CN100391544C - The E type DNA vaccine of Chlamydi trachomatis and its preparation methods and applications - Google Patents
The E type DNA vaccine of Chlamydi trachomatis and its preparation methods and applications Download PDFInfo
- Publication number
- CN100391544C CN100391544C CNB2006100162482A CN200610016248A CN100391544C CN 100391544 C CN100391544 C CN 100391544C CN B2006100162482 A CNB2006100162482 A CN B2006100162482A CN 200610016248 A CN200610016248 A CN 200610016248A CN 100391544 C CN100391544 C CN 100391544C
- Authority
- CN
- China
- Prior art keywords
- type
- vaccine
- trachomatis
- dna vaccine
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention provides preparation method and use of E-DNA vaccines of chlamydia trachoma. By means of molecular cloning and other genetic engineering technology, the invention clones the major outer membrane protein gene (CR genes) from E-chromosome gene of Chlamydia trachoma using PCR technology then directional connected with eukaryotic expression plasmid pcDNA3.1 (+) to construct the DNA vaccine. Confirmed through animal experiments, the constructed E-DNA vaccine of chlamydia trachoma induces mice to produce certain cell and humoral immunity specific to chlamydia trachoma. Cellular immunity is even more markedly, predominated with the Th1 reaction, and acts as a protection to the attacks of chlamydia trachoma to E-genital tract. The vaccine is expected to improve the high incidence of chlamydia trachoma infections in genitourinary tract, difficult to cure, easy to relapse and costly conditions.
Description
[technical field]
The present invention relates to the biological medicine technology field, specifically relate to a kind of E type DNA vaccine of Chlamydi trachomatis and preparation method thereof and purposes.
[background technology]
(Chlamydia trachomatis C.t) once caused being widely current of world wide trachoma to chlamydia trachomatis, caused serious harm, was still the first cause of some developing country's blindings so far.The mid-80 becomes the The main pathogenic fungi that spreads through sex intercourse and infect again, and sickness rate occupies the first place of spreading through sex intercourse and infecting.The incidence of infection that spreads through sex intercourse that is caused by chlamydia trachomatis rises just rapidly in recent years.C.t usually infects symptom that even more serious is is slight even do not have a symptom, can not cause enough attentions of people, can not be diagnosed in time and be treated, continue to exist several months even several years, finally cause a series of relatively severe complications and sequela such as pelvic inflammatory disease, infertility, ectopic pregnancy, epididymitis, can also cause vertical transmission, cause the neonate perinatal infection.The report of drug resistance C.t strain constantly occurs in addition, quite a few C.t infects insensitive to treating, and the recurrence easily of treatment back also exists quite high C.t infection rate more simultaneously, therefore it is particularly important to prevent C.t to infect, and control C.t propagates and popular essential measure just is prevention.People seek the infection that a kind of effective vaccine wishes fundamentally to prevent and to control C.t tireless always.
The C.t vaccine is divided into albumen or polypeptide vaccine and nucleic acid vaccine two classes.Preceding a kind of vaccine once was whole-bacterial-vaccine, subunit vaccine and synthetic polypeptide vaccine, because the body specific immune response that this class vaccine is excited is more weak and of short duration, thereby was not enough to prevent the infection again of C.t; The emerging in recent years incomparable superiority of other class vaccines that nucleic acid vaccine showed is that a most promising field has been opened up in the prevention of C.t.
The C.t kind has three biovarieties, is respectively trachoma biovariety, LGV biovariety and Mus biovariety.A in the trachoma biovariety～C type causes trachoma, and D～K type causes urogenital infections; The L1 of lymphogranuloma venereum biovariety～L3 type causes lymphogranuloma venereum; Mus pneumoniae strain in the Mus biovariety mainly causes the infection of Mus, not affects humans.
