CA2884082A1 - Method for selectively inhibiting the activity of acat1 in the treatment of alzheimer's disease - Google Patents

Abstract

The present invention features methods for decreasing the size and density of amyloid plaques, decreasing cognitive decline associated with amyloid pathology, and treating Alzheimer's disease by selectively inhibiting the activity of Acyl-CoA: Cholesterol Acyltransferase 1, but not Acyl-CoA: Cholesterol Acyltransferase 2.

Description

DC0412W0.2 -1-PATENT

THE TREATMENT OF ALZHEIMER'S DISEASE
Introduction [0001] This invention was made with government support under grant number R01HL060306 awarded by the National Institutes of Health. The government has certain rights in the invention.
Background of the Invention [0002] Alzheimer's disease is characterized by two pathological hallmarks, namely extracellular accumulation of plaques, which are aggregates of amyloid beta (Ap) peptides derived from proteolytic cleavages of amyloid precursor protein (APP), and intracellular accumulation of hyperphosphorylated tau (Hardy & Selkoe (2002) Science 297:353-356). APP can be cleaved via two competing pathways, the alpha and the beta secretase pathways, which are distinguished by different subcellular sites of proteolysis and cleavage points within APP (Thinakaran & Koo (2008) J.
Biol. Chem. 283:29615-29619). Several proteases are capable of producing the alpha-cleavage, after which the gamma-secretase complex that includes presenilin 1 as a catalytic subunit, further cleaves the APP fragment to produce small, non-amyloidogenic fragments. The beta-secretase pathway involves sequential cleavages by beta-secretase and gamma-secretase complexes, and generates A. APP and secretases are all membrane bound proteins/enzymes. Studies have shown that cholesterol content in cells can affect the production of Ap, in part by the ability of cholesterol to modulate the enzyme activities of various secretases in cell membranes (Wolozin (2004) Neuron 41:7-10). Cholesterol metabolism has also been implicated in the pathogenesis of Alzheimer's DC0412W0 .2 -2-PATENT
disease in other manners (Jiang, et al. (2008) Neuron 58:681-693; Wellington (2004) Clin. Genet. 66:1-16; Hartmann (2001) Trends Neurosci. 24:S45-48).

[0003] In the brain, cholesterol is derived from endogenous biosynthesis (Dietschy & Turley (2004) J. Lipid Res.
45:1375-1397). The transcription factor SREBP2 controls the expression of enzymes involved in cholesterol biosynthesis, including the rate-limiting enzyme HMG-CoA reductase (HMGR) (Goldstein, et al. (2006) Cell 124:35-46). Other transcription factors, including liver X receptors (LXRs), control the expression of proteins which function in cholesterol transport (Repa & Mangelsdorf (2000) Annu. Rev.
Cell Dev. Biol. 16:459-481; Beaven & Tontonoz (2006) Annu.
Rev. Med. 57:313-329), including apoE, ABCA1, and others (Wang, et al. (2008) FASEB J. 22:1073-1082; Tarr & Edwards (2008) J. Lipid Res. 49:169-182). In the brain, cholesterol can be enzymatically converted by a brain-specific enzyme, 24-hydroxylase (CYP46A1) (Russell, et al. (2009) Annu. Rev.
Biochem. 78:1017-1040), to an oxysterol called 245-hydoxycholesterol (24S0H); the concentration of 24S0H far exceeds those of other oxysterols in the brain (Lutjohann, et al. (1996) Proc. Natl. Acad. Sci. USA 93:9799-9804 Bjorkhem (2006) J. Intern. Med. 260:493-508; Karu, et al.
(2007) J. Lipid Res. 48:976-987). Various oxysterols, including 24S0H, can downregulate sterol synthesis in intact cells and in vitro (Song, et al. (2005) Cell Metab. 1:179-189; Wang, et al. (2008) J. Proteome Res. 7:1606-1614). When provided to neurons, 24SOH decreases the secretion of Ap (Brown, et al. (2004) J. Biol. Chem. 279:34674-34681).
However, whether 24S0H or other oxysterols can act in similar fashion(s) in vivo remains to be demonstrated. 24S0H
levels have been shown to be decreased in brain samples from Alzheimer's disease patients (Heverin, et al. (2004) J.

DC0412WO. 2 -3-PATENT
Lipid Res. 45:186-193), suggesting a relationship between 24S0H and Alzheimer's disease.

[0004] Acyl-CoA:Cholesterol Acyltransferase (ACAT) converts free cholesterol to cholesterol ester, and is one of the key enzymes in cellular cholesterol metabolism. Two ACAT genes have been identified which encode two different enzymes, ACAT1 and ACAT2 (also known as SOAT1 and SOAT2). While both ACAT1 and ACAT2 are present in the liver and intestine, the cells containing either enzyme within these tissues are distinct, suggesting that ACAT1 and ACAT2 have separate functions. Both enzymes are potential drug targets for treating dyslipidemia and atherosclerosis.

[0005] Using the non-selective ACAT inhibitor, CP-113,818 (Chang et al. (2000) J. Biol. Chem. 275:28083-28092), Alzheimer's disease-like pathology in the brains of transgenic mice expressing human APP(751) containing the London (V717I) and, Swedish (K670M/N671L) mutations has been demonstrated (Hutter-Paier, et al. (2004) Neuron. 44(2):227-38). Two months of treatment with CP-113,818 was shown to reduce the accumulation of amyloid plaques by 88%-99% and membrane/insoluble Amyloid p levels by 83%-96%, while also decreasing brain cholesteryl-esters by 86%. Additionally, soluble Ap(42) was reduced by 34% in brain homogenates.
Spatial learning was slightly improved and correlated with decreased Ap levels. In non-transgenic littermates, CP-113,818 also reduced ectodomain shedding of endogenous APP
in the brain.

[0006] A 50% decrease in ACAT1 expression has also been shown to reduce cholesteryl ester levels by 22%, reduce proteolytic processing of APP, and decrease Ap secretion by 40% (Huttunen, et al. (2007) FEBS Lett. 581(8):1688-92) in an in vitro neuronal cell line. In this regard, it has been suggested that ACAT inhibition could serve as a strategy to DC0412W0.2 -4-PATENT
treat Alzheimer's disease (Huttunen & Kovacs (2008) Neurodegener. Dis. 5(3-4):212-4).
Summary of the Invention [0007] The present invention features methods for decreasing the size and density of amyloid plaques, decreasing cognitive decline associated with amyloid pathology, and treating Alzheimer's Disease by administering to a subject in need of treatment an agent that selectively inhibits the expression or activity of Acyl-CoA:Cholesterol Acyltransferase 1 (ACAT1). In one embodiment, the agent has an ICH value for ACAT1 which is at no more than one half the corresponding IC50 value for ACAT2. In another embodiment, the agent does not inhibit the expression of ACAT2. In an alternative embodiment, the agent is a siRNA or microRNA
molecule. In a further embodiment, the agent has an IC50 value in the range of 1 nM to 100 pM. In a particular embodiment of the invention, the agent is selectively delivered to the brain of the subject. In a specific embodiment, the agent is administered via a liposome or nanoparticle.
Brief Description of the Drawings [0008] Figure 1 shows amyloid beta 42 (Ap1-42) levels in the hemibrains of wild-type (WT) Alzheimer's Disease (AD) mice or AD mice lacking Acatl (Acatri-) after injection of PBS, or injection with adeno-associated virus (AAV) vectors harboring a negative control miRNA or with siRNA targeting ACAT1 (ACAT1 KD). Mice were injected at 10 months of age and analyzed at 12 months of age. Group 1, WT mice (n=1); Group 2, mixed background AD mice injected with PBS (n=6); Group 3, mixed background AD mice injected with negative control AAV (n=8); Group 4, mixed background AD mice injected with DC0412W0.2 -5-PATENT
Acat1 KD AAV (n=13); Group 5, mixed background AD/Acatl-/-mice injected with phosphate-buffered saline (PBS) (n=9);
Group 6, mixed background AD/Acatl-/- mice injected with negative control AAV (AAV NC) (n=4); Group 7, mixed background AD/Acatl-/- mice injected with Acatl KD AAV (n=4).

[0009] Figure 2 depicts results of analysis of human full-length amyloid precursor protein (hAPP) levels and A31-42 in the hemibrains of WT mice, AD mice and AD/Acat-/- mice.
Results for ELISA assay levels of Ap1-42 are shown in panel 2A. Sample pools of mouse brain homogenates in sucrose buffer were subjected to formic acid extraction. The neutralized extracts were assayed for Ap1-42 by ELISA.
Formic acid extraction followed by ELISA was performed three separate times on different sample pools; each time the ELISA assay was run in duplicate or triplicate for each sample. Error bars represent standard error of the mean (SEM). * p<0.05, **p<0.005. In panel 2B, results for hAPP
quantification are presented. Quantification of six Western blots of total (mature + immature) hAPP in brain homogenate sample pools from 12-month old AD or AD/Acat-/- mice treated with either PBS, AAV-NC, or AAV-Acat1 that received brain injection at 10 months of age. Total hAPP band intensity was normalized to Ponceau S staining in the lane; data is shown relative to AD mice treated with PBS. Error bars represent the mean + SEM. *p<0.05. In the figure, the following abbreviations apply: WT=wild-type mice; AD= Alzheimer's disease mice; AD/Acat-/-= Alzheimer's disease mice with knocj=kout of Acat1 gene; AAV=adeno-associated virus;
ACAT=acyl-CoA:cholesterol acyltransferase; AD=Alzheimer's disease; hAPP=human amyloid precursor protein;
PBS=phosphate-buffered saline.

DC0412W0.2 -6-PATENT
Detailed Description of the Invention (00010]Amyloid beta-peptide (Abeta or Ap) accumulation in specific brain regions is a pathological hallmark of Alzheimer's disease (AD). It has now been found that ACAT1, but not ACAT2, plays a significant role in amyloid pathology of AD in vivo. Specifically, ACAT1 modulates the sizes and densities of amyloid plaques and cognitive decline manifested in a mouse model for the AD in vivo. Contrary to previous reports (Huttunen, et al. (2007) FEBS Lett.
581(8):1688-92), which were performed in an in vitro neuronal cell line, it has now been shown that partial ACAT1 deficiency leads to a significant reduction of Ap peptide 1-42 in an in vivo animal model for AD. Furthermore, in this AD mouse model, cognitive deficits become obvious at 6 months of age; Ap peptide 1-42 accumulation also becomes obvious at 10 months of age. When AAV expressing siRNA
targeting ACAT1 was delivered to the AD mice at 10 months of age, Ap 1-42 peptide reduction was demonstrated within 2 months of starting the siRNA treatment (at 12 months of age). This result demonstrates clearly that ACAT1 is a target for treating AD, either to treat disease progression or to prevent disease from occurring.

