CA2845444A1 - Soybean markers linked to phytophthora resistance - Google Patents

Abstract

This disclosure concerns compositions and methods for identifying the phytophthora resistant phenotype in soybean. In some embodiments, the disclosure concerns methods for performing marker-assisted breeding and selection of plants carrying one or more determinants of phytophthora resistance in soybean. In some embodiments, the disclosure concerns methods for detecting phytophthora resistance in soybean via the use of an amplification reaction.

Description

=
DEMA.NDES OU BREVETS VOLUMINEUX
= LA PRESENTE PARTIE DE CUTE DEIVIANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
= CECI EST LE TOME I DE a = NOTE: Pour les tomes additionels, veillez contacter le Bureau Cartadien des Brevets.
=
JUMBO APPLICATIONS / PATENTS

THAN ONE VOLUME.
THIS IS VOLUME I OF _________________________________________________ .
NOTE: For additional volumes please contact the Canadian Patent Office.

I.
SOYBEAN MARKERS LINKED TO PHYTOPHTHORA RESISTANCE
[0001] This application claims the benefit of U.S. Provisional Application No.
61/777,575 which was filed in the U.S. Patent and Trademark Office on March 12, 2013, the entire disclosure of which is hereby incorporated by reference in its entirety.

[0002]
FIELD OF THE DISCLOSURE

[0003] The present disclosure relates to plant disease resistance. In some embodiments, the disclosure relates to phytophthora resistance in soybean. In particular embodiments, the disclosure relates to compositions and methods for identifying a phytophthora resistance trait in an organism. Examples include molecular markers that are tightly linked to phytophthora resistance traits and amplification detection assays that can detect the molecular markers that are tightly linked to phytophthora resistance traits. Further embodiments relate to compositions and methods for introducing a phytophthora resistance trait into a host organism, for example, by using molecular markers tightly linked to phytophthora resistance.
BACKGROUND

[0004] The soybean, Glycine max, is one of the major economic crops grown worldwide as a primary source of vegetable oil and protein. Growing demand for low cholesterol and high fiber diets has increased soybean's importance as a food. Over 10,000 soybean varieties have now been introduced into the United States, of which a limited number form the genetic base of lines developed from hybridization and selection programs. Johnson and Bernard, The Soybean, Norman Ed., Academic Press, N.Y., pp. 1-73, 1963.

[0005] Phytophthora is a highly destructive disease in soybean, and is only second to soybean cyst nematode in causing damage to soybean crops. This disease causes an annual yield loss of $300 million dollars (US) in North America (Wrather, J. A., and S. R.
Koenning, (2006) Estimates of disease effects on soybean yields in the United States 2003 to 2005.
JNematol 38: 173-180), and occurs in most of the soybean-growing areas in many different countries.
Phytophthora sojae, is a soilborne, oomycete pathogen and can cause Phytophthora root and stem rot (PRR), pre- and post-emergence of damping-off, yellowing and wilting of lower leaves, and death of soybean plants.
More than fifty-five races of P. sojae have been identified (Slaminko et al., (2010) Multi-year evaluation of commercial soybean lines for resistance to Phytophthora sojae.
Plant Disease 94).
Developing soybean line resistance is one of the primary methods to control this disease. The Rpsl-c (50%), Rpsl-k (40%), and Rpsl-a (10%) traits are the most commonly used genes that are introgressed into germplasm to provide protection to P. sojae (Slaminko et al., 2010).

[0006] Markers that are linked to the phytophthora resistance trait, Rpsl-k, include RFLPs, SSRs and SNPs. The markers identified in this disclosure can be used for phytophthora resistance genotyping to support a breeding program. Using the presently disclosed markers to perform phytophthora resistance genotyping in support of a breeding program provides:
cost and time savings; early selection of desired progeny; and more accurate and rapid commercialization of phytophthora resistant soybean varieties.
BRIEF SUMMARY OF THE DISCLOSURE

[0007] Molecular markers that are linked to a phytophthora resistance phenotype may be used to facilitate marker-assisted selection for the phytophthora resistance trait in soybean. Marker-assisted selection provides significant advantages with respect to time, cost, and labor, when compared to phytophthora resistance phenotyping. Surprisingly, it is disclosed herein that among 115 SNP
markers identified to be within or near the phytophthora disease resistance QTL regions in the soybean genome that were polymorphic in parent genotypes, only 10 were linked to the phytophthora resistance trait. These 10 SNP markers offer superior utility in marker-assisted selection of phytophthora resistant soybean varieties.
10008] Described herein as embodiments are nucleic acid molecular markers that are linked to (e.g., linked; tightly linked; or extremely tightly linked) a phytophthora resistance phenotype. In particular embodiments, the molecular markers may be SNP markers. Also described herein are methods of using nucleic acid molecular markers that are linked to a phytophthora resistance phenotype, for example and without limitation, to identify plants with a phytophthora resistance phenotype; to introduce a phytophthora resistance phenotype into new plant genotypes (e.g., through marker-assisted breeding or genetic transformation); and to cultivate plants that are likely to have a phytophthora resistance phenotype.
100091 In one embodiment, are means for introducing a phytophthora resistance phenotype to soybean and means for identifying plants having a phytophthora resistance phenotype. In some embodiments, a means for introducing a phytophthora resistance phenotype into soybean may be a marker that is linked (e.g., linked; tightly linked; or extremely tightly linked) to a phytophthora resistance phenotype. In some embodiments, a means for identifying plants having a phytophthora resistance phenotype may be a probe that specifically hybridizes to a marker that is linked (e.g., linked; tightly linked; or extremely tightly linked) to a phytophthora resistance phenotype.
100101 In one embodiment, methods of identifying a soybean plant that displays resistance to phytophthora infestation, comprising detecting in germplasm of the soybean plant at least one allele of a marker locus are provided. The marker locus is located within a chromosomal interval comprising and flanked by NCSB_000559 and NCSB_000582; and at least one allele is associated with phytophthora resistance. The marker locus can be selected from any of the following marker loci NCSB_000559, Gmax7x198 656813, SNP18196, NCSB 000575, Gmax7x259 44054, SNP18188, Gmax7x259 98606, BARC 064351 18628, BARC 064351 18631, and NCSB 000582, as well as any other marker that is linked to these markers. The marker locus can be found on chromosome 3, within the interval comprising and flanked by NCSB_000559 and NCSB 000582, and comprises at least one allele that is associated with phytophthora resistance.
Soybean plants identified by this method are also of interest.

[0011] In another embodiment, methods for identifying soybean plants with resistance to phytophthora infestation by detecting a haplotype in the germplasm of the soybean plant are provided. The haplotype comprises alleles at one or more marker loci, wherein the one or more marker loci are found on chromosome 3 within the interval comprising and, flanked by, PZE-NCSB 000559 and NCSB 000582. The haplotype comprises alleles at one or more marker loci, wherein the one or more marker loci are found on chromosome 3 and are selected from the group consisting NC SB_000559, Gmax7x198_656813, SNP18196, NCSB_000575, Gmax7x259_44054, SNP18188, Gmax7x259_98606, BARC_064351_18628, BARC_064351_18631, and NCSB 000582. The haplotype is associated with phytophthora resistance.
[0012] In a further embodiment, methods of selecting plants with resistance to phytophthora infestation are provided. In one aspect, a first soybean plant is obtained that has at least one allele of a marker locus wherein the allele is associated with phytophthora resistance.
The marker locus can be found on chromosome 3, within the interval comprising and flanked by NCSB_000559 and NCSB 000582. The first soybean plant can be crossed to a second soybean plant, and the progeny resulting from the cross can be evaluated for the allele of the first soybean plant Progeny plants that possess the allele from the first soybean plant can be selected as having resistance to phytophthora. Soybean plants selected by this method are also of interest.
[0013] Also described herein are plants and plant materials that are derived from plants having a phytophthora resistance phenotype as identified using molecular markers described herein. Thus, soybean plants that are produced by marker-assisted selection using one or more molecular marker(s) that are linked to a phytophthora resistance phenotype are described.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 illustrates the strategy of Rpsl-k specific SNP marker development.
[0015] FIG. 2 includes an example of the results of a distribution graph of a KASPARTM assay that was sorted based on Relative Fluorescence Units (RFU).
[0016] FIG. 3 includes the physical map of polymorphic SNPs markers identified on chromosome 3.
BARC 064351 18628 was located roughly at the same locus as BARC 064351 18631. Figure 3 further illustrates a chromosomal interval. This interval, located on chromosome 3, comprises and is flanked by PZE- NCSB_000559 and NCSB_000582.
A
subinterval of chromosomal interval NCSB 000559 and NCSB 000582 is NCSB 000575 and Gmax7x259 44054.
[0017] FIG. 4 describes a distribution graph, based on Relative Fluorescence Units (RFU), of the Rpsl-k TAQMANTm specific assay developed from the SNP marker, BARC_064351 18631.
DETAILED DESCRIPTION
I. Overview of several embodiments [0018] Particular embodiments include ten exemplary SNP markers (NCSB_000559, Gmax7x198 656813, SNP18196, NCSB 000575, Gmax7x259 44054, SNP18188, Gmax7x259 98606, BARC 064351 18628, BARC 064351 18631, and NCSB 000582) that show co-segregation with the phytophthora resistance trait, Rpsl-k, in the tested soybean lines.
[0019] Markers that co-segregate with phytophthora resistance are linked to this trait, and therefore may be useful in marker-assisted selection and breeding. Also disclosed herein is a strategy used to identify the exemplary SNP markers linked to phytophthora resistance. In addition, an amplification detection assay that can detect the exemplary SNP markers is disclosed herein.
The physical map positions of these exemplary SNP markers in the Glycine max genome are provided. Using the exemplary SNP markers described herein, a specific fret-based amplification assay using the KBiosciences Competitive Allele-Specific PCR SNP genotyping system (KASPARTM) and the TAQMANTm hydrolysis probe assay was developed to rapidly and accurately identify plants carrying the phytophthora resistance trait. While embodiments of the disclosure are described with reference to the exemplary SNP markers linked to phytophthora resistance, those of skill in the art will appreciate that additional, equivalent markers may be identified using the techniques described herein. SNP markers linked to phytophthora resistance may be used, for example, in phytophthora genotyping to select phytophthora resistant plants from soybean breeding populations.
[0020] Phytophthora infestation may be caused by one or more different strains of Phytophthora spp. The resistance for this disease may be provided by different resistant genes located on different linkage groups. See, e.g., Table 1.