Year surplus the research of C.t dna vaccination existing ten, the overwhelming majority selects the Mus pneumoniae strain (MoPn) in the C.t kind to go the animal model of infecting mouse respiratory tract to come the immune effect of researching DNA vaccine, and causes that the dna vaccination research of the C.t type of human nongonococcal urethritis only sees one piece of report.This article has made up C.t D type dna vaccination, estimate the immune effect of dna vaccination behind the immune mouse by the level of gamma interferon in Serum Antibody Detection, spleen lymphocyte proliferation test and the spleen cell cultures supernatant, the result confirms to stimulate body to produce cellular immunization and humoral immunization.But a lot of data show that the C.t of urogenital infections is maximum with the E type, and promptly the E type is the advantage type that infects, and is " type specificity " because C.t infects the protective effect that produces, so the dna vaccination of C.t D type is not strong to the protective effect that C.t E type infects.
[summary of the invention]
Purpose of the present invention is intended to for overcoming the defective of prior art, selects this advantage type of C.t E type as object of study, and a kind of E type DNA vaccine of Chlamydi trachomatis and preparation method thereof and purposes are provided.The present invention studies confirm that by experiment, and constructed practical immune effect and the protective effect of C.t E type dna vaccination for the further investigation and the application of C.t dna vaccination lays the foundation, has important scientific research and clinical value.
For realizing purpose of the present invention, the invention discloses a kind of E type DNA vaccine of Chlamydi trachomatis, it is characterized in that comprising chlamydia trachomatis E type omp1 gene and carrier for expression of eukaryon, the omp1 gene encoding production is a chlamydia trachomatis major outer membrane albumen, said omp1 gene nucleotide series is shown in SEQ ID NO:1, and said carrier for expression of eukaryon is pcDNA3.1 (+).
The invention also discloses a kind of method for preparing described E type DNA vaccine of Chlamydi trachomatis, it is characterized in that from chlamydia trachomatis E type BOUR strain, extracting chromosomal DNA, the pcr amplification proteic omp1 gene of major outer membrane that goes out to encode is cloned in pcDNA3.1 (+) vector plasmid and is built into the Chlamydia Trachomatis DNA vaccine.5 of its genes of interest ' end inserts from the BamHI site, and 3 of genes of interest ' end inserts from Not I site.
E type DNA vaccine of Chlamydi trachomatis of the present invention, the vaccine that is used to prepare prevention and treats urogenital tract chlamydia trachomatis infection disease.
The present invention is based on the research basis of prior art; select this advantage type of C.t E type as object of study; make up E type DNA vaccine of Chlamydi trachomatis; confirm that by a series of zooperies this dna vaccination can stimulate animal body to produce effective humoral immunization and cellular immunization, the reproductive tract infection of chlamydia trachomatis E type is had protective effect.By the mode immunity of intramuscular injection, can effectively excite humoral immunization and cellular immunization, have advantages such as immunologic process is simple, inoculation safety, effect is obvious, repeatability is strong.
[description of drawings]
Fig. 1: C.t E type dna vaccination structural models figure
Fig. 2: the amplification of the complete omp1 gene of C.t E type;
Fig. 3: the double digestion of omp1 gene;
The double digestion of Fig. 4: pcDNA3.1 (+) plasmid;
Fig. 5: omp1-pcDNA3.1 (+) recombiant plasmid double digestion electrophoresis is identified;
Fig. 6: omp1-pcDNA3.1 (+) recombiant plasmid pcr amplification is identified.
[specific embodiment]
The present invention clones coding major outer membrane proteic omp1 gene from chlamydia trachomatis E type BOUR strain chromogene, and the external source chlamydia trachomatis E type omp1 gene structure that its directed cloning constructs the dna vaccination insertion in the carrier for expression of eukaryon pcDNA3.1 (+) is described below:
(1) sequence signature
Length: 1182bp
Type: nucleic acid
Chain number: two strands
Geometry: linearity
(2) molecule type: DNA
(3) chlamydia trachomatis E type BOUR strain (Trachoma type E strain BOUR) is purchased
Collect center (ATCC), goods number: VR-348BTM from the US mode strain.
