CN100344770C - Primer, probe for rat lymph cell P59 fyn gene quantitative expression test - Google Patents

Abstract

The present invention relates to a primer and a probe for the quantitative expression and test of a rat lymphocyte P59<fyn> gene, which is characterized in that the sequence of a primer 378U on the upper stream is 5'TCGCGGTGAAGGCTATGT3' in a primer sequence, the sequence of a primer 485L on the downstream is 5'CCAGGTTCTCCCCCTCACTAA3', and the sequence of a probe 423-FT is 5'CTGCAGCACCCTTCCAGCGCAACCC3'. The present invention has the advantages of good sensitivity and specificity of the gene, the probe and the primer, real-time corresponding and quantitative analysis, high accuracy, simple operation and small required sample amount; the P59<fyn> gene expression level peak value which is detected by a real-time corresponding quantitative analysis method is consistent with CD4+, CD8+ lymphocyte infiltration time in a transplantation heart myocardium organization.

Description

Rat lymphocyte P59 FynGene quantification is expressed test primer, probe

Technical field:

The present invention relates to a kind of rat lymphocyte P59 ^FynGene quantification is expressed test primer, probe

Technical background:

At present, organ transplantation is still the effective ways of many organs of treatment and tissue pathology in whole latter stage.But immunological rejection also remains one of main reason that causes organ transplantation treatment failure at present.Because making, the restriction of donor source can not realize that the optimization of donor and acceptor joins type, therefore allogenic antigen remains the immediate cause that causes rejection, and this also makes the success of clinical organ transplantation more depend on the early discovery of immunological rejection and control in time.

P59 ^FynBe one of phosphate tyrosine kinase (PTKs) family member, mainly in the T cell, express, and be connected in the endochylema afterbody of CD4 and CD8.It is the important component in the T cell activation signal transduction pathway.When identification took place antigen peptide-MHC mixture of at surface of cell membrane antigen presenting cell APC being presented as TXi Baoshouti TCR and CD4 or CD8, CD4 or CD8 afterbody bonded comprised P59 ^FynBe caused to less and the endochylema caudal action of the cellular immunization molecule CD3 in the TCR complex proteins at interior Tyrosylprotein kinase, tyrosine phosphatase binding site generation phosphorylation in its relevant tyrosine structural domain of catalysis, immune signal is transmitted in the T cell, and mediation activates the genetic transcription and the expression of a series of cellular immunization molecules, activating T cell.So tyrosine protein kinase P59 ^FynGenetic expression be the early stage representative indication of T cell activation.

The measuring method of existing immune molecule genetic expression comprises: gene difference display gray scale scan method, in situ hybridization (sorthen blot) technology etc., but aforesaid method is complicated, accuracy and poor repeatability and problem such as isotopic contamination is arranged, and therefore is necessary to provide a kind of primer and probe that quick accurate quantification is measured the immune molecule gene expression dose that adapt to.

Summary of the invention:

The purpose of this invention is to provide a kind of rat lymphocyte P59 ^FynGene quantification is expressed test with primer and probe, utilizes this primer and the probe can be to rat lymphocyte P59 ^FynGene is made real-time fluorescent PCR detection by quantitative, because this primer, probe has and testing gene homologous high specific and high affinity, can obtain the result of highly sensitive, high precision and repeatability.

For achieving the above object the present invention by the following technical solutions: primer provided by the invention and probe sequence are:

CDNA probe: 423-FT 5 ' TGCAGCACCCTTCCAGCGCAACC 3 '

Primer: 378U 5 ' TCGCGGTGAAGGCTATGT 3 '

485L 5’CCAGGTTCTCCCCCTCACTAA 3’

P59 ^FynGene total order and probe thereof, primer location See Attachment 1

Wherein: 378U is a upstream primer, is normal chain

423-FT is a probe, is anti-chain

485L is a downstream primer, is anti-chain

Description of drawings:

β-the actin and the P59 of the different samples that Fig. 1 real-time fluorescence quantitative PCR is measured ^FynGene amplification curve (in the experiment point) sometime

Fig. 2 is that different time is transplanted CD4+, CD8+ lymphocytic infiltration curve and P59 in the cardiac muscular tissue before and after the cardiac allograft rejection in rats art ^FynGene quantification is expressed curve ratio

Fig. 3 P59 ^FynThe comparison of amplification curve during different templates concentration

Fig. 4 P59 ^FynThe agarose electrophoresis figure of gene amplification product

P59 in Fig. 5 PCR reaction ^FynThe Auele Specific Primer fundamental diagram

Fig. 6 P59 ^FynThe specific probe synoptic diagram

Embodiment

The invention will be further described by the following examples

Experiment rat lymphocyte P59 among the present invention ^FynThe preparation method of gene-specific probe and primer: at first according to P59 ^FynThe gene total order is carried out rat lymphocyte P59 with the primer-design software bag ^FynSpecific probe and primer design, and designed primer and probe screened, select best primer and probe combinations and experimentize.

