CA2834053C - Yeast strains engineered to produce ethanol from glycerol - Google Patents

Yeast strains engineered to produce ethanol from glycerol Download PDF

Info

Publication number
CA2834053C
CA2834053C CA2834053A CA2834053A CA2834053C CA 2834053 C CA2834053 C CA 2834053C CA 2834053 A CA2834053 A CA 2834053A CA 2834053 A CA2834053 A CA 2834053A CA 2834053 C CA2834053 C CA 2834053C
Authority
CA
Canada
Prior art keywords
ala
leu
gly
val
ile
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CA2834053A
Other languages
French (fr)
Other versions
CA2834053A1 (en
Inventor
Johannes Adrianus Maria De Bont
Aloysius Wilhelmus Rudolphus Hubertus Teunissen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DSM IP Assets BV
Original Assignee
DSM IP Assets BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DSM IP Assets BV filed Critical DSM IP Assets BV
Publication of CA2834053A1 publication Critical patent/CA2834053A1/en
Application granted granted Critical
Publication of CA2834053C publication Critical patent/CA2834053C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/32—Processes using, or culture media containing, lower alkanols, i.e. C1 to C6
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1018—Carboxy- and carbamoyl transferases (2.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to genetically modified yeast cells comprising exogenous genes coding for pyruvate formate lyase and acetaldehyde dehydrogenase activities. The yeast cells further comprises genetic modifications that improve glycerol utilization such as modifications that increases NAD+ -linked glycerol dehydrogenase activity, and preferably one or more of dihydroxyacetone kinase activity and transport of glycerol into the cell. The yeast cell further preferably comprises a functional exogenous xylose isomerase gene and/or functional exogenous genes which confer to the cell the ability to convert L-arabinose into D-xylulose 5-phosphate and they may comprise a genetic modification that increase acetyl-CoA synthetase activity. The process is further characterised in that glycerol is present in or fed into the culture medium, whereby the modified yeast cell ferments the hexoses, pentoses,acetic acid and glycerol to ethanol. The invention further relates to processes for producing a fermentation product and formate from carbon sources comprising glycerol and at least one of a hexose and a pentose, wherein the genetically modified yeast cells are used to ferment the carbon sources to the fermentation product and formate. A preferred fermentation product is ethanol.

Description

Yeast strains engineered to produce ethanol from glycerol Field of the invention The present invention relates to metabolic engineering in microorganisms such as yeast. In particular the invention relates to yeast strains that have been engineered to produce ethanol from glycerol. These strains have retained their natural ability to produce ethanol from hexoses (glucose, fructose, galactose, etc) and comprise an engineered ability to produce ethanol from pentoses like xylose. The invention further relates to the processes wherein the engineered strains of the invention produce ethanol from glycerol, either as main fermentation feedstock, or concomitantly with one or more of hexoses and pentoses.
Background of the invention Both the formation and the degradation of glycerol in the yeast Saccharomyces cerevisiae are important processes that have been studied for more than a century.
During the last decades, the emphasis has been on (1) suppression of the formation of glycerol during ethanol production. In the beginning of the previous century,
(2) the optimization of glycerol production from sugars has been studied. Both of these aspects have profound economic impacts. More recently, a fully new aspect has been introduced in this glycerol field. It deals with (3) the anaerobic fermentation of glycerol into ethanol.
(1) Suppression of glycerol formation during ethanol production.
Bioethanol is produced by Saccharomyces cerevisiae from a range of substrates including lignocellulosic hydrolysates of non-food feedstocks (e.g. energy crops and agricultural residues). One problem of yeast-based ethanol production is that during anaerobic ethanolic fermentation of sugar feedstocks, substantial amounts of glycerol are invariably formed as a by-product. Sugar dissimilation during anaerobic growth of S. cerevisiae occurs via alcoholic fermentation. In this process, the NADH
formed in glycolysis is reoxidised via a NAD dependent alcohol dehydrogenase which converts acetaldehyde (formed by decarboxylation of pyruvate) to ethanol. This dissimilatory pathway is redox-neutral and can therefore not compensate a net reduction of NAD to NADH occurring elsewhere in metabolism. Such net reduction of NAD to NADH
occurs in assimilation when yeast biomass is synthesized under anaerobic conditions from sugars and e.g. ammonia. Under anaerobic conditions, NADH reoxidation in S.
cerevisiae to compensate for the assimilatory-associated NADH-formation is mainly dependent on reduction of at least part of the sugar carbon source to glycerol, resulting in a lower ethanol yield. To address this problem, several metabolic engineering approaches have been explored to reduce or eliminate glycerol production in anaerobically grown S. cerevisiae. Two examples are:
Nissen et al (2000) disclose an approach in which the enzyme NADPH-dependent glutamate dehydrogenase was deleted. Glutamine synthetase and glutamate synthase were overexpressed. The resulting strain no longer synthesized glutamate from ammonium and 2-oxoglutarate via a NADPH-requiring route, but rather via a NADH- and ATP-requiring pathway. The resulting strain had a 10% higher yield in ethanol and a 38% lower glycerol yield than the wild type strain.
Guadalupe Medina et al. (2009, Appl. Environ. Microbiol., 76: 190-195) disclose a S. cerevisiae strain wherein production of the by-product glycerol is eliminated by disruption of the endogenous NAD-dependent glycerol 3-phosphate dehydrogenase genes (GPD1 and GPD2). Expression of the E. coli mhpF gene, encoding the acetylating NAD-dependent acetaldehyde dehydrogenase restored the ability of the GPD-disrupted strain to grow anaerobically. However, the GPD-disrupted strain could only grow anaerobically if the medium is supplemented with acetic acid.
(2) Optimization of glycerol production from sugars.
Production of glycerol from sugars, as opposed to minimizing its production during ethanol formation, has been an economically important process during World War 1 in Germany. In recent years, a renewed interest in this process is seen, as witnessed for instance by the work of Overkamp et al (2002, Appl. Environ.
Microbiol.
68:2814-21).
(3) Fermentation of glycerol into ethanol.
The fermentation of glycerol into ethanol is not feasible in normal S.
cerevisiae and under fully anoxic cultivation conditions due to an unbalanced balance for NADH.
Glycerol is more reduced than ethanol and hence the organism cannot dispose of its excess NADH by reoxidation under normal anoxic conditions. Some initial work has been done in the field of fermentation of glycerol into ethanol: Yu et al.
(2010, Bioresour. Technol. 101(11):4157-61. Epub 2010 Feb 9) disclose S. cerevisiae strains metabolically engineered for improved ethanol production from glycerol by simultaneous overexpression of glycerol dehydrogenase (GCY), dihydroxyacetone kinase (DAK) and the glycerol uptake protein (GUP1). In a later communication, Yu et al (2010, J. Biotechnol. doi:10.1016/j.jbiotec.2010.09.932) disclose an optimisation of their strain for ethanol production from glycerol by deleting two glycerol production genes, FPS1 and GPD2. It was shown that ethanol production from glycerol is possible in their strains. However, the increase in yield was dependent on micro aerobic conditions, which can be explained by the requirement for NADH oxidation. The excess of NADH produced in the path from glycerol to ethanol apparently could only be reoxidised via an oxygen-dependent reaction.
Waks and Silver (2009, Appl. Environ. Microbiol., 75:1867-1875) disclose a synthetic dual-organism system for biohydrogen production. In a first step formate is produced by an engineered S. cerevisiae strain wherein a formate-overproducing pathway has been implemented. In a second step the formate produced by the engineered yeast is processed into hydrogen by Escherichia coll. The S.
cerevisiae strain was engineered to produce formate by expressing the anaerobic enzyme pyruvate formate lyase (PFL) from E. coli. Formate production was further increased by also introducing expression of a downstream enzyme, the AdhE of E. coli, the bifunctional enzyme that reduces acetyl-CoA generated by PFL into ethanol.
It is an object of the present invention to provide for yeasts that are capable of producing ethanol from glycerol while retaining their abilities of fermenting hexoses (glucose, fructose, galactose, etc) as well as pentoses like xylose, as well as processes wherein these strains are used for the production of ethanol and/or other fermentation products.
Description of the invention Definitions Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity"
also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.

"Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the
4 sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods. The terms "sequence identity" or "sequence similarity" means that two (poly)peptide or two nucleotide sequences, when optimally aligned, preferably over the entire length (of at least the shortest sequence in the comparison) and maximizing the number of matches and minimizes the number of gaps such as by the programs ClustalW (1.83), GAP or BESTFIT using default parameters, share at least a certain percentage of sequence identity as defined elsewhere herein. GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizes the number of gaps.
Generally, the GAP default parameters are used, with a gap creation penalty =

(nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins).
For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919).
A preferred multiple alignment program for aligning protein sequences of the invention is ClustalW (1.83) using a blosum matrix and default settings (Gap opening penalty:10;
Gap extension penalty: 0.05). It is clear than when RNA sequences are said to be essentially similar or have a certain degree of sequence identity with DNA
sequences, thymine (T) in the DNA sequence is considered equal to uracil (U) in the RNA
sequence. Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-USA or the open-source software Emboss for Windows (current version 2.10.0-0.8).
Alternatively percent similarity or identity may be determined by searching against databases such as FASTA, BLAST, etc.
A variant of a nucleotide or amino acid sequence disclosed herein may also be defined as a nucleotide or amino acid sequence having one or several substitutions, insertions and/or deletions as compared to the nucleotide or amino acid sequence specifically disclosed herein (e.g. in de the sequence listing).
Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine,
5 arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to ser; Arg to lys; Asn to gln or his; Asp to glu; Cys to ser or ala; Gln to asn; Glu to asp; Gly to pro; His to asn or gln;
Ile to leu or val; Leu to ile or val; Lys to arg; gln or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.
Nucleotide sequences of the invention may also be defined by their capability to hybridise with parts of specific nucleotide sequences disclosed herein, respectively, under moderate, or preferably under stringent hybridisation conditions.
Stringent hybridisation conditions are herein defined as conditions that allow a nucleic acid sequence of at least about 25, preferably about 50 nucleotides, 75 or 100 and most preferably of about 200 or more nucleotides, to hybridise at a temperature of about 65 C in a solution comprising about 1 M salt, preferably 6 x SSC or any other solution having a comparable ionic strength, and washing at 65 C in a solution comprising about 0.1 M salt, or less, preferably 0.2 x SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having about 90% or more sequence identity.
Moderate conditions are herein defined as conditions that allow a nucleic acid sequences of at least 50 nucleotides, preferably of about 200 or more nucleotides, to hybridise at a temperature of about 45 C in a solution comprising about 1 M
salt, preferably 6 x SSC or any other solution having a comparable ionic strength, and washing at room temperature in a solution comprising about 1 M salt, preferably 6 x
6 SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours, and preferably washing is performed for at least one hour with at least two changes of the washing solution.
These conditions will usually allow the specific hybridisation of sequences having up to 50% sequence identity. The person skilled in the art will be able to modify these hybridisation conditions in order to specifically identify sequences varying in identity between 50% and 90%.
A "nucleic acid construct" or "nucleic acid vector" is herein understood to mean a man-made nucleic acid molecule resulting from the use of recombinant DNA
technology. The term "nucleic acid construct" therefore does not include naturally occurring nucleic acid molecules although a nucleic acid construct may comprise (parts of) naturally occurring nucleic acid molecules. The terms "expression vector"
or expression construct" refer to nucleotide sequences that are capable of affecting expression of a gene in host cells or host organisms compatible with such sequences.
These expression vectors typically include at least suitable transcription regulatory sequences and optionally, 3' transcription termination signals. Additional factors necessary or helpful in effecting expression may also be present, such as expression enhancer elements. The expression vector will be introduced into a suitable host cell and be able to effect expression of the coding sequence in an in vitro cell culture of the host cell. The expression vector will be suitable for replication in the host cell or organism of the invention.
As used herein, the term "promoter" or "transcription regulatory sequence"
refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences, and is located upstream with respect to the direction of transcription of the transcription initiation site of the coding sequence, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to .. regulate the amount of transcription from the promoter. A "constitutive"
promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, e.g. by the application of a chemical inducer.
7 The term "selectable marker" is a term familiar to one of ordinary skill in the art and is used herein to describe any genetic entity which, when expressed, can be used to select for a cell or cells containing the selectable marker. The term "reporter" may be used interchangeably with marker, although it is mainly used to refer to visible markers, such as green fluorescent protein (GFP). Selectable markers may be dominant or recessive or bidirectional.
As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked"
when it is placed into a functional relationship with another nucleic acid sequence. For instance, a transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA
sequences being linked are typically contiguous and, where necessary to join two protein encoding regions, contiguous and in reading frame.
The terms "protein" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3-dimensional structure or origin.
"Fungi" (singular fungus) are herein understood as heterotrophic eukaryotic microorganism that digest their food externally, absorbing nutrient molecules into their cells. Fungi are a separate kingdom of eukaryotic organisms and include yeasts, molds, and mushrooms. The terms fungi, fungus and fungal as used herein thus expressly includes yeasts as well as filamentous fungi.
The term "gene" means a DNA fragment comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene will usually comprise several operably linked fragments, such as a promoter, a 5' leader sequence, a coding region and a 3'nontranslated sequence (3'end) comprising a polyadenylation site.
"Expression of a gene" refers to the process wherein a DNA region which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide.
The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is
8 produced by a host cell or organisms of the same species, preferably of the same variety or strain. If homologous to a host cell, a nucleic acid sequence encoding a polypeptide will typically (but not necessarily) be operably linked to another (heterologous) promoter sequence and, if applicable, another (heterologous) secretory signal sequence and/or terminator sequence than in its natural environment. It is understood that the regulatory sequences, signal sequences, terminator sequences, etc.
may also be homologous to the host cell. In this context, the use of only "homologous"
sequence elements allows the construction of "self-cloned" genetically modified organisms (GMO's) (self-cloning is defined herein as in European Directive Annex II). When used to indicate the relatedness of two nucleic acid sequences the term "homologous" means that one single-stranded nucleic acid sequence may hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentration as discussed later.
The terms "heterologous" and "exogenous" when used with respect to a nucleic acid (DNA or RNA) or protein refers to a nucleic acid or protein that does not occur naturally as part of the organism, cell, genome or DNA or RNA sequence in which it is present, or that is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature.
Heterologous and exogenous nucleic acids or proteins are not endogenous to the cell into which it is introduced, but have been obtained from another cell or synthetically or recombinantly produced. Generally, though not necessarily, such nucleic acids encode proteins, i.e.
exogenous proteins, that are not normally produced by the cell in which the DNA is transcribed or expressed. Similarly exogenous RNA encodes for proteins not normally expressed in the cell in which the exogenous RNA is present.
Heterologous/exogenous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins.
Any nucleic acid or protein that one of skill in the art would recognize as foreign to the cell in which it is expressed is herein encompassed by the term heterologous or exogenous nucleic acid or protein. The terms heterologous and exogenous also apply to non-natural combinations of nucleic acid or amino acid sequences, i.e.
combinations where at least two of the combined sequences are foreign with respect to each other.
9 The "specific activity" of an enzyme is herein understood to mean the amount of activity of a particular enzyme per amount of total host cell protein, usually expressed in units of enzyme activity per mg total host cell protein. In the context of the present invention, the specific activity of a particular enzyme may be increased or decreased as compared to the specific activity of that enzyme in an (otherwise identical) wild type host cell.
"Anaerobic conditions" or an anaerobic fermentation process is herein defined as conditions or a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than 5, 2.5 or 1 mmol/L/h, more preferably 0 mmol/L/h is consumed (i.e. oxygen consumption is not detectable), and wherein organic molecules serve as both electron donor and electron acceptors.
Detailed description of the invention Biodiesel is having and will continue to have a substantial impact in the area of bio fuels. It can be produced from a variety of sources including algae, rape and palm. A
comprehensive list of potential feedstock sources is available from "Feedstock and Biodiesel Characteristics Report, "Renewable Energy Group, Inc., www.regfuel.com (2009)". The vegetable oils from which the biodiesel is produced by interesterification inevitably result in large byproduct streams of glycerol. Furthermore, the plant material from which the oil is extracted will give rise to lignocellulosic byproduct.
The latter by-product will contain cellulose and hemicelluloses in varying relative concentrations.
These polymeric sugars can be hydrolyzed into glucose and pentoses such as xylose, respectively, by known processes that are still optimized. Hence, two by-product streams may result from the production of biodiesel. The present invention describes a method for the concomitant fermentation of both glycerol and the sugars into ethanol.
This process can be applied for various feedstocks. As an example, the situation in the palm oil industry is presented in some detail below.
The palm oil industry produces huge amounts of by-products. The oil consists of only 10% of the total biomass produced in the plantation. The remainder consists of lignocellulosic materials such as oil palm fronds, trunks and empty fruit bunches (EFB) (See e.g. http ://umpir.ump. edu.my/697/1/Kamarul_Azlan_Abd._Hamid.pdf). These lignocellulosic materials can be used for the production of value added products such as ethanol that may be used as biofuel. The lignocellulosic materials may be hydrolysed
10 PCT/NL2011/050787 by known methods into streams containing hexoses and pentose such as glucose and xylose, which can then be fermented to ethanol by engineered yeast strains as e.g.
described by Kuypers et al (2005, FEMS Yeast Res. 5:399-409). However, hexose-and pentose-containing streams obtained from hydrolysis of this type of lignocellulo sic 5 materials are relatively dilute, and will therefore yield relatively low ethanol concentrations of no more than about 5% (v/v).
At the same time, large amounts of concentrated glycerol are generated as a by-product in biodiesel production from transesterification reactions using vegetable oils such as palm oil and alcohols. The availability of crude glycerol is predicted to increase 10 over the next years as a result of the growth in biodiesel production worldwide.
Consequently large amounts of concentrated glycerol will be available at low cost near palm oil plantations. This offers the possibility to increase the carbon concentration of diluted streams obtained in the above-described hydrolysis of lignocellulosic materials by mixing in the available highly concentrated glycerol. Utilisation of such mixed streams would require engineered yeast strains which can ferment not only hexoses and pentose but also glycerol to ethanol. However, anaerobic consumption of large amount of glycerol would produce a redox imbalance in yeast. The present invention addresses this problem by engineering the yeast to produce formic acid, in addition to ethanol.
The present invention therefore provides yeast strains engineered to produce ethanol and formic acid from carbon sources containing one or more of glycerol, hexose and pentose, as well as processes wherein these strains are used to produce ethanol and formic acid from these carbon sources.
In a first aspect the invention relates to a fungal host cell comprising an exogenous gene coding for a enzyme with the ability to convert pyruvate and coenzyme-A into formate and acetyl-CoA. An enzyme with the ability to convert pyruvate and coenzyme-A into formate and acetyl-CoA katalyses the reaction (EC

2.3.1.54):
pyruvate + coenzyme A (CoA)<¨ acetyl-CoA + formate.
11 ty atA _________________________ Pf 1-60 f-130 S.00A H

Such an enzyme is herein understood as an enzyme having pyruvate formate lyase activity and is referred to as a pyruvate formate lyase (PFL) or formate C-acetyltransferase.
A suitable exogenous gene coding for an enzyme with pyruvate formate lyase activity is e.g. a prokaryotic pyruvate formate lyase, such as the pyruvate formate lyase from E. coli. The E. coli pyruvate formate lyase is a dimer of PflB (encoded by pflB), whose maturation requires the activating enzyme PflAE (encoded by pflA), radical S-adenosylmethionine, and a single electron donor, which in the case of E. coli is flavodoxin (Buis and Broderick, 2005, Arch. Biochem. Biophys. 433:288-296;
Sawers and Watson, 1998, Mol. Microbiol. 29:945-954). However, Waks and Silver (supra) have shown that for activation of the pyruvate formate lyase in yeast, only co-expression of an activating enzyme is required but expression of flavodoxin is not necessary.
The exogenous gene coding for an enzyme with pyruvate formate lyase activity preferably comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO: 1. Suitable examples of organisms comprising an enzyme with pyruvate formate lyase activity are provided in Table 1. Further examples of such organisms are listed by Lehtii5 and Goldman (2004, Prof. Engin. Design & Selection, 17:545-552).
The amino acid sequences of these enzymes are available in public databases and can be used by the skilled person to design codon-optimised nucleotide sequences coding for the corresponding enzyme with pyruvate formate lyase activity (see e.g.
SEQ ID
NO: 2). The exogenous gene coding for an enzyme with pyruvate formate lyase activity may also comprises a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to the amino acid sequence of SEQ ID NO: 1. Preferably the amino acid sequence has no more than 420, 380, 300, 250, 200, 150, 100, 75, 50, 40, 30, 20, 10 or 5 amino acid substitutions, insertions and/or deletions as compared to SEQ ID NO: 1.
12 Table 1: Enzymes with pyruvate formate lyase activity related to E.coli pflB
Organism Amino acid identity (/o) Escherichia coli str. K12 substr. MG1655 100%
Shigella boydii 100%
Escherichia albertii TW07627 99%
Salmonella enter/ca 97%
Citrobacter rodentium ICC168 97%
Klebsiella pneumoniae NTUH-K2044 96%
Yersinia aldovae ATCC 35236 91%
Proteu.s mirabilis HI4320 87%
Haemophilus influenzae Rd KW20 86%
Actinobacillus succinogenes 130Z 83%
Piromyces sp. E2 57%
The host cell of the invention further preferably comprises an exogenous gene coding for the PflAE activating enzyme for activation of the pyruvate formate lyase.
The pyruvate formate lyase activating enzyme is herein understood as an enzyme that katalyses the reaction:
S-adenosyl-L-methionine + dihydroflavodoxin + [pyruvate formate lyase]-glycine 5'-deoxyadenosine + L-methionine + flavodoxin semiquinone +
[formate C-acetyltransferase]-glycin-2-y1 radical The exogenous gene coding for the pyruvate formate lyase activating enzyme preferably comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO: 3. Suitable examples of organisms comprising an enzyme with pyruvate formate lyase activity are provided in Table 2. The amino acid sequences of these enzymes are available in public databases and can be used by the skilled person to design codon-optimised nucleotide sequences coding for the corresponding enzyme with pyruvate formate lyase activity (see e.g. SEQ ID NO: 4). The exogenous gene
13 coding for the pyruvate formate lyase activating enzyme may also comprises a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to the amino acid sequence of SEQ ID NO: 3. Preferably the amino acid sequence has no more than 135, 125, 100, 75, 50, 25, 20, 15, 10, 8, 5 or 2 amino acid substitutions, insertions and/or deletions as compared to SEQ ID NO: 3.
Table 2: Pyruvate formate lyase activating enzymes related to E.coli pflA
Organism Amino acid identity (%) Escherichia colt str. K12 substr. MG1655 100%
Shigella boydii 100%
Escherichia albertii TW07627 99%
Salmonella enterica 98%
Citrobacter rodendum ICC168 98%
Klebsiella pneumoniae NTUH-K2044 97%
Yersinia rohdei ATCC 43380 89%
Proteus penneri ATCC 35198 85%
Haemophilus parasuis 29755 70%
In a preferred host cell of the invention, the exogenous genes coding for the enzyme with pyruvate formate lyase activity and the pyruvate formate lyase activating enzyme are from the same donor organism, i.e. be homologous to each other.
However, the exogenous genes coding for the enzyme with pyruvate formate lyase activity and the pyruvate formate lyase activating enzyme may also be from different donor organisms, i.e. be heterologous to each other.
In one aspect the invention relates to methods for preparing or constructing the yeast cells of the invention. For this purpose standard genetic and molecular biology techniques are used that are generally known in the art and have e.g. been described by Sambrook and Russell (2001, "Molecular cloning: a laboratory manual" (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press) and Ausubel et al. (1987, eds., "Current protocols in molecular biology", Green Publishing and Wiley
14 Interscience, New York). Furthermore, the construction of mutated host yeast strains is carried out by genetic crosses, sporulation of the resulting diploids, tetrad dissection of the haploid spores containing the desired auxotrophic markers, and colony purification of such haploid host yeasts in the appropriate selection medium. All of these methods are standard yeast genetic methods known to those in the art. See, for example, Sherman et al., Methods Yeast Genetics, Cold Spring Harbor Laboratory, NY
(1978) and Guthrie et al. (Eds.) Guide To Yeast Genetics and Molecular Biology Vol.
194, Academic Press, San Diego (1991).
The exogenous genes coding for the enzyme having pyruvate formate lyase activity and the pyruvate formate lyase activating enzyme, preferably are expression constructs comprising the nucleotide sequence coding for the enzymes operably linked to suitable expression regulatory regions/sequences to ensure expression of the enzymes upon transformation of the expression constructs into the host cell of the invention. Thus, the gene or expression construct will at least comprise a promoter that is functional in the host cell operably linked to the coding sequence. The gene or construct may further comprise a 5' leader sequence upstream of the coding region and a 3'-nontranslated sequence (3'end) comprising a polyadenylation site and a transcription termination site downstream of the coding sequence. It is understood that the nucleotide sequences coding for the enzyme having pyruvate formate lyase activity and the pyruvate formate lyase activating enzyme may be present together on a single expression construct, or each enzyme may be present on a separate expression construct.
Suitable promoters for expression of the nucleotide sequences coding for the enzyme having pyruvate formate lyase activity and the pyruvate formate lyase activating enzyme (as well as other enzymes of the invention; see below) include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Promoters having these characteristics are widely available and known to the skilled person. Suitable examples of such promoters include e.g.
promoters from glycolytic genes such as the phosphofructokinase (PPK), triose phosphate isomerase (TPI), glyceraldehyde-3-phosphate dehydrogenase (GPD, TDH3 or GAPDH), pyruvate kinase (PYK), phosphoglycerate kinase (PGK), glucose-6-phosphate isomerase promoter (PGII) promoters from yeasts. More details about such promoters from yeast may be found in (WO 93/03159). Other useful promoters are ribosomal protein encoding gene promoters (TEF1), the lactase gene promoter (LAC4), alcohol dehydrogenase promoters (ADH1, ADH4, and the like), the enolase promoter (ENO) and the hexose(glucose) transporter promoter (HXT7). Alternatively, the 5 nucleotide sequences encoding the enzyme having pyruvate formate lyase activity and the PflAE activating enzyme are expressed under anaerobic conditions by using an anoxic promoter such as e.g. the S. cerevisiae ANB1 promoter (SEQ ID NO: 24).
Other promoters, both constitutive and inducible, and enhancers or upstream activating sequences will be known to those of skill in the art. Preferably the promoter that is 10 operably linked to nucleotide sequence as defined above is homologous to the host cell.
Suitable terminator sequences are e.g. obtainable from the cytochrome cl (CYC1) gene or an alcohol dehydrogenase gene (e.g. ADH1).
To increase the likelihood that the enzyme having pyruvate formate lyase activity is expressed at sufficient levels and in active form in the transformed host cells of the
15 invention, the nucleotide sequence encoding these enzymes, as well as the pyruvate formate lyase activating enzyme and other enzymes of the invention (see below), are preferably adapted to optimise their codon usage to that of the host cell in question. The adaptiveness of a nucleotide sequence encoding an enzyme to the codon usage of a host cell may be expressed as codon adaptation index (CAI). The codon adaptation index is herein defined as a measurement of the relative adaptiveness of the codon usage of a gene towards the codon usage of highly expressed genes in a particular host cell or organism. The relative adaptiveness (w) of each codon is the ratio of the usage of each codon, to that of the most abundant codon for the same amino acid. The CAI
index is defined as the geometric mean of these relative adaptiveness values. Non-synonymous codons and termination codons (dependent on genetic code) are excluded. CAI
values range from 0 to 1, with higher values indicating a higher proportion of the most abundant codons (see Sharp and Li, 1987, Nucleic Acids Research 15: 1281-1295;
also see: Jansen et al., 2003, Nucleic Acids Res. 31(8):2242-51). An adapted nucleotide sequence preferably has a CAI of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or 0.9. Most preferred are the sequences which have been codon optimised for expression in the fungal host cell in question such as e.g. S. cerevisiae cells.
The fungal host cell to be transformed with a nucleic acid construct comprising a nucleotide sequence encoding an enzyme with pyruvate formate lyase activity
16 preferably is a yeast host cell. Preferably the host cell is a cultured cell.
The host cell of the invention, preferably is a host capable of active or passive pentose (xylose and preferably also arabinose) transport into the cell. The host cell preferably contains active glycolysis. The host cell may further preferably contains an endogenous pentose phosphate pathway and may contain endogenous xylulose kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate. The host further preferably contains enzymes for conversion of a pentose (preferably through pyruvate) to a desired fermentation product such as ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, 1,3-propane-diol, butanols (1-butano1, 2-butanol, isobutanol) and isoprenoid-derived products. A particularly preferred host cell is a yeast cell that is naturally capable of alcoholic fermentation, preferably, anaerobic alcoholic fermentation. The yeast host cell further preferably has a high tolerance to ethanol, a high tolerance to low pH (i.e. capable of growth at a pH lower than 5, 4, or 3) and towards organic acids like lactic acid, acetic acid or formic acid and sugar degradation products such as furfural and hydroxy-methylfurfural, and a high tolerance to elevated temperatures. Any of these characteristics or activities of the host cell may be naturally present in the host cell or may be introduced or modified by genetic modification, preferably by self cloning or by the methods of the invention described below.
A
suitable cell is a cultured cell, a cell that may be cultured in fermentation process e.g. in submerged or solid state fermentation. Particularly suitable host cells are eukaryotic microorganism like e.g. fungi, however, most suitable for use in the present inventions are yeasts.
Yeasts are herein defined as eukaryotic microorganisms and include all species of the subdivision Eumycotina (Yeasts: characteristics and identification, J.A.
Barnett, R.W. Payne, D. Yarrow, 2000, 3rd ed., Cambridge University Press, Cambridge UK;
and, The yeasts, a taxonomic study, C.P. Kurtzman and J.W. Fell (eds) 1998, 4th ed., Elsevier Science Publ. B.V., Amsterdam, The Netherlands) that predominantly grow in unicellular form. Yeasts may either grow by budding of a unicellular thallus or may grow by fission of the organism. Preferred yeasts cells for use in the present invention belong to the genera Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, and Yarrowia.
Preferably the yeast is capable of anaerobic fermentation, more preferably anaerobic alcoholic fermentation. Over the years suggestions have been made for the introduction
17 of various organisms for the production of bio-ethanol from crop sugars. In practice, however, all major bio-ethanol production processes have continued to use the yeasts of the genus Saccharomyces as ethanol producer. This is due to the many attractive features of Saccharomyces species for industrial processes, i.e., a high acid-, ethanol-and osmo-tolerance, capability of anaerobic growth, and of course its high alcoholic fermentative capacity. Preferred yeast species as host cells include S.
cerevisiae, S.
exiguus, S. bayanus, K. lactis, K. marxianus and Schizosaccharotnyces pombe.
In a further embodiment, the host cell of the invention further comprises a genetic modification that reduces specific NAD '-dependent formate dehydrogenase activity in the cell. NAD -dependent formate dehydrogenases (FDH; EC 1.2.1.2) katalyse the oxidation of formate to bicarbonate, donating the electrons to NAD In the cells of the invention, the specific formate dehydrogenase activity is preferably reduced by at least a factor 0.8, 0.5, 0.3, 0.1, 0.05 or 0.01 as compared to a strain which is genetically identical except for the genetic modification causing the reduction in specific activity, preferably under anaerobic conditions. Formate dehydrogenase activity may be determined as described by Overkamp et al. (2002, Yeast 19:509-520).
Preferably, formate dehydrogenase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an formate dehydrogenase. Preferably, the genetic modifications reduce or inactivate the expression of each endogenous copy of the gene encoding a specific formate dehydrogenase in the cell's genome. A given cell may comprise multiple copies of the gene encoding a specific formate dehydrogenase with one and the same amino acid sequence as a result of di-, poly- or aneu-ploidy. In such instances preferably the expression of each copy of the specific gene that encodes the formate dehydrogenase is reduced or inactivated. Alternatively, a cell may contain several different (iso)enzymes with formate dehydrogenase activity that differ in amino acid sequence and that are each encoded by a different gene. In such instances, in some embodiments of the invention it may be preferred that only certain types of the isoenzymes are reduced or inactivated while other types remain unaffected. Preferably, however, expression of all copies of genes encoding (iso)enzymes with formate dehydrogenase activity is reduced or inactivated.
Preferably, a gene encoding formate dehydrogenase activity is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context
18 the term gene also includes any non-coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of formate dehydrogenase activity in the host cell.
A preferred gene encoding a formate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention is the S. cerevisiae FDH1 as described by van den Berg and Steensma (1997, Yeast 13:551-559), encoding the amino acid sequence of SEQ ID NO: 5 and orthologues thereof in other species.
Therefore a gene encoding a formate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention preferably is a gene encoding a formate dehydrogenase having an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 5 or a gene encoding a formate dehydrogenase having an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to the amino acid sequence of SEQ ID
NO: 5.
However, in some strains of S. cerevisiae a second gene encoding a formate dehydrogenase is active, i.e. the FDH2, see e.g. Overkamp et al. (2002, supra). Another preferred gene encoding a formate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention therefore is an S. cerevisiae FDH2 as described by Overkamp et al. (2002, supra), encoding the amino acid sequence of SEQ ID
NO: 6 and orthologues thereof in other species. Therefore a gene encoding a formate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention preferably is a gene encoding a formate dehydrogenase having an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ
ID NO: 6 or a gene encoding a formate dehydrogenase having an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to the amino acid sequence of SEQ ID NO: 6.
In a further embodiment, the activity of all the genes in the host cell encoding a formate dehydrogenase is reduced or inactivated. In such cells preferably all copies of endogenous genes encoding a formate dehydrogenase having an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ
ID NO: 5 or 6 (or having an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to the amino acid sequences of SEQ ID
NO: 5 or 6) are inactivated or at least reduced in expression.
19 In a preferred embodiment, the host cell of the invention further comprises an exogenous gene coding for a enzyme with the ability to reduce acetylCoA into acetaldehyde, which gene confers to the cell the ability to convert acetylCoA
(and/or acetic acid) into ethanol. An enzyme with the ability to reduce acetylCoA into acetaldehyde is herein understood as an enzyme which catalyze the reaction (ACDH;
EC 1.2.1.10):
acetaldehyde + NAD + Coenzyme A acetyl-Coenzyme A + NADH + H.
Thus, the enzyme catalyzes the conversion of acetylCoA into acetaldehyde (and vice versa) and is also referred to as an (acetylating NAD-dependent) acetaldehyde dehydrogenase or an acetyl-CoA reductase. The enzyme may be a bifunctional enzyme which further catalyzes the conversion of acetaldehyde into ethanol (and vice versa; see below). For convenience we shall refer herein to an enzyme having at least the ability to reduce acetylCoA into either acetaldehyde or ethanol as an "acetaldehyde dehydrogenase". It is further understood herein that the host cell has endogenous alcohol dehydrogenase activities which allow the cell, being provided with acetaldehyde dehydrogenase activity, to complete the conversion of acetyl-CoA
into ethanol. It is further also preferred that the host cell has endogenous acetyl-CoA
synthetase which allow the cell, being provided with acetaldehyde dehydrogenase activity, to complete the conversion of acetic acid (via acetyl-CoA) into ethanol.
The exogenous gene may encode for a monofunctional enzyme having only acetaldehyde dehydrogenase activity (i.e. an enzyme only having the ability to reduce acetylCoA into acetaldehyde) such as e.g. the acetaldehyde dehydrogenase encoded by the E.coli mhpF gene. A suitable exogenous gene coding for an enzyme with acetaldehyde dehydrogenase activity comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO: 7. Suitable examples of prokaryotes comprising monofunctional enzymes with acetaldehyde dehydrogenase activity are provided in Table 3. The amino acid sequences of these monofunctional enzymes are available in public databases and can be used by the skilled person to design codon-optimised nucleotide sequences coding for the corresponding mono functional enzyme (see e.g. SEQ ID NO: 8). The exogenous gene coding for the monofunctional enzyme having only acetaldehyde dehydrogenase activity may also comprises a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to SEQ ID NO: 7.
5 Table 3: Enzymes with acetaldehyde dehydrogenase activity related to E.coli mhpF
Organism Amino acid identity (%) Escherichia coli str. K12 substr. MG1655 100%
Shigella sonnei 100%
Escherichia coli IA139 99%
Citrobacter youngae ATCC 29220 93%
Citrobacter sp. 30_2 92%
Klebsiella pneumoniae 342) 87%
Klebsiella variicola 87%
Pseudomonas putida 81%
Ralstonia eutropha JMP134 82%
Burkholderia sp. H160 81%
Azotobacter vinelandii DJ 79%
Ralstonia metallidurans CH34 70%
Xanthobacter autotrophicus Py2 67%
Burkholderia cenocepacia J2315 68%
Frankia sp. EAN 1pec 67%
Polaromonas sp. JS666 68%
Burkholderia phytofirmans PsJN 70%
Rhodococcus opacus B4 64%
Preferably, the host cell comprises an exogenous gene coding for a bifunctional enzyme with acetaldehyde dehydrogenase and alcohol dehydrogenase activity, which gene confers to the cell the ability to convert acetylCoA into ethanol. The advantage of 10 using a bifunctional enzyme with acetaldehyde dehydrogenase and alcohol dehydrogenase activities as opposed to separate enzymes for each of the acetaldehyde dehydrogenase and alcohol dehydrogenase activities, is that it allows for direct channelling of the intermediate between enzymes that catalyze consecutive reactions in a pathway offers the possibility of an efficient, exclusive, and protected means of metabolite delivery. Substrate channelling thus decreases transit time of intermediates, prevents loss of intermediates by diffusion, protects labile intermediates from solvent, and forestalls entrance of intermediates into competing metabolic pathways.
The bifunctional enzyme therefore allows for a more efficient conversion of acetylCoA into ethanol as compared to the separate acetaldehyde dehydrogenase and alcohol dehydrogenase enzymes. A further advantage of using the bifunctional enzyme is that it may also be used in host cells having little or no alcohol dehydrogenase activity under the condition used, such as e.g. anaerobic conditions and/or conditions of catabolite repression.
Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity are known in the art prokaryotes and protozoans, including e.g.
the bifunctional enzymes encoded by the Escherichia coli adhE and Entamoeba histolytica ADH2 genes (see e.g. Bruchaus and Tannich, 1994, J. Biochem. 303:

