Background technology:
Biochip technology has been one of the most far-reaching great science and technology progress of influence since the mid-90, be that to melt microtronics, biology, physics, chemistry, computer science be the new technology that the height of one intersects, have great fundamental research and be worth, have tangible industrialization prospect again.Biochip is meant methods such as adopting the synthetic or micro-sampling of photoconduction original position, the large number of biological macromole is solidified surface in upholder in an orderly manner such as biological samples such as nucleic acid fragment, peptide molecule even tissue slice, cells, form intensive two-dimentional molecular arrangement, then with the molecular hybridization that hits of the biological sample to be measured of mark, by specific instrument such as laser confocal scanning or electric charge coupling photography camera (CCD) to intensity of hybridization signal carry out fast, walk abreast, check and analysis efficiently, thereby the quantity of target molecule in the judgement sample.Because slide/silicon chip commonly used is as solid support, and in the technology of preparing of preparation process analog calculation machine chip, so be referred to as biochip technology.
Biochip can be applicable to detection, gene diagnosis, drug screening, individuation medical treatment, order-checking, the information biology research of gene expression dose, and biochip technology is widely used in medical diagnosis on disease and many fields such as treatment, medicine Genome Atlas, drug screening, Chinese medicine species are identified, the good child-rearing of farm crop is preferred, judicial expertise, Food Hygiene Surveillance, environment measuring, national defence at present.It will open up brand-brand-new way for human knowledge's origin of life, heredity, growth and evolution, for the diagnosis of human diseases, treatment and control, for the rapid screening and the pharmacogenomics research of lead compound in macromolecular brand-new design of biology and the drug development provides the technical support platform.
Along with the development of biochip technology, gene chip is widely used in physianthropy communicable disease and genetic diseases diagnosis.The disease gene chip diagnosis principle is to isolate DNA and the DNA chip hybridization can draw standard diagram from normal people's genome.From patient's genome, isolate DNA and the DNA chip hybridization just can draw the pathology collection of illustrative plates.By comparing, analyzing this two kinds of collection of illustrative plates, just can draw the DNA information of pathology.Characteristics such as this gene chip diagnosis technology is quick, efficient with it, sensitivity, economy, parallelization, automatization will become a modernization diagnosis new technology.For example Affymetrix company is integrated in the probe of P53 full length gene sequence and known mutations on the chip, makes the P53 gene chip, will play a role in early diagnosis of cancer.And for example, Heller etc. have made up the little battle array of cDNA of 96 genes, are used for the relevant gene of check and analysis rheumatic arthritis (RA), to inquire into the DNA chip in the application aspect the infectious diseases diagnosis.Now, a series of diagnosing chips such as hepatitis virus detection diagnosing chip, Mycobacterium tuberculosis drug-resistant detection chip, multiple malignant tumour correlated virus gene chip progressively begin to come into the market.Diagnosing chip is beneficial to characteristics such as large-scale promotion application because have all kinds of Disease-causing gene fragment detection efficiency height, early diagnosis and less, high sensitivity, specificity, reliability and the level of automation height of testing sample consumption, receives much concern.Aspect medical diagnosis on disease, U.S. Affymetrix company has utilized gene chip to carry out the research work of AIDS (HIV), and business-like GeneChip HIV PRT diagnosing chip listing is arranged, and is used for the early diagnosis of AIDS.
Yet research is not seen as yet to the bitter rot or anthracnose of grape gene chip.Bitter rot or anthracnose of grape is to endanger one of severe diseases the most in the grape production, and the production loss that annual bitter rot or anthracnose of grape causes is very big.Owing to can not carry out the disease screening in early stage, cause a large amount of chemical pesticides of later stage to use, fruit is seriously polluted.The development grape anthracnose disease biochip reduces chemical pesticide and pollutes this disease early diagnosis and control, and it is very meaningful to produce the grape non-harmful product.
Embodiment
1, for the examination material
Bacterial strain: grape anthracnose, PDA culture medium culturing.
Reagent: Digestive system (0.01M TrisCl, 0.005M EDTA, 0.5%SDS, 50 μ g/ml Proteinase Ks), phenol, chloroform, primary isoamyl alcohol, Proteinase K, agarose, PCR test kit (Promega company) arm molecule aminopropyltriethoxywerene werene (APTES) is (SIGMA), dNTP (worker bio-engineering corporation is given birth in Shanghai), sampling liquid, elutriant, hybridization solution.
