CN100360674C - Prokaryotic expression carrier pASK-75-EX - Google Patents

Prokaryotic expression carrier pASK-75-EX Download PDF

Info

Publication number
CN100360674C
CN100360674C CNB2005100461403A CN200510046140A CN100360674C CN 100360674 C CN100360674 C CN 100360674C CN B2005100461403 A CNB2005100461403 A CN B2005100461403A CN 200510046140 A CN200510046140 A CN 200510046140A CN 100360674 C CN100360674 C CN 100360674C
Authority
CN
China
Prior art keywords
pask
expression vector
vector
purifying
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CNB2005100461403A
Other languages
Chinese (zh)
Other versions
CN1840666A (en
Inventor
徐明恺
张惠文
张成刚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Applied Ecology of CAS
Original Assignee
Institute of Applied Ecology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Applied Ecology of CAS filed Critical Institute of Applied Ecology of CAS
Priority to CNB2005100461403A priority Critical patent/CN100360674C/en
Publication of CN1840666A publication Critical patent/CN1840666A/en
Application granted granted Critical
Publication of CN100360674C publication Critical patent/CN100360674C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to a prokaryotic expression vector. The present invention uses designed and synthesized genes of a vector cloning expression area to form the new prokaryotic expression vector pASK-75-EX which is provided with a base sequence in a sequence list SEQ ID NO: 1 and is provided with multiple cloning sites and purifying check labels composed of common restriction enzyme. Results show that the pASK-75-EX can effectively express the foreign protein scFv-ML and B-L-SEC2, and an expression product can be conveniently purified and checked with low price by the purifying check labels additionally arranged in the vector.