(4) nucleotide sequence of omp1 gene is described below:
atgaaaaaac?tcttgaaatc?ggtattagta?tttgccgctt?tgagttctgc?ttcctccttg 60
caagctctgc?ctgtggggaa?tcctgctgaa?ccaagcctta?tgatcgacgg?aattctgtgg 120
gaaggtttcg?gcggagatcc?ttgcgatcct?tgcaccactt?ggtgtgacgc?tatcagcatg 180
cgtatgggtt?actatggtga?ctttgttttc?gaccgtgttt?tgaaaacaga?tgtgaataaa 240
gaattccaaa?tgggtgacaa?gcctacaagt?actacaggca?atgctacagc?tccaaccact 300
cttacagcaa?gagagaatcc?tgcttacggc?cgacatatgc?aggatgctga?gatgtttaca 360
aatgccgctt?gcatggcatt?gaatatttgg?gatcgctttg?atgtattctg?tacactagga 420
gcctctagcg?gataccttaa?aggaaactct?gcttctttca?atttagttgg?attgtttgga 480
gataatgaaa?atcaaagcac?ggtcaaaacg?aattctgtac?caaatatgag?cttagatcaa 540
tctgttgttg?aactttacac?agatactgcc?ttctcttgga?gcgtgggcgc?tcgagcagct 600
ttgtgggagt?gcggatgtgc?gactttaggg?gcttctttcc?aatacgctca?atctaaacct 660
aaagtcgaag?aattaaacgt?tctctgtaac?gcagctgagt?ttactatcaa?taagcctaaa 720
ggatatgtag?ggcaagaatt?ccctcttgca?ctcatagcag?gaactgatgc?agegacgggc 780
actaaagatg?cctctattga?ttaccatgag?tggcaagcaa?gtttagctct?ctcttacaga 840
ttgaatatgt?tcactcccta?cattggagtt?aaatggtctc?gagcaagttt?tgatgccgat 900
acgattcgta?tagcccagec?aaaatcagct?acagctatct?ttgatactac?cacgcttaac 960
ccaactattg?ctggagctgg?cgatgtgaaa?gctagcgcag?agggtcagct?cggagatacc 1020
atgcaaatcg?tctccttgca?attgaacaag?atgaaatcta?gaaaatcttg?cggtattgca 1080
gtaggaacga?ctattgtaga?tgcagacaaa?tacgcagtta?cagttgagac?tcgcttgatc 1140
gatgagagag?ctgctcacgt?aaatgcacaa?ttccgcttct?aa 1182
One, the preparation of E type DNA vaccine of Chlamydi trachomatis and evaluation
1. the preparation of E type DNA vaccine of Chlamydi trachomatis
1. get C.t E type type strain and cultivate cell culture 100 μ l positive and that collect, 12000rpm, centrifugal 20min abandons supernatant; Add 50 μ l lysates (containing the 200mg/L E.C. 3.4.21.64) in the precipitation, behind the vibration mixing, put into 55 ℃ of water-baths and be incubated 1h; Boil 15min ,-20 ℃ store for future use.
2. design the amplimer P15 ' cgggatccatgaaaaaactcttgaaatcgg3 ' of omp1 gene; P25 ' atttgcggccgcttagaagcggaattgtgcat 3 '.Genetic fragment total length 1202 base pairs of P1, P2 primer amplification (base pair, bp), comprising the complete omp1 gene 11 82bp of C.t E type, two restriction endonuclease recognition sites are total to 14bp, protectiveness base 6bp, the PCR reaction system sees Table 1.Pcr amplification condition: 94 ℃ of pre-degeneration 5min; 94 ℃ of degeneration 50s; 62 ℃ of annealing 60s; 72 ℃ are extended 130s; After 35 circulations, extend 10min after 72 ℃, make to react completely.Get 10 μ l PCR products, contrast with Marker behind 1% agarose gel electrophoresis, clear specific band appears in the 1202bp position, consistent with the target gene fragment size that will increase, prompting PCR success the results are shown in Figure 1, (there is amplified production in 1,2,7,8 roads at the 1202bp place, 3,4,5 do not have amplified production, 6 negative contrasts, M:DNA Marker IV).