[0021] The strategy described herein is used to identify markers in other unknown linkage groups that are linked to phytophthora resistance. Thus, methods for identifying such markers and an amplification method for detecting the markers in plant tissue are provided.
The general strategy is also used to map other traits of interest. The strategy is more efficient than traditional mapping strategies and may be particularly useful in molecular breeding programs.
Table 1: Sources of phytophthora resistance reported in the literature.
Locus Linkage Chromosomal Reference Group Location Rps 1 N Gm03 Bernard, R.L. (1957) Agron. J.
49:391 Rps2 J Gm16 Kilen, T.C. (1974) Crop Sci. 14:260-262.
Rps3 F Gm13 Mueller, E.H. (1978) Phytopathology 68:1318-1322.
Rps4 G Gm18 Athow, K.L. (1980) Phytopathology 70:97 7-980.
Rps5 G Gm18 Buzzell, R.I. (1981) Soybean Genet.
News!. 8:30-33.
Rps6 G Gm18 Athow, K.L. (1982) Phytopathology 72:15 64-1567.
Rps7 N Gm18 Anderson, T. R. (1992) Plant Dis.
76:958-959.
Rps8 A2 or F Gm08 Burnham, K.D. (2003) Crop Sci.
43:101-105.
[0022] II. Terms [0023] Mapping population: As used herein, the term "mapping population" may refer to a plant population used for gene mapping. Mapping populations are typically obtained from controlled crosses of parent genotypes. Decisions on the selection of parents and mating design for the development of a mapping population, and the type of markers used, depend upon the gene to be mapped, the availability of markers, and the molecular map. The parents of plants within a mapping population must have sufficient variation for the trait(s) of interest at both the nucleic acid sequence and phenotype level. Variation of the parents' nucleic acid sequence is used to trace recombination events in the plants of the mapping population. The availability of informative polymorphic markers is dependent upon the amount of nucleic acid sequence variation.

[0024] Backcrossing: Backcrossing methods may be used to introduce a nucleic acid sequence into plants. The backcrossing technique has been widely used for decades to introduce new traits into plants. Jensen, N., Ed. Plant Breeding Methodology, John Wiley & Sons, Inc., 1988. In a typical backcross protocol, the original variety of interest (recurrent parent) is crossed to a second variety (non-recurrent parent) that carries a gene of interest to be transferred. The resulting progeny from this cross are then crossed again to the recurrent parent, and the process is repeated until a plant is obtained wherein essentially all of the desired morphological and physiological characteristics of the recurrent plant are recovered in the converted plant, in addition to the transferred gene from the non-recurrent parent.
[0025] The term "allele" refers to one of two or more different nucleotide sequences that occur at a specific locus.
[0026] An "amplicon" is amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, or the like).
[0027] The term "amplifying" in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid for a transcribed form thereof) are produced. Typical amplification methods include various polymerase based replication methods, including the polymerase chain reaction (PCR), ligase mediated methods such as the ligase chain reaction (LCR) and RNA polymerase based amplification (e.g., by transcription) methods.
[0028] The term "assemble" applies to BACs and their propensities for coming together to form contiguous stretches of DNA. A BAC "assembles" to a contig based on sequence alignment, if the BAC is sequenced, or via the alignment of its BAC fmgerprint to the fingerprints of other BACs.
The assemblies can be found using the Phytozome website, which is publicly available on the interne.
[0029] A "haplotype" is the genotype of an individual at a plurality of genetic loci, i.e. a combination of alleles. Typically, the genetic loci described by a haplotype are physically and genetically linked, i.e., on the same chromosome segment. The term "haplotype"
can refer to sequence, polymorphisms at a particular locus, such as a single marker locus, or sequence polymorphisms at multiple loci along a chromosomal segment in a given genome.
The former can also be referred to as "marker haplotypes" or "marker alleles", while the latter can be referred to as "long-range haplotypes".
[0030] An allele is "associated with" a trait when it is linked to it and when the presence of the allele is an indicator that the desired trait or trait form will occur in a plant comprising the allele.
[0031] KBiosciences Competitive Allele-Specific PCR SNP genotyping system (KASPARTm):
KASPARTM is a commercially available homogeneous fluorescent system for determining SNP
genotypes (KBiosciences Ltd., Hoddesdon, UK). A KASPARTM assay comprises an SNP-specific "assay mix," which contains three unlabelled primers, and a "reaction mix,"
which contains all the other required components; for example, a universal fluorescent reporting system. In addition to these mixes, the user provides, inter alia, a FRET-capable plate reader, microtitre plate(s), and DNA
samples that contain about 5 ng/L DNA.
[0032] Chromosomal interval: A chromosomal interval designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome. The genetic elements or genes located on a single chromosomal interval are physically linked. The size of a chromosomal interval is not particularly limited. In some aspects, the genetic elements located within a single chromosomal interval are genetically linked, typically with a genetic recombination distance of, for example, less than or equal to 20 cM, or alternatively, less than or equal to 10 cM. That is, two genetic elements within a single chromosomal interval undergo recombination at a frequency of less than or equal to 20% or 10%.
[0033] The term "chromosomal interval" designates any and all intervals defined by any of the markers set forth in this invention. A chromosomal interval that correlates with phytophthora resistance is provided. This interval, located on chromosome 3, comprises and is flanked by PZE-NCSB 000559 and NCSB 000582. A subinterval of chromosomal interval NCSB 000559 and NCSB 000582 is NCSB 000575 and Gmax7x259 44054.
[0034] A typical KASPARTM assay comprises the steps of: allele-specific primer design;
preparation of reaction mix including the allele-specific primers; admixing the reaction mix to DNA
samples in a microtitre plate; thermocycling; reading the plate in a fluorescent plate reader; and plotting and scoring the fluorescent data. Data from each sample are plotted together on a 2-D
graph, where the x- and y-axes correspond to fluorophore excitation. Samples having the same SNP

genotype cluster together on the plot (i.e., A/A; A/a; and a/a). More technical information about the KASPARTM system, including a guide of solutions to common problems, is obtainable from KBiosciences Ltd. (e.g., the KASPar SNP Genotyping System Reagent Manual).
[0103] The TAQMANTm hydrolysis probe assay is another commercially available homogeneous fluorescent system for determining SNP genotypes (Roche Technologies, Indianapolis, IN). A TAQMANTm reaction relies on the 5' ¨3' exonuclease activity of the Taq polymerase to cleave a FRET oligonucelotide probe during hybridization of the probe to a complementary target sequence. The dual-labeled oligonucleotide probe is designed to overlap the SNP molecular marker. The dual-labeled probe contains both a fluorophore and a quencher. The release of the fluorophore and the resulting separation of the fluorophore from the quencher allows the fluorophore to release a fluorescent signal. The fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
100351 As in other real-time PCR methods, the resulting fluorescence signal permits quantitative measurements of the accumulation of the product during the exponential stages of the PCR. The TAQMANTm assay comprises an assay mix, which contains two unlabelled primers and a dual-labeled probe, and all the other required components. In addition to these mixes, the user provides, inter alia, a FRET-capable plate reader, microtitre plate(s), and DNA samples.
100361 Linked, tightly linked, and extremely tightly linked: As used herein, linkage between genes or markers may refer to the phenomenon in which genes or markers on a chromosome show a measurable probability of being passed on together to individuals in the next generation. The closer two genes or markers are to each other, the closer to (1) this probability becomes. Thus, the term "linked" may refer to one or more genes or markers that are passed together with a gene with a probability greater than 0.5 (which is expected from independent assortment where markers/genes are located on different chromosomes). When the presence of a gene contributes to a phenotype in a plant, markers that are linked to the gene may be said to be linked to the phenotype. Thus, the term "linked" may refer to a relationship between a marker and a gene, or between a marker and a phenotype.
100371 Because the proximity of two genes or markers on a chromosome is directly related to the probability that the genes or markers will be passed together to individuals in the next generation, =
the term "linked" may also refer herein to one or more genes or markers that are located within about 2.0 Mb of one another on the same chromosome. Thus, two "linked" genes or markers may be separated by about 2.1 Mb; 2.00 Mb; about 1.95 Mb; about 1.90 Mb; about 1.85 Mb; about 1.80 Mb; about 1.75 Mb; about 1.70 Mb; about 1.65 Mb; about 1.60 Mb; about 1.55 Mb;
about 1.50 Mb;
about 1.45 Mb; about 1.40 Mb; about 1.35 Mb; about 1.30 Mb; about 1.25 Mb;
about 1.20 Mb;
about 1.15 Mb; about 1.10 Mb; about 1.05 Mb; about 1.00 Mb; about 0.95 Mb;
about 0.90 Mb;
about 0.85 Mb; about 0.80 Mb; about 0.75 Mb; about 0.70 Mb; about 0.65 Mb;
about 0.60 Mb;
about 0.55 Mb; about 0.50 Mb; about 0.45 Mb; about 0.40 Mb; about 0.35 Mb;
about 0.30 Mb;
about 0.25 Mb; about 0.20 Mb; about 0.15 Mb; about 0.10 Mb; about 0.05 Mb;
about 0.025 Mb;
and about 0.01 Mb. Particular examples of markers that are "linked" to the phytophthora phenotype in soybean include nucleotide sequences on chromosome 3 (linkage group N) of the soybean genome.
100381 As used herein, the term "tightly linked" may refer to one or more genes or markers that are located within about 0.5 Mb of one another on the same chromosome. Thus, two "tightly linked" genes or markers may be separated by about 0.6 Mb; about 0.55 Mb; 0.5 Mb; about 0.45 Mb; about 0.4 Mb; about 0.35 Mb; about 0.3 Mb; about 0.25 Mb; about 0.2 Mb;
about 0.15 Mb;
= about 0.1 Mb; and about 0.05 Mb.
100391 As used herein, the term "extremely tightly linked" may refer to one or more genes or markers that are located within about 100 kb of one another on the same chromosome. Thus, two "extremely tightly linked" genes or markers may be separated by about 125 kb;
about 120 kb; about 115 kb; about 110 kb; about 105 kb; 100 kb; about 95 kb; about 90 kb; about 85 kb; about 80 kb;
about 75 kb; about 70 kb; about 65 kb; about 60 kb; about 55 kb; about 50 kb;
about 45 kb; about 40 kb; about 35 kb; about 30 kb; about 25 kb; about 20 kb; about 15 kb; about 10 kb; about 5 kb; and about 1 kb.
100401 In view of the foregoing, it will be appreciated that markers linked to a particular gene or phenotype include those markers that are tightly linked, and those markers that are extremely tightly linked, to the gene or phenotype. Linked, tightly linked, and extremely tightly genetic markers of the phytophthora phenotype may be useful in marker-assisted breeding programs to identify phytophthora resistant soybean varieties, and to breed this trait into other soybean varieties to confer phytophthora resistance.
[0041] Locus: As used herein, the term "locus" refers to a position on the genome that corresponds to a measurable characteristic (e.g., a trait). An SNP locus is defined by a probe that hybridizes to DNA contained within the locus.
[0042] Marker: As used herein, a marker refers to a gene or nucleotide sequence that can be used to identify plants having a particular allele. A marker may be described as a variation at a given genomic locus. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, or "SNP"), or a long one, for example, a microsatellite/simple sequence repeat ("SSR"). A "marker allele" refers to the version of the marker that is present in a particular individual.
[0043] The term marker as used herein may refer to a cloned segment of soybean chromosomal DNA, and may also or alternatively refer to a DNA molecule that is complementary to a cloned segment of soybean chromosomal DNA.
[0044] In some embodiments, the presence of a marker in a plant may be detected through the use of a nucleic acid probe. A probe may be a DNA molecule or an RNA molecule.
RNA probes can be synthesized by means known in the art, for example, using a DNA
molecule template. A
probe may contain all or a portion of the nucleotide sequence of the marker and additional, contiguous nucleotide sequence from the plant genome. This is referred to herein as a "contiguous probe." The additional, contiguous nucleotide sequence is referred to as "upstream" or "downstream" of the original marker, depending on whether the contiguous nucleotide sequence from the plant chromosome is on the 5' or the 3' side of the original marker, as conventionally understood. As is recognized by those of ordinary skill in the art, the process of obtaining additional, contiguous nucleotide sequence for inclusion in a marker may be repeated nearly indefinitely (limited only by the length of the chromosome), thereby identifying additional markers along the chromosome. All above-described markers may be used in some embodiments of the present disclosure.
[0045] An oligonucleotide probe sequence may be prepared synthetically or by cloning. Suitable cloning vectors are well-known to those of skill in the art. An oligonucleotide probe may be labeled or unlabeled. A wide variety of techniques exist for labeling nucleic acid molecules, including, for example and without limitation: radiolabeling by nick translation; random priming; tailing with terminal deoxytransferase; or the like, where the nucleotides employed are labeled, for example, with radioactive 32P. Other labels which may be used include, for example and without limitation:
Fluorophores (e.g., FAM and VIC); enzymes; enzyme substrates; enzyme cofactors; enzyme inhibitors; and the like. Alternatively, the use of a label that provides a detectable signal, by itself or in conjunction with other reactive agents, may be replaced by ligands to which receptors bind, where the receptors are labeled (for example, by the above-indicated labels) to provide detectable signals, either by themselves, or in conjunction with other reagents. See, e.g., Leary et al. (1983) Proc. Natl. Acad. Sci. USA 80:4045-9.
[0046] A probe may contain a nucleotide sequence that is not contiguous to that of the original marker; this probe is referred to herein as a "noncontiguous probe." The sequence of the noncontiguous probe is located sufficiently close to the sequence of the original marker on the genome so that the noncontiguous probe is genetically linked to the same gene or trait (e.g., phytophthora resistance). For example, in some embodiments, a noncontiguous probe is located within 500 kb; 450 kb; 400 kb; 350 kb; 300 kb; 250 kb; 200 kb; 150 kb; 125 kb;
100 kb; 0.9 kb; 0.8 kb; 0.7 kb; 0.6 kb; 0.5 kb; 0.4 kb; 0.3 kb; 0.2 kb; or 0.1 kb of the original marker on the soybean genome.
[0047] A probe may be an exact copy of a marker to be detected. A probe may also be a nucleic acid molecule comprising, or consisting of, a nucleotide sequence which is substantially identical to a cloned segment of the subject organism's (for example, soybean) chromosomal DNA. As used herein, the term "substantially identical" may refer to nucleotide sequences that are more than 85%
identical. For example, a substantially identical nucleotide sequence may be 85.5%; 86%; 87%;
88%; 89%; 90%; 91%; 92%; 93%; 94%; 95%; 96%; 97%; 98%; 99% or 99.5% identical to the reference sequence.
[0048] A probe may also be a nucleic acid molecule that is "specifically hybridizable" or "specifically complementary" to an exact copy of the marker to be detected ("DNA target").
"Specifically hybridizable" and "specifically complementary" are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the nucleic acid molecule and the DNA target. A nucleic acid molecule need not be 100%
complementary to its target sequence to be specifically hybridizable. A nucleic acid molecule is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the nucleic acid to non-target sequences under conditions where specific binding is desired, for example, under stringent hybridization conditions.
[0049] Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ and/or Mr concentration) of the hybridization buffer will determine the stringency of hybridization, though wash times also influence stringency.
Calculations regarding hybridization conditions required for attaining particular degrees of stringency are known to those of ordinary skill in the art, and are discussed, for example, in Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11; and Hames and Higgins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, 1985. Further detailed instruction and guidance with regard to the hybridization of nucleic acids may be found, for example, in Tijssen, "Overview of principles of hybridization and the strategy of nucleic acid probe assays," in Laboratory Techniques in Biochemistry and Molecular Biology- Hybridization with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, NY, 1993; and Ausubel et al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, NY, 1995.
[0050] As used herein, "stringent conditions" encompass conditions under which hybridization will only occur if there is less than 50% mismatch between the hybridization molecule and the DNA
target. "Stringent conditions" include further particular levels of stringency. Thus, as used herein, "moderate stringency" conditions are those under which molecules with more than 50% sequence mismatch will not hybridize; conditions of "high stringency" are those under which sequences with more than 20% mismatch will not hybridize; and conditions of "very high stringency" are those under which sequences with more than 10% mismatch will not hybridize.
[0051] The following are representative, non-limiting hybridization conditions.