[00011] Accordingly, the present invention features compositions and methods for decreasing the size and density of amyloid plaques, decreasing cognitive decline associated with amyloid pathology, and treating AD. In accordance with the methods of this invention, a subject having, suspected of having or predisposed to have AD is administered an effective amount of an agent that selectively inhibits the activity of ACAT1 so that the size and density of amyloid plaques in the subject are decreased, cognitive decline associated with amyloid pathology is decreased, and/or the DC0412W0 .2 -7-PATENT
progression of the AD is slowed or prevented, thereby treating AD.

[00012]As used herein, a "selective inhibitor of ACAT1" or "ACAT1-selective inhibitor" is any molecular species that is an inhibitor of the ACAT1 enzyme but which fails to inhibit, or inhibits to a substantially lesser degree ACAT2. Methods for assessing the selectively of ACAT1 inhibitors are known in the art and can be based upon any conventional assay including, but not limited to the determination of the half maximal (50%) inhibitory concentration (IC) of a substance (i.e., 50% IC, or IC50), the binding affinity of the inhibitor (i.e., Ki), and/or the half maximal effective concentration (ECH) of the inhibitor for ACAT1 as compared to ACAT2. See, e.g., Lada, et al. (2004) J. Lipid Res.
45:378-386 and U.S. Patent No. 5,968,749. As one of skill in the art will understand, lower IC50 values for an ACAT
inhibitor indicates that the inhibitor is more potent or more active as an inhibitor of the activity of ACAT1 or ACAT2. Thus, a selective ACAT inhibitor is one wherein the IC50 value for inhibition of ACAT1 is lower than the IC50 value for inhibition of ACAT2. ACAT1 and ACAT2 proteins that can be employed in such assays are well-known in the art and set forth, e.g., in GENBANK Accession Nos. NP 000010 (human ACAT1) and NP 005882 (human ACAT2). See also U.S. Patent No.
5,834,283.

[00013] In a particular embodiment, a selective inhibitor of ACAT1 is an agent which has an IC50 value for ACAT1 that is at least twice or, more desirably, at least three, four, five, or six times lower than the corresponding IC50 value for ACAT2. Most desirably, a selective inhibitor of ACAT1 has an IC50 value for ACAT1 which is at least one order of magnitude or at least two orders of magnitude lower than the IC50 value for ACAT2.

DC0412W0 .2 -8-PATENT

[00014] Selective inhibitors of ACAT1 activity have been described. For example, Ikenoya, et al. ((2007) Atherosclerosis 191:290-297) teach that K-604 has an ICH
value of 0.45 pmol/L for human ACAT1 and 102.85 pmol/L for human ACAT2. As such K-604 is 229-fold more selective for ACAT1 than ACAT2. In addition, diethyl pyrocarbonate has been shown to inhibit ACAT1 with 4-fold greater activity (ICH = 44 pM) compared to ACAT-2 (ICH - 170 pM) (Cho, et al. (2003) Biochem. Biophys. Res. Comm. 309:864-872).
Ohshiro, et al. ((2007) J. Antibiotics 60:43-51) teach selective inhibition for ACAT1 over ACAT2 with beauveriolides I (0.6 pM vs. 20 pM) and III (0.9 pM vs. >20 pM). In addition, beauveriolide analogues 258, 280, 274, 285, and 301 exhibit ACAT1-selective inhibition with pICH
values in the range of 6 to 7 (Tomoda & Doi (2008) Accounts Chem. Res. 41:32-39). Lada, et al. ((2004) J. Lipid Res.
45:378-386) teach a compound (designated therein as Compound 1A), and derivatives thereof (designated Compounds 1B, 1C, and 1D), which inhibit ACAT1 more efficiently than ACAT2 with ICH values 66- to 187-fold lower for ACAT1 than for ACAT2. Moreover, Lee, et al. ((2004) Bioorg. Med. Chem.
Lett. 14:3109-3112) teach methanol extracts of Saururus chinensis root that contain saucerneol B and manassantin B
for inhibiting ACAT activity. Saucerneol B inhibited human ACAT-1 (hACAT1)and human ACAT-2 (hACAT2) with ICH values of 43.0 and 124.0 pM, respectively, whereas manassantin B
inhibited hACAT-1 with an ICH value of 82.0 pM, only exhibiting 32% inhibition of hACAT2 at a very high concentration of 1 mM.

[00015] Desirably, ACAT1-selective inhibitors of the present invention have an ICH value in the range of 1 nM to 100 pM.
More desirably, ACAT1-selective inhibitors of the invention have an ICH value less than or equal to 100 pM. Most DC0412W0 .2 -9-PATENT
desirably, ACAT1-selective inhibitors of the invention have an IC50 value in the nM range (e.g., 1 to 999 nM).

[00016] In addition to the above-referenced ACAT1-selective inhibitors, it is contemplated that any conventional drug screening assay can be employed for identifying or selecting additional or more selective ACAT1 inhibitors or derivatives or analogs of known ACAT1 inhibitors. See, e.g., Lada, et al. (2004) J. Lipid Res. 45:378-386. Such agents can be identified and obtained from libraries of compounds containing pure agents or collections of agent mixtures.
Examples of pure agents include, but are not limited to, proteins, peptides, nucleic acids, oligonucleotides, carbohydrates, lipids, synthetic or semi-synthetic chemicals, and purified natural products. Examples of agent mixtures include, but are not limited to, extracts of prokaryotic or eukaryotic cells and tissues, as well as fermentation broths and cell or tissue culture supernates.
In the case of agent mixtures, one may not only identify those crude mixtures that possess the desired activity, but also monitor purification of the active component from the mixture for characterization and development as a therapeutic drug. In particular, the mixture so identified may be sequentially fractionated by methods commonly known to those skilled in the art which may include, but are not limited to, precipitation, centrifugation, filtration, ultrafiltration, selective digestion, extraction, chromatography, electrophoresis or complex formation. Each resulting subfraction may be assayed for the desired activity using the original assay until a pure, biologically active agent is obtained.

[00017] Library screening can be performed in any format that allows rapid preparation and processing of multiple reactions such as in, for example, multi-well plates of the DC0412W0.2 -10-PATENT
96-well variety. Stock solutions of the agents as well as assay components are prepared manually and all subsequent pipetting, diluting, mixing, washing, incubating, sample readout and data collecting is done using commercially available robotic pipetting equipment, automated work stations, and analytical instruments for detecting the signal generated by the assay. Examples of such detectors include, but are not limited to, luminometers, spectrophotomers, calorimeters, and fluorimeters, and devices that measure the decay of radioisotopes. It is contemplated that any suitable ACAT enzymatic assay can be used in such screening assays. Moreover, preclinical efficacy of ACAT1 inhibitors can be assessed using conventional animal models of AD. Examples of conventional animal models of AD include but are not limited to models discussed in the scientific literature and cited herein.
Many of these models are models where mice have been genetically altered to either express certain genes or to ablate expression of certain genes (transgenic mice). Such transgenic mouse models have been well-accepted for use in screening drugs for potential therapeutic activity in humans and are commonly used in drug development.

[00018]As disclosed herein, there are a number of suitable molecules that selectively inhibit the activity of ACAT1 without modulating the expression of ACAT1. Accordingly, in one embodiment of the present invention, a "selective inhibitor of ACAT1" specifically excludes molecules such as antisense molecules or ribozymes. However, in alternative embodiments, the ACAT1 selective inhibitor is a molecule which selectively inhibits the expression of ACAT1, without modulating the expression of ACAT2. While some RNAi molecules have been shown to induce significant neurotoxicity in brain tissue (McBride, et al. (2008) Proc.

DC0412W0 .2 -11-PATENT
Natl. Acad. Sci. USA 105:5868-5873), specific embodiments of this invention embrace one or more siRNA and/or microRNA
molecules as the ACAT1-selective inhibitor. As is conventional in the art, miRNA or microRNA refer to 19-25 nucleotide non-coding RNAs derived from endogenous genes that act as post-transcriptional regulators of gene expression. They are processed from longer (ca 70-80 nucleotide) hairpin-like precursors termed pre-miRNAs by the RNAse III enzyme Dicer. MicroRNAs assemble in ribonucleoprotein complexes termed miRNPs and recognize their target sites by antisense complementarity thereby mediating down-regulation of their target genes. By way of illustration, target sequences for mouse ACAT1 microRNA
molecules include, but are not limited to, those listed in Table 2 as SEQ ID NOs:37-40. Artificial microRNAs against human ACAT1 gene (e.g., GENBANK Accession No. NM 000019, incorporated by reference) were also generated and shown to decrease human ACAT1 protein expression by 80% in human cells. Exemplary microRNA sequences targeting human ACAT1 include, but are not limited, those listed in Table 4. In a similar manner, microRNA against the ACAT1 gene in primates (e.g., GENBANK Accession No. XM_508738, incorporated by reference) can be developed, and used to selectively inhibit the expression of primate ACAT1.

[00019] SiRNA and/or microRNA molecules, which selectively inhibit the expression of ACAT1, can be administered as naked molecules or via vectors (e.g., a plasmid or viral vector such as an adenoviral, lentiviral, retroviral, adeno-associated viral vector or the like) harboring nucleic acids encoding the siRNA and/or microRNA. Desirably, a vector used in accordance with the invention provides all the necessary control sequences to facilitate expression of the siRNA
and/or microRNA. Such expression control sequences can DC0412W0.2 -12- PATENT
include but are not limited to promoter sequences, enhancer sequences, etc. Such expression control sequences, vectors and the like are well-known and routinely employed by those skilled in the art. In particular embodiments, the siRNA
and/or microRNA molecule is delivered by a non-viral delivery method, e.g., liposome, nanoparticle, or liposome-siRNA-peptide complex (Pulford et al. 2010. PloS One 5:e11085).