748; Burdette and Zeikus, 1994, J. Biochem. 302: 163-170; Koo et al., 2005, Biotechnol. Lett. 27: 505-510; Yong et al., 1996, Proc Natl Acad Sci USA, 93:

6469). Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity are larger proteins consisting of around 900 amino acids and they arc bifunctional in that they exhibit both acetaldehyde dehydrogenasc (ACDH; EC
1.2.1.10) and alcohol dchydrogenase activity (ADH; EC 1.1.1.1). The E. coli adhE and Entamoeba histolytica ADH2 show 45% amino acid identity. Therefore, in one embodiment of the invention, a suitable exogenous gene coding for a bifunctional enzyme with acetaldehyde dehydrogenase and alcohol dehydrogenase activity comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO: 9 and 11. Suitable examples of prokaryotes comprising bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity are provided in Tables 4 and 5. The amino acid sequences of these bifunctional enzymes are available in public databases and can be used by the skilled person to design codon-optimised nucleotide sequences coding for the corresponding bifunctional enzyme (see e.g. SEQ ID NO: 10 or 12). The exogenous gene coding for the a bifunctional enzyme with acetaldehyde dehydrogenase and alcohol dehydrogenase activity may also comprises a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to at least one of SEQ ID NO: 9 and 11.
Table 4: Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity related to E.coli adhE
Organism Amino acid identity (%) Escherichia coli 0157:H7 str. Sakai 100%
Shigella sonnei 100%
Shigella dysenteriae 1012 99%
Klebsiella pneumoniae 342 97%
Enterobacter sp. 638 94%
Yersinia pestis biovar Microtus str. 91001 90%
Serratia proteamaculans 568 90%
Pectobacterium carotovorum WPP14 90%
Soda/is glossinidius str. 'morsitans 87%
Erwinia tasmaniensis Et1/99 86%
Aeromonas hydrophila ATCC 7966 81%
Vibrio vulnificus YJO16] 76%
Table 5: Bifunctional enzymes with acetaldehyde dehydrogenase and alcohol dehydrogenase activity related to Entamoeba histolyfica ADH2 Organism Amino acid identity (/0) Entamoeba histolytica HM-1 :IMSS 99%
Entamoeba dispar 5AW760 98%
Mollicutes bacterium D7 65%
Fusobacterium mortiferum ATCC 9817 64%
Actinobacillus succinogenes 130Z 63%
Pasteurella multocida Pm70 62%
Mannheimia succiniciproducen.s MBEL55E 61%
Streptococcus sp. 2_1_36FAA] 61%

For expression of the nucleotide sequence encoding the bifunctional enzyme having acetaldehyde dehydrogenase and alcohol dehydrogenase activities, or the enzyme having acetaldehyde dehydrogenase activity, the nucleotide sequence (to be expressed) is placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure expression of the enzyme upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for expression of the nucleotide sequence coding for the enzyme having the bifunctional enzyme having acetaldehyde dehydrogenase and alcohol dehydrogenase activities, or the enzyme having acetaldehyde dehydrogenase activity include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Examples of such promoters are given above.
Preferably, the nucleotide sequence encoding the bifunctional enzyme having acetaldehyde dehydrogenase and alcohol dehydrogenase activities, or the enzyme having acetaldehyde dehydrogenase activity is adapted to optimise its codon usage to that of the host cell in question (as described above).
The enzyme having acetaldehyde dehydrogenase and optionally alcohol dehydrogenase activities preferably is expressed in active form in the transformed host cell. Thus, expression of the nucleotide sequence in the host cell produces an acetaldehyde dehydrogenase with a specific activity of at least 0.005, 0.010, 0.020, 0.050 or 0.10 [tmol min-1 (mg protein)-1, determined as acetyl-CoA dependent rate of NADH reduction in cell extracts of the transformed host cell at 30 C as described in the Examples herein.
In a further embodiment, the host cell of the invention further comprises a genetic modification that increases at least one of: i) the specific activity of glycerol dehydrogenase; ii) the specific activity of dihydroxyacetone kinase; and, iii) transport of glycerol into the cell.
Preferably, the genetic modification that increases the specific activity of at least one of glycerol dehydrogenase and dihydroxyacetone kinase is overexpression of a nucleotide sequence encoding at least one of a glycerol dehydrogenase and dihydroxyacetone kinase. However, alternatively, the specific activity of the glycerol dehydrogenase and/or dihydroxyacetone kinase may be increased by expressing an enzyme having increased activity as compared to the endogenous wild type enzyme of the host cell, in addition to, or as a replacement for the wild type enzyme.
A glycerol dehydrogenase is herein understood as an enzyme that catalyzes the chemical reaction (EC 1.1.1.6):
glycerol + NAD glycerone + NADH +
Other names in common use include glycerin dehydrogenase, NAD+-linked glycerol dehydrogenase and glycerol:NAD+ 2-oxidoreductase. Preferably the genetic modification causes overexpression of a glycerol dehydrogenase, e.g. by overexpression of a nucleotide sequence encoding a glycerol dehydrogenase. The nucleotide sequence encoding the glycerol dehydrogenase may be endogenous to the cell or may be a glycerol dehydrogenase that is heterologous to the cell.
Nucleotide sequences that may be used for overexpression of glycerol dehydrogenase in the cells of the invention are e.g. the glycerol dehydrogenase gene from S. cerevisiae (GCY1) as e.g. described by Oechsner et al. (1988, FEBS Lett. 238: 123-128) or Voss et al. (1997, Yeast 13: 655-672). Preferably, the nucleotide sequence encoding the glycerol dehydrogenase comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO: 13 or a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to SEQ ID NO: 13. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the glycerol dehydrogenase is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the glycerol dehydrogenase of SEQ ID
NO:
13.
The glycerol dehydrogenase encoded by the yeast GCY1 gene however appears to be specific for the cofactor NADP- (EC 1.1.1.72) as opposed to NAD+ (EC
1.1.1.6).
The yeasts such S. cerevisiae appear to lack NAD+-dependent glycerol dehydrogenase activity (EC 1.1.1.6) (see e.g. KEGG pathway 00561). More preferred nucleotide sequences for overexpression of a heterologous glycerol dehydrogenase in the cells of the invention are therefore e.g. sequences encoding bacterial glycerol dehydrogenases which use NAD+ as cofactor (EC 1.1.1.6), such as e.g. the gldA gene from E.
coli described by Truniger and Boos (1994, J Bacteriol. 176(6):1796-1800), the expression of which in yeast has already been reported (Lee and Dasilva, 2006, Metab Eng.

8(1):58-65). Preferably, the nucleotide sequence encoding a heterologous glycerol dehydrogenase comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence 5 identity with SEQ ID NO: 49 or a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to SEQ ID NO: 49. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the heterologous glycerol dehydrogenase is overexpressed, such as e.g. a codon-optimised nucleotide sequence encoding the amino acid sequence of the 10 glycerol dehydrogenase of SEQ ID NO: 49. Such a codon-optimised nucleotide sequence is e.g. provided in SEQ ID NO: 50 (positions 10 - 1113; CAI = 0.976).
For overexpression of the nucleotide sequence encoding the glycerol dehydrogenase, the nucleotide sequence (to be overexpressed) can be placed in an expression construct wherein it is operably linked to suitable expression regulatory 15 regions/sequences to ensure overexpression of the glycerol dehydrogenase enzyme upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the enzyme having glycerol dehydrogenase activity include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic
20 conditions and/or that preferably do not require xylose or arabinose for induction.
Examples of such promoters are given above. In the cells of the invention, a glycerol dehydrogenase to be overexpressed is preferably overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. Preferably, the glycerol 25 dehydrogenase is overexpressed under anaerobic conditions by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity in the cell), the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme in the cell.
Overexpression of the nucleotide sequence in the host cell produces a specific glycerol dehydrogenase activity of at least 0.2, 0.5, 1.0, 2.0, or 5.0 U min-' (mg protein)1, determined in cell extracts of the transformed host cells at 30 C as described in the Examples herein.

A dihydroxyacetone kinase is herein understood as an enzyme that catalyzes the chemical reaction ((EC 2.7.1.29):
ATP + glycerone ADP + glycerone phosphate Other names in common use include glycerone kinase, ATP:glycerone phosphotransferase and (phosphory1ating) acetol kinase. It is understood that glycerone and dihydroxyacetone are the same molecule. Preferably the genetic modification causes overexpression of a dihydroxyacetone kinase, e.g. by overexpression of a nucleotide sequence encoding a dihydroxyacetone kinase. The nucleotide sequence encoding the dihydroxyacetone kinase may be endogenous to the cell or may be a dihydroxyacetone kinase that is heterologous to the cell. Nucleotide sequences that may be used for overexpression of dihydroxyacetone kinase in the cells of the invention are e.g. the dihydroxyacetone kinase genes from S. cerevisiae (DAK1) and (DAK2) as e.g.
described by Molin et al. (2003, J. Biol. Chem. 278:1415-1423). Preferably, the nucleotide sequence encoding the dihydroxyacetone kinase comprises an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO's: 14 and 15 or a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to at least one of SEQ ID NO's: 14 and 15. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the dihydroxyacetone kinase is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the dihydroxyacetone kinase of SEQ ID NO: 14 or a codon optimised nucleotide sequence encoding the dihydroxyacetone kinase of SEQ ID
NO: 15. A preferred nucleotide sequence for overexpression of a dihydroxyacetone kinase is a nucleotide sequence encoding a dihydroxyacetone kinase comprises an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO's: 14 (S. cerevisiae (DAK1), having one or several substitutions, insertions and/or deletions as compared to SEQ ID NO:
14.
Nucleotide sequences that may be used for overexpression of a heterologous dihydroxyacetone kinase in the cells of the invention are e.g. sequences encoding bacterial dihydroxyacetone kinases such as the dhaK gene from Citrobacter freundii e.g. described by Daniel et al. (1995, J. Bacteriol. 177:4392-4401).
Preferably, the nucleotide sequence encoding a heterologous dihydroxyacetone kinase comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with SEQ ID NO: 52 or a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to SEQ ID NO: 52. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the heterologous dihydroxyacetone kinase is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the amino acid sequence of the dihydroxyacetone kinase of SEQ ID NO: 52. Such a codon-optimised nucleotide sequence is e.g. provided in SEQ ID NO: 53 (positions 10 - 1668).
For overexpression of the nucleotide sequence encoding the dihydroxyacetone kinase, the nucleotide sequence (to be overexpressed) can be placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure overexpression of the dihydroxyacetone kinase enzyme upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the enzyme having dihydroxyacetone kinase activity include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylosc or arabinose for induction.
Examples of such promoters are given above. In the cells of the invention, a dihydroxyacetone kinase to be overexpressed is preferably overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. Preferably, the dihydroxyacetone kinase is overexpressed under anaerobic conditions by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity in the cell), the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme in the cell.
Overexpression of the nucleotide sequence in the host cell produces a specific dihydroxyacetone kinase activity of at least 0.002, 0.005, 0.01, 0.02 or 0.05 U min-1 (mg protein)-1, determined in cell extracts of the transformed host cells at 30 C as described in the Examples herein.

Preferably, the genetic modification that increases transport of glycerol into the cell preferably is a genetic modification that causes overexpression of a nucleotide sequence encoding at least one of a glycerol uptake protein and a glycerol channel.
A glycerol uptake protein is herein understood as a multimembrane-spanning protein that belongs to the included in the membrane bound 0-acyltransferases (MBOAT) superfamily including e.g. the S. cerevisiae glycerol uptake proteins encoded by the GUPI and GUP2 genes. Preferably the genetic modification causes overexpression of a glycerol uptake protein, e.g. by overexpression of a nucleotide sequence encoding a glycerol uptake protein. The nucleotide sequence encoding the .. glycerol uptake protein may be endogenous to the cell or may be a glycerol uptake protein that is heterologous to the cell. Nucleotide sequences that may be used for overexpression of glycerol uptake protein in the cells of the invention are e.g. the glycerol uptake protein genes from S. cerevisiae (GUPI) and (GUP2) and orthologues thereof as e.g. described by Neves et al. (2004, FEMS Yeast Res. 5:51-62).
Preferably, the nucleotide sequence encoding the glycerol uptake protein comprises a nucleotide sequence coding for an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO's:

(Guplp) and 17 (Gup2p) or a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to at least one of SEQ ID NO's: 16 and 17. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the glycerol uptake protein is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the glycerol uptake protein SEQ ID NO: 16 or a codon optimised nucleotide sequence encoding the glycerol uptake protein of SEQ ID NO: 17. Although the exact nature of the influence of on glycerol transport is not yet clear, Yu et al. (2010, supra) have shown that overexpression of GUP1 in S. cerevisiae improves ethanol production on glycerol grown cells. A preferred nucleotide sequence for overexpression of a glycerol uptake protein is therefore a nucleotide sequence encoding a glycerol uptake protein that is capable of rescuing salt stress-associated phenotype of a S. cerevisiae guplA
mutant by complementation as described by Neves et al. (2004, supra). Such complementing orthologues of S. cerevisiae GUPI include nucleotide sequences encoding amino acid sequences having at least 60, 68, 72, 75, 80, 85, 90, 95, 98, 99% identity with the amino acid sequence of SEQ ID NO: 16 and may be obtained from yeast species belonging to the genera of Saccharonzyces, Zygosaccharomyces, Kluyveromyces, Candida, Pichia, Hansen ula, Kloeckera, Schwannioznyces, and Yarrowia.
A glycerol channel is herein understood as a member of the MIP family of channel proteins reviewed by Reizer et al. (1993, CRC Crit. Rev. Biochem. Mol.
Biol., 28: 235-257), which channel proteins comprise a 250 -280 amino acid transmembrane domain consisting of six membrane-spanning domains and have at least 30, 35, 40, 45, 50, 60, 70, 80, 90, 95, 98 or 99 % amino acid identity, or at least 55, 60, 65, 70, 80, 90, 95, 98 or 99% amino acid similarity with the amino acid sequence between amino acids 250 and 530 of SEQ ID NO: 18, the S. cerevisiae FPS1 aquaglyceroporin.
Alternatively the channel protein comprises a 250 -280 amino acid transmembrane domain consisting of six membrane-spanning domains, and having one or several substitutions, insertions and/or deletions as compared to the amino acid sequence between amino acids 250 and 530 of SEQ ID NO: 18.
Nucleotide sequences that may be used for overexpression of a glycerol channel in the cells of the invention include nucleotide sequences encoding the yeast aquaglyceroporin FPS1 gene from e.g. S. cerevisiae (Van Aelst et al., 1991, EMBO J.
10:2095-2104) and orthologues thereof from other yeasts including Kluyveroznyces lactis, Kluyveromyces marxianus and Z.ygosaccharomyces rouxii as e.g.
described by Neves et al. (2004, supra). However, the use of bacterial or plant glycerol channels is not excluded as e.g. Luyten et al. (1995, EMBO J. 14:1360-1371) have shown that the E.coli glycerol facilitator, having only 30% sequence identity with the amino acid sequence between amino acids 250 and 530 of the S. cerevisiae FPS1 aquaglyceroporin, can complement glycerol uptake in a S. cerevisiae fPs.14 mutant. The nucleotide sequence encoding the glycerol channel may be endogenous to the cell or may be a glycerol channel that is heterologous to the cell. In a preferred embodiment a codon-optimised (see above) nucleotide sequence encoding the glycerol channel is overexpressed, such as e.g. a codon optimised nucleotide sequence encoding the aquaglyceroporin of SEQ ID NO: 18.
For overexpression of the nucleotide sequence encoding the glycerol uptake protein and/or the glycerol channel protein, the nucleotide sequence (to be overexpressed) can be placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure overexpression of the glycerol uptake protein and/or the glycerol channel protein upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the glycerol uptake protein and/or the glycerol channel protein include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that 5 preferably do not require xylose or arabinose for induction. Examples of such promoters are given above. In the cells of the invention, a glycerol uptake protein and/or a glycerol channel protein to be overexpressed are preferably overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression.
Preferably, the 10 glycerol uptake protein and/or the glycerol channel protein are overexpressed under anaerobic conditions by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity in the cell), the steady 15 state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme in the cell.
In a further embodiment, the host cell of the invention further comprises a genetic modification that increases the specific acetyl-CoA synthetase activity in the cell, preferably under anaerobic conditions as this activity is rate-limiting under these 20 conditions. Acetyl-CoA synthetase or acetate-CoA ligasc (EC 6.2.1.1) is herein understood as an enzyme that catalyzes the formation of a new chemical bond between acetate and coenzyme A (CoA). Preferably the genetic modification causes overexpression of a acetyl-CoA synthetase, e.g. by overexpression of a nucleotide sequence encoding a acetyl-CoA synthetase. The nucleotide sequence encoding the 25 acetyl-CoA synthetase may be endogenous to the cell or may be a acetyl-CoA
synthetase that is heterologous to the cell. Nucleotide sequences that may be used for overexpression of acetyl-CoA synthetase in the cells of the invention are e.g.
the acetyl-CoA synthetase genes from S. cerevisiae (ACSI and ACS2) as e.g. described by de Jong-Gubbels et al. (1998, FEMS Microbiol Lett. 165: 15-20). Preferably, the 30 nucleotide sequence encoding the acetyl-CoA synthetase comprises an amino acid sequence with at least 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99% amino acid sequence identity with at least one of SEQ ID NO's: 19 and 20, or a nucleotide sequence coding for an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to at least one of SEQ ID NO's: 19 and 20.
In one embodiment, the nucleotide sequence that is overexpressed encodes an acetyl-CoA synthetase with a high affinity for acetate. Use of an acetyl-CoA
synthetase with a high affinity for acetate is preferred for conditions under which there is a relatively low concentration of acetic acid in the culture medium, e.g. no more than 2 g acetic acid/L culture medium. An acetyl-CoA synthetase with a high affinity for acetate is herein defined as an acetyl-CoA synthetase with a higher affinity for acetate than the acetyl-CoA synthetase encoded by the S. cerevisiae ACS2 (SEQ ID NO: 20).
Preferably, an acetyl-CoA synthetase with a high affinity for acetate has a Km for acetate of no more than 10, 5, 2, 1, 0.5, 0.2 or 0.1 mM, such e.g. the acetyl-CoA
synthetase encoded by the S. cerevisiae ACS1 gene. More preferably a codon-optimised (see above) nucleotide sequence encoding the amino acid sequence of SEQ ID NO:

is overexpressed.
In another embodiment, the nucleotide sequence that is overexpressed encodes an acetyl-CoA synthetase with a high maximum rate (vmax). Use of an acetyl-CoA
synthetase with a high maximum rate is preferred for condition under which there is a relatively high concentration of acetic acid in the culture medium, e.g. at least 2, 3, 4 or 5 g acetic acid/L culture medium. An acetyl-CoA synthetase with a high maximum rate is herein defined as an acetyl-CoA synthetase with a higher maximum rate than the acetyl-CoA synthetase encoded by the S. cerevisiae ACSI. Preferably, the acetyl-CoA
synthetase with a high maximum rate is the acetyl-CoA synthetase encoded by the S.
cerevisiae ACS2 gene. More preferably a codon-optimised (see above) nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 20 is overexpressed.
For overexpression of the nucleotide sequence encoding the acetyl-CoA
synthetase (to be overexpressed) can be placed in an expression construct wherein it is operably linked to suitable expression regulatory regions/sequences to ensure overexpression of the acetyl-CoA synthetase enzyme upon transformation of the expression construct into the host cell of the invention (see above). Suitable promoters for (over)expression of the nucleotide sequence coding for the enzyme having acetyl-CoA synthetase activity include promoters that are preferably insensitive to catabolite (glucose) repression, that are active under anaerobic conditions and/or that preferably do not require xylose or arabinose for induction. Examples of such promoters are given above. In the cells of the invention, an acetyl-CoA synthetase to be overexpressed is overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. Preferably, the acetyl-CoA synthetase is overexpressed under anaerobic conditions by at least a factor 2, 5, 10, 20, 50, or 100 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity (specific activity), the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.
In a further embodiment, the host cell of the invention further comprises a genetic modification that reduces specific NAD '-dependent glycerol 3-phosphate dehydrogenase activity in the cell. Glycerol 3-phosphate dehydrogenase or glycerolphosphate dehydrogenase (EC 1.1.1.8) katalyses the reduction of dihydroxyacetone phosphate to sn-glycerol 3-phosphate while oxidising NADH to NAD+. In the cells of the invention, the specific glycerolphosphate dehydrogenase activity is preferably reduced by at least a factor 0.8, 0.5, 0.3, 0.1, 0.05 or 0.01 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression, preferably under anaerobic conditions.
Preferably, glycerolphosphate dehydrogenase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an glycerolphosphate dehydrogenase. Preferably, the genetic modifications reduce or inactivate the expression of each endogenous copy of the gene encoding a specific glycerolphosphate dehydrogenase in the cell's genome. A given cell may comprise multiple copies of the gene encoding a specific glycerolphosphate dehydrogenase with one and the same amino acid sequence as a result of di-, poly- or aneu-ploidy. In such instances preferably the expression of each copy of the specific gene that encodes the glycerolphosphate dehydrogenase is reduced or inactivated.
Alternatively, a cell may contain several different (iso)enzymes with glycerolphosphate dehydrogenase activity that differ in amino acid sequence and that are each encoded by a different gene. In such instances, in some embodiments of the invention it is preferred that only certain types of the isoenzymes are reduced or inactivated while other types remain unaffected (see below). Preferably, the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non-coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of glycerolphosphate dehydrogenase activity in the host cell.
A preferred gene encoding a glycerolphosphate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention is the S. cerevisiae GPD2 gene as described by Eriksson et al. (1995, Mol. Microbiol. 17: 95-107), encoding the amino acid sequence of SEQ ID NO: 21 and orthologues thereof in other species.
Therefore a gene encoding a glycerolphosphate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention preferably is a gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 21 or an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to SEQ ID NO: 21.
In a preferred embodiment of the invention, the host cell of the invention comprises a functional high-osmolarity glycerol response pathway. Preferably therefore, only the activity of the gene(s) encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70% sequence identity to SEQ ID
NO: 21 arc reduced or inactivated, while at least one endogenous gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 22 is functional.
SEQ ID
NO: 22 depicts the amino acid sequence encoded by the S. cerevisiae GPD1 gene as described by Albertyn et al. (1994, Mol. Cell. Biol. 14: 4135-4144), which has 69%
amino acid identity with the S. cerevisiae GPD2 glycerolphosphate dehydrogenase.
The S. cerevisiae GPD1 gene is the stress-induced glycerolphosphate dehydrogenase of S. cerevisiae, which is important for growth under osmotic stress as may occur under industrial fermentations conditions. Its expression is inter alia regulated by the high-osmolarity glycerol response pathway. It is therefore advantageous that a host cell of the invention has at least one functional copy of a endogenous gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 22 or an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to SEQ ID NO: 22.

In a further embodiment, the activity of all the genes in the host cell encoding a glycerolphosphate dehydrogenase is reduced or inactivated. In such cells preferably all copies of endogenous genes encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 21 or 22 (or having an amino acid sequence having one or several substitutions, insertions and/or deletions as compared to at least one of SEQ
ID NO's:
21 and 22) are inactivated or at least reduced in expression.
In a further preferred embodiment, the host cell of the invention has at least one of: a) the ability of isomerising xylose to xylulose; and, b) the ability to convert L-arabinose into D-xylulose 5-phosphate. For a) the cell preferably has a functional exogenous xylose isomerase gene, which gene confers to the cell the ability to isomerise xylose into xylulose. For b) the cell preferably has functional exogenous genes coding for a L-arabinose isomerase, a L-ribulokinase and a L-ribulose-5-phosphate 4-epimerase, which genes together confers to the cell the ability to isomerise convert L-arabinose into D-xylulose 5-phosphate.
Fungal host cells having the ability of isomerising xylose to xylulose as e.g.

described in WO 03/0624430 and in WO 06/009434. The ability of isomerising xylose to xylulose is preferably conferred to the cell by transformation with a nucleic acid construct comprising a nucleotide sequence encoding a xylose isomerase.
Preferably the cell thus acquires the ability to directly isomerise xylose into xylulosc.
More preferably the cell thus acquires the ability to grow aerobically and/or anaerobically on xylose as sole energy and/or carbon source though direct isomerisation of xylose into xylulose (and further metabolism of xylulose). It is herein understood that the direct isomerisation of xylose into xylulose occurs in a single reaction catalysed by a xylose isomerase, as opposed to the two step conversion of xylose into xylulose via a xylitol intermediate as catalysed by xylose reductase and xylitol dehydrogenase, respectively.
Several xylose isomerases (and their amino acid and coding nucleotide sequences) that may be successfully used to confer to the cell of the invention the ability to directly isomerise xylose into xylulose have been described in the art. These include the xylose isomerases of Piromyces sp. and of other anaerobic fungi that belongs to the families Neocallimastix, Caecomyces, Piromyces or Ruminomyces (WO
03/0624430), Cyllamyces aberensis (US 20060234364), Orpinomyces (Madhavan et al., 2008, DOT 10.1007/s00253-008-1794-6), the xylose isomerase of the bacterial genus Bacteroides, including e.g. B. thetaiotaomicron (WO 06/009434), B.
fragilis, and B. unifbrmis (WO 09/109633), the xylose isomerase of the anaerobic bacterium Clostridium phytolennentans (Brat et al., 2009, Appl. Environ. Microbiol. 75:

2311), and the xylose isomerases of Clostridium difficile, Ciona intestinales and 5 Fusobacterium mortiferum (WO 10/074577).
Fungal host cells having the ability to convert L-arabinose into D-xylulose 5-phosphate as e.g. described in Wisselink et al. (2007, AEM Accepts, published online ahead of print on 1 June 2007; Appl. Environ. Microbiol. doi:10.1128/AEM.00177-07) and in EP 1 499 708. The ability of to converting L-arabinose into D-xylulose 10 phosphate is preferably conferred to the cell by transformation with a nucleic acid construct(s) comprising nucleotide sequences encoding a) an arabinose isomerase; b) a ribulokinase, preferably a L-ribulokinase a xylose isomerase; and c) a ribulose-5-P-4-epimerase, preferably a L-ribulose-5-P-4-epimerase. Preferably, in the cells of the invention, the ability to convert L-arabinose into D-xylulose 5-phosphate is the ability 15 to convert L-arabinose into D-xylulose 5-phosphate through the subsequent reactions of 1) isomerisation of arabinose into ribulose; 2) phosphorylation of ribulose to ribulose 5-phosphate; and, 3) epimerisation of ribulose 5-phosphate into D-xylulose 5-phosphate.
Suitable nucleotide sequences encoding arabinose isomerases, a ribulokinases and ribulose-5-P-4-epimerases may be obtained from Bacillus subtilis, Escherichia coli (see 20 e.g. EP 1 499 708), Lactobacilli, e.g. Lactobacillus plantarum (see e.g.
Wisselink et al.
supra), or species of Clavibacter, Arthmbacter and Gramella, of which preferably Clavibacter michiganensi s, Arthrobacter aurescens and Gramella forsetii (see W02009/011591).
The transformed host cell of the invention further preferably comprises xylulose 25 kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate. Preferably, the cell contains endogenous xylulose kinase activity.
More preferably, a cell of the invention comprises a genetic modification that increases the specific xylulose kinase activity. Preferably the genetic modification causes overexpression of a xylulose kinase, e.g. by overexpression of a nucleotide sequence 30 encoding a xylulose kinase. The gene encoding the xylulose kinase may be endogenous to the cell or may be a xylulose kinase that is heterologous to the cell. A
nucleotide sequence that may be used for overexpression of xylulose kinase in the cells of the invention is e.g. the xylulose kinase gene from S. cerevisiae (XKS1) as described by Deng and Ho (1990, App!. Biochem. Biotechnol. 24-25: 193-199). Another preferred xylulose kinase is a xylose kinase that is related to the xylulose kinase from Piromyces (xylB; see WO 03/0624430). This Piromyces xylulose kinase is actually more related to prokaryotic kinase than to all of the known eukaryotic kinases such as the yeast kinase.
The eukaryotic xylulose kinases have been indicated as non-specific sugar kinases, which have a broad substrate range that includes xylulose. In contrast, the prokaryotic xylulose kinases, to which the Piromyces kinase is most closely related, have been indicated to be more specific kinases for xylulose, i.e. having a narrower substrate range. In the cells of the invention, a xylulose kinase to be overexpressed is overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.
A cell of the invention further preferably comprises a genetic modification that increases the flux of the pentose phosphate pathway as described in WO
06/009434. In particular, the genetic modification causes an increased flux of the non-oxidative part pentose phosphate pathway. A genetic modification that causes an increased flux of the non-oxidative part of the pentose phosphate pathway is herein understood to mean a modification that increases the flux by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to the flux in a strain which is genetically identical except for the genetic modification causing the increased flux. The flux of the non-oxidative part of the pentose phosphate pathway may be measured as described in WO 06/009434.
Genetic modifications that increase the flux of the pentose phosphate pathway may be introduced in the cells of the invention in various ways. These including e.g.
achieving higher steady state activity levels of xylulose kinase and/or one or more of the enzymes of the non-oxidative part pentose phosphate pathway and/or a reduced steady state level of unspecific aldose reductase activity. These changes in steady state activity levels may be effected by selection of mutants (spontaneous or induced by chemicals or radiation) and/or by recombinant DNA technology e.g. by overexpression or inactivation, respectively, of genes encoding the enzymes or factors regulating these genes.

In a preferred cell of the invention, the genetic modification comprises overexpression of at least one enzyme of the (non-oxidative part) pentose phosphate pathway. Preferably the enzyme is selected from the group consisting of the enzymes encoding for ribulose-5-phosphate isomerase, ribulose-5-phosphate 3-epimerase, transketolase and transaldolase. Various combinations of enzymes of the (non-oxidative part) pentose phosphate pathway may be overexpressed. E.g. the enzymes that are overexpressed may be at least the enzymes ribulose-5-phosphate isomerase and ribulose-5-phosphate 3-epimerase; or at least the enzymes ribulose-5-phosphate isomerase and transketolase; or at least the enzymes ribulose-5-phosphate isomerase and transaldolase; or at least the enzymes ribulose-5-phosphate 3-epimerase and transketolase; or at least the enzymes ribulose-5-phosphate 3-epimerase and transaldolase; or at least the enzymes transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate 3-epimerase, transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, transketolase and transaldolase;
or at least the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate 3-epimerase, and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate 3-epimerase, and transketolase. In one embodiment of the invention each of the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate 3-epimerase, transketolasc and transaldolasc are overexpressed in the cell of the invention. Preferred is a cell in which the genetic modification comprises at least overexpression of the enzyme transaldolase. More preferred is a cell in which the genetic modification comprises at least overexpression of both the enzymes transketolase and transaldolase as such a host cell is already capable of anaerobic growth on xylose. In fact, under some conditions we have found that cells overexpressing only the transketolase and the .. transaldolase already have the same anaerobic growth rate on xylose as do cells that overexpress all four of the enzymes, i.e. the ribulose-5-phosphate isomerase, ribulose-5-phosphate 3-epimerase, transketolase and transaldolase. Moreover, cells of the invention overexpressing both of the enzymes ribulose-5-phosphate isomerase and ribulose-5-phosphate 3-epimerase are preferred over cells overexpressing only the isomerase or only the 3-epimerase as overexpression of only one of these enzymes may produce metabolic imbalances.
There are various means available in the art for overexpression of enzymes in the host cells of the invention. In particular, an enzyme may be overexpressed by increasing the copynumber of the gene coding for the enzyme in the cell, e.g.
by integrating additional copies of the gene in the cell's genome, by expressing the gene from an episomal multicopy expression vector or by introducing a episomal expression vector that comprises multiple copies of the gene. The coding sequence used for overexpression of the enzymes preferably is homologous to the host cell of the invention. However, coding sequences that are heterologous to the host cell of the invention may likewise be applied. Alternatively overexpression of enzymes in the cells of the invention may be achieved by using a promoter that is not native to the sequence coding for the enzyme to be overexpressed, i.e. a promoter that is heterologous to the coding sequence to which it is operably linked. Although the promoter preferably is heterologous to the coding sequence to which it is operably linked, it is also preferred that the promoter is homologous, i.e. endogenous to the cell of the invention. Preferably the heterologous promoter is capable of producing a higher steady state level of the transcript comprising the coding sequence (or is capable of producing more transcript molecules, i.e. mRNA molecules, per unit of time) than is the promoter that is native to the coding sequence, preferably under conditions where one or more of xylose, arabinose and glucose are available as carbon sources, more preferably as major carbon sources (i.e. more than 50% of the available carbon source consists of one or more of xylosc, arabinosc and glucose), most preferably as sole carbon sources.
A further preferred cell of the invention comprises a genetic modification that reduces unspecific aldose reductase activity in the cell. Preferably, unspecific aldose reductase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an unspecific aldose reductase.
Preferably, the genetic modifications reduce or inactivate the expression of each endogenous copy of a gene encoding an unspecific aldose reductase that is capable of reducing an aldopentose, including, xylose, xylulose and arabinose, in the cell's genome. A given cell may comprise multiple copies of genes encoding unspecific aldose reductases as a result of di-, poly- or aneu-ploidy, and/or a cell may contain several different (iso)enzymes with aldose reductase activity that differ in amino acid sequence and that are each encoded by a different gene. Also in such instances preferably the expression of each gene that encodes an unspecific aldose reductase is reduced or inactivated. Preferably, the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non-coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of unspecific aldose reductase activity in the host cell. A nucleotide sequence encoding an aldose reductase whose activity is to be reduced in the cell of the invention and amino acid sequences of such aldose reductases are described in WO 06/009434 and include e.g. the (unspecific) aldose reductase genes of S. cerevisiae GRE3 gene (Traff et al., 2001, Appl. Environm. Microbio1.67: 5668-5674) and orthologues thereof in other species.
A further preferred transformed host cell according to the invention may comprises further genetic modifications that result in one or more of the characteristics selected from the group consisting of (a) increased transport of xylose and/or arabinose into the cell; (b) decreased sensitivity to catabolite repression; (c) increased tolerance to ethanol, osmolarity or organic acids; and, (d) reduced production of by-products. By-products are understood to mean carbon-containing molecules other than the desired fermentation product and include e.g. xylitol, arabinitol, glycerol and/or acetic acid.
Any genetic modification described herein may be introduced by classical mutagenesis and screening and/or selection for the desired mutant, or simply by screening and/or selection for the spontaneous mutants with the desired characteristics.
Alternatively, the genetic modifications may consist of overexpression of endogenous genes and/or the inactivation of endogenous genes. Genes the overexpression of which is desired for increased transport of arabinose and/or xylose into the cell are preferably chosen form genes encoding a hexose or pentose transporter. In S. cerevisiae and other yeasts these genes include HXT1, HXT2, HXT3, FIXT4, HXT5, HXT7 and GAL2, of which HXT7, HXT5 and GAL2 are most preferred (see Sedlack and Ho, Yeast 2004; 21: 671-684).
Another preferred transporter for expression in yeast is the glucose transporter encoded by the P. stipitis SUT1 gene (Katahira et al., 2008, Enzyme Microb. Technol.
43: 115-119). Similarly orthologues of these transporter genes in other species may be overexpressed. Other genes that may be overexpressed in the cells of the invention include genes coding for glycolytic enzymes and/or ethanologenic enzymes such as alcohol dehydrogenases. Preferred endogenous genes for inactivation include hexose kinase genes e.g. the S. cerevisiae HXK2 gene (see Diderich et al., 2001, Appl.
Environ. Microbiol. 67: 1587-1593); the S. cerevisiae MIG1 or MIG2 genes;
genes coding for enzymes involved in glycerol metabolism such as the S. cerevisiae glycerol-phosphate dehydrogenase 1 and/or 2 genes; or (hybridising) orthologues of these genes in other species. Other preferred further modifications of host cells for xylose fermentation are described in van Mans et al. (2006, Antonie van Leeuwenhoek 5 90:391-418), W02006/009434, W02005/023998, W02005/111214, and W02005/091733. Any of the genetic modifications of the cells of the invention as described herein are, in as far as possible, preferably introduced or modified by self cloning genetic modification.
A preferred host cell according to the invention has the ability to grow on at least 10 one of xylose and arabinose as carbon/energy source, preferably as sole carbon/energy source, and preferably under anaerobic conditions, i.e. conditions as defined herein below for anaerobic fermentation process. Preferably, when grown on xylose as carbon/energy source the host cell produces essentially no xylitol, e.g. the xylitol produced is below the detection limit or e.g. less than 5, 2, 1, 0.5, or 0.3%
of the carbon 15 consumed on a molar basis. Preferably, when grown on arabinose as carbon/energy source, the cell produces essentially no arabinitol, e.g. the arabinitol produced is below the detection limit or e.g. less than 5, 2, 1, 0.5, or 0.3 % of the carbon consumed on a molar basis.
A preferred host cell of the invention has the ability to grow on at least one of a 20 hexose, a pcntose, glycerol, acetic acid and combinations thereof at a rate of at least 0.01, 0.02, 0.05, 0.1, 0.2, 0,25 or 0,3 hi under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01, 0.02, 0.05, 0.08, 0.1, 0.12, 0.15 or 0.2 111 under anaerobic conditions. Therefore, preferably the host cell has the ability to grow on at least one of xylose and arabinose as sole carbon/energy source at a rate of at least 0.01, 25 0.02, 0.05, 0.1, 0.2, 0,25 or 0,3 hi under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01, 0.02, 0.05, 0.08, 0.1, 0.12, 0.15 or 0.2 if' under anaerobic conditions. More preferably, the host cell has the ability to grow on a mixture of a hexose (e.g. glucose) and at least one of xylose and arabinose (in a 1:1 weight ratio) as sole carbon/energy source at a rate of at least 0.01, 0.02, 0.05, 0.1, 0.2, 0,25 or 0,3 If' 30 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01, 0.02, 0.05, 0.08, 0.1, 0.12, 0.15 or 0.2 hi under anaerobic conditions. Most preferably, the host cell has the ability to grow on a mixture of a hexose (e.g. glucose), at least one of xylose and arabinose and glycerol (in a 1:1:1 weight ratio) as sole carbon/energy source at a rate of at least 0.01, 0.02, 0.05, 0.1, 0.2, 0,25 or 0,3 h-1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01, 0.02, 0.05, 0.08, 0.1, 0.12, 0.15 or 0.2 111 under anaerobic conditions.
In a one aspect, the invention relates to the use of a yeast cell according to the invention for the preparation of a fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, 1,3-propane-diol, butanols and isoprenoid-derived products.
In another aspect the invention relates to a process for producing a fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, 1,3-propane-dio1, butanols (1-butano1, 2-butanol, isobutanol) and isoprenoid-derived products. The process can be a process wherein formate is produced in addition to the fermentation product. The process preferably comprises the step of: a) fermenting a medium with a yeast cell, whereby the medium contains or is fed with: a) a source of at least one of a hexose, a pentose and glycerol and whereby the yeast cell ferments the at least one of a hexose, pentose and glycerol to the fermentation product, and optionally to formate. The yeast cell preferably is a (host) cell as herein defined above. The process preferably comprise one or more further steps wherein the fermentation product and/or the formate are recovered. The process may be a batch process, a fed-batch process or a continuous process as are well known in the art.
In a preferred process the source of at least one of a hexose, a pentose and glycerol comprises or consist of: hexose and pentose; hexose and glycerol;
pentose and glycerol; hexose, pentose and glycerol. In a further preferred process, the source of at least one of a hexose, a pentose and glycerol further comprises acetic acid.
In a preferred process the source of hexose comprises or consists of glucose.
Preferably the source of pentose comprises or consists of at least one of xylose and arabinose, of which xylose is preferred. Preferably, the medium fermented by the cells of the invention comprises or is fed with (fractions of) hydrolysed biomass comprising at least one at least one of a hexose and a pentose such as glucose, xylose and/or arabinose. The (fractions of) hydrolysed biomass comprising the hexoses and pentose will usually also comprise acetic acid (or a salt thereof). An example of hydrolysed biomass to be fermented in the processes of the invention is e.g. hydrolysed lignocellulosic biomass. Lignocellulosic biomass is herein understood as plant biomass that is composed of cellulose, hemicellulose, and lignin. The carbohydrate polymers (cellulose and hemicelluloses) are tightly bound to the lignin. Examples of lignocellulosic biomass to be hydrolysed for use in the present invention include agricultural residues (including e.g. empty fruit bunches (EFB) of oil palm, corn stover and sugarcane bagasse), wood residues (including sawmill and paper mill discards and (municipal) paper waste. Methods for hydrolysis of biomass such as lignocelluloses are known in the art per se and include e.g. acids, such as sulphuric acid and enzymes such as cellulases and hemicellulases.
In the process of the invention, the sources of xylose, glucose and arabinose may be xylose, glucose and arabinose as such (i.e. as monomeric sugars) or they may be in the form of any carbohydrate oligo- or polymer comprising xylose, glucose and/or arabinose units, such as e.g. lignocellulose, arabinans, xylans, cellulose, starch and the like. For release of xylose, glucose and/or arabinose units from such carbohydrates, appropriate carbohydrases (such as arabinases, xylanases, glucanases, amylases, cellulases, glucanases and the like) may be added to the fermentation medium or may be produced by the modified host cell. In the latter case the modified host cell may be genetically engineered to produce and excrete such carbohydrases. An additional advantage of using oligo- or polymeric sources of glucose is that it enables to maintain a low(er) concentration of free glucose during the fermentation, e.g. by using rate-limiting amounts of the carbohydrases preferably during the fermentation.
This, in turn, .. will prevent repression of systems required for metabolism and transport of non-glucose sugars such as xylose and arabinose. In a preferred process the modified host cell ferments both the glucose and at least one of xylose and arabinose, preferably simultaneously in which case preferably a modified host cell is used which is insensitive to glucose repression to prevent diauxic growth. In addition to a source of at least one of a hexose, a pentose and glycerol, as carbon source, the fermentation medium will further comprise the appropriate ingredients required for growth of the modified host cell. Compositions of fermentation media for growth of eukaryotic microorganisms such as yeasts are well known in the art.
In the process of the invention, the medium further preferably comprises and/or is fed a source of glycerol. Glycerol for use in the process of the present invention may advantageously be glycerol that is generated as a by-product in biodiesel production from transesterification reactions using vegetable oils, such as palm oil, or animal fats and an alcohol.