= .
[0052] Very High Stringency (detects sequences that share at least 90%
sequence identity):
Hybridization in 5x SSC buffer at 65 C for 16 hours; wash twice in 2x SSC
buffer at room temperature for 15 minutes each; and wash twice in 0.5x SSC buffer at 65 C
for 20 minutes each.
[0053] High Stringency (detects sequences that share at least 80% sequence identity):
Hybridization in 5x-6x SSC buffer at 65-70 C for 16-20 hours; wash twice in 2x SSC buffer at room temperature for 5-20 minutes each; and wash twice in lx SSC buffer at 55-70 C for 30 minutes each.
[0054] Moderate Stringency (detects sequences that share at least 50% sequence identity):
Hybridization in 6x SSC buffer at room temperature to 55 C for 16-20 hours;
wash at least twice in 2x-3x SSC buffer at room temperature to 55 C for 20-30 minutes each.
[0055] With respect to all probes discussed, supra, the probe may comprise additional nucleic acid sequences, for example, promoters; transcription signals; and/or vector sequences. Any of the probes discussed, supra, may be used to define additional markers that are tightly-linked to a gene involved in phytophthora resistance, and markers thus identified may be equivalent to exemplary markers named in the present disclosure, and thus are within the scope of the disclosure.
[0056] Marker-assisted breeding: As used herein, the term "marker-assisted breeding" may refer to an approach to breeding directly for one or more complex traits (e.g., phytophthora resistance).
In current practice, plant breeders attempt to identify easily detectable traits, such as flower color, seed coat appearance, or isozyme variants that are linked to an agronomically desired trait. The plant breeders then follow the agronomic trait in the segregating, breeding populations by following the segregation of the easily detectable trait. However, there are few of these linkage relationships available for use in plant breeding.
[0057] Marker-assisted breeding provides a time- and cost-efficient process for improvement of plant varieties. Several examples of the application of marker-assisted breeding involve the use of isozyme markers. See, e.g., Tanksley and Orton, eds. (1983) Isozymes in Plant Breeding and Genetics, Amsterdam: Elsevier. One example is an isozyme marker associated with a gene for resistance to a nematode pest in tomato. The resistance, controlled by a gene designated Mi, is located on chromosome 6 of tomato and is very tightly linked to Aps 1 , an acid phosphatase isozyme. Use of the Apsl isozyme marker to indirectly select for the Mi gene provided the advantages that segregation in a population can be determined unequivocally with standard electrophoretic techniques; the isozyme marker can be scored in seedling tissue, obviating the need to maintain plants to maturity; and co-dominance of the isozyme marker alleles allows discrimination between homozygotes and heterozygotes. See, e.g., Rick (1983) in Tanksley and Orton, supra.
[0058] Quantitative trait locus: As used herein, the term "Quantitative trait locus" (QTL) may refer to stretches of DNA that have been identified as likely DNA sequences (e.g., genes, non-coding sequences, and/or intergenic sequences) that underlie a quantitative trait, or phenotype, that varies in degree, and can be attributed to the interactions between two or more DNA sequences (e.g., genes, non-coding sequences, and/or intergenic sequences) or their expression products and their environment. Quantitative trait loci (QTLs) can be molecularly identified to help map regions of the genome that contain sequences involved in specifying a quantitative trait.
[0059] As used herein, the term "QTL interval" may refer to stretches of DNA
that are linked to the genes that underlie the QTL trait. A QTL interval is typically, but not necessarily, larger than the QTL itself. A QTL interval may contain stretches of DNA that are 5' and/or 3' with respect to the QTL.
[0060] Sequence identity: The term "sequence identity" or "identity," as used herein in the context of two nucleic acid or polypeptide sequences, may refer to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
[0061] As used herein, the term "percentage of sequence identity" may refer to the value determined by comparing two optimally aligned sequences (e.g., nucleic acid sequences) over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleotide or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity.