[00020] The siRNA molecules of this invention may be modified by methods known in the art to increase stability, increase resistance to nuclease degradation or the like. These modifications are known in the art and include, but are not limited to modifying the backbone of the oligonucleotide, modifying the sugar moieties, or modifying the base. In one embodiment, the invention features a siRNA molecule, wherein the siRNA molecule includes a sense region and an antisense region and wherein the antisense region has a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the ACAT1 gene and the sense region has a nucleotide sequence that is complementary to the antisense region. In certain embodiments, the siRNA
is composed of two nucleic acid molecules, e.g., a sense and antisense strand. In other embodiments, the siRNA is composed of one nucleic acid molecules, wherein the sense and antisense strand are connected by a linker. In one embodiment, the purine nucleotides present in the antisense region include 2'-deoxy-purine nucleotides. In another embodiment, the purine nucleotides present in the antisense region include 2'-0-methyl purine nucleotides. In either of the above embodiments, the antisense region can include a phosphorothioate internucleotide linkage at the 3' end of the antisense region. In an alternative embodiment, the antisense region includes a glyceryl modification at the 3' DC0412W0.2 -13-PATENT
end of the antisense region. In another embodiment of any of the above described siRNA molecules, any nucleotides present in a non-complementary region of the antisense strand (e.g.
overhang region) are 2'-deoxy nucleotides. See, e.g., US
8,232,383; WO 00/44914; or WO 01/68836.

[00021] As indicated, selective inhibitors of ACAT1 find application in methods for decreasing the size and density of amyloid plaques, decreasing cognitive decline associated with amyloid pathology, and treating AD. Generally, such methods involve administering to a subject in need of treatment a selective inhibitor of ACAT1 in an amount that effectively reduces the activity of ACAT1 by at least 60% to as much as 100%, including levels of inhibition between 60%
and 100%. Subjects benefiting from treatment with an agent of the invention include subjects confirmed as having AD, subjects suspected of having AD, or subjects predisposed to have AD (e.g., subjects with a family history of Down's syndrome or ones with a genetic predisposition to Alzheimer's disease). In the context of this invention, a subject can be any mammal including human, companion animals (e.g., dogs or cats), livestock (e.g., cows, sheep, pigs, or horses), or zoological animals (e.g., monkeys). In particular embodiments, the subject is a human.

[00022] While certain embodiments of this invention embrace in vivo applications, in vitro use of agents of the invention are also contemplated for examining the effects of ACAT1 inhibition on particular cells, tissues or regions of the brain. In addition to treatment, agents of the invention also find application in monitoring the phenotypic consequences (e.g., rate of plaque formation or rate of cognitive decline) of amyloid pathology in animal models of AD.

DC0412W0.2 -14-PATENT

[00023] When used in therapeutic applications, an ACAT1-selective inhibitor of the invention will have the therapeutic benefit of decreasing the size and density of amyloid plaques in the subject, decreasing or slowing the cognitive decline associated with amyloid pathology in the subject, and/or treating AD in the subject as compared to subjects not receiving treatment with the ACAT1-selective inhibitor. An ACAT1-selective inhibitor of the invention is expected to decrease the size and density of amyloid plaques in a subject by any amount from 10% to 60% or more as compared to an untreated subject. Similarly, an ACAT1-selective inhibitor of the invention is expected to decrease or slow the cognitive decline associated by amyloid pathology by from any amount from 10% to 60% or more as compared to an untreated subject (e.g., as determined by commonly applied tests that would include but be limited to the Blessed Information-Memory-Concentration Test, the Blessed Orientation-Memory-Concentration Test, and the Short Test of Mental Status, Or the Mini-Mental State Examination). Cognitive assessment can include monitoring of learning and retaining new information (e.g., does the subject have trouble remembering recent conversations, events, appointments; or frequently misplace objects), monitoring handling of complex tasks (e.g., can the subject follow a complex train of thought, perform tasks that require many steps such as balancing a checkbook or cooking a meal), monitoring reasoning ability (e.g., is the subject able to respond with a reasonable plan to problems at work or home, such as knowing what to do if the bathroom flooded), monitoring subject's spatial ability and orientation (e.g., can the subject drive, organize objects around the house, or find his or her way around familiar places), and/or monitoring language (e.g., does the subject DC0412W0 .2 -15-PATENT
have difficulty finding words to express what he or she wants to say and with following conversations). Based upon a decrease in the observed and or measured signs and symptoms of AD, it is expected that AD will be prevented or slowed in a subject receiving treatment with an agent of the present invention, thereby treating the AD.

[00024] Successful clinical use of an ACAT1-selective inhibitor can be determined by the skilled practitioner, such as a clinician or veterinarian, based upon routine clinical practice, e.g., by monitoring cognitive decline via methods disclose herein, monitoring or measuring levels of functional activities (e.g., the Functional Activities Questionnaire), and monitoring or measuring levels of sensory impairment and physical disability according to methods known in the art.

[00025] For therapeutic use, ACAT1-selective inhibitors can be formulated with a pharmaceutically acceptable carrier at an appropriate dose. Such pharmaceutical compositions can be prepared by methods and contain carriers which are well-known in the art. A generally recognized compendium of such methods and ingredients is Remington: The Science and Practice of Pharmacy, Alfonso R. Gennaro, editor, 20th ed.
Lippincott Williams & Wilkins: Philadelphia, PA, 2000. A
pharmaceutically acceptable carrier, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, is involved in carrying or transporting the agent in the subject from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and must not be significantly injurious to the patient, although some level of toxicity can be expected as well. One of skill in the art would understand how to ensure that any agent DC0412W0.2 -16-PATENT
used in a subject is one wherein the benefits to the subject outweigh the risks to the subject. Given the serious nature of AD, agents with some level of toxicity or risk to subject health could be tolerated and developed as a useful therapeutic agent to treat AD.

[00026] Examples of materials which can serve as pharmaceutically acceptable carriers include sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc;
excipients, such as cocoa butter and suppository waxes;
oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid;
pyrogen-free water; isotonic saline; Ringer's solution;
ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

[00027] Compositions of the present invention can be administered parenterally (for example, by intravenous, intraperitoneal, subcutaneous or intramuscular injection), topically, orally, intranasally, intravaginally, or rectally according to standard medical practices.

DC0412W0.2 -17-PATENT

[00028] In certain embodiments of the present invention, the ACAT1-selective inhibitor is selectively delivered to the brain. For the purposes of the present invention, "selective delivery to the brain" or "selectively delivered to the brain" is intended to mean that the agent is administered directly to the brain of the subject (e.g., by a shunt or catheter; see, e.g., U.S. Patent Application No.
20080051691), to the perispinal space of the subject without direct intrathecal injection (see, e.g., U.S. Patent No.
7,214,658), or in a form which facilitates delivery across the blood brain barrier thereby reducing potential side effects associated with ACAT1 inhibition in other organs or tissues. In this regard, formulation of the agent into a nanoparticle made by polymerization of a monomer (e.g., a methylmethacrylate, polylactic acid, polylactic acid-polyglycolic acid-copolymer, or polyglutaraldehyde) in the presence of a stabilizer allows passage of the blood brain barrier without affecting other organs with the agent. See, e.g., U.S. Patent No. 7,402,573, incorporated herein by reference in its entirety. Moreover, an exemplary system for selectively delivering microRNAs to the brain is the Adeno-Associated Virus (AAV) vector system. See, e.g., Cearley &
Wolfe (2007) J. Neurosc. 27(37):9928-9940.

[00029] The selected dosage level of an ACAT1-selective inhibitor will depend upon a variety of factors including the activity of the particular agent of the present invention employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular agent being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular agent employed, the age, sex, weight, condition, general health and prior medical DC0412W0.2" -18-PATENT
history of the patient being treated, and other factors well-known in the medical arts.

[00030] A practitioner, such as a physician or veterinarian, having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required based upon the administration of similar compounds or after routine experimental determination. For example, the physician or veterinarian could start doses of an agent at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. This is considered to be within the skill of the artisan and one can review the existing literature on a specific agent or similar agents to determine optimal dosing.

[00031] The invention is described in greater detail by the following non-limiting examples.
Example 1: Methods [00032] Mice. Mice were fed ad libitum with standard chow diet, maintained in a pathogen-free environment in single-ventilated cages and kept on a 12 hour light/dark schedule.

[00033] Generation of Acatl-/-Alz (A1-/Alz) and Acat2-/-/Alz (A2-/Alz) Mice. Acatl-/- and Acat2-/- mice (Meiner, et al. (1996) Proc. Natl. Acad. Sci. USA 93:14041-14; Buhman, et al. (2000) Nat. Med. 6:1341-1347) in C575L/6 background are known in the art. The 3XTg-Alz mice (Alzheimer's disease mice) in hybrid 129/C57BL/6 background contain two mutant human transgenes, hAPP harboring Swedish mutation (hAPPswe), and mutant htau (htaup3oiL) under a neuron-specific promoter, and contain the knock-in mutant presenilin 1 (PS1/4146v) (Oddo, et al. (2003) Neuron 39:409-421).

DC0412W0.2 -19-PATENT

[00034] Mouse Tissue Isolation. Animals were sacrificed by CO2 asphyxiation. The brains, adrenals and livers were rapidly isolated. Mice brains were dissected into various regions on ice within 5 minutes and were either used fresh (for ACAT enzyme activity assay) or were rapidly frozen on dry ice for other usage.

[00035] ACAT Activity Assay, Immunoprecipitation CM and Immunoblot Analyses. Freshly isolated tissue samples were homogenized on ice in 50 mM Tris, 1 mM EDTA, pH 7.8 and solubilized in detergent using 2.5% CHAPS and 1 M KC1. The homogenates were centrifuged at 100,000g for 45 minutes. The supernatants were used for ACAT activity assay in mixed micelles, and for IP and immunoblot analyses (Chang, et al.
(1998) J. Biol. Chem. 273:35132-35141; Chang, et al. (2000) J. Biol. Chem. 275:28083-28092).