Description

A kind of prokaryotic expression carrier pASK-75-EX
Technical field
The present invention relates to prokaryotic expression carrier, specifically adopt the carrier cloning that designs and synthesizes to express a kind of novel prokaryotic expression carrier pASK-75-EX of the gene constructed one-tenth in district.
Background technology
Carrier pASK-75 is a kind of efficient expression vector at the expression in escherichia coli foreign protein, the promotor tetA of its stringent type control has guaranteed under the situation of inductor disappearance expression of exogenous gene to be suppressed, be fit to express to the cytotoxic foreign protein of host bacterium, the tsiklomitsin of trace can fully be induced the startup of tetA promotor, makes it have higher expression efficiency.In addition, the tetA promoter expression system is not subjected to the control of any other cell regulation mechanism, therefore to the selection of expressive host bacterium without limits.But the multiple clone site of pASK-75 lacks the restriction endonuclease sites of common high vigor, and the purifying cost that the Strep-tag purification tag of its downstream fusion need be high, has limited the application of pASK-75.
Summary of the invention
The object of the present invention is to provide convenient, the cheap prokaryotic expression carrier pASK-75-EX of a kind of application.
For achieving the above object, the present invention transforms the pASK-75 carrier, has kept tetA promoter sequence and OmpA signal peptide sequence, has newly added the multiple clone site that contains restriction enzyme commonly used, and, be built into new expression vector pASK-75-EX with His-tag label replacement Strep-tag.Compare with original vector, pASK-75-EX makes the clone of foreign gene and the more convenient cheapness of purification assays of foreign protein;
The present invention designs and synthesizes carrier cloning and expresses district's gene, comprise StuI, NcoI, ShpI, EcoRI, NotI, BglII, XhoI and PstI restriction endonuclease sites, His-tag purifying appraisement label, it has base sequence among the sequence table SEQ ID NO:1;
It is as follows that the carrier cloning that designs and synthesizes is expressed district's gene base sequence:
CCTGGCCCAG CCGGCCCATG GCATGCGAAT?TCGCGGCCGC 40
AGATCTGCTC GAGCTGCAGC ATCATCATCA?TCATCATA 78
Utilize the enzyme of restriction endonuclease StuI and Hind III to cut interconnection technique, the synthetic carrier cloning is expressed district's gene integration go into expression vector pASK-75 clonal expression district (substituting the base sequence of 201 to 292 of former pASK-75 expression vectors), be built into new expression vector pASK-75-EX.
The present invention has following advantage:
1. the new expression vector pASK-75-EX of the present invention's structure has the multiple clone site that contains multiple restriction enzyme composition commonly used, greatly facilitates the clone of foreign gene.
2. the new expression vector pASK-75-EX of the present invention's structure replaces the Strep-tag purifying appraisement label of original vector with His-tag purifying appraisement label, simplified the foreign protein purifying of expression and the operation of evaluation, and significantly reduced the cost of purifying and evaluation.
3. the present invention has kept the tetA promoter sequence and the OmpA signal peptide sequence of original vector, has kept the expression vector pASK-75-EX of new structure that the stringent type of foreign gene is expressed control.
4. the new expression vector of Application Example preparation, convenient cheap realization to expression, purifying and the biological assay of single chain antibody protein (scFv-ML) and fusion immunotoxin albumen (B-L-SEC2).
Description of drawings
Fig. 1 is that the single endonuclease digestion of pASK-75-EX multiple clone site is verified with 1.0% agarose gel electrophoresis analytical results figure, wherein: 1. the original pASK75 plasmid of cutting without enzyme, 2. the pASK75-EX plasmid of cutting without enzyme, 3-7. respectively through SphI, EcoRI, BglII, XhoI, pASK75-EX plasmid behind the PstI single endonuclease digestion, 4.DL2000 dna molecular amount standard
Fig. 2 is for utilizing the His-tag that introduces with the result of single-chain antibody ML albumen behind Ni affinity chromatography column purification who expresses.
Fig. 3 is for utilizing the His-tag that introduces with the result of fusion immunotoxin B-L-SEC2 albumen behind Ni affinity chromatography column purification who expresses.