[0062] Methods for aligning sequences for comparison are well-known in the art. Various programs and alignment algorithms are described in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443;
Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet etal. (1988) Nucleic Acids Res.
16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol.
Biol. 24:307-31;
Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50. A detailed consideration of sequence alignment methods and homology calculations can be found in, e.g., Altschul et al. (1990) J. Mol.
Biol. 215:403-10.
[0063] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLASTTm; Altschul et al. (1990)) is available from several sources, including the National Center for Biotechnology Information (Bethesda, MD), and on the internet, for use in connection with several sequence analysis programs. A description of how to determine sequence identity using this program is available on the interne under the "help"
section for BLASTTm. For comparisons of nucleic acid sequences, the "Blast 2 sequences" function of the BLASTTm (Blastn) program may be employed using the default BLOSUM62 matrix set to default parameters. Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identity when assessed by this method.
[0064] Single-nucleotide polymorphism: As used herein, the term "single-nucleotide polymorphism" (SNP) may refer to a DNA sequence variation occurring when a single nucleotide in the genome (or other shared sequence) differs between members of a species or paired chromosomes in an individual. Within a population, SNPs can be assigned a minor allele frequency that is the lowest allele frequency at a locus that is observed in a particular population. This is simply the lesser of the two allele frequencies for single-nucleotide polymorphisms. Different populations are expected to exhibit at least slightly different allele frequencies. Particular populations may exhibit significantly different allele frequencies. In some examples, markers linked to phytophthora resistance are SNP markers.
[0065] SNPs may fall within coding sequences of genes, non-coding regions of genes, or in the intergenic regions between genes. SNPs within a coding sequence will not necessarily change the amino acid sequence of the protein that is produced, due to degeneracy of the genetic code. An SNP in which both forms lead to the same polypeptide sequence is termed "synonymous"
(sometimes called a silent mutation). If a different polypeptide sequence is produced, they are termed "non-synonymous." A non-synonymous change may either be missense or nonsense, where a missense change results in a different amino acid, and a nonsense change results in a premature stop codon. SNPs that are not in protein-coding regions may still have consequences for gene splicing, transcription factor binding, or the sequence of non-coding RNA.
SNPs are usually biallelic and thus easily assayed in plants and animals. Sachidanandam (2001) Nature 409:928-33.
100661 Trait or phenotype: The terms "trait" and "phenotype" are used interchangeably herein.
For the purposes of the present disclosure, a trait of particular interest is phytophthora resistance.
QTL-based identification of markers linked to a trait of interest A. Overview 100671 In some embodiments, a trait (e.g., phytophthora resistance) is mapped using a strategy that is different from traditional mapping approaches. For example, a trait may be mapped according to a strategy that, for the sake of convenience, may be described as comprising 4 steps. In a first step, QTL interval target regions that correspond to a trait (e.g., Rps 1 -k) to be mapped may be determined. In a second step, markers (e.g., SNP markers) may be selected which are located within or near determined QTL intervals of the target genome (e.g., soybean genome). In a third step, specific primers may be designed that facilitate the genotyping of individual subjects with respect to selected markers. In particular examples, specific primers are designed for use in a KASPARTM or TAQMANTm genotyping assay in phytophthora resistant and susceptible soybean lines. In a fourth step, populations that show segregation for the trait may be screened using the specific primers to identify those markers that are linked to the trait. See, e.g., Fig. 1.
B. Markers linked to a trait of interest and the identification thereof 100681 Determination of QTL interval target regions and identification of markers.
[0069] QTLs may be determined by any technique available to those of skill in the art. For example, the physical positions of a QTL that corresponds to a particular trait of interest may be initially determined by reference to the location of genes that are known to contribute to the CA 02845444 2014-03-.11 . .
particular trait. In some embodiments, phytophthora resistance genes may be identified on different regions of chromosome 3. In some embodiments, the initially identified QTLs are grouped or divided into a less complicated or extensive list of QTLs that may have boundaries in the genome that are the same or different than the boundaries of the initially identified QTLs.
100701 In some embodiments, a region of DNA may be selected that is likely to contain markers that are linked to the QTL trait. This region may be referred to as a QTL
interval. For example, a QTL interval may be a region of DNA that includes the QTL and additional genomic DNA that is near the QTL in either, or both, the 5' and 3' directions. In some embodiments, a QTL interval may be about 4 Mb; about 3.5 Mb; about 3 Mb; about 2.5 Mb; about 2 Mb; about 1.5 Mb; 1 Mb; 0.5 Mb;
or about 0.25Mb.
100711 In particular embodiments, the target genome may be searched to identify markers that are physically located in, near, or between the QTLs and QTL intervals. If a reference map containing the location of known markers is available for the target genome, the reference map may be used to identify markers. Nucleic acid sequences of the target genome may also be searched, for example, by software such as BLASTTm. In some embodiments, SNP markers may be identified. In some embodiments, markers may be identified that are physically located in, near, or between QTLs and QTL intervals of the soybean genome that correspond to the phytophthora resistance trait. In particular examples, identified SNP markers that are physically located in, near, or between QTLs and QTL intervals of the soybean genome that correspond to the phytophthora resistance trait may be selected from the group consisting of the markers identified as being linked to phytophthora resistance and listed in Table 4A.
100721 In other embodiments, particular markers may be selected from the identified markers that are physically located in, near, or between QTLs and QTL intervals that correspond to a trait of interest, which markers are polymorphic among the parental lines from which a mapping population will be generated. Polymorphism of a given marker among the parental lines is directly related to the ability to trace recombination events in a mapping population produced from the parental lines.
100731 In particular examples, polymorphic markers among parental soybean lines are selected to screen phytophthora resistance mapping populations to determine which, if any, of the polymorphic markers are linked to the phytophthora resistance trait. Such markers may segregate so that one . .
allele of the SNP marker appears exclusively in phytophthora resistant individuals, and the other allele of the SNP marker appears exclusively in phytophthora susceptible individuals. Mapping populations may be generated by crossing one variety that is phytophthora resistant with another variety that is phytophthora susceptible. In embodiments, a mapping population may comprise about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 95, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, or more individuals. In some embodiments, phytophthora resistant soybean germplasm may be crossed with one or more phytophthora susceptible germplasm(s) to create mapping populations.
[0074] In some embodiments, the polymorphic markers may be single nucleotide polymorphisms (SNPs) linked to or within the gene or QTL corresponding to the phytophthora resistance trait of interest. These SNP markers may be detected by sequencing through the region containing the gene or QTL using any DNA sequencing methods known in the art, including but not limited to Sanger sequencing or high throughput sequencing ("Next Generation") methodologies that enable short or long sequence reads through the region of interest. In such embodiments, where genotyping by sequencing is used for the detection of SNP markers, primers corresponding to the flanking sequences of the region containing the SNPs in gene or QTL of interest may be used for the sequencing chemistries in order to sequence through the region of interest. In such embodiments, when different genotypes are used for sequencing through the region of interest for the detection of SNPs exemplified herein, other SNPs may be identified in addition to the SNPs exemplified herein.
In such embodiments, the SNPs exemplified herein by themselves (individual SNPs) or in combination with other SNPs linked to exemplified sequences (haplotypes) may be utilized for differentiating genotypes towards marker assisted selection of plants for the phytophthora resistance trait of interest.
[0075] Primer design and linkage screening.
[0076] Oligonucleotide probes or primers may be designed to specifically detect markers that are physically located in, near, or between QTLs and QTL intervals that correspond to a trait of interest.
In general, an oligonucleotide probe or primer may be designed that specifically hybridizes to only one allele of a marker. In some embodiments, two sets of oligonucleotide probes and primers are designed to detect an SNP marker, such that each specifically hybridizes to the SNP allele to which . .
the other probe and primer does not specifically hybridize. As is understood by those of skill in the art, the length or composition of oligonucleotide probe and primers for a particular marker may be varied according to established principles without rendering the probe non-specific for one allele of the marker.
[0077] In some embodiments, the oligonucleotide probes may be primers. In specific embodiments, primers may be designed to detect markers in a KASPARTM
genotyping assay. In particular embodiments, primers may be designed to detect markers linked to the phytophthora resistance phenotype in soybean using a KASPARTM genotyping assay. In these and further embodiments, the detection system may provide a high-throughput and convenient format for genotyping individuals in a mapping population, which may greatly facilitate the identification of individuals carrying a particular gene or trait, and may also greatly facilitate the implementation or execution of a marker-assisted selection program.
[0078] In specific embodiments, the oligonucleotide probes may be primers designed to detect markers in a TAQMAN genotyping assay. This method utilizes primers specific to the marker closely linked to the phytophthora resistance gene and fluorescent labeled probes containing a single nucleotide polymorphism (SNP). The SNP probe associated with resistance is labeled with a fluorescent dye such as FAM while the probe associated with susceptibility is labeled with a different fluorescent dye such as VIC. The data is analyzed as the presence or absence of a fluorescent dye signal. The detection system may provide a high-throughput and convenient format such as multiplexing for genotyping individuals in a mapping population, which may greatly facilitate the identification of individuals carrying a particular gene or trait, and may also greatly facilitate the implementation or execution of a marker-assisted selection program.
[0079] Additional markers may be identified as equivalent to any of the exemplary markers named herein, for example, by determining the frequency of recombination between the exemplary marker and an additional marker. Such determinations may utilize a method of orthogonal contrasts based on the method of Mather (1931), The Measurement of Linkage in Heredity, Methuen & Co., London, followed by a test of maximum likelihood to determine a recombination frequency. Allard (1956) Hilgardia 24:235-78. If the value of the recombination frequency is less than or equal to 0.10 (i.e., 10%), then the additional marker is considered equivalent to the particular exemplary marker for the purposes of use in the presently disclosed methods.
[0080] Markers that are linked to any and all phytophthora resistance genes may be identified in embodiments of the disclosure. Further, markers that control any and all of resistance contributing loci for all phytophthora races may be identified in embodiments of the disclosure.
[0081] A means for providing phytophthora resistance in soybean may be an SNP
marker allele, the detection of which SNP marker allele in soybean plants provides at least a strong indication that the plant comprising the nucleic acid sequence has the phytophthora resistance phenotype. In some examples, a means for providing phytophthora resistance in soybean is a marker selected from the group consisting of the markers described as being linked to phytophthora resistance listed in Table 4A. In particular examples, a means for providing phytophthora resistance in soybean is a marker selected from the group consisting of NCSB_000559, Gmax7x198_656813, SNP18196, NCSB 000575, Gmax7x259 44054, SNP18188, Gmax7x259 98606, BARC 064351 18628, BARC 064351 18631, and NC SB 000582.
[0082] A means for identifying soybean plants having the phytophthora resistance phenotype may be a molecule that presents a detectable signal when added to a sample obtained from a soybean plant having the phytophthora resistance genotype, but which means does not present a detectable signal when added to a sample obtained from a soybean plant that does not have the phytophthora resistance phenotype. Specific hybridization of nucleic acids is a detectable signal, and a nucleic acid probe that specifically hybridizes to an SNP marker allele that is linked to the phytophthora resistance phenotype may therefore be a means for identifying soybean plants having the phytophthora resistance phenotype. In some examples, a means for identifying soybean plants having the phytophthora resistance phenotype is a probe that specifically hybridizes to a marker that is linked to the phytophthora resistance phenotype.
B. Methods of using markers linked to a trait of interest [0083] Methods of using nucleic acid molecular markers that are linked to a trait of interest (e.g., phytophthora resistance in soybean) to identify plants having the trait of interest may result in a cost savings for plant breeders and producers, because such methods may eliminate the need to =
phenotype individual plants generated during development (for example, by crossing soybean plant varieties having phytophthora resistance with vulnerable plant varieties).
[0084] In particular embodiments, markers linked to phytophthora resistance in soybean may be used to transfer segment(s) of DNA that contain one or more determinants of phytophthora resistance. In particular embodiments, the markers may be selected from a group of markers comprising the markers listed in Table 4A and markers that are their equivalents. In some embodiments, a marker may be selected from the group consisting of NCSB_000559, Gmax7x198 656813, SNP 1 8 196, NCSB 000575, Gmax7x259 44054, SNP18188, Gmax7x259 98606, BARC 064351 18628, BARC 064351 18631, and NCSB 000582. In some embodiments, a method for using markers linked to phytophthora resistance in soybean to transfer segment(s) of DNA that contain one or more determinants of phytophthora resistance may comprise analyzing the genomic DNA of two parent plants with probes that are specifically hybridizable to markers linked to the phytophthora resistance phenotype; sexually crossing the two parental plant genotypes to obtain a progeny population, and analyzing those progeny for the presence of the markers linked to the phytophthora resistance phenotype; backcrossing the progeny that contain the markers linked to the phytophthora resistance phenotype to the recipient genotype to produce a first backcross population, and then continuing with a backcrossing program until a final progeny is obtained that comprises any desired trait(s) exhibited by the parent genotype and the phytophthora resistance phenotype. In particular embodiments, individual progeny obtained in each crossing and backcrossing step are selected by phytophthora marker analysis at each generation. In some embodiments, analysis of the genomic DNA of the two parent plants with probes that are specifically hybridizable to markers linked to phytophthora resistance phenotype reveals that one of the parent plants comprises fewer of the linked markers to which the probes specifically hybridize, or none of the linked markers to which the probes specifically hybridize. In some embodiments, individual progeny obtained in each cross and/or backcross are selected by the sequence variation of individual plants.
[0085] In some embodiments, markers linked to the phytophthora resistance phenotype may be used to introduce one or more determinants of phytophthora resistance into a plant (e.g., soybean) by genetic transformation. In particular embodiments, the markers may be selected from a group of markers comprising the markers listed in Table 4A and markers that are their equivalents. In some embodiments, a method for introducing one or more determinants of phytophthora resistance into a plant by genetic recombination may comprise analyzing the genomic DNA of a plant (e.g., soybean) with probes that are specifically hybridizable to markers linked to the phytophthora resistance phenotype to identify one or more determinants of phytophthora resistance in the plant; isolating a segment of the genomic DNA of the plant comprising the markers linked to the phytophthora resistance phenotype, for example, by extracting the genomic DNA and digesting the genomic DNA with one or more restriction endonuclease enzymes; optionally amplifying the isolated segment of DNA; introducing the isolated segment of DNA into a cell or tissue of a host plant; and analyzing the DNA of the host plant with probes that are specifically hybridizable to markers linked to the phytophthora resistance phenotype to identify the one or more determinants of phytophthora resistance in the host plant In particular embodiments, the isolated segment of DNA may be introduced into the host plant such that it is stably integrated into the genome of the host plant.
[0086] In some embodiments, markers that are linked to the phytophthora resistance phenotype may be used to introduce one or more determinants of phytophthora resistance into other organisms, for example, plants. In particular embodiments, the markers can be selected from a group of markers listed in Table 4A and markers that are their equivalents. In some embodiments, a method for introducing one or more determinants of phytophthora resistance into an organism other than soybean may comprise analyzing the genomic DNA of a plant (e.g., a soybean plant) with probes that are specifically hybridizable to markers linked to the phytophthora resistance phenotype to identify one or more determinants of phytophthora resistance in the plant;
isolating a segment of the genomic DNA of the plant comprising the one or more determinants of phytophthora resistance, for example, by extracting the genomic DNA and digesting the genomic DNA with one or more restriction endonuclease enzymes; optionally amplifying the isolated segment of DNA; introducing the isolated segment of DNA into an organism other than soybean; and analyzing the DNA of the organism other than soybean with probes that are specifically hybridizable to markers linked to the phytophthora resistance phenotype to identify the one or more determinants of phytophthora resistance in the organism. In other embodiments, the isolated segment of DNA
may be introduced into the organism such that it is stably integrated into the genome of the organism.