[00036] RNA Isolation, RT-PCR, and Real-Time PCR. Total RNA
was isolated with TRIZOL reagent (Invitrogen), stored at -80 C, and used for RT-PCR experiments, using the protocol supplied by the manufacturer. Real-time PCR was performed using the DYNAMO HS SYBR Green qPCR kit (New England Biolabs). Relative quantification was determined by using the delta CT method (Pfaffl, et al. (2002) Nucleic Acids Res. 30:e36). Mouse ACAT1 and human APP primers were designed using Oligo 4.0 Primer Analysis Software. Mouse ACAT2, neurofilament 120-kD (NF120), GAPDH primers sequences are known in the art (Sakashita, et al. (2003) Lab. Invest.
83:1569-1581; Kuwahara, et al. (2000) Biochem. Biophys. Res.
Commun. 268:763-766; Pan, et al. (2007) Bmr Mbl. Biol.
8:22). Sequences of primers used herein are listed in Table 1.

DC0412W0 . 2 -20- PATENT

Amplicon SEQ ID
Gene Sense/Antisense (5'->3') Size NO:

[00037] The PCR reaction conditions for amplification of ACAT1, ACAT2, GAPDH, NF120 and Human APP included an initial denaturation at 94 C for 5 minutes. Subsequently, 40 cycles of amplification were performed which included: denaturation DC0412W0.2 -21-PATENT
at 94 C for 10 seconds, annealing at 56 C for 20 seconds, and elongation at 72 C for 29 seconds. Amplification conditions for the remaining primers listed in Table 1 were as previously described (Van Eck, et al. (2003) J. Biol.
Chem. 278:23699-23705).
[00038] In Situ Hybridization, Immunohistochemical and Thioflavin S Staining. In situ hybridization was performed using standard procedures (Poirier, et al. (2008) J. Biol.
Chem. 283:2363-2372) Immunohistochemistry was performed according to standard methods (Oddo, et al. (2003) supra).
Thioflavin S staining was according to the protocol as described (Guntern, et al. (1992) Experientia 48:8-10), using free-floating sections. Confocal analysis of thioflavin S-positive amyloid deposits was performed using known methods (Dickson & Vickers (2001) Neuroscience 105:99-107).

[00039] Preparation of Brain Homogenates and Immunoblot Analysis of APP and Its Fragments, and Human Tau. Brain homogenates were prepared in sucrose buffer with protease inhibitors at 4 C according to a published protocol (Schmidt, et al. (2005) Methods Mbl. Biol. 299:267-278).
Aliquots of homogenates were quickly frozen on dry ice and stored at -80 C. Upon usage, frozen homogenates were thawed on ice and centrifuged for 1 hour at 100,000g at 4 C; the supernatants contained soluble proteins including sAPPa and sAPPp, while the pellet contained membrane-associated, insoluble proteins including full-length APP, CTFa, CTFp, etc. Immunoblot analysis of APP and its fragments was according to (Cheng, et al. (2007) J. Biol. Chem. 282:23818-23828). The following antibodies were used: anti-human-Ap 6E10 (1:5000) (Covance), anti-human-APP 369 antiserum (1:1000), anti-human-tau HT7 (1:1000) (Pierce), anti-human-tau phosphorylated at Ser202 AT8 (1:1000) (Peirce), DC0412W0 .2 -22-PATENT
monoclonal anti-HMG-CoA reductase IgG-A9 (1:3) (obtained from ATCC), and 13-actin (1:5000) (Sigma). Densitometric analysis was performed using NIH Image software.

[00040] Ap Analysis by ELISA. Samples were prepared according to a standard protocol (Schmidt, et al. (2005) Methods Mol.
Biol. 299:279-297), then loaded undiluted or diluted 5-10 fold onto the "human p amyloid (1-40)" or "human p Amyloid (1-42)" ELISA plate (Wako), and analyzed according to the protocol provided by the manufacturer (Wako).

[00041] Contextual Fear Conditioning. Contextual fear conditioning was performed according to a published protocol (Comery, et al. (2005) J. Neurosci. 25:8898-8902; Jacobsen, et al. (2006) Proc. Natl. Acad. Sci. USA 103:5161-5166). The auditory cue was from e2s (London, U.K.). GoldWave software program was used to edit the auditory cue; Winamp software was used to play the cue sound using the speakers. The digital sound level meter (RadioShack) was used to adjust the cue sound level to 87 dB. Each mouse's behavior was recorded using a computer webcam (QuickCam from Logitech) and ANY-maze recording software. The videos were analyzed for freezing behavior, using time sampling at 5 second intervals.

[00042] Sterol Composition Analysis in Mice Brains. Mice forebrains were homogenized and extracted using chloroform:methanol (2:1) (at 12 ml final vol. per mouse brain), dried down under nitrogen, and re-dissolved in methanol. Ten percent of the sample was placed in a 2 ml GC/MS autosampler vial, dried down, and trimethyl-silyl derivatized overnight at room temperature with 0.5 ml TRI-SIL TBT (Pierce). One microliter of derivatized sample (or 0.1 pl for cholesterol measurements) was injected into a Shimadzu QP 2010 GC-Mass instrument. GC/MS analysis of sterols was performed according to known methods (Ebner, et DC0412W0 .2 -23- PATENT
al. (2006) Endocrinology 147:179-190) with modifications, using selected ion monitoring (cholesterol: 24 329, 353, 368, 458; desmosterol: 441, lanosterol: 393; 24S-hydroxycholesterol: 413) and standard curves for quantification.

[00043] Sterol, Fatty Acid and Cholesterol Ester Synthesis in Mice Brains. Sterol and fatty acid synthesis in mice brains was measured according to known methods (Reid, et al. (2008) J. Neurosci. Methods 168:15-25). A similar method was developed to measure cholesterol esterification from 3H-cholesterol in vivo: mice were anesthetized with ketamine xylazine (0.1 m1/30 g body weight), and mounted onto a Kopf stereotaxic instrument. After sagittal skin incision, 3H
cholesterol at 10 pCi/mouse prepared in 3 pl of 5 mM methyl beta-cylodextrin in PBS was injected into the right lateral ventricle with a glass syringe (in 2 minutes). Mice were kept in cages for 3 hours, and then euthanized by CO2 gas.
The forebrains were removed; lipids were extracted and redissolved in methanol as described earlier. Ten percent of the redissolved sample was analyzed by TLC, using plates from Analtech, and solvent system hexanes: ethyl ether (anhydrous): acetic acid (60:40:1). The cholesterol and 3H
cholesterol ester (CE) bands were scraped off the TLC plate and counted. Percent cholesterol esterification was determined by dividing the CE count by the total 3H-cholesterol count.

[00044] Sterol Synthesis and Cholesterol Esterification in Primary Neuronal Cell Culture. Hippocampal neurons were isolated from Al+/Alz and Al-/Alz mice at postnatal day 5 according to standard protocols (Brewer (1997) J. Neurosci.
Methods 71:143-155; Price & Brewer (2001) In Protocols for Neural Cell Culture. Fedoroff & Richardson, editors. Totowa, NJ: Humana Press, Inc. 255-264). Cells were seeded in 6-well DC0412W0.2 -24-PATENT
dishes in triplicate at 300,000 cells/well, and grown in 3 ml/well Neurobasal A medium with lx B27, 0.5mM L-Gln and 5 ng/ml FGF for 14 days. Half of the medium was replaced with fresh media once every 7 days. Forty-eight hours after the second media replacement, 50 pCi of [3H] sodium acetate (100 mCi/mmol) in phosphate-buffered saline (PBS) was added per well for 3 hours. Lipids in cells and in media were extracted, saponified, and analyzed by using the same TLC
system described herein. To minimize sterol oxidation, samples were protected from light and heat during lipid extraction, and were analyzed without storage. To improve separation, after sample loading, the TLC plate was placed under vacuum for 30 minutes prior to chromatography. 3H-labeled sterol bands were identified based on iodine staining of unlabeled sterols added to samples prior to lipid extraction. Rf values: lanosterol, 0.5; cholesterol, 0.38; 2450H: 0.2. The bands were scraped off and counted.
For each labeled sterol, the counts present in cells and in media were added to calculate the synthesis rate for that sterol. Cholesterol esterification in intact cells was conducted according to established methods (Chang, et al.
(1986) Biochemistry 25:1693-1699); the 3H-oleate pulse time was 3 hours.

[00045] Statistical Analysis. Statistical comparisons were made by using a two-tailed, unpaired Student's-test. The difference between two sets of values was considered significant when the P value was less than 0.05. Symbols used: *p < 0.05; **p < 0.01; ***p < 0.001.
Example 2: ACAT Expression in Mouse Brains [00046] It has not been previously reported as to whether brain tissue has ACAT enzyme activity. Therefore, to examine this, brain homogenates were prepared from wild-type, Acatl-DC0412W0 .2 -25- PATENT
/- (Al-) and Acat2-/- (A2-) mice. This analysis indicated that brain tissue of wild-type and A2- mice contained comparable ACAT enzyme activity, while Al- brain tissue contained negligible activity. Various brain regions prepared from wild-type mice all contained ACAT activities, while regions examined in Al- mice brain contained no measurable activity. Mouse ACAT1 is a 46-kDa protein (Meiner, et al. (1997) J. Lipid Res. 38:1928-1933).
Immunoblot analysis showed that in homogenates prepared from mouse brain (but not from other mouse tissues), a non-ACAT1 protein band appeared in the 46-kDa region; the presence of this non-specific band precluded the use of immunoblotting or histochemical staining to identify ACAT1 in the mouse brain. To unambiguously identify ACAT1 protein, immunoprecipitation (IP) experiments were performed using detergent solubilized wild-type mouse brain extracts. The results of the IP experiment showed that ACAT activity could be efficiently immunodepleted by ACAT1-specific antibodies, but not by control antibodies. Immunoblot analysis of the immunoprecipates was then performed. The results showed that in homogenates from wild-type mouse brain regions, the ACAT1 antibodies specifically identified a 46-kDa-protein band;
control experiments showed that this band was absent in homogenates prepared from the adrenals and brains of Al-mice. This result indicated that ACAT1 is expressed in mouse brain tissue and is the major ACAT isoenzyme.