Fig. 4 identifies the single-chain antibody ML albumen of expressing for the His-tag that utilizes introducing through protein immunization marking method result.
Fig. 5 identifies the fusion immunotoxin B-L-SEC2 albumen of expressing for the His-tag that utilizes introducing through protein immunization marking method result.
Embodiment
Embodiment 1
Carrier cloning is expressed the preparation of district's gene, and it has the base sequence shown in the sequence table SEQ ID NO:1:
ACCATCGAATGGCCAGATGATTAATTCCTAATTTTTGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCC
CTATCAGTGATAGAGAAAAGTGAAATGAATAGTTCGACAAAAATCTAGATAACGAGGGCAAAAAATGAAAAAGAC
AGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGG CCTGGCCCAGCCGGCCCATGGCATG
CGAATTCGCGGCCGCAGATCTGCTCGAGCTGCAGCATCATCATCATCATCATAAGCTTGACCTGTGAAGTGAAAA
ATGGCGCACATTGTGCGACATTTTTTTTGTCTGCCGTTTACCGCTACTGCGTCACGGATCTCCACGCGCCCTGTA
GCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCG
CTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCC
CTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTG
GGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCC
AAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATT
GGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCAGGTG
GCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCA
TGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCG
CCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATG
CTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTC
GCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACG
CCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA
AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCA
ACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTC
GCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAA
TGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTGATAGACTGGA
TGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTG
GAGCCGGTGAGCGTGGCTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTA
TCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTA
AGCATTGGTAGGAATTAATGATGTCTCGTTTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATG
AGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGC
ATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCC
CTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATC
GCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCT
TTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCAGTGGGGCATTTTACTTTAGGTT
GCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCAT
TATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCA
TATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCTTAAAAGCAGCATAACCTTTTTCCGTGATGGTAAC
TTCACTAGTTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTT
CGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCT
GCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTC
CGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACT
TCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATA
AGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTT
CGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCG
CCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGG
AGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTT
TGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTT
GCTGGCCTTTTGCTCACATGACCCGAC
The sequence of above carrier is to utilize the enzyme of restriction endonuclease StuI and Hind III to cut interconnection technique, the synthetic carrier cloning is expressed district's gene (the base sequence fragment of band underscore part in the above sequence) be integrated into the expression vector pASK-75 clonal expression district (base sequence that alternative former pASK-75 expression vector is 201 to 292, replacing the presequence fragment is CCTGAGACCAGAATTCGAGCTCGGTACCCGGGGATCCCTCGAGGTCGACCTGCAGG CAGCGCTTGGCGTCACCCGCAGTTCGGTGGTTAATA), be built into new expression vector pASK-75-EX.
(1) information of SEQ ID NO.1 (referring to sequence table)
(a) sequence signature:
* length: 3252 base pairs
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: DNA
(c) suppose: not
(d) antisense: not
(e) initial source: carrier pASK-75
(2) carrier cloning is expressed the preparation of district's gene
1) it is synthetic that carrier cloning is expressed the design of distinguishing gene:
Intended purposes according to making up new expression vector designs and synthesizes two oligonucleotide chains:
Forward chain p-F:5 '-CC TGG CCC AGC CGG CCC ATG GCA TGC GAATTC GCG GCC GCA GAT CTG CTC GAG CTG CAG CAT CAT CAT CATCAT CATA-3 ';
Reverse strand p-R:5 '-A GCT ATG ATG ATG ATG ATG ATG GTC CAG CTCGAG CAG ATC TGC GGC CGC GAA TTC GCA TGC CAT GGG CCG GCTGGG CCA GG-3 '
2) annealing of oligonucleotide chain:
10 * annealing hybridization buffer (SSC) composition: 1.5mol/LNaCl
0.3M trisodium citrate 2H 2O,