Plant and instrument: pcr amplification instrument (Biometra Personal PCR system, USA), voltage stabilization and current stabilization electrophoresis apparatus (BIO-RAD Mini II, USA), refrigerated centrifuge (SIGMA, USA), biochip point sample instrument (MG II600, BioRobotics Ltd, England), laser scanner (Gene TAC
TMLS IV, GenomicSolutions Inc.USA), digital display Constant Temp. Oven (202-0, Shanghai sunlight laboratory apparatus company limited)
2, extracting genome DNA and quantitative
Scrape the grape anthracnose bacterium colony of getting on the substratum, place 2ml EP pipe, add Digestive system 1ml, vibration mixes, 37 ℃ of water-bath 30min.Adding equal-volume phenol-chloroform mixed solution (phenol: chloroform: primary isoamyl alcohol=25: 24: 1), mixing, the centrifugal 5min of 16000r/min abandons organic phase, gets supernatant.Repeat the phenol extraction step, to two alternate no egg white layers.Add the equal-volume chloroform, mixing, the centrifugal 5min of 16000r/min abandons organic phase, gets supernatant.The dehydrated alcohol that adds 2 times of volume-20 ℃ precoolings is put upside down and is shaken for several times, leaves standstill 1 hour in-20 ℃.The centrifugal 10min of 16000r/min, 70% washing with alcohol, Air drying.Add an amount of aseptic deionized water dissolving DNA, 4 ℃ of refrigerators are preserved standby.Adopt ultraviolet spectrophotometry quantitative assay genomic dna content.In the light absorption value of wavelength 260nm and the mensuration DNA of 280nm place sample, the purity of DNA sample according to a preliminary estimate.Work as OD
260/ OD
280〉=1.8 expression purity are than higher.Otherwise expression purity is not enough, extracting again.According to 1OD
260Be equivalent to 50 μ g/ml dsDNA, estimate each sample concentration, add an amount of aseptic bacterium deionized water and adjust each sample concentration to about 1 μ g/ μ l.
3, polymerase chain reaction (PCR) amplification
4, the preparation of gene chip and sample detection
The preparation of gene chip and sample detection are undertaken by flow process.
5, substrate is handled and preparation
Get 20 * 20 cover glasses, soak in chromic acid solution more than 12 hours, distilled water is cleaned, and 1N NaOH soaked 1 hour, acetonization 3min.Immerse arm molecule solution (2% aminopropyltriethoxywerene werene is with 5% acetone solution) 10min, acetone cleans, and baking is fixing, soaked overnight in 5% glutaraldehyde.
6, probe design
Grape anthracnose 28S rRNA sequence is:
1 ACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCTTCGTATGCGAGTGT
51 TCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGCAGGTCAGAGCTT
101?C---GGCGCATCATCGACCGATCCTGATGTTCTCGGATGGATTTGAGTAA
151?GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGT
201?GAAGCCAGAGGAAACTCTGGTGGAGGC227
Sequencing result design anthrax probe according to the grape anthracnose sample.Simultaneously with the complementary strand of unmarked primer as positive control, with isoconcentration probe damping fluid as blank, with the irrelevant probe (referring to does not have homology or the very low oligonucleotide sequence of homology with target sequence) of isoconcentration as negative control.Sequence is as follows:
The anthrax probe: 5 '-ACGGGGCCGGACCCGAAAGAA-3 ' (21bases)
Positive control: 5 '-TGCTGGGCAGAACTTTGTGC-3 ' (20bases)
Negative control: 5 '-ATGCTTACCGAATCCTTAGC-3 ' (20bases)
Probe and primer are synthetic all to carry out in handsome Bioisystech Co., Ltd.
7, chip point system
Cryodesiccated probe is diluted to 100 μ M with the 0.2M carbonate buffer solution.4 ℃ of preservations are standby.
The oligonucleotide probe for preparing is added 384 orifice plates respectively, use biochip point sample instrument, make pre-designed microarray.Note in the point sample keeping humidity 70-80%, 37 ℃ of aquations are spent the night behind the point sample, dry fixing, standby for 80 ℃.
8, sealing and nucleic acid hybridization
Get the biochip for preparing, with preceding with the unnecessary not covalently bound probe of 0.1%SDS flush away.(0.01MPB, PH9), room temperature is sealed 30min, fully cleans to dry up to immerse 5% diethylamine.The PCR product adds hybridization solution (10 μ l salmon sperm dnas are dissolved in 1ml 10 * Denhart liquid) by 1: 1 dilution mixing, gets 15 μ l and is covered in each microarray, places the cover plate through hydrophobic treatment.Insert 55 ℃ of insulation 30min in the hybridization cabin.
9, washing and detection
Take out hybridization hybrid chip, remove cover plate.Be preheated to 60 ℃ washing lotion (concentration is respectively 1 * SSC/0.1%SDS, 0.5 * SSC/0.1%SDS, 0.1 * SSC) carries out gradient washing, each 3min that vibrates, ddH
2O cleans and dries up.Laser scanner scans detects results of hybridization, carries out the result with signal to noise ratio and judges.
10, different strain check and analysis
Gather the grape anthracnose sample, through extracting genome DNA, pcr amplification (fluorescent mark), the PCR product adds hybridization solution (10 μ l salmon sperm dnas are dissolved in 1ml10 * Denhart liquid) by 1: 1 dilution mixing, gets 15 μ l and is covered in each microarray, places the cover plate through hydrophobic treatment.Insert 55 ℃ of insulation 30min in the hybridization cabin.Washing dries up, and detects results of hybridization in laser scanner scans respectively, the susceptibility of observation sample, and judge with the noise comparison result.