[00047] To determine the distribution pattern of ACAT1 mRNA
in mouse brain, in situ hybridization experiments were performed. Both hippocampus and cortex contained ACAT1 mRNA;
with hippocampus showing a stronger signal. Other ACAT1 positive regions included choroid plexus, medial habenular nucleus, amygdala, and rostral extension of the olfactory peduncle. Subsequently, hippocampus-rich regions and cortex-DC0412W0.2 -26-PATENT
rich regions were isolated from wild-type mice, and ACAT1 mRNA levels were compared by real-time PCR. The result validated the in situ hybridization experiment, and showed that ACAT1 mRNA was -2-fold higher in hippocampus than in cortex. A separate, RT-PCR experiment using ACAT2-specific primers showed that only the thalamus-rich region, but no other brain region, expressed low but detectable ACAT2 mRNA.
It has similarly been shown that monkey brain tissue exhibits nearly undetectable levels of ACAT2 mRNA (Anderson, et al. (1998) J. Biol. Chem. =273:26747-26754).
Example 3: ACAT1-Deficient Alzheimer's Mice (Al-tAlz Mice) [00048] While non-selective ACAT inhibition has suggested a role for ACAT activity in AD pathology, it had not been shown whether the effects of the ACAT inhibitor are due to activity to inhibit ACAT activity alone, or due to activity on other biological process(es) in mouse brain tissue, or due to a combination of both. Accordingly, a genetic approach was employed to definitively assess the role of each ACAT isoenyzme in the pathology of AD.

[00049] To carry out this analysis, a triple transgenic AD
mouse model (3XTg-Alz; Oddo, et al. (2003) supra), which has been shown to be an effective research tool for studying AD
(Morrissette, et al. (2009) J. Biol. Chem. 284:6033-6037) was crossed to an ACAT1 (Al-) or ACAT2 (A2-) knock-out mouse (Buhman, et al. (2000) Biochim. Biophys. Acta 1529:142-154) and amyloid pathology development was monitored in the mice with or without ACAT. The results showed that, at 4 months of age, when compared to the control mice, the intraneuronal amyloid-3 load in the hypocampal neurons was significantly decreased in the Al-/Alz mice, but not in the A2-/Alz mice.
At 17 months of age, when compared to the control mice, the sizes and densities of the amyloid plaques were DC0412W0.2 -27-PATENT
significantly decreased in the Al/Alz- mice. Behavioral analysis showed that ACAT1 deficiency rescued the cognitive decline manifested in the mouse model of AD. These results showed that ACAT1 gene inactivation caused a significant decrease in amyloid pathology in a mouse model for AD. Thus, ACAT1, but not ACAT2, is a therapeutic target for treating AD.
Example 4: Effect of Inactivating ACAT1 on Ap Deposition, hAPP Processing, and on hTau [00050] To investigate the effect of inactivating ACAT1 on amyloid and tau pathologies in the 3XTg-Alz mice, Al-/Alz mice were examined used the human specific anti-A13 antibody 6E10 to perform intraneuronal immunostaining in the CA1 region of hippocampal brain tissue of 4-month-old mice.
Results showed that the staining was significantly diminished (by -78%) in the Al-/Alz mice. An enzyme-linked immunosorbent assay (ELISA) was next used to measure the total Ap40 and A342 levels in mouse brain homogenates at 17 months of age. Results showed that the Ap42 levels were significantly decreased (by -78 %) in Al-/Alz mice; the A1340 levels were also decreased, but the difference observed was not statistically significant. Control experiments showed that the brains of nontransgenic mice did not contain measurable A. Thioflavin S was subsequently used to stain amyloid plaques in Alz mouse brains at 17 months of age. The results showed that in Al-/Alz mice the amyloid plaque load in the hippocampal region of brain tissue was significantly reduced (by -77%); in the cortex region, the amyloid plaque load in these mice showed a trend toward decreasing (p=0.17).

[00051] The effect of Al- on human APP processing in 4-month-old Alz mice was also analyzed. The human-specific anti-A3 DC0412W0.2 -28- PATENT
antibody 6E10 was used to detect full-length human APPswe (hAPP), and its proteolytic fragments sAPPot (hsAPP(x) (soluble APP fragment produced by a secretase cleavage) and CTET (hCTFp) (C-terminal APP fragment produced by p secretase cleavage) (Thinakaran & Koo (2008) supra). The results showed that in Al-/Alz mice, hsAPPcx and hCTFp levels were decreased (by -67% and by -37%, respectively).
Unexpectedly, the hAPP level was also significantly reduced (by -62%). In contrast to the hAPP protein levels, there was no difference in hAPP mRNA levels between the Al+/Alz mice and the Al-/Alz mice. hAPP is synthesized in the endoplasmic reticulum in its immature form (with a molecular weight of -105-kDa); the immature form moves from the endoplasmic reticulum to the Golgi via a secretory pathway (Cal, et al.
(2003) J. Biol. Chem. 278:3446-3454), and becomes highly glycosylated (mature form has a molecular weight of -115-kDa) (Weidemann, et al. (1989) Cell 57:115-126; Oltersdorf, et al. (1990) J. Biol. Chem. 265:4492-4497; Thinakaran, et al. (1996) J. Biol. Chem. 271:9390-9397). Thus, the effects of Al- on the immature and the mature forms of hAPP in young Alz mice (of 25-day old) were examined. The results showed that Al- decreased both forms to approximately the same extent (by -52-54%), indicating that the effect(s) of A/-occur before newly synthesized hAPP exits the endoplasmic reticulum.

[00052] The Alz mice express both hAPP and endogenous (mouse) APP. It is possible that Al- may affect both the hAPP and the mAPP levels. To investigate the total APP levels in Alz mice, a different antibody (antiserum 369) was used, which recognizes the C-terminal fragments of both hAPP and mAPP
(Buxbaum, et al. (1990) Proc. Natl. Acad. Sci. USA 87:6003-6006). The results showed that there was no detectable difference in the total APP levels between the non-Tg, the DC0412W0.2 -29-PATENT
Al+/Alz, and the Al-/Alz mice, indicating that in the Alz mice strain, the hAPP is not over-expressed, when compared to the endogenous mAPP protein level. mAPP processing was also examined in mice that did not contain the hAPP gene. In these mice, Al- also did not affect the levels of mAPP (and its homolog APLP2 (Slunt, et al. (1994) J. Biol. Chem.
269:2637-2644)), or any of the proteolytic fragments derived from mAPP. These results led to the conclusion that Al- only reduced the hAPP level, and not the mAPP level. It is known that subtle sequence differences exist between hAPP and mAPP, and these differences may play an important role in causing differential fates of hAPP and mAPP (Du, et al.
(2007) J. Pharmacol. Exp. Ther. 320:1144-1152; Muhammad, et al. (2008) Proc. Natl. Acad. Sci. USA 105:7327-7332). The results herein are in contrast to previous reports that indicated that an ACAT inhibitor affected the proteolytic processing of mouse APP, in addition to affecting the processing of hAPP (Hutter-Paier et al. (2004) supra). The discrepancy between the results herein and those of Hutter-Paier, et al. may be attributable to off-target or side effect(s) of the ACAT inhibitor used in their study.

[00053] Tau pathology is one of the hallmarks of AD.
Accordingly, the effect of Al- on mutant human tau (htau) was analyzed in 3XTg-Alz mice. The results showed that at 4 months of age, Al- mice exhibited a significant decrease in htau (by -57%), but at 17 months of age, Al- mice had an increased level of hyperphosphorylated htau. No significant change was observed in the number of hippocampal neurofibrillary tangles between the Al+/Alz and the Al-/Alz mice. These results indicated that Al- does not attenuate tau pathology in Alz mice.

DC0412W0.2 -30-PATENT
Example 5: Effect of Inactivating ACAT1 on Cognitive Deficits of Alz Mice [00054] To examine effects of agents on cognitive deficits in Alz mice, contextual (hippocampus dependent) and cued (amygdala dependent) memory tests were performed on age-matched (2, 9 and 12 months old) Al+/Alz, Al-/Alz and Non-Tg mice. The results showed that mice of all three genotypes at different ages were able to learn equally well. In contextual memory testing, there was no difference among these mice at 2 months of age. However, at 9 and 12 months, when compared to Non-Tg mice, the Al+/Alz mice exhibited a -50% deficit, while the Al-/Alz mice exhibited no deficit.
In cued memory tests, there was again no difference among the mice at 2 months. Yet, at 9 months, when compared to Non-Tg mice, the Al+/Alz mice exhibited a trend toward a decline; however, the difference was not statistically significant. At 12 months, a statistically significant memory decline in the Al+/Alz mice was observed. In contrast, the Al-/Alz mice exhibited no deficit at either 9 or 12 months age. These results indicate that A/-ameliorated the hippocampal- and amygdala-dependent cognitive deficits in Alz mice at 9-12 months of age. As a control, contextual and cued tests were also performed on A2+ and Al- mice in the C57BL/6 background at 9 and 12 months of age. The results showed that the Al+ and the Al-mice were able to learn equally well in either contextual or cued memory tests, wherein the difference between the Al-mice and the Al+ mice was not statistically significant.
Example 6: Effects of Inactivating ACAT1 on Sterol Metabolism in Alz Mouse Brains [00055]ACAT is an important enzyme in cellular cholesterol homeostasis. It was contemplated that Al- may decrease hAPP

DC0412110.2 -31-PATENT
content by affecting sterol metabolism in Alz mice brains.
To demonstrate this, sterol fractions from Al+/Alz and A/-/Alz mouse brains were isolated and analyzed by GC/MS. The results showed that at 4 months of age, ACAT1 deficiency caused a -13% decrease in cholesterol content (p=0.04) and a -32% increase in 24S0H content (p=0.007), without causing significant changes in either lanosterol or desmosterol content. A similar decrease in cholesterol content of the Al-/Alz mouse brain was observed when a colorimetric enzyme assay kit (Wako) as used to determine free cholesterol. It was also found that in the brains of 2-month-old Alz mice, Al deficiency caused a -10% decrease in cholesterol content and a -23% increase in 24S0H content. Subsequently, the relative sterol synthesis and fatty acid synthesis rates were compared in the brains of these mice in vivo. The results showed that Al- caused a -28% decrease in the sterol synthesis rate (p=0.04) without significantly changing the fatty acid synthesis rate. In mouse brain, cholesteryl ester contents are reported to be very low (Yusuf & Mozaffar (1979) J. Neurochem. 32:273-275; Liu, et al. (2009) Proc.
Natl. Acad. Sci. USA 106:2377-2382). An attempt was made to measure CE in Al+ mouse brain tissue by separating the CE
fraction from the free cholesterol fraction using column chromatography and determining the cholesterol content in CE
by GC/MS after CE was saponified. While the low level of CE
prevented a reliable measurement, the results suggested that CE might be present at no more than 1% of the total cholesterol mass in mouse brain tissue. Using a similar procedure to determine the 24S0H ester content, it was estimated that no more than 1% of total 24S0H was esterified in the brain. These results are consistent with the finding that ACAT prefers to use cholesterol, as opposed to various oxysterols, as its enzymatic substrate (Zhang, et al. (2003) DC0412W0.2 -32-PATENT
J. Biol. Chem. 278:11642-11647; Liu, et al. (2005) Biochem.
J. 391:389-397).