The fermentation process may be an aerobic or an anaerobic fermentation process. An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than 5, 2.5 or 1 mmol/L/h, more preferably 0 mmol/L/h is consumed .. (i.e. oxygen consumption is not detectable), and wherein organic molecules serve as both electron donor and electron acceptors. In the absence of oxygen, NADH
produced in glycolysis and biomass formation, cannot be oxidised by oxidative phosphorylation.
To solve this problem many microorganisms use pyruvate or one of its derivatives as an electron and hydrogen acceptor thereby regenerating NAD Thus, in a preferred anaerobic fermentation process pyruvate is used as an electron (and hydrogen acceptor) and is reduced to fermentation products such as ethanol, as well as non-ethanol fermentation products such as lactic acid, 3-hydroxy-propionic acid, acrylic acid, 1,3-propane-diol, butanols (1-butanol, 2-butanol, isobutanol) and isoprenoid-derived products, preferably under concomitant production of formate. Anaerobic processes of the invention are preferred over aerobic processes because anaerobic processes do not require investments and energy for aeration and in addition, anaerobic processes produce higher product yields than aerobic processes. Alternatively, the fermentation process of the invention may be run under aerobic oxygen-limited conditions.
Preferably, in an aerobic process under oxygen-limited conditions, the rate of oxygen consumption is at least 5.5, more preferably at least 6 and even more preferably at least 7 mmol/L/h.
The fermentation process is preferably run at a temperature that is optimal for the modified cells of the invention. Thus, for most yeasts cells, the fermentation process is performed at a temperature which is less than 42 C, preferably less than 38 C.
For yeast .. cells, the fermentation process is preferably performed at a temperature which is lower than 35, 33, 30 or 28 C and at a temperature which is higher than 20, 22, or 25 C.
Because undissociated formic acid is more toxic to the host cells of the invention as compared to the dissociated acid ion, the fermentation process is preferably run at a pH that is higher than the pKa of formic acid, which is 3.75. The fermentation process .. is therefore preferably run at a pH of at least 3.8, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5 or 8Ø Preferably the fermentation process is run at at least the aforementioned pHs for the entire duration of the process. Alternatively the pH may be regulated so as to maintain the concentration of undissociated formic acid below a given concentration.

Preferably the pH of the medium is regulated during the fermentation process to maintain a concentration of undissociated formic acid that is not higher than 50.0, 30.0, 20.0, 18.1, 15.0, 10.0, 5.0, 2.0 or 1.0 mM.
A preferred fermentation process according to the invention is a process for the production of ethanol and optionally formate, whereby the process comprises the step of fermenting a medium with a yeast cell, whereby the medium contains or is fed with a source of at least one of a hexose, a pentose and glycerol and whereby the yeast cell ferments the at least one of a hexose, pentose and glycerol to ethanol and optionally formate. Optionally the process comprises the step of recovery of at least one of ethanol and optionally formate. The fermentation may further be performed as described above.
In the process the volumetric ethanol productivity is preferably at least 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 5.0 or 10.0 g ethanol per litre per hour. The ethanol yield on hexose and/or pentose and/or glycerol (and/or acetate) in the process preferably is at least 50, 60, 70, 80, 90, 95 or 98%. The ethanol yield is herein defined as a percentage of the theoretical maximum yield, which, for xylose, glucose and arabinose is 0.51 g. ethanol per g.
hexose or pentose. For glycerol the theoretical maximum yield is 0.50 g.
ethanol per g.
glycerol and for acetic acid the theoretical maximum yield is 0.77 g. ethanol per g.
acetic acid.
In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word arc included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".
The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

Examples 1. Enzyme activity assays Cell extracts for activity assays were prepared from exponentially growing aerobic or anaerobic batch cultures and analysed for protein content as described by 5 Abbot et al., (2009, App!. Environ. Microbiol. 75: 2320-2325).
NAD -dependent acetaldehyde dehydrogenase (EC 1.2.1.10) activity was measured at 30 C by monitoring the oxidation of NADH at 340 nm. The reaction mixture (total volume 1 ml) contained 50 mM potassium phosphate buffer (pH
7.5), 0.15 mM NADH and cell extract. The reaction was started by addition of 0.5 mM
10 acetyl-Coenzyme A.
For glycerol 3-phosphate dehydrogenase (EC 1.1.1.8) activity determination, cell extracts were prepared as described above except that the phosphate buffer was replaced by triethano famine buffer (10 mM, pH 5). Glycerol-3-phosphate dehydrogenase activities were assayed in cell extracts at 30 C as described previously 15 (Blomberg and Adler, 1989, J. Bacteriol. 171: 1087-1092.9). Reaction rates were proportional to the amounts of cell extract added.
Acetyl-CoA synthase (EC 6.2.1.1) activity was measured as described by Frenkel and Kitchens (1977, J. Biol. Chem. 252: 504-507) which is a modification of the method of Webster (Webster, 1969, Methods Enzymol. 13: 375-381). NADH
20 formation measured is spectrophotometrically when the acetyl-CoA produced is coupled with citrate synthase and malate dehydrogenase reactions. The assay system contained 100 mM Tris-C1(pH 7.6), 10 mM MgCl2, 6 m1V1 ATP, 5 m1\4 malate, 1 mM

NAD', 0.1 mM NADH, 2.5 mM dithiothreitol or 2-mercaptoethanol, 0.2 mM
coenzyme A, 25 pg citrate synthase (80 units/mg), 20 [1g malate dehydrogenase (1000 25 units/mg), and 10 mM acetate and the reaction was measured rate was measured at 340 um and calculated from the extinction coefficient of NADH (6.22 x 106 cm2/mol).
The activity of glycerol dehydrogenase and dihydroxyacetone kinase are measured at 30 C in cell extracts, essentially as previously described (Gonzalez et al., 2008, Metab. Eng. 10, 234-245). Enzyme activities of glycerol dehydrogenase and 30 dihydroxyacetone kinase are repotted as moles of substrate/min/mg of cell protein.
2. Strain construction All modifications start with the xylose fermenting strain RN1041. RN1041 is a CEN.PK based strain with the following genotype:
Mat a, ura3-52, 1ett2-112, gre3::loxP, loxP-Ptpi::TAL1, loxP-Ptpi::RKI1, loxP-Ptpi-TKL1, loxP-Ptpi-RPE1, deltas:PadhlXKS1Tcycl-LEU2, delta::URA3-Ptpi-xy1A-Tcyc 1 Mat a= mating type a ura3-52, 1eu2-112, h1s3::loxP mutations in the genes ura3, 1eu2 and his3, the ura3 is complemented by the Piromyees xylA overexpression construct, 1eu2 is complemented by the XKS1 overexpression construct. his3 could be used for selection of additional plasmids, R1N1041 needs histidine in the medium for growth.
gre3::loxP= deletion of the gre3 gene encoding xylose reductase, loxP site is left after marker removal.
loxP-Ptpi .......................................................... =
overexpression of het pentose phosphate pathway, loxP site upstream of constitutive promoter is left after marker removal delta:: = integration of the construct after recombination on the long terminal repeats of the Tyl retrotransposon.
Constructs for expression of the E.coli pflA and pflB genes in yeast The E.coli pflA and pflB genes were obtained as codon optimized synthetic genes.
The pflA expression construct by ligating a TEF1 promoter-fragment (cut with the restriction enzymes Sall and Hind111; from plasmid collection Royal Nedalco), a pflA
synthetic ORF (cut with HindIll and BssHII) and an ADH1 terminator-fragment (cut with BssHII and BsiWI; from plasmid collection Royal Nedalco) together into pCRII
blunt (Invitrogen) to yield pRN613.
The pflB expression construct by ligating a PGK1 promoter-fragment (cut with the restriction enzymes Spel and P.stI; from plasmid collection Royal Nedalco), a pflB
synthetic ORF (cut with Pstl and Sall) and an PGI1 terminator-fragment (cut with Xhol and BsiWI; from plasmid collection Royal Nedalco) together into pCRII blunt (Invitrogen) to yield pRN614.
The LEU2 marker from plasmid pRS305 (Sikorski and Hieter, 1989, Genetics 122:19-27) is exchanged for the ZeoMX marker (zeoll1X = resistance to phleomycin due to expression of the Tn5 ble gene with a TEF1 promoter and terminator sequence of Ashbya gossypii). Yeast transformants are selected on media containing Zeomycin.
pRS305 is cut with Bstal and BsrGI and a ZeoMX fragment (from plasmid collection Royal Nedalco) is cut with the same restriction enzymes. Ligation gives plasmid pRS30z.
A 2u0RI is introduced by cutting pRS30z with Af/II en Mfel and cutting a 2u fragment (from plasmid collection Royal Nedalco) with Af/II and EcoRl. The fragments are ligated to yield pRN615 (634 lbp) For the final construction pRN615 is cut with Xhol and Spel, this vector is combined with the inserts from pRN613 cut with Sall and BsiWl (1510bp) and pRN614cut with Spel and BsiWl (3381bp) to produce pRN616 (SEQ ID NO: 31).
For expression of the E.coli pflA gene only, pRN613 is cut with Sall and BsiWI
and this fragment is ligated into pRN615 cut with Acc65I and XhoI to produce pRN619 (SEQ ID NO: 32).
For expression of the E.coli pf19 gene only, pRN614 is cut with Xhol and BsiWI
and this fragment is ligated into pRN615 cut with Acc65I and XhoI to produce pRN620 (SEQ ID NO: 33).
Plasmid pRN616, pRN619 and pRN620 are used to transform the yeast strain together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7.
Constructs for overexpression of GCY1, gldA, DAK1 dhaK, and GUP1 PCR is performed on genomic DNA of S. cerevisiae with primers introducing a Pstl site 5'of the ATG and an Afill site 3'of the TAA to produce the fragment of SEQ ID
NO: 25. A DNA fragment comprising the S. cerevisiae Actinl promoter is ligated upstream of the GCY1 ORF and DNA fragment comprising the S. cerevisiae ADH1 terminator fragment is ligated downstream of the GCY1 ORF.
gldA
The construct for expression in yeast of the E.coli glelA was made by ligating a yeast ACT1 promoter fragment (cut with the restriction enzymes Spel and Pstl), a synthetic ORF (SEQ ID NO:50), encoding the E.coli gldA, (cut with PstI en BssHII) and a yeast CYC1 terminator fragment (cut with BssHII and BsiWI) together into pCRII blunt (Invitrogen) to yield pRNgldA (SEQ ID NO:51).

PCR is performed on genomic DNA of S. cerevisiae with primers introducing a Xbal site 5'of the ATG and a Sall site 3 'of the TAA to produce the fragment as contained in SEQ ID NO: 26. A DNA fragment comprising the S. cerevisiae TPI1 promoter is ligated upstream of the DAK1 ORF and DNA fragment comprising the S. cerevisiae PGI1 terminator fragment is ligated downstream of the DAK1 ORF to produce the expression construct of SEQ ID NO: 26.
dhaK
The construct for expression in yeast of the Citrobacter .freundii dhaK was made by ligating the yeast TPI1 promoter fragment (cut with the restriction enzymes Xhol and Xbal), a synthetic ORF (SEQ ID NO:53), encoding the C. .freundii dhaK, (cut with Xbal and Sall) and a yeast PGIl terminator fragment (cut with Xhol and BsiWI) together into pCRII blunt (Invitrogen) to yield pRNdhaK (SEQ ID NO:54).
GUN
PCR is performed on genomic DNA of S. cerevisiae with primers introducing a HindIll site 5'of the ATG and a Baml-ll site 3'of the TAA to produce the fragment as contained in SEQ ID NO: 27. A DNA fragment comprising the S. cerevisiae TDH3 promoter is ligated upstream of the GUP1 ORF and DNA fragment comprising the S. cerevisiae CYC1 terminator fragment is ligated downstream of the GUP1 ORF to produce the expression construct of SEQ ID NO: 27.
Strains overexpressing GCY1, DAK1 and GUP1 The above-described expression constructs of GCY1, DAK1 and GUP1 are combined into a pRS315-based centromeric plasmid having the hygromycine resistance gene as selectable marker to produce pRN605 (SEQ ID NO: 29). Plasmid pRN605 is used to transform the yeast strain RN1041 together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7.
The above-described expression constructs of GCY1 and DAK1 are combined into a pRS315-based centromeric plasmid having the hygromycine resistance gene as selectable marker to produce pRN608 (SEQ ID NO: 30). is used to transform the yeast strain RN1041 together with the other plasmids as indicated in Table 7 to generate the strain RN1098, as indicated in Table 7.
Strains expressing E.coli gldA with or without expression of Cfreundii dhaK

The E.coli gldA expression construct is cut from plasmid pRNgldA with the restriction enzymes Spel and BsiWI. The Cfreundii dhaK expression construct is cut from plasmid pRNdhaK with the restriction enzymes BsiWI and Xhol. These fragments are ligated into plasmid pRN595 cut with the restriction enzymes Spel and Sall to yield pRN957 (SEQ ID NO: 55). Plasmid pRN958 (SEQ ID NO: 56) is subsequently made from plasmid pRN957 by deleting the C.freundii dhaK expression construct. To this end plasmid pRN957 is cut with the restriction enzymes P.spOMI and A vrIl, the single stranded parts are filled in with the DNA polymerase phusion (Finnzymes) and the plasmid is religated.
The expression constructs of DAK1 and GUP1 are combined into a pRS315-based centromeric plasmid having the hygromycine resistance gene as selectable marker to produce pR1N607 (SEQ ID NO: 57).
Plasmids pRN957, pRN958 and pRN607 used to transform yeast together with the other plasmids indicated in Table 7 to produce strain RN1194, RN1195 and RN1196.
Construct for overexpression of FPS1 PCR is performed on genomic DNA of S. cerevisiae with primers introducing a Nsil site 5'of the ATG and a BainHI site 3'of the TAA to produce the fragment as contained in SEQ ID NO: 28. A DNA fragment comprising the S. cerevisiae ADH1(medium) promoter is ligated upstream of the FSP1 ORF and DNA fragment comprising the S.
cerevisiae CYC1 terminator fragment is ligated downstream of the FSP1 ORF to produce the expression construct of SEQ ID NO: 28. Ligation of these fragments in pCRII blunt produces pRN617. The insert of pRN617 is cut with B.slIATI and Xhol and cloned in pRN616 cut with BsrGI and Sall to produce pRN618 (SEQ ID NO: 34).
Plasmid pRN618 is used to transform the yeast strain RN1041 together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7.
Constructs for deletion of FDH1 and FDH2 Primers FDHuf, FDHur, FDHdf and FDHdr are used for amplification of genomic sequences fragments upstream and downstream of both FDH1 and FDH2 genes for their inactivation. The same primers are used for both FDH1 and FDH2 alleles.
For inactivation of the FDH1 allele, a 423bp upstream PCR fragment with a BspEI site at the 3'-end for ligation to the MX marker, and a Bbsl site at the 5'-end for isolation of the deletion construct is amplified using FDHuf and FDHur and cloned in pCRII

(blunt) using topo-cloning (Invitrogen), which results in an additional B.s1131 site at the 5 '-end.
FDHuf: TCGAAGACTCCGAATGAAAAAGACATGCCAG (SEQ ID NO: 35) FDHur: TCCGGATACCAAGTTCATTTTCAATACACCCCA (SEQ ID NO: 36) A 378bp downstream PCR fragment with a Nsil and a Sphl site at the 5'-end for ligation to the MX marker, and a BbsI site at the 3'-end for isolation of the deletion construct is amplified using FDHdf and FDHdr.
10 FDHdf: ATGCATGCAGAATGGTTCTTATGCCAC (SEQ ID NO: 37) FDHdr: GAAGACAGTTCTGTTATTAACGACGAGCCA (SEQ ID NO: 38) For the final construction the downstream fragment cut with Xhol and Nsil is ligated to the patMX marker (collection Royal Nedalco) cut with BspEl and Nsil in the plasmid 15 containing the upstream-fragment cut with BspEl and Xhol. The final plasmid, pRN621 (SEQ ID NO: 39), is cut with Bbs1 prior to yeast transformation. Transformants are selected for phosphinotricin resistance. Correct integration of the disruption fragment is verified by PCR with specific primers.
FDH2 is found as a pseudogene in some strains (e.g. S288C, YPL275W and 20 YPL276W). Two mutations restore the ORF homology with FDH1 (T436C and del A476). Sequence analysis shows that in the CEN.PK background (RN1041) FDH2 is one ORE homologous to FDH1.
For the final construction the downstream fragment cut with Xhol and Sphl is ligated to the kanMX marker (collection Royal Nedalco) cut with BspEI and Sphl into the 25 plasmid containing the upstream fragment cut with BspEl and XhoI. The final plasmid, pRN622 (SEQ ID NO: 40), is cut with Bbsl prior to yeast transformation.
Transformants are selected for G418 resistance. Correct integration of the disruption fragment is verified by PCR with specific primers.
Disruption fragments from pRN621 and pRN622 are used to transform the yeast strain 30 RN1041 together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7.
Constructs for expression of the E.coli mhpF, adhE or the Entamoebe histolytica adh2 genes in yeast For expression of the E.coli mhpF gene, a yeast PGK1 promoter fragment (Spel-Pstl) and an ADH1 terminator fragment (AfTII-Notl) (both from the Nedalco plasmid collection) were ligated onto the codon-optimized synthetic fragment encoding the E.coli mhpF (SEQ ID NO: 8).
pRS 303 with 211 on (= pRN347, Royal Nedalco plasmid collection) was cut with Spel and Notl and the mhpF expression construct was cloned into this vector to produce pRN558 (SEQ ID NO: 41). pRN558 is used to transform the yeast strain RN1041 (selection on medium lacking histidine) together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7. Overexpression of mhpF is verified by qPCR.
For expression of the E.coli adhE gene, a codon optimized synthetic fragment encoding the E.coli adhE (SEQ ID NO: 10) is cut with Xbal and 4f/II and ligated into pRN558 cut with Xbal and AfIll (replacing the E.coli mhpF gene in pRN558) to produce pRN595 (SEQ ID NO: 42). pRN595 is used to transform the yeast strain RN1041 (selection on medium lacking histidine) together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7. Overexpression of adhE is verified by qPCR.
For expression of the Entatnoebe histolytica adh2, a codon optimized synthetic fragment encoding the E. histolytica adh2 (SEQ ID NO: 12) is cut with Xbal and Afill and ligated into pRN558 cut with Xbal and AfIll (replacing the E.coli mhpF
gene in pRN558) to produce pRN596 (SEQ ID NO: 43). pRN596 is used to transform the yeast strain RN1041 (selection on medium lacking histidine) together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7.
Overexpression of adh2 is verified by qPCR.
.. Constructs for deletion of GPD2 Primers GPD2uf, GPD2ur, GPD2df and GPD2dr are used for amplification of genomic sequences fragments upstream and downstream of the GPD2 gene for its inactivation.
A 407bp upstream PCR fragment with an Afill site at the 3'-end (derived from the GPD2 sequence) and a BglIl site at the 5'-end (for isolation of the deletion construct) is amplified using GPD2uf, GPD2ur and cloned in pCR2.1 (topo T/A, Invitrogen).
GPD2uf: GGTACCAGATCTTTTGCGGCGAGGTGCCG (SEQ ID NO: 44) GPD2ur: TCTAGACTTAAGGAATGTGTATCTTGTTAATCTTCTGACAGC (SEQ
ID NO: 45) A 417bp downstream PCR fragment with a Xhol site at the 5'-end and a Bell site at the 3 '-end is amplified using GPD2df and GPD2dr.
GPD2df: CTCGAGATAGTCTACAACAACGTCCGCA (SEQ ID NO: 46) GPD2dr: CCATGGAGATCTGCAGTGAAAAAGCTCGAAGAAACAGCT (SEQ ID
NO: 47) For the final construction the plasmid containing the upstream fragment is cut with 4f/II and Kpn, the downstream fragment is cut with Xhol en Ncol and the natMX
marker (plasmid collection Royal Nedalco) is cut with Afill en Xhol and the fragments are ligated to produce plasmid pRN594 (SEQ ID NO: 48). pRN594 is cut with B,ell prior to yeast transformation. pRN594 is used to transform the yeast strain (selection for nourseotricin resistance) together with the other plasmids as indicated in Table 7 to generate the strains as indicated in Table 7. Correct integration is verified by PCR using specific primers.
3. Fermentations with the constructed strains 3.1 Experimental set-up Strains RN1041, RN1088, RN1089, RN1090, RN1091, RN1092, RN1093, RN1094, RN1095, RN1096, RN1097, RN1098, RN1099, RN1194, RN1195 and RN1196. are all tested for their ability to grow under both anoxic conditions (no oxygen present) at the expense of glycerol as carbon source. At the same time, formation of ethanol and formic acid is monitored. In several instances it is confirmed by experiments that the glycerol-consuming strains also retain their ability to ferment glucose and xylose.
Precultures of strains are prepared by inoculating a frozen glycerol stock culture of the yeast in an YP (Yeast extract Peptone) medium with addition of the sugar glucose (2.5% w/v) at 32 C and pH 5.5. After 24 h incubation, this culture is used to inoculate the fermenter cultures. Cells are harvested by centrifugation and washed with cold dH20. Yeast inoculation used is 2 gram dry matter yeast per litre of fermentation medium.

Fermentations are performed as chemostat cultivation at 32 C in 1-liter fermenters with a working volume of 800 ml. The dilution rate is set at 0.1 111. These anoxic batch fermentations are performed in YP medium to which glycerol in combination with xylose and/or glucose is added. The culture pH is kept at pH = 7.0 by automatic addition of 2M KOH. Cultures were stirred at 300 rpm.
Samples for analysis of glucose, xylose, ethanol, glycerol and formic acid production are taken at steady state situations which are obtained after 5 volume changes of the fermentation vessel. Ethanol, glycerol and formic acid concentrations are monitored by HPLC analysis. Glucose and xylose are determined by HPAEC (Dionex) analysis.
3.2 Results Strain RN1041 (Tables 6 and 7) is a strain that is derived from strain RN1001 (RN1001 his3::loxP). Strain RN1001 has been described previously. If either glucose (25 mM) or xylose (25 mM) are added to the YP medium, then the anoxic fermentations under the conditions described above, leads to a full consumption of either glucose or xylose by this strain. The concentrations of ethanol in the glucose and xylose media, respectively, are 40 mM and 33 mM at steady state. Small amounts of glycerol are formed both for glucose and xylose (1.8 and 1.5 mM, respectively). No formic acid formation is observed. In the absence of sugars in the YP medium, no ethanol nor glycerol or formic acid is formed. If glycerol was added to the medium at 50 mM concentration, then the organism did not produce additional ethanol or formic acid as compared to the situations with glucose or xylose alone.
Strain RN1088 was derived from strain RN1041 by 1. upregulating DAK1, GCY1 and GUP1 allowing for enhanced uptake and consumption of glycerol under anoxic conditions 2. heterologous expression of pflA + pflB allowing for the conversion of pyruvate into formic acid and acetylCoA
3. heterologous expression of adhE2 allowing the conversion of acetylCoA into ethanol 4. deleting FDH1 and FDH2 preventing the oxidation of formic acid by this strain.
The organism is tested for growth and product formation in the same way as as described above. With either glucose or xylose, similar results are obtained as for RN1041 in terms of ethanol production. However, the formation of glycerol was slightly lower and traces of formic acid are observed. If glycerol is added to either the xylose- or glucose-containing medium at 50 mM concentration, then the organism does not consume more glycerol or produce additional ethanol and furthermore no additional formic acid is produced. Strains RN1089 and RN1090 have a similar genetic background as RN1088. The only difference is that adhE is not expressed in these organisms. Instead adh2 or mhpF are expressed. The characteristics of these strains during glycerol fermentations are similar to the characteristics of strain RN1088. Both strains showed similar characteristics as RN1088 for both glucose or xylose fermentation as strain RN1088.
Strains RN1091, RN1092 and RN1093 have the same genetic background as strain RN1088 with the exception of formic acid dehydrogenases. These strains have either 1 or 2 genes still present encoding for a formate dehydrogenase. Neither of the organisms is able to perform good fermentations on glycerol. Only traces of either ethanol and formic acid were seen during fermentation experiments. The organisms do ferment both glucose or xylose at rates comparable to strain RN1088.
Strains RN1094, RN1095 and RN1096 have the same genetic background as strain RN1088 with the exception of the expression of either pflA or pflB. These strains lack either both these genes or either of the genes. Neither of the 3 organisms is able to perform good fermentations on glycerol. No additional ethanol or formic acid are seen as based on the addition of 50 mNI glycerol to xylose-containing medium (25 mM) during fermentation experiments. The organisms do ferment both glucose or xylose at rates comparable to strain RN1088.
Strain RN1097 is derived from strain RN1088 by deleting GPD2. In doing so, a partial operation of a futile cycle might be prevented at the level of glycerol consumption/production. With glucose or xylose, the ethanol concentration at steady states are 38mM and 31 mM, respectively. Glycerol accumulates at 0.9mM and 0.5mM, respectively and formic acid had accumulates at 1.0 mM and 0.8 mM
respectively. If glycerol is added to either the xylose- or glucose-containing medium at 50 mM concentration, then the organism does not consume more glycerol or produce additional ethanol and furthermore no additional formic acid is produced.
Strains RN1098 and RN1099 resemble strain RN1088 but differ genetically at the level of the glycerol transporter(s). Strain RN1098 has FPS1 overexpressed instead of GUP1, whereas strain RN1099 has both transporter genes expressed. The organisms are tested for growth and product formation in the same way as RN1041 as described above.
With either glucose or xylose, similar results are obtained as for RN1041 in terms of ethanol production. However, the formation of glycerol was slightly lower and traces of formic acid were observed. If glycerol was added to either the xylose- or glucose-containing medium at 50 mM concentration, then the RN1098 and RN1099 organisms did not 5 consume more glycerol or produce additional ethanol and furthermore no additional formic acid was produced.
RN1194 is tested for growth and product formation in the same way as RN1041 as described above. With either glucose or xylose, similar results are obtained as for RN1041 in terms of ethanol production. However, the formation of glycerol is slightly 10 .. lower and traces of formic acid were observed. If glycerol is added to either the xylose-or glucose-containing medium at 50 mM concentration, then the organism produces additional ethanol and furthermore formic acid is produced. The concentration of ethanol at steady state in the glycerol/glucose medium is 75 mM and the formic acid concentration is 32 mM. The remaining glycerol level is 7 mM. The concentration of 15 ethanol at steady state in the glycerol/xylose medium is 66 mM and the formic acid concentration is 30 mM. The remaining glycerol level is 8 mM. No attempts are made to test for any other fermentation products that might have been produced on the basis of glycerol. RN1196 produces similar results as RN1194 although glycerol consumption and production of ethanol and formic acid are somewhat reduced 20 .. compared to RN1194.
Strain RN1195 is derived from strain RN1194 by deleting GPD2. In doing so, a partial operation of a futile cycle might be prevented at the level of glycerol consumption/production. With glucose or xylose, the ethanol concentration at steady states are 38mM and 31 mM, respectively. Glycerol accumulates at 0.9mM and 25 0.5mM, respectively and formic acid accumulates at 1.0 mM and 0.8 mM, respectively.
If glycerol is added to the xylose-medium (25 mM) at 50 mM concentration, then the organism additionally produces both ethanol and formic acid. The final concentration of ethanol at steady state was 72 mM, for glycerol 2 mM, and for formic acid 37 mM.
No attempts were made to test for any other fermentation products that might have 30 been produced on the basis of glycerol. These results clearly indicate that deletion of the GPD2 gene has a beneficial effect on the fermentation of glycerol in strain RN1195 as compared to strain RN1194.

o t.) =
Table 6 , =
c, Gene GPD2 adhE ade2 mphF DAK1 GCY1 GUP1 FPS1 FDH1 FDH2 pf1A+pflB
E.c gldA C.f. dhaK
fA
-, =
Strain /