[0087] In some embodiments, markers that are linked to the phytophthora resistance phenotype may be used to identify a plant with one or more determinants of phytophthora resistance. In some embodiments, the plant may be a soybean plant. In particular embodiments, nucleic acid molecules (e.g., genomic DNA or mRNA) may be extracted from a plant. The extracted nucleic acid molecules may then be contacted with one or more probes that are specifically hybridizable to markers linked to the phytophthora resistance phenotype. Specific hybridization of the one or more probes to the extracted nucleic acid molecules is indicative of the presence of one or more determinants of phytophthora resistance in the plant.
[0088] In some embodiments, markers that are linked to multiple determinants of phytophthora resistance may be used simultaneously. In other embodiments, markers that are linked to only one determinant of phytophthora resistance may be used. In specific examples, markers that are linked to phytophthora resistance with respect to one or more particular Phytophthora spp. may be used simultaneously For example, a plurality of markers that are linked to phytophthora resistance with respect to different Phytophthora spp. races may be used simultaneously.
[0089] The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.
EXAMPLES
Example 1: Marker Development Strategy [0090] The following strategy was developed to identify novel SNP markers tightly linked to Rpsl-k. Nucleotide sequences which encode the two Rpsl-k disease proteins, NBS-LRR type disease resistance proteins Rpsl-k-1 and Rpsl-k-2, were identified in GenBank (Accession No:
EU450800) based on the disclosure of Gao H. and Bhattacharyya M. K. (2008) The soybean-Phytophthora resistance locus Rps 1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences. Gao and Bhattacharyya (2008) BMC
Plant Biol 8:29.
The bacterial artificial chromosome (BAC) sequence was divided into 37 fragments of about 5 kB
and each fragment was BLASTed against the soybean genomic database located on the Phytozome website (www.phytozome.com) to identify its physical location in the soybean genome. Once the physical location of Rpsl-k was identified, a set of single nucleotide polymorphism (SNP) markers were selected in the region from the soybean genomic database. KBioscience Competitive Allele-Specific PCR genotyping system (KASPARTM) assays were developed for the SNPs in the region and were screened against a panel of soybean plants that included Rpsl-k, Rpsl-a, and Rpsl-c resistant and susceptible lines. By comparing the KASPARTM genotyping data with the known phenotype of the plants from the panel, it was possible to identify the polymorphic SNP markers between Rpsl-k, Rpsl-a, Rpsl-c resistant lines and susceptible lines.
Additional validation of these selected polymorphic SNPs markers with mapping populations allowed identification of previously undescribed, novel markers that were tightly linked with Rpsl-k, and are useful for soybean marker assisted selection (MAS) for phytophthora resistance. A schematic of this strategy is outlined in Figure 1.
Example 2: Plant Material 100911 Six mapping parents of 18 plant introduction (PI) lines were included in the marker screening panel. The panel included Rpsl-k, Rpsl-a, and Rpsl-c resistant and susceptible lines that are listed in Table 2.
Table 2: Soybean lines used in the initial Rpsl-k SNP marker screening. The "Trait" column indicates which lines were susceptible or resistant to phytophthora, and identifies the trait (Rpsl-k, Rpsl-c, and Rpsl-a) associated with the phytophthora resistant lines.
Lines Entry Trait 75357-71 susceptible 75448 Rpsl-k 20430-74 Rpsl-k 20130-77 Rpsl-c . =
20281 Rpsl-c 75477 susceptible PI542044 Kunitz Rpsl-k PI547677 L59-731 Rpsl-a PI547405 L61-4222 Rpsl-a PI547679 L61-5047 Rpsl PI547834 L75-3735 Rpsl-c Maverick Rpsl-k PI547619 L75-3901 Rpsl-c PI547890 L77-1794 Rpsl-k PI547639 L77-2015 Rpsl-k PI547646 L79-1380 Rpsl-c PI547647 L79-1404 Rpsl-c PI547879 L87-0482 Rpsl-k PI591536 L90-8003 Rpsl-k PI591534 L90-8047 Rpsl-k PI591539 L91-8558 Rpsl-k PI591535 L93-7290 Rpsl-k PI548631 Williams susceptible PI518670 Williams79 Rpsl-c [0092] Three mapping populations were developed for use. The first population included 127 F23 lines from a cross between 75357-71 (susceptible) and 75448 (Rps1-k resistant). The second population consisted of 204 F2:3 lines from a cross between 20430-74 (Rps1-k resistant) and 20130-77 (Rpsl-c resistant). The third population included 125 F2:3 lines from a cross between 20281 (Rpsl-c resistant) and 75477 (susceptible).
Example 3: DNA Extraction and Sample Preparation [0093] Eight leaf discs per soybean plant were collected at the second-node stage. The DNA was extracted using the MAGATTRACTTm DNA extraction method (Qiagen, Valencia, CA) using the BIOCEL 1800Tm DNA isolation system (Agilent Technologies, Santa Clara, CA).
DNA was quantified using the NANODROP 8000TM Spectrophotometer (Thermo Scientific, Rockford, IL) per manufacturer's instructions. DNA from each of the 10 F3 progenies was pooled together per F
2:3 line. The pooled DNA samples were diluted to 1-5 nanograms/microliter (ng/
1) for genotyping.

Example 4: Phytophthor a Phenotyping 100941 For each F 2:3 lines, 10 seeds were grown in a greenhouse. The cotyledons of the soybean plants were infected by Phytophthora sojae, race 4. The infected plants were observed and the number of plants which survived versus plants which were susceptible to the infestation were recorded. If all 10 plants survived, the F2 phenotype was defined as 'r', indicating homologous Rpsl-k resistance. If all 10 plants died after infestation, the F2 phenotype was defined as 's', indicating homologous susceptible to Rpsl-k . If the 10 plants produced a mixed population which was constituted of some living and some susceptible plants the F2 phenotype was defined as if , which indicated that the plants were segregating for Rpsl-k resistance.
Example 5: The KBioscience Competitive Allele-Specific PCR genotyping system (KASPARTM) 100951 The KASPARTM genotyping system is comprised of two components (1) the SNP-specific assay (a combination of three unlabelled primers), and (2) the universal Reaction Mix, which contains all other required components including the universal fluorescent reporting system and a specially-developed Taq polymerase. The three primers, allele-specific 1 (Al), allele-specific 2 (A2), and common (Cl), or reverse, (Table 4) were designed using the assay design algorithm of the workflow manager, Kraken (KBiosciences, Hoddesdon, Hertfordshire, UK).
100961 An Assay Mix of the three primers was made, consisting of 12 micromolar ( M) each of Al and A2 and 30 [IM of CI. The universal Reaction Mix was diluted to 1X and an additional amount of MgCl2 was added so that the final MgC12 concentration of Reaction Mix at 1X
concentration was 1.8 millimolar (mM). DNA was dispensed into 384 well PCR
plates at a concentration of 1-5 ng/ 1 per well and was dried down in the plates in a 65 C oven for 1 hour and 15 minutes. The Assay Mix and universal Reaction Mix were combined in a 1:54 ratio and 4 1 was dispensed into the DNA plates using a liquid handler robot, so that the final amount of the Assay Mix in the plate was 0.07 1 and the final amount of the diluted Reaction Mix was 3.93 I.
GENEAMP PCR SYSTEM 9700TM machines (Applied Biosystems, Foster City, CA) were used for thermocycling with the following conditions: 94 C for 15 minutes, 20 cycles of 94 C for 10 seconds, 57 C for 5 seconds, 72 C for 10 seconds; 22 cycles of 94 C for 10 seconds, 57 C for 20 seconds, 72 C for 40 seconds. After thermocycling was complete, allele-specific fluorescent intensities were read using a PHERASTAR Spectrofluorometer (BMG LabTech, Cary, NC) at room temperature and data was uploaded to the Kraken system for analysis.
Example 6: Genotyping Data Analysis [0097] The J<j5p.,J?TM reaction incorporates the use of the fluorophores FAM
and VIC into the Al and A2 primers which were respectively designed to bind susceptible and resistant genotypes for each SNP marker. The passive reference dye ROX was also incorporated into the reaction to normalize variations in fluorophore signal caused by differences in well-to-well liquid volume.
Using Kraken, the results of the KASPARTM reactions for each sample was plotted on the x- and y-=
axes of a graph. The x- axes were plotted with samples that resulted in reactions which produced FAM fluorescence and the y- axes were plotted with samples that resulted in reactions which produced VIC fluorescence. The different resistant and susceptible genotypes were determined according to the location of each sample clusters (Figure 2).
[0098] A total of 115 independent KASPARTM assays were developed to detect SNPs that were identified in the 1.7 to 4.9 megabase pair (Mbp) region on chromosome 3 (Table 3). The resulting 115 KASPARTM assays were subsequently screened on the panel of soybean lines described in Table 2. The results of this screening via the KASPARTM assays resulted in the identification of 24 novel markers. The novel SNP markers are listed in shaded and bold text within Table 3. Next, the 24 markers were used to screen the 3 mapping populations which were described in Example 2.
Table 3: List of the 115 SNP markers screened on the marker screening panel.
Position Start Marker Name Sequence SNP (bp) (bp) End (bp) NCSB_000547 SEQ ID NO: 1 A/G 1764856 NCSB 000548 SEQ ID NO: 2 TIC

NCSB 000549 SEQ ID NO: 3 A/G 1971666 1971634 1971754 SNP5s83 Magellan SEQ ID NO: 4 TIC 1995295 1195235 1995355 BARC_042969 08482 SEQ M NO: 5 A/C ¨ 1999380 BARC_042969_08479 SEQ ID NO: 6 TIC ¨ 1999446 2000006 SNP09979 SEQ LD NO: 7 TIC 2030525 2030494 2030614 NCSB 000550 SEQ ID NO: 8 A/G

