sample synthetic cDNA.
Therefore first purpose of the present invention provides the DNA chip of screening peroxisome proliferation, and comprising can specificity and the probe of individual gene recombination of expressing when taking medicine peroxisome proliferation.
Second purpose of the present invention provides the method for this DNA chip of preparation.
The 3rd purpose of the present invention provides the test kit of screening peroxisome proliferation, and it comprises the DNA chip.
The 4th purpose of the present invention provides the method for using screening reagent box screening peroxisome proliferation.
Detailed Description Of The Invention
The DNA chip that the present invention screens peroxisome proliferation comprises: by the probe that 121bp forms to 587bp Nucleotide, this probe specificity is attached to by the gene of peroxisome proliferation abduction delivering; By oligomerization (dT)
15, (CH
2)
6-and the joint formed with sequential order of amido, oligomerization (dT)
153 ' end can be incorporated into 5 ' end of probe; The solid substrate of the aldehyde radical that is connected by the effect of Schiff alkali with the amido of pan coating and joint.In the preferred embodiment of the invention, probe is not limited thereto, and is selected from the ESTs of following SEQ ID Nos:1 to 12.
AA818910:5′-ACAAAAAAAAGAAAAAAAAAAAACACTTTTATTTTCCACAAGGAAGAGCAATAGGAAAAGTCAAATCATTTCCCACATGGTTTTCTTAAAACAGAGCCTACAAGGACATATTCAGCACCAAATAAAAGATTACAACAGCCATAGAATATAATCTATAAAGCAAACATTTAATATTGCACTTTGTTTCGCAAACATTTTGGATTTTACTTTTCCTAAATGAAAAATTAGGAATTCAAGATAGCTTGAATACTAGAGCGCAACTGTGACCCTCAGATGTTATGTCAGGAATTGACCAATATTTAGAATAGTGTAATGCCTCAAAAGAGTAAAGAAATACTTAATGGGAAAAATAAAACTTTACTTCACCAACTCTTAAAATAATTTTGTCACCAATGCCAATTATCAGAATATTGGTCATTCTTGCTTAATAAAGTATTTTGTAGAACATGGTAGTGAGCGCCCCGAGGCCATGCACACCAACAATTGTTCCCTAGTCAGACATAACACAGAGTCAGGTGTTTTTACACAATCCCTCCCAACAAAAACAAATCCACCAAATGCCCTTTATGCCAAATATCCCATCAGCT-3′(SEQ?ID?No:1)
AI045827:5′-TTTATTGTGGGGCCACATGAAAAGGGCTGGGGTAGGGGATGTGGGGCCAGCCCCCGAGGCCTGGGGATGAGGAAAAAGTTAATACACAGTACATATAGAAGGCACAAGTGGGGAATTGGAG-3′(SEQ?ID?No:2)
AI045814:5′-CATCTCAGTTCTAAGATAGACCAATGCTCAAAGTTTTATTAATTTTCCTGAAGTGTATCTGGGACGCATGCTCCTCTAAAGAGGAGGCACTTTATTTGTTTACCCCAGAGTCCACTGTTGGCAAACAGATACTTTTTTTTCTGCACCTACCAATTTTAAATGTTCTAAATAAAACAGAAAATGTAGAAATTCTATTAACACAAGTAATGTATAATAGGAGCTAGGATCAGCATTATTATCAGTGAATGTGCTATGAGGTCTGAGGAAGCATTTGATGCCCAGTCCCCT-3′(SEQ?ID?No:3)
AA819408:5′-TGCACTATCACTCCCCAACCTACAGCCATCTGATACGCCGTGTACTGTTGCCTAGACTACAGTGAAAGGAAATGGAACTTTGTTACTTGGCTGTAGAGGACCTGATGGAAACCCTCTGTAAATGCTGGTGTTCTGAGAGAGTGCTTGTTCTGTCAAAGACCACAACCCAGAGCATTGCAGCAGTGCTGGGGAGACCAGTGAAGGCACTAGGGTAGAGAGCATTGGCATGGGTCACTGGCCCAGTAGACTTAATTCCCCTCGTGCCG-3′(SEQ?ID?No:4)
AA819426:5′-GAGGTGCGAAGGACCACATCTCCAGTCGGAACACGTTCCGTTAGTTAATTAAAAAAAAAAAAAAAGACTTGGGTTTTTGAAAACCCAAACCAGCTTTCTTCAAAGATGTCACCCTCATTTGTACCCCTGGGCTTAGCAGCGTTAAGAGGGCTCTTGGCTCATGGATGTTCCTCTCTGGACTGACTGGTGAGCAGGTCCAGGCAGGGCGGCCTCCGGGCAGGCTCCTCCCTAGCTCCATCCAGCAGCGACGCTCCCAGCAGGCTCCAGATGGCGCTCCTCCCAGAAGGAGTG?GCACTGGGGGCAGCAGGTGAACTGAGGATCCTCGCCCCACAGACCGCGGCCGTTTTTTATTACACACAGGTAAAACCACA-3′(SEQ?ID?No:5)