marker natMX HIS3 HIS3 HIS3 hphMX hphMX hphMX zeoMX patMX kanMX zeoMX
RN1041 wt absent absent absent wt wt wt wt wt wt absent/absent absent absent RN1088 wt expr absent absent up up up wt del del expr/expr absent absent RN1089 wt absent expr absent up up up wt del del expr/expr absent absent n RN1090 wt absent absent expr up up up wt del del expr/expr absent absent 0 1.) RN1091 wt expr absent absent up up up wt wt wt expr/expr absent absent co ui Ø
RN1092 wt expr absent absent up up up wt del wt expr/expr absent absent 0 u, (...) RN1093 wt expr absent absent up up up wt wt del expr/expr absent absent I.) RN1094 wt expr absent absent up up up wt del del absent/absent absent absent i RN1095 wt expr absent absent up up up wt del del expr/absent absent absent 0 i 1.) 1.) RN1096 wt expr absent absent up up up wt del del absent/expr absent absent RN1097 del expr absent absent up up up wt del del expr/expr absent absent RN1098 wt expr absent absent up up wt up del del expr/expr absent absent RN1099 wt expr absent absent up up up up del del expr/expr absent absent -ci RN1194 wt expr absent absent wt wt wt wt del del expr/expr expr expr n RN1195 del expr absent absent wt wt wt wt del del expr/expr expr expr rh' RN1196 wt expr absent absent up wt up wt del del expr/expr expr absent =
-, -, '-' rA
=
--.1 oo --.1 Table 7 plasnnids loxPNatMXIox selection: HIS3 hph P nat kan zeo Strain RN1041 pRN347 RN1088 pRN595 pRN605 pRN621 pRN622 pRN616 RN1089 pRN596 pRN605 pRN621 pRN622 pRN616 RN1090 pRN558 pRN605 pRN621 pRN622 pRN616 RN1091 pRN595 pRN605 pRN616 RN1092 pRN595 pRN605 pRN621 pRN616 RN1093 pRN595 pRN605 pRN622 pRN616 RN1094 pRN595 pRN605 pRN621 pRN622 RN1095 pRN595 pRN605 pRN621 pRN622 pRN619 RN1096 pRN595 pRN605 pRN621 pRN622 pRN620 RN1097 pRN595 pRN605 pRN594 pRN621 pRN622 pRN616 RN1098 pRN595 pRN608 pRN621 pRN622 pRN618 RN1099 pRN595 pRN605 pRN621 pRN622 pRN618 RN1194 pRN957 pRN621 pRN622 pRN616 RN1195 pRN957 pRN594 pRN621 pRN622 pRN616 RN1196 pRN958 pRN607 pRN621 pRN622 pRN616 pRN347 = pRS303+2p0R1 SEQUENCE LISTING IN ELECTRONIC FORM
In accordance with Section 111(1) of the Patent Rules, this description contains a sequence listing in electronic form in ASCII
text format (file: 52215-155 Seq 27-SEP-13 vl.txt).
A copy of the sequence listing in electronic form is available from the Canadian Intellectual Property Office.
The sequences in the sequence listing in electronic form are reproduced in the following table.
SEQUENCE TABLE
<110> DSM IP Assets B.V.
<120> Yeast strains engineered to produce ethanol from glycerol <130> 52215-155 <140> CA national phase of PCT/NL2011/050787 <141> 2011-11-18 <150> EP 10191736.7 <151> 2010-11-18 <150> US 61/415,054 <151> 2010-11-18 <150> US 61/471,836 <151> 2011-04-05 <160> 57 <170> PatentIn version 3.3 <210> 1 <211> 760 <212> PRT
<213> Escherichia coli <400> 1 Met Ser Glu Leu Asn Glu Lys Leu Ala Thr Ala Trp Glu Gly Phe Thr Lys Gly Asp Trp Gin Asn Glu Val Asn Val Arg Asp Phe Ile Gin Lys Asn Tyr Thr Pro Tyr Glu Gly Asp Glu Ser Phe Leu Ala Gly Ala Thr Glu Ala Thr Thr Thr Leu Trp Asp Lys Val Met Glu Gly Val Lys Leu Glu Asn Arg Thr His Ala Pro Val Asp Phe Asp Thr Ala Val Ala Ser Thr Ile Thr Ser His Asp Ala Gly Tyr Ile Asn Lys Gln Leu Glu Lys Ile Val Gly Leu Gin Thr Glu Ala Pro Leu Lys Arq Ala Lou Ile Pro She Gly Gly Ile Lys Met Ile Glu Gly Ser Cys Lys Ala Tyr Asn Arg Glu Leu Asp Pro Met Ile Lys Lys Ile Phe Thr Glu Tyr Arg Lys Thr His Asn Gin Gly Val She Asp Val Tyr Thr Pro Asp Ile Leu Arg Cys Arg Lys Ser Gly Val Leu Thr Gly Leu Pro Asp Ala Tyr Gly Arg Gly Arg Ile Ile Gly Asp Tyr Arg Arg Val Ala Leu Tyr Gly Ile Asp Tyr Leu Met Lys Asp Lys Leu Ala Gin She Thr Ser Leu Gin Ala Asp Leu Glu Asn Gly Val Asn Leu Glu Gin Thr Ile Arg Leu Arg Glu Glu Ile Ala Glu Gin His Arg Ala Leu Gly Gin Met Lys Glu Met Ala Ala Lys Tyr Gly Tyr Asp Ile Ser Gly Pro Ala Thr Asn Ala Gin Glu Ala Ile Gin Trp Thr Tyr Phe Gly Tyr Leu Ala Ala Val Lys Ser Gin Asn Gly Ala Ala Met Ser Phe Gly Arg Thr Ser Thr Phe Leu Asp Val Tyr Ile Glu Arg Asp Leu Lys Ala Gly Lys Ile Thr Glu Gin Glu Ala Gin Glu Met Val Asp His Leu Val Met Lys Leu Arg Met Val Arg She Leu Arg Thr Pro Glu Tyr Asp Glu Leu Phe Ser Gly Asp Pro Ile Trp Ala Thr Clu Ser Ile Gly Gly Met Gly Leu Asp Gly Arg Thr Leu Val Thr Lys Asn Ser Phe Arg Phe Leu Asn Thr Leu Tyr Thr Met Gly Pro Ser Pro 355 360 .365 Glu Pro Asn Met Thr Ile Leu Trp Ser Glu Lys Leu Pro Leu Asn Phe Lys Lys Phe Ala Ala Lys Val Ser Ile Asp Thr Ser Ser Leu Gin Tyr Glu Asn Asp Asp Leu Met Arg Pro Asp Phe Asn An Asp Asp Tyr Ala Ile Ala Cys Cys Val Ser Pro Met Ile Val Gly Lys Gin Met Gin She Phe Gly Ala Arg Ala Asn Leu Ala Lys Thr Met Leu Tyr Ala Ile Asn Gly Gly Val Asp Glu Lys Leu Lys Met Gin Val Gly Pro Lys Ser Glu Pro Ile Lys Gly Asp Val Leu Asn Tyr Asp G1u Val Met Glu Arg Met Asp His Phe Met Asp Trp Leu Ala Lys Gin Tyr Ile Thr Ala Leu Asn Ile Ile His Tyr Met His Asp Lys Tyr Ser Tyr Glu Ala Ser Leu Met Ala Leu His Asp Arg Asp Val Ile Arg Thr Met Ala Cys Gly Ile Ala Gly Leu 'Ser Val Ala Ala Asp Ser Leu Ser Ala Ile Lys Tyr Ala Lys Vol Lys Pro Ile Arg Asp Glu Asp Gly Leu Ala Ile Asp Phe Glu Ile Glu Gly Glu Tyr Pro Gln Phe Gly Asn Asn Asp Pro Arg Val Asp Asp Leu Ala Val Asp Leu Val Glu Arg Phe Met Lys Lys Ile Gln Lys Leu His Thr Tyr Arg Asp Ala Ile Pro Thr Gln Ser Val Leu Thr Ile Thr Ser Asn Val Val Tyr Gly Lys Lys Thr Gly Asn Thr Pro Asp Gly Arg Arg Ala Gly Ala Pro Phe Gly Pro Gly Ala Asn Pro Met His Gly Arg Asp Gln Lys Gly Ala Val Ala Ser Leu Thr Ser Val Ala Lys Leu Pro Phe Ala Tyr Ala Lys Asp Gly Ile Ser Tyr Thr Phe Ser Ile Vol Pro Asn Ala Leu Gly Lys Asp Asp Glu Val Arg Lys Thr Asn Leu Ala Gly Leu Met Asp Gly Tyr Phe His His Glu Ala Ser Ile Glu Gly Gly Gln His Leu Asn Vol Asn Val Met Asn Arg Glu Met Leu Leu Asp Ala Met Glu Asn Pro Glu Lys Tyr Pro Gln Leu Thr Ile Arg Val Ser Gly Tyr Ala Val Arg Phe Asn Ser Leu Thr Lys Glu Gln Gln Gln Asp Vol Ile Thr Arg Thr Phe Thr Gln Ser Met <210> 2 <211> 2283 <212> DNA
<213> Artificial Sequence <220>
<223> synthetic codon optimised E.coli pflB
<400> 2 atgtctgaat tgaacgagaa gttgqctacc gcttgqqaag qtttcaccaa gggtqactqg 60 caaaacgaag ttaacgttag agacttcatc caaaagaact acaccccata cgaaggtgac 120 gaatctttct tggctggtgc taccgaagct accaccacct tgtgggacaa ggttatggaa 180 ggtgttaagt tggaaaacag aacccacgct ccagttgact tcgacaccgc tgttgcttct 240 accatcacct ctcacgacgc tggttacatc aacaagcaat tggaaaagat cgttggttta 300 caaaccgaag ctccattgaa gagagctttg atcccattcg gtggtatcaa gatgatcgaa 360 ggttcttgta aggcttacaa cagagaattg gacccaatga tcaagaagat tttcaccgaa 420 tacagaaaga cccacaacca aggtgttttc gacgtttaca ctccagacat cttgagatgt 480 agaaagtctg gtgttttgac tggtttgcca gacgcttacg gtagaggtag aatcatcggt 540 gaotacagaa gagttqcttt gtacggtatc gactacttga tgaaggacaa gttggctcaa 600 ttcacctctt tgcaagctga cttggaaaac ggtgttaact tggaacaaac catcagattg 660 agagaagaaa tcgctgaaca acacagagct ttgggtcaaa tgaaggaaat ggctgctaag 720 tacggttacg acatctctgg tccagctacc aacgctcaag aagctatcca atggacctac 780 ttcggttact tggctgctgt taagtctcaa aacggtgctg ctatgtcttt cggtaggacc 840 tctaccttct tggacgttta catcgaaaga gacttgaagg ctggtaagat caccgaacaa 900 gaagctcaag aaatggttga ccacttggtt atgaagttga gaatggttag attcttgaga 960 accccagaat acgacgaatt gttctctggt gacccaatct gggctaccga atctatcggt 1020 ggtatgggtt tggacggtag aaccttggtt accaagaact ctttcagatt cttgaacacc 1080 ttatacacca tqggtccatc tccagaacca aacatgacca tcttgtggtc tgaaaagtta 1140 ccattgaact tcaagaagtt cgctgctaag gtttctatcg acacctcttc tttgcaatac 1200 gaaaacgacg acttgatgag accagacttc aacaacgacg actacgctat cgctLgttgt 1260 gtttctccaa tgatcgttgg taagcaaatg caattcttcg gtgctagagc taacttggct 1320 aagaccatgt tgtacgctat caacggtggt gttgacgaaa agttgaagat gcaagttggt 1380 ccaaagtctg aaccaatcaa gggtgacgtt ttgaactacg acgaagttat ggaaagaatg 1440 gaccacttca tggactggtt ggctaagcaa tacatcaccg ctttgaacat catccaCtac 1500 atgcacgaca agtactctta cgaagcatca ttgatggctt tgcacgacag agacgtaatc 1560 agaaccatgg cttgtggtat cgctggtttg tctgttgctg ctgactcttt gtctgctatc 1620 aagtacgcta aggttaagcc aatcagagac gaagacggtt tggctatcga cttcgaaatc 1680 gaaggtgaat accctcaatt cggtaacaac gacccaagag ttgacgactt ggctgttgac 1740 ttggttgaaa gatttatgaa gaagatccaa aagttgcaca cctacagaga cgctatccca 1800 acccaatctg ttttgactat cacatctaac gttgtttacg gtaagaagac tggtaacacc 1860 ccagacggta gaagagctgg tgctccattc ggtccaggtg ctaacccaat gcacggtaga 1920 gaccaaaagg gtgctgtagc atctttgacc tctgttqcta agttgccatt cgcttacgct 1980 aaggagggta tctcttacac cttctctatc gttccaaacg ctttgggtaa ggacgatgaa 2040 gttagaaaga ccaacttggc tggtttgatg gacggttact tccaccacga agcatctatc 2100 gaaggtggtc aacacttgaa cgtaaatgtt atgaacagag aaatgttgtt ggacgctatg 2160 gaaaacccag aaaagtaccc acaattgacc atcagagttt ctggttacgc tgttagattc 2220 aactctttga ccaaggaaca acaacaaqac gttatcacca gaaccttcac ccaatctatg 2280 taa 2283 <210> 3 <211> 246 <212> PRT
<213> Escherichia ccli <400> 3 Met Ser Vol Ile Gly Arg Ile His Ser Phe Glu Ser Cys Gly Thr Val Asp Gly Pro Gly Ile Arg Phe Ile Thr Phe Phe Gin Gly Cys Leu Met Arg Cys Leu Tyr Cys His Asn Arg Asp Thr Trp Asp Thr His Gly Gly Lys Glu Val Thr Val Glu Asp Leu Met Lys Glu Val Val Thr Tyr Arg His Phe Met Asn Ala Ser Gly Gly Gly Val Thr Ala Ser' Gly Gly Glu Ala Ile Leu Gin Ala Glu Phe Val Arg Asp Trp Phe Arg Ala Cys Lys Lys Glu Gly Ile His Thr Cys Leu Asp Thr Asn Gly Phe Val Arg Arg Tyr Asp Pro Val Ile Asp Glu Leu Leu Glu Val Thr Asp Leu Val Met Leu Asp Leu Lys Gin Met Asn Asp Glu Ile His Gin Asn Leu Val Gly Val Ser Asn His Arg Thr Leu Glu Phe Ala Lys Tyr Leu Ala Asn Lys Asn Val Lys Val Trp Ile Arg Tyr Val Val Val Pro Gly Trp Ser Asp Asp Asp Asp Ser Ala His Arg Leu Gly Glu Phe Thr Arg Asp Met Gly Asn Val Glu Lys Ile Glu Leu Leu Pro Tyr His Glu Leu Gly Lys His Lys Trp Val Ala Met Gly Glu Glu Tyr Lys Leu Asp Gly Val Lys Pro Pro Lys Lys Glu Thr Met Glu Arg Val Lys Gly Ile Leu Glu Gln Tyr Gly His Lys Val Met Phe <210> 4 <211> 741 <212> DNA
<213> Artificial Sequence <220>
<223> synthetic codon optimised E.coli pflA
<400> 4 atgtctgtta tcggtagaat ccactctttc gaatcttgtg gtactgttga cggtccaggt 60 atcagattca tcaccttctt ccaaggttgt ttgatgagat gtttgtactg tcacaacaga 120 gacacctggg acacccacgg tggtaaggaa gttactgttg aagacttgat gaaggaagtt 180 gttacctaca gacactttat gaacgcttca ggaggtggtg ttaccgcttc tggtggtgaa 240 gctatcttgc aagctgaatt tgttagagac tggttcagag cttgtaagaa ggaaggtatc 300 cacacctgtt tggacaccaa cggtttcgtt agaagatacg acccagttat cgacgaattg 360 ttggaagtta ccgacttggt tatgttggac ttgaagcaaa tgaacgacga aatccaccaa 420 aacttggttg gligtttctaa ccacagaacc ttggaatttg ctaagtactt ggctaacaag 480 aacgttaagg tttggatcag atacgttgtt gttccaggtt ggtctgacga cgacgactct 540 gctcacagat tgggtgagtt caccagagac atgggtaacg ttgaaaagat cgaattgttg 600 ccataccacg aattgggtaa gcacaagtgg gttgctatgg gtgaagaata caagCtggac 660 ggtgttaagc caccaaagaa ggaaaccatg gaaagagtta agggtatctt ggaacaatac 720 ggtcacaagg ttatgttcta a 741 <210> 5 <211> 376 <212> PRT
<213> Saccharomyces cerevisiae <400> 5 Met Ser Lys Gly Lys Val Leu Leu Val Leu Tyr Glu Gly Gly Lys His Ala Glu Glu Gln Glu Lys Leu Leu Gly Cys Ile Glu Asn Glu Leu Gly Tie Arg Asn Phe Ile Glu Glu Gln Gly Tyr Glu Leu Val Thr Thr Ile Asp Lys Asp Pro Glu Pro Thr Ser Thr Val Asp Arg Glu Leu Lys Asp Ala Glu Ile Val Ile Thr Thr Pro Phe Phe Pro Ala Tyr Ile Ser Arg Asn Arg Ile Ala Glu Ala Pro Asn Leu Lys Leu Cys Val Thr Ala Gly Val Gly Ser Asp His Val Asp Leu Glu Ala Ala Asn Glu Arg Lys Ile Thr Val Thr Glu Val Thr Gly Ser Asn Val Val Ser Val Ala Glu His =