SNP5610_Magellun SEQ,11) NO: 9 A/G 2095329 2 095333 2095389 e SNP5617_Magellan SEQ ID NO: 10 A/G 2134691 2134631 2134751 NCSB 000551 SEQ ID NO: 11 TIC

SNP5631_Magellan SEQ ID NO: 12 TIC 2194394 2194334 2194454 NCSB 000552 SEQ ID NO: 13 A/G 2239604 2239560 2239680 BARC_044123_08621 SEQ ID NO: 14 C/G 2277352 NCSB 000553 SEQ ID NO: 15 A/T 2322483 2322435 2322555 NCSB 000554 SEQ ID NO: 16 A/G 2414989 2414939 2415059 Cmax7x162 1365688 SEQ ID NO: 17 A/G 2457747 NCSB 000555 SEQ ID NO: 18 A/G 2483210 2483173 2483293 Gmax7x162_1451621 SEQ ID NO: 19 ATI' ¨ 2543138 . =

NO: 20 T/C 2551406 2551360 2551480 -BARC_ 1fr 7_11277 SEQ ID NO: 21 C/C; ¨
2555405 245166 r BARC_051877_11280 SEQ ID NO: 22 A/G ¨

SNPI 3.346 SEQ ID
NO: 23 T/G 2735461 2735393 2735513 BARC 027728 06650 1 SEQ ID NO: 24 A/G

BARC_027728_06650_2 SEQ ID NO: 25 T/C

NCSB_000557 SEQ ID
NO: 26 T/C 2746959 2746900 2747020 BARC_030965_06980 SEQ ID NO: 27 T/C

NO: 28 C/G 2827042 2826974 2827094 NCSB_000559 SEQ ID
NO: 29 ATP 2904801 2904738 2904858 Gmax7x198_656813 SEQ ID NO: 30 A/T ¨

SNP3510_P1516C SEQ ID
NO: 31 T/C 2915547 2915487 2915607 BARC 041781_08094 1 SEQ ID NO: 32 T/C

BARC_041781_08094_2 SEQ ID NO: 33 A/T

BARC_041781_08098 SEQ ID NO: 34 T/C

11) NO: 35 A/C 2979605 2979546 2979666 BARC_028645_05979 SEQ ID NO: 36 T/C

NCSB_000561 SEQ
NO: 37 All' 3003271 3003212 3003332 BARC_056039_14002 SEQ rD NO: 38 T/C

BARC_056115_14110 SEQ ID NO: 39 T/G

NCSB_000562 SEQ ID
NO: 40 A/C 3045691 3045608 3045728 NCSB_000563 SEQ ID
NO: 41 A/T 3084032 3083955 3084075 SNP5728_Magellan SEQ ID
NO: 42 T/C 3096381 3096321 3096441 NCSB 001474 SEQ ID NO: 43 All' --NO: 44 A/C 3132867 3132793 3132913 BARC_013815_01247 SEQ ID NO: 45 MT ¨

NCSB_000565 SEQ ID
NO: 46 T/C 3176950 3176891 3177011 NO: 47 A/G 3237646 , 3237579 3237699 NO: 48 A/T 3261666 3261607 3261727 BARC_028619_05977 SEQ ID NO: 49 A/G , NCSB_000567 SEQ ID
NO: 50 T/C 3313385 3313274 3313440 Gmax7x198_230985 SEQ ID NO: 51 A/C --NCSB_000568 SEQ ID
NO: 52 ATI' 3341379 3341317 3341437 Gmax7x198_ 174690 SEQ ID NO: 53 A/G ¨

NCSB_000569 SEQ 1D
NO: 54 TIC 3394116 3394056 3394149 SE1DNO55 VI' 346 .3 3463823, 3463943 6 =
NCS13_000571 SEQ
ID NO: 56 T/C 3518009 3517924 3518044 NCSB_000572 SEQ
NO: 57 T/G 3539955 3539896 3540016 NCSB_000573 SEQ
ID NO: 58 A/G 3593983 3593905 3594025 NO: 59 T/G 3626800 3626731 3626854 NCSB_000575 SEQ
ID NO: 60 T/C 3669543 3669465 3669585 NCSB_000576 SEQ
ID NO: 61 A/C 3774187 3774117 3774237 BARC_027438_06568 SEQ ID NO: 62 T/C ¨

BARC 064351 18627 SEQ ID NO: 63 T/C ¨

BO4C__064351 1864 sEil ID NO: 64 _ BARC_064351_18629 SEQ ID NO: 65 T/C

BARC 064351 18630 SEQ ID NO: 66 T/C

BARC 064351_18631 SEQ ID NO: 67 T/C ¨"M

ID NO: 68 A/C 3843479 3843406 3843k6 NCSB_000577 SEQ
ID NO: 69 T/G 3862087 3862027 3862147 NCSB_000174 SEQ ID NO: 70 T/C

SNP5855_Magellan SEQ
ID'NO: 71 A/C 3874278 3874218 3874309 Gmai7x259 98606 _ SEQ ID NO: 72 A/C ¨

BARC 00`3095 002S1 Q 11) NO 7') ,V(J

SNP181:*: SEQ
ID NO: 74 TIC 3915285 3915214 3915334 = NCSI$ 000578 SEQ
ID NO: 75 Tiki 3927664 3927,784 Gum 7x-'59 53;91 SEQ ID NO 7() 3934846 3µr4966 =Gm47x2/59 44054 SEQ-111 NO: 77 A/C 3944185 3944305 ID NO: 78 T/C 3953122 3953050 3953170 BARC_014709_01624 SEQ ID NO: 79 A/C ¨

BARC_014709_01625 SEQ ID NO: 80 A/G ¨

BARC_014709_01626 SEQ NO: 81 T/C

BARC_014709_01628 SEQ ID NO: 82 T/C

BARC_014709_01629 SEQ ID NO: 83 T/G

BARC_014709_01630 SEQ ID NO: 84 T/C

BARC 014709 01631 SEQ ID NO: 85 A/G
_ Gmax7x259 17365 SEQ ID NO: 86 A/G ¨

BARC_051499_11144 SEQ
ID NO: 87 T/C 4038123 4038071 4038430 BARC_051499_11145 SEQ
ID NO: 88 C/G 4038339 4038071 4038430 BARC_064081_18547 SEQ ID NO: 89 A/G

NCSB_000160 SEQ ID NO: 90 T/C

NCSB_000580 SEQ
ID NO: 91 A/T 4198334 4198261 4198306 = = , BARC 060517 16709 SEQ ID NO: 92 A/G ¨

N613 00W5S2 _SEQ ID NO: 93 A/C ¨

BARC_058135_15105 SEQ ID NO: 94 TIC

BARC 058135 15106 SEQ ID NO: 95 C/G

BARC 058135_15107 SEQ ID NO: 96 T/G

BARC_058135_15108 SEQ ID NO: 97 A/G

BARC_058135_15109 SEQ ID NO: 98 TIC

BARC_058135_15110 SEQ ID NO: 99 T/G

NCSB_000583 SEQ
ID NO: 100 A/C 4602406 4602328 4602448 NCSB_000584 SEQ
ID NO: 101 TIC 4649955 4648129 4650001 BARC_043191_08550 SEQ ID NO: 102 TIC

BARC_043191_08551 SEQ NO: 103 , A/G

5NP5970_Magellan SEQ
ID NO: 104 A/C 4694539 4694389 4694559 NCSB_000585 SEQ
ID NO: 105 TIC 4738427 4738342 4738462 NCSB_000586 SEQ
ID NO: 106 A/G 4775267 4775207 4775327 BARC_057997_15049 SEQ ID NO: 107 A/G

BARC_057997_15050 SEQ ID NO: 108 TIC

NCSB_000587 SEQ
ID NO: 109 A/G 4831681 4831609 4831727 SNP5996_Magellan SEQ
ID NO: 110 A/C 4837292 4837232 4837347 =
NCSB_000588 SEQ ID NO: 111 TIC 4894872 4894798 4894918 BARC_044085_08610_1 SEQ ID NO: 112 TIC ¨