Embodiment:

1, the experiment grouping

Selecting the wistar rat is acceptor, and the SD rat is a donor, body weight 200-220g, male and female half and half (purchasing the animal center in Military Medical Science Institute--secondary animal).Be divided into 6 time groups, that is: 24h, 72h, 7d, 10d, 12d organize every group of 6 rats after the preceding group of transplanting, the heart transplantation.

2, blood specimen collection

Each organizes the wistar rat respectively at corresponding time point before and after transplanting, through 3% vetanarcol intraperitoneal anesthesia, and abdominal aortic blood 4ml, 2%EDTA anti-freezing in 1: 9.Be used to extract total RNA and quantitative PCR detection, get heart transplant simultaneously and do pathological section and carry out immunohistochemical methods and measure CD4+ and CD8+ lymphocytic infiltration number.

3, total RNA extracts

The lymphocyte separation medium isolated lymphocytes.Adopt the operation of Trizol method (GIBCO company test kit) by specification: lymphocyte is added 1ml Trizol make lysis, 4 ℃ of centrifugal 12000rpm 10 minutes, get supernatant, add 0.2ml chloroform concussion mixing, 4 ℃ of centrifugal 12000rpm 20 minutes, get the superiors and add the 0.5ml Virahol, 4 ℃ of 12000rpm are centrifugal 15 minutes, abandon supernatant and stay precipitation, add 1ml 75% ethanol, jog dissolving RNA, 7500rpm4 ℃ is centrifugal 5 minutes, abandon supernatant, after the ethanol volatilization total RNA is dissolved in the 50 μ l 0.1%DEPC water.

4, reverse transcription PCR (RT-PCR) and quantitative PCR

Reaction system is 24ul, comprising: total RNA 2ul (5ug/ml), Mg ₂SO ₄1ul (25uM), dNTP 1ul (10mM), RT-PCR enzyme mixture 1ul, buffer 5ul, β-actin or P59 ^FynEach 2ul of gene upstream and downstream Auele Specific Primer (31.25uM), β-actin or P59 ^FynGene-specific probe 2ul (3.13uM), all the other are supplied with 0.1%DEPC water, reaction conditions be 42 ℃ 30 minutes, 95 ℃ of sex change 15 minutes, 1 circulation; 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 60 seconds, 72 ℃ were extended 5 circulations 60 seconds; 94 ℃ of sex change 10 seconds, 60 ℃ were extended totally 40 circulations 60 seconds; Be cooled to 40 ℃ at last.

P of Rats 59 ^FynThe basic functional principle of gene-specific primer and probe:

P59 in the PCR reaction ^FynAuele Specific Primer principle of work (see figure 5).

P59 ^FynOpen chain P59 during the annealing temperature of gene-specific primer in PCR reaction and behind the reverse transcription ^FynThe complete complementary combination in specific region of cDNA nucleotide chain, and when elongating temperature, guide corresponding P59 ^FynNucleotide chain duplicate amplification.Process as shown.Its characteristics: because the specificity of primer is only carried out P59 when having realized the PCR reaction ^FynDuplicating and increasing of gene cDNA do not have the amplification of non-specific gene.

P59 ^FynThe specific probe (see figure 6) of gene.

The designed probe of this experiment is the Taqman probe, and probe 5 ' connects a Fam fluorophor (this fluorophor all can detect) in the 520-740um wavelength region, and 3 ' end connects 1 Tamra quenching group, and this two group is the automatic mark of dna synthesizer.The P59 that PCR when reaction specific probe at first generates with reverse transcription last time ^FynCDNA specific region nucleotide sequence is realized complete complementary combination, but because this moment, the fluorescence report group is controlled by quenching group and is not fluoresced, when cyclic amplification next time, the Taq enzyme combines when extending to specific probe and template bonded position with template under specific primer-primed, Taq enzyme wherein cuts off specific probe in the time of 60 ℃, the fluorescence report group separates with quenching group, cause fluorophor luminous, the quantitative PCR instrument writes down fluorescence intensity simultaneously, the template number of cDNA before being used for quantitatively this time increasing.