Transfer pH to 7.0 with HCl
The annealing reaction system:
10×SSC?buffer 1μl
Positive and negative each 5pmol of oligonucleotide chain
Aseptic ultrapure water polishing volume to 10 μ l
Annealing reaction condition: 94 ℃ of 10min; 0 ℃ of 10min; 72 ℃ of 20min;
Embodiment 2
The structure of new expression vector pASK-75-EX
(1) double digestion of pASK-75 carrier: the German Biometra pASK-75 of company vector plasmid DNA is fully digested through restriction endonuclease StuI and HindIII, and digestion product is through 0.8% agarose gel electrophoresis analysis, and glue reclaims the big fragment of purifying 3200bp;
(2) enzyme is cut the connection and the conversion of product: annealed oligonucleotide chain and the big fragment of the pASK-75 carrier molar ratio with 5: 1 is mixed, and spend the night with 16 ℃ of connections of T4 dna ligase, be built into expression vector pASK-75-EX.(conversion operation is pressed F. Ao Sibai, R. Brunt, R.E. James Kingston to connect product Transformed E .coli DH5 α competent cell, D.D. Moore, J.G Sai Deman, J.A. Smith, K. Si Telaer " fine works molecular biology experiment guide " USA New York John Wiley﹠amp; The nineteen ninety-five third edition P39-40 of Sons press), with acillin resistance screening transformant.
(3) checking of expression vector pASK-75-EX: the positive transformant of selecting is spread cultivation, (the plasmid DNA extracting method is pressed J. Sa nurse Brooker to extract plasmid DNA, E.F. Flitch, T. Manny A Disi " molecular cloning experiment guide " cold spring port, the USA New York calendar year 2001 third edition P27-30 of press), carrier cloning through existing only in design is expressed the restriction enzyme SphI in district respectively, EcoRI, BglII, XhoI, the PstI single endonuclease digestion is identified (accompanying drawing 1), and confirms with the terminal cessation method order-checking of the two deoxidations of Sanger.
Embodiment 3
The practical application of new expression vector pASK-75-EX and effect assessment
(1) exogenous genetic fragment is connected into new expression vector pASK-75-EX: pASK-75-EX plasmid DNA and the pET-28a-ml plasmid DNA that contains single-chain antibody ML gene are used Nco I, Not I double digestion respectively, through 1.0% agarose gel electrophoresis, glue reclaims ml fragment and the pASK-75-EX plasmid 3200bp fragment that test kit reclaims 770bp, spend the night with 16 ℃ of connections of T4 dna ligase, make up single chain antibody protein expression vector pASK-75-EX-ml.Connect product Transformed E .coli BL21 (DE3) competent cell.With acillin resistance screening transformant, select recombinant clone and spread cultivation, extract plasmid DNA, identify correct recombinant clone through Nco I, Not I double digestion.
With NcoI, XhoI double digestion pASK-75-EX plasmid with contain the pET-28a-b-l-sec2 plasmid DNA of fusion immunotoxin gene, make up fusion immunotoxin protein expression vector pASK-75-EX-b-l-sec2 with quadrat method.
(2) expression of foreign protein: respectively inoculation transformed recombinant plasmid pASK-75-EX-ml and pASK75-EX-b-l-sec2 the single bacterium colony of BL21 (DE3) in the liquid LB that contains 100 μ g/ml acillins 37 ℃ spend the night, next day, 37 ℃ were cultured to OD by switching in 1: 50 6000.8 the adding final concentration is that the tsiklomitsin of 0.2ug/ml is induced 6h for 37 ℃.
(3) utilize the new His-tag label purifying foreign protein of introducing: the thalline behind the centrifugal collection abduction delivering, the thalline of every 100ml stock culture is resuspended in the damping fluid of 10ml 20mmol/L Tris-HCl pH7.5, add 0.025% N,O-Diacetylmuramidase in 37 ℃ of lysing cell, in 0 ℃ of ultrasonication until bacterium liquid become limpid, the centrifugal 20min of 12000g collects supernatant, be splined on the good Ni affinity column of level pad balance (available from U.S. Novagen company), with balance in conjunction with damping fluid (5mmol/L imidazoles, 0.5MNaCl, 20mmol/L Tris-HCl pH7.5) balance is to baseline, with the balance that contains the 100mmol/L imidazoles in conjunction with the buffer solution elution target protein, and with SDS-PAGE purity assay (accompanying drawing 2,3).(the SDS-PAGE concrete operation method is pressed Guo Yaojun " protein electrophorese experimental technique " first version P132 in 1999 of Science Press).The molecular weight of single-chain antibody ML albumen and fusion immunotoxin protein B-L-SEC2 is respectively 35kD and 60kD.