BARC_044085_08610_2 SEQ ID NO: 113 A/G

BARC_044085_08610_3 SEQ ID NO: 114 T/C

BARC_046750_12729 SEQ ID NO: 115 A/G

Example 7: Mapping and Statistical Analysis [0099] Pearson's Chi-squared test was used to analyze the association between the 24 SNP
markers described in Table 2 and the Rpsl-k resistance phenotype. JMP 9.0 (SAS, Cary, NC) was used for all Chi-squared analysis. As a result of the statistical analysis of the data from the 3 mapping populations, 10 of the 24 markers were determined to be tightly linked with Rpsl-k specific phytophthora resistance and produced p-values less than 0.0001. These 10 tightly linked markers are shown in Table 4A and the KASParTM assay primer sequences are described in Table 4B. All 10 markers were polymorphic in the Rpsl-k x Rpsl-c soybean line mapping population and were polymorphic in the Rpsl-k soybean line population. The sample segregation ratio (AA:AB:BB) in the Rpsl-k x Rpsl-c mapping population was roughly 1:2:1 for the 10 SNPs. The , .
Chi-squared association test data are show in Table 5 for the Rpsl-k x Rpsl-c mapping population and in Table 6 for the Rpsl-k mapping population.
[00100] There are several explanations for the low R2 values shown in Tables 5 and 6. The Rpsl-k gene(s) are a class of highly clustered R genes encoding coiled coil-nucleotide binding site leucine-rich repeat (CC-NBS-LRR) proteins (Gao et al. 2005). The soybean genome is estimated to contain about 38 copies of similar Rpsl-k gene sequences, most of which are clustered in approximately 600 kb of contiguous DNA of the Rpsl-k region (Bhattacharyya et al. 2005). The identification of unique and specific nucleotide sequences for designing primers and probes from such a high number of gene copies within this gene family is challenging. The lack of readily identifiable gene-specific markers may explain the low R2 values.
[00101] In addition, it is possible that Rpsl-k resistance is caused by other Rps QTLs in addition to the Rpsl-k gene. Partial resistance to phytophthora that is not gene-specific has been reported in many publications (Burnham et al. 2003; Ferro et al. 2006; Li et al. 2010;
Ranathunge et al. 2008;
Tucker et al. 2010). Currently, the phenotyping process cannot separate partial resistance from gene-specific resistance. The phenotypic complexity of this disease and the multiple copies of highly similar gene sequences make marker development more elusive and highly challenging.
[00102] JOINMAPO 4.0 (Van Ooijen, 2006) was used to construct a linkage group (LG) to confirm that the markers were mapped with the phytophthora phenotypic trait together on LG N of chromosome 3. QTL analysis was carried out using JMP Genomics 5.0 (SAS, Cary, NC). QTL
analysis confirmed that all the polymorphic SNPs were mapped together with Rpsl-k phenotypic resistance on the same linkage group (Figure 3).
Table 4: Summary of the 10 SNP markers that are used for identification of phytophthora resistant soybean lines and their KASPARTM primer sequences.
Table 4A:
Sequence of SNP
Polymorphism Marker Comprising Physical Present in Phytophthora Location on Breeding SNP Marker SNP Resistance Chromosome 3 Population 2,904,738 to 1-k x 1-c Gmax7x198 656813 MT at bp 61 SEQ ID NO:151 2,904,858 . . .
2,907,997 to 1-k x 1-c NCSB_000559 A/T at bp 61 SEQ ID NO:150 2,908,117 3,843,406 to 1-k x 1-c and 1-SNP18196 AJG at bp 61 SEQ ID NO:152 3,843,526 k 3,669,465 to 1-k x 1-c NCSB 000575 T/C at bp 61 SEQ ID NO:153 3,669,585 3,994,185 to 1-k x 1-c and 1-Gmax7x259_44054 A/G at bp 61 SEQ ED NO:154 3,994,305 k 3,915,214 to 1-k x 1-c SNP18188 T/G at bp 61 SEQ ID NO:155 3,915,334 3,889,538 to 1-k x 1-c Gmax7x259_98606 A/G at bp 61 SEQ ID NO:156 3,889,658 3,826,881 to 1-k x 1-c and 1-BARC_064351_18628 A/G at bp 95 SEQ ID NO:157 3,827,418 k 3,826,881 to 1-k x 1-c and 1-BARC_ 064351 18631 TIC at bp 73 SEQ BD NO:158 3,827,418 k 4,547,450 to 1-k x 1-c and 1-NCSB 000582 A/G at bp 61 SEQ ID NO:159 4,547,570 k Table 4B:
Primer Sequence Gmax7x198_656813_Al SEQ ID NO: 116 , Gmax7x198_656813_A2 SEQ ID NO: 117 Gmax7x198_656813_Cl SEQ ID NO: 118 , . NCSB 000559 Al SEQ ID NO: 119 NCSB 000559 A2 SEQ ID NO: 120 NCSB 000559 Cl SEQ ID NO: 121 SNP18196_A1 SEQ ID NO: 122 SNP18196_A2 SEQ ID NO: 123 SNP18196_C1 SEQ ID NO: 124 NCSB_000575_Al SEQ ID NO: 125 NCSB_000575_A2 SEQ ID NO: 126 NCSB_000575_Cl SEQ ID NO: 127 Gmax7x259_44054_A1 SEQ ID NO: 128 _ Gmax7x259_44054_A2 SEQ ID NO: 129 Gmax7x259_44054_C1 SEQ ID NO: 130 SNP18188 Al SEQ ID NO: 131 SNP18188_A2 SEQ ID NO: 132 SNP18188_C1 SEQ ID NO: 133 Gmax7x259_98606_Al SEQ ID NO: 134 Gmax7x259_98606_A2 SEQ ID NO: 135 , . .
Gmax7x259_98606_C1 SEQ ID NO: 136 BARC 064351_18628 Al SEQ ID NO: 137 BARC_064351_18628_A2 SEQ ID NO: 138 BARC_064351_18628_Cl SEQ ID NO: 139 BARC_064351_18631_Al SEQ ID NO: 140 BARC_064351_18631_A2 SEQ ID NO: 141 BARC_064351_18631_C1 SEQ ID NO: 142 NCSB_000582_A1 SEQ ID NO: 143 NCSB 000582_A2 SEQ ID NO: 144 NCSB_000582_C1 SEQ ID NO: 145 Table 5: The association tests of the 10 SNP genotypes with the Rpsl-k resistant phenotypes in the Rpsl-k x Rpsl-c mapping population (p<0.0001).
% Variance Resistant Chi-Explained Marker Chromosome Genotype squared (R2) LOD
Gmax7x198_656813 3 1:1 155.32 34.97 71.08 NCSB_000559 3 T:T 168.46 37.47 77.75 SNP18196 3 G:G 149.32 51 76.46 NCSB 000575 3 C:C 193.9 43.19 87.61 , Gmax7x259_44054 3 C:C 198.28 43.86 89.4 SNP18188 3 T:T 216.48 49.51 98.91 Gmax7x259_98606 3 A:A 203.62 43.91 93.47 BARC_064351_18628 3 G:G 134.26 47.94 65.12 BARC_064351_18631 3 C:C 196.44 45.33 87.77 NCSB_000582 3 G:G 200.18 44.33 91.14 Table 6: The association tests of the identified 5 polymorphic SNP genotypes with the Rpsl-k resistant phenotypes in the Rpsl-k mapping population (p<0.0001).
Resistant Chi- %
Variance Marker Chromosome Genotype squared Explained (R2) LOD
SNP18196 3 G:G 78.133 25.31 33.84 Gmax7x259_44054 3 C:C 81.87 27.87 36.08 BARC_064351_18628 3 G:G 75.19 23.38 32.8 BARC_064351_18631 3 C:C 77.93 27.2 35.96 NCSB_000582 3 G:G 84.66 28.49 36.56 1001031 The disclosure of the ten SNP markers that are tightly linked with soybean phytophthora resistance trait, Rpsl-k, provide reagents which can be utilized for the mapping of phytophthora resistance in soybean lines. The ten SNP markers were identified out of 115 SNP markers using a KASPARTM genotyping platform. The ten SNP markers that were identified were isolated and can now be utilized to screen soybean populations for phytophthora resistance, and the zygosity of soybean plants for the phytophthora QTL. All ten of the SNP markers were mapped on chromosome 3 to linkage group N. The ten SNP markers comprise a contiguous chromosomal fragment which contains QTL for phytophthora resistance. The contiguous chromosomal fragment spans a fragment comprising base pair 2,904,738 to 4,547,450 on chromosome 3 as is illustrated in Figure 3.
Example 8: Plant Material and DNA Extraction 1001041 The Rpsl-k TAQMANTm assay was validated using a soybean breeding population, consisting of 359 lines that were segregating for Rpsl-k resistance. Genomic DNA from the soybean lines was isolated from 1 leaf disc per sample using the MAGATTRACTTm DNA
extraction kit (Qiagen, Valencia, CA) per manufacturer's instructions.

Example 9: Endpoint TAQMANTm Assay Development 1001051 The endpoint TAQMANTm assay was developed for the detection of phytophthora locus Rpsl-k resistance and is based on the sequence of a tightly linked Single Nucleotide Polymorphism (SNP) marker. The SNP marker, BARC_064351_18631 (SEQ ID NO:158), was identified as linked to the Rpsl-k locus on linkage group N and features a T:C SNP. The presence of the T allele indicates that soybean plants are susceptible to phytophthora infestation, while the presence of the C
allele indicates that soybean plants are resistant to phytophthora infestation. The Rpsl-k TAQMANTm assay resulted in the amplification of a 72-bp fragment using the common forward primer, D-Sb-Rpslk-F, and common reverse primer, D-Sb-Rpslk-R. The oligonucleotide probe specific to the resistant allele (D-Sb-Rpslk-FM) and that of the susceptible allele (D-Sb-Rpslk-VC) bind to the amplicon between the two primers and are labeled with the FAM and VIC fluorescent reporter dyes, respectively, at the 5' end and MGBNFQ (minor grove binding non-fluorescent quencher) as a quencher at the 3' end. PCR products are measured using a spectrofluorometer at the end of the thermocycling program. Genotype is determined by the presence or absence of fluorescence specific to either the resistant allele or the susceptible allele. Common primers and = allele specific probes were designed using Applied Biosystem's Custom Design service (Foster City, CA). Primer and probe sequences are listed in Table 7.
Table 7: List of primers and probes for Rpsl-k TAQMANTm endpoint assay.
SEQI
Name Function Sequence D-Sb-Rpslk-F forward primer TGAAGCTGCTAAACCACCAGAAT

AATTGCTAAGGTCAATCACTGAATATTG
D-Sb-Rpslk-R reverse primer GA

D- Sb-Rps1k-FM resistant probe ATTCCCATAGCTCCCG

D-Sb-Rpslk- susceptible VC probe CATTCCCATAACTCCCG

Example 10: PCR Conditions and Analysis [001061 Components for a TAQMANTm reaction containing oligonucleotides specific for Rpsl-k genomic sequence are shown in Table 8. The PCR reaction mixture was prepared as a Master Mix containing all components except the DNA templates. The PCR reaction mix was dispensed into a 384-well plate (Abgene, Rochester, NY). Genomic DNA templates and positive and negative controls, shown in Table 9, were then included in separate wells of the plate.
The reactions was amplified in a GENAMP PCR SYSTEM 9700TM (Applied Biosystems, Foster City, CA) under the following cycling conditions: 1 cycle at 50 C for 2 minutes; 1 cycle at 95 C
for 10 minutes; and 35 cycles at 95 C for 15 seconds and 60 C for 30 seconds. Following completion of the TAQMANTm PCR and fluorescence reading reactions, a distribution graph was generated.
Example 11: Validation of the Rpsl-k TAQMANTm Assay [00107] The TAQMANTm assay was validated using a soybean breeding population of 359 lines which were segregating for phytophthora resistance (Figure 4). Homozygous samples containing the Rpsl-k susceptible allele resulted in Relative Fluorescence Units (RFU) readings of the VIC dye only. These samples are shown in the upper left hand cluster and have a genotype of T:T.
Heterozygous samples which contain one copy of the Rpsl-k susceptible allele and a second copy of the Rpsl-k resistant allele are shown in the upper right hand cluster and have a genotype of T:C.
Homozygous samples containing the Rpsl-k resistant allele are shown in the lower right cluster and have a genotype of C:C. Samples that were heterozygous or homozygous for the Rpsl-k resistant allele resulted in Relative Fluorescence Units (RF'U) readings for the FAM dye at least 0.5-1 unit higher than that of the no template control (NTC), which is shown in the lower left hand corner.
[00108] Genotypic calls for the population were compared with those of alternative gel-based PCR assay and the phenotypic scores which were determined from susceptibility or resistance to phytophthora infestation. The genotypes based on the TAQMANTm assay of the breeding population corresponded with the genotypes based on the alternative gel-based PCR assay (only one sample of the 354 lines showed a discrepancy between the alternative gel-based PCR method and the novel TAQMANTm assay).
Table 8: PCR mix for Rpsl-k TAQMANTm assay Component Stock Concentration Final Volume ( 1) TAQMANTm Genotyping Master Mix 2X 2.0 . , D-Sb-Rps 1 k-F 201.tM 0.1 D-Sb-Rps 1 k-R 20 M 0.1 D-Sb-Rpslk-VC 10 M 0.1 D-Sb-Rps 1 k-FM 10 M 0.1 0.8% Polyvinylpyrrolidone (PVP) 0.6 Sample DNA 1.0 Total volume 4.0 Table 9: Positive and negative controls for Rpsl-k assay.
Type of Control Description Expected Result Interpretation Master mix negative No DNA is added to Background RFU Mix is not control the reaction. readings. No PCR
contaminated.
products.
Mut/Resistant DNA Genomic DNA The FAM fluorescent Control shows positive control sample known to be signal is the only amplification of homozygous for the signal observed. No the resistance Rps 1 -k resistance is VIC signal present. allele (FAM) and added. no amplification from the susceptible (VIC) allele from genomic DNA.
Heterozygous DNA Genomic DNA The FAM and VIC Control shows positive control sample known to be signal are both present amplification of heterozygous for the at equal units. the resistant Rps 1 -k resistance is allele (FAM) and added. the susceptible allele (VIC) from genomic DNA.
Wildtype / Genomic DNA The VIC fluorescent Control only Conventional DNA sample known to be signal is the only shows negative control homozygous for the signal observed. No amplification of Rps 1 -k susceptibility FAM signal present. the susceptible is added. allele (VIC) and no amplification of the resistant allele (FAM) from genomic DNA.