Table 1:omp1 gene PCR amplification system
3. use the omp1 gene and pcDNA3.1 (+) vector plasmid of restriction endonuclease BamHI and NotI cutting amplification, 37 ℃ of insulation 6h.The result shows: omp1 gene electrophoretic velocity basically identical enzyme action and double digestion, there is not the restriction enzyme site of BamHI and NotI in the middle of the prompting omp1 gene, and see Fig. 2 (1: enzyme action omp1 gene not; 2: double digestion omp1 gene; M:DNA 200bp ladder); At about 5400bp place DNA band is clearly arranged behind the double digestion carrier, the plasmid electrophoretic velocity of BamHI single endonuclease digestion and double digestion is consistent, the circulus of plasmid is broken into wire behind the prompting enzyme action, the theoretical size of fragment and pcDNA3.1 (+) carrier is consistent, sees Fig. 3 (1: enzyme action pcDNA3.1 (+) plasmid not; 2:BamHI single endonuclease digestion pcDNA3.1 (+) plasmid; 3: double digestion pcDNA3.1 (+) plasmid; M:DNA MarkerIV).The double digestion product of omp1 gene and pcDNA3.1 (+) carrier is downcut the purpose fragment respectively behind the electrophoresis in 1% agarose gel, reclaim the test kit description operation, reclaim the double digestion fragment, be dissolved in respectively in the 20 μ l distilled water according to the agarose gel dna fragmentation.The omp1 gene and pcDNA3.1 (+) plasmid that reclaim behind the above-mentioned enzyme action are set up reaction system by about 4: 1 molecular ratio, and 16 ℃ of reaction 16～24h carry out coupled reaction under the effect of T4DNA ligase, be built into dna vaccination.
4. Calcium Chloride Method transforms preparation competence E.coli DH5 α with dna vaccination, and this step is set up two matched groups: positive control, get 10 μ l (about 40ng) pcDNA3.1 (+) plasmid transformed competence colibacillus E.coli; Negative control does not add plasmid, and generation is with 10 μ l distilled water transformed competence colibacillus E.coli.As a result positive control dull and stereotyped with is connected the conversion flat board colony growth is all arranged, and the former is intensive than latter's bacterium colony, the aseptic length of being born of negative control flat board.
2.C.t the evaluation of E type dna vaccination
1. enzyme action is identified
Alkaline lysis extracts the recombiant plasmid that is transformed among the E.coli DH5 α in a small amount, BamHI and NotI restriction endonuclease are carried out double digestion, 37 ℃ of incubated overnight, 1% agarose gel electrophoresis, omp1-pcDNA3.1 (+) recombiant plasmid was cut into 1.2Kb and two fragments of 5.4Kb after the result showed double digestion, proof omp1 gene has been inserted in pcDNA3.1 (+) plasmid, sees Fig. 4 (1-6: the double digestion of recombiant plasmid; The double digestion of (7:pcDNA3.1+) vector plasmid; M:DNA Marker IV).
2. amplification is identified
To transform " recombiant plasmid " that extract the back is template, with the omp1 gene among P1, the P2 primer PCR amplification recombiant plasmid omp1-pcDNA3.1 (+), the PCR product is through 1% agarose gel electrophoresis, the result is presented at about 1202bp position amplified production clearly, the segmental length of product is consistent with the omp1 gene, confirm to have in the recombiant plasmid omp1 gene segment to insert, see Fig. 5 (1-7: the amplification of recombiant plasmid; M:DNA Marker IV).
3. gene sequencing
Sequencing analysis through recombiant plasmid, (number of landing: X52557) its similarity of comparing is 99.92% to the C.t E type BOUR type strain omp1 gene complete sequence that result and Genbank land, the 489th A replaced by G, is samesense mutation, so amino acid sequence homology is 100%.The sequencing results shows that also the direction and the reading frame that insert the site insertion are all correct.
Two, the immune effect of E type DNA vaccine of Chlamydi trachomatis
1.C.t the immunne response that E type dna vaccination brings out
1. the BALB/C female mice is divided into three groups at random: pcDNA3.1 (+) empty plasmid immune group (negative control group), dna vaccination immune group and deactivation substance immune group (positive controls).Respectively at 0,2,4 all intramuscular injection pcDNA3.1 (+) empty plasmids, 150 μ g/DNA vaccines, 150 μ g/ deactivation substances, 150 μ l.