Val Met Ala Thr Ile Leu Val Leu Ile Arg Asn Tyr Asn Gly Gly His Gln Gin Ala Ile Asn Gly Glu Trp Asp Ile Ala Gly Val Ala Lys Asn Glu Tyr Asp Leu Glu Asp Lys Ile Ile Ser Thr Val Gly Ala Gly Arg Ile Gly Tyr Arg Val Leu Glu Arg Lou Val Ala Phe Asn Pro Lys Lys Leu Leu Tyr Tyr Asp Tyr Gin Glu Leu Pro Ala Glu Ala Ile Asn Arg Leu Asn Glu Ala Ser Lys Leu Phe Asn Gly Arg Gly Asp Ile Val Gin Arg Val Glu Lys Leu Glu Asp Met Val Ala Gin Ser Asp Val Val Thr Ile Asn Cys Pro Leu His Lys Asp Ser Arg Gly Leu Phe Asn Lys Lys Lou Ile Ser His Met Lys Asp Gly Ala Tyr Leu Val Asn Thr Ala Arg Gly Ala Ile Cys Val Ala Glu Asp Val Ala Glu Ala Val Lys Ser Gly Lys Leu Ala Gly Tyr Gly Gly Asp Val Trp Asp Lys Gin Pro Ala Pro Lys Asp His Pro Trp Arg Thr Met Asp Asn Lys Asp His Val Gly Asn Ala Met Thr Val His Ile Ser Gly Thr Ser Leu Asp Ala Gin Lys Arg Tyr Ala Gin Gly Val Lys Asn Ile Lou Asn Ser Tyr Phe Ser Lys Lys Phe Asp Tyr Arg Pro Gin Asp Ile Ile Val Gin Asn Gly Ser Tyr Ala Thr Arg Ala Tyr Gly Gin Lys Lys <210> 6 <211> 376 <212> PRT
<213> Saccharomyces cerevisiae <400> 6 Met Ser Lys Gly Lys Val Leu Leu Val Leu Tyr Glu Gly Gly Lys His Ala Glu Glu Gin Glu Lys Leu Leu Gly Cys Ile Glu Asn Glu Leu Gly Ile Arg Asn Phe Ile Glu Glu Gin Gly Tyr Glu Leu Val Thr Thr Ile Asp Lys Asp Pro Glu Pro Thr Ser Thr Val Asp Arg Glu Leu Lys Asp Ala Glu Ile Val Ile Thr Thr Pro Phe Phe Pro Ala Tyr Ile Ser Arg Asn Arg Ile Ala Glu Ala Pro Asn Leu Lys Leu Cys Val Thr Ala Gly Val Gly Ser Asp His Val Asp Leu Glu Ala Ala Asn Glu Arg Lys Ile Thr Val Thr Glu Val Thr Gly Ser Asn Val Val Ser Val Ala Glu His Val Met Ala Thr Ile Leu Val Leu Ile Arg Asn Tyr Asn Gly Gly His Gin Gin Ala Ile Asn Gly Glu Trp Asp Tie Ala Gly Val Ala Lys Asn Glu Tyr Asp Leu Glu Asp Lys Ile Ile Ser Thr Val Gly Ala Gly Arg Ile Gly Tyr Arg Val Leu Glu Arg Leu Vol Ala Phe Asn Pro Lys Lys Leu Leu Tyr Tyr Asp Tyr Gin Glu Leu Pro AJa Glu Ala Ile Asn Arg Leu Asn Glu Ala Ser Lys Leu Phe Asn Gly Arg Gly Asp Ile Val Gin Arg Vol Glu Lys Leu Glu Asp Met Vol Ala Gin Ser Asp Val Vol Thr Ile Asn Cys Pro Leu His Lys Asp Ser Arg Gly Leu Phe Asn Lys Lys Leu Ile Ser His Met Lys Asp Gly Ala Tyr Leu Val Asn Thr Ala Arg Gly Ala Ile Cys Val Ala Glu Asp Val Ala Glu Ala Val Lys Ser Gly Lys Leu Ala Gly Tyr Gly Gly Asp Val Trp Asp Lys Gin Pro Ala Pro Lys Asp His Pro Trp Arg Thr Met Asp Asn Lys Asp His Vol Gly Asn Ala Met Thr Val His Ile Ser Gly Thr Ser Leu Asp Ala Gin Lys Arg Tyr Ala Gin Gly Vol Lys Asn Ile Leu Asn Ser Tyr Phe Ser Lys Lys Phe Asp Tyr Arg Pro Gin Asp Ile Ile Vol Gin Asn Gly Ser Tyr Ala Thr Arg Ala Tyr Gly Gin Lys Lys <210> 7 <211> 316 <212> PRT
<213> Escherichia coil <400> 7 Met Ser Lys Arg Lys Val Ala Ile Ile Gly Ser Gly Asn Ile Gly Thr Asp Leu Met Ile Lys Ile Leu Arg His Gly Gin His Leu Glu Mel Ala Val Met Val Gly Ile Asp Pro Gin Ser Asp Gly Leu Ala Arg Ala Arg Arg Met Gly Val Ala Thr Thr His Glu Gly Val Ile Gly Leu Met Asn Met Pro Glu Phe Ala Asp Ile Asp Ile Val Phe Asp Ala Thr Ser Ala Gly Ala His Val Lys Asn Asp Ala Ala Leu Arg Glu Ala Lys Pro Asp Tle Arg Leu Ile Asp Leu Thr Pro Ala Ala Ile Gly Pro Tyr Cys Val Pro Vol Vol Asn Leu Glu Ala Asn Vol Asp Gin Leu Asn Val Asn Met Val Thr Cys Gly Gly Gin Ala Thr Ile Pro Met Val Ala Ala Val Ser Arg Val Ala Arg Val His Tyr Ala Glu Ile Ile Ala Ser Ile Ala Ser Lys Ser Ala Gly Pro Gly Thr Arg Ala Asn Ile Asp Glu Phe Thr Glu Thr Thr Ser Arg Ala Ile Glu Val Val Gly Gly Ala Ala Lys Gly Lys Ala Ile Ile Val Leu Asn Pro Ala Glu Pro Pro Leu Met Met Arg Asp Thr Val Tyr Val Leu Ser Asp Glu Ala Ser Gin Asp Asp Ile Glu Ala Ser Ile Asn Glu Met Ala Glu Ala Val Gin Ala Tyr Val Pro Gly Tyr Arg Leu Lys Gin Arg Val Gin Phe Glu Val Ile Pro Gin Asp Lys Pro Val Asn Leu Pro Gly Val Gly Gin Phe Ser Gly Leu Lys Thr Ala Val Trp Leu Glu Val Glu Gly Ala Ala His Tyr Leu Pro Ala Tyr Ala Gly Asn Leu Asp Tie Met Thr Ser Ser Ala Leu Ala Thr Ala Glu Lys Met Ala Gin Ser Leu Ala Arg Lys Ala Gly Glu Ala Ala <210> 8 <211> 968 <212> DNA
<213> Artificial Sequence <220>
<223> synthetic codon optimised E.coli mhpF
(400> 8 ctgcagtcta gatgtctaag agaaaggttg ctatcatcgg ttctggtaac atcggtactg 60 acttgatgat caagatccta agacacggtc aacacttgga aatggctgtt atggttggta 120 tcgacccaca atctgacggt ttggctagag ctagaagaat gggtgttgct accacccacg 180 aaggtgttat cggtttgatg aacatgccag aattcgctga catcgacatc gttttcgacg 240 ctacctctgc tggtgctcac gttaagaacg acgctgcttt gagagaagct aagccagaca 300 tcagattgat cgacttgacc ccagctgcta tcggtccata ctgtgttcca gttgttaact 360 tggaagctaa cgttgaccaa ttaaacgtta acatggttac ctgtggtggt caagctacca 420 tcccaatggt tgctgctgtt tcaagagttg ctagagttca ctacgctgaa atcatcgctt 480 ctatcgcttc taagtctgct ggtccaggta ccagagctaa catcgacgaa ttcaccgaaa 540 ccacctctag ggctatcgaa gttgttggtg gtgctgctaa gggtaaggct atcatcgttt 600 tgaacccagc tgaaccacca ttgatgatga gagacaccgt ttacgttttg totgacgaag 660 catctcaaga cgacatcgaa gcttcaatca acgaaatggc tgaagctgtt caagcatacg 720 ttccaggtta cagattgaag caaagagttc aattcgaagt tatcccacaa gacaagccag 780 ttaacttgcc aggtgttggt caattctctg gtttgaagac cgctgtttgg ttggaagttg B40 aaggtgctgc tcactacttg ccagcttacg ctggtaactt ggacattatg acctcttctg 900 ctttggctac cgctgaaaag atggctcaat ctttggctag aaaggctggt gaagctgctt 960 aagcgcgc 968 <210> 9 <211> 891 <212> PRT
<213> Escherichia coil <400> 9 Met Ala Val Thr Asn Val Ala Glu Leu Asn Ala Leu Val Glu Arg Val Lys Lys Ala Gln Arg Glu Tyr Ala Ser Phe Thr Gln Glu Gln Val Asp Lys Ile Phe Arg Ala Ala Ala Leu Ala Ala Ala Asp Ala Arg Ile Pro Leu Ala Lys Met Ala Val Ala Glu Ser Gly Met Gly Ile Val Glu Asp Lys Val Ile Lys Asn His Phe Ala Ser Glu Tyr Ile Tyr Asn Ala Tyr Lys Asp Glu Lys Thr Cys Gly Val Leu Ser Glu Asp Asp Thr Phe Gly Thr Ile Thr Ile Ala Glu Pro Ile Gly Ile Ile Cys Gly Ile Val Pro Thr Thr Asn Pro Thr Ser Thr Ala Ile Phe Lys Ser Leu Ile Ser Leu 1:5 120 125 Lys Thr Arg Asn Ala Ile Ile Phe Ser Pro His Pro Arg Ala Lys Asp Ala Thr Asn Lys Ala Ala Asp Ile Val Leu Gin Ala Ala Ile Ala Ala Gly Ala Pro Lys Asp Leu Ile Gly Trp Ile Asp Gin Pro Ser Val Glu Leu Ser Asn Ala Leu Met His His Pro Asp Ile Asn Leu Ile Leu Ala Thr Gly Gly Pro Gly Met Val Lys Ala Ala Tyr Ser Ser Gly Lys Pro Ala Ile Gly Val Gly Ala Gly Asn Thr Pro Val Val Ile Asp Glu Thr Ala Asp Ile Lys Arg Ala Val Ala Ser Val Leu Met Ser Lys Thr Phe Asp Asn Gly Val Ile Cys Ala Ser Glu Gln Ser Val Val Val Val Asp Ser Val Tyr Asp Ala Val Arg Glu Arg Phe Ala Thr His Gly Gly Tyr Leu Leu Gln Gly Lys Glu Leu Lys Ala Val Gin Asp Val Ile Leu Lys Asn Gly Ala Leu Asn Ala Ala Ile Val Gly Gln Pro Ala Tyr Lys Ile Ala Glu Leu Ala Gly Phe Ser Val Pro Glu Asn Thr Lys Ile Leu Ile Gly Glu Val Thr Val Val Asp Glu Ser Glu Pro Phe Ala His Glu Lys Leu Ser Pro Thr Leu Ala Met Tyr Arg Ala Lys Asp Phe Glu Asp Ala Val Glu Lys Ala Glu Lys Leu Val Ala Met Gly Gly Ile Gly His Thr Ser Cys Leu Tyr Thr Asp Gln Asp Asn Gln Pro Ala Arg Val Ser Tyr Phe Gly Gln Lys Met Lys Thr Ala Arg Ile Leu Ile Asn Thr Pro Ala Ser Gln Gly Gly Ile Gly Asp Leu Tyr Asn Phe Lys Leu Ala Pro Ser Leu Thr Leu Gly Cys Gly Ser Trp Gly Gly Asn Ser Ile Ser Glu Asn Val Gly Pro Lys His Leu Ile Asn Lys Lys Thr Val Ala Lys Arg Ala Glu Asn Met Leu Trp His Lys Leu Pro Lys Ser Ile Tyr Phe Arg Arg Gly Ser Leu Pro Ile Ala Leu Asp Glu Val Ile Thr Asp Gly His Lys Arg Ala Leu Ile Val Thr Asp Arg Phe Leu Phe Asn Asn Gly Tyr Ala Asp Gin Ile Thr Ser Val Leu Lys Ala Ala Gly Val Glu Thr Glu Val Phe Phe Glu Val Glu Ala Asp Pro Thr Leu Ser Ile Val Arg Lys Gly Ala Glu Leu Ala Asn Ser Phe Lys Pro Asp Val Ile Ile Ala Leu Gly Gly Gly Ser Pro Met Asp Ala Ala Lys Ile Met Trp Val Met Tyr Glu His Pro Glu Thr His Phe Glu Glu Lou Ala Leu Arq Phe Met Asp Ile Arg Lys Arg Ile Tyr Lys Phe Pro Lys Met Gly Val Lys Ala Lys Met Ile Ala Val Thr Thr Thr Ser Gly Thr Gly Ser Glu Val Thr Pro Phe Ala Val Val Thr Asp Asp Ala Thr Gly Gin Lys Tyr Pro Leu Ala Asp Tyr Ala Leu Thr Pro Asp Met Ala Ile Val Asp Ala Asn Leu Val Met Asp Met Pro Lys Ser Leu Cys Ala Phe Gly Gly Lou Asp Ala Val Thr His Ala Met Glu Ala Tyr Val Ser Val Leu Ala Ser Glu Phe Ser Asp Gly Gin Ala Leu Gin Ala Leu Lys Leu Leu Lys Glu Tyr Leu Pro Ala Ser Tyr His Glu Gly Ser Lys Asn Pro Val Ala Arg Glu Arg Val His Ser Ala Ala Thr Ile Ala Gly Ile Ala Phe Ala Asn Ala Phe Leu Gly Val Cys His Ser Met Ala His Lys Leu Gly Ser Gin Phe His Ile Pro His Gly Leu Ala Asn Ala Leu Leu Ile Cys Asn Val Ile Arg Tyr Asn Ala Asn Asp Asn Pro Thr Lys Gin Thr Ala Phe Ser Gin Tyr Asp Arg Pro Gln Ala Arg Arg Arg Tyr Ala Glu Ile Ala Asp His Leu Gly Leu Ser Ala Pro Gly Asp Arg Thr Ala Ala Lys Ile Glu Lys Leu Leu Ala Trp Leu Glu Thr Leu Lys Ala Glu Leu Gly Ile Pro Lys Ser Ile Arg Glu Ala Gly Val Gin Glu Ala Asp Phe Leu Ala Asn Val Asp Lys Leu Ser Glu Asp Ala Phe Asp Asp Gin Cys Thr Gly Ala Asn Pro Arg Tyr Pro Leu Ile Ser Glu Leu Lys Gln Ile Leu Leu Asp Thr Tyr Tyr Gly Arg Asp Tyr Val Glu Gly Glu Thr Ala Ala Lys Lys Glu Ala Ala Pro Ala Lys Ala Glu Lys Lys Ala Lys Lys Ser Ala <210> 10 <211> 2690 <212> DNA
<213> Artificial Sequence <220>
<223> synthetic codon optimised E.coli adhE
<400> 10 tctagaaaat ggctgttacc aacgttgctg aattgaacgc tttggttgaa agggttaaga 60 aggctcaaag agaatacgct tctttcaccc aagaacaagt tgacaagatc ttcagagctg 120 ctgctttggc tgctgctgac gctagaatcc cattggctaa gatggctgtt gctgaatctg 180 gtatgggtat cgttgaagac aaggttatca agaaccactt cgcttctgaa tacatctaca 240 acgcttacaa ggacgaaaag acctgtggtg ttttgtcaga agacgacacc ttcggtacca 300 tcaccatcgc tgaaccaatc gqtatcatct gtggtatcgt tccaaccacc aacccaacct 360 ctaccgctat cttcaagtct ttgatctctt tgaagaccag aaacqctatc atattctotc 420 cacacccaag agctaaagac gctaccaaca aggctgctga catcgttttg caagctgcta 480 tcgctgctgg tgctccaaag gacttgatcg gttggatcga ccaaccatct gttgaattgt 540 ctaacgcttt gatgcaccac ccagacatca acttgatctt ggctaccggt ggtccaggta 600 tggttaaggc tgcttactct tctggtaagc cagctatcgg tgttggtgct ggtaacaccc 660 cagttgttat cgacgaaacc qctgacatca agagaqctgt tgcttctgtt ttgatgtcta 720 agaccttcga caacggtgtt atctgtgctt ctgaacaatc tgttgttgtt gttgactctg 780 tttacgacgc tgttagagaa agattcgcta cccacggtgg ttacttgttg caaggtaagg 840 aattgaaggc tgttcaagac gtLaLcLtga agaacggtgc tttgaacgct gctatcgttg 900 gtcaaccagc ttacaagatc gctgaattag ctggtttctc tgttccagaa aacaccaaga 960 tcttgatcgg tgaagttacc gttgttgacg aatctgaacc attcgctcac gaaaagttgt 1020 ctccaacctt ggctatgtac agagctaagg acttcgaaga cgctgttgaa aaagctgaaa 1080 agttggttgc tatgggtggt attggtcaca cctcttgttt gtacaccgac caagacaacc 1140 aaccagctag agtttcttac ttcggtcaaa agatgaagac cgctagaatc ttgatcaaca 1200 ccccagcttc tcaaggtggt atcggtgact tgtacaactt caagttggct ccatctttga 1260 ccttgggttg tggttcttgg ggtggtaact ctatctctga aaacgttggt ccaaagcact 1320 tgatcaacaa gaagaccgtt gctaagagag ctgaaaacat gttgtggcac aagttgccaa 1380 aatctatcta cttcagaaga ggttctttgc caatcgcttt ggacgaagtt atcaccgacg 1440 gtcacaagag agctttgatc gttaccgaca cjaLtcLtgtt caacaacggt tacgctgacc 1500 aaatcacctc tgttttgaag gctgctggtg ttgaaaccga agttttcttc gaagttgaag 1560 ctgacccaac cttgtctatc gttagaaagg gtgctgaatt ggctaactct ttcaagccag 1620 acgttatcat cgctttgggt ggtggttctc caatggacgc tgctaagatc atgtgggtta 1680 tgtacgaaca cccagaaacc cacttcgaag aattggcttt gagattcatg gacatcagaa 1740 agagaatcta caagttccca aagatgggtg ttaaggctaa gatgatcgct gttaccacca 1800 cctctggtac cggttctgaa gttaccccat tcgctgttgt taccgacgac gctaccggtc 1860 aaaagtaccc attggctgac tacgctttga ccccagacat ggctatcgtt gacgctaact 1920 tggttatgga catgccaaag tcLLtgtgtg ctttcggtgg tttggacgct gttacccacg 1980 ctatggaagc ttacgtttct gttttggctt ctgaattctc tgacggtcaa gctttgcaag 2040 ctttgaagtt gttgaaggaa tacttgccag cttcttacca cgaaggttct aagaacccaq 2100 ttgctagaga aagagttcac tctgctgcta ccatcgctgg tatcgctttc gctaacgctt 2160 tcttgggtgt ttgtcactct atggctcaca agttgggttc tcaattccac atcccacacg 2220 gtttggctaa cgctttgttg atctgtaacg ttatcagata caacgctaac gacaacccaa 2280 ccaagcaaac cgctttctct caatacgaca gaccacaagc tagaagaaga tacgctgaaa 2340 tcgctgacca cttgggtttg tctgctccag gtgacagaac cgctgcaaag atcgaaaagt 2400 tgttggcttg gttggaaacc ttgaaggctg aattqqgtat cccaaagtct atcagagaag 2460 ctggtgttca agaagctgac ttcttggcta acgttgacaa gttgtctgaa gacgctttcg 2520 acgaccaatg taccggtgct aacccaagat acccattgat ctctgaattg aagcaaatct 2580 tgttggacac ctactacqgt agagactacg ttqaaggtga aaccgctgot aagaaggaag 2640 ctgctccagc taaggctgaa aagaaggcta agaagtotgc ttagcttaag 2690 <210> 11 <211> 870 <212> PRT
<213> Fntamoeba histolytica <400> 11 Met Ser Thr Gin Gin Thr Met Thr Val Asp Glu His Ile Asn Gin Leu 1 5 10 = 15 Vol Arg Lys Ala Gin Val Ala Leu Lys Glu Tyr Leu Lys Pro Glu Tyr Thr Gin Glu Lys Ile Asp Tyr Ile Val Lys Lys Ala Ser Val Ala Ala Leu Asp Gin His Cys Ala Leu Ala Ala Ala Ala Val Glu Glu Thr Gly Arg Gly Ile Phe Glu Asp Lys Ala Thr Lys Asn Ile Phe Ala Cys Glu His Vol Thr His Glu Met Arg His Ala Lys Thr Val Gly Ile Ile Asn Val Asp Pro Leu Tyr Giy Ile Thr Glu Ile Ala Glu Pro Val Gly Val Val Cys Gly Val Thr Pro Val Thr Asn Pro Thr Ser Thr Ala Ile Phe Lys Ser Leu Ile Ser lle Lys Thr Arg Asn Pro Ile Val Phe Ser Phe His Pro Ser Ala Leu Lys Cys Ser Ile Met Ala Ala Lys Ile Val Arg Asp Ala Ala Ile Ala Ala Gly Ala Pro Glu Asn Cys Ile Gin Trp Ile Glu Phe Gly Gly Ile Glu Ala Ser Asn Lys Leu Met Asn His Pro Gly Val Ala Thr Ile Leu Ala Thr Gly Gly Asn Ala Met Val Lys Ala Ala Tyr Ser Ser Gly Lys Pro Ala Leu Gly Vol Gly Ala Gly Asn Val Pro Thr Tyr Ile Glu Lys Thr Cys Asn Ile Lys Gin Ala Ala Asn Asp Vol Val Met Ser Lys Ser Phe Asp Asn Gly Met Ile Cys Ala Ser Glu Gin Ala Ala Ile Ile Asp Lys Glu Tie Tyr Asp Gin Val Val Glu Glu Met Lys Thr Leu Gly Ala Tyr Phe Ile Asn Glu Glu Glu Lys Ala Lys Leu Glu Lys Phe Met Phe Gly Val Asn Ala Tyr Ser Ala Asp Val Asn Asn Ala Arg Leu Asn Pro Lys Cys Pro Giy Met Ser. Pro Gin Trp Phe Ala Glu Gin Val Gly Ile Lys Val Pro Glu Asp Cys Asn Ile Ile Cys Ala Vol Cys Lys Glu Val Gly Pro Asn Glu Pro Leu Thr Arg Glu Lys Leu Ser Pro Val Leu Ala Ile Leu Lys Ala Glu Asn Thr Gin Asp Gly Ile Asp Lys Ala Glu Ala Met Val Glu Phe Asn Gly Arg Gly His Ser Ala Ala Ile His Ser Asn Asp Lys Ala Val Val Gill Lys Tyr Ala Leu Thr Met Lys Ala Cys Arg Ile Leu His Asn Thr Pro Ser Ser Gin Gly Gly Ile Gly Ser Ile Tyr Asn Tyr Ile Trp Pro Ser Phe Thr Leu Gly Cys Gly Ser Tyr Gly Gly Asn Ser Val Ser Ala Asn Val Thr Tyr His Ash Leu Leu Asn Ile Lys Arg Leu Ala Asp Arg Arg Asn Asn Leu Gin Trp Phe Arg Val Pro Pro Lys Ile Phe Phe Glu Pro His Ser Ile Arg Tyr Len Ala Glu Leu Lys Glu Leu Ser Lys Ile Phe Ile Val Ser Asp Arg Met Met Tyr Lys Leu Gly Tyr Val Asp Arg Val Met Asp Val Leu Lys Arg Arg Ser Asn Glu Val Glu Ile Glu Ile Phe Ile Asp Val Glu Pro Asp Pro Ser Ile Gin Thr Val Gin Lys Gly Leu Ala Val Met Asn Thr Phe Gly Pro Asp Asn Ile Ile Ala Ile Gly Gly Gly Ser Ala Met Asp Ala Ala Lys Ile Met Trp Leu Leu Tyr Glu His Pro Glu Ala Asp Phe Phe Ala Met Lys Gin Lys Phe Ile Asp Leu Arg Lys Arg Ala Phe Lys Phe Pro Thr Met Gly Lys Lys Ala Arg Leu Ile Cys Ile Pro Thr Thr Ser Gly Thr Gly Ser Glu Val Thr Pro Phe Ala Val Ile Ser Asp His Glu Thr Gly Lys Lys Tyr Pro Leu Ala Asp Tyr Ser Leu Thr Pro Ser Val Ala Ile Val Asp Pro Met Phe Thr Met Her Leu Pro Lys Arg Ala Ile Ala Asp Thr Gly Leu Asp Val Leu Val His Ala Thr Glu Ala Tyr Val Ser Val Met Ala Asn Glu Tyr Thr Asp Gly Leu Ala Arg Glu Ala Val Lys Leu Val Phe Glu Asn Leu Leu Lys Ser Tyr Asn Gly Asp Leu Glu Ala Arg Glu Lys Met His Asn Ala Ala Thr Ile Ala Gly Met Ala Phe Ala Ser Ala Phe Leu Gly Met Asp His Ser Met Ala His Lys Val Gly Ala Ala Phe His Leu Pro His Gly Arg Cys Val Ala Val Leu Leu Pro His Val Ile Arg Tyr Asn Gly Gln Lys Pro Arg Lys Leu Ala Met Trp Pro Lys Tyr Asn Phe Tyr Lys Ala Asp Gin Arg Tyr Met Glu Leu Ala Gin Met Val Gly Len Lys Cys Asn Thr Pro Ala G10 Gly Val Glu Ala Phe Ala Lys Ala Cys Glu Glu Leu Met Lys Ala Thr Glu Thr lie Thr Gly Phe Lys Lys Ala Asn Ile Asp Glu Ala Ala Trp Met Ser Lys Val Pro Glu Met Ala Leu Leu Ala Phe Glu Asp Gln Cys Ser Pro Ala Am n Pro Arg Val Pro Met Val Lys Asp Met Glu Lys Ile Lou Lys Ala Ala Tyr Tyr Pro Ile Ala <210> 12 <211> 2627 <212> DNA
<213> Artificial Sequence <220>
<223> synthetic codon optimised E.histolytica ADH2 <400> 12 tctagaaaat gtctacccaa caaaccatqa ccgttgacga acacatcaac caattagtta 60 gaaaggctca agttgctttg aaggaatact tgaagccaga atacacccaa gaaaagatcg 120 actacatcgt taagaaggct tctgttgctg ctttggacca acactgtgct ttggctgctg 180 ctgctgttga agaaaccggt agaggtatct Lcgaagacaa ggctaccaag aacatcttcg 240 cttgtgaaca cgttacccac gaaatgagac acgctaagac cgttggtatc atcaacgttg 300 acccattgta cggtatcacc gaaatcgctg aaccagttgg tgttgtttgt ggtgttaccc 360 cagttaccaa cccaacctct accgctatct tcaagtcttt gatctctatc aagaccagaa 420 acccaatcgt tttctctttc cacccatctg ctttgaagtg ttctattatg gctgctaaaa 480 tcgttagaga cgctgctatc gctgctggtg ctccagaaaa ctgtatccaa tggatcgaat 540 tcggtggtat cgaagcttct aacaagttga tgaaccaccc aggtgttgct actatcttgg 600 ctaccggtgg taacgctatg gttaaggctg catactcttc tggtaagcca gotttgggtg 660 ttggtgctgg taacgttcca acctacatcg aaaagacctg taacatcaag caagctgota 720 acgacgttgt tatgtctaag tctttcgaca acggtatgat ctgtgcttct gaacaagctg 780 ctatcatcga caaggaaatc tacgaccaag ttgttgaaga aatgaagacc ttgggtgctt 840 acttcatcaa cgaagaagaa aaggctaagt tggaaaagtt catgttcggt gttaacgctt 900 actctgctga cgttaacaac gctagattga acccaaagtg tccaggtatg tctccacaat 960 ggttcgctga acaagttggt atcaaggtac cagaagactg taacatcatc tgtgctgttt 1020 gtaaggaagt tggtccaaac gaaccattga ccagagaaaa gttgtctcca gttttggcta 1080 tetLgaaagc tgaaaacacc caagacggta tcgacaaggc tgaagctatg gttgaattta 1140 acggtagagg tcactctgct gctatccact ctaacgacaa ggctgttgtt gaaaagtacg 1200 ctttgaccat gaaggcttgt agaatcttgc acaacacccc atcttctcaa ggtggtatcg 1260 gttctatcta caactacatc tggccatctt tcaccttggg ttgtggttct tacggtggta 1320 actctgtttc tgctaacgtt acctaccaca acttgttgaa catcaagaga ttggctgaca 1380 gaagaaacaa cttgcaatgg ttcagagttc caccaaagat cttcttcgaa ccacactcta 1440 tcagatactt ggctgaattg aaggaattgt ctaagatctt catcgtttct gacagaatga 1500 tgtacaagtt gggttacgtt gacagagtta tggacgtttt gaagagaaga tctaacgaag 1560 ttgaaatcga aatcttcatc gacgttgaac cagacccatc tatccaaacc gttcaaaagg 1620 gtttggctgt tatgaacacc ttcggtccag acaacatcat cgctatcggt ggtggttctg 1680 ctatggacgc tgctaagatc atgtggttgt tgtacgaaca cccagaagct gacttcttcg 1740 ctatgaagca aaagttcatc gacttgagaa agagagcttt caagttccca accatgggta 1800 agaaggctag attgatctgt atcccaacca cctctggtac cggttctgaa gttaccccat 1860 tcgctgttat ctctgaccac gaaaccggta agaagtaccc attggctgac tactctttga 1920 ccccatctgt tgctatcgtt gacccaatgt tcaccatgtc tttgccaaag agagctatcg 1980 ctgacaccgg tttggacgtt ttggttcacg ctaccgaagc ttacgtttct gttatggcta 2040 acgaatacac cgacggtttg gctagagaaq ctgttaagtt ggtttttgaa aacttgttga 2100 agtcttacaa cggtgacttg gaagctagag aaaagatgca caacgctgct accatcgctg 2160 gtatggottt cgcttctgct ttcttgggta tggaccactc tatggctcac aaggttggtg 2220 ctgctttcca cttgccacac ggtagatgtg ttgctgtttt gttgccacac gttatcagat 2280 acaacggtca aaagccaaga aagttggcta tgtggccaaa gtacaacttc tacaaggctg 2340 accaaagata catggaattg gctcaaatgg ttggtttgaa gtgtaacacc ccagctgaag 2400 gtgttgaagc tttcgcLaag gcttgtgaag aattgatgaa ggctaccgaa accatcaccg 2460 gtttcaaqaa ggctaacatc gacgaagctg cttggatgtc taaggttcca gaaatggctt 2520 tgttggcttt cgaagaccaa tgttctccag ctaacccaag agttccaatg qttaaggaca 2580 tggaaaagat cttgaaggct gcttactacc caatcgctta gcttaag 2627 <210> 13 <211> 312 <212> PRT
<213> Saccharomyces cerevisiae <400> 13 Met Pro Ala Thr Leu His Asp Ser Thr Lys Ile Leu Ser Leu Asn Thr Gly Ala Gin Ile Pro Gin Ile Gly Leu Gly Thr Trp Gin Ser Lys Glu Asn Asp Ala Tyr Lys Ala Val Leu Thr Ala Leu Lys Asp Gly Tyr Arg His Ile Asp Thr Ala Ala Ile Tyr Arg Asn Glu Asp Gin Val Gly Gin Ala Ile Lys Asp Ser Gly Val Pro Arg Glu Glu Ile Phe Val Thr Thr Lys Leu Trp Cys Thr Gin His His Glu Pro Glu Vol Ala Leu Asp Gin Ser Leu Lys Arg Leu Gly Leu Asp Tyr Val Asp Leu Tyr Leu Met His Trp Pro Ala Arg Leu Asp Pro Ala Tyr Ile Lys Asn Glu Asp Ile Leu Ser Val Pro Thr Lys Lys Asp Gly Ser Arg Ala Val Asp Ile Thr Asn Trp Asn Phe Ile Lys Thr Trp Glu Leu Met Gin Glu Leu Pro Lys Thr Gly Lys Thr Lys Ala Val Gly Val Ser Asn Phe Ser Ile Asn Asn Lou Lys Asp Lou Leu Ala Ser Gin Gly Asn Lys Leu Thr Pro Ala Ala Asn Gin Val Glu Ile His Pro Leu Leu Pro Gin Asp Glu Leu Ile Asn Phe Cys Lys Ser Lys Gly Ile Val Val Glu Ala Tyr Ser Pro Leu Gly Ser Thr Asp Ala Pro Leu Leu Lys Glu Pro Val Ile Leu Glu Ile Ala Lys Lys Asn Asn Val Gin Pro Gly His Val Val Ile Ser Trp His Val Gln Arg Gly Tyr Val Val Leu Pro Lys Ser Val Asn Pro Asp Arg Ile Lys Thr Asn Arg Lys Ile Phe Thr Leu Ser Thr Glu Asp Phe Glu Ala Ile Asn Asn Ile Ser Lys Glu Lys Gly Glu Lys Arg Val Val His Pro Asn Trp Ser Pro Phe Glu Val Phe Lys <210> 14 <211> 504 <212> PRT
<213> Saccharomyces cerevisiae <400> 14 Met Ser Ala Lys Ser Phe Glu Val Thr Asp Pro Val Asn Ser Ser Leu Lys Gly Phe Ala Leu Ala Asn Pro Ser Ile Thr Leu Val Pro Glu Glu Lys Ile Leu Phe Arg Lys Thr Asp Ser Asp Lys Ile Ala Leu Ile Ser Sly Gly Gly Ser Gly His Glu Pro Thr His Ala Gly Phe lie Gly Lys Gly Met Leu Ser Gly Ala Val Val Gly Glu Ile Phe Ala Ser Pro Her Thr Lys Gin Ile Leu Asn Ala Ile Arg Leu Val Asn Glu Asn Ala Ser Gly Val Leo Leu Ile Val Lys Asn Tyr Thr Gly Asp Val Leu His. Phe Gly Leu Ser Ala Glu Arg Ala Arg Ala Leu Gly Ile Asn Cys Arg Val Ala Val Ile Gly Asp Asp Val Ala Val Gly Arg Giu Lys Gly Gly Met Val Sly Arg Arg Ala Leu Ala Gly Thr Val Leo Val His Lys Ile Val Gly Ala Phe Ala Glu Glu Tyr Ser Ser Lys Tyr Gly Leu Asp Gly Thr Ala Lys Val Ala Lys Ile Ile Asn Asp Asn Leu Val Thr Ile Gly Ser Ser Leu Asp His Cys Lys Val Pro Gly Arg Lys Phe Glu Ser Glu Leo Asn Glu Lys Gin Met Glu Leu Gly Met Gly Ile His Asn Giu Pro Gly Val Lys Val Leu Asp Pro Ile Pro Ser Thr Glu Asp Leu Ile Ser Lys Tyr Met Leu Pro Lys Leu Leu Asp Pro Asn Asp Lys Asp Arg Ala Phe Val Lys Phe Asp Glu Asp Asp Glu Val Val Leu Leu Val Asn Asn Leu Gly Gly Val Ser Asn Phe Val Ile Ser Ser Ile Thr Ser Lys Thr Thr Asp Phe Leu Lys Glu Asn Tyr Asn Ile Thr Pro Val Gin Thr Ile Ala Gly Thr Leu Met Thr Ser Phe Asn Gly Asn Gly Phe Ser Ile Thr Leu Leu Asn Ala Thr Lys Ala Thr Lys Ala Leu Gin Ser Asp Phe Glu Glu Ile Lys Ser Val Leu Asp Leu Leo Asn Ala Phe Thr Asn Ala Pro Gly Trp Pro Ile Ala Asp Phe Glu Lys Thr Ser Ala Pro Ser Val Asn Asp Asp Leu Leu His Asn Glu Val Thr Ala Lys Ala Val Gly Thr Tyr Asp Phe Asp Lys Phe Ala Glu Trp Met Lys Ser Gly Ala Glu Gln Val Ile Lys Ser Glu Pro His Ile Thr Glu Leu Asp Asn Gin Val Gly Asp Gly Asp Cys Gly Tyr Thr Leu Val Ala Gly Val Lys Gly Ile Thr Glu Asn Leu Asp Lys Leu Ser Lys Asp Ser Leu Ser Gin Ala Val Ala Gin Ile Ser Asp Phe Ile Glu Gly Ser Met Gly Gly Thr Ser Gly Gly Leu Tyr Ser Ile Leu Leu Ser Gly Phe Ser His Gly Leu Ile Gin Val Cys Lys Ser Lys Asp Glu Pro Val Thr Lys Glu Ile Val Ala Lys Ser Leu Gly Ile Ala Leu Asp Thr Leu Tyr Lys Tyr Thr Lys Ala Arg Lys Gly Ser Ser Thr Met Ile Asp Ala Leu Glu Pro Phe Val Lys Glu Phe Thr Ala Ser Lys Asp Phe Asn Lys Ala Val Lys Ala Ala Glu Glu Gly Ala Lys Ser Thr Ala Thr Phe Glu Ala Lys Phe Gly Arg Ala Ser Tyr Val Gly Asp Ser Ser Gin Val Glu Asp Pro Gly Ala Val Gly Leu Cys Glu Phe Leu Lys Gly Val Gin Ser Ala Leu <210> 15 <211> 591 <212> PRT
<213> Saccharomyces cerevisiae <400> 15 Met Ser His Lys Gin Phe Lys Ser Asp Gly Asn Ile Val Thr Pro Tyr Leu Leu Gly Leu Ala Arg Ser Asn Pro Gly Leu Thr Val Ile Lys His Asp Arg Val Val Phe Arg Thr Ala Ser Ala Pro Asn Ser Gly Asn Pro Pro Lys Val Ser Leu Val Ser Gly Gly Gly Ser Gly His Glu Pro Thr His Ala Gly Phe Val Gly Glu Gly Ala Leu Asp Ala Ile Ala Ala Gly Ala Ile Phe Ala Ser Pro Ser Thr Lys Gin Ile Tyr Ser Ala Ile Lys Ala Val Glu Ser Pro Lys Gly Thr Leu Ile Ile Val Lys Asn Tyr Thr Gly Asp Ile Ile His Phe Gly Leu Ala Ala Glu Arg Ala Lys Ala Ala Gly Met Lys Val Glu Leu Val Ala Val Gly Asp Asp Val Ser Val Gly Lys Lys Lys Gly Ser Leu Val Gly Arg Arg Gly Leu Gly Ala Thr Val Leu Val His Lys Ile Ala Gly Ala Ala Ala Ser His Gly Leu Glu Leu Ala Glu Val Ala Glu Val Ala Gin Ser Val Val Asp Asn Ser Val Thr Ile Ala Ala Ser Leu Asp His Cys Thr Val Pro Gly His Lys Pro Glu Ala Ile Leu Gly Glu Asn Glu Tyr Glu Ile Gly Met Gly Ile His Asn Glu Ser Gly Thr Tyr Lys Ser Ser Pro Leu Pro Ser Ile Ser Glu Leu Val Ser Gin Met Leu Pro Leu Leu Leu Asp Glu Asp Glu Asp Arg Ser Tyr Val Lys Phe Glu Pro Lys Glu Asp Val Val Leu Met Val Asn Asn Met Gly Gly Met Ser Asn Leu Glu Leu Gly Tyr Ala Ala Glu Val Ile Ser Glu Gin Leu Ile Asp Lys Tyr Gin Ile Val Pro Lys Arg Thr Ile Thr Gly Ala Phe Ile Thr Ala Leu Asn Gly Pro Gly Phe Gly Ile Thr Leu Met Asn Ala Ser Lys Ala Gly Gly Asp Ile Leu Lys Tyr Phe Asp Tyr Pro Thr Thr Ala Ser Gly Trp Asn Gin Met Tyr His Ser Ala Lys Asp Trp Glu Val Leu Ala Lys Gly Gin Val Pro Thr Ala Pro Ser Len Lys Thr Leu Arg Asn Glu Lys Gly Ser Gly Val Lys Ala Asp Tyr Asp Thr Phe Ala Lys Ile Leu Leu Ala Gly Ile Ala Lys Ile Asn Glu Val Glu Pro Lys Val Thr Trp Tyr Asp Thr Ile Ala Gly Asp Gly Asp Cys Gly Thr Thr Leu Val Ser Gly Gly Glu Ala Lou Glu Glu Ala Ile Lys Asn His Thr Leu Arg Leu Glu Asp Ala Ala Leu Gly Ile Glu Asp Ile Ala Tyr Met Val Glu Asp Ser Met Gly Gly Thr Ser Gly Gly Leu Tyr Ser Ile Tyr Leu Ser Ala Leu Ala Gln Gly Val Arg Asp Ser Gly Asp Lys Glu Leu Thr Ala Glu Thr Phe Lys Lys Ala Ser Asn Val Ala Leu Asp Ala Leu Tyr Lys Tyr Thr Arg Ala Arg Pro Gly Tyr Arg Thr Leu Ile Asp Ala Leu Gin Pro Phe Val Glu Ala Leu Lys Ala Gly Lys Gly Pro Arg Ala Ala Ala Gin Ala Ala Tyr Asp Gly Ala Glu Lys Thr Arg Lys Met Asp Ala Leu Val Gly Arg Ala Ser Tyr Val Ala Lys Glu Glu Leu Arg Lys Leu Asp Ser Glu Gly Gly Leu Pro Asp Pro Gly Ala Val Gly Leu Ala Ala Leu Leu Asp Gly Phe Val Thr Ala Ala Gly Tyr <210> 16 <211> 560 <212> PRT
<213> Saccharomyces cerevisiae <400> 16 Met Ser Leu Ile Ser Ile Leu Ser Pro Leu Ile Thr Ser Glu Gly Leu Asp Ser Arg Ile Lys Pro Ser Pro Lys Lys Asp Ala Ser Thr Thr Thr Lys Pro Ser Leu Trp Lys Thr Thr Glu Phe Lys Phe Tyr Tyr Ile Ala Phe Leu Val Val Val Pro Leu Met Phe Tyr Ala Gly Leu Gin Ala Ser Ser Pro Glu Asn Pro Asn Tyr Ala Arg Tyr Glu Arg Leu Leu Ser Gin Gly Trp Leu Phe Gly Arg Lys Vol Asp Asn Ser Asp Ser Gin Tyr Arg Phe Phe Arg Asp Asn Phe Ala Leu Lou Ser Val Lou Met Leu Val His Thr Ser Ile Lys Arg Ile Vol Leu Tyr Ser Thr Asn Ile Thr Lys Leu Arg Phe Asp Leu Ile Phe Gly Leu Ile Phe Lou Val Ala Ala His Gly Vol Asn Ser Ile Arg Ile Leu Ala HLs Met: Leu Ile Leu Tyr Ala Ile Ala His Val Leu Lys Asn Phe Arg Arg Ile Ala Thr Ile Ser Ile Trp Ile Tyr Gly Ile Ser Thr Leu Phe Ile Asn Asp Asn Phe Arg Ala Tyr Pro Phe Gly Asn Ile Cys Ser Phe Leu Her Pro Leu Asp His Trp Tyr Arg Gly Ile Ile Pro Arg Trp Asp Val Phe Phe Asn Phe Thr Leu Lou Arg Val Leu Ser Tyr Asn Lou Asp Phe Leu Glu Arg Trp Glu Asn Leu Gin Lys Lys Lys Ser Pro Ser Tyr Glu Ser Lys Glu Ala Lys Ser Ala Ile Leu Leu Asn Glu Arg Ala Arg Leu Thr Ala Ala His Pro Ile Gin Asp Tyr Ser Leu Met Asn Tyr Ile Ala Tyr Val Thr Tyr Thr Pro Leu Phe Ile Ala Gly Pro Ile Ile Thr Phe Asn Asp Tyr Val Tyr Gin Ser Lys His Thr Leu Pro Ser Ile Asn Phe Lys Phe Ile Phe Tyr Tyr Ala Val Arg Phe Val Ile Ala Leu Lou Ser Met Glu Phe Ile Leu His Phe Lou His Val Val Ala Ile Ser Lys Thr Lys Ala Trp Glu Asn Asp Thr Pro Phe Gin Ile Ser Met Ile Gly Lou Phe Asn Lou Asn lie lie Trp Lou Lys Lou Lou Ile Pro Trp Arg Leu Phe Arg Leu Trp Ala Lou Leu Asp Gly Ile Asp Thr Pro Glu Asn Met Ile Arg Cys Val Asp Asn Asn Tyr Ser Ser Leu Ala Phe Trp Arg Ala Trp His Arg Ser Tyr Asn Lys 405 410 415 .
Trp Val Val Arg Tyr Ile Tyr Ile Pro Leu Gly Gly Ser Lys Asn Arg Val Leu Thr Ser Leu Ala Val Phe Ser Phe Val Ala Ile Trp His Asp Ile Glu Leu Lys Leu Leu Leu Trp Gly Trp Leu Ile Val Leu Phe Leu Leu Pro Glu Ile Phe Ala Thr Gln Ile Phe Ser His Tyr Thr Asp Ala Val Trp Tyr Arg His Vol Cys Ala Val Gly Ala Val Phe Asn Ile Trp Val Met Met Ile Ala Asn Leu Phe Gly Phe Cys Leu Gly Ser Asp Gly Thr Lys Lys Leu Leu Ser Asp Met Phe Cys Thr Val Ser Gly Phe Lys Pile Val Ile Leu Ala Ser Vol Ser Leu Phe Ile Ala Val Gln Ile Met Phe Glu Ile Arg Glu Glu Glu Lys Arg His Gly Ile Tyr Leu Lys Cys 545 550 555 . 560 <210> 17 <211> 609 <212> PRT
<213> Saccharomyces cerevisiae <400> 17 Met Ser Met Leu Arg Ile Trp Ser Cys Ile Vol His Phe Phe Ser Val Gln Ala Leu Asp Ser Arg Ile Lys Pro Asp Ile Glu Phe Lys Arg Arg Gln Arg Ile Phe Ile Asn Ser Ser Lys Glu Glu Asn Gly Ser Ser Ser Ser Ala Val Thr Vol Thr Arg Asn Pro Val Leu Ser Ser Asn Ser Pro Ser Pro Pro Lou Trp Asn Thr Trp Glu Phe Arg Leu Tyr Tyr Leu Ala Phe Thr Val Vol Vol Pro Phe Met Ile Lys Ala Ala Lou Ala Thr Ser Ser Glu Ser Asn Pro Asn Tyr Tyr Lys Phe Ser Gly Leu Leu Ala His Gly Trp Ile Leu Gly Arg Lys Val Asp Asn Ser Asp Pro Gln Tyr Arg Phe Phe Arg Ser Asn Phe Phe Leu Leu Ala Ile Leu Ile Leu Leu Gln Ile Ile Leu Lys Lys Val Phe Val Lys Phe Ser Lys Ile Pro Lys Thr Lys Phe Asp Phe Ala Cys Gly Leu Val Phe Vol Cys Phe Met Tyr Gly Ile Asn Ser Val Lys Leu Phe Thr His Ala She Ile Phe She Thr Leu Ala His Ser Leu Lys Arg Lys Arg Leu Ile Ala Ala Phe Ala Ile Trp Ser Tyr Gly Ile Phe Thr Leu Phe Ile Asn Gln Lys Met Lys Asn Leu Pro Phe Asn Asn Ile Ala Ile Ile Leu Ser Pro Met Asp Gin Trp Tyr Lys Gly Ile Val Pro Arg Trp Asp Phe Phe Phe Asn Phe Thr Leu Leu Arg Leu Leu Ser Tyr Ser Met Asp Phe Leu Glu Arg Trp His Glu Gin Leu Ser Arg Gin Pro Ser Ile Asp Tyr Asp Asp Arg Arg Pro Glu Phe Arg Lys Ser Leu Ser Gly Ser Thr Leu Gin Thr Ile Tyr Glu Ser Gly Lys Asn Val Leu Glu Glu Lys Glu Arg Leu Val Ala Glu His His Ile Gin Asp Tyr Asn Phe Ile Asn Phe Ile Ala Tyr Ile Thr Tyr Ala Pro Leu Phe Leu Val Gly Pro Ile Ile Thr Phe Asn Asp Tyr Leu Tyr Gin Ser C1u Asn Lys Leu Pro Ser Leu Thr Lys Lys Asn Ile Gly Phe Tyr Ala Leu Lys Val Phe Ser Ser Leu Leu Leu Met Glu Ile Ile Leu His Tyr Ile Tyr Val Gly Ala Ile Ala Arg Thr Lys Ala Trp Asn Asn Asp Thr Pro Leu Gin Gin Ala Met Ile Ala Leu Phe Asn Leu Asn Ile Met Tyr Leu Lys Leu Leu Ile Pro Trp Arg Leu Phe Arg Leu Trp Ala Met Val Asp Gly Ile Asp Ala Pro Glu Asn Met Lou Arg Cys Val Asp Asn Asn Tyr Ser Thr Val Gly Phe Trp Arg Ala Trp His Thr Ser Phe Asn Lys Trp Val Ile Arg Tyr Ile Tyr Val Pro Phe Gly Gly Ser Asn Asn Lys Ile Leu Thr Ser Phe Ala Val Phe Ser Phe Val Ala Ile Trp His Asp Ile Gin Leu Arg Val Lou Phe Trp Gly Trp Lou Thr Val Leu Leu Leu Leu Gly Glu Thr Tyr Ile Thr Asn Cys Phe Ser Arg Tyr Arg Phe Arg Ser Trp Tyr Arg Phe Val Cys Gly Ile Gly Ala Ala Ile Asn Ile Cys Met Met Met Ile Ile Asn Val Tyr Gly Phe Cys Leu Gly Ala Glu Gly Thr Lys Leu Leu Leu Lys Gly Ile Phe Asn Asn Ser His Ser Pro Glu Phe Lou Thr Ala Val Met Val Ser Leu Phe Ile Ala Val Gin Val Met Phe Glu Ile Arg Clu G1u Glu Lys Arg His Gly Ile Asn Leu Lys Cys <210> 18 <211> 669 <212> PRT