[00109] The TAQMAN detection method for phytophthora resistance in soybean was tested against ,354 soybean lines which comprise phytophthora resistant and phytophthora susceptible phenotypes. The assay was successfully designed to specifically detect the soybean SNP marker BARC 064351 18631 (SEQ ID NO:158) which identifies soybean plants that are resistant to phytophthora. The event specific primers and probes can be used effectively for the detection of the soybean SNP marker BARC 064351_18631 (SEQ ID NO:158) and these conditions and reagents are applicable for zygosity assays.
[00110] Finally, the skilled artisan would appreciate that the TAQMAN method described in the preceding examples is readily applicable for the detection of the other soybean SNP markers, described within this disclosure, which can be used to identify soybean plants that are resistant to phytophthora resistance. For example, the SNP markers of Table 4A provide sequences that can be used for the design of primers and probes which can be specifically used to detect the SNP
marker via a TAQMAN assay. In addition, the TAQMAN assay conditions may be modified by altering the reagent components, and changing the amplification temperatures and conditions.
The skilled artisan would understand that the teachings of this disclosure provide guidance to design such TAQMAN assays for the detection of any SNP markers disclosed herein. For example; TAQMAN assays for the detection of the phytophthora resistance SNP
markers of Gmax7x198 656813 (SEQ ID NO:151), NCSB 000559 (SEQ ID NO:150), SNP18196 (SEQ
ID NO:152), NCSB 000575 (SEQ ID NO:153), Gmax7x259 44054 (SEQ ID NO:154), SNP18188 (SEQ ID NO:155), Gmax7x259 98606 (SEQ ID NO:156), BARC 064351 18628 (SEQ ID NO:157), and NCSB 000582 (SEQ ID NO:159) are within the scope of the current disclosure.
[00111] While aspects of this invention have been described in certain embodiments, they can be further modified within the spirit and scope of this disclosure. This application is therefore intended to cover any variations, uses, or adaptations of embodiments of the invention using its general principles. Further, this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which these embodiments pertain and which fall within the limits of the appended claims.

=
DEIVIA.NDES OU BREVETS VOLUMINEUX
. LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME I DE a NOTE: Pour les tonics additionels, veillez contacter le Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME I OF ______________________________________ .
NOTE: For additional volumes please contact the Canadian Patent Office.

Claims (40)

What is claimed is:

1. A method for identifying at least one determinant of phytophthora resistance in a soybean plant, the method comprising:
isolating nucleic acid molecules from a soybean plant; and, screening the isolated nucleic acid molecules for a marker linked to the phytophthora resistance phenotype in the soybean plant, wherein the marker is genetically linked to a marker selected from the group consisting of NC SB_000559, Gmax7x198_656813, SNP18196, NCSB_000575, Gmax7x259_44054, SNP18188, Gmax7x259_98606, BARC_064351_18628, BARC_064351_18631, and NCSB_000582 and the presence of the marker is indicative of phytophthora resistance in the soybean plant.

2. The method according to claim 1, wherein the marker linked to the phytophthora resistance phenotype in the soybean plant is in soybean linkage group N.

3. The method according to claim 1, wherein the isolated nucleic acid molecules are genomic DNA.

4. The method according to claim 1, wherein screening the isolated nucleic acid molecules for a marker linked to the phytophthora resistance phenotype in the soybean plant is performed using competitive allele-specific polymerase chain reaction.

5. The method according to claim 4, wherein the at least one determinant of phytophthora resistance in the soybean plant is Rps1-k.

6. The method according to claim 1, further comprising determining the genotype of the soybean plant for the marker linked to the phytophthora resistance phenotype in the soybean plant.

7. A soybean plant identified by the method according to claim 6.

8. A plant comprising the at least one determinant of phytophthora resistance in a soybean plant of claim 1, wherein the plant is not a soybean plant.

9. A method for producing a phytophthora resistant soybean plant, the method comprising:
crossing a soybean plant having the trait of phytophthora resistance with a soybean plant from a soybean plant of interest;
using marker-assisted selection to identify an F1 soybean plant comprising a marker linked to the phytophthora resistance phenotype in the soybean plant having the trait of phytophthora resistance, wherein the marker is genetically linked to a marker selected from the group consisting of NCSB_000559, Gmax7x198_656813, SNP18196, NCSB_000575, Gmax7x259_44054, SNP18188, Gmax7x259_98606, BARC_064351_18628, BARC_064351_18631, and NCSB_000582, and the F1 soybean plant has any desirable traits of the soybean plant of interest;
and, propagating the identified F1 soybean plant, thereby producing an phytophthora resistant soybean plant.

10. The method according to claim 9, wherein the marker linked to the phytophthora resistance phenotype in the soybean plant having the trait of phytophthora resistance is in soybean linkage group N.

11. The method according to claim 9, wherein the marker linked to the phytophthora resistance phenotype in the soybean plant having the trait of phytophthora resistance is on soybean chromosome number 3.

12. The method according to claim 9, wherein the soybean plant of interest is a phytophthora susceptible soybean plant.

13. The method according to claim 9, wherein marker-assisted selection is performed using competitive allele-specific polymerase chain reaction.

14. A phytophthora resistant soybean plant produced by the method according to claim 9.

15. A method for introducing phytophthora resistance to a soybean plant, the method comprising introducing a marker linked to the phytophthora resistance phenotype in soybean into a phytophthora susceptible soybean plant.

16. The method according to claim 15, wherein the marker linked to the phytophthora resistance phenotype in soybean plant is selected from the group consisting of NCSB_000559, Gmax7x198_656813, SNP18196, NCSB_000575, Gmax7x259_44054, SNP18188, Gmax7x259_98606, BARC_064351_18628, BARC_064351_18631, and NCSB_000582.

17. A nucleic acid probe substantially identical to a probe selected from the group consisting of SEQ 1D NO:150, SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153, SEQ
ID
NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, and SEQ ID

NO:159.

18. A nucleic acid probe that is specifically hybridizable to a stretch of contiguous nucleotides in the soybean genome comprising base pair 2,904,738 to 4,547,450 on chromosome 3.

19. A method for producing a phytophthora resistant plant, the method comprising:
introducing into a plant of interest at least one means for providing phytophthora resistance in soybean, thereby producing an phytophthora resistant plant.

20. The method of claim 19, further comprising propagating the plant of interest.

21. The method of claim 19, wherein the plant of interest is a legume.

22. The method of claim 19, wherein the plant of interest is selected from the group consisting of soybean, green beans, snap beans, dry beans, red beans, lima beans, mung beans, bush beans, Adzuki beans, garden peas, and cowpeas.

23. The method according to claim 1, wherein screening the isolated nucleic acid molecules comprises polymerase chain reaction.

24. The method according to claim 23, wherein polymerase chain reaction is performed using at least two primers and at least one probe that are capable of specifically hybridizing to SEQ
ID NO:150, SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID
NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, and SEQ ID NO:159.

25. The method according to claim 23, wherein polymerase chain reaction is performed using at least two primers and at least one probe that are capable of specifically hybridizing to SEQ
ID NO:158.

26. The method according to claim 23, wherein the primers and probes comprise primers and probes selected from the group consisting of SEQ ID NO:146, SEQ ID
NO:147, SEQ
ID NO:148, and SEQ ID NO:149.

27. A plant identified by the method according to claim 23.

28. The plant of claim 27, wherein the plant is a soybean plant.

29. A method for identifying a plant comprising at least one determinant of phytophthora resistance in a soybean plant, the method comprising:

isolating nucleic acid molecules from a plant; and, contacting the isolated nucleic acid molecules with means for identifying soybean plants having the phytophthora resistance phenotype to produce a detectable signal that is indicative of the presence of at least one determinant of phytophthora resistance in a soybean plant within the plant.

30. A method for transferring at least one determinant of phytophthora resistance in a soybean plant, the method comprising:
analyzing with probes that are specifically hybridizable to at least one marker that is linked to the phytophthora resistance phenotype in the soybean plant the genomic DNA
of a first plant with a donor genotype and the DNA of a second plant with a recipient genotype;
sexually crossing the two parental plant genotypes to obtain a progeny population;
analyzing the progeny population for the presence of the at least one marker that is linked to the phytophthora resistance phenotype in the soybean plant;
backcrossing an individual from the progeny population that comprises the at least one marker that is linked to the phytophthora resistance phenotype in the soybean plant to the recipient genotype to produce a next generation population;
determining if a member of the next generation population comprises a desired trait from the recipient genotype and the marker that is linked to the phytophthora resistance phenotype in the soybean plant or; and, if no member of the next generation population comprises the desired trait from the recipient genotype and the marker that is linked to the phytophthora resistance phenotype in the soybean plant, repeating steps (d) and (e) until an individual is identified that comprises the desired trait from the recipient genotype and the marker that is linked to the phytophthora resistance phenotype in the soybean plant.

31. The method of claim 30, wherein individual progeny obtained in each crossing and backcrossing step are selected by phytophthora marker analysis at each generation.

32. A method of identifying a soybean plant that displays resistance to phytophthora infestation, the method comprising detecting in germplasm of the soybean plant at least one allele of a marker locus wherein:
the marker locus is located within a chromosomal interval comprising and flanked by NCSB_000559 and NCSB_000582; and, the at least one allele is associated with phytophthora resistance.

33. The method of claim 32, wherein the marker locus is located within a chromosomal interval comprising and flanked by NCSB_000575 and Gmax7x259_44054.

34. A soybean plant identified by the method of claim 1.

35. A method of identifying a soybean plant that displays resistance to phytophthora infestation, the method comprising detecting in germplasm of the soybean plant a haplotype comprising alleles at one or more marker loci, wherein:
the one or more marker loci are located within a chromosomal interval comprising and flanked by NCSB_000559 and NCSB_000582; and, the haplotype is associated with phytophthora resistance.

36. The method of claim 35, wherein the one or more marker loci are located within a chromosomal interval comprising and flanked by NCSB_000575 and Gmax7x259_44054.

37. A soybean plant identified by the method of claim 35, wherein the soybean plant comprises within its germplasm a haplotype associated with phytophthora resistance wherein the haplotype comprises alleles at one or more marker loci located within a chromosomal interval comprising and flanked by NCSB_000559 and NCSB_000582.

38. A method of marker assisted selection comprising:
obtaining a first soybean plant having at least one allele of a marker locus, wherein the marker locus is located within a chromosomal interval comprising and flanked by NCSB_000559 and NCSB_000582 and the allele of the marker locus is associated with phytophthora resistance;
crossing the first soybean plant to a second soybean plant;
evaluating the progeny for the at least one allele; and, selecting progeny plants that possess the at least one allele.

39. The method of claim 38, wherein the marker locus is located within a chromosomal interval comprising and flanked by NCSB_000575 and Gmax7x259_44054.

40. A soybean progeny plant selected by the method of claim 38 wherein the plant has at least one allele of a marker locus wherein the marker locus is located within a chromosomal interval comprising and flanked by NCSB_000559 and NCSB_000582.