(4) utilize the new His-tag label of introducing to identify foreign protein: the single-chain antibody ML albumen behind the purifying is separated with SDS-PAGE with fusion immunotoxin protein B-L-SEC2 with protein immunization marking method, half-dried commentaries on classics film instrument goes to nitrocellulose membrane, the sealing of 2% skimmed milk, goat anti-rabbit antibody with the anti-His-tag antibody of rabbit, alkali phosphatase enzyme mark is handled successively, NBT/BCIP colouring reagents box colour developing (accompanying drawing 4,5).(used damping fluid and concrete operation method are pressed Wang Jiazheng, model bright " protein technical manual " the 2002 first version P166 of Science Press)
SEQUENCE?LISTING
<110〉Shenyang Inst. of Applied Ecology, Chinese Academy of Sciences
<120〉a kind of prokaryotic expression carrier pASK-75-EX
<130>
<160>1
<170>PatentIn?version?3.1
<210>1
<211>3252
<212>DNA
<213〉carrier pASK-75
<220>
<221>misc_feature
<222>(1)..(3252)
<223>
<400>1
accatcgaat?ggccagatga?ttaattccta?atttttgttg?acactctatc?attgatagag 60
ttattttacc?actccctatc?agtgatagag?aaaagtgaaa?tgaatagttc?gacaaaaatc 120
tagataacga?gggcaaaaaa?tgaaaaagac?agctatcgcg?attgcagtgg?cactggctgg 180
tttcgctacc?gtagcgcagg?cctggcccag?ccggcccatg?gcatgcgaat?tcgcggccgc 240
agatctgctc?gagctgcagc?atcatcatca?tcatcataag?cttgacctgt?gaagtgaaaa 300
atggcgcaca?ttgtgcgaca?ttttttttgt?ctgccgttta?ccgctactgc?gtcacggatc 360
tccacgcgcc?ctgtagcggc?gcattaagcg?cggcgggtgt?ggtggttacg?cgcagcgtga 420
ccgctacact?tgccagcgcc?ctagcgcccg?ctcctttcgc?tttcttccct?tcctttctcg 480
ccacgttcgc?cggctttccc?cgtcaagctc?taaatcgggg?gctcccttta?gggttccgat 540
ttagtgcttt?acggcacctc?gaccccaaaa?aacttgatta?gggtgatggt?tcacgtagtg 600
ggccatcgcc?ctgatagacg?gtttttcgcc?ctttgacgtt?ggagtccacg?ttctttaata 660
gtggactctt?gttccaaact?ggaacaacac?tcaaccctat?ctcggtctat?tcttttgatt 720
tataagggat?tttgccgatt?tcggcctatt?ggttaaaaaa?tgagctgatt?taacaaaaat 780
ttaacgcgaa?ttttaacaaa?atattaacgc?ttacaatttc?aggtggcact?tttcggggaa 840
atgtgcgcgg?aacccctatt?tgtttatttt?tctaaataca?ttcaaatatg?tatccgctca 900
tgagacaata?accctgataa?atgcttcaat?aatattgaaa?aaggaagagt?atgagtattc 960
aacatttccg?tgtcgccctt?attccctttt?ttgcggcatt?ttgccttcct?gtttttgctc 1020
acccagaaac?gctggtgaaa?gtaaaagatg?ctgaagatca?gttgggtgca?cgagtgggtt 1080
acatcgaact?ggatctcaac?agcggtaaga?tccttgagag?ttttcgcccc?gaagaacgtt 1140
ttccaatgat?gagcactttt?aaagttctgc?tatgtggcgc?ggtattatcc?cgtattgacg 1200
ccgggcaaga?gcaactcggt?cgccgcatac?actattctca?gaatgacttg?gttgagtact 1260
caccagtcac?agaaaagcat?cttacggatg?gcatgacagt?aagagaatta?tgcagtgctg 1320
ccataaccat?gagtgataac?actgcggcca?acttacttct?gacaacgatc?ggaggaccga 1380
aggagctaac?cgcttttttg?cacaacatgg?gggatcatgt?aactcgcctt?gatcgttggg 1440
aaccggagct?gaatgaagcc?ataccaaacg?acgagcgtga?caccacgatg?cctgtagcaa 1500
tggcaacaac?gttgcgcaaa?ctattaactg?gcgaactact?tactctagct?tcccggcaac 1560
aattgataga?ctggatggag?gcggataaag?ttgcaggacc?acttctgcgc?tcggcccttc 1620
cggctggctg?gtttattgct?gataaatctg?gagccggtga?gcgtggctct?cgcggtatca 1680
ttgcagcact?ggggccagat?ggtaagccct?cccgtatcgt?agttatctac?acgacgggga 1740
gtcaggcaac?tatggatgaa?cgaaatagac?agatcgctga?gataggtgcc?tcactgatta 1800
agcattggta?ggaattaatg?atgtctcgtt?tagataaaag?taaagtgatt?aacagcgcat 1860
tagagctgct?taatgaggtc?ggaatcgaag?gtttaacaac?ccgtaaactc?gcccagaagc 1920
taggtgtaga?gcagcctaca?ttgtattggc?atgtaaaaaa?taagcgggct?ttgctcgacg 1980
ccttagccat?tgagatgtta?gataggcacc?atactcactt?ttgcccttta?gaaggggaaa 2040
gctggcaaga?ttttttacgt?aataacgcta?aaagttttag?atgtgcttta?ctaagtcatc 2100
gcgatggagc?aaaagtacat?ttaggtacac?ggcctacaga?aaaacagtat?gaaactctcg 2160
aaaatcaatt?agccttttta?tgccaacaag?gtttttcact?agagaatgca?ttatatgcac 2220
tcagcgcagt?ggggcatttt?actttaggtt?gcgtattgga?agatcaagag?catcaagtcg 2280
ctaaagaaga?aagggaaaca?cctactactg?atagtatgcc?gccattatta?cgacaagcta 2340
tcgaattatt?tgatcaccaa?ggtgcagagc?cagccttctt?attcggcctt?gaattgatca 2400
tatgcggatt?agaaaaacaa?cttaaatgtg?aaagtgggtc?ttaaaagcag?cataaccttt 2460
ttccgtgatg?gtaacttcac?tagtttaaaa?ggatctaggt?gaagatcctt?tttgataatc 2520
tcatgaccaa?aatcccttaa?cgtgagtttt?cgttccactg?agcgtcagac?cccgtagaaa 2580
agatcaaagg?atcttcttga?gatccttttt?ttctgcgcgt?aatctgctgc?ttgcaaacaa 2640
aaaaaccacc?gctaccagcg?gtggtttgtt?tgccggatca?agagctacca?actctttttc 2700
cgaaggtaac?tggcttcagc?agagcgcaga?taccaaatac?tgtccttcta?gtgtagccgt 2760
agttaggcca?ccacttcaag?aactctgtag?caccgcctac?atacctcgct?ctgctaatcc 2820
tgttaccagt?ggctgctgcc?agtggcgata?agtcgtgtct?taccgggttg?gactcaagac 2880
gatagttacc?ggataaggcg?cagcggtcgg?gctgaacggg?gggttcgtgc?acacagccca 2940
gcttggagcg?aacgacctac?accgaactga?gatacctaca?gcgtgagcta?tgagaaagcg 3000
ccacgcttcc?cgaagggaga?aaggcggaca?ggtatccggt?aagcggcagg?gtcggaacag 3060
gagagcgcac?gagggagctt?ccagggggaa?acgcctggta?tctttatagt?cctgtcgggt 3120
ttcgccacct?ctgacttgag?cgtcgatttt?tgtgatgctc?gtcagggggg?cggagcctat 3180
ggaaaaacgc?cagcaacgcg?gcctttttac?ggttcctggc?cttttgctgg?ccttttgctc 3240
acatgacccg?ac 3252