[00056] To demonstrate the functionality of ACAT1 in the intact mouse brain, a procedure was developed to measure CE
synthesis in vivo by injecting 3H-labeled cholesterol (as a cyclodextrin complex) into intact mouse brain. The 3H-CE
produced in A/+ and Al- mice was monitored 3 hours after injection. The results of this experiment showed that in Al+/Alz mice, a small percentage of 3H-cholesterol was converted to 3H-CE (0.56% in 3 hours); in contrast, such conversion was not detectable in the Al-/Alz mouse brain.
This result demonstrated that ACAT1 in intact mouse brain can synthesize CE, although at a low rate.

[00057] The data herein indicated that in Alz mouse brain, Al- leads to an increased 24S0H level, which in turn leads to a down-regulation of the sterol synthesis rate. Studies in cell culture have suggested that 24S0H may down-regulate sterol synthesis by two mechanisms, namely by blocking transcriptional activations of SREBP2 target genes, and/or increasing the degradation rate of HMGR protein (Goldstein, et al. (2006) Cell 124:35-46). To test the first possibility, the mRNA levels of various SREBP2 and LXR
target genes (i.e., HMGR, HMGS, SQS, LRP, LDLR, SREBP2, SREBP1, APOE, ABCA1, ABCG1, ABCG4, and CYP46A1) were compared in the Al+/Alz and the Al-/Alz mouse brain. This analysis indicated no significant alterations in the expression levels of these genes in the brains of mice with or without ACAT1. To test the second possibility, immunoblot analysis was performed on brain homogenates prepared from the Alz mice with or without ACAT1. The results showed that HMGR protein content was decreased by -65% in Al-/Alz mouse brain (p=0.0009), while the HMGR mRNA in Al- mouse brain was not changed. Additional results showed that in Alz mice at DC0412W0 .2 -33-PATENT
25-days of age, Al- caused a -62% decrease in HMGR protein content, demonstrating that the effect of Al- on HMGR
content occurs in mice at a young age.
Example 7: Biosynthesis of 24S0H in Hippocampal Neuronal Cell Cultures [00058] The results described herein show that Al-/Alz mouse brain exhibits elevated 24S0H levels, indicating that in mouse neurons, Al- may cause an increase in the biosynthesis of 24S0H. In so far as cultured neurons isolated from brains have been shown to synthesize and secrete 24S0H (Russell, et al. (2009) supra; Kim, et al. (2007) J. Biol. Chem.
282:2851-2861), a hippocampal neuronal cell culture system was established from Al+/Alz and Al-/Alz mice to determine whether these cells exhibit an increase in the biosynthesis of 24S0H. CE biosynthesis was monitored in these neurons by incubation with labeled 3H-oleic acid. Upon entering cells, 3H-oleic acid is rapidly converted to 3H-CE by ACAT. Both the Al+ cells and the Al- cells synthesize CE; however, A/-cells synthesize 3H-CE at a much reduced capacity compared to Al+ cells. The effect of Al- on 24S0H biosynthesis was subsequently analyzed by feeding neurons with the sterol precursor 3H-actetate for 3 hours, then isolating and analyzing the labeled sterols present in the cells and media. The results showed that Al- cells exhibited a reduced trend in cholesterol synthesis rate; the difference observed between Al+ cells and Al- cells approached but did not reach statistical significance (p=0.05). The 24S0H synthesis rate in Al- cells was significantly increased (by -27%). The 3H-sterols in the media of Al+ and Al- cells was also examined.
The results showed that the 3H-cholesterol content was not significantly different; in contrast, the 3H-24S0H content DC0412W0.2 -34- PATENT
in Al- cells was significantly (-56%) higher than that in Al+ cells. The percent of total 3H-sterols secreted into the media was calculated and it was found that neurons secreted only about 2% of total 3H-cholesterol, but secreted 13-15%
of total 3H-24S0H into the media.

[00059] The results herein demonstrate that Al- causes an increased 24S0H biosynthesis rate in neurons. Mouse neurons maintained in culture express CYP46A1 as a single 53-kDa-protein, which can be identified by immunoblot analysis (Russell, et al. (2009) supra). It is possible that the increased synthesis of 24S0H observed in Al- neurons may be due to an increase in CYP46A1 protein content in these neurons. To determine this, CYP46A1 protein content in Al+
and Al- neurons was analyzed by immunoblot analysis. The results showed that the intensities of the 53-kDa-protein band were comparable between the Al+/Alz and Al-/Alz cell types. This result indicates that in hippocampal neurons, the mechanism(s) involved in the Al- associated increase in 24S0H synthesis does not require an increase in CYP46A1 protein content.
Example 8: 24S0H Treatment of Alz Mouse Neurons Decreases hAPP Protein Content [00060] The observations made in intact A1-/Alz mouse brains (i.e., an increase in 24S0H content and a decrease in hAPP
content) indicated that 24S0H may decrease hAPP content in neurons. To test this, hippocampal neurons from Al+/Alz mice were treated with 24S0H, and the hAPP protein content and the HMGR protein content were monitored in parallel. It was found that 1 pM 24S0H rapidly decreased the protein content of both hAPP and HMGR (within 3 hours). A separate experiment showed that 1-5 pM 24S0H caused a rapid decline in hAPP protein content without affecting its mRNA level.

DC0412W0.2 -35-PATENT
This result indicates that accumulation of 24S0H in neurons may down-regulate hAPP protein content in vivo.

[00061] Thus, the current findings link cellular cholesterol trafficking with ACAT1, CYP46A1, 24S0H synthesis, and HMGR
at the endoplasmic reticulum. In neurons, cholesterol trafficking in and out of the endoplasmic reticulum occurs.
The unnecessary buildup of unesterified cholesterol at the endoplasmic reticulum (and other membranes) is toxic (Tabas (2002) J. Clin. Invest. 110:905-911; Warner, et al. (1995) J. Biol. Chem. 270:5772-5778). To minimize cholesterol accumulation, ACAT1, a resident enzyme located at the endoplasmic reticulum (Chang, et al. (2006) Annu. Rev. Cell Dev. Biol. 22:129-157), removes a portion of endoplasmic reticulum cholesterol by converting it to CE. ACAT1 deficiency leads to an increase in the endoplasmic reticulum cholesterol pool and raises the substrate level for CYP46A1, another endoplasmic reticulum resident enzyme (Russell, et al. (2009) supra). This leads to an increase in 24S0H
biosynthesis in neurons. The increased 24S0H concentration leads to rapid down-regulation of hAPP protein content, limiting its capacity to produce Ap. 24S0H secreted by neurons can enter astrocytes and other cell types and lead to efficient down-regulation of HMGR and cholesterol biosynthesis in these cells. Therefore, the beneficial effects of ACAT1 inhibition on cholesterol biosynthesis and on amyloid pathology is attributed to its ability to increase 24S0H level in Alz mouse brains. Therefore, agents that inhibit ACAT1 enzyme activity or decrease ACAT1 gene expression can ameliorate amyloid pathology, and have therapeutic value for treating AD in humans. These results also indicate that agents that increase the concentration of 24S0H may help to combat AD by decreasing APP content in the DC0412W0.2 -36-PATENT
brain. Such agent include, but are not limited to, 24S0H
itself.
Example 9: MicroRNA-Mediated Inhibition of ACAT1 Expression [00062]Artificial microRNA molecules were designed to target the 5' end of the coding sequence of mouse ACAT1 sequences listed in Table 2.

microRNA ACAT1 Target Sequence SEQ ID NO:
#52 GGAGCTGAAGCCACTATTTAT 37 #53 CTGTTTGAAGTGGACCACATCA 38 #54 CCCGGTTCATTCTGATACTGGA 39 #55 AACTACCCAAGGACTCCTACTGTA 40 [00063] For example, the pre-microRNAs (including sense, antisense and loop regions) of microRNAs #54 and #55 were 5f-TGC TGT CCA GTA TCA GAA TGA ACC GGG TTT TGG CCA CTG ACT
GAC CCG GTT CAC TGA TAC TGG A-3' (SEQ ID NO:41) and 5'-TGC
TGT ACA GTA GGA GTC CTT GGG TAG TTT TGG CCA CTG ACT GAC TAC
CCA AGC TCC TAC TGT A-3' (SEQ ID NO:42), respectively.

[00064] NIH-3T3 mouse fibroblasts were transiently transfected with one of several rAAV vectors encoding EmGFP
and microRNA (miR) #52, #53, #54 or #55. Forty-eight hours post-transfection, GFP-positive cells were harvested by FACS. GFP-positive cells were washed then lysed in 10% SDS
and syringe homogenized. Twenty microgram of protein per sample was subjected to SDS-PAGE. After western blot analysis, bands were quantified with ImageJ. ACAT1 intensity was normalized to GAPDH as a loading control and expressed as relative intensity. The results of this analysis are presented in Table 3.

DC0412W0.2 -37-PATENT

Treatment Relative Intensity Mock Transfected 1.00 miR Negative Control 1.02 miR #52 0.77 miR #53 0.56 miR #54 0.54 miR #55 0.39 [00065] This analysis indicated that microRNA molecules directed to mouse ACAT1 sequences could effectively decrease mouse ACAT1 gene expression by more than 50% compared to untreated controls.

[00066] Similarly, treatment of human HeLa cells or MCF-7 cells with either of the microRNAs listed in Table 4 (10 nM
concentration for two days) decreased human ACAT1 protein expression by 80%.

MicroRNA Sequence (5'->3') SEQ ID NO:

Example 10: Clinical Assessment of Therapeutic Efficacy [00067]A cohort of subjects fulfilling NINCDS-ADRDA criteria (McKhann, et al. (1984) Neurology 34:939-44) for probable or possible AD will be recruited. The median age of the sample group will be determined. Clinical diagnosis will be made independently by, e.g., a psychiatrist and neurologist based on a checklist for symptoms of the disease with strict adherence to NINCDS-ADRDA criteria. Cognitive assessment will be recorded by trained clinical research nurses using the MMSE (Mini Mental State Examination; Folstein et al.
(1975) J. Psychiatric Res. 12:189-98). Assessment will be followed a standardized protocol to maximize inter-rater reliability. All subjects will be followed up at yearly DC0412W0.2 -38-PATENT
intervals, for a period of up to three years or more with repeat MMSE on each occasion.