AA925545:5′-TGGCCAGGTGGCAAGGTCACCGGTGGCCCGGTCACCGATACAGGTAGTCAGCCTGGATGTTGGCCGCGATCTCGGCCTCCCACTTGTCACCATTGTTGAGTAGCTTCTCCTTGTTGTACAGCAACTCCTCATGCGTCTCGGTGGAGAACTCAAAGTTGGGGCCCTCCACGATAGCGTCAACAGGGCAGGCTTCCTGGCAGAAACCACAGTAGATACACTTGGTCATGTCAATGTCATAGCGTGTAGTCCGGCGGCTGCCATCTGCTCTTGGCTCAGCCTCAATGGTGATGGCCTGTGCAGGACAGATGGCCTCACAGAGCTTGCAGGCGATGCAACGCTCCTCCCCAGACGGGTAGCGGCGCAGTGCATGCTCCCCACGGAAGCGCGGACTCA-3′(SEQ?ID?No:6)
AA859586:5′-AGGGTGTGGGGAGAGCTAGGCTCCTGATGTCTCCTCGGCACTGGACTGTGGGCCTGGTCAGTACACACGGGCTTGTAGAGAAAGTCAGTATCTCATTAAAAAAAGAAGCGGCGGCGGCGGCAGCATCCCGGCTGTGCAGACCGCAGCAGTGCATGTGCCTAAGACAGGCCGTACCGTCCTCTGGACCAGCACGCTCTGGACAGCCTGAGCCAGGGCAGGGTGCTGCAAAGAGGGGGCTGGGCAGGCTTAGGAGACCACAGGGAACCATACCTCAATAGGCTTCTGGCCTTGCCCAGGGTCTGGACCAAAGGGACCCCAGGCCCTGCCTCTGGGTGAACCCGTCATACGTCCATAAAGTCATCGTCCTCGTCTGTCTCACTCTCCAATGAGGACTCCTGGCTGGATGTCTCCAGAACCTCCAGGGCTGGCTGGCACAGGCTCTCCTTCCTCACATTGGCGGCA-3′(SEQ?ID?No:7)
AA875496:5′-GTGAATCAATAAAACAAAAGCTAAGGACAATGAGCTCAAGTTATCGATTCTTAAGTTTCAAAATAGAACAGTAGGAAAGCTATGAAAGTGGGGGGGTGGACTTTGGGGTGTATGAGCAATAGGAATCTAAAGCATCAAAACACAGGCTAAGAAAGTCTAGGACACAAGGAAGACTCCAGCAGCTCCCTCAGATGTCTAATTCCGGTCATTTACTTTTCACTCTAAAAAGTATCTTAAATTTTTAATATTTATTAGTTTTTTGTTTTTTCAAGACAGGGTCTCACATATAGCTCTGCCTACCCCAGAACTCACAATGAAGTCCAGGCTGACCTTGAACTCACAGAGACCCTCTAGCCTCTGCCTCTGTCGTGCTGGAATTAAAGGCACATGCACCACTATGCCCAGCATAA?ATATTTA-3′(SEQ?ID?No:8)
AI029385:5′-CACTTACTAAACTAACATTATATGTTTTACAATTTTGAACAACTTTACAAGTTACTGTTATTTTCAATTCTGAGTAGAAAGGTAAACTCCAAGCAAGACAAAGCCAATAGAGGCTTAAGTTCATCACCAACAAGTTTCAACAATTTACCCCAAATTTACTGTTAAACAGTACCTGGTTGAAGACACAAGCTGCGCCTTAAATAAGCTGGAGCGACTCTGGGATGTTATGAACTTAACCTTGAAAGGAAGAAGGTATAGGAACTTCTATTTGGTTTGGATTGTAAGAACAGACAAATTACTTACAGAAACTGAATTACTTCAATACACATGTGAAGAC-3′(SEQ IDNo:9)
AI030748:5′-TATAGTAAATACGTGTGTTTTCCAGGATGCCACAGAATTTCATTGGAAAACAATGAAACTAGATTAACCTGAGACCCCCCCCTTCCCCTTAGAAAATAAGGACTATAGGATTAGACCACAAGCAGACTAGTAAAGGGGATGGGGTTGTGGTACACCTGATTTTAGCCAGACTTTCCCAAGCTAAATCCAGATAAAACTGCTTCTGTATTAGTAAGTTGGGTGAGTGTGTAAAATCTATCATTCAAAAAGT-3′(SEQ?IDNo:10)
AA819399:5′-AGAGCATAGATGTGGCAGGGTCTCAGTCCCTGCACAGAAATGAGAGATGAACAAAAACGAGACACTTCCACCTGGCCAGAGTCTGGGAGGGCAGGGAGGAACACAGACCTGGACATTCGTAAGAAAAATAAAACCTAAATCAAACATTCAATCTTGTACCCAATAAAGGTTTGAACAGGGAACTCAGTCACCACCAGTTCCCACCCTCCCCTGCCAGCACTGAAGAAAAACAAAAGTTCAACACACACTAAGGGCTTAGGAGGAAGGGGCATTCTCCTGCCTTCCCCCAACCCCCAAGAATGGGCTGGGGAAAAAACGGCTATATTTCCCCACCCCTTACAGTGTCAACCCTACACGAGTTCTGAATGTGATCCGTAAGAATCAGCAGCTCAA-3′(SEQ?ID?No:11)
AA925128:5′-TGTGTTCTTAGAAAGCAAACTTAATGGCTTTCAAACCAAATCCTTAGAGCCAGTACATCAAAGGCATTGCGGTCCACGTATGCAAGGGTGTGCATGTAGAGGCCAGAGGGCAACTTTAGGAGTCAGTATTCTCCTTCCACCCTCGGCTCCAGAGTCGAATTCAGGCCTCATGAGCAACAAGCATGTTCACCTCTTGGGCCATTCACCAGTCCCAGGATCAAGACTTCTTTGATGCTTCTATTTCTTCCCACAATGCAGCTTCAATTTTTGAAGTGTCATATTCTCTCATCATATCAAACTCAAGCCATGGCTTGCTCCACTTCTGGGCTTCTTTCATTTGCTCTTCAGTTAAAGCAAGATCAAATCTGATCCCTTTAATGTTGAAGTTCGGACGTT-3′(SEQ?ID?No:12)
The method of the DNA chip of preparation screening peroxisome proliferation comprises the steps: the synthetic probe of being made up of to 587bp Nucleotide 121bp, and this probe specificity is attached to by the gene of peroxisome proliferation abduction delivering; Synthetic by oligomerization (dT)
15, (CH
2)
6-and the joint formed with sequential order of amido; 5 ' end of synthetic probe is attached to the oligomerization (dT) of synthetic joint