Claims (1)

1. prokaryotic expression carrier pASK-75-EX, it is characterized in that: sequence is shown in base sequence among the sequence table SEQ ID NO:1.
CNB2005100461403A 2005-03-30 2005-03-30 Prokaryotic expression carrier pASK-75-EX Expired - Fee Related CN100360674C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2005100461403A CN100360674C (en) 2005-03-30 2005-03-30 Prokaryotic expression carrier pASK-75-EX

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2005100461403A CN100360674C (en) 2005-03-30 2005-03-30 Prokaryotic expression carrier pASK-75-EX

Publications (2)

Publication Number Publication Date
CN1840666A CN1840666A (en) 2006-10-04
CN100360674C true CN100360674C (en) 2008-01-09

Family

ID=37029861

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2005100461403A Expired - Fee Related CN100360674C (en) 2005-03-30 2005-03-30 Prokaryotic expression carrier pASK-75-EX

Country Status (1)

Country Link
CN (1) CN100360674C (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001078756A2 (en) * 2000-04-18 2001-10-25 Depuy Biotech Jena Gmbh Agent for postoperative use after the removal of bone tumours
WO2003016489A2 (en) * 2001-08-20 2003-02-27 Purina Mills, Llc Porcine leptin protein, antisense and antibody

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001078756A2 (en) * 2000-04-18 2001-10-25 Depuy Biotech Jena Gmbh Agent for postoperative use after the removal of bone tumours
WO2003016489A2 (en) * 2001-08-20 2003-02-27 Purina Mills, Llc Porcine leptin protein, antisense and antibody

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Overexpression of the phytase from Escherichia coli and itsextracellular production in bioreactors. G. Miksch 等.Applied Microbiology and Biotechnology,Vol.59 No.6. 2002 *

Also Published As

Publication number Publication date
CN1840666A (en) 2006-10-04

Similar Documents

Publication Publication Date Title
CN103635583B (en) enzymatic amination
KR100868765B1 (en) A primer set for amplifying target sequences of bacterial species resistant to antibiotics, probe set specifically hybridizable with the target sequences of the bacterial species, a microarray having immobilized the probe set and a method for detecting the presence of one or more of the bacterial species
CN107245500B (en) A kind of leaching based on OCTS technology is leukaemia CAR-T therapy vector and its construction method and application
KR102157197B1 (en) CAR-T transformation vector used for suppression of immune evasion through PDL1 blocking and its construction method and use
CN107058315A (en) Strike the siRNA for subtracting people PD 1, recombination expression CAR carrier Ts and its construction method and application
CN108148863B (en) CAR-T transgenic vector for blocking IL6R and relieving CRS (cell-specific receptor), and construction method and application thereof
WO1995003426A2 (en) Method for nucleic acid amplification by transcription using displacement, and reagents and kit therefor
KR20190038645A (en) SiRNA of human interleukin 6, recombinant expression CAR-T vector, and its production method and use
CN107287207B (en) A kind of label and application for tracing in vivo and artificial removing CAR-T cell
CN108018312A (en) A kind of CAR-T therapy vectors of T lymphocytic leukemias and its construction method and application
CN107674862A (en) CIK of similar Chimeric antigen receptor modification and preparation method and application
CN100360674C (en) Prokaryotic expression carrier pASK-75-EX
CN107326089A (en) A kind of method and its application that Septin9 gene promoter methylations are detected based on NGS
CN106754883B (en) An a kind of step, seamless, non-homogeneous, multiple clips gene splicing remodeling method and its kit
CN112442515B (en) Application of gRNA target combination in construction of hemophilia model pig cell line
CN101331236A (en) Repair of nucleic acids for improved amplification
CN114381537B (en) Bacterial screening reagent, screening method, kit and application
CN114381537A (en) Bacterial screening reagent, screening method, kit and application
CN112442513B (en) Cas9 overexpression vector and construction method and application thereof
CN112501103B (en) Recombinant escherichia coli for over-expressing lsrB gene and construction method and application thereof
CN111411114B (en) Method for regulating content of exopolysaccharide of streptococcus thermophilus
CN112538497B (en) CRISPR/Cas9 system and application thereof in construction of alpha, beta and alpha &amp; beta thalassemia model pig cell lines
CN112522292B (en) CRISPR/Cas9 system for constructing congenital amaranth clone pig nuclear donor cells and application thereof
US20030157661A1 (en) De novo synthesized plasmid, methods of making and use thereof
KR101989814B1 (en) Shuttle plasmid replicable in clostridium and escherichia coli, and recombinant microorganism having enhanced pentose metabolism and fermentation performance prepared using the same

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20080109

Termination date: 20140330