<213> Saccharomyces cerevisiae <400> 18 Met Ser Asn Pro Gin Lys Ala Leu Asia Asp Phe Leu Ser Ser Glu Ser Val His Thr His Asp Ser Ser Arg Lys Gin Ser Asn Lys Gin Ser Ser Asp Glu Gly Arg Ser Ser Ser Gin Pro Ser His His His Ser Gly Gly Thr Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Ser Asn Asn Asn Asn Asn Gly Asn Asp Gly Gly Asn Asp Asp Asp Tyr Asp Tyr Glu Met Gin Asp Tyr Arg Pro Ser Pro Gin Ser Ala Arg Pro Thr Pro Thr Tyr Val Pro Gin Tyr Ser Val Glu Ser Gly Thr Ala Phe Pro Ile Gin Glu Val Ile Pro Ser Ala Tyr Ile Asn Thr Gin Asp Ile Asn His Lys Asp Asn Gly Pro Pro Ser Ala Ser Ser Asn Arg Ala Phe Arg Pro Arg Gly Gin Thr Thr Val Ser Ala Asn Val Leu Asn Ile Glu Asp Phe Tyr Lys Asn Ala Asp Asp Ala His Thr Ile Pro Glu Ser His Leu Ser Arg Arg Arg Ser Arg Ser Arg Ala Thr Ser Asn Ala Gly His Ser Ala Asn Thr Gly Ala Thr Asn Gly Arg Thr Thr Gly Ala Gin Thr Asn Met Glu Ser Asn Glu Ser Pro Arg Asn Val Pro Ile Met Val Lys Pro Lys Thr Leu Tyr Gin Asn Pro Gin Thr Pro Thr Val Leu Pro Ser Thr Tyr His Pro Ile Asn Lys Trp Ser Ser Val Lys Asn Thr Tyr Leu Lys Glu Phe Leu Ala Glu Phe Met Gly Thr Met Val Met Ile Ile Phe Gly Ser Ala Val Val Cys Gin Val Asn Val Ala Gly Lys Ile Gin Gin Asp Asn Phe Asn Val Ala Leu Asp Asn Leu Asn Val Thr Gly Ser Ser Ala Glu Thr Ile Asp Ala Met Lys Ser Leu Thr Ser Leu Val Ser Ser Val Ala Gly Gly Thr Phe Asp Asp Val Ala Leu Gly Trp Ala Ala Ala Val Val Met Gly Tyr Phe Cys Ala Gly Gly Ser Ala Ile Ser Gly Ala His Leu Asn Pro Ser Ile Thr Leu Ala Asn Leu Val Tyr Arg Gly Phe Pro Leu Lys Lys Val Pro Tyr Tyr Phe Ala Gly Gin Leu Ile Gly Ala Phe Thr Gly Ala Leu Ile Leu Phe Ile Trp Tyr Lys Arg Val Leu Gin Glu Ala Tyr Ser Asp Trp Trp Met Asn Glu Ser Val Ala Gly Met Phe Cys Val Phe Pro Lys Pro Tyr Leu Ser Ser Gly Arg Gln Phe Phe Ser Glu Phe Leu Cys Gly Ala Met Leu Gln Ala Gly Thr Phe Ala Leu Thr Asp Pro Tyr Thr Cys Leu Ser Ser Asp Val Phe Pro Leu Met Met Phe Ile Leu Ile Phe lie Ile Asn Ala Ser Met Ala Tyr Gln Thr Gly Thr Ala Met Asn Leu Ala Arg Asp Leu Gly Pro Arg Leu Ala Leu Tyr Ala Val Gly Phe Asp His Lys Not Lou Trp Val His His His His Phe Phe Trp Val Pro Met Val Gly Pro Phe Ile Gly Ala Leu Met Gly Gly Leu Val Tyr Asp Val Cys Ile Tyr Gln Gly His Glu Ser Pro Val Asn Trp Ser Leu Pro Val Tyr Lys Glu Met Ile Met Arg Ala Trp Phe Arg Arg Pro Gly Trp Lys Lys Arg Asn Arg Ala Arg Arg Thr Ser Asp Leu Ser Asp Phe Ser Tyr Asn Asn Asp Asp Asp Glu Glu Phe Gly Glu Arg Met Ala Leu Gln Lys Thr Lys Thr Lys Ser Ser Ile Ser Asp Asn Glu Asn Glu Ala Gly Glu Lys Lys Val Gln She Lys Ser Val Gln Arg Gly Lys Arg Thr Phe Gly Gly Ile Pro Thr Ile Leu Glu Glu Glu Asp Ser Ile Glu Thr Ala Ser Leu Gly Ala Thr Thr Thr Asp Ser Ile Gly Leu Ser Asp Thr Ser Ser Glu Asp Ser His Tyr Gly Asn Ala Lys Lys Val Thr <210> 19 <211> 713 <212> PRT
<213> Saccharomyces cerevisiae <400> 19 Met Ser Pro Ser Ala Val Gln Ser Ser Lys Leu Glu Glu Gln Ser Ser Glu Ile Asp Lys Leu Lys Ala Lys Met Ser Gln Ser Ala Ala Thr Ala Gln Gln Lys Lys Glu His Glu Tyr Glu His Leu Thr Ser Val Lys Ile Val Pro Gln Arg Pro Ile Ser Asp Arg Leu Gln Pro Ala Ile Ala Thr His Tyr Ser Pro His Leu Asp Gly Leu Gln Asp Tyr Gln Arg Leu His Lys Glu Ser Ile Glu Asp Pro Ala Lys Phe Phe Gly Ser Lys Ala Thr Gln Phe Leu Asn Trp Ser Lys Pro Phe Asp Lys Val Phe Ile Pro Asp Pro Lys Thr Gly Arg Pro Ser Phe Gln Asn Asn Ala Trp Phe Leu Asn Gly Gln Leu Asn Ala Cys Tyr Asn Cys Val Asp Arg His Ala Leu Lys Thr Pro Asn Lys Lys Ala Ile Ile Phe Glu Gly Asp Glu Pro Gly Gln Gly Tyr Ser Ile Thr Tyr Lys Glu Leu Leu Glu Glu Val Cys Gln Val Ala Gln Val Leu Thr Tyr Ser Met Gly Val Arg Lys Gly Asp Thr Val Ala Val Tyr Met Pro Met Val Pro Glu Ala Ile Ile Thr Leu Leu Ala Ile Ser Arg Ile Gly Ala Ile His-Ser Val Val Phe Ala Gly Phe Ser Ser Asn Ser Leu Arg Asp Arg Ile Asn Asp Gly Asp Ser Lys Val Val Ile Thr Thr Asp Giu Ser Asn Arg Gly Gly Lys Vol Ile Glu Thr Lys Arg Ile Val Asp Asp Ala Leu Arg Glu Thr Pro Gly Val Arg His Val Leu Val Tyr Arg Lys Thr Asn Asn Pro Ser Val Ala Phe His Ala Pro Arg Asp Leu Asp Trp Ala Thr Glu Lys Lys Lys Tyr Lys Thr Tyr Tyr Pro Cys Thr Pro Val Asp Ser Glu Asp Pro Leu Phe Leu Leu Tyr Thr Ser Gly Ser Thr Gly Ala Pro Lys Gly Val Gln His Ser Thr Ala Gly Tyr Leu Leu Gly Ala Leu Leu Thr Met Arg Tyr Thr Phe Asp Thr His Gln Glu Asp Val Phe Phe Thr Ala Gly Asp Ile Gly Trp Ile Thr Gly His Thr Tyr Val Val Tyr Gly Pro Leu Leu Tyr Gly Cys Ala Thr Leu Val Phe Glu Gly Thr Pro Ala Tyr Pro Asn Tyr Ser Arg Tyr Trp Asp Ile Ile Asp Glu His Lys Val Thr Gln Phe Tyr Val Ala Pro Thr Ala Leu Arg Leu Leu Lys Arg Ala Gly Asp Ser Tyr Ile Glu Asn His Ser Leu Lys Ser Lou Arg Cys Lou Gly Ser Val Gly Glu Pro Ile Ala Ala Glu Val Trp Glu Trp Tyr Ser Glu Lys Ile Gly Lys Asn Glu Ile Pro Ile Val Asp Thr Tyr Trp Gln Thr Glu Ser Gly Ser His Leu Val Thr Pro Leu Ala Gly Gly Val Thr Pro Met Lys Pro Gly Ser Ala Ser Phe Pro Phe Phe Gly Ile Asp Ala Vol Val Leu Asp Pro Asn Thr Gly Glu Glu Leu Asn Thr Ser His Ala Glu Gly Val Leu Ala Val Lys Ala Ala Trp Pro Ser Phe Ala Arg Thr Ile Trp Lys Asn His Asp Arg Tyr Leu Asp Thr Tyr Lou Asn Pro Tyr Pro Gly Tyr Tyr Phe Thr Gly Asp Gly Ala Ala Lys Asp Lys Asp Gly Tyr Ile Trp Ile Leu Gly Arg Val Asp Asp Val Val Asn Vol Ser Gly His Arg Leu Ser Thr Ala Glu Ile Glu Ala Ala Ile Ile Glu Asp Pro Ile Val Ala Glu Cys Ala Val Val Gly Phe Asn Asp Asp Leu Thr Gly Gin Ala Val Ala Ala Phe Val Val Leu Lys Asn Lys Ser Ser Trp Ser Thr Ala Thr Asp Asp Glu Leu Gin Asp Ile Lys Lys His Leu Val Phe Thr Val Arg Lys Asp Tie Gly Pro Phe 645 650 655 .
Ala Ala Pro Lys Leu Ile Ile Len Val Asp Asp Leu Pro Lys Thr Arg Ser Gly Lys Ile Met Arg Arg Ile Leu Arg Lys Ile Leu Ala Gly Glu Ser Asp Gin Leu Gly Asp Vol Ser Thr Leu Ser Asn Pro Gly Ile Val Arg His Leu Ile Asp Ser Val Lys Leu <210> 20 <211> 683 <212> PRT
<213> Saccharomyces cerevisiae <400> 20 Met Thr Ile Lys Glu His Lys Val Val Tyr Gin Ala His Asn Val Lys Ala Lou Lys Ala Pro Gln His Phe Tyr Asn Ser Gin Pro Gly Lys Gly Tyr Val Thr Asp Met Gin His Tyr Gin Glu Met Tyr Gin Gin Ser Ile Asn Glu Pro Glu Lys She Phe Asp Lys Met Ala Lys Glu Tyr Len His Trp Asp Ala Pro Tyr Thr Lys Val Gin Ser Gly Ser Leu Asn Asn Gly Asp Vol Ala Trp Phe Lou Asn Gly Lys Leu Asn Ala Ser Tyr Asn Cys Val Asp Arg His Ala Phe Ala Asn Pro Asp Lys Pro Ala Leu Ile Tyr Glu Ala Asp Asp Glu Ser Asp Asn Lys Ile Ile Thr Phe Gly Glu Leu Leu Arg Lys Val Ser Gin Ile Ala Gly Val Leu Lys Ser Trp Gly Val Lys Lys Gly Asp Thr Vol Ala Ile Tyr Leu Pro Met Ile Pro Glu Ala Val Ile Ala Met Leu Ala Val Ala Arg Ile Gly Ala Ile His Ser Val Val Phe Ala Gly She Ser Ala Gly Ser Leu Lys Asp Arg Val Val Asp Ala Asn Ser Lys Val Val Ile Thr Cys Asp Gin Gly Lys Arg Gly Gly Lys Thr Ile Asn Thr Lys Lys Ile Val Asp Glu Gly Leu Asn Gly Val Asp Leu Vol Ser Arg Ile Leu Val Phe Gin Arg Thr Gly Thr Glu Gly Ile Pro Met Lys Ala Gly Arg Asp Tyr Trp Trp His Glu Glu Ala Ala Lys Gln Arg Thr Tyr Leu Pro Pro Val Ser Cys Asp Ala Glu Asp Pro Leu Phe Leu Leu Tyr Thr Ser Gly Ser Thr Gly Ser Pro Lys Gly Val Val His Thr Thr Gly Gly Tyr Leu Leu Gly Ala Ala Leu Thr Thr Arg Tyr Val Phe Asp Ile His Pro Glu Asp Val Leu Phe Thr Ala Gly Asp Val Gly Trp Ile Thr Gly His Thr Tyr Ala Leu Tyr Gly Pro Leu Thr Leu Gly Thr Ala Ser Ile Ile Phe Glu Ser Thr Pro Ala Tyr Pro Asp Tyr Gly Arg Tyr Trp Arg Ile Ile Gln Arg His Lys Ala Thr His Phe Tyr Val Ala Pro Thr Ala Leu Arg Leu Ile Lys Arg Val Gly Glu Ala Glu Ile Ala Lys Tyr Asp Thr Ser Ser Leu Arg Vol Leu Gly Ser Val Gly Glu Pro Ile Ser Pro Asp Leu Trp Glu Trp Tyr His Glu Lys Val Gly Asn Lys Asn Cys Vol Ile Cys Asp Thr Met Trp Gln Thr Glu Ser Gly Ser His Leu Ile Ala Pro Leu Ala Gly Ala Vol Pro Thr Lys Fro Gly Ser Ala Thr Val Pro Phe Phe Gly Ile Asn Ala Cys Ile Ile Asp Pro Val Thr Gly Val Glu Leu Glu Gly Asn Asp Val Glu Gly Val Leu Ala Val Lys Ser Pro Trp Pro Ser Met Ala Arg Ser Val Trp Asn His His Asp Arg Tyr Met Asp Thr Tyr Leu Lys Pro Tyr Pro Gly His Tyr Phe Thr Gly Asp Gly Ala Gly Arg Asp His Asp Gly Tyr Tyr Trp Ile Arg Gly Arg Vol Asp Asp Val Val Asn Vol Ser Gly His Arg Leu Ser Thr Ser Glu Ile Glu Ala Ser Ile Ser Asn His Glu Asn Vol Ser Glu Ala Ala Vol Val Gly Ile Pro Asp Glu Leu Thr Gly Gln Thr Val Vai Ala Tyr Val Ser Leu Lys Asp Gly Tyr Leu Gln Asn Asn Ala Thr Glu Gly Asp Ala Glu His Ile Thr Pro Asp Asn Lou Arg Arg Glu Leu Ile Leu Gln Val Arg Gly Glu Ile Gly Pro Phe Ala Ser Pro Lys Thr Ile Ile Leu Val Arg Asp Lou Pro Arg Thr Arg Ser Gly Lys Ile Met Arg Arg Val Leu Arg Lys Val Ala Ser Asn Glu Ala Glu Gin Leu Gly Asp Lou Thr Thr Leu Ala Asn Pro Glu Val Val Pro Ala Ile Ile Ser Ala Vol Glu Asn Gin Phe Phe Ser Gin Lys Lys Lys <210> 21 <211> 440 <212> PRT
<213> Saccharomyces cerevisiae <400> 21 Met Leu Ala Val Arg Arg Leu Thr Arg Tyr Thr Phe Leu Lys Arg Thr His Pro Val Leu Tyr Thr Arg Arg Ala Tyr Lys Ile Leu Pro Ser Arg Ser Thr Phe Leu Arg Arg Ser Leu Leu Gin Thr Gin Leu His Ser Lys Met Thr Ala His Thr Asn Ile Lys Gin His Lys His Cys His Glu Asp His Pro Ile Arg Arg Ser Asp Ser Ala Val Ser Ile Val His Leu Lys Arg Ala Pro Phe Lys Val Thr Val Ile Gly Ser Gly Asn Trp Gly Thr Thr Ile Ala Lys Val lie Ala Glu Asn Thr Glu Leu His Ser His Ile Phe Glu Pro Glu Val Arg Met Trp Val Phe Asp Glu Lys Ile Gly Asp Glu Asn Leu Thr Asp Ile Ile Asn Thr Arg His Gin Asn Val Lys Tyr Leu Pro Asn Ile Asp Leu Pro His Asn Leu Val Ala Asp Pro Asp Leu Leu His Ser Ile Lys Gly Ala Asp Ile Leu Val Phe Asn Ile Pro His Gin Phe Leu Pro Asn Ile Val Lys Gin Leu Gin Gly His Val Ala Pro His Val Arg Ala Ile Ser Cys Leu Lys Gly Phe Glu Leu Gly Ser Lys Gly Val Gin Leu Leu Ser Ser Tyr Val Thr Asp Glu Leu Gly Ile Gin Cys Gly Ala Lou Ser Gly Ala Asn Leu Ala Pro Glu Val Ala Lys Glu His Trp Ser Glu Thr Thr Val Ala Tyr Gin Leu Pro Lys Asp Tyr Gln Gly Asp Gly Lys Asp Val Asp His Lys Ile Lou Lys Leu Leu Phe His Arg Pro Tyr Phe His Val Asn Val Ile Asp Asp Val Ala Gly Ile Ser Ile Ala Gly Ala Lou Lys Asn Val Val Ala Leu Ala Cys Gly Phe Val Glu Gly Met Gly Trp Gly Asn Asn Ala Ser Ala Ala Ile Gin Arg Leu Gly Leu Gly Glu Ile Ile Lys Phe Gly Arg Met Phe Phe Pro Glu Ser Lys Val Glu Thr Tyr Tyr Gin Glu Ser Ala Gly Val Ala Asp Leu Ile Thr Thr Cys Ser Gly Gly Arg Asn Val Lys Val Ala Thr Tyr Met Ala Lys Thr Gly Lys Ser Ala Leu Glu Ala Glu Lys Glu Leu Lou Asn Gly Gin Ser Ala Gin Gly Ile Ile Thr Cys Arg Glu Val His Glu Trip Leu Gin Thr Cys Glu Leu Thr Gin Glu Phe Pro Leu Phe Glu Ala Val Tyr Gin Ile Val Tyr Asn Asn Val Arg Met Glu Asp Leu Pro Glu Met Ile Glu Glu Leu Asp Ile Asp Asp Glu <210> 22 <211> 391 <212> PRT
<213> Saccharomyces cerevisiae <400> 22 Met Ser Ala Ala Ala Asp Arg Leu Asn Leu Thr Ser Gly His Leu Asn Ala Gly Arg Lys Arg Ser Ser Ser Ser Val Ser Leu Lys Ala Ala Glu Lys Pro Phe Lys Val Thr Val Ile Gly Ser Gly Asn Trp Gly Thr Thr Ile Ala Lys Val Val Ala Glu Asn Cys Lys Gly Tyr Pro Glu Val Phe Ala Pro Ile Val Gin Met Trp Val Phe Glu Glu Glu Ile Asn Gly Glu Lys Leu Thr Glu Ile Ile Asn Thr Arg His Gin Asn Val Lys Tyr Leu Pro Gly Ile Thr Leu Pro Asp Asn Leu Val Ala Asn Pro Asp Leu Ile Asp Ser Val Lys Asp Val Asp Ile Ile Val Phe Asn Ile Pro His Gin Phe Leu Pro Arg Ile Cys Ser Gin Leu Lys Gly His Val Asp Ser His Val Arg Ala Ile Ser Cys Leu Lys Gly Phe Glu Val Gly Ala Lys Gly Val Gin Leu Leu Ser Ser Tyr Ile Thr Glu Glu Leu Gly Ile Gin Cys Gly Ala Leu Ser Gly Ala Asn Ile Ala Thr Glu Val Ala Gin Glu His Trp Ser Glu Thr Thr Val Ala Tyr His Ile Pro Lys Asp Phe Arg Gly Glu Gly Lys Asp Val Asp His Lys Val Leu Lys Ala Leu Phe His Arg Pro Tyr Phe His Val Ser Val Ile Glu Asp Val Ala Gil/ Ile Ser Ile Cys Gly Ala Leta Lys Asn Val Val Ala Leu Gly Cys Gly Phe Val Glu Gly Leu Gly Trp Gly Asn Asn Ala Ser Ala Ala lie Gin Arg Val Gly Leu Gly Glu Ile Ile Arg Phe Gly Gin Met Phe Phe Pro Glu Ser Arg Glu Glu Thr Tyr Tyr Gin Glu Ser Ala Gly Val Ala Asp Leu Ile Thr Thr Cys Ala Gly Gly Arg Asn Val Lys Val Ala Arg Leu Met Ala Thr Ser Gly Lys Asp Ala Trp Glu Cys Glu Lys Glu Leu Leu Asn Gly Gin Ser Ala Gin Gly Leu Ile Thr Cys Lys Glu Val His Glu Trp Leu Glu Thr Cys Gly Ser Val Glu Asp Phe Pro Leu Phe Glu Ala Vol Tyr Gin Ile Val Tyr Asn Asn Tyr Pro Met Lys Asn Leu Pro Asp Met Ile Glu Glu Leu Asp Leu His Glu Asp <210> 23 <211> 2058 <212> DNA
<213> Artificial Sequence <220>
<223> GPD2 disruption <400> 23 agatcttttg cggcgaggtg ccgatgggtt gctgagggga agagtgttta gcttacggac 60 ctattgccat tgttaLtccg attaatctat Lgttcagcag ctcttctcta ccctgtcatt 120 ctagtatttt tttttttttt ttttggtttt actttttttt CttCttgcct ttttttcttg 180 ttactttttt tctagttttt tttccttcca ctaagctttt tccttgattt atccttgggt 240 tcttctttct actcctttag attttttttt tatatattaa tttttaagtt tatgtatttt 300 ggtagattca attctctttc cctttccttt tccttcgctc cccttcctta tcaatgcttg 360 ctgtcagaag attaacaaga tacacattcc ttaaggcctc gtccccgccg ggtcacccgg 420 ccagcgacat ggaggcccag aataccctcc ttgacagtct tgacgtgcgc agctcagggg 480 catgatgtga ctgtcgcccg tacatttagc ccatacatcc ccatgtataa tcatttgcat 540 ccatacattt tgatggccgc acggcgcgaa gcaaaaatta cggctcctcg ctgcagacct 600 gcgagcaggg aaacgctccc ctcacagacg cgttgaattg tccccacgcc gcgcccctgt 660 agagaaatat aaaaggttag gatttgccac tgaggttctt ctttcatata cttcctttta 720 aaatcttgct aggatacagt tctcacatca catccgaaca taaacaacca tgtaaaatga 780 ccactcttga cgacacqqct taccggtacc gcaccagtgt cccgggggac gccgaggcca 840 tcgaggcact ggatgggtcc ttcaccaccg acaccgtctt ccgcgtcacc gccaccgggg 900 acggcttcac cctgcgggag gtgccggtgg acccgcccct gaccaaggtg ttccccgacg 960 acgaatcgga cgacgaatcg gacgccgggg aggacggcga cccggactcc cggacgttcg 1020 tcgcgtacgg ggacgacggc gacctggcgg gcttcgtggt cgtctcgtac tccqgctgga 1080 accgccggct gaccgtcgag gacatcgagg tcgccccgga gcaccggggg cacggggtcg 1140 ggcgcgcgtt gatggggctc gcgacggagt tcgcccgcga gcggggcgcc gggcacctct 1200 ggctggaggt caccaacgtc aacgcaccgg cgatccacgc gtaccggcgg atggggttca 1260 ccctctgcgg cctggacacc gccctgtacg acggcaccgc ctcggacggc gagcaggcgc 1320 tctacatgag catgccotgc ccctagtact gacaataaaa agattcttgt tttcaagaac 1380 ttgtcatttg tatagttttt ttatattgta gttgttctat tttaatcaaa tgttagcgtg 1440 atttatattt tttttcgcct cgacatcatc tgcccagatg cgaagttaag tgcgcagaaa 1500 gtaatatcat gcgtcaatcg tatgtgaatg ctggtcgcta tactgctgtc gattcgatac 1560 taacgccgcc atccagtgtc gacggatcct aggtgtacag ggcccaaaag ggcgaattct 1620 gcagatatcc atcacactgg cggccgctcg aggatagtct acaacaacgt ccgcatggaa 1680 gacctaccgg agatgattga agagctagac atcgatgacg aatagacact ctcccccccc 1740 ctccccctct gatctttcct gttgcctctt tttcccccaa ccaatttatc attatacaca 1800 agttctacaa ctactactag taacattact acagttatta taattttcta ttctottttt 1860 ctttaagaat ctatcattaa cgttaatttc tatatataca taactaccat tatacacgct 1920 attatcgttt acatatcaca tcaccgttaa tgaaagatac gacaccctgt acactaacac 1980 aattaaataa tcgccataac cttttctgtt atctatagcc cttaaagctg tttcttcgag 2040 ctttttcact gcagatct 2058 <210> 24 <211> 816 <212> DNA
<213> Saccharomyces cerevisiae <400> 24 ccatatgatc atgtgtcgtc gcacacatat atatatgcct gtatgtgtca gcactaaagt 60 tgcctggcca tccacgctat atatacacgc ctggcggatc tgctcgagga ttgcctacgc 120 gtgggcttga tccaccaacc aacgctcgcc aaatgaactg gcgctttggt cttctgccat 180 cgtccgtaaa ccccggccaa agagaccgga aagatcggtg aaaacatctt gatcttgctc 240 ccgggaattt tagattcagg taggaaattg attacatcaa tactgttacc ctgaatcata 300 ttcgacgatg tcgtctcaca cggaaatata attcatttct tggttttcca aaaaaatztt 360 catttttttt cacttttttg tttcgtcctc cttttttttt tttttttttt attttttttc 420 ctgtgttcac cttttttttt ttcagttgac atctttctgc attcttttct gtgttttttt 480 tttttttttt cgtAtttcca ttgttcgttc gttgcctgtt ttttcgccct attgttctcg 540 agcctaaaaa ttttttcctt tcctgctttc ctttcttcgt tcaaagtttc ctattccatt 600 gttctctttg gtaaactcat tgttgtcgga actcagatat attcaggtca atttactgta 660 cttcaattga cttttttctt gaaatttcaa cttgcctttt caacttgttc ttctttttta 720 atcttattct acactttagt tcccttacct tgttcctaat tattgtctag caaaaagaaa 780 acatacacct atttcattca cacactgcag aaaatg 816 <210> 25 <211> 954 <212> DNA
<213> Artificial Sequence <220>
<223> GCY1 PCR fragment <400> 25 ctgcagaaaa tgcctgctac tttacatgat tctacgaaaa tiactttctct aaatactgga 60 gcccaaatcc ctcaaatagg tttaggtacg tggcagtcga aagagaacga tgcttataag 120 gctgttttaa ccgctttgaa agatggctac cgacacattg atactgctgc tatttaccgt 180 aatgaagacc aagtcggtca agccatcaag gattcaggtg ttcctcggga agaaatcttt 240 gttactacaa agttatggtg tacacaacac cacgaacctg aagtagcgct ggatcaatca 300 ctaaagaggt taggattgga ctacgtagac ttatatttga tgcattggcc tgccagatta 360 gatccagcct acatcaaaaa tgaagacatc ttgagtgtgc caacaaagaa ggatggttct 420 cgtgcagtgg atatcaccaa ttggaatttc atcaaaacct gggaattaat gcaggaacta 480 ccaaagactg gtaaaactaa ggccgttgga gtctccaact tttctataaa taacctgaaa 540 gatctattag catctcaagg taataagctt acgccagctg ctaaccaagt cgaaatacat 600 ccattactac ctcaagacga attgattaat ttttgtaaaa gtaaaggcat tgtggttgaa 660 gcttattctc cgttaggtag taccgatgct ccactattiya aggaacoggt tatccttgaa 720 attgcgaaga aaaataacgt tcaacccgga cacgttgtta ttagctggca cgtccaaaga 780 qqttatgttg tcttgccaaa atctgtgaat cccgatcgaa tcaaaacgaa caggaaaata 840 tttactttgt ctactgagga ctttgaagct atcaataaca tatcgaagga aaagggcgaa 900 aaaagggttg tacatccaaa ttggtctcct ttcgaagtat tcaagtaact taag 954 <210> 26 <211> 2986 <212> DNA
<213> Artificial Sequence <220>
<223> DAK1 PCR fragment <400> 26 ctcgagtacc ggtttcttct tcagattccc tcatggagaa agtgaggcag atgtatatga 60 cagagtcgcc agtttccaag agactttatt caggcacttc catgataggc aagagagaag 120 acccagagat gttgttgtcc tagttacaca tggtatttat tccagagtat tcctgatgaa 180 atggtttaga tggacatacg aagagtttga atcgtatacc aatgttccta acgggagcgt 240 aatggtgatg gaactggacg aatccatcaa tagatacgtc ctgaggaccg tgctacccaa 300 atggactgat tgtgagggag acctaactac atagtgttta aagattacgg atatttaact 360 tacttagaat aatgccattt ttttgagtta taataatcct acgttagtgt gagcgggatt 420 taaactgtga ggaccttaat acattcagac acttctgagg tatcacccta cttattccct 480 tcgagattat atctaggaac ccatcaggtt ggLggaagat tacccgttct aagacttttc 540 agcttccict attgatgtta cacctggaca cccctrttct ggcatccagt ttttaatctt 600 cagtggcatg tgagattctc cgaaattaat taaagcaatc acacaattct ctcggatacc 660 acctcgqttg aaactgacag gtggtttgtt acgcatgcta atgcaaagga gcctatatac 720 ctttggctcg gctgctgtaa cagggaatat aaagggcagc ataatttagg agtttagtga 780 acttgcaaca tttactattt tcccttctta cgtaaatatt tttcttttta attctaaatc 840 aatctttttc aattttttgt ttgtattctt ttcttgctta aatctataac tacaaaaaac 900 acatacataa atctagaaaa tgtccgctaa atcgtttgaa gtcacagatc cagtcaattc 960 aagtctcaaa gggtttgocc ttgctaaccc ctccattacg ctggtccctg aagaaaaaat 1020 tctcttcaga aagaccgatt ccgacaagat cgcattaatt tctggtggtg gtagtggaca 1080 tgaacctaca cacgccggtt tcattggtaa gggtatgttg agtggcgccg tggttggcga 1140 aatttttgca tccccttcaa caaaacagat tttaaatgca atccgtttag tcaatgaaaa 1200 tgcgtctggc gttttattga ttgtgaagaa ctacacaggt gatgttttgc attttggtct 1260 gtccgctgag agagcaagag ccttggqtat taactgccgc gttgctgtca taggtgatga 1320 tgttgcagtt ggcagagaaa agggtggtat ggttggtaga agagcattgg caggtaccgt 1380 tttggttcat aagattgtag gtgccttcgc agaagaatat tctagtaagt atggcttaga 1440 cggtacagct aaagtggcta aaattatcaa cgacaatttg gtgaccattg gatcttcttt 1500 agaccattgt aaagttcctg gcaggaaatt cgaaagtgaa ttaaacgaaa aacaaatgga 1560 attgggtatg ggtattcata acgaacctgq tgtgaaagtt ttagacccta ttccttctac 1620 cgaagacttg atctccaagt atatgctacc aaaactattg gatccaaacg ataaggatag 1680 agcttttgta aagtttgatg aagatgatga agttgtcttg ttagttaaca atctcggcgg 1740 tgtttctaat tttgttatta gLtctatcac ttccaaaact acggatttct taaaggaaaa 1800 ttacaacata accccggttc aaacaattgc tggcacattg atgacctcct tcaatggtaa 1860 tgggttcagt atcacattac taaacgccac taaggctaca aaggctttgc aatctgattt 1920 tgaggagatc aaatcagtac tagacttgtt gaacgcattt acgaacgcac cgggctggcc 1980 aattgcagat tttgaaaaga cttctgcccc atctgttaac gatgacttgt tacataatga 2040 agtaacagca aaggccgtcg gtacctatga ctttgacaag tttgctgagt ggatgaagag 2100 tggtgctgaa caagttatca agagcgaacc gcacattacg gaactagaca atcaaqttgg 2160 tgatggtqat tgtggttaca ctttagtggc aggagttaaa ggcatcaccg aaaaccttga 2220 caagctgtcg aaggactcat tatctcaggc ggttgcccaa atttcagatt tcattgaagg 2280 ctcaatggga ggtacttctg ytygtttata ttcLattctt ttgtcgggtt tttcacacgg 2340 attaattcag gtttgtaaat caaaggatga acccgtcact aaggaaattg tggctaagtc 2400 actcggaatt gcattggata ctttatacaa atatacaaag gcaaggaagg gatcatccac 2460 catgattgat gctttagaac cattcgttaa agaatttact gcatctaagg atttcaataa 2520 ggcggtaaaa gCtgCagagg aaggtgctaa atccactgct acattcgagg ccaaatttgg 2580 cagagcttcg tatgtcggcg attcatctca agtagaagat cctggtgcag taggcctatg 2640 tgagtttttg aaggggqttc aaagcgcctt gtaagtcgag acaaatcgct cttaaatata 2700 tacctaaaga acattaaagc tatattataa gcaaagatac gtaaattttg cttatattat 2760 tatacacata tcatatttct atatttttaa gatttggtta tataatgtac gtaatgcaaa 2820 ggaaataaat tttatacatt attgaacagc gtccaagtaa ctacattatg tgcactaata 2880 gtttagcgtc gtgaagactt tattgtgtcg cgaaaagtaa aaattttaaa aattagagca 2940 ccttgaactt gcgaaaaagg ttcrcatcaa ctgtttaaaa cgtacg 2986 <210> 27 <211> 2651 <212> DNA
<213> Artificial Sequence <220>
<223> GUP1 PCR fragment <400> 27 ggtacctagg accggtttat cattatcaat actgccattt caaagaatac gtaaataatt 60 aatagtagtg aLtttccLaa citLatattag tcaaaaaatt agcctttiaa ttctgcLgLa 120 acccgtacat gcccaaaata gggggcgggt tacacagaat atataacatc gtaggtgtct 180 gggtgaacag tttattcctg gcatccacta aatataatgg agcccgcttt ttaagctggc 240 atccagaaaa aaaaagaatc ccagcaccaa aatattgttt tcttcaccaa ccatcagttc 300 ataggtccat tctcttagcg caactacaga gaacaggggc acaaacaggc aaaaaacggg 360 cacaacctca atggagtgat gcaacctgcc tggagtaaat gatgacacaa ggcaattgac 420 ccacgcatgt atctatctca ttttcttaca ccttctatta ccttctgctc tctctgattt 480 ggaaaaagct gaaaaaaaag gttgaaacca gttccctgaa attattcccc tacttgacta 540 ataagtatat aaagacggta ggtattgatt gtaattctgt aaatctattt cttaaacttc 600 ttaaattcta cttttatagt tagtcttttt tttagtttta aaacaccaag aacttagttt 660 cgaataaaca cacataaaga attcgaaaat gtcgctgatc agcatcctgt ctcccctaat 720 tacttccgag ggcttagatt caagaatcaa accttcacca aaaaaggatg cctctactac 780 cactaagcca tcactatgga aaactactqa qttcaaattc tactacattg catttctggt 840 cgtggttccc ttgatgttct atgctgggtt acaagctagt tcgcccgaaa atccaaacta 900 tgcaagatac gaacgtctcc tatctcaagg ttggttattt ggcagaaaag tagacaatag 960 tgattctcaa tataggtttt tcagggacaa Uttgcgcta ttgtcagttt taatgctagt 1020 ccacacttct ataaaacgca ttgtacttta ttcaacaaat atcactaaat tgaggtttga 1080 tctgatattt ggtttgatct ttttagtggc cgctcatggt gtcaattcga taagaatttt 1140 agcccatatg ctaattttat atgccatcgc ccatgtacta aagaacttta gaagaatagc 1200 caccatcagc atttggattt atggtatttc tacgcttttt attaacgaca acttcagagc 1260 atatccattt ggtaatattt gctctttttt aagcccattg gaccattggt atagaggtat 1320 cattccaaga tgggatgtct ttttcaattt tactcttttg agagtcttaa gttacaactt 1380 ggacttctta gagaggtggg agaatttaca aaagaagaaa agtccatcct atgaatcaaa 1440 agaagctaaa tcagccattt tgctcaatga acgtgctaga ttaactgctg cacaccccat 1500 acaggactac agcttaatga attatattgc atatgttact tacacgccac ttttcattgc 1560 cggccccatt ataacattca atgattatgt ttaccaatcg aaacatacct tgccatcaat 1620 aaatttcaaa ttcatttttt actatgcggt gagattcgtt attgctctct tatctatgga 1680 gttcatttta cactttctcc acgttgtggc aatctcaaaa accaaagcgt gggaaaatga 1740 cacacctttc cagatttcca tgattggctt atttaatttg aatattattt ggctaaaact 1800 actgattccg tggaggctgt ttaggctgtg ggctttgcta gacggaatcg atacacctga 1860 aaatatgatc aggtgtgttg ataacaatta cagttcacta gcattctgga gagcttggca 1920 tagaagctac aataagtgqg ttgtccgtta catatatatt cctctaggtg gttcaaaaaa 1980 tagagttttg acatcactag cagtcttttc cttcgtagct atatggcatg acatcgaact 2040 aaagttatta ttatggggtt ggctaatagt tttgttcctc ttaccagaaa tttttgctac 2100 ccaaattttc tctcattata ccgacgcagt cLggLacaga cacgtttgcg ctgtcggtgc 2160 tgttttcaac atatgggtta tgatgatcgc taatcttttt ggattctgct tqggctctga 2220 cggtactaaa aaattactaa gcgatatgtt ctgtaccgta tctggtttca aatttgtaat 2280 tttggcaagc gttagtttat tcatcgcagt acaaataatg tttgaaatca gagaagaaga 2340 aaagaggcac ggaaLttacc taaaatgctg aggatcccct tttcctttgt cgatatcatg 2400 taattagtta tgtcacgctt acattcacgc cctcctccca catccgctct aaccgaaaag 2460 gaaggagtta gacaacctga agtctaggtc cctatttatt ttttttaata gttatgttag 2520 tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaaa cgcgtgtacg 2580 catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg aaggcttcct 2640 aggctcgagt t 2651 <210> 28 <211> 3037 <212> DNA
<213> Artificial Sequence <220>
<223> FPS1 PCR fragment <400> 28 aagagctccg gactagtcgt acgaattcta tccttttgtt gtttccgggt gtacaatatg 60 gacttcctct tttctggcaa ccaaacccat acatcgggat tcctataata ccttcgttgg 120 tctccctaac atgtaggtgg cggaggggag atatacaata gaacagatac cagacaagac 180 ataatgggct aaacaagact acaccaatta cactgcctca ttgatggtgg tacataacga 240 actaatactg tagccctaga cttgatagcc atcatcatat cgaagtttca ctaccctttt 300 tccatttgcc atctattgaa gtaataatag gcgcatgcaa cttcttttct ttttttttct 360 tttctctctc ccccgttgtt gtctcaccat atccgcaatg acaaaaaaat gatggaagac 420 actaaaggaa aaaattaacg acaaagacag caccaacaga tgtcgttgtt ccagagctga 480 tgaggggtat ctcgaagcac acgaaacttt ttccttcctt cattcacgca cactactctc 540 taatgagcaa cggtatacgg ccttccttcc agttacttga atttgaaata aaaaaagttt 600 gctgtcttgc tatcaagtat aaatagacct gcaattatta atcttttgtt tcctcgtcat 660 tgttctcgtt ccctttcttc cttgtttctt tttctgcaca atatttcaag ctataccaag 720 catacaatca actccagctg cattaaaatg agtaatcctc aaaaagctct aaacgacttt 780 ctgtccagtg aatctgttca tacacatgat agttctagga aacaatctaa taagcagtca 840 tccgacgaag gacgctottc atcacaacct tcacatcatc actctggtgg tactaacaac 900 aataataaca ataataataa taataataac agtaacaaca acaacaacgg caacgatggg 960 ggaaatgatg acgactatga ttatgaaatg caagattata gaccttctcc gcaaagtgcg 1020 cggcctactc ccacgtaLgt_ Lccacaatat tctgtagaaa gtgggactgc tttcccgatt 1080 caagaggtta ttcctagcgc atacattaac acacaagata taaaccataa agataacggt 1140 ccgccgagtg caagcagtaa tagagcattc aggcctagag ggcagaccac agtgtcggcc 1200 aacgtgctta acattgaaga tttttacaaa aatgcagacg atgcgcatac catcccggag 1260 tcacatttat cgagaaggag aagtaggtcg agggctacga gtaatgctgg gcacagtgcc 1320 aatacaggcg ccacgaatgg caggactact ggtgcccaaa ctaatatgga aagcaatgaa 1380 tcaccacgta acgtccccat tatggtgaag ccaaagacat tataccagaa ccctcaaaca 1440 cctacaqtct tgccctccac ataccatcca attaataaat ggtottccgt caaaaacact 1500 tatttgaagg aatttttagc cgagtttatg ggaacaatgg ttatgattat tttcggtagt 1560 gctgttgttt gtcaggtcaa tgttgctggg aaaatacagc aggacaattt caacgtggct 1620 ttggataacc ttaacgttac cgggtcttct gcagaaacga tagacgctat gaagagttta 1680 acatccttqg tttcatccgt tgcgggcggt acctttgatg atgtggcatt gggctgggct 1740 gctgccgtgg tgatgggcta tttctgcgct ggtggtagtg ccatctcagg tgctcatttg 1800 aatccgtcta ttacattagc caatttggtg tatagaggtt ttcccctgaa gaaagttcct 1860 tattactttg ctggacaatt gatcggtgcc ttcacaggcg ctttgatctt gtttatttgg 1920 tacaaaaggg tgttacaaga ggcatatagc gattggtgga tgaatgaaag tgttgcggga 1980 atgttttgcg tttttccaaa gccttatcta agttcaggac ggcaattttt ttccgaattt 2040 ttatgtggag ctatgttaca agcaggaaca tttgcgctga ccgatcctta tacgtgtttg 2100 tcctctgatg ttttcccatt gatgatgttt attttgattt tcattatcaa tgcttccatg 2160 gcttatcaga caggtacagc aatgaatttg gctcgtgatc tgggcccacg tcttgcacta 2220 tatgcagttg gatttgatca taaaatgctt tgggtgcatc atcatcattt cttttgggtt 2280 cccatggtag gcccatttat tggtgcgtta atgggggggt tggtttacga tgtctgtatt 2340 tatcagggtc atgaatctcc agtcaactgg tctttaccag tttataagga aatgattatg 2400 agagcctggt ttagaaggcc tggttgqaag aagagaaata gagcaagaag aacatcggac 2460 ctgagtqact tctcatacaa taacgatgat gatgaggaat ttggagaaag aatggctctt 2520 caaaagacaa agaccaagtc atctatttca gacaacgaaa atgaagcagg agaaaagaaa 2580 gtgcaattta aatctgttca gcgoggcaaa agaacgtttg gtggtatacc aacaattctt 2640 gaagaagaag attccattga aactgcttcg ctaggtgcga cgacgactga ttctattggg 2700 ttatccgaca catcatcaga agattcgcat tatggtaatg ctaagaaggt aacatgagga 2760 tccccttttc ctttgtcgat atcatgtaat tagttatgtc acgcttacat tcacgccctc 2820 ctcccacatc cgctctaacc gaaaaggaag gagttagaca acctgaagtc taggtcccta 2880 tttatttttt ttaatagtta tgttagtatt aagaacgtta tttatatttc aaatttttct 2940 tttttttctg tacaaacgcg tgtacgcatg taacattata ctgaaaacct tgcttgagaa 3000 ggttttggga cgctcgaagg cttcctaggc tcgagtt 3037 <210> 29 <211> 12954 <212> DNA
<213> Artificial Sequence <220>