Adopted the relative quantitative assay method as the initial copy number of object of reference among the present invention with β-actin.

Because the expression level of lymphocyte β-actin mRNA is only relevant with cell count, and its content constant in cell, this experiment with β-actin as object of reference.Utilize β-actin and the P59 of real-time fluorescence quantitative PCR technology to same sample template ^FynGene expression dose is measured simultaneously.If each gene is in 40 amplification cycles, the cycle number that fluorescence intensity begins to increase from baseline is Ct.Be the initial cycles number of Ct value representation gene when beginning to increase, (reflection template radix).Because 10 times of the every increases of the template radix of cDNA, the cycle number that begins to increase (Ct value) just reduces 3.33, so the difference of different sample template radixes can be by formula:

10 ^{(CtA-CtB)/3.33}Calculate.P59 ^FynMultiple with respect to β-actin template number is:

10 ^{(P59fyn-β-actin)/3.33}。

Among Fig. 1, following arrow is β-actin, and upward arrow is P59 ^Fyn

Wherein: with the test result of putting four routine samples before the cardiac allograft rejection in rats art sometime is example,

See Table 1

Table 1

Numbering	P59 fyn	β-actin	10(p59-β-actin) /3.33
				1 2 3 4	12.44 12.83 12.31 13.95	7.692 7.803 8.027 7.863	26.658 32.330 19.328 67.286
Average	36.40±21.267

In the above-mentioned table, the P59 that average 36.40 ± 21.267 expressions four routine sample quantitative PCRs (starting template multiple relatively) are measured ^FynThe Ct value is to the average+standard deviation of the relative multiple of β-actinCt value,

Two kinds of comparative results see Table 2 and Fig. 2

Shi Yan immunofluorescence tissue staining as a comparison:

Get the original position heart of SD rat before transplanting respectively and transplant the transplantation donor heart of each time group of back, freezing back in 1/3 place crosspiece face section far away, 95% ethanol is 30min fixedly, PBS washing 3 times, each 5min, use fluorescently-labeled anti-CD4, CD8 labeling of monoclonal antibodies respectively, 37 ℃ of constant temperature are hatched 30min, PBS washing 3 times, each 5min, 4 ℃ keep in Dark Place after the glycerine mounting, carry out CD4 under the fluorescent microscope respectively ⁺, CD8 ⁺The lymphocyte numeration.

The (see figure 1) real-time fluorescence quantitative PCR is measured peripheral blood lymphocyte P59 ^FynGene expression dose (P59 ^FynMultiple to β-actin) measure to transplant CD4+ in the cardiac muscular tissue, CD8+ lymphocyte (number) with the immunohistochemical methods method and soak into number compare (see Table 2 and Fig. 2)

Table 2 CD4, the infiltration of CD8 rat implantation control group, molecule and P59 ^FynGenetic expression relatively

	Before the art	Postoperative 24h	72h	7d		10d		12d
									CD4+ soaks into CD8+ and soaks into P59 fynGene	15.5 16.8 36.4	4.8 3.3 87.7	5.3 3.7 95.3	11.8 8.2 77.6	9.2 6.5 98	11.8 6.7 44.3

P59 in the table ^FynIts numeral of genetic expression is peripheral blood lymphocyte P59 ^FynThe template multiple of gene pairs β-actin encoding gene, numeral increase the negative mileometer adjustment of expression and reach.

Among Fig. 2,3 curves are arranged, 1 is CD4+ lymphocytic infiltration curve, and the time that the infiltration peak value appears in the A point expression on the curve is 7 days; 2 is CD8+ lymphocytic infiltration curve, and the time that the infiltration peak value appears in the B point expression on the curve is 7 days; Be P59 ^FynGene quantification is expressed curve, and the time that positive mileometer adjustment peaking appears in the C point expression on the curve is postoperative 7 days.Article three, the variation tendency unanimity of curve.

As seen from Figure 2, with different time before and after the cardiac allograft rejection in rats art, myocardium CD4+, CD8+ lymphocytic infiltration change and peripheral blood lymphocyte P59 ^FynChanges in gene expression relatively be example: in post-transplantation in the time of the 7th day, transplant that CD4+, CD8+ lymphocytic infiltration reach the postoperative peak value, peripheral blood lymphocyte P59 in the cardiac muscle ^FynAlso in rise in the time of the 7th day first peak value after reaching transplanting of postoperative, the result shows peripheral blood lymphocyte P59 to the gene relative expression quantity ^FynGene quantification express at least with transplant cardiac muscle in CD4+, CD8+ lymphocytic infiltration to reach time of postoperative peak value consistent.