2. the Bradford method is carried out protein quantification to the C.t E type substance of purification
According to the processing mode of protein standard, getting testing sample is that C.t EB liquid carries out serial dilution after the deactivation.According to the protein concentration under three kinds of dilution ratios of protein standard curve chart calculating testing sample, extrapolate the protein concentration of stock solution, the meansigma methods of getting the three is as final C.t EB original liquid concentration.
3. change of serum C .t major outer membrane protein-specific IgG and IgM antibody ELISA detect
C.t purification major outer membrane protein solution 0.1ml with 20g/ml wraps by the reacting hole of polystyrene board, the serum 0.1ml to be checked that adds 1: 40 dilution proportion (does blank well simultaneously, negative control hole and positive control hole), 37 ℃ of incubation 60min, TMB develops the color after adding enzyme labelled antibody again, 2M sulphuric acid cessation reaction, record the OD450nm value in each hole, the result shows that the C.t E type specificity IgG antibody horizontal that the dna vaccination group produces is higher than negative control group (p＜0.05), and the IgG antibody of deactivation substance immune group is higher than dna vaccination immune group (p＜0.001).The C.t E type specificity IgM antibody horizontal that the dna vaccination group produces is higher than negative control group (p＜0.001), and the IgM antibody horizontal of deactivation substance immune group is higher than dna vaccination immune group (p＜0.001).
4. cytokine IFN-γ, IL-4 detect
The detection of cytokine comprises the detection of IFN-γ and IL-4 content in mice serum and the splenocyte culture supernatant.The result shows that dna vaccination group serum I FN-γ level is higher than negative control group (p＜0.05), and deactivation substance immune group serum I FN-γ level is higher than dna vaccination immune group (p＜0.001).Dna vaccination group splenocyte culture supernatant IFN-γ level is higher than negative control group (p＜0.05), and deactivation substance immune group splenocyte culture supernatant IFN-γ level and dna vaccination immune group and negative control group difference do not have significance (p＜0.001).Serum il-4 level of deactivation substance immune group is higher than dna vaccination group and negative control group (p＜0.05), and except the dna vaccination immune group, two groups do not detect the existence that IL-4 is arranged in the splenocyte culture supernatant in addition.
5. antibody neutralization test
C.t E type EB with purification and dilution fully mixes with the serum of dilution, and 37 ℃ of insulation 1h infect the McCoy cell that has grown up to fine and close monolayer with said mixture, and 48～72h cultivates the inclusion body quantity that the back counting forms.The result shows in dna vaccination group and the deactivation substance immune group serum and the ability of C.t EB is higher than negative control group (p＜0.001).
6. delayed hypersensitivity
Half mice of every group carries out this part experiment.After of the C.t E type EB dilution of PBS liquid with purification, 56 ℃ of deactivation 30min, inject the C.t E type EB of 25 μ l dilution at the left hind foot pad of mice, right back foot pad injection 25 μ l 2SP liquid are done contrast, 48h measures the thickness of every mice left and right sides metapedes pad, and the result shows that the delayed hypersensitivity that dna vaccination group and deactivation substance immune group produce is better than negative control group (p＜0.05).
7. spleen lymphocyte proliferation test
After observing the DTH reaction, kill Mus and get spleen, obtain 2～4 * 106/ml of concentration mouse spleen lymphocyte suspension.With 2SP liquid the C.t E type EB of purification being diluted to protein concentration is 200～300 μ g/ml, 56 ℃ of deactivation 30min.By every hole 50 μ l splenocyte suspension is added in 96 orifice plates, every hole adds cell culture fluid 200 μ l, and the splenocyte suspension of every mice is established 3 multiple holes, and first hole adds ConA and does the positive control hole, second hole adds C.t E type EB liquid, and the 3rd hole does not add other materials as negative control.Cultivate 68h, mtt assay detects the absorbance of each hole at wavelength 570nm, and calculates lymphocyte stimulation indices, and the result shows that the spleen lymphocyte proliferation of dna vaccination group and deactivation substance immune group is more than negative control group (p＜0.001).