<223> pRN605 plasmid for overexpression of GCY1, DAK1 and GUP1 <400> 29 tacgccaagc tcggaattaa ccctcactaa agggaacaaa agctgggtac cgggcccccc 60 ctcgagccta ggaagccttc gagcgtccca aaaccttctc aagcaaggtt ttcagtataa 120 tgttacatgc gtacacgcgt ttgtacagaa aaaaaagaaa aatttgaaat ataaataacg 180 ttcttaatac taacataact attaaaaaaa ataaataggg acctagactt caggttgtct 240 aactccttcc ttttcggtta gagcggatgt gggaggaggg cgtgaatgta agcgtgacat 300 aactaattac atgatatcga caaaggaaaa ggggatcctc agcattttag gtaaattccg 360 tgcctctttt cttcttctct gatttcaaac attatttgta ctgcgatgaa taaactaacg 420 cttgccaaaa ttacaaattt gaaaccagat acggtacaga acatatcgct tagtaatttt 480 ttagtaccgt cagagcccaa gcagaatcca aaaagattag cgatcatcat aacccatatg 540 ttgaaaacag caccgacagc gcaaacgtgt ctgtaccaga ctgcgtcggt ataatgagag 600 aaaatttggg tagcaaaaat ttctggtaag aggaacaaaa ctattagcca accccataat 660 aataacttta gttcgatgtc atgccatata gctacgaagg aaaagactgc tagtgatgtc 720 aaaactctat tttttgaacc acctagagga atatatatgt aacggacaac ccacttattg 780 tagcttctat gccaagctct ccagaatqct agtgaactgt aattgttatc aacacacctg 840 atcatatttt caggtgtatc gattccgtct agcaaagccc acagcctaaa cagcctccac 900 ggaatcagta gttttagcca aataatattc aaattaaata agccaatcat ggaaatctgg 960 aaaggtgtgt cattttccca cgctttggtt tttgagattg ccacaacgtg gagaaagtgt 1020 aaaatgaact ccatagataa gagagcaata acgaatctca ccgcatagta aaaaatgaat 1080 ttgaaattta ttgatqqcaa ggtatgtttc gattggtaaa cataatcatt gaatgttata 1140 atggggccgg caatgaaaag tggcgtgtaa gtaacatatg caatataatt cattaagctg 1200 tagtcctgta tggggtgtgc agcagttaat ctagcacgtt cattgagcaa aatggctgat 1260 ttagcttctt ttgattcata ggatggactt ttcttctttt gtaaattctc ccacctctct 1320 aagaagtcca agttgtaact taagactctc aaaagagtaa aattgaaaaa gacatcccat 1380 cttggaatga tacctctata ccaatggtcc aatgggctta aaaaagagca aatattacca 1440 aatggatatg ctctgaagtt gtcgttaata aaaagcgtag aaataccata aatccaaatg 1500 ctgatgg-Egg ctattcttct aaagttcLtt agtacatggg cgatggcata taaaattagc 1560 atatgggcta aaattcttat cgaattgaca ccatgagcgg ccactaaaaa gatcaaacca 1620 aatatcagat caaacctcaa tttagtgata tttgttgaat aaagtacaat gcgttttata 1680 gaagtgtgga ctagcattaa aactgacaat agcgcaaaat tgtccctgaa aaacctatat 1740 tgagaatcac tattgtctac ttttctgcca aataaccaac cttgagatag gagacgttcg 1800 tatcttgcat agtttggatt ttcgggcgaa ctagcttgta acccagcata gaacatcaag 1860 ggaaccacga ccagaaatgc aatgtagtag aatttgaact cagtagtttt ccatagtgat 1920 ggcttagtgg tagtagaggc atcctttttt ggtgaaggtt tgattcttga atctaagccc 1980 tcggaagtaa ttaggggaga caggatgctg atcagcgaca ttttgaattc tttatgtgtg 2040 tttattcgaa actaagttct tggtgtttta aaactaaaaa aaagactaac tataaaagta 2100 gaatttaaga agtttaagaa atagatttac agaattacaa tcaataccta ccqtctttat 2160 atacttatta gtcaagtagg ggaataattt cagggaactg gtttcaacct tttttttcag 2220 ctttttccaa atcagagaga gcagaaggta atagaaggtg taagaaaatg agatagatac 2280 atgcgtgggt caattgcctt gtgtcatcat ttactccagg caggttgcat cactccattg 2340 aggttgtgcc cgttttttgc cLgtttgtgc ccctgttctc tgtagttgcg ctaagagaat 2400 ggacctatga actgatggtt ggtgaagaaa acaatatttt ggtgctggga ttcttttttt 2460 ttctggatgc cagcttaaaa agcgggctcc attatattta gtggatgcca ggaataaact 2520 gttcacccag acacctacga tgttatatat tctgtgtaac ccgcccccta ttttgggcat 2580 gtacgggtta cagcagaatt aaaaggctaa ttttttgact aaataaagtt aggaaaatca 2640 ctactattaa ttatttacgt attctttgaa atggcagtat tgataatgat aaaccggttt 2700 cttcttcaga ttccctcatq gagaaagtgc ggcagatgta tatgacagag tcgccagttt 2760 ccaagagact ttattcaggc acttccatga taggcaagag agaagaccca gagatgttgt 2820 tgtcctagtt acacatggta tttattccag agtattcctg atgaaatggt ttagatggac 2680 atacgaagag tttgaatcgt ttaccaatgt tcctaacggg agcgtaatgg tgatggaact 2940 ggacgaatcc atcaatagat acgtcctgag gaccgtgcta cccaaatgga ctgattgtga 3000 qqqagaccta actacataqt gtttaaagat tacggatatt taacttactt agaataatgc 3060 catttttttg agttataata atcctacgtt agtgtgagcg ggatttaaac tgtgaggacc 3120 ttaatacatt cagacacttc tgcggtatca ccctacttat tcccttcgag attatatcta 3180 ggaacccatc aggttggtgg aagattaccc gttctaagac ttttcagctt cctctattga 3240 tgttacacct ggacacccct tttctggcat ccagttttta atcttcagtg gcatgtgaga 3300 ttctccgaaa ttaattaaag caatcacaca attctctcgg ataccacctc ggttgaaact 3360 gacaggtggt ttgttacgca tgctaatgca aaggagccta tatacctttg gctcggctgc 3420 tgtaacaggg aatataaagg gcagcataat ttaggagttt agtgaacttg caacatttac 3480 tattttccct tctLacgtaa atatttttct ttttaattct aaatcaatct ttttcaattt 3540 tttgtttgta ttcttttctt gcttaaatct ataactacaa aaaacacata cataaatcta 3600 gaaaatgtcc gctaaatcgt ttgaagtcac agatccagtc aattcaagtc tcaaagggtt 3660 tgcccttgct aacccctcca ttacgctggt ccctgaagaa aaaattctct tcagaaagac 3720 cgattccgac aagatcgcat taatttctgg tggtggtagt ggacatgaac ctacacacgc 3780 cggtttcatt ggtaagggta tgttgagtgg cgccgtggtt ggcgaaattt ttgcatcccc 3840 ttcaacaaaa cagattttaa atgcaatccg tttagtcaat gaaaatgcgt ctggcgtttt 3900 attgattqtg aagaactaca caggtgatgt tttgcatttt ggtotgtccg ctgagagagc 3960 aagagccttg ggtattaact gccgcgttgc tgtcataggt gatgatgttg cagttggcag 4020 agaaaagggt ggtatggttg gtagaagagc attggcaggt accgttttgg ttcataagat 4080 tgtaggtgcc ttcgcagaag aatattctag taagtatggc ttagacggta cagctaaagt 4140 ggctaaaatt atcaacgaca atttggtgac cattggatct tctttagacc attgtaaagt 4200 tcctggcagg aaattcgaaa qtgaattaaa cgaaaaacaa atggaattgg gtatgggtat 4260 tcataacgaa cctggtgtga aagttttaga ccctattcct tctaccgaag acttgatctc 4320 caagtatatg ctaccaaaac tattggatcc aaacgataag gatagagctt ttgtaaagtt 4380 tgatgaagat gatgaagttg tcttgttagt taacaatctc ggcggtgttt ctaattttgt 4440 tattagttct atcacttcca aaactacgga tttcttaaag gaaaattaca acataacccc 4500 ggttcaaaca attgctggca cattgatgac ctccttcaat ggtaatgggt tcagtatcac 4560 attactaaac gccactaagg ctacaaaggc tttgcaatct gattttgagg agatcaaatc 4620 agaactagac ttgttgaacg catttacgaa cgcaccgggc tggccaattg cagattttga 4680 aaagacttct gccccatctg ttaacgatga cttgttacat aatgaagtaa cagcaaaggc 4740 cgtcggtacc tatgactttg acaagtttgc tgagtggatg aagagtggtg ctgaacaagt 4800 tatcaagagc gaaccgcaca ttacggaact agacaatcaa gttggtgatg gtgattgtgg 4860 ttacacttta gtggcaggag ttaaaggcat caccgaaaac cttgacaagc tgtcgaagga 4920 ctcattatct caggcggttg cccaaatttc agatttcatt gaaggctcaa tgggaggtac 4980 ttctggtggt ttatattcta ttcttttgtc gggtttttca cacggattaa ttcaggtttg 5040 taaatcaaag gatgaacccg tcactaagga aattgtggct aagtcactcg gaattgcatt 5100 ggatacttta tacaaatata caaaggcaag gaagggatca tccaccatga ttgatgcttt 5160 agaaccattc gLLaaagaat ttactgcatc taaggatttc aataaggcgg taaaagctgc 5220 agaggaaggt gctaaatcca ctgctacatt cgaggccaaa tttggcagag cttcgtatgt 5280 cggcgattca tctcaagtag aagatcctgg tgcagtaggc ctatgtgagt ttttgaaggg 5340 ggttcaaagc gccttgtaag tcgagacaaa tcgctcttaa atatatacct aaagaacatt 5400 aaagctatat tataagcaaa gatacgtaaa ttttgcttat attattatac acatatcata 5460 tttctatatt tttaagattt ggttatataa tgtacgtaat gcaaaggaaa taaattttat 5520 acattattga acagcgtcca agtaactaca ttatgtgcac taatagttta gcgtcgtgaa 5580 gactttattg tgtcgcgaaa agtaaaaatt ttaaaaatta gacicaccttg aacttgcgaa 5640 aaaggttctc atcaactgtt taaaacgtac gtgtggaaga acgattacaa caggtgttgt 5700 cctctgagga cataaaatac acaccgagat tcatcaactc attgctggag ttagcatatc 5760 tacaattggg tgaaatgggg agcgatttgc aggcatttgc tcggcatgcc ggtagaggtg 5820 tggtcaataa gagcgacctc atgctatacc tgagaaagca acctgaccta caggaaagag 5880 ttactcaaga ataagaattt tcgttttaaa acctaagagt cactttaaaa tttgtataca 5940 cttatttttt ttataactta tttaataata aaaatcataa atcataagaa attcgcgcgc 6000 ttacttgaat acttcgaaag gagaccaatt tggatgtaca accctttttt cgcccttttc 6060 cttcgatatg ttattgatag cttcaaagtc ctcagtagac aaagtaaata ttttcctgtt 6120 cgttttgatt cgatcgggat tcacagattt tggcaagaca acataacctc tttggacgtg 6180 ccagctaata acaacgtgtc cgggttgaac gttatttttc ttcgcaattt caaggataac 6240 cggttccttc aatagtggag catcggtact acctaacgga gaataagctt caaccacaat 6300 gcctttactt ttacaaaaat taatcaattc gtcttgaggt agtaatggat gtatttcgac 6360 ttggttagca gctggcgtaa gcttattacc ttgagatgct aatagatctt tcaggttatt 6420 tatagaaaag ttggagactc caacggcctt agttttacca gtctttggta gttcctgcat 6480 taattcccag gttttgatga aattccaatt ggtgatatcc actgcacgag aaccatcctt 6540 ctttgttggc acactcaaga tgtcttcatt tttgatgtag gctggatcta atctggcagg 6600 ccaatgcatc aaatataagt ctacgtagtc caatcctaac ctctttagtg attgatccag 6660 cgctacttca ggttcgtggt gttgtgtaca ccataacttt gtagtaacaa agatttcttc 6720 ccgaggaaca cctgaatcct tgatggcttg accgacttgg tcttcattac ggtaaatagc 6780 agcagtatca atgtgtcggt agccatcttt caaagcggtt aaaacagcct tataagcatc 6840 gttctctttc gactgccacg tacctaaacc tatttgaggg atttgggctc cagtatttag 6900 agaaaggatt ttcgtagaat catgtaaagt agcaggcatt ttctgcagtt aattcagtaa 6960 attttcgatc ttgggaagaa aaaagcagta agcgtgaaaa atctaaaagc tgatgtagta 7020 gaagatccta ttctttaaca aagattgacc ttttctttalt cttcttggtt tgagtagaaa 7080 ggggaaggaa gaatacaaga gagaggaaaa aaaggaagat aaaaagagag cgtgatataa 7140 atgaatatat attaaacaag agagattgqg aaggaaagga tcaaacaaac ccaaaaatat 7200 ttcaaaaagg agagagagag gcgagttagg tttcaaaacg gtttatttat ttatgcaaga 7260 ggacgtggaa gaaaaagaag aaggaagaaa aaaatttgaa agaaaaaaac gcgtggcggg 7320 taaagaagaa aatggaaaat agaggccggg tgacagagaa atattgaggg ttaattggaa 7380 aatatgttag ggtgaggcat atgtttttaa gggttttgag gatccgataa ggaagaatgt 7440 aggttaaatg ttgtgcatta attgctgtgg caqcttaccc gcttccccac acatttacta 7500 gttctagagc ggccgccacc gcggtggagc tccaattcgc cctatagtga gtcgtattac 7560 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt 7620 aatcgccttg cagcacatcc ccccttcgcc agctggcgta atagcgaaga ggcccgcacc 7680 gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcgacgc gccctgtagc 7740 ggcgcattaa qcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc 7800 gccctagcgc ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggtagt 7860 gttagacctg aacaaggttt actaaaaatc cgtaaagaac ttcaattgta cgccaactta 7920 aggcctcgtc cccgccgggt cacccggcca gcgacatgga ggcccagaat accctccttg 7980 acagtcttga cgtgcgcagc tcaggggcat gatgtgactg tcgcccgtac atttagccca 8040 tacatcccca tgtataatca tttgcatcca tacattttga tggccgcacg gcgcgaagca 8100 aaaattacgg ctcctcgctg cagacctgcg agcagggaaa cgctcccctc acagacgcgt 8160 gaattgtccc cacgccgcgc ccctgtagag aaaLataaaa ggttaggatt tgccactgag 8220 gttcttcttt catatacttc cttttaaaat cttgctagga tacagttctc acatcacatc 8280 cgaacataaa caaccatggg taaaaagcct gaactcaccg cgacgtctgt cgagaagttt 8340 ctgatcgaaa agttcgacag cgtctccgac ctgatgcagc tctcggaggg cgaagaatct 8400 cgtgctttca gcttcgatgt aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc 8460 gatggtttct acaaagatcg ttatgtttat cggcactttg catcggccgc gctcccgatt 8520 ccggaagtgc ttgacattgg ggaattcagc gagagcctga cctattgcat ctcccgccgt 8580 gcacagggtg tcacgttgca agacctgcct gaaaccgaac tgcccgctgt tctgcagccg 8640 gtcgcggagg ccatggatgc gatcgctgcg gccgatctta gccagacgag cgggttcggc 8700 ccattcggac cgcaaggaat cggtcaatac actacatggc gtgatttcat atgcgcgatt 8760 gctgatcccc atgtgtatca ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc 8820 gcgcaggctc tcgatgagct gatqctttqg gccgaggact gccccgaagt ccggcacctc 8880 gtgcacgcgg atttcggctc caacaatgtc ctgacggaca atggccgcat aacagcggtc 8940 attgactgga gcgaggcgat gttcggggat tcccaatacg aggtcgccaa catcttcttc 9000 tggaggccgt ggttggcttg tatggagcag cagacgcgct acttcgagcg gaggcatccg 9060 gagcttgcag gatcgccgcg gctccgggcg tatatgctcc gcattggtct tgaccaactc 9120 tatcagagct tggttgacgg caatttcgat gatgcagctt gggcgcaggg tcgatgcgac 9180 gcaatcgtcc gatccggagc cgggactqtc gggcgtacac aaatcgcccg cagaagcgcg 9240 gccgtctgga ccgatggctg tgtagaagta ctcgccgata gtggaaaccg acgccccagc 9300 actcgtccga gggcaaagga ataatcagta ctgacaataa aaagattctt gttttcaaga 9360 acttgtcatt tgtatagttt ttttatattg tagttgttct attttaatca aatqttagcg 9420 tgatttatat tttttttcqc ctcgacatca tctgcccaga tgcgaagtta agtgcgcaga 9480 aagtaatatc atgcgtcaat cgtatgtgaa tgctggtcgc tatactgctg tcgattcgat 9540 actaacgccg ccatccagtg tcgacggatc ctaggtgtac ataaacttLa taaatgaaat 9600 tcataataga aacgacacga aattacaaaa tggaatatgt tcatagggta gacgaaacta 9660 tatacgcaat ctacatacat ttatcaagaa ggagaaaaag gaggatagta aaggaataca 9720 ggtaagcaaa ttgatactaa tggctcaacg tgataaggaa aaagaattgc actttaacat 9780 taatattgac aaggaggagg gcaccacaca aaaagttagg tgtaacagaa aatcatgaaa 9840 ctacgattcc taatttgata ttggaggatt ttctctaaaa aaaaaaaaat acaacaaata 9900 aaaaacactc aatgacctga ccatttgatg gagtttaagt caataccttc ttgaaccatt 9960 tcccataatg gtgaaagttc cctcaagaat tttactctgt cagaaacggc cttacgacgt 10020 agtcgatatg gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagcccc 10080 gacacccgcc aacacccgct gacgcgccct gacgggcttg tcatgatcccg gcatccgctt 10140 acagacaagc tgtgaccgtc tccgggagct gcatgtgLca gaggttttca ccgtcatcac 10200 cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt tttataggtt aatgtcatga 10260 taataatggt ttcttaggac ggatcgcttg cctgtaactt acacgcgcct cgtatctttt 10320 aatgatggaa taatttggga atttactctg tgtttattta tttttatgtt ttgtatttgg 10380 attttagaaa gtaaataaag aaggtagaag agttacggaa tgaagaaaaa aaaataaaca 10440 aaggtttaaa aaatttcaac aaaaagcgta ctttacatat atatttatta gacaagaaaa 10500 gcagattaaa tagatataca ttcgattaac gataagtaaa atgtaaaatc acaggatttt 10560 cgtgtgtggt cttctacaca gacaagatga aacaattcgg cattaatacc tgagagcagg 10620 aagagcaaqa taaaagqtag tatttgttgg cgatccccct agagtctttt acatcttcgg 10680 aaaacaaaaa ctattttttc tttaatttct ttttttactt tctattttta atttatatat 10740 ttatattaaa aaatttaaat tataattatt tttatagcac gtgatgaaaa ggacccaggt 10800 ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca 10860 aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg 10920 aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc 10980 cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg 11040 ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt 11100 cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta 11160 ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat 11220 gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga 11280 gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca 11340 acgatcggag gaccgaagga gctaaccgct ttttttcaca acatggggga tcatgtaact 11400 cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc 11460 acgatgcctg tagcaatggc aacaacgttq cgcaaactat taactggcga actacttact 11520 ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt 11580 ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt 11640 gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt 11700 atctacacga cgggcagtca ggcaactatg gatgaacgaa atagacagat cgctgagata 11760 ggtgcctcac tgattaagca ttggtaactg tcagaccaag fttactcata tatactttag 11820 attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat 11880 ctcatgacca aaatccctta acgLgagttt tcgttccact gagcgtcaga ccccgtagaa 11940 aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 12000 aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 12060 ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg 12120 tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 12180 ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 12240 cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 12300 agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagca ttgagaaagc 12360 gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 12420 ggagagcgca cgagggagct tccagggggg aacgcctggt atctttatag tcctgtcggg 12480 tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gccgagccta 12540 tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 12600 cacatgttct ttcctgcgtt atcccctgat tctqtggata accgtattac cgcctttgag 12660 tgagctaata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa 12720 gcggaagagc gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc 12780 agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg 12840 agttacctca ctcattaggc accccaggct ttacacttta tgcttccggc tcctatgttg 12900 tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacca tgat 12954 <210> 30 <211> 10329 <212> DNA
<213> Artificial Sequence <220>
<223> pRN608 p1asmid for overexpression of DAK1 and GCY1 <400> 30 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 60 gctgaacggg gggttcgtqc acacagccca gcttggagcg aacgacctac accgaactga 120 gatacctaca gcgtgagcat tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 180 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggga 240 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 300 tgtgatgctc gtcagggggg ccgagcctat ggaaaaacgc cagcaacgcg gcctttttac 360 ggttcctggc cttttgctgg cottttgctc acatgttctt tcctgcgtta tcccctgatt 420 ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc agccgaacga 480 ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cccaatacgc aaaccgcctc 540 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag 600 cgggcagtga gcgcaacgca attaatgtga gttacctcac tcattaggca ccccaggctt 660 tacactttat gcttccggct cctatgttgt gtggaattgt gagcggataa caatttcaca 720 caggaaacag ctatgaccat gattacgcca agctcggaat taaccctcac taaagggaac 780 aaaagctggg taccgggccc cccctcgagt accggtttct tcttcagatt ccctcatgga 840 gaaagtgcgg cagatgtata tgacagagtc gccagtttcc aagagacttt attcaggcac 900 ttccatgata ggcaagagag aagacccaga gatgttgttg tcctagttac acatggtatt 960 tattccagag tattcctgat gaaatggttt agatggacat acgaagagtt tgaatcgttt 1020 accaatgttc ctaacgggag cgtaatggtg atggaactgg acgaatccat caatagatac 1080 gtcctgagga ccgtgctacc caaatggact gattgtgagg gagacctaac tacatagtgt 1140 ttaaagatta cggatattta acttacttag aataatgcca tttttttgag ttataataat 1200 cctacgttag tgtgagcggg atttaaactg tgaggacctt aatacattca gacacttctg 1260 cggtatcacc ctacttattc ccttcgagat tatatctagg aacccatcag gttggtggaa 1320 gattacccgt tctaagactt ttcagcttcc tctattgatg ttacacctgg acaccccttt 1380 tctggcatcc agtttttaat cttcagtggc atgtgagatt utccgaaatt_ aattaaagca 1440 atcacacaat tctctcggat accacctcgg ttgaaactga caggtggttt attacgcatg 1500 ctaatgcaaa ggagcctata tacctttggc taggctgctg taacagggaa tataaagggc 1560 agcataattt aggagtttag tgaacttgca acatttacta ttttcccttc ttacgtaaat 1620 atttttcttt ttaattctaa atcaatcttt ttcaattttt tgtttgtatt cttttcttgc 1680 ttaaatctat aactacaaaa aacacataca taaatctaga aaatgtccgc taaatcgttt 1740 gaagtcacag atccagtcaa ttcaagtctc aaagggtttg ccottqctaa cccctccatt 1800 acgctggtcc ctgaagaaaa aattctcttc agaaagaccg attccgacaa gatcgcatta 1860 atttctggtg gtggtagtgg acatgaacct acacacgccg gtttcattgg taagggtatg 1920 Ltgagtggcg ccgtggttgg cgaaattttt gcatcccctt caacaaaaca gattttaaat 1980 gcaatccgtt tagtcaatga aaatgcgtct ggcgttttat tgattgtgaa gaactacaca 2040 ggtgatgttt tgcattttgg tatgtccgct gagagagcaa gagccttggg tattaactgc 2100 cgcgttgctg tcataggtga tgatgttgca gttggcagag aaaagggtgg tatggttggt 2160 agaagagcat tggcaggtac cgttttggtt cataagattg taggtgcctt cgcagaagaa 2220 tattctagta agtatggctt agagggtaca gctaaagtgg ctaaaattat caacgacaat 2280 ttggtgacca ttggatcttc tttagaccat tgtaaagttc ctggcaggaa attcgaaagt 2340 gaattaaacg aaaaacaaat ggaattgggt atgggtattc ataacgaacc tgqtqtqaaa 2400 gttttagacc ctattccttc taccgaagac ttgatctcca agtatatgct accaaaacta 2460 ttggatccaa acgataagga tagagctttt gtaaagtttg atgaagatga tgaagttgtc 2520 ttgttagtta acaatctogg cggtgtttct aattttgtta ttaqttctat cacttccaaa 2580 actacggatt tcttaaagga aaattacaac ataaccccgg ttcaaacaat tgctggcaca 2640 ttgatgacct ccttcaatgg taatgggttc agtatcacat tactaaacgc cactaaggct 2700 acaaaggctt tgcaatctga ttttgaggag atcaaatcag tactagactt gttgaacgca 2760 tttacgaacg caccgggctg gccaattgca gattttgaaa agacttctgc cccatctgtt 2820 aacgatgact tgttacataa tgaagtaaca gcaaaggccg tcggtaccta tgactttgac 2880 aagtttgctg agtggatgaa gagtggtgct gaacaagtta tcaagagcga accgcacatt 2940 acggaactag acaatcaagt tggtgatggt gattgtggtt acactttagt ggcaggagtt 3000 aaaggcatca ccgaaaacct tgacaagctg tcgaaggact cattatctca ggcggttgcc 3060 caaatttcag atttcattga aggctcaatg ggaggtactt ctggtggttt atattctatt 3120 cttttgtcgg gtttttcaca cggattaatt caggtttgta aatcaaagga tgaacccgtc 3180 actaaggaaa ttgtggctaa gtcactcgga attgcattgg atactttata caaatataca 3240 aaggcaagga agggatcatc caccatgatt gatgctttag aaccattcgt taaagaattt 3300 actgcatcta aggatttcaa taaggcggta aaagctgcag aggaaggtgc taaatccact 3360 gctacattcg aggccaaatt tggcagagct tcgtatgtcg gcgattcatc tcaagtagaa 3420 gatcctggtg cagtaggcct atgtgagttt ttgaaggggg ttcaaagcgc cttgtaagtc 3480 gagacaaatc gctcttaaat atatacctaa agaacattaa agctatatta taagcaaaga 3540 tacgtaaatt ttgcttatat tattatacac atatcatatt tctatatttt taagatttgg 3600 ttatataatg tacgtaatgc aaaggaaata aattttatac attattgaac agcgtccaag 3660 taactacatt atgtgcacta atagtttagc gtcgtgaaga ctttattgtg tcgcgaaaag 3720 taaaaatttt aaaaattaga gcaccttgaa cttgcgaaaa aggttctcat caactgttta 3780 aaacgtacgt gtggaagaac gattacaaca ggtgttgtcc tctgaggaca taaaatacac 3840 accgagattc atcaactcat tgctggagtt agcatatcta caattgggtg aaatggggag 3900 cgatttgcag gcatttgctc ggcatgccgg tagaggtgtg gtcaataaga gcgacctcat 3960 gctatacctg agaaagcaac ctgacctaca ggaaagagtt actcaagaat aagaattttc 4020 gttttaaaac ctaagagtca ctttaaaatt tgtatacact tatttttttt ataacttatt 4080 taataataaa aatcataaat cataagaaat tcgcgcgctt acttgaatac ttcgaaagga 4140 gaccaatttg gatgtacaac ccttttttcg cccttttcct tcgatatgtt attgatagct 4200 tcaaagtcct cagtagacaa agtaaatatt ttcctgttcg ttttgattcg atcgggattc 4260 acagattttg gcaaqacaac ataacctctt tggacgtgcc agctaataac aacgtgtccg 4320 ggttgaacgt tatttttctt cgcaatttca aggataaccg gttccttcaa tagtggagca 4380 tcggtactac ctaacggaga ataagcttca accacaatgc ctttactttt acaaaaatta 4440 atcaattcgt cttgaggtag taatggatgt atttcgactt ggttagcagc tggcgtaagc 4500 ttattacctt gagatgctaa tagatctttc aggttattta Lagaaaagtt ggagactcca 4560 acggccttag ttttaccagt ctttggtagt tcctgcatta attcccaggt tttgatgaaa 4620 ttccaattgg tgatatccac tgcacgagaa ccatccttct ttgttggcac actcaagatg 4680 tcttcatttt tgatgtaggc tggatctaat ctggcaggcc aatgcatcaa atataagtct 4740 acgtagtcca atcctaacct ctttagtgat tgatccagcg ctacttcagg ttcgtggtgt 4800 tgtgtacacc ataactttgt agtaacaaag atttcttccc gaggaacacc tgaatccttg 4860 atggcttgac cgacttggtc ttcattacgg taaatagcag cagtatcaat gtgtcggtag 4920 ccatctttca aagcggttaa aacagcctta taagcatcgt tctctttcga ctgccacgta 4980 cctaaaccta tttgagggat ttgggctcca gtatttagag aaaggatttt cgtagaatca 5040 tgtaaagtag caggcatttt ctgcagttaa ttcagtaaat tttcgatctt gggaagaaaa 5100 aagcagtaag cgtgaaaaat ctaaaagctg atgtagtaga agatcctatt ctttaacaaa 5160 gattgacctt ttctttttct tcttggtttg agtagaaagg ggaaggaaga atacaagaga 5220 gaggaaaaaa aggaagataa aaagagagcg tgatataaat gaatatatat taaacaagag 5280 agattgggaa ggaaaggatc aaacaaaccc aaaaatattt caaaaaggag agagagaggc 5340 gagtttggtt tcaaaacggt ttatttattt atgcaagagg acgtggaaga aaaagaagaa 5400 ggaagaaaaa aatttgaaag aaaaaaacgc gtggcgggta aagaagaaaa tggaaaatag 5460 aggccgggtg acagagaaat attgagggtt aattggaaaa tatgttaggg tgaggcatat 5520 gtttttaagg gttttgagga tccgataagg aagaatgtag gttaaatgtt gtgcattaat 5580 tgctgtggca gcttacccgc ttccccacac atttactagt tctagagcgg ccgccaccgc 5640 ggtggagctc caattcgccc tatagtgagt cgtattacaa ttcactggcc gtcgttttac 5700 aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc 5760 ccttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc 5820 gcagcctgaa tggcgaatgg cgcgacgcgc cctgtagcgg cgcattaagc gcggcgggtg 5880 tggtgqttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc gctcctttcg 5940 ctttcttccc ttcctttctc gccacgttcg ccggtagtgt tagacctgaa caaggtttac 6000 taaaaatccg taaagaactt caattgtacg ccaacttaag gcctcgtccc cgccgggtca 6060 cccggccagc gacatggagg cccagaatac cctccttgac agtcttgacg tgcgcagctc 6120 aggggcatga tgtgactgtc gcccgtacat ttagcccata catccccatg tataatcatt 6180 tgcatccata cattttgatg gccgcacggc qcgaagcaaa aattacggct cctcgctgca 6240 gacctgcgag cagggaaacg ctcccctcac agacgcgtga attgtcccca cgccgcgccc 6300 ctgtagagaa atataaaagg ttaggatttg ccactgaggt tcttctttca tatacttcct 6360 tttaaaatct tgctaggata cagttctcac atcacatccg aacataaaca accatgggta 6420 aaaagcctga actcaccgcg acgtctgtcg agaagtttct gatcgaaaag ttcgacagcg 6480 tctccgacct gatgcagctc tcggagggcg aagaatctcg tgctttcagc ttcgatgtag 6540 gagggcgtgg atatgtcctg cgggtaaata gctgcgccga tggtttctac aaagatcgtt 6600 atgtttatcg gcactttgca tcggccgcgc tcccgattcc ggaagtgctt gacattgggg 6660 aattcagcga gagcctgacc tattgcatct cccgccgtgc acagggtgtc acgttgcaag 6720 acctgcctga aaccgaactg cccgctgttc tgcagccggt cgcggaggcc atggatgcga 6780 tcgctgcggc cgatcttagc cagacgagcg qgttcggccc attcggaccg caaggaatcg 6840 gtcaatacac tacatggcgt gatttcatat gcgcgattgc tgatccccat gtgtatcact 6900 ggcaaactgt gatggacgac accgtcagtg cgtccgtcgc gcaggctctc gatgagctga 6960 tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca 7020 acaatqtcct gacggacaat ggccgcataa cagcggtcat tgactggagc gaggcgatgt 7080 tcggggattc ccaatacgag gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta 7140 tggagcagca gacgcgctac ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc 7200 tccgggcgta tatgctccgc attggtcttg accaactcta tcagagcttg gttgacggca 7260 atttcgatga tgcagcttgg gcgcagggtc gaLgcgacgc aatcgtccga tccggagccg 7320 ggactqtcgg gcgtacacaa atcgcccgca gaagcgcggc cgtctggacc gatggctgtg 7380 tagaagtact cgccgatagt gqaaaccgac qccccagcac tcgtccgagg gcaaaggaat 7440 aatcagtact gacaataaaa agattcttgt tttcaagaac ttgtcatttg tatagttttt 7500 ttatattgta gLLgttctat tttaatcaaa tgttagcgtg atttatattt tttttcgcct 7560 cgacatcatc tgcccagatg cgaagttaag tgcgcagaaa gtaatatcat gcgtcaatcg 7620 tatgtgaatg ctggtcgcta tactgctgtc gattcgatac taacgccgcc atccagtgtc 7680 gacggatcct aggtgtacat aaactttata aatgaaattc ataatagaaa cgacacgaaa 7740 ttacaaaatg gaatatgttc atagggtaga cgaaactata tacgcaatct acatacattt 7800 atcaagaagg agaaaaagga ggatagtaaa ggaatacagg taagcaaatt gatactaatg 7860 gctcaacgtg ataaggaaaa agaattgcac tttaacatta atattgacaa ggaggagggc 7920 accacacaaa aagttaggtg taacagaaaa tcatgaaact acgattccta atttgatatt 7980 ggaggatttt ctctaaaaaa aaaaaaatac aacaaataaa aaacactcaa tgacctgacc 8040 atttgatgga gtttaagtca ataccttctt gaaccatttc ccataatggt gaaagttccc 8100 tcaagaattt tactctgtca gaaacggcct tacgacgtag tcgatatggt gcactctcag 8160 tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga 8220 cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc 8280 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg 8340 cctcgtgata cgcctatttt tataggttaa Lgtcatgata ataatggttt cttaggacgg 8400 atcgcttgcc tgtaacttac acgcgcctcg tatcttttaa tgatggaata atttgggaat 8460 ttactctgtg tttatttatt tttatgtttt gtatttggat tttagaaagt aaataaagaa 8520 ggtagaagag ttacggaatg aagaaaaaaa aataaacaaa ggtttaaaaa atttcaacaa 8580 aaagcgtact ttacatatat aLttattaga caagaaaagc agattaaata gatatadatt 8640 cgattaacga taagtaaaat gtaaaatcac aggattttcg tgtgtggtct tctacacaga 8700 caagatgaaa caattcggca ttaatacctg agagcaggaa gagcaagata aaaggtagta 8760 tttgttggcg atccccctag agtcttttac atcttoggaa aacaaaaact attttttctt 8820 taatttcttt ttttactttc tatttttaat ttatatattt atattaaaaa atttaaatta 8860 taattatttt tatagcacgt gatgaaaagg acccaggtgg cacttttcgg ggaaatgtgc 8940 gcggaacccc tatttgttta tEtttctaaa tacattcaaa tatgtatccg ctcatgagac 9000 aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt 9060 tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag 9120 oppt a22332,3205 T3012=133 BoEqp.3.3.332 3q4653popq 2353453205 3.43-4223552 23533233Eu 2525533D-4g bbollleqb3 uqbque3252 ebboe3qqob OZET obeqp4b-e4e 424223223v ;bqoou-25.44 424245eqpb po2pub4poo 44445ebbbq 093T poppbopipo eebqmpeb qq23-4ep33p 4q.6-4-40eqb3 qpbop4-44e6 epeqqiqbqo 00ZI eueoebooqe qeeqoperepe qebebbe5qq. qoboeqeefo qq2Tebqeep qoqlobeobq 0t,TT obcpbq5qe5 op4eqq-eqqp oqeopfiqobb Tepopqoqqo ea6.6peeep5 4epa5e4oub 0801 ebeeebeboo e6eq352432 2223523532 bo5334pq24 o4qpbEe4oq 253535E355 2334254.42'4 34023.35j3.3. qowepougq cobbpboeeq qqop4b4goo 096 qbbeogoboo qqpeopTebo 2354323336 33g3eq2.302 33op4243eb P4P43pbb3e 006 33q3.223.-Tee bP61PDP220 153.3622420 q2b3T2432b 53333523.35 TeDboDE6D5 Of78 eu3333bbv5 pub5bbob6o opeblbbboo .6633533.5-42 p3333bb.60 lluqbbbubb 08L 22o3.533-e6e poq6peobob 33b 33333 53.2332o2D3 623253565o eqbleeewb OZL bb4v4b4vbb bb4eoeqvq.q. vb4.eppa5T2 bbquqb4ppe oqeocb.50.6 15=505344 099 ofmqq-12p-1 5oo5p66p8o 8po5lo156p o534:7)64ono q44636e66.6 5p6354o-In3 009 boevoqq.epo e655b.q.bobb obob55bee 33q33-44242, 333333224o pq222065-45 vo3op22022 BEee5q.e4e4 Bpubbueupq 33.3.-ebueobu 33 323543u ube.6464ufq 2'444544654 2008644022 04E64.02055 0226500205 2848508080 0040600260 3022620046 6045503625 3032262.6.65 0334.522602 2E6065=20 eooubboopq boqboupga b3 b;53 obobooebbq 00E poqbbqopeo oeobbooqbq qbqbbflepob beoppepeop peoboboobb epoiLogobe 3pqb3bbo43 eopebooqco vb3p3e.6.535 044fte5boo 04.50.55vbbo oobboobbqP
081 335b3333pb opElogobqob boeoopopflo 33qove5obb bpoboboqbb boobboobqg OZT Beofmeo5i5 pebopoobbo qooqofq.00q hpoq8q5715-2 o-4.61-4e44aq qp;ppbppop 09 eeebqqoq35 eepebquueo egelpuueue eegegeeppq peupeebe ulqublqq TE <OOP>
9I9L\Idd <CZ>
<OZZ>
Bouenbes TeToTgTqzv <ET>
VNG <ZTZ>
E911I <ITZ>
TE <OTZ>
63E0T 2q2b30535 OZEOT poob4ob.435 84.623orqqb qoaq.ee435.4 oqabo400eq 2ou3o3033e ob.245;343E
0930I ebevoggoep oupobbuqqb Eqb3302354 Ereqoqq33q6 loeqeeepou qebppbobeb 0030I 238204.4066 4322qhbue5 33333.q3D-43 peoopq3626 peoTebboof, -4-4-3.0qqqbbq OPTOT bbobucoeqo booppouee uu=eeupb4 qobqcb4oqu eqbobobqoq -44-4-4-44DD4e 08001 5263303433 2E08223325 222252-453o oppbuogeoel ebqoPoqqb 34444E,3046 OZOOT oeeqq03332 2223325q2o qogeeqp5T4 444poq2bee 5q.56pqoqeE, bpuPeqqq.Pe peel:m.12b3 125233321 rququoqouq 4452203262 0464022465 23qoo5a 5622,252533 03q25232.52 3222532253 abbquqouuo 01786 bbeogbupbb boubopoego qeqqbeqb34 24boo34o33 bPPq.653ebu 3o55bb4opo 08L6 b2D0332332 3503503035 bbqb35-25.45 5=5250;33 222325;353 32a335b3o0 03L6 bqobboDqqo 3355330535 qoqqouppeb bpobqq.bupp 4ubbobbe6b 42bbq325e3 0996 peqquepeeD bboDoTlobu qoweTweq opebobbqou eqleweeep boblqfpoePo 0096 Eeobb3eea6 pq.6400fq.2.6 ceoopophqb oftbouboes eopeqeop5e ebleebqoft 017g6 6b3oppb654 qboqubqqop 6343er353e oqubbbbbqu ouu3vo3444 ;433633eu3 08176 002.5522533 25525533.25 322320333; o2333p2335 53.633e3ev3 eb35e54p33 03176 up3.233.543.5 qbPabqeggu e5eb223beo 2532355;25 50P3404P35 PPPP5P3PO3 09E6 flepoupqopq 0e0y4.6Eq3D pbmepbuoao qmeqopouqu 3.633534553 weeobpbee 00E6 3.65633.63P6 332353o332 332-3003535 0.4.53233033 3302223333 opobeb4ebq 01,36 2233333303 5152538353 555-435233e 5225305326 2222352225 3553053228 agcatatctt tgttaacgaa gcatctgtgc ttcattttgt agaacaaaaa tgcaacgcga 1500 gagcgctaat ttttcaaaca aagaatctga gctgcatttt tacagaacag aaatgcaacg 1560 cgaaagcgct attttaccaa cgaagaatct gtgcttcatt tttgtaaaac aaaaatgcaa 1620 cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc atttttacag aacagaaatg 1680 caacgcgaga gcgctatttt accaacaaag aatctatact tcttttttgt tctacaaaaa 1740 tgcatcccga gagcgctatt tttctaacaa agcatcttag attacttttt ttctcctttg 1800 tgcgctctat aatgcagtct cttgataact ttttgcactg taggtccgtt aaggttagaa 1860 gaaggctact ttggtqtcta ttttctcttc cataaaaaaa gcctgactcc acttcccgcg 1920 tttactgatt actagcgaag ctgcgggtgc attttttcaa gataaaggca tccccgatta 1980 tattctatac cgatgtggat tgcgcatact ttgtgaacag aaagtgatag cgttgatgat 2040 tottcattgg tcagaaaatt atgaacggtt tcttctattt tgtctctata tactacgtat 2100 aggaaatgtt tacattttcg tattgttttc gattcactct atgaatagtt cttactacaa 2160 tttttttgtc taaagagtaa tactagagat aaacataaaa aatgtagagg tcgagtttag 2220 atgcaagttc aaggagcgaa aggtggatgg gtaggttata tagggatata gcacagagat 2280 atatagcaaa gagatacttt tgagcaatgt ttgtggaaag cggtattcgc aatgccggca 2340 aaagggcgaa ttgattttga agagaatgtg gattttgatg taattgttgg gattccattt 2400 ttaataaggc aataatatta ggtatgtgga tatactagaa gttctcctcg accgtcgata 2460 tgeggtqtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa 2520 cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca 2580 ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag 2640 tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg 2700 gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt 2760 tttggggtcg aggtgccgta aagcactaaa tcqgaaccct aaagggagcc cccgatttag 2820 agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc 2880 gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc 2940 gcttaatgcg ccgctacagg gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg 3000 ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaagg ggggatgtgc 3060 tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac 3120 ggccagtgaa ttgtaatacg actcactata gggcgaattg gagctccacc gcggtggcgg 3180 ccgctctaga actagtctcg agctcttcaa ctcaagacgc acagatatta taacatctgc 3240 ataataggca tttgcaagaa ttactcgtga gtaaggaaag agtgaggaac tatcgcatac 3300 ctgcatttaa agatgccgat ttgggcgcga atcctttatt ttggcttcac cctcatacta 3360 ttatcagggc cagaaaaagg aagtgtttcc ctccttcttg aattgatgtt accctcataa 3420 agcacgtggc ctcttatcga gaaagaaatt accgtcgctc gtgatttgtt tgcaaaaaga 3480 acaaaactga aaaaacccag acacgctcga cttcctgtct tcctattgat tgcagcttcc 3540 aatttcgtca cacaacaagg tcctagcgac ggctcacagg ttttgLaaca agcaatcgaa 3600 ggttctggaa tggcgggaaa gggtttagta ccacatgcta tgatgcccac tgtgatctcc 3660 agagcaaagt tcgttcgatc gtactgttac tctctctctt tcaaacagaa ttgtccgaat 3720 cgtgtgacaa caacagcctg ttctcacaca ctcttttctt ctaaccaagg gggtggttta 3780 gtttagtaga acctcgtgaa acttacattt acatatatat aaacttgcat aaattggtra 3840 atgcaagaaa tacatatttg gtcttttcta attcgtagtt tttcaagttc ttagatgctt 3900 tctttttctc tfttttacag atcatcaagg aagtaattat ctacttttta caacaaatat 3960 atctagactg cagaaaatgt ctgaattgaa cgagaagttg gctaccgctt gggaaggttt 4020 caccaagggt gactggcaaa acgaagtLaa cgttagagac ttcatccaaa agaactacac 4080 cccatacgaa ggtgacgaat ctttcttggc tggtgctacc gaagctacca ccaccttgtg 4140 ggacaaggtt atggaaggtg ttaagttgga aaacagaacc cacgctccag ttgacttcqa 4200 caccgctgtt gottctacca tcacctctca cgacgctggt tacatcaaca agcaattgga 4260 aaagatcgtt ggtttacaaa ccgaagctcc attgaagaga gctttgatcc cattcggtgg 4320 tatcaagatg atcgaaggtt cttgtaaggc ttacaacaga gaattggacc caatgatcaa 4380 gaagattttc accgaataca gaaagaccca caaccaaggt gttttcgacg tttacactcc 4440 agacatcttg agatgtagaa agtctggtgt tttgactggt ttgccagacg cttacggtag 4500 aggtagaatc atcggtgact acagaagagt tgctttgtac ggtatcgact acttgatgaa 4560 ggacaagttg gctcaattca cctctttgca agctgacttg gaaaacggtg ttaacttgga 4620 acaaaccatc agattgagag aagaaatcgc tgaacaacac agagctttgg gtcaaatgaa 4680 ggaaatggct gctaagtacg gttacgacat ctctggtcca gctaccaacg ctcaagaagc 4740 tatccaatgg acctacttcg gttacttggc tgctgttaag tctcaaaacg gtgctgctat 4800 gtctttcggt aggacctcta ccttcttgga cgtttacatc gaaagagact tgaaggctgg 4860 taagatcacc gaacaagaag ctcaagaaat ggttgaccac ttggttatga agttgagaat 4920 ggttagattc ttgagaaccc cagaatacga cgaattgttc tctggtgacc caatctgggc 4980 taccgaatct atcggtggta tgggtttgga cggtagaacc ttggttacca agaactcttt 5040 cagattcttg aacaccttat acaccatggg tccatctcca gaaccaaaca tgaccatctt 5100 gtggtctgaa aagttaccat tgaacttcaa gaagttcgct gctaaggttt ctatcgacac 5160 ctcttctttg caatacgaaa acgacgactt gatgagacca gacttcaaca acgacgacta 5220 cgctatcgct tgttgtgttt ctccaatgat cgttggtaag caaatgcaat tcttcggtgc 5280 tagagctaac ttggctaaga ccatgttgta cgctatcaac ggtggtgttg acgaaaagtt 5340 gaagatgcaa gttggtccaa agtctgaacc aatcaagggt gacgttttga actacgacga 5400 agttatggaa agaatggacc acttcatgga ctggttggct aagcaataca tcaccgcttt 5460 gaacatcatc cactacatgc acgacaagta ctcttacgaa gcatcattga tggctttgca 5520 cgacagagac gtaatcagaa ccatggcttg tggtatcgct ggtttgtctg ttgctgctga 5580 ctctttgtct gCtatCaagt acgctaaggt taagccaatc agagacgaag acggtttggc 5640 tatcgacttc gaaatcgaag gtgaataccc tcaattCggt aaCaaCgacC Caagagttga 5700 cgacttggct gttgacttgg ttgaaagatt tatgaagaag atccaaaagt tgcacaccta 5760 cagagacgct atcccaaccc aatctgtttt gactatcaca tctaacgttg tttacggtaa 5820 gaagactggt aacaccccag acggtagaag agCtggtgct CCattcggtc caggtgctaa 5880 cccaatgcac ggtagagacc aaaagggtgc tgtagcatct ttgacctctg ttgctaagtt 5940 gccattcgct tacgctaagg acggtatctc ttacaccttc tctatcgttc caaacgcttt 6000 gggtaaggac gatgaagtta gaaagaCcaa cttggctggt ttgatggacg gttacttcca 6060 ccacgaagca tctatcgaag gtggtcaaca cttgaacgta aatgttatga acagagaaat 6120 gttgttggac gctatggaaa acccagaaaa gtaCCCaCaa ttgaccatca gagtttctgg 6180 ttacgctgtt agattcaact ctttgaccaa ggaaCaaCaa caagacgtta tcaccagaac 6240 cttcacccaa tctatgtaag tcgagacaaa tCgCtcttaa atatatacct aaagaacatt 6300 aaagctatat tataagcaaa gatacgtaaa ttttgcttat attattatac acatatcata 6360 tttctatatt tttaagattt