[00068] During the trial period, subjects will either receive regular doses of an ACAT1-selective inhibitor or placebo.
The rate of cognitive decline will be based on the average slope of MMSE points change per year. Differences in the average annual MMSE decline in the whole group by the presence or absence of the K variant of the ACAT1-selective inhibitor will be assessed by the Mann-Whitney U test. The subjects will then be grouped into four categories depending on their baseline MMSE scores (e.g., >24; 24 and >16; -<16 and >8; _<8 points). Differences in the average annual MMSE
decline in the four categories by the presence or absence of the K variant of ACAT1-selective inhibitor will be initially assessed by independent t-tests. Linear regression analysis with the average annual MMSE decline as the dependent variable will then be used to assess for confounding and effect modification by the independent variables, e.g., MMSE
at baseline, age, age of onset, and sex. It is expected that the results of this analysis will indicate that subjects receiving the ACAT1-selective inhibitor will exhibit a decrease in the rate or severity of cognitive decline as compared to subjects receiving placebo.
Example 11: Specificity of ACAT1 Inhibitors [00069] It has been shown that when the ACAT inhibitor CP113818 or CI 1011 are administered to AD mice, amyloid plaques are significantly reduced and cognitive deficits are rescued, suggesting that inhibiting ACAT may prevent and/or slow down the progression of AD (Hutter-Paier, et al. (2004) supra; Huttunen & Kovacs (2008) supra; Huttunen, et al.
(2009) supra). However, close comparison of the instant data and data of the prior art indicates that several important DC0412W0.2 -39-PATENT
differences exist between the effects of the ACAT inhibitors and the effects of ACAT1 gene expression. CP113818 inhibits the processing of both human APP and mouse APP, whereas CI
1011 decreases the mature/immature ratio of hAPP. In contrast, Al- only caused a decrease in the full-length human APP protein content and did not affect the mouse APP
at any level or alter the mature/immature ratio of hAPP.
Another important difference is that unlike the effect of Al-, CP113818 causes a reduction in the full-length hAPP
content (Hutter-Paier, et al. (2004) supra). The differences in results indicate that the ACAT inhibitors used in the prior art are not selective for ACAT1, as evidenced by the differences in results seen with complete ablation of ACAT1 (AT1-).

[00070]ACAT is a member of the membrane bound 0-acyltransferase (MBOAT) enzyme family (Hofmann (2000) Trends Biochem. Sci. 25:111-112), which includes sixteen enzymes with similar substrate specificity and similar catalytic mechanisms, but with diverse biological functions. In addition, many ACAT inhibitors are hydrophobic, membrane active molecules (Homan & Hamelehle (2001) J. Pharm. Sci.
90:1859-1867). When administrated to cells, it is likely that they partition into membranes at high concentration, thereby perturbing membrane properties nonspecifically.
Although CP113818 and CI 1011 are designated as ACAT
inhibitors, they also may inhibit other enzymes in the MBOAT
family, and/or interfere with other biological processes.

[00071] The present data shows that inactivating the ACAT1 gene alone is sufficient to ameliorate amyloid pathology in the 3XTg-AD mouse model. In this mouse model, Al- acts to reduce Ap load mainly by reducing the hAPP protein content.
In this context, the action of Al- is similar to that of cerebrolysin, a peptide mixture with neurotrophic effects.

DC0412W0 .2 -40-PATENT
It has been shown that cerebrolysin reduces Ap in an AD
mouse model, mainly by decreasing the hAPP protein content (Rockenstein, et al. (2006) J. Neurosci. Res. 83:1252-1261;
Rockenstein, et al. (2007) Acta Neuropathol. 113:265-275).
To further demonstrate that Al- leads to hAPP content reduction, it was shown that the brains of Al-/Alz mice contain a significantly greater amount of 24S0H. Moreover, in neuron-rich cultures, it was shown that 24S0H, when added to the medium, leads to rapid decrease in hAPP protein content. It is possible that APP may act as a sterol sensing protein (Beel, et al. (2008) Biochemistry 47:9428-9446);
sequence analysis shows that APP contains three CRAC motifs, a consensus motif known to bind cholesterol (Epand (2008) Biochim. Biophys. Acta 1778:1576-1582). It is also possible that cholesterol and/or oxysterol may directly interact with the hAPP protein to accelerate its rate of degradation.
Alternatively, 24S0H may act indirectly by reducing membrane cholesterol content.

[00072] The data presented herein also show that in mouse brain, Al- caused a decrease in HMGR protein and a decrease in cholesterol biosynthesis. This finding is consistent with previous analysis showing that inhibition of ACAT in macrophages, or in CHO cells, increases the ER "regulatory sterol pool" that causes down-regulation of HMGR levels and SREBP processing (Tabas, et al. (1986) J. Biol. Chem.
261:3147-3155; Scheek, et al. (1997) Proc. Natl. Acad. Sci.
USA 94:11179-11183). Studies have suggested that the "regulatory sterol" could be cholesterol itself, and/or an oxysterol derived from cholesterol; however, whether oxysterol(s) plays important roles in regulating sterol biosynthesis in the brain in vivo has been debated (Bjorkhem (2009) J. Lipid Res. 50:S213-218).

DC0412W0 .2 -41-PATENT

[00073] To address this issue, it has been shown that knocking out the 24-hydroxylase gene Cyp46a1 causes a near elimination in the 24S0H content, a decrease in cholesterol biosynthesis rate in the brain, and a decrease in cholesterol turnover in the brain; the total brain cholesterol content in the Cyp46a1-/- mice remained unchanged; Cyp46a1-/- did not affect the amyloid pathology in an AD mouse model (Lund, et al. (2003) J. Biol. Chem.
278:22980-22988; Kotti, et al. (2006) Proc. Natl. Acad. Sci.
USA 103:3869-3874; Halford & Russell (2009) Proc. Natl.
Acad. Sci. USA 106:3502-3506), In contrast, use of a cell-type non-specific promoter to drive the ectopic expression of Cyp46a1 in mouse brain shows that over-expressing Cyp46a1 causes a two-fold increase in 24S0H content and significantly ameliorates amyloid pathology in the AD mice (Hudry, et al. (2010) Mol. Ther. 18:44-53). In this study, a reduction in the hAPP protein content was not observed;
instead, a decrease in hAPP processing, an increase in SREBP2 mRNA, and no change in brain cholesterol content was demonstrated. The present results show that in the Al-/Alz mice, a 30% increase in 24S0H in brain cholesterol content, a modest reduction in cholesterol biosynthesis rateõ and a significant reduction in amyloid pathology occurred. The Cyp46a1 gene knockout or Cyp46a1 overexpression in mice may have produced compensatory effects that did not occur in the Al- mice, and vice versa; thus a direct comparison of the results described above is difficult. On the other hand, the combined results suggest that 24S0H may play an auxiliary, but not an obligatory, role in affecting cholesterol metabolism and amyloid biology, and its effects may be cell-type dependent. Based on other evidence, it has been independently proposed that a given oxysterol may play auxiliary but not obligatory roles in regulating cellular DC0412W0 .2 -42-PATENT
cholesterol homeostasis (Brown & Jessup (2009) Mol. Aspects Med. 30:111-122).

[00074] The instant data demonstrate a link between ACAT1, CYP46A1, 24S0H synthesis, and HMGR at the level of the endoplasmic reticulum (ER) in cellular cholesterol trafficking. The unnecessary buildup of unesterified cholesterol at the ER (and other membranes) is toxic (Warner, et al. (1995) J. Biol. Chem. 270:5772-5778; Tabas (2002) J. Clin. Invest. 110:905-911). In order to minimize cholesterol accumulation, ACAT1, a resident enzyme located at the ER (Sun, et al. (2003) J. Biol. Chem. 278:27688-27694), removes a portion of ER cholesterol by converting it to CE. Al- leads to an increase in the ER cholesterol pool and raises the substrate level for CYP46A1, another ER
resident enzyme. This leads to an increase in 24S0H
biosynthesis in neurons. The increased 2450H and/or cholesterol concentration in the ER leads to rapid down-regulation of hAPP protein content, thereby limiting its capacity to produce Ap. 24S0H secreted by neurons can enter astrocytes and other cell types, and lead to efficient down-regulation of HMGR and cholesterol biosynthesis in these cells. Therefore, the beneficial effects of Al- on cholesterol biosynthesis and on amyloid pathology in AD
mouse brains is attributed to an increase(s) in ER
cholesterol and/or 24501-I level in the neurons. Barring the possible side effects caused by altering cholesterol metabolism in the brain, the instant data indicate that agents that selectively and specifically inhibit ACAT1 enzyme activity or decrease ACAT1 gene expression can ameliorate amyloid pathology, and have therapeutic value for treating AD in humans.

DC0412W0.2 -43-PATENT
Example 12: Effect of Recombinant Adeno-Associated Virus Expressing Acatl siRNA

[00075] Four different siRNA sequences (#52-#55; Table 2) targeting the mouse Acatl gene were inserted into an endogenous mouse microRNA (miR) scaffold using Invitrogen's RNAi design tool. The artificial miRs were ligated into the mammalian expression vector pcDNA6.2-GW/EmGFP-miR. These AcatlmiR constructs were tested along with a negative control (NC) miR (5'-TACTGCGCGTGGAGACG-3'; SEQ ID NO:9), which does not match the sequence of any known vertebrate gene, in NIH-3T3 mouse fibroblasts. The miRs were delivered to the cells using a standard cDNA transfection protocol.
The results showed that two of the Acatl miRs (containing the siRNA sequence #54, 5'-TACAGTAGGAGTCCTTGGGTA-3'; SEQ ID
NO:10, and sequence #55, 5'-TCCAGTATCAGAATGAACCGGG-3'; SEQ
ID NO:11) were effective in causing 50-60% reduction in the ACAT1 protein content in treated mouse 3T3 fibroblasts.