2.C.t the protective effect that E type dna vaccination immunity homotype C.t reproductive tract are attacked
Second half mice of every group carries out this part laboratory observation.
1. the reproductive tract of C.t E type EB are attacked
About 6.6 * 105IFU C.t E type EB is from the reproductive tract infection mice, and C.t attacks the back and gathered mouse propagation road exfoliative cyte on the 6th day, attacks 2 weeks of back and gathers mouse vein blood, genital secretion flushing liquor, splenocyte and the complete uterus of mice specimen.
2. C.t E type major outer membrane protein-specific IgG, sIgA antibody test
Method is the same, and the result shows that change of serum C .t E specific IgG antibodies level and reproductive tract Local C .t E specificity sIgA antibody horizontal that dna vaccination group and deactivation substance immune group produce all are higher than negative control group (p＜0.001).
3. spleen lymphocyte proliferation test
C.t E type EB attacks 2 weeks behind the mouse propagation road, kills Mus and gets spleen and carry out the spleen lymphocyte proliferation test.The result shows that the lymphopoiesis of dna vaccination group is more more remarkable than ConA stimulation hole and negative control hole; Change not obvious before the cell proliferation situation in deactivation substance group and each hole of empty plasmid group is attacked.
4. mouse propagation road C.t cultivates and counting
The mouse propagation road fine and close monolayer McCoy cell of inoculation after the epithelial cell fragmentation that comes off, 37 ℃, 5%CO
2Incubator is counted the inclusion body quantity that forms in each hole after cultivating 48～72h.Empty plasmid group mouse propagation road comes off and count down to respectively outside 64,18,41,54,38,41 inclusion bodys in the cell hole of epithelium inoculation as a result, other each groups do not find that inclusion body forms, and confirm that the C.t of reproductive tract under dna vaccination group and three groups of mices of deactivation substance group all has been eliminated or has all lost infection activity.
5. uterine cancer cell pathological observation
The section of employing routine paraffin wax, the H-E colouring method.Result: get empty plasmid group mouse propagation road tissue and do the pathology section, as seen destroyed at tissue part's epithelial cell of vagina stratified squamous epithelium and endometrium simple columnar epithelium intersection (being equivalent to the cervix uteri place), the epithelium edema, invade the little pus infections of formation in the epithelial cell based on the inflammatory cell of neutrophilic granulocyte, more visible neutrophilic granulocytes, histiocyte and lymphocytic infiltration in the lamina propria confirm that the reproductive tract attack of C.t causes this group mice local organization significantly infringement to occur.
Get the pathological section of dna vaccination group and deactivation substance group mouse propagation road tissue, as seen complete organizing of vagina stratified squamous epithelium and endometrium simple columnar epithelium intersection (being equivalent to the cervix uteri place), do not destroy, inflammatory cell infiltration is slight in the lamina propria.
The E type DNA vaccine of Chlamydi trachomatis of application build has carried out a series of zooperies, and the result confirms:
1. laboratory animal is a protection antibody at the antibody of the major outer membrane albumen generation of C.t omp1 coded by said gene, has neutralising capacity.
2. the C.t E type dna vaccination immune mouse of Gou Jianing can be induced and be produced certain C.t specific cellular immunity and humoral immunization; wherein cellular immune level is more remarkable; preponderate with Th1 reaction, the attack of C.tE type reproductive tract is had good protective action, brought into play the effect of vaccine.
E type DNA vaccine of Chlamydi trachomatis omp1 gene nucleotide series table
＜110〉General Hospital of Tianjin Medical Univ.