ggttatataa tgtacgtaat gcaaaggaaa taaattttat 6420 acattattga acagcgtCCa agtaactaca ttatgtgcac aaatagttta gcgtcgagaa 6460 gactttattg tgtcgcgaaa agtaaaaatt ttaaaaatta gagcaccttg aacttgCgaa 6540 aaaggttctc atcaactgtt taaaacgtac gtgtggaaga acgattacaa caggtgttgt 6600 cctctgagga cataaaatac acaccgagat tcatcaactc attgctggag ttagcatatc 6660 tacaattggg tgaaatgggg agcgatttgc aggcatttgc tcggcatgcc ggtagaggtg 6720 tggtcaataa gagcgacctc atgctatacc tgagaaagca acctgaccta caggaaagag 6780 ttactcaaga ataagaattt tcgttttaaa acctaagagt cactttaaaa tttqtataca 6840 cttatttttt ttataactta tttaataata aaaatcataa atcataagaa attcgcgcgc 6900 ttagaacata accttgtgac cgtattgttc caagataccc ttaactcttt ccatggtttc 6960 cttctttggt ggcttaacac cgtccaactt gtattcttca cccatagcaa cccacttgtg 7020 cttacccaat tcgtggtatg gcaaCaattc gatcttttca acgttaccca tgtctctggt 7080 gaactcaccc aatctgtgag cagagtcgtC gtcgtcagac caacctggaa caacaacgta 7140 tctgatccaa accttaacgt tcttgttagc caagtactta gcaaattcca aggttctgtg 7200 gttagaaaca ccaaccaagt tttggtggat ttcgtcgttc atttgcttca agtccaacat 7260 aaccaagtcg gtaacttcca acaattcgtc gataactggg tcgtatcttc taacgaaacc 7320 gttggtgtcc aaacaggtgt ggataccttc cttcttacaa gctatgaacc agtctctaac 7380 aaattcagct tgcaagatag cttcaccacc agaagcggta acaccacctc ctgaagcgtt 7440 cataaagtgt ctgtaggtaa caacttcctt catcaagtct tcaacagtaa cttccttacc 7500 accgtggqtg tcccaggtgt ctCtgttgtg acagtacaaa catctcatca aaCaaccttg 7560 gaagaaggtg atgaatctga tacctggacc gtcaacaqta ccacaagatt cgaaagagtg 7620 gattctaccg ataaCagaCa ttttaagctt ctgcagCtta gattagattg ctatgotttc 7680 tttctaatga gcaagaagta aaaaaagttg taatagaaca agaaaaatga aactgaaact 7740 tgagaaattg aagaccgttt attaacttaa atatcaatgg gaggtcatcg aaagagaaaa 7600 aaatcaaaaa aaaaaatttt caagaaaaag aaacgtgata aaaattttta ttgccttttt 7660 cgacgaagaa aaagaaacga ggCggtctct tttttctttt ccaaaccttt agtacgggta 7920 attaaCgaCa CCctagagga agaaagaggg gaaatttagt atgctgtgct tgggtgtttt 7980 gaagtggtac ggcgatgcgc ggagtccgag aaaatctgga agagtaaaaa aggagtagaa 8040 acattttgaa gctatggtgt gtgggaccgg tcgagggggg gcccggtacc cagcttttgt 8100 tcCCtttagt gagggttaat tCCgagCttg gcgtaatcat ggtcatagct gtttectgtg 8160 tgaaattgtt atccgctcac aattccacac aacataggag ccggaagcat aaagtgtaaa 8220 gcctggggtg cctaatgagt gaggtaactc acattaattg cgttgcgctc actgcccgct 8280 ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga 8340 ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc 8400 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 8460 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 8520 aaaaaggccg cgttgctggc gtttttccat aggctcggcc cccctgacga gcatcacaaa 8580 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttc 8640 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 8700 tccgcctttc tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc 8760 agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 8620 gaccgctgcg ccttatccgg taactatcgt crtgagtcca acccggtaag acacgaCtta 8880 tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct 8940 acagagttct tgaagtggtg gcctaactac qqctacacta qaaqqacagt atttgqtatc 9000 tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa 9060 caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa 9120 aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 9180 aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt 9240 ttaaattaaa aatqaaqttt taaatcaatc taaagtatat atgagtaaac ttggtctgac 9300 agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc 9360 atagttgcct gactgcccgt cgtgtagata actacgatac gggagggctt accatctggc 9420 cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata 9480 aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc 9540 cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc 9600 aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca 9660 ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgadaaaaa 9720 gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca 9780 ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt 9840 tctqtqactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt 9900 tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg 9960 ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga 10020 tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc 10080 agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg 10140 acacggaaat gttgaatact catactcttc ctttttcaat attattqaag catttatcag 10200 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 10260 gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg 10320 acattaacct ataaaaatag gcgtatcacg aggccctttc gtctcgcgcg tttcggtgat 10380 gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg 10440 gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc 10500 tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat cgactacgtc 10560 gtaaggccgt ttctgacaga gtaaaattct tgagggaact ttcaccatta tgggaaatgg 10620 ttcaagaagg tattgactta aactccatca aatggtcagg tcattgagtg ttttttattt 10680 gttgtatttt ttttttttta gagaaaatcc tccaatatca aattaggaat cgtagtttca 10740 tgattttctg ttacacctaa ctttttgtgt ggtgccctcc tccttgtcaa tattaatgtt 10800 aaagtgcadt tctttttcct tatcacgttg agccattagt atcaatttgc ttacctgtat 10860 tcctttacta tcctcctttt tctccttctt gataaatgta tgtagattgc gtatatagtt 10920 tcqtctaccc tatgaacata ttccattttg taatttcgtg tcgtttctat tatgaatttc 10980 atttataaag tttatgtaca cctaggatcc gtcgacactg gatggcggcg ttagtatcga 11040 atcgacagca gtatagcgac cagcattcac atacgattga cgcatgatat tactttctgc 11100 gcacttaact tcgcatctgg gcagatgatg tcgaggcgaa aaaaaatata aatcacgcta 11160 aca 11163 <210> 32 <211> 7830 <212> DNA
<213> Artificial Sequence <220>
<223> pRN619 <400> 32 aataccgcgc cacatagcag aactttaaaa gtgatcatca ttggaaaacg ttattagggg 60 cgaaaactct caaggatctt accgctattg agatccagtt cgatgtaacc cactcgtgca 120 cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 180 aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 240 ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata 300 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtq 360 ccacctgacg tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc 420 acgaggccct ttcgtctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag 480 ctccaggaga cggtcacagc ttgLcLgtaa gcggatgccg ggagcagaca agcccgtcag 540 ggcgcgtcag cgggtgttgg cgggtgtcgg ggctggctta actatgcggc atcagagcag 600 attgtactga gagtgcacca tatcgactac gtcgtaaggc cgtttctgac agagtaaaat 660 tcttgaggga actttcacca ttatgggaaa tggttcaaga aggtattgac ttaaactcca 720 tcaaatggtc aggtcattga gtgtttttta tttgttgtat tttttttttt ttagagaaaa 780 tcctccaata tcaaattagg aarcgtagtt tcatgatttt ctgttacacc taactttttg 840 tgtggtgccc tcctccttgt caatattaat gttaaagtgc aattcttttt ccttatcacg 900 ttgagccatt agtatcaatt tgcttacctg tattccttta ctatcctcct ttttctcctt 960 cttgataaat gtatgtagat tgcgtatata gtttcgtcta ccctatgaac atattccatt 1020 ttgtaatttc gtgtcgtttc tattatgaat ttcatttata aagtttatgt acacctagga 1080 tccgtcgaca ctggatggcg gcgttagtat cgaatcgaca gcagtatagc gaccagcatt 1140 cacatacgat tgacgcatga tattactttc tgcgcactta acttcgcatc tgggcagatg 1200 atgtcgaggc gaaaaaaaat ataaatcacg ctaacatttg attaaaatag aacaactaca 1260 atataaaaaa actatacaaa tgacaagttc ttgaaaacaa gaatcttttt attgtcagtg 1320 tatcagtact gctactaggc cacgaagtgc acgcagttgc cggccgggtc gcgcagggcg 1380 aactcccgcc cccacggctg ctcgccgatc tcggtcatgg caggccagga ggcgtcccgg 1440 aagttcgtgg acacgacctc cgaccactcg gcgtacagct cgtccaggcc gcgcacccac 1500 acccaggcca gggtgttgtc cggcaccacc tggtcctgga ccgcgctgat gaacagggtc 1560 acgtcgtccc ggaccacacc ggcgaagtcg tcctccacga agtaccggga gaacccgagc 1620 cggtaggtcc agaactcgac cgctccggcg acgtcgcgcg cggtgagcac cggaacggca 1680 ctggtcaact tggccatggt tgtttatgtt cggatgtgat gtgagaactg tatcctagca 1740 agattttaaa aggaagtata tgaaagaaga acctcagtgg caaatcctaa ccttttatat 1800 ttctctacag gggcgcggcg tggggacaat tcaacgcgtc tgtgagggga gcgtttccct 1860 gctcgcaggt ctgcagcgag gagccgtaat ttattgattcg cgccgtgcgg ccatcaaaat 1920 gtatggatgc aaatgattat acatggggat gtatgggcta aatgtacggg cgacagtcac 1980 atcatgcccc tgagctgcgc acgtcaagac tgtcaaggag ggtattctgg gcctccatgt 2040 cgctggccgg gtgacccggc ggggacgagg cattaagagg ccgcatgcta gctccggatt 2100 atcgatgata agctgtcaaa catgagaatt aattccacgg actatagact atacctagta 2160 tactccgtct actgtacgat acacttccgc tcaggtcctt gtcatttaac gaggccttac 2220 cactcttttg ttactctatt gatccagctc agcaaaggca gtgtgatcta agattctatc 2280 ttcgcgatgt agtaaaacta gctagaccga gaaagagact agaaatgcaa aaggcacttc 2340 tacaatggct gccatcatta ttatccgatg tgacgctgca gcttctcaat gatattcgaa 2400 tacgctttga ggagatacag cctaatatcc gacaaactgt tttacagatt tacgatcgta 2460 cttgttaccc atcattgaat tttgaacatc cgaacctggg agttttccct gaaacagata 2520 gtatatttga acctgtataa taatatatag tctagcgctt tacggaagac aatgtatgta 2580 tttcggttcc tggagaaact attacatcta ttgcataggt aatcttgcac gtcgcatccc 2640 cggttcattt tctgcgtttc catcttgcac ttcaatacca tatctttgtt aacgaagcat 2700 ctgtgcttca ttttgtagaa caaaaatgca acgcgagagc gctaattttt caaacaaaga 2760 atctgagctg catttttaca gaacagaaat gcaacgcgaa agcgctattt taccaacgaa 2620 gaatctgtgc ttcatttttg taaaacaaaa atgcaacgcg agagcgctaa tttttcaaac 2880 aaagaatctg agctgcattt ttacagaaca gaaatgcaac gcgagagcgc tattttacca 2940 acaaagaatc tatacttctt ttttgLtcta caaaaatgca tcccgagagc gctatttttc 3000 taacaaagca tcttagatta ctttttttct cctttgtgcg ctctataatg cagtctcttg 3060 ataacttttt gcactgtagg tccqttaagg ttagaagaag gctactttgg tgtctatttt 3120 ctcttccata aaaaaagcct gactccactt cccgcgttta ctgattacta gcgaagctgc 3180 gggtgcattt tttcaagata aaggcatccc cgattatatt ctataccgat gtggattgcg 3240 catactttgt gaacagaaag tgatagcgtt gatgattctt cattggtcag aaaattatga 3300 acggtttott ctattttgtc tctatatact acgtatagga aatgtttaca ttttcgtatt 3360 gttttcgatt cactctatga atagttctta ctacaatttt tttgtctaaa gagtaatact 3420 agagataaac ataaaaaatg tagaggtcga gtttagatgc aagttcaagg agcgaaaggt 3480 ggatgggtag gttatatagg gatatagcac agagatatat agcaaagaga LacLtttgag 3540 caatgtttgt ggaaagcggt attcgcaatg ccggcaaaag ggcgaattga ttttgaagag 3600 aatgtggatt ttgatgtaat tgttgggatt ccatttttaa taaggcaata atattaggta 3660 tgtggatata ctagaagttc tcctcgaccg tcgatatgcg gtgtgaaata ccgcacagat 3720 gcgtaaggag aaaataccgc atcaggaaat tgtaaacgtt aatattttgt taaaattcgc 3780 gttaaatttt tgttaaatca gctcattttt taaccaatag gccgaaatcg gcaaaatccc 3840 ttataaatca aaagaataga ccgagatagg gttgagtgtt gttccagttt ggaacaagag 3900 tccactatta aagaacgtgg actccaacgt caaagggcga aaaaccgtct atcagggcga 3960 tggcccacta cgtgaaccat caccctaatc aagttttttg gggtcgaggt gccgtaaagc 4020 actaaatcgg aaccctaaag ggagccgccg atttagagct tgacggggaa agccggcgaa 4080 cgtggcgaga aaggaaggga agaaagcgaa aggagcgggc gctagggcgc tggcaagtgt 4140 agoggtcacg ctgcgcgtaa ccaccacacc cgccgcgctt aatgcgccgc tacagggcgc 4200 qtcqcgccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatogg tgcgggcctc 4260 ttcgctatta cgccagctgg cgaagggggg atgtgctgca aggcgattaa gttgggtaac 4320 gccagggttt tcccagtcac gacgttgtaa aacgacggcc agtgaattgt aatacgactc 4380 actatagggc gaattggagc tccaccgcgg tggcggccgc tctagaacta gtggatcccc 4440 cgggctgcag gaattcgata tcaagcttat cgataccgtc gacctcgacc ggtcccacac 4500 accatagctt caaaatgttt ctactccttt tttactcttc cagattttct cggactccgc 4560 gcatcgccgt accacttcaa aacacccaag cacagcatac taaatttccc ctctttcttc 4620 ctctagggtg tcgttaatta cccgtactaa aggtttggaa aagaaaaaag agaccgcctc 4680 gtttcttttt cttcgtcgaa aaaggcaata aaaattttta tcacgtttct ttttcttgaa 4740 aatttttttt tttgattttt ttctctttcg atgacctccc attgatattt aagttaataa 4800 acggtcttca atttctcaag tttcagtttc atttttcttg ttctattaca acttttttta 4860 cttcttgctc attagaaaga aagcatagca atctaatcta agctgcagaa gcttaaaatg 4920 tctgttatcg gtagaatcca ctctttcgaa tcttgtggta ctgttgacgg tccaggtatc 4980 agattcatca ccttcttcca aggttgtttg atgagatgtt tgtactgtca caacagagac 5040 acctgggaca cccacggtgg taaggaagtt actgttgaag acttgatgaa ggaagttgtt 5100 acctacagac actttatgaa cgcttcagga ggtggtgtta ccgcttctgg tggtgaagct 5160 atcttgcaag ctgaatttgt tagagactgg ttcagagctt gtaagaagga aggtatccac 5220 acctgtttgg acaccaacgg tttcgttaga agatacgacc cagttatcga cgaattgttg 5280 gaagttaccg acttggttat gttggacttg aagcaaatga acgacgaaat ccaccaaaac 5340 ttggttggtg tttctaacca cagaaccttg gaatttgcta agtacttggc taacaagaac 5400 gttaaggttt ggatcagata cgttgttgtt ccaggttggt ctgacgacga cgactctgct 5460 cacagattgg gtgagttcac cagagacatg ggtaacgttg aaaagatcga attgttgcca 5520 taccacgaat tgggtaagca caagtgggtt gctatgggLg aagaatacaa gttggacggt 5580 gttaagccac caaagaagga aaccatggaa agagttaagg gtatcttgga acaatacggt 5640 cacaaggtta tgttctaagc gcgcgaattt cttatqattt atqattttta ttattaaata 5700 agttataaaa aaaataagtg tatacaaatt ttaaagtgac tcttaggttt taaaacgaaa 5760 attcttattc ttgagtaact ctttcctgta ggtcaggttg ctttctcagg tatagcatga 5820 ggtcgctctt attgaccaca cctctaccgg catgccgagc aaatgcctgc aaatcgctcc 5680 ccatttcacc caattgtaga tatgctaact ccagcaatga gttgatgaat ctcggtgtgt 5940 attttatgtc ctcagaggac aacacctgtt gtaatcgttc ttccacacgt acccagcttt 6000 tgttcccttt agtgagggtt aattccgagc ttggcgtaat catggtcata gctgtttccg 6060 gtgtgaaatt gttatccgct cacaattcca cacaacatag gagccggaag cataaagtgt 6120 aaagcctggg gtgcctaatg agtgaggtaa ctcacattaa ttgcgttgcg ctcactgccc 6180 gctttccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 6240 agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 6300 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 6360 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 6420 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcg gcccccctga cgagcatcac 6480 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 6540 ttcccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 6600 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat 6660 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 6720 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 6780 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 6840 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 6900 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 6960 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 7020 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 7080 gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 7140 cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 7200 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 7260 tccatagttg cctgactgcc cgtcgtgtag ataactacga tacgggaggg cttaccatct 7320 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 7380 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 7440 atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 7500 cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 7560 tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgaaaa 7620 aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 7680 tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 7740 ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 7800 agttgctctt gcccggcgtc aatacgggat 7830 <210> 33 <211> 9695 <212> DNA
<213> Artificial Sequence <220>
<223> pRN620 <400> 33 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcaqcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc 240 accattatgg gaaatggttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca 300 ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat 360 taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc 420 ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc 480 aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt 540 agattgcgta tatagtrtcg tctaccctat gaacatattc cattttgtaa tttcqtgtcq 600 tttctattat gaatttcatt tataaagttt atgtacacct aggatccgtc gacactggat 660 ggcggcgtta gtatcgaatc gacaqcagta tagcgaccag cattcacata cgattgacgc 720 atgatattac tttctgcgca cttaacttcg catctgggca gatgatgtcg aggcgaaaaa 780 aaatataaat cacgctaaca tttgattaaa atagaacaac tacaatataa aaaaactata 840 caaatgacaa gttcttgaaa acaagaatct ttttattgtc agtgtgtcag tcctgctcct 900 cggccacgaa gtgcacgcag ttgccggccg ggtcgcgcag ggcgaactcc cgcccccacg 960 gctgctcgcc gatctcggtc atggccggcc cggaggcgtc ccggaagttc gtggacacga 1020 cctccgacca ctcggcgtac agctcgtcca ggccgcgcac ccacacccag gccagggtgt 1080 tgtccggcac cacctggtcc tggaccgcgc tgatgaacag ggtcacgtcg tcccggacca 1140 caccggcgaa gtcgtcctcc acgaagtccc gggagaaccc gagccggtcg gtccagaact 1200 cgaccgctcc ggcgacgtcg cgcgcggtga gcaccggaac ggcactggtc aacttggcca 1260 tggttgttta tgttcggatg tgatgtgaga actgtatcct agcaagattt taaaaggaag 1320 tatatgaaag aagaacctca gtggcaaatc ctaacctttt atatttctct acaggggcgc 1380 ggcgtgggga caattcaacg cgtctgtgag gggagcgttt ccctqctcgc aggtctgcag 1440 cgaggagccg taatttttgc ttcgcgccgt gcggccatca aaatgtatgg atgcaaatga 1500 ttatacatgg ggatgtatgg gctaaatgta cgggcgacag tcacatcatg cccctgagct 1560 gcgcacgtca agactgtcaa ggagggtatt ctgggcctcc atgtcgctgg ccgggtgacc 1620 cggcggggac gaggccttaa gcggccgcat gctagctccg gattatcgat gataagctgt 1680 caaacatgag aattaattcc acggactata gactatacct agtatactcc gtctactgta 1740 cgatacactt ccgctcaggt ccttgtcctt taacgaggcc ttaccactct tttgttactc 1800 tattgatcca gctcagcaaa ggcagtgtga tataagattc tatcttcgcg atgtagtaaa 1860 actagctaga ccgagaaaga gactagaaat gcaaaaggca cttctacaat ggctqccatc 1920 attattatcc gatgtgacgc tgcagcttct caatgatatt cgaatacgct ttgaggagat 1980 acagcctaat atccgacaaa ctgttttaca gatttacgat cgtacttgtt acccatcatt 2040 gaattttgaa catccgaacc tgggagtttt ccctgaaaca gatagtatat ttgaacctgt 2100 ataataatat atagtctagc gctttacgga agacaatgta tgtatttcgg ttcctggaga 2160 aactattgca tctattgcat aggtaatctt gcacgtcgca tcccoggttc attttctgcg 2220 tttccatctt gcacttcaat agcatatctt tgttaacgaa gcatctgtgc ttcattttgt 2280 agaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca aagaatctga gctgcatttt 2340 tacagaacag aaatgcaacg cgaaagcgct attttaccaa cgaagaatct gtgcttcatt 2400 tttgtaaaac aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc 2460 atttttacag aacagaaatg caacgcgaga gcgctatttt accaacaaag aatctatact 2520 tcttttt'tgt tctacaaaaa tgcatcccga gagcgctatt tttctaacaa agcatcttag 2580 attacttttt ttctoctttg tgcgctctat aatgcagtct cttgataact ttttgcactg 2640 taggtccgtt aaggttagaa gaaggctact ttggtgtcta ttatt_ctcttc cataaaaaaa 2700 gcctgactcc acttcccgcg tttactgatt actagcgaag ctgcgggtgc attttttcaa 2760 gataaaggca tccccgatta tattctatac cgatgtggat tgcgcatact ttgtgaacag 2820 aaagtgatag cgttgatgat tcttcattqg tcagaaaatt atgaacggtt tcttctattt 2880 tgtctctata tactacgtat aggaaatgtt tacattttcg tattgttttc gattcactct 2940 atgaatagtt cttactacaa tttttUgLc taaagagtaa tactagdgat daacataaaa 3000 aatgtagagg tcgagtttag atgcaagttc aaggagcgaa aggtggatgg gtaggttata 3060 tagggatata gcacagagat atatagcaaa gagatacttt tgagcaatqt ttgtggaaag 3120 cggtattcgc aatgccggca aaagggcgaa ttgattttga agagaatgtg gattttgatg 3180 taattgttgg gattccattt ttaataaggc aataatatta ggtatgtgga tatactagaa 3240 gttctcctcg accgtcgata tgcggtgtga aataccgcac agatgcgtaa ggagaaaata 3300 ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa 3360 atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa 3420 tagaccgaga tagggtzgag tgttgttcca gtttggaaca agagtccact attaaagaac 3480 gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa 3540 ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct 3600 aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa 3660 gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc 3720 gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtcgcg ccattcgcca 3780 ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag 3840 ctggcgaagg ggggatgtgc tgcaaggcga ttaagttggg taacgccagg gttttcccag 3900 tcacgacgtt gtaaaacgac ggccagtgaa ttgtaatacg actcactata gggcgaattg 3960 gagctccacc gcggtggcgg ccgctctaga actagtggat cccccgggct gcaggaattc 4020 gatatcaagc ttatcgatac cgtcgacctc gagctcttca actcaagacg cacagatatt 4080 ataacatctg cataataggc atttgcaaga attactcgtg agtaaggaaa gagtgaggaa 4140 ctatcgcata cctgcattta aagatgccga tttgggcgcg aatcctttat tttggcttca 4200 ccctcatact attatcaggg ccagaaaaag gaagtgtttc cctccttctt gaattgatgt 4260 taccctcata aagcacgtgg cctcttatcg agaaagaaat taccgtcgct cgtgatttgt 4320 ttgcaaaaag aacaaaactg aaaaaaccca gacacgctcg acttcctgtc ttcctattga 4380 ttgcagcttc caatttcgtc acacaacaag gtcctagcga cggctcacag gttttgtaac 4440 aagcaatcga aggttctgga atggcgggaa agggtttagt accacatgct atgatgccca 4500 ctgtgatctc cagagcaaag ttcgttcgat cgtactgtta ctctctctct ttcaaacaga 4560 attgtccgaa tcgtgtgaca acaacagcct gttctcacac actotttLct. tctaaccaag 4620 ggggtggttt agtttagtag aacctcgtga aacttacatt tacatatata taaacttgca 4680 taaattggtc aatgcaagaa atacatattt ggtottttct aattcgtagt ttttcaagtt 4740 cttagatgct ttctttttct cttttttaca gatcatcaag gaagtaatta tctacttttt 4800 acaacaaata tatctagact gcagaaaatg tctgaattga acgagaagtt ggctaccgct 4660 tgggaaggtt tcaccaaggg tgactggcaa aacgaagtta acgttagaga cttcatccaa 4920 aagaactaca ccccatacga aggtgacgaa tatttottgg ctggtgctac cgaagctacc 4980 accaccttgt gggacaaggt tatggaaggt gttaagttgg aaaacagaac ccacgctcca 5040 gttgacttcg acaccgctgt tgcttctacc atcacctctc acgacgctgg ttacatcaac 5100 aagcaattgg aaaagatcgt tggtttacaa accgaagctc cattgaagag agctttgatc 5160 ccattcggtg gratcaagat gatcgaaggt tcttgtaagg cttacaacag agaattggac 5220 ccaatgatca agaagatttt caccgaatac agaaagaccc acaaccaagg tgttttcgac 5280 gtttacactc cagacatctt gagatgtaga aagtctggtg ttttgactgg tttgccagac 5340 gcttacggta gaggtagaat catcggtgac tacagaagag ttgctttgta cggtatcgac 5400 tacttgatga aggacaagtt ggctcaattc acctctttgc aagctgactt ggaaaacggt 5460 gttaacttgg aacaaaccat cagattgaga gaagaaatcg ctgaacaaca cagagctttg 5520 ggtcaaatga aggaaatggc tgctaagtac ggttacgaca tctctggtcc agctaccaac 5580 gctcaagaag ctatccaatg gacctacttc ggttacttgg ctgctgttaa gtctcaaaac 5640 ggtgctgcta tgtctttcgg taggacctct accttcttgg acgtttacat cgaaagagac 5700 ttgaaggctg gtaagatcac cgaacaagaa gctcaagaaa tggttgacca cttggttatg 5760 aagttgagaa tggttagatt cttgagaacc ccagaatacg acgaattgtt ctctggtgac 5820 ccaatctggg ctaccgaatc tatcggtggt atgggtttgg acggtagaac cttggttacc 5880 aagaactctt tcagattctt gaacacctta tacaccatgq gtccatctcc agaaccaaac 5940 atgaccatct tgtggtctga aaagttacca ttgaacttca agaagttcgc tgctaaggtt 6000 tctatcgaca cctcttcttt gcaatacgaa aacgacgact tgatgagacc agacttcaac 6060 aacgacgact acgctatcgc ttgttgtgtt tctccaatga tcgttggtaa gcaaatgcaa 6120 ttattcggtg ctagagctaa cttggctaag accatgttgt acgctatcaa cggtggtgtt 6180 gacgaaaagt tgaagatgca agttggtcca aagtctgaac caatcaaggg tgacgttttg 6240 aactacgacg aagttatgga aagaatggac cacttcatgg actggttggc taagcaatac 6300 atcaccgctt tgaacatcat ccactacatg cacgacaagt actcttacga agcatcattg 6360 atggctttgc acgacagaga cgtaatcaga accatggctt gtggtatcgc tggtttgtct 6420 gttgctgctg actctttgtc tgctatcaag tacgctaagg ttaagccaat cagagacgaa 6480 gacggtttgg ctatcgactt cgaaatcgaa ggtgaatacc ctcaattcgg taacaacgac 6540 ccaagagttg acgacttggc tgttgacttg gttgaaagat ttatgaagaa gatccaaaag 6600 ttgcacacct acagagacgc tatcccaacc caatctgttt tgactatcac atctaacgtt 6660 gtttacggta agaagactgg taacacccca gacggtagaa gagctggtgc tccattcggt 6720 ccaggtgcta acccaatgca cggtagagac caaaagggtg ctgtagcatc tttgacctct 6780 gttgctaagt tgccattcgc ttacgctaag gacggtatct cttacacctt ctctatcgtt 6840 ccaaacgctt tgggtaagga cgatgaagtt agaaagacca acttggctgg tttgatggac 6900 ggttacttcc accacgaagc atctatcgaa ggtggtcaac acttgaacgt aaatgttatg 6960 aacagagaaa tgttgttgga cgctatggaa aacccagaaa agtacccaca attgaccatc 7020 agagtttctg gttacgctgt tagattcaac tctttgacca aggaacaaca acaagacgtt 7080 atcaccagaa ccttcaccca atctatgtaa gtcgagacaa atcgctctta aatatatacc 7140 taaagaacat taaagctata ttataagcaa agatacgtaa attttgctta taLtattata 7200 cacatatcat atttctatat ttttaagatt tggttatata atgtacgtaa tgcaaaggaa 7260 ataaatttta tacattatta aacagcgtcc aagtaactac attatgtqca ctaatagttt 7320 agcgtcgtga agactttatt gtgtcgcgaa aagtaaaaat tttaaaaatt agagcacctt 7380 gaacttgcga aaaaggttct catcaactgt ttaaaacgta cccagctttt gttcccttta 7440 gtgagggtta attccgagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg 7500 ttatccgctc acaattccac acaacatagg agccggaagc ataaagtgta aagcctgggg 7560 tgcctaatga gtgaggtaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc 7620 gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt 7680 gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct 7740 gaggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga 7800 taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc 7860 cgcgttgctg gcgtrtttcc ataggctcgg cccccctgac gagcatcaca aaaatcgacg 7920 ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt tcccccctgg 7980 aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 8040 tctcccttcg ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc tcagttcggt 8100 gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg 8160 cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 8220 ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 8280 cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct 8340 gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 8400 cgctggtagc ggtgqttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 8460 tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg 8520 ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta 8580 aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca 8640 atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc 8700 ctgactgccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc 8760 tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc 8820 agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat 8880 taattgttgc cgggaagcta gagtaagtag ttcgccagtr aatagtttgc gcaacgttgt 8940 tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc 9000 cggttcccaa cgatcaaggc gagttacatg atcccccatq ttqtqaaaaa aagcggttag 9060 ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt 9120 tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac 9180 tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg 9240 cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat 9300 tggaaaacgt tcttoggggc gaaaactctc aaggatctta ccgctqttga gatccagttc 9360 gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc 9420 tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa 9480 atgttgaata ctcatactct tcctttttca atattattga agcatttatc agggttattg 9540 tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg 9600 cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc attattatca tgacattaac 9660 ctataaaaat aggcgtatca cgaggccctt tcgtc 9695 <210> 34 <211> 14159 <212> DNA
<213> Artificial Sequence <220>
<223> pRN618 <400> 34 tggtatacca acaattcttg aagaagaaga ttccattgaa actgcttcgc taggtgcgac 60 gacgactgat tctattqqqt tatccgacac atcatcagaa gattcgcatt atggtaatgc 120 taagaaggta acatgaggat ccccttttcc tttgtcgata tcatgtaatt agttatgtca 180 cgcttacatt cacgccctcc tcccacatcc gctctaaccg aaaaggaagg agttagacaa 240 cctgaagtct aggtccctat ttattttttt taatagttat gttagtatta agaacgttat 300 ttatatttca aatttttctt ttttttctgt acaaacqcgt gtacgcatqt aacattatac 360 tgaaaacctt gcttgagaag gttttgggac gctcgaaggc ttcctaggct cgacactgga 420 tggcggcgtt agtatcgaat cgacagcagt atagcgacca gcattcacat acgattgacg 480 catgatatta ctttctgcgc acttaacttc gcatctgggc agatgatgtc gaggcgaaaa 540 aaaatataaa tcacgctaac atttgattaa aatagaacaa ctacaatata aaaaaactat 600 acaaatgaca agttcttgaa aacaagaatc tttttattgt cagtgtgtca gtcctgctcc 660 tcggccacga agtgcacgca qttgccqgcc gqgtcqcgca gggcgaactc ccgcccccac 720 ggctgctcgc cgatctcggt catggccggc ccggaggcgt cccggaagtt cgtggacacg 780 acctccgacc actcggcgta cagctcgtcc aggccgcgca cccacaccca ggccagggtg 840 ttgtccggca ccacctggtc ctggaccgcg ctgatgaaca gggtcacgtc gtcccggacc 900 acaccggcga agtcgtcctc cacgaagtcc cgggagaacc cgagccggtc ggtccagaac 960 tcgaccgctc cggcgacgtc gcgcgaggtg agcaccggaa cggcactggt caacttggcc 1020 atggttgttt atgttcggat gtgatgtgag aactgtatcc tagcaagatt ttaaaaggaa 1080 gtatatgaaa gaagaacctc agtggcaaat cctaaccttt tatatttctc tacaggggcg 1140 cggcgtgggg acaattcaac gcgtctgtga ggggagcgtt tccctgctcg caggtctgca 1200 gcgaggagcc gtaatttttg cttcgcgccg tgcggccatc aaaatgtatg gatgcaaatg 1260 attatacatg gggatgtatg ggctaaatat acgggcgaca gtcacatcat gcccctgagc 1320 tgcgcacgtc aagactgtca aggagggtat tctgggcctc catgtcgctg gccgggtgac 1380 ccggcgggga cgaggcctta agcggccgca tgctagctcc ggattatcga tgataagctg 1440 tcaaacatga gaattaattc cacggactat agactatacc tagtatactc egt=actgt 1500 acgatacact tccgctcagg tcattgtoct ttaacgaggc cttaccactc ttttgttact 1560 ctattgatcc agctcagcaa aggcagtgtg atctaagatt ctatcttcgc gatgtagtaa 1620 aactagctag accgagaaag agactagaaa tgcaaaaggc acttctacaa tggctgccat 1680 cattattatc cgatgtgacg ctgcagcttc tcaatgarat tcgaatacgc tttgaggaga 1740 tacagcctaa tatccgacaa actgttttac agatttacga tcgtacttgt tacccatcat 1600 tgaattttga acatccgaac ctgggagttt tccctgaaac agatagtata tttgaacctg 1660 tataataata tatagtctag cgotttacgg aagacaatgt atqtatttcg gttcctggag 1920 aaactattgc atctattgca taggtaatct tgcacgtcgc atccccggtt cattttctgc 1980 gtttccatct tgcacttcaa tagcatatct ttgttaacga agcatctgtg cttcattttg 2040 tagaacaaaa atgcaacgcg agagcgctaa tttttcaaac aaagaatctg agctgcattt 2100 ttacagaaca gaaatgcaac gcgaaagcgc tattttacca acgaagaatc tgtgcttcat 2160 ttttqtaaaa caaaaatgca acgcgagagc gctaattttt caaacaaaga atctgagctg 2220 catttttaca gaacagaaat gcaacgcgag agcgctattt taccaacaaa gaatctatac 2280 ttcttttttg ttctacaaaa atgcatcccg agagcgctat ttttctaaca aagcatctta 2340 gattactttt tttctccttt gtgcgctcta taatgcagtc tcttgataac tttttgcact 2400 gtaggtccgt taaggttaga agaaggctac tttggtgtct attttctctt ccataaaaaa 2460 agcctgactc cacttcccgc qtttactgat tactagcgaa gctgcgggtg cattttttca 2520 agataaaggc atccccgatt atattctata ccgatgtgga ttgcgcatac tttgtgaaca 2580 gaaagtgata gcgttgatga ttcttcattg gtcagaaaat tatgaacggt ttcttctatt 2640 ttgtctctat atactacgta Laggaaatgt ttacattttc gtattgtttt cgattcactc 2700 tatgaatagt tcttactaca atttttttgt ctaaagagta atactagaga taaacataaa 2760 aaatgtagag gtcgagttta gatgcaagtt caaggagcga aaggtggatg ggtaggttat 2820 atagggatat agcacagaga tatatagcaa agagatactt ttgagcaatg tttgtggaaa 2880 gcggtattcg caatgccggc aaaagggcga attgattttg aagagaatgt ggattttgat 2940 gtaattgttg ggattccatt tttaataagg caataatatt aggtatgtgg atatactaga 3000 agttctcctc gaccgtcgat atgcggtgtg aaataccgca cagatgcgta aggagaaaat 3060 accgcatcag gaaattgtaa acgttaatat tttgttaaaa ttcgcgttaa atttttgtta 3120 aatcagctca ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga 3180 atagaccgag atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa 3240 cgtggactcc aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga 3300 accatcaccc taatcaagtt ttttggggtc gaggtgccgt aaagcactaa atcggaaccc 3360 taaagggagc ccccgattta gagattgagg gggaaagccg gcgaacgtgg cgagaaagga 3420 agggaagaaa gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg 3480 cgtaaccacc acacccgccg cgcttaatgc gccgctacag ggcgcgtcgc gccattcgcc 3540 attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc tattacgcca 3600 gctggcgaag gggggatgtg ctgcaaggcg attaagttgg gtaacgccag ggttttccca 3660 gtcacgacgt tgtaaaacga cggccagtga attgtaatac gactcactat agggcgaatt 3720 ggagctccac cgcggtggcg gccgctctag aactagtctc gagctcttca actcaagacg 3780 cacagatatt ataacatctg cataataggc atttgcaaga attactcgtg agtaaggaaa 3840 gagtgaggaa ctatcgcata cctgcattta aagatgccga tttgggcgcg aatcctttat 3900 tttggcttca ccctcatact attatcaggg ccagaaaaag gaagtgtttc cctccttctt 3960 gaattgatgt taccctcata aagcacgtgg cctcttatcg agaaagaaat taccgtcgct 4020 cgtgatttgt ttgcaaaaag aacaaaactg aaaaaaccca gacacgctcg acttcctgtc 4080 ttcctattga ttgcagcttc caatttcgtc acacaacaag gtcctagcga cggctcacag 4140 gttttgtaac aagcaatcga aggttctgga atggcgggaa agggtttagt accacatgct 4200 atgatgccca ctgtgatctc cagagcaaag ttcgttcgat cgtactgtta ctctctctct 4260 ttcaaacaga attgