CN100387303C - Heterogenous skin transfected by recombined genes - Google Patents

Abstract

The present invention provides heterogeneous skin which is transfected by recombination genes CTLA4Ig and can express the recombination protein CTLA4Ig. The heterogeneous skin of the present invention can be used for covering and sealing burn wound surfaces to promote the concrescence of the wound surface and reduce scars.

Description

A kind of Corii Sus domestica skin that exsomatizes that is used to cover people burn wound

Technical field

The present invention relates to a kind of Corii Sus domestica skin that exsomatizes that is used to cover people burn wound, specifically, the present invention relates to a kind of Corii Sus domestica tissue that exsomatizes, be used for covering burn and wait wound surface, thereby promote wound healing, reduce cicatrization with the transfection of CTLA4Ig recombination.

Background technology

Dermatoplastic research is pressing for of modern burn treating to burn wound's allosome (kind): burn is a class incidence rate and all higher specific type wound of disability rate, its root problem is exactly the wound surface problem, if burn wound can not get covering timely and effectively, sealing, will cause the generation of disorder, infection and the multiple organs dysfunction of patient's organismic internal environment; In addition, the non-physiologic healing of wound surface also will occur, and cicatrization be increased, the disabled degree aggravation.Therefore, the research to burn wound is the focus and the difficult point of the research of burn circle always.

Allograft skin and xenogenesis Corii Sus domestica are applied in burn wound's treatment already, but because the immunological rejection after transplanting makes their application and curative effect be subjected to greatly restriction.Deep burn wound needs to transplant and could heal through skin, and large tracts of land, especially big Area Burn patient is from body skin source wretched insufficiency, need through non-from body (allosome and xenogenesis) skin flap coverage, but non-from the body skin will be at short notice (2-4 week) be ostracised, even attempt the microparticle skin technology wound closure that gets up by developed recently, also need use allosome (kind) skin is covered on the microparticle skin, think from the body microparticle skin suitable growth hypertrophy condition is provided, but we find clinically: before microparticle skin is not also grown flap coverage fully, allosome (kind) skin is with regard to because immunologic rejection etc. and necrosis comes off, make microparticle skin lose the environment of continued growth expansion, thereby make operation not reach ideal effect.In addition, cutting from the body skin equally also is a kind of wound, and a lot of patients are reluctant to cut from the body skin, and wish to have other skin to replace.So how prolonging the research that burn wound's allosome (kind) cutify survives even forever survive is pressing for of modern burn treating.

The key that influences the organ transplantation success is an immunological rejection, and so far, the main countermeasure of control graft-rejection is by crossing the immunologic function that various approach suppress the host.Also, comprise that the organ transplantation of skin transplantation has obtained considerable progress just because of of the appearance of inhibitive ability of immunity medicine as ring bleb mycin, FK506, OKT3 etc.But these medicines all have a common characteristic, its suppress the effect right and wrong of body's immunity special, comprehensive and lasting, thereby easily cause serious consequences such as infecting, produce tumor.So medical circle has proposed the specific immunologic tolerance theory in recent years: promptly body only produces tolerance to transplantation antigen, and keeps other immunologic function of body.Induce the host specificity immunologic tolerance to mainly contain following four kinds of methods at present: injection donorcells or MHC antigen in (1) thymus; (2) sealing CD4 and CD8T lymphocyte; (3) the MHC antigen of transformation donor; (4) blocking t cell costimulating signal system.Wherein, blocking t cell costimulating signal system is considered to the most promising method.From the immunologic tolerance theory, and in conjunction with clinical practice, the someone has proposed local immunity tolerance (local immune tolerance) theory again recently, promptly suppresses host's immunologic function in transplanting local environment by the whole bag of tricks, causes the local immunity tolerance.Like this, both reached the prolongation graft survival time, and made influence drop to minimum level again host's autoimmune function.This is particularly crucial to burn treating, because of burn patient, and serious burn patient particularly, immunologic function disorder, hypoimmunity, and cause very easily accompanying infection.As suppressing patient's immunologic function, serious consequences such as then easier initiation mortality infection this moment again.So our comprehensive blocking t cell auxiliary signal and two academic viewpoints of local immunologic tolerance, and in conjunction with burn wound's treatment actual features, by induce the local specific immunologic tolerance of cutify in burn wound, transplant the purpose that xenogenesis skin survives even forever survives and reach to prolong.

Dermatoplastic immunological rejection is typical cellularity rejection, and the activated T cell plays decisive role in the skin transplantation rejection.And studies show that in recent years, the T cell must could activate under TCR/MHC identification and costimulating signal combined effect fully.The blocking-up costimulating signal will cause the reactionless of T cell, or apoptosis (apoptosis).So far, found multiple costimulating signal system, as the B7/CD28-CTLA4 system, CD40/CD40L system, CD95 (Fas)/FasL system etc.But research so far thinks, in all costimulating signal systems, and the effect maximum of B7/CD28-CTLA4 system, the most sure.The B7 molecule of the competitive blocking-up of soluble CTL A 4 energy antigen presenting cell combines with the CD28 on the T cell, thus the activation fully of blocking t cell.Studies show that exogenous CTLA4 can obviously suppress the activation of the T cell of various antigenic stimulus.But it does not influence the functions such as cytotoxicity of T cell, and the T cell of this moment has immunocompetence to the virus, antibacterial etc. of invasion equally; And the only just activation of blocking t cell when using of CTLA4 does not continue and additive effect.These are that the various immunosuppressant of using are incomparable at present.Studies show that CTLA4 is to being that the autoimmune disease etc. of main cause has the obvious treatment effect with T cell transition activation; It can also obviously prolong surviving of transplant organs such as the heart, kidney, islets of langerhans.In the prior art, there is not its application aspect burn wound's skin transplantation.Simultaneously because preparation, the purification difficult of CTLA4, whole body even topical application expense costliness, and discover have only as the intravital CTLA4 of machine to maintain certain level always, and it induces the ability of graft specific immunologic tolerance just the most obvious.Illustrate that not only difficulty is bigger directly to use the pure product of CTLA4, and effect is limited.

Summary of the invention

The purpose of this invention is to provide a kind of Corii Sus domestica skin that exsomatizes that is used to cover people burn wound, be used for covering, sealing burn wound.

The invention provides a kind of Corii Sus domestica skin that exsomatizes that is used to cover people burn wound.It contains as the CTLA4Ig recombination of exogenous gene and the CTLA4Ig recombinant protein of this recombinant gene expression.Described Corii Sus domestica skin can be the skin of the pig of any strain, Rongchang County pig for example, (the Corii Sus domestica skin with inbreeding or standard strain are good) such as Wuzhi Mountain pigs; The Corii Sus domestica skin that described Corii Sus domestica skin can be any age (is good with the Corii Sus domestica skin taken from less than 6 months pig ages).

CTLA4 described in the present invention is people's cytotoxic t lymphocyte-associated antigen 4 molecule extracellular part.Being used for CTLA4 of the present invention can be the CTLA4 of this molecule extracellular region total length, also can be to comprise the wherein CTLA4 fragment of a part.CTLA4 of the present invention preferably also comprises signal peptide.Described Ig is human normal immunoglobulin IgG γ 1, and its nucleotide sequence comprises human IgG γ 1 hinge region, CH1 and CH2 district; CTLA4 is that hinge region is connected with the continuous mode of Ig.CTLA4 gene preferred for the present invention has the nucleotide sequence shown in Fig. 5 (SEQ ID NO:1).

Expressed by in the tissue that transforms for the CTLA4Ig gene that makes reorganization, this gene should effectively be connected with the promoter that can drive this gene expression.Effectively connect and be meant that the connected mode of promoter and recombination can make this promoter can guide this recombination to express in Skin Cell.Can use any known promoter that can in Skin Cell, guide exogenous gene expression among the present invention.These promoteres can be SV40, CMV and CAG etc., are preferably the CAG promoter.

In order to transform in the Skin Cell, the recombinant nucleotide that recombination is connected with promoter can be incorporated in a kind of carrier.Express in Skin Cell as long as can guarantee described recombination, can use any other mode that recombination is imported Skin Cell.When using carrier, can use any known carrier that recombinant nucleic acid can be transformed in the Skin Cell, adenovirus vector for example, retroviral vector preferably uses adenovirus vector.In adenovirus vector, the integration site of recombinant nucleic acid is the SwaI restriction enzyme site preferably.

Cut and the processing method of Corii Sus domestica skin is at first to take off big Zhang Quanhou fresh porcine skin, and the reuse drum dermatome breaks through thicker middle pachydermia.Then the Adv-CTLA4Ig in-vitro transfection is treated cutify.

Brief Description Of Drawings

Fig. 1 is that the pCTLA4Ig fusion protein expression vector makes up sketch map;

Fig. 2 is the expression of Adv-CTLA4Ig in cultured cell, the A:293 cell; B: human fibroblasts; The C:HeLa cell;

Fig. 3 represents the external infection rat skin of Adv-CTLA4Ig carrier SABC;

Fig. 4 represents cream type Adv-CTLA4Ig carrier transfecting pig skin SABC;

Fig. 5 represents CTLA4 fusion rotein structural representation (A), and signal peptide and CTLA4 extracellular region DNA sequence and aminoacid sequence (B) (sequence is gone into shown in the SEQ ID NO:1).

Use transgenosis heterogenous skin of the present invention, for the time has been striven in large tracts of land patient's treatment; For some be reluctant to cut from the body skin or from body skin source because of patient's burn of difficulty or providing of the skin surface of a wound is provided Better growing conditions, promoted the healing of the surface of a wound; Because the transgenosis pigskin has effectively been protected wound Face and surface of a wound scar form to be reduced.

Specifically, the AdV-CTLA4Ig expression vector of the present invention's structure can transfection 0.1-0.6 Skin histology cm thick, that be used for transplanting comprises pigskin and fell tissue; This AdV-CTLA4Ig The pigskin of transfection or fell can be expressed CTLA4Ig; The pigskin of this AdV-CTLA4Ig transfection or fell In free AdV-CTLA4Ig can transfection surface of a wound granulation tissue; The pig of this AdV-CTLA4Ig transfection Skin or fell can be used for the covering of people's body surface damage, and survival period significantly be longer than untransfected pigskin or Fell (from about 10 days to more than 20 days); The pigskin of this AdV-CTLA4Ig transfection or fell Be particularly useful for the covering of people's body surface burn wound, comprise the protection of the microparticle skin that the surface of a wound covers.

Embodiment

Embodiment 1

The structure of Ig fusion protein expression vector (Fig. 1)

1. separation, the activation of peripheral blood lymphocytes (PBMC)

The conventional healthy human peripheral blood mononuclearcell that separates, it is 1 * 10 that RPMI1640 regulates cell density ⁶Cells/ml adds PMA (15nM) and anti-CD3 monoclonal antibody (10 mcg/ml), 37 ℃ of 5%CO ₂Cultivated 6 hours, and made lymphocyte activation, high expressed CTLA-4mRNA.

2. the extraction of cell total rna, evaluation

1) extract: centrifugal collection activating PBMC, PBS (DEPC) washes cell * 2, by per 1 * 10 ⁷PBMC adds 1 milliliter of Tripure, mixing, RT 5 minutes, add 0.2 milliliter of chloroform again, concuss 15 seconds, RT 5 minutes, 10000 rev/mins centrifugal 15 minutes, the colourless water in upper strata is moved to another centrifuge tube, add 0.5 milliliter of isopropyl alcohol, mixing,-20 ℃ 10 minutes, 10000 rev/mins centrifugal 15 minutes, add 1 milliliter of 75% washing with alcohol precipitation, wait to precipitate dry back and add 200 microlitre DEPC water dissolutioies ,-20 ℃ of preservations.

2) RNA electrophoresis: 1.5% denaturing formaldehyde agarose gel solidifies in rearmounted 1 * MOPS electrophoresis liquid to the plate glue; 5 microlitre RNA samples and 15 microlitre load sample buffer, 95 ℃ of water-bath degeneration 2 minutes, 50V, electrophoresis, ultraviolet detection RNA integrity.

3) rna content is measured: survey O.D. behind the RNA diluted sample on the uv-spectrophotometric instrument ₂₆₀And O.D. ₂₈₀Value, RNA concentration (mcg/ml)=O.D. ₂₆₀* 40 * extension rate.

3. design of primers

By computer-assisted analysis, according to people CTLA-4 gene order in the gene bank, design following three primers, wherein primer 1# comprises 7 amino acid residues of CTLA-4 extracellular region N-terminal and 15 amino acid residues of tumour inhibitor M signal peptide C end; Primer 2 # is corresponding to CTLA-4119-125 amino acids residue, and introducing Bcl I restriction enzyme site; Primer 3# comprises all the other amino acid residues of tumour inhibitor M signal peptide and overlaps with the tumour inhibitor M signal peptide of primer 1#, introduces the HindIII restriction enzyme site at the 5 ' end of primer 3#.Primer is synthesized by Chinese Academy of Sciences's Shanghai cell, the PAGE purification.

Primer 1#:CTCAGTCTGGTCCTTGACCTCCTGTTTCCAAGCATGGCGA

GCATGGCAATGCACGTGGCCCAGCC

Primer 2 #:TTTGGGCTCCTGATCAGAATCTGGGCACGGTTC

——Bcl?I

Primer 3#:GCAAGCTTCAATGGGTTGACTGCTCACACAGAGGACGCTG

——HindIII

CTCAGTTCGGTCCTTGCATCT

4.RT-PCR amplification CTLA-4 extracellular region cDNA fragment

1) cDNA first chain synthetic (reverse transcription): with total RNA 10 microlitres, oligo (dT ₁₂) 2 microlitres, ddH ₂O (DEPC) 11.5 microlitres, 65 ℃ of water-bath degeneration are 10 minutes behind the mixing, put rapidly on ice, add 5 * reverse transcription buffer, 8 microlitres again, 100mM DTT 2 microlitres, RNasin0.5 microlitre, 2mM dNTP 4 microlitres, AMV 2 microlitres, (cumulative volume 40 microlitres), 42 ℃ 1 hour ,-20 ℃ of preservations.

2) PCR reaction: be template with cDNA first chain earlier, carry out first round amplification with primer 1# and 2#, condition is: cDNA first chain 5 microlitres, 10 * PCR buffer, 5 microlitres, 10mM dNTP4 microlitre, each-1 microlitre (final concentration 100nM) of primer 2 # and 3#, ddH ₂O 29.5 microlitres, 95 ℃ of degeneration 7 minutes add Taq enzyme 0.5 microlitre, cumulative volume 50 microlitres, cycling condition: 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 1 minute, back 72 ℃ of 30 circulations 7 minutes; Be template with first round PCR product subsequently, carry out second with primer 2 # and 3# and take turns amplification that reaction condition is the same, 2% agarose gel electrophoresis detects amplified production.

5. plasmid extracts

Press the operation of plasmid extraction kit description, 100 microlitre ddH ₂O, 1 eluting plasmid DNA.

6. escherichia coli are competent, frozen

Reference " molecular cloning " (Jin Dongyan, Li Mengfeng translates, " molecular cloning experiment guide ", second edition Beijing: Science Press 1996; P852-907) CaCl ₂The escherichia coli competence is got in preparation, adds final concentration 10-15% glycerol, and-70 ℃ frozen.

7. the conversion of plasmid and recombinant DNA

Get frozen escherichia coli competence antibacterial, add plasmid or DNA and connect product 1-2 microlitre, gently behind the mixing; ice bath 30 minutes, 42 ℃ of water-baths 2 minutes add 900 microlitre LB culture medium; 37 ℃ of water-baths 60 minutes are got and are coated in right amount on the LB agar plate that contains 100 mcg/ml ampicillin.37 ℃ of incubator overnight incubation.

8.DNA segmental recovery

Press dna fragmentation and reclaim the operation of test kit description.

9.PCR amplified fragments is connected with the Ig fusion protein expression vector

Take turns pcr amplification product with second and carry out 2% agarose gel electrophoresis, reclaim required fragment, behind HindIII, Bcl I double digestion, pX/Ig carrier (other people give) fragment with the same enzyme action of warp: 3: 1 ratio of carrier, connecting the test kit explanation fast according to DNA connects, (ATCC, USA) competence bacteria, HindIII, Xba I enzyme action identify that positive transformed clone inserts clip size to transform MC1061.

10. sequencing

Enzyme action is identified and is inserted the correct recombiant plasmid of clip size, the directed pUC19 plasmid (TaKaRa that inserts behind HindIII, Xba I double digestion, Japan) in, adopt the Sanger dideoxy sequencing method, with the plasmid double-stranded DNA is template, under the guiding of pUC19 universal primer, the full-automatic sequenator automatic sequencing of ABI Prism377.

The structure of embodiment 2CTLA-4Ig retrovirus expression vector

With pLXSN (Clontech, USA) and pUC19-CTLA-4Ig respectively with carrying out enzyme action with EcoRI and HindIII, use dATP then respectively, dNTP and DNA Escherichia coli polymerase Klenow fragment are filled and led up, reuse BamHI carries out enzyme action, electrophoresis is reclaimed the big fragment of pLXSN and the small fragment of pUC19-CTLA-4Ig is connected, promptly obtain the expression pLXCTLA-4Ig of CTLA-4Ig.

The structure of embodiment 3 CTLA4Ig adenovirus expression carriers

1. with the terminal flush endization of cDNA fragment.

Add 10 * buffer, 1 μ l in precipitate with ethanol cDNA (0.5pmol) centrifuge tube, add aseptic double-distilled water to 9 μ l again, 70 ℃ 5 minutes, add 1 μ l T4DNA polymerase, mix gently, must not thermal agitation, incubation is 5 minutes in 37 ℃, transferring DNA concentration with DNA Dilition buffer is 1 μ g, 50 μ l, fully mixing.Go to deactivation polymerase in the ice bath, can be directly used in coupled reaction (as can not use, then extracting precipitate with ethanol immediately is stored in-20 ℃ after the dissolving of reuse DNA Dilition buffer at once).

2. the cDNA that will equal endization inserts pAxCAwt, and (TakaRa is Japan) in the Ke Shi plasmid.

With pAxCAwt linearisation: pAxCAwt 5 μ l, h buffer (high-salt buffer) 5 μ l, Swa I 2 μ l, ddH ₂O 38 μ l, 25 ℃ of incubations are 2 hours behind the mixing; Adding EDTA liquid to final concentration is 10mM, the extracting of phenol chloroform, add the flat about 0.2 μ g. of terminal cDNA fragment, precipitate with ethanol behind the mixing is before the last bone dry, add 5 μ l DNA dissolving and 5 μ l and connect buffer, 25 ℃ of incubations 2 hours add h buffer 5 μ l before the precipitate with ethanol, last bone dry, Swa I 2 μ l, ddH ₂O to 50 μ l, 25 ℃ of incubations 2 hours are to reduce the probability that wild-type virus and naked virus occur.

3. pack the cosmid that has inserted the CTLA4 gene with bacteriophage lambda.

The extract that bacteriophage lambda is packed among the kit is centrifugal to managing the end, add the 5 μ l dissolved 2 μ g plasmid DNA of TE, adding aseptic double-distilled water to final volume is 25 μ l, behind the mixing centrifugal with extract and plasmid DNA to managing the end, RT incubation 2 hours, add 0.5 milliliter of SM buffer and 25 milliliters of chloroforms, mixing gently, centrifugal 30 seconds, take out the new centrifuge tube of supernatant to, attention must not be taken out floccule, with 100,1000,10000 times of dilutions of SM buffer supernatant, respectively gets 100 μ l and adds 100 μ l and be diluted to A with the SM buffer ₆₀₀Be among 2.0 the DH5 α (LE392), RT absorption, balance 20 minutes, with the LB flat board of 1/100,1/10 coating Amp resistance, 37 ℃ be incubated overnight (10-16 hour) selects positive bacterium colony amplification, extracts plasmid.

4. identify the correct insertion of CTLA4

Plasmid DNA 10 μ l, buffer 2 μ l, Sal I 1 μ l, ddH ₂O 16 μ l, 37 ℃ of incubations are 2 hours behind the mixing, and precipitate with ethanol is before the last bone dry, add 5 μ l DNA dissolving buffer and 5 μ l and connect buffer, 25 ℃ of incubations are 2 hours behind the mixing, the transformed competence colibacillus escherichia coli, the amplification positive colony extracts plasmid, and enzyme action, PCR, Dot Blotting identify.

5. with the further amplification of positive colony plasmid

The extract that bacteriophage lambda is packed among the kit is centrifugal to managing the end, add the 5 μ l dissolved 2 μ g plasmid DA N of TE, adding aseptic double-distilled water to final volume is 25 μ l, needn't mixing, centrifugal with the extract in the water and plasmid DNA to managing the end, RT incubation 2 hours, add 0.5 milliliter of SM buffer and 25 milliliters of chloroforms, mix gently, high-speed centrifugal 30Sec takes out the new centrifuge tube of supernatant to, and attention must not be taken out floccule, with 100,1000,10000 times of SM buffer dilution supernatant, respectively get 100 μ l and add 100 μ l and be diluted to A with the SM buffer ₆₀₀Be among 2.0 the DH5 α (LE392), RT absorption, balance 20 minutes are with the LB flat board of 1/100,1/10 coating Amp resistance, 37 ℃ be incubated overnight (10-16 hour); Last packaging plasmid is added overnight incubation in 50 milliliters of LB culture medium that contain Amp, and more than more than 10, it is standby then to extract plasmid as the clone; Be less than 10 as the clone, then abandon corresponding SM buffer dilution supernatant.

6. will correctly insert big plasmid co-transfection 293 cells of plasmid and adenovirus

1) be 100 mcg/ml with the plasmid DNA of extracting in 5 with HEPES buffer accent concentration, get 45 microlitres and add 5 microlitre DNA-TPC, mix gently, it is slowly dropped in the sterile glass tube that contains 30 microlitre DOTAP, mix gently while dripping, adding about 20 microlitres of HEPES buffer again is 100 microlitres to cumulative volume, and room temperature was placed 15 minutes; Other gets one bottle of degrees of fusion near 100% cultivation 293 cells, remove culture fluid, add the transfection mixed liquor, shake gently, make transfection mixed liquor uniformly dispersing, put into cell culture incubator and cultivated 4 hours, remove the transfection mixed liquor, add fresh medium, collected culture supernatant and floating cell in the 3rd day.

7. screening positive cell clone

293 cells are transferred cell density to 1 * 10 ⁵/ milliliter, different dilution cell inoculation 96 orifice plates are got in 10 times of dilutions again, every hole 100 microlitres, multiple hole, cultivate after per 5 days and add culture fluid 50 microlitres again, cultivate after 15 days, collect cultivate after 8 days on the just floating or foramen lacerum of cell clear, collect the greatest dilution hole as far as possible, with the capable point of supernatant immunologic test, extract DNA in the supernatant, the performing PCR inspection.

8. positive colony is increased in 293 cells

The positive colony supernatant is diluted to 0.5 milliliter, adds 80% and merge, cultivate in the 3.5cm culture dish of 293 cells, uniformly dispersing, in cell culture incubator, cultivate, per 15 minutes, jiggle once, cultivate after 1 hour, add 2 milliliters of culture fluid, continue to cultivate 72 hours, collect supernatant and floating cell, with same 293 cells that infect of this supernatant, and the amplification adenovirus expression carrier is collected adenovirus, and-80 ℃ of refrigerators are preserved.

Embodiment 4

Adv-CTLA4Ig is to the transfection of cultured cell in vitro

1.CTLA4Ig the making of adenovirus vector

After 293 incasing cellss are cultured to 70%-90% and merge, add the direct infection of recombinant adenovirus stock solution, 37 ℃ of CO behind the 0.1M PBS rinsing cell 3 times ₂Behind the constant incubator 1 hour, take out to add the DMEM culture fluid that contains 5% hyclone, cultivate collecting cell and supernatant after 3 days, behind liquid nitrogen multigelation 5 times, 4 ℃ 10000 rev/mins centrifugal 20 minutes, the degerming of 0.22um film ,-70 ℃ of preservations are standby.During use, it is 7.2 that transfection liquid is transferred PH.

2. the mensuration of virus titer

The plaque laboratory method: with 293 cells with 2 * 10 ⁶Cells/well is inoculated in 6 orifice plates, cultivates after 20 to 24 hours, and adding with 0.3 milliliter/hole will be with the viral liquid of serum-free DMEM 10 times of dilutions successively.Cultivate transfection 1 hour in the cell culture incubator (jiggled once, so that viral homogeneous scatters in per 15 minutes.)。After discarding viral liquid, every hole adds 1 milliliter of complete DMEM cell culture fluid covering that contains 0.5% cell with low melting-point agarose and 5% hyclone.Observe after 7 days.With differentiable cytopathy under the mirror as plaque forming unit (Plaque Forming Unite, PFU).With the viral dilution degree that occurs pathological changes near 100% cell, the following formula of substitution calculates virus titer: virus titer (PFU)=[12 * 10 ⁵Dilution factor * 10 virus/cell] 0.3 milliliter of ÷ (because of about cell of per 10 viral infection, complete pathological changes appears in cell after 7 days).

3. transfection

It is good to get growth conditions, and 293 cells that propagation is active are with the trypsinization counting, by 1.5 * 10 ⁵Cell drips in coverslip central authorities, is put in 37 ℃ of CO ₂Constant incubator 1 hour (attention prevents the cell dry tablet) is treated to add the DMEM culture fluid 10mL/ culture dish that contains 5% calf serum behind the cell attachment, cultivates and can carry out transfection in 12 hours.Promptly take out culture fluid with aseptic suction nozzle earlier, sterilization 0.1M PBS is gentle gently to add transfection liquid by 1mL/ coverslip/culture dish after washing cell sheet 1 time, put into the transfection of 37 ℃ of CO2 constant incubators 2,4,6,8,9 hours, 37 ℃ of 0.IMPBS that continue wash cell 3 times, use the DMEM routine that contains 5% calf serum instead and are cultured to 12,18,24,36,60 hours.Same transfection human fibroblasts, epidermis cell and HeLa cell.

4. the SABC method detects cell CTLA-4Ig expression

293 cells, human fibroblasts, epidermis cell and the vascular endothelial cell of above-mentioned transfection are stopped at the fixed time, after washing 3 times with 0.1MPBS, with 4% paraformaldehyde (pH7.3) fix 8 hours, 0.1M PBS soaked 8 hours, carry out SABC subsequently and detect CTLA-4Ig and express.Do blank with the corresponding cell of untransfected simultaneously.

5. transfectional cell morphologic observation and active detection

Take out the transfectional cell slide, dry and drip 4% tongue after the culture medium immediately and expect after indigo plant is dyed 3 clocks and observe that dead cell is dyed blue color, living cells is not colored.Examine under a microscope transfectional cell form and activity change.Find CTLA-4Ig adenovirus infection adenovirus packaging cell 293 cells, the cell that infects about 3-5 days begins in the part that peplos shrinks, becomes circle, adhesiveness reduces, levitating then, and can be beading sample and arrange.Owing to acellular district appears in the levitating that comes off of local cells, it is viral pathological changes plaque that district's periphery has cell attachment.Not see then behind adenovirus infection human fibroblasts, the HeLa born of the same parents that cellular morphology changes and plaque forms, show that recombinant adenovirus is a kind of replicability defective virus, reproducible not in the cell that no E1 expresses, proved that also the CTLA-4Ig that adenovirus carries does not integrate with host gene, so no genotoxicity.

6. qualitative, quantitative, the localization and expression of transfectional cell CTLA-4Ig

Microscopically is observed the transfectional cell SABC and be found that: the positive grain of pale brown color sees cytoplasm.100 cell records of numeration positive cell number wherein under high power lens.Find that 293 cell transfectings cultivate 8 hours CTLA-4Ig again and begin to express after 1 hour, all cells all is strong positive after 36 hours; Human fibroblasts and epidermis cell are cultivated after 4 hours in transfection and were begun in 12 hours to express, and reach the peak in 36 hours, and positive expression rate is 50%, and the prompting adenovirus vector is the transfection skin histology effectively.And find that adenovirus titre, cell category, transfection time, incubation time all have appreciable impact to the CTLA-4Ig expression of transfectional cell.The adenovirus vector transfection efficiency is concentration, and (with titre is 7 * 10 according to patience ⁸Adenovirus dilution 15 times of HeLa, human fibroblasts of PFU/ milliliter do not have the CTLA-4Ig expression, and titre is 7 * 10 ⁸Enough time HeLa are cultivated in transfection during the PFU/ milliliter, human desmocyte all has positive expression), illustrate that virus titer is most important for improving transfection efficiency.In the certain hour scope, the transfection liquid of identical titre, transfection time, incubation time prolong, and the positive expression cell number is many more.Reaching enough transfections time, cell can have 100% positive expression.The result also shows the transfection efficiency difference of constructed adenovirus expression carrier to different cells, and 293 cell transfectings are most effective, and the HeLa cell takes second place 80%, becomes the fiber transfection efficiency minimum, the dyeing of 60% cell positive.The matched group non-transfected cells there is no pale brown color positive cell, shows that normal cell does not have CTLA-4Ig and expresses (see figure 2).

Embodiment 5

The Adv-CTLA4Ig in-vitro transfection is treated cutify (I):

Transfer recombinant adenoviral vector titre to 5 * 10 with the DMEM culture fluid ⁸/ L, the skin chunk that will take from Rongchang County pig at 6 monthly ages is put into wherein and is cultivated in cell culture incubator.In cultivating the capable frozen section of back different time phases bark fetching skin tissue piece, immunohistochemical detection.Found that just as seen the expression of destination protein CTLA4Ig is arranged in transfection after 6 hours, 24,36 hours visible CTLA4Ig express further and increase after cultivation, see that after after the transfection 48,72 hours the expression of CTLA4Ig no longer increases.See under the mirror that CTLA4Ig is mainly in fibroblast and follicular epithelium cellular expression (see figure 3).

The Adv-CTLA4Ig in-vitro transfection is treated cutify (II):

With being 2 * 10 with titre ⁹After the cream type recombinant adenoviral vector of/L directly is applied to the dermis of skin face, place cell culture incubator to cultivate.In cultivating the capable frozen section of back different time phases bark fetching skin tissue piece, immunohistochemical detection.Result and (I) similar (see figure 4).

Implementation column 6

The Adv-CTLA4Ig transfecting pig is in the application of Mus burn wound

1. above-mentioned planting in burn Balb/c mouse back 2 * 2cm with Adv-CTLA4Ig transfecting pig skin seam cut the crust wound surface.Postoperative is found:

(1) cutify part and peripheral group are woven with the expression of CTLA4Ig.

(2) the Corii Sus domestica time-to-live average out to of Adv-CTLA4Ig transfection is 21 days, the longlyest surpasses 28 days.

And the matched group time-to-live is 8 to 9 days;

(3) granulation tissue that heterogenous skin covered of Adv-CTLA4Ig transfection is also expressed CTLA4Ig.

2. above-mentioned planting in burn Wistar rat back 3 * 4cm with Adv-CTLA4Ig transfecting pig skin seam cut the crust wound surface.Experiment is found:

(1) cutify part and peripheral group are woven with the expression of CTLA4Ig.

(2) the heteroplastic transplantation skin time-to-live average out to of Adv-CTLA4Ig transfection is 17 days, and the matched group time-to-live is 8 to 9 days;

(3) granulation tissue that heterogenous skin covered of Adv-CTLA4Ig transfection is also expressed CTLA4Ig

Embodiment 7

The Adv-CTLA4Ig transfecting pig is in the application of people burn wound

Above made transgenic Corii Sus domestica is applied to the fire victim of different situations, and used maximum area reaches 0.4M ², minimum is transplanted the transgenic Corii Sus domestica by 4 * 5cm. and is survived in burn wound, and the live time that lives forever most reaches 37 days, and other case different time after transplanting all needs excision, its well-grown during excision because of treatment.

SEQUENCE?LISTING

＜110〉Chongqing Zongshen Junhui Biotechnology Co.ltd

＜120〉a kind of heterogenous skin with the recombination transfection

<130>I00020

<140>00103528.2

<141>2000-03-27

<160>2

<170>PatentIn?version?3.1

<210>1

<211>450

<212>DNA

<213>Homo?sapiens

<220>

<221>CDS

<222>(1)..(450)

<223>

<400>1

atg?ggt?gta?ctg?ctc?aca?cag?agg?acg?ctg?ctc?agt?ctg?gtc?ctt?gca 48

Met?Gly?Val?Leu?Leu?Thr?Gln?Arg?Thr?Leu?Leu?Ser?Leu?Val?Leu?Ala

1 5 10 15

ctc?ctg?ttt?cca?agc?atg?gcg?agc?atg?gca?atg?cac?gtg?gcc?cag?cct 96

Leu?Leu?Phe?Pro?Ser?Met?Ala?Ser?Met?Ala?Met?His?Val?Ala?Gln?Pro

20 25 30

gct?gtg?gta?ctg?gcc?agc?agc?cga?ggc?atc?gcc?agc?ttt?gtg?tgt?gag 144

Ala?Val?Val?Leu?Ala?Ser?Ser?Arg?Gly?Ile?Ala?Ser?Phe?Val?Cys?Glu

35 40 45

tat?gca?tct?cca?ggc?aaa?gcc?act?gag?gtc?cgg?gtg?aca?gtg?ctt?cgg 192

Tyr?Ala?Ser?Pro?Gly?Lys?Ala?Thr?Glu?Val?Arg?Val?Thr?Val?Leu?Arg

50 55 60

cag?gct?gac?agc?cag?gtg?act?gaa?gtc?tgt?gcg?gca?acc?tac?atg?atg 240

Gln?Ala?Asp?Ser?Gln?Val?Thr?Glu?Val?Cys?Ala?Ala?Thr?Tyr?Met?Met

65 70 75 80

ggg?aat?gag?ttg?acc?ttc?cta?gat?gat?tcc?atc?tgc?acg?ggc?acc?tcc 288

Gly?Asn?Glu?Leu?Thr?Phe?Leu?Asp?Asp?Ser?Ile?Cys?Thr?Gly?Thr?Ser

85 90 95

agt?gga?aat?caa?gtg?aac?ctc?act?atc?caa?gga?ctg?agg?gcc?atg?gac 336

Ser?Gly?Asn?Gln?Val?Asn?Leu?Thr?Ile?Gln?Gly?Leu?Arg?Ala?Met?Asp

100 105 110

acg?gga?ctc?tac?atc?tgc?aag?gtg?gag?ctc?atg?tac?cca?ccg?cca?tac 384

Thr?Gly?Leu?Tyr?Ile?Cys?Lys?Val?Glu?Leu?Met?Tyr?Pro?Pro?Pro?Tyr

115 120 125

tac?ctg?ggc?ata?ggc?aac?gga?acc?cag?att?tat?gta?att?gat?cca?gaa 432

Tyr?Leu?Gly?Ile?Gly?Asn?Gly?Thr?Gln?Ile?Tyr?Val?Ile?Asp?Pro?Glu

130 135 140

ccg tgc cca gat tct gac

450

Pro?Cys?Pro?Asp?Ser?Asp

145 150

<210>2

<211>150

<212>PRT

<213>Homo?sapiens

<400>2

Met?Gly?Val?Leu?Leu?Thr?Gln?Arg?Thr?Leu?Leu?Ser?Leu?Val?Leu?Ala

1 5 10 15

Leu?Leu?Phe?Pro?Ser?Met?Ala?Ser?Met?Ala?Met?His?Val?Ala?Gln?Pro

20 25 30

Ala?Val?Val?Leu?Ala?Ser?Ser?Arg?Gly?Ile?Ala?Ser?Phe?Val?Cys?Glu

35 40 45

Tyr?Ala?Ser?Pro?Gly?Lys?Ala?Thr?Glu?Val?Arg?Val?Thr?Val?Leu?Arg

50 55 60

Gln?Ala?Asp?Ser?Gln?Val?Thr?Glu?Val?Cys?Ala?Ala?Thr?Tyr?Met?Met

65 70 75 80

Gly?Asn?Glu?Leu?Thr?Phe?Leu?Asp?Asp?Ser?Ile?Cys?Thr?Gly?Thr?Ser

85 90 95

Ser?Gly?Asn?Gln?Val?Asn?Leu?Thr?Ile?Gln?Gly?Leu?Arg?Ala?Met?Asp

100 105 110

Thr?Gly?Leu?Tyr?Ile?Cys?Lys?Val?Glu?Leu?Met?Tyr?Pro?Pro?Pro?Tyr

115 120 125

Tyr?Leu?Gly?Ile?Gly?Asn?Gly?Thr?Gln?Ile?Tyr?Val?Ile?Asp?Pro?Glu

130 135 140

Pro?Cys?Pro?Asp?Ser?Asp

145 150

Claims (4)

1. Corii Sus domestica skin that exsomatizes that is used to cover people burn wound, it contains as the CTLA4Ig recombination of exogenous gene and the CTLA4Ig recombinant protein of this recombinant gene expression, and the CTLA4 part encoded protein matter in the wherein said CTLA4Ig recombination has the sequence shown in SEQ IDNO:2.

2. according to the described Corii Sus domestica skin of claim 1, it derives from Rongchang County's Corii Sus domestica skin less than 6 monthly ages.

3. according to the described Corii Sus domestica skin of claim 1, wherein, described CTLA4Ig recombination effectively is connected with SV40, CMV or CAG promoter.

4. according to the described Corii Sus domestica skin of claim 1, wherein, described CTLA4Ig recombination effectively is connected with the CAG promoter, should be incorporated into the SwaI site of adenovirus vector with the recombination that promoter effectively is connected.

Images