153 ' end; The joint that is attached to probe is connected by the solid substrate that the effect of Schiff alkali is coated with aldehyde radical with the surface; With the unreacted aldehyde radical of reduction.In the preferred embodiment of the invention, glass, but be not limited thereto be used as solid substrate, and the reduction of aldehyde is not limited thereto, by reductive agent NaBH for example
4Carry out.
On the other hand, the test kit that the present invention screens oxide compound enzyme body proliferator can prepare by the described DNA chip that uses the screening peroxisome proliferation: promptly screen the test kit of peroxisome proliferation, comprise being used for screening the DNA chip of peroxisome proliferation and being used for the fluorescently-labeled deoxynucleotide of mark from the isolating RNA synthetic of sample cDNA.In the preferred embodiment of the invention, fluorescently-labeled deoxynucleotide is the red dATP of Texas, cyanine 3dCTP, and cyanine 5dGTP or fluorescein-12dUTP, but be not limited thereto.
In addition, peroxisome proliferation can use the test kit of screening peroxisome proliferation to screen.Be active screening of peroxisome proliferation of the chemical that can take medicine by checking of peroxisome proliferation, adopt following steps: animals administer peroxisome proliferation candidate chemical; From the animal isolation of RNA; Use the synthesizing fluorescently labeled cDNA of fluorescently-labeled deoxynucleotide the test kit from isolating RNA; Synthetic cDNA is used for DNA chip at test kit screening peroxisome proliferation, to allow hybridization; With the DNA chip of washing hybridization, and use scanning device to check the probe of hybridizing in the DNA chip.
According to the present invention, the peroxisome proliferation of abnormal cells reaction can easily screen by the test kit that uses the screening peroxisome proliferation in the inductor, and it makes the widespread use in different chemical product safety test field become possibility.
The present invention further sets forth by following examples, and it should not be considered as limitation of the scope of the invention.
Embodiment 1: with the selection of the EST (expressed sequence tag) of the gene specific of expressing by administration peroxisome proliferation hybridization
Be prepared as follows experimental group 1-3, and the rat that does not have a chemical treatments is prepared as control group, hepatectomizes from experimental group and control group.
Experimental group 1:6-week rat in age (Sprague-Dawley VAF+ albino) has the active chlorine Bei Te of peroxisome proliferation (clofibrate) 2 weeks of processing by belly injection 0.2mg/kg every day;
Experimental group 2:6-week rat in age (Sprague-Dawley VAF+ albino) has the active Ji Feinuoqi of peroxisome proliferation (gemfibrozil) 2 weeks of processing by belly injection 0.2mg/kg every day; With
Experimental group 3:6-week rat in age (Sprague-Dawley VAF+ albino) does not have the active Phenytoin Sodium Salt of peroxisome proliferation (phenytoin) to handle for 2 weeks by belly injection 0.2mg/kg every day.
Each liver from the rat collection, use RNA extraction agent box (the total RNA purification system of Micro-to-Midi, Life Technologies, Inc., USA) separating mRNA, and by the reverse transcription test kit (Platinum Biochip Reagent Kit, Genocheck, Korea) and cyanine 5dGTP from the synthesizing fluorescently labeled cDNA of mRNA.
On the other hand, from having the Clone-Library of different ESTs
TM(Research Genetics USA) extracts plasmid, and ESTs increases by round pcr, and point sample contains the DNA chip of EST as probe with preparation to glass baseplate.
From each experimental group synthetic cDNAs be used to the DNA chip and with the probe hybridization of DNA chip 12 hours.Then, (GenePix Scanner4000A, Axon Inc., Union CA) carries out the scanning of DNA chip by scanning device, to measure each the probe emitted fluorescence level from the DNA chip.The result uses image analysis system, and (GenePix Pro 4.0, Axon instrumentInc. USA) analyze to select 12 kinds of ESTs from the probe material standed for.
The cDNAs hybridization emitted fluorescence relative intensity of the ESTs that selects and their SEQ ID Nos. and described ESTs and each experimental group is shown in following table 1.The level of considering relative intensity of fluorescence and specific hybrid is proportional, and relative intensity of fluorescence calculates based on reference value 1.00, and it is from cyanine 5dGTP emitted fluorescence level when control group cDNA and DNA chip hybridization.
Table 1: can with by each chemical of administration
*And the ESTs of specific expressed gene recombination and the relative intensity of fluorescence that produces from hybridization
*: experiment 1, test 2, the experimental group of handling with chlorine Bei Te 1 is represented in experiment 3 respectively, with the experimental group 2 of Ji Feinuoqi processing and the experimental group of handling with Phenytoin Sodium Salt 3.
As shown in table 1, produce the high value of relative intensity of fluorescence from the hybridization between the ESTs of the cDNA of experimental group 1 and SEQ ID Nos 1 to 11, also produce the high value of relative intensity of fluorescence from the hybridization between the ESTs of the cDNA of experimental group 2 and SEQID Nos12, but produce the low value of relative intensity of fluorescence from the hybridization between the ESTs of the cDNA of experimental group 3 and SEQ ID Nos1 to 12.
Considering the chemical that is used for experimental group 1 and 2, known to have a peroxisome proliferation active and chemical that be used for experimental group 3 does not have activity, can infer that having the active chemical of peroxisome proliferation can use described 12 kinds of ESTs to screen.
The preparation of embodiment 2:DNA chip
As the probe that is used for the DNA chip, 12 kinds of ESTs that embodiment 1 selects are respectively by chemosynthesis, and preparation is by oligomerization (dT)
15,-(CH
2)
6-and each joint of forming with sequential order of amido, the thymine residue of joint is incorporated into 5 ' end of synthetic ESTs then.
Then, the probe that is attached to joint be dissolved in the damping fluid of concentration 50 μ M (the 350mM sodium bicarbonate, pH9.0) in and by dot-matrix device (arrayer) (MicroGrid II, BioRobotics, USA
) with
The spacing point sample of the size of 150 μ m and 400 μ m scribble the slide glass of aldehyde radical (silylated slide glass, CSS-100, CEL, Houston, TX USA) on the surface, and carries out the effect of Schiff alkali.Then, described slide glass washs in proper order with 0.2% (w/v) SDS solution and distilled water, and is dipped into NaBH
4Solution (0.1g NaBH
4, 30ml PBS, 10ml ethanol) in 15 minutes.Then, the aldehyde radical that reduction does not react with amine is with distilled water wash and dry with preparation DNA chip.
Embodiment 3: use DNA chip screening peroxisome proliferation
Check shows whether the active chemical of peroxisome proliferation can screen by the DNA chip that uses embodiment 2 preparations: fluorescently-labeled cDNAs is synthetic in mode similar to Example 1, difference is to use following different chemical, and the fluorescently-labeled cDNAs of synthetic each experimental group.
Experimental group 4:6-week rat in age (Sprague-Dawley VAF+ albino) has the active 1-methyl of peroxisome proliferation-4-piperidyl-two (p-chlorophenoxy) acetic ester by 2 weeks of belly injection treatment with 0.05mg/kg every day;
Experimental group 5:6-week rat in age (Sprague-Dawley VAF+ albino) use 0.05mg/kg Wy-14 every day, and 643 (a kind of have the active carcinogen of peroxisome proliferation) pass through 2 weeks of belly injection treatment;
Pass through belly injection treatment 2 weeks with 0.05mg/kg two-(2-ethylhexyl) phthalic acid ester (a kind of have the active endocrine disturbing agent of peroxisome proliferation) rat in age (Sprague-Dawley VAF+ albino) every day in experimental group 6:6-week; With,
Rat in age (Sprague-Dawley VAF+ albino) every day in experimental group 7:6-week is with 0.05mg/kg 2-hydroxyl-3-propyl group-4-[(6-tetrazolium-5-yl) hexyloxy]-methyl phenyl ketone (the active liver fat acid oxidase of a kind of demonstration peroxisome proliferation inhibitor) is by 2 weeks of belly injection treatment.
Fluorescently-labeled cDNAs is used to the DNA chip of embodiment 2 preparations, and hybridizes 12 hours.Then, screen dna chip and measure emission respectively from the fluorescence intensity of each experimental group (referring to, table 2).
The relative intensity of fluorescence result of the gene recombination that table 2:DNA chip is specific expressed with passing through each chemical
*: experiment 4, experiment 5, experiment 6 and experiment 7 experimental group 4 that representative 1-methyl-4-piperidyl-two (p-chlorophenoxy) handled respectively, use Wy-14,643 experimental group of handling 5, the experimental group of handling with two-(2-ethylhexyl) phthalic acid esters 6 and with 2-hydroxyl-3-propyl group-4-[(6-tetrazolium-5-yl) hexyloxy] experimental group 7 of processing.
As shown in table 2, from the cDNA of experimental group 4 to 7 show with the DNA chip in each ESTs than higher hybridization degree, show this result and the experimental group 1 of embodiment 1 and 2 come to the same thing.
Therefore, clearly show that having DNA chip that the active chemical of peroxisome proliferation can the application of the invention very much screens in mode rapidly and accurately.
As above-mentioned diagram clearly and explanation, the invention provides the DNA chip, it comprises a kind of probe, the gene specific hybridization of expressing when this probe can be taken medicine peroxisome proliferation with individuality, and relate to the test kit of the screening peroxisome proliferation that comprises the DNA chip, prepare the method for this test kit and use this test kit to screen the method for peroxisome proliferation.According to the present invention, the abnormal cells reaction can easily be screened by the test kit that uses the screening peroxisome proliferation in the peroxisome proliferation inductor, and this makes and becomes possibility using widely aspect the proof test of various chemical.
Though the present invention openly has been used to do the preferred embodiment of purpose of illustration, those skilled in the art will recognize that multiple modification, it is possible adding and replacing, and does not depart from disclosed scope and spirit of the present invention in claims.
Sequence table
<110〉Genocheck Co., Ltd. (GENOCHECK CO., LTD.) etc.
<120〉the DNA chip of screening peroxisome proliferation
(DNA?CHIP?FOR?SCREENING?OF?PEROXISOME?PROLIFERATOR)
<130>SCT054826-47
<160>12
<170>KopatentIn?1.71
<210>1
<211>587
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>1
acaaaaaaaa?gaaaaaaaaa?aaacactttt?attttccaca?aggaagagca?ataggaaaag 60
tcaaatcatt?tcccacatgg?ttttcttaaa?acagagccta?caaggacata?ttcagcacca 120
aataaaagat?tacaacagcc?atagaatata?atctataaag?caaacattta?atattgcact 180
ttgtttcgca?aacattttgg?attttacttt?tcctaaatga?aaaattagga?attcaagata 240
gcttgaatac?tagagcgcaa?ctgtgaccct?cagatgttat?gtcaggaatt?gaccaatatt 300
tagaatagtg?taatgcctca?aaagagtaaa?gaaatactta?atgggaaaaa?taaaacttta 360
cttcaccaac?tcttaaaata?attttgtcac?caatgccaat?tatcagaata?ttggtcattc 420
ttgcttaata?aagtattttg?tagaacatgg?tagtgagcgc?cccgaggcca?tgcacaccaa 480
caattgttcc?ctagtcagac?ataacacaga?gtcaggtgtt?tttacacaat?ccctcccaac 540
aaaaacaaat?ccaccaaatg?ccctttatgc?caaatatccc?atcagct 587
<210>2
<211>121
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>2
tttattgtgg?ggccacatga?aaagggctgg?ggtaggggat?gtggggccag?cccccgaggc 60
ctggggatga?ggaaaaagtt?aatacacagt?acatatagaa?ggcacaagtg?gggaattgga 120
g 121
<210>3
<211>288
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>3
catctcagtt?ctaagataga?ccaatgctca?aagttttatt?aattttcctg?aagtgtatct 60
gggacgcatg?ctcctctaaa?gaggaggcac?tttatttgtt?taccccagag?tccactgttg 120
gcaaacagat?actttttttt?ctgcacctac?caattttaaa?tgttctaaat?aaaacagaaa 180
atgtagaaat?tctattaaca?caagtaatgt?ataataggag?ctaggatcag?cattattatc 240
agtgaatgtg?ctatgaggtc?tgaggaagca?tttgatgccc?agtcccct 288
<210>4
<211>266
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>4
tgcactatca?ctccccaacc?tacagccatc?tgatacgccg?tgtactgttg?cctagactac 60
agtgaaagga?aatggaactt?tgttacttgg?ctgtagagga?cctgatggaa?accctctgta 120
aatgctggtg?ttctgagaga?gtgcttgttc?tgtcaaagac?cacaacccag?agcattgcag 180
cagtgctggg?gagaccagtg?aaggcactag?ggtagagagc?attggcatgg?gtcactggcc 240
cagtagactt aattcccctc gtgccg 266
<210>5
<211>371
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>5
gaggtgcgaa?ggaccacatc?tccagtcgga?acacgttccg?ttagttaatt?aaaaaaaaaa 60
aaaaagactt?gggtttttga?aaacccaaac?cagctttctt?caaagatgtc?accctcattt 120
gtacccctgg?gcttagcagc?gttaagaggg?ctcttggctc?atggatgttc?ctctctggac 180
tgactggtga?gcaggtccag?gcagggcggc?ctccgggcag?gctcctccct?agctccatcc 240
agcagcgacg?ctcccagcag?gctccagatg?gcgctcctcc?cagaaggagt?ggcactgggg 300
gcagcaggtg?aactgaggat?cctcgcccca?cagaccgcgg?ccgtttttta?ttacacacag 360
gtaaaaccac?a 371
<210>6
<211>393
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>6
tggccaggtg?gcaaggtcac?cggtggcccg?gtcaccgata?caggtagtca?gcctggatgt 60
tggccgcgat?ctcggcctcc?cacttgtcac?cattgttgag?tagcttctcc?ttgttgtaca 120
gcaactcctc?atgcgtctcg?gtggagaact?caaagttggg?gccctccacg?atagcgtcaa 180
cagggcaggc?ttcctggcag?aaaccacagt?agatacactt?ggtcatgtca?atgtcatagc 240
gtgtagtccg?gcggctgcca?tctgctcttg?gctcagcctc?aatggtgatg?gcctgtgcag 300
gacagatggc?ctcacagagc?ttgcaggcga?tgcaacgctc?ctccccagac?gggtagcggc 360
gcagtgcatg?ctccccacgg?aagcgcggac?tca 393
<210>7
<211>462
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>7
agggtgtggg?gagagctagg?ctcctgatgt?ctcctcggca?ctggactgtg?ggcctggtca 60
gtacacacgg?gcttgtagag?aaagtcagta?tctcattaaa?aaaagaagcg?gcggcggcgg 120
cagcatcccg?gctgtgcaga?ccgcagcagt?gcatgtgcct?aagacaggcc?gtaccgtcct 180
ctggaccagc?acgctctgga?cagcctgagc?cagggcaggg?tgctgcaaag?agggggctgg 240
gcaggcttag?gagaccacag?ggaaccatac?ctcaataggc?ttctggcctt?gcccagggtc 300
tggaccaaag?ggaccccagg?ccctgcctct?gggtgaaccc?gtcatacgtc?cataaagtca 360
tcgtcctcgt?ctgtctcact?ctccaatgag?gactcctggc?tggatgtctc?cagaacctcc 420
agggctggct?ggcacaggct?ctccttcctc?acattggcgg?ca 462
<210>8
<211>417
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>8
gtgaatcaat?aaaacaaaag?ctaaggacaa?tgagctcaag?ttatcgattc?ttaagtttca 60
aaatagaaca?gtaggaaagc?tatgaaagtg?ggggggtgga?ctttggggtg?tatgagcaat 120
aggaatctaa?agcatcaaaa?cacaggctaa?gaaagtctag?gacacaagga?agactccagc 180
agctccctca?gatgtctaat?tccggtcatt?tacttttcac?tctaaaaagt?atcttaaatt 240
tttaatattt?attagttttt?tgttttttca?agacagggtc?tcacatatag?ctctgcctac 300
cccagaactc?acaatgaagt?ccaggctgac?cttgaactca?cagagaccct?ctagcctctg 360
cctctgtcgt?gctggaatta?aaggcacatg?caccactatg?cccagcataa?atattta 417
<210>g
<211>337
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>9
cacttactaa?actaacatta?tatgttttac?aattttgaac?aactttacaa?gttactgtta 60
ttttcaattc?tgagtagaaa?ggtaaactcc?aagcaagaca?aagccaatag?aggcttaagt 120
tcatcaccaa?caagtttcaa?caatttaccc?caaatttact?gttaaacagt?acctggttga 180
agacacaagc?tgcgccttaa?ataagctgga?gcgactctgg?gatgttatga?acttaacctt 240
gaaaggaaga?aggtatagga?acttctattt?ggtttggatt?gtaagaacag?acaaattact 300
tacagaaact?gaattacttc?aatacacatg?tgaagac 337
<210>10
<211>250
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>10
tatagtaaat?acgtgtgttt?tccaggatgc?cacagaattt?cattggaaaa?caatgaaact 60
agattaacct?gagacccccc?ccttcccctt?agaaaataag?gactatagga?ttagaccaca 120
agcagactag?taaaggggat?ggggttgtgg?tacacctgat?tttagccaga?ctttcccaag 180
ctaaatccag?ataaaactgc?ttctgtatta?gtaagttggg?tgagtgtgta?aaatctatca 240
ttcaaaaagt 250
<210>11
<211>393
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>11
agagcataga?tgtggcaggg?tctcagtccc?tgcacagaaa?tgagagatga?acaaaaacga 60
gacacttcca?cctggccaga?gtctgggagg?gcagggagga?acacagacct?ggacattcgt 120
aagaaaaata?aaacctaaat?caaacattca?atcttgtacc?caataaaggt?ttgaacaggg 180
aactcagtca?ccaccagttc?ccaccctccc?ctgccagcac?tgaagaaaaa?caaaagttca 240
acacacacta?agggcttagg?aggaaggggc?attctcctgc?cttcccccaa?cccccaagaa 300
tgggctgggg?aaaaaacggc?tatatttccc?caccccttac?agtgtcaacc?ctacacgagt 360
tctgaatgtg?atccgtaaga?atcagcagct?caa 393
<210>12
<211>396
<212>DNA
<213>Artificial?Sequence
<220>
<223>probe
<400>12
tgtgttctta?gaaagcaaac?ttaatggctt?tcaaaccaaa?tccttagagc?cagtacatca 60
aaggcattgc?ggtccacgta?tgcaagggtg?tgcatgtaga?ggccagaggg?caactttagg 120
agtcagtatt?ctccttccac?cctcggctcc?agagtcgaat?tcaggcctca?tgagcaacaa 180
gcatgttcac?ctcttgggcc?attcaccagt?cccaggatca?agacttcttt?gatgcttcta 240
tttcttccca?caatgcagct?tcaatttttg?aagtgtcata?ttctctcatc?atatcaaact 300
caagccatgg?cttgctccac?ttctgggctt?ctttcatttg?ctcttcagtt?aaagcaagat 360
caaatctgat?ccctttaatg?ttgaagttcg?gacgtt 396
Claims (6)
1. screen the DNA chip of peroxisome proliferation, it comprises:
(i) be selected from the probe of more than one genes of SEQ ID Nos:1 to 12, its specificity is attached to by the gene of peroxisome proliferation abduction delivering;
(ii) by oligomerization (dT)
15,-(CH
2)
6-and the joint formed with sequential order of amido, oligomerization (dT)
153 ' end can be incorporated into 5 ' end of probe; With
(iii) pan coating has the solid substrate of the aldehyde radical that is connected by the effect of Schiff alkali with the amido of joint.
2. preparation is used to screen the method for the DNA chip of peroxisome proliferation, and it comprises the steps:
(i) the synthetic probe that is selected from more than one genes of SEQ ID Nos:1 to 12, this probe specificity is attached to by the gene of peroxisome proliferation abduction delivering;
(ii) synthetic by oligomerization (dT)
15,-(CH
2)
6-and the joint formed with sequential order of amido;
(iii) 5 ' end of synthesising probing needle is attached to the oligomerization (dT) of synthetic linker
153 ' end;
The joint that (iv) will be attached to probe is connected by the solid substrate that the Schiff alkali reaction is coated with aldehyde radical with the surface; With
(v) reduce unreacted aldehyde radical.
3. the test kit of screening peroxisome proliferation comprises the DNA chip of claim 1 and is used for the fluorescently-labeled deoxynucleotide of mark from the isolating RNA synthetic of sample cDNA.
4. the test kit of the screening peroxisome proliferation of claim 3, wherein fluorescently-labeled deoxynucleotide is the red dATP of Texas, cyanine 3dCTP, cyanine 5dGTP or fluorescein-12dUTP.
5. use the method for the test kit screening peroxisome proliferation of claim 3, it comprises the steps:
(i) to animals administer peroxisome proliferation candidate chemical;
(ii) from the animal isolation of RNA;
(iii) use the synthesizing fluorescently labeled cDNA of fluorescently-labeled deoxynucleotide the test kit of claim 5 from isolating RNA;
(iv) synthetic cDNA is used for DNA chip, to allow hybridization at test kit screening peroxisome proliferation; With
(the v) DNA chip of washing hybridization, and use scanning device is checked the probe of hybridizing in the DNA chip.
6. the test kit of the use claim 3 of claim 5 screens the method for peroxisome proliferation, and wherein fluorescently-labeled deoxynucleotide is the red dATP of Texas, cyanine 3dCTP, cyanine 5dGTP or fluorescein-12dUTP.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020040022408 | 2004-03-31 | ||
KR20040022408 | 2004-03-31 |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1798852A CN1798852A (en) | 2006-07-05 |
CN100408695C true CN100408695C (en) | 2008-08-06 |
Family
ID=36819199
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2004800150696A Expired - Fee Related CN100408695C (en) | 2004-03-31 | 2004-04-13 | DNA chip for screening of peroxisome proliferator |
Country Status (3)
Country | Link |
---|---|
KR (1) | KR100885711B1 (en) |
CN (1) | CN100408695C (en) |
WO (1) | WO2005095649A1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004027376A2 (en) * | 2002-09-20 | 2004-04-01 | Bristol-Myers Squibb Company | Assay for ppar ligand dependent gene modulation |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2001280889A1 (en) | 2000-07-31 | 2002-02-13 | Gene Logic, Inc. | Molecular toxicology modeling |
JP2003304888A (en) | 2002-03-14 | 2003-10-28 | F Hoffmann La Roche Ag | Method for toxicity prediction of compound |
-
2004
- 2004-04-13 CN CNB2004800150696A patent/CN100408695C/en not_active Expired - Fee Related
- 2004-04-13 WO PCT/KR2004/000852 patent/WO2005095649A1/en active Application Filing
- 2004-04-13 KR KR1020067022611A patent/KR100885711B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004027376A2 (en) * | 2002-09-20 | 2004-04-01 | Bristol-Myers Squibb Company | Assay for ppar ligand dependent gene modulation |
Non-Patent Citations (4)
Title |
---|
Target genes of peroxisome proliferator-activated receptorgamma in colorectal cancer cells.. Gupta R.A., et al.J Biol Chem,Vol.276 No.32. 2001 |
Target genes of peroxisome proliferator-activated receptorgamma in colorectal cancer cells.. Gupta R.A., et al.J Biol Chem,Vol.276 No.32. 2001 * |
基因芯片技术在消化病学领域的应用进展. 陈胜良等.中华消化杂志,第22卷第8期. 2002 |
基因芯片技术在消化病学领域的应用进展. 陈胜良等.中华消化杂志,第22卷第8期. 2002 * |
Also Published As
Publication number | Publication date |
---|---|
CN1798852A (en) | 2006-07-05 |
KR20070011417A (en) | 2007-01-24 |
KR100885711B1 (en) | 2009-04-10 |
WO2005095649A1 (en) | 2005-10-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2215261B1 (en) | A method of diagnosing neoplasms | |
AU735756B2 (en) | Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6 | |
US6709855B1 (en) | Methods for detection and use of differentially expressed genes in disease states | |
JP2003514538A (en) | Mammalian toxicological response markers | |
KR20100095564A (en) | Methods and compositions for assessing responsiveness of b-cell lymphoma to treatment with anti-cd40 antibodies | |
CN1256714A (en) | Diagnostic method and kit for neuropsychiatric diseases using trinucleotide repeats sequence | |
AU2020201779B2 (en) | Method for using gene expression to determine prognosis of prostate cancer | |
CA2939539A1 (en) | Prostate cancer survival and recurrence | |
KR20120013992A (en) | Methods for assessing responsiveness of b-cell lymphoma to treatment with anti-cd40 antibodies | |
US20030065157A1 (en) | Genes expressed in lung cancer | |
AU2008203226A1 (en) | Colorectal cancer prognostics | |
US20090215033A1 (en) | Prediction of Clinical Outcome Using Gene Expression Profiling and Artificial Neural Networks for Patients with Neuroblastoma | |
KR20150051171A (en) | A new dna marker and a detecting method of using the same | |
KR101140022B1 (en) | Probe and DNA Chip for Identifying Freshwater Fish Species | |
EP1108067A2 (en) | Toxicological response markers | |
CN100408695C (en) | DNA chip for screening of peroxisome proliferator | |
CA2450004A1 (en) | Complete mitochondrial genome sequences as a diagnostic tool for the health sciences | |
CN101372712B (en) | MUC4 molecular marker capable of identifying western pig breed weaned piglet F4 diarrhoea susceptibility/resistance and use thereof | |
JP2004535776A (en) | Rat toxicity related gene and its use | |
US20080108511A1 (en) | Genes and gene products differentially expressed during heart failure | |
US20030175761A1 (en) | Identification of genes whose expression patterns distinguish benign lymphoid tissue and mantle cell, follicular, and small lymphocytic lymphoma | |
JP2009005698A (en) | Microsatellite sequence for canine genotyping | |
US7091033B2 (en) | Array of toxicologically relevant canine genes and uses thereof | |
WO2009107614A2 (en) | Method for detection of target nucleic acid and device for detection of target nucleic acid | |
Stoeckle et al. | Microsatellites for North American species of Triops (Branchiopoda: Notostraca) |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080806 Termination date: 20120413 |