＜120〉E type DNA vaccine of Chlamydi trachomatis and preparation method and purposes
<160>1
<210>1
<211>1182
<212>DNA
＜213〉chlamydia trachomatis kind (Chlamydia trachomatis)
<400>1
atgaaaaaac?tcttgaaatc?ggtattagta?tttgccgctt?tgagttctgc?ttcctccttg 60
caagctctgc?ctgtggggaa?tcctgctgaa?ccaagcctta?tgatcgacgg?aattctgtgg 120
gaaggtttcg?gcggagatcc?ttgcgatcct?tgcaccactt?ggtgtgacgc?tatcagcatg 180
cgtatgggtt?actatggtga?ctttgttttc?gaccgtgttt?tgaaaacaga?tgtgaataaa 240
gaattccaaa?tgggtgacaa?gcctacaagt?actacaggca?atgctacagc?tccaaccact 300
cttacagcaa?gagagaatcc?tgcttacggc?cgacatatgc?aggatgctga?gatgtttaca 360
aatgccgctt?gcatggcatt?gaatatttgg?gatcgctttg?atgtattctg?tacactagga 420
gcctctagcg?gataccttaa?aggaaactct?gcttctttca?atttagttgg?attgtttgga 480
gataatgaaa?atcaaagcac?ggtcaaaacg?aattctgtac?caaatatgag?cttagatcaa 540
tctgttgttg?aactttacac?agatactgcc?ttctcttgga?gcgtgggcgc?tcgagcagct 600
ttgtgggagt?gcggatgtgc?gactttaggg?gcttctttcc?aatacgctca?atctaaacct 660
aaagtcgaag?aattaaacgt?tctctgtaac?gcagctgagt?ttactatcaa?taagcctaaa 720
ggatatgtag?ggcaagaatt?ccctcttgca?ctcatagcag?gaactgatgc?agcgacgggc 780
actaaagatg?cctctattga?ttaccatgag?tggcaagcaa?gtttagctct?ctcttacaga 840
ttgaatatgt?tcactcccta?cattggagtt?aaatggtctc?gagcaagttt?tgatgccgat 900
acgattcgta?tagcccagcc?aaaatcagct?acagctatct?ttgatactac?cacgcttaac 960
ccaactattg?ctggagctgg?cgatgtgaaa?gctagcgcag?agggtcagct?cggagatacc 1020
atgcaaatcg?tctccttgca?attgaacaag?atgaaatcta?gaaaatcttg?cggtattgca 1080
gtaggaacga?ctattgtaga?tgcagacaaa?tacgcagtta?cagttgagac?tcgcttgatc 1140
gatgagagag?ctgctcacgt?aaatgcacaa?ttccgcttct?aa 1182
Claims (3)
1. an E type DNA vaccine of Chlamydi trachomatis is characterized in that comprising chlamydia trachomatis E type omp1 gene and carrier for expression of eukaryon, and the omp1 gene encoding production is a chlamydia trachomatis major outer membrane albumen; Said omp1 gene nucleotide series is shown in SEQ ID NO:1; Said carrier for expression of eukaryon is pcDNA3.1 (+); 5 of described genes of interest ' end inserts from the BamHI site, and 3 of genes of interest ' end inserts from the NotI site.
2. preparation method according to the described E type DNA vaccine of Chlamydi trachomatis of claim 1, it is characterized in that extracting chromosomal DNA from chlamydia trachomatis E type BOUR strain, the pcr amplification proteic omp1 gene of major outer membrane that goes out to encode is cloned in pcDNA3.1 (+) vector plasmid and is built into the Chlamydia Trachomatis DNA vaccine.