Can see specificity of the present invention and susceptibility from Fig. 3, Fig. 4.1 expression template concentrations is 3.288ug/ml among Fig. 3, and 2 expression template concentrations are 3.288 * 10 ^-1Ug/ml, 3 expression template concentrations are 3.288 * 10 ^-2Ug/ml, 4 expression template concentrations are 3.288 * 10 ^-3Ug/ml, 5 expression template concentrations are 3.288 * 10 ^-4Ug/ml is in Fig. 3, when template concentrations is diluted to 3.288 * 10 ^-4Also can obtain good Ct value and amplification curve during ug/ml.Among Fig. 4, agarose electrophoresis result is that this primer has single amplified band, wherein five samples of 1,2,3,4,5 expressions.

The sensitivity of advantage of the present invention: Ben Jiyin, probe and primer and specificity are good, real-time relative quantitative assay, and the accuracy height, simple to operate, required sample size is little, does not have wound, adopts real-time relative quantitative assay method to detect peripheral blood P59 ^FynGene expression dose posttransplantation first peak value with transplant cardiac muscle in CD4+, CD8+ lymphocytic infiltration number to reach time of postoperative peak value consistent.

Annex one

   1 atgacagcca aggagatgaa ggcgaccgag agtgcggcgc agccggtgcc gctgcccaag

  61 aaggaagtgg atgtcagccc caaacaggat gaaggagtgc tgaaagtcat caagacagag

 121 ggcacaggta cagagatgcc catgactggg gacctagtct ttgtccacta cactggctgg

 181 ctgttagagg gcacaaagtt tgactccagt gtggatcgca aggacaaatt ctcctttgac

 241 ctgggaaaag gggaggtcat caaggcttgg gacattgccg tagcaaccat gaagttcagc

 301 agacagtcct ccaacgatct ccccataacg ccacgcttgt gtttgaaaga tgggggaatc

 361 atccgcagaa tagggact cg cggtgaaggc tatgtcaagc ccgatgaggg cgctatggtg

                               378U

 421 gag gttgcgc tggaagggtg ctgcaaggac cagctctttg accaacgggc gctccgcttt

423-FT

481 gaggt tagtg agggggagaa cctggatctg ccttatgatc tcgagagggc cattcagcac

485L

541 ttggagaaag gagaacattc cactgtgtac ctcaagccca gctatgcttt tggcagtgtt

601 gggaaggaaa agttccaaat cccaccaaat gccgagctga aatatgaatt atatctcaag

661 agttttgaaa aggccaagga atcttgggag atgatttcag aagagaagct ggaacagaac

721 accgtagtga aagagcaggg cagtgtgtac ttcaaggaag gcaaatacaa gcaagcttta

781 ctacagtcac agaaggcaca ggcccctcca ctggcctctc acctcgacct ggccatgtgt

841 cagctgaaac tacaggcctt ctctgctgcc attgaaagct gtaacaaggc cctagaactg

901 gacagcaaca acgagaaggg ccccttccgc cggggagagg cccacctggc ggtgaatgac

961 tttgaactgg catgggctga cttccagaag gtcctgcagc tctaccccaa caacaaagcc

1021 gccagggccc agctggctgt gtgtcagcag cggatccaca ggcagcttgc ccggaagaag

1081 ttctatgcca aaatgtttga gaggctggct gaggaggaga acaaggccaa ggcagaggct

1141 tgctcaggag accatcccac tgacacagag atgaaggcgg agtggaagag caacacagca

1201 gggagccagt ctcaggtgga gacagaagca tag

Sequence table

＜110〉Beijing Institute of Cardiopulmonary Vascular Disease

＜120〉rat lymphocyte P59fyn gene quantification is expressed test primer, probe

<130>

<160>3

<170>PatentIn version 3.1

<210>1<211>23<212>DNA

＜213〉synthetic

<400>1

tgcagcaccc ttccagcgca acc 23

<210>2

<211>18

<212>DNA

＜213〉synthetic

<400>2

tcgcggtgaa ggctatgt 18

<210>3

<211>21

<212>DNA

＜213〉synthetic

<400>3

ccaggttctc cccctcacta a 21

Claims (1)

1, a kind of rat lymphocyte P59 ^FynGene quantification is expressed test and is used primer, and it is characterized in that: in the described primer sequence, the sequence of upstream primer 378U is 5 ' TCGCGGTGAAGGCTATGT 3 ', and the sequence of downstream primer 485L is 5 ' CCAGGTTCTCCCCCTCACTAA 3 '.

Images