[00076] These two Acatl miR sequences and the NC miR sequence were also subcloned into a rAAV backbone vector (AAV-6P-SEWB) that contained the neuron-specific hSyn promoter (Sibley, et al. (2012) Nucl. Acids Res.
Doi:10.1093/nar/gks712). This vector contained a strong and cell-type nonspecific promoter that expresses Acatl miRs in any cell type where the viral genome is expressed. For identification purpose, it also co-expresses the GFP with the miRs. These three constructs were used to produce three recombinant AAV viruses. To test the efficacy and specificity of these viruses, cultured primary hippocampal neurons isolated from the triple transgenic Alzheimer neurons from AD mice (AD/Acatl+/+ mice) were treated with the NC AAV, or with AAV that expressed miR containing siRNA
Acatl #55. Two weeks after viral infection, the effects of AAVs on cholesteryl ester biosynthesis were tested in DC0412W0.2 -44- PATENT
neurons. The results showed that the AAV harboring siRNA
Acatl #55 reduced cholesteryl ester biosynthesis by more than 50% (P<0.01), when compared with values in NC virus treated cells.

[00077] The NC AAV or the Acatl AAV (that includes both siRNA
Acatl #54 and #55) were also injected into the hippocampal region of the AD mice at 4 months of age. After a single bilateral injection, mice were allowed to recover. One month after injection, mice were sacrificed and the ACAT1 enzyme activities in the mouse brain homogenates were analyzed by using a standard ACAT enzyme activity assay in vitro. The result showed that when compared with the control values, the Acatl AAV reduced ACAT1 enzyme activity by 42%
(P<0.005).

[00078] Brain injections can cause various inflammatory responses in mice. Therefore, in a separate experiment, transcript levels of various inflammatory markers were assessed one month after brain injections. The results showed that the brain injections of PBS and/or AAV caused alterations in the transcript levels of various inflammatory markers (iba, GFAP, TNFalpha, and iNOS); however, the degree of alteration was modest (i.e., within 20% of control values).

[00079] Subsequently, single bilateral injections of PBS, or NC AAV or Acatl AAV were made into the hippocampal region of AD mice with ACAT1 (AD/ACAT1), or AD mice without ACAT1 (AD/ACAT.1.-/-); both mouse strains were at 10 months of age.
After injections, mice were allowed to recover, and were sacrificed two months later (at 12 months of age) to determine Ap1-42 content. The results showed that injecting AAV unexpectedly caused significant reduction of the Ap 1-42 levels in the AD mice. Additional results also showed that DC0412W0.2 -45- PATENT
injecting the AAV that expresses the Acatl KD microRNA
caused a clear reduction in the Ap1-42 level (see Figure 1).

[00080] In the AD mouse brain, Acatl genetic ablation (Acatl-/-) caused a 60-80% reduction in the A131-42 content;
however, residual Al-42 was still present in the brains of the AD/Acatl-/- mouse brain. In a control experiment, it was shown that, in the AD/Acatl-/- mouse brain, treating with either Acatl AAV (Figure 1) or with NC AAV (Figure 1) caused about 25% reduction in the residual A131-42 levels, confirming that injecting AAV could cause significant Al-42 reduction, in a manner independent of its ability to recognize the Acatl mRNA sequence.

[00081] By using the residual A-beta 1-42 level remaining in the AD/Acatl-/- mouse brain injected with AAV as the baseline value, it was estimated that the efficiency of Acatl AVV to reduce Ap1-42 in an ACAT1 sequence-dependent manner was 70%.

[00082] Overall, these results showed that siRNAs against ACAT1 can be employed to cause inhibition of ACAT1 enzyme activity and to cause significant A131-42 reduction in the AD
mouse brains in vivo, after cognitive deficit occurred in these mice.

[00083]Additional experiments were performed where homogenates from the hemibrains of 12-month old AD or AD/ACAT1-/- mice that had received brain injections with 1.0 ul PBS, AAV-NC or AAV-Acatl in the hippocampi at 10 months of age were examined. Equal amounts of brain homogenate from individual mice were combined to create sample pools representative of each group. The sample pools were subjected to formic acid extraction, followed by ELISA assay for Ap42. Results showed that there was a difference among the mean levels of A31-42, with levels of the protein significantly decreased in all groups of AD/Acatl-/- mice compared to AD mice treated with PBS of AAV-NC (Figure 2A).

DC0412W0.2 -46- PATENT
Moreover, Ap1-42 levels were significantly decreased in AD
mice treated with AAV-Acatl compared with AD mice treated with AAV-NC or PBS. There was no difference in Al-42 levels in AD mice treated with AAV-Acatl versus AD/Acat1-1- mice, and also no significant difference in Al-42 levels between the AD/ACAT-/- mice treated with PBS, AAV-NC or AAV-Acatl (Figure 2A). 1\myloidp1-40 levels were also assayed by ELISA
and levels in these mice were near the lower limit of detection in the assay and these were no significant differences detected among treatment groups. These data also provide in vivo evidence for the therapeutic efficacy of using siRNA molecules to reduce levels of amyloid proteins in an animal model of AD. These data support the use of such molecules to treat AD in humans.

[00084] Given that hAPP levels had been shown to be significantly decreased in AD/Acat-/- mice, experiments were performed to investigate the role of hAPP in mice injected with the ACAT1 vector. Thus, in the same mice described above, levels of hAPP were measured by isolation of brain homogenates, followed by Western blot using eht 6E10 antibody which recognizes the N-terminal sequence in hAPP
and m=does not recognize mouse APP. Results showed that the levels detected paralleled the levels of A1342 seen in the various test groups (Figure 2B). There was a statistically significant decrease in hAPP in AD' mice treated with AAV-Acatl compared with AD mice treated with PBS. There was also a significant decrease in full-length hAPP levels in all treatment groups of AD/Acat-/- mice compared with AD mice treated with PBS (Figure 2B). These data demonstrate the in vivo activity of the siRNA ACAT1 molecules when delivered in the microRNA viral vector in vivo. These data also provide support for the therapeutic efficacy of siRNA molecules DC0412W0.2 -4 7-PATENT
targeted to ACAT1 and the use of such molecules to treat AD
in humans.

Claims (27)

What is claimed is:

1. A method for decreasing the size and density of amyloid plaques comprising administering to a subject in need of treatment an effective amount of an agent that selectively inhibits the activity of Acyl-CoA:Cholesterol Acyltransferase 1 thereby decreasing the size and density of amyloid plaques in the subject.

2. The method of claim 1, wherein the agent has an IC50 value for Acyl-CoA:Cholesterol Acyltransferase 2 which is at least twice the corresponding IC50 value for Acyl-CoA:Cholesterol Acyltransferase 1.

3. The method of claim 1, wherein the agent does not inhibit the expression of Acyl-CoA:Cholesterol Acyltransferase 2.

4. The method of claim 1, wherein the agent has an IC50 value in the range of 1 nM to 100 µM.

5. The method of claim 1, wherein the agent is selectively delivered to the brain of the subject.

6. The method of claim 1, wherein the selective inhibitor of Acyl-CoA:Cholesterol Acyltransferase 1 is an siRNA or microRNA.

7. The method of claim 6, wherein the Acyl-CoA:Cholesterol Acyltransferase 1 inhibitor is administered via a liposome or nanoparticle.

8. A method for decreasing cognitive decline associated with amyloid pathology comprising administering to a subject in need of treatment an effective amount of an agent that selectively inhibits the activity of Acyl-CoA:Cholesterol Acyltransferase 1 thereby decreasing cognitive decline associated with amyloid pathology in the subject.

9. The method of claim 8, wherein the agent has an IC50 value for Acyl-CoA:Cholesterol Acyltransferase 2 which is at least twice the corresponding IC50 value for Acyl-CoA:Cholesterol Acyltransferase 1.

10. The method of claim 8, wherein the agent does not inhibit the expression of Acyl-CoA:Cholesterol Acyltransferase 2.

11. The method of claim 8, wherein the agent has an IC50 value in the range of 1 nM to 100 µM.

12. The method of claim 8, wherein the agent is selectively delivered to the brain of the subject.

13. The method of 8, wherein the selective inhibitor of Acyl-CoA:Cholesterol Acyltransferase 1 is an siRNA or microRNA.

14. The method of claim 13, wherein the Acyl-CoA:Cholesterol Acyltransferase 1 inhibitor is administered via a liposome or nanoparticle.

15. A method for treating Alzheimer's Disease comprising administering to a subject in need of treatment an effective amount of an agent that selectively inhibits the activity of Acyl-CoA:Cholesterol Acyltransferase 1 thereby treating the subject's Alzheimer's Disease.

16. The method of claim 15, wherein the agent has an IC50 value for Acyl-CoA:Cholesterol Acyltransferase 2 which is at least twice the corresponding IC50 value for Acyl-CoA:Cholesterol Acyltransferase 1.

17. The method of claim 15, wherein the agent does not inhibit the expression of Acyl-CoA:Cholesterol Acyltransferase 2.

18. The method of claim 15, wherein the agent has an IC50 value in the range of 1 nM to 100 µM.

19. The method of claim 15, wherein the agent is selectively delivered to the brain of the subject.

20. The method of claim 15, wherein the selective inhibitor of Acyl-CoA:Cholesterol Acyltransferase 1 is an siRNA or microRNA.

21. The method of claim 20, wherein the Acyl-CoA:Cholesterol Acyltransferase 1 inhibitor is administered via a liposome or nanoparticle.

22. A method for decreasing the size and density of amyloid plagues comprising administering to a subject in need of treatment a microRNA that selectively inhibits the expression of Acyl-CoA:Cholesterol Acyltransferase 1 thereby decreasing the size and density of amyloid plagues in the subject.

23. The method of claim 22, wherein the microRNA is selectively delivered to the brain of the subject.

24. A method for decreasing cognitive decline associated with amyloid pathology comprising administering to a subject in need of treatment a microRNA that selectively inhibits the expression of Acyl-CoA:Cholesterol Acyltransferase 1 thereby decreasing cognitive decline associated with amyloid pathology in the subject.

25. The method of claim 24, wherein the microRNA is selectively delivered to the brain of the subject.

26. A method for treating Alzheimer's Disease comprising administering to a subject in need of treatment a microRNA that selectively inhibits the expression of Acyl-CoA:Cholesterol Acyltransferase 1 thereby treating the subject's Alzheimer's Disease.

27. The method of claim 26, wherein the microRNA is selectively delivered to the brain of the subject.