3. one kind according to the described E type DNA vaccine of Chlamydi trachomatis of claim 1, is used to prepare the vaccine of prevention and treatment urogenital tract chlamydia trachomatis infection disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100162482A CN100391544C (en) | 2006-10-24 | 2006-10-24 | The E type DNA vaccine of Chlamydi trachomatis and its preparation methods and applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100162482A CN100391544C (en) | 2006-10-24 | 2006-10-24 | The E type DNA vaccine of Chlamydi trachomatis and its preparation methods and applications |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1943788A CN1943788A (en) | 2007-04-11 |
| CN100391544C true CN100391544C (en) | 2008-06-04 |
Family
ID=38043580
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100162482A Expired - Fee Related CN100391544C (en) | 2006-10-24 | 2006-10-24 | The E type DNA vaccine of Chlamydi trachomatis and its preparation methods and applications |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100391544C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101837133A (en) * | 2010-04-16 | 2010-09-22 | 中国科学院海洋研究所 | Gram positive microbes DNA vaccine and construction and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101812473B (en) * | 2009-02-25 | 2012-10-03 | 温州医学院 | Human papillomavirus and chlamydia trachomatis chimeric nucleic acid vaccine and applications thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1280619A (en) * | 1997-11-28 | 2001-01-17 | 根瑟特公司 | i(Chlamydia trachomatic) genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection |
-
2006
- 2006-10-24 CN CNB2006100162482A patent/CN100391544C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1280619A (en) * | 1997-11-28 | 2001-01-17 | 根瑟特公司 | i(Chlamydia trachomatic) genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection |
Non-Patent Citations (1)
| Title |
|---|
| UF-100尿沉渣检测仪检测沙眼衣原体体外抗菌药物的敏感性. 邢卫斌，黄清霞，彭军，叶文静，付国俊，牟兆新，刘全忠.中国麻风皮肤病杂志，第21卷第5期. 2005 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101837133A (en) * | 2010-04-16 | 2010-09-22 | 中国科学院海洋研究所 | Gram positive microbes DNA vaccine and construction and application thereof |
| CN101837133B (en) * | 2010-04-16 | 2011-12-07 | 中国科学院海洋研究所 | Gram positive microbes DNA vaccine and construction and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1943788A (en) | 2007-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107298716A (en) | A kind of recombinant helicobacterpylori protein vaccine and preparation method thereof | |
| CN103266090A (en) | Asia1 type foot-and-mouth disease recombinant virus and preparation method and application thereof | |
| Liang et al. | Understanding the research advances on lumpy skin disease: A comprehensive literature review of experimental evidence | |
| CN104628865B (en) | A kind of pseudo- mad dog epitope polypeptide recombinant vaccine | |
| CN100391544C (en) | The E type DNA vaccine of Chlamydi trachomatis and its preparation methods and applications | |
| CN103421832A (en) | Preparation and application of egg yolk antibody containing florfenicol drug resistance gene protein | |
| Hou et al. | Subunit vaccine based on glycoprotein B protects pattern animal guinea pigs from tissue damage caused by infectious bovine rhinotracheitis virus | |
| CN105198969B (en) | The B cell epitope and its identification method of a kind of 1 type duck hepatitis A virus VP3 albumen and application | |
| Nelson | Infectious bovine rhinotracheitis (Herpesvirus bovis) infection in swine | |
| CN103191420A (en) | Preparation method of periodic wuchereria malayi compound multivalent DNA (deoxyribonucleic acid) vaccine | |
| CN105316252A (en) | Five-gene-deleted streptococcus suis serotype 2 strain and application | |
| CN101422608A (en) | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence | |
| CN101177684B (en) | Sheep brucella M5 strain ribosome protein L7/L12 gene, encoding protein and uses thereof | |
| CN109136198A (en) | A kind of expression Chicken Infectious Anemia Virus VP1, VP2 genetic recombination bird pox virus live vector vaccine | |
| CN102741414B (en) | By recombination yeast oral/method of mucosal vaccination vaccine | |
| CN105233306A (en) | Reproducible RNA vaccine for control of toxoplasmosis and construction method and application thereof | |
| CN103965350A (en) | Tick cystatin Rhcyst-2, and gene and applications thereof | |
| CN103421729B (en) | Gene recombined swine cholera salmonella choleraesuis vaccine for blue-ear disease and application thereof | |
| CN102676570B (en) | Recombinant bacillus subtilis immunoglobulin binding protein functional-domain expression vector and application thereof | |
| CN101979607A (en) | Method for preparing foot-and-mouth disease virus-resistant RNAi transgenic livestock | |
| CN107823640B (en) | A kind of grass carp reovirus class fibre is dashed forward VP56 protein subunit vaccine and its preparation method and application | |
| CN101732710A (en) | Foot and mouth disease virus inhibitor and preparation method and application thereof | |
| CN101153284A (en) | Gene of sheep type brucella M5 mycopremna ribosomal protein L7, its encoding protein and application | |
| TWI378144B (en) | Recombinant plasmic containing multicopy cpg motifs and transformant thereof for applying on dna adjuvant in avian vaccines | |
| CN110760472A (en) | Brucella vaccine strain for canine rough breed |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080604 Termination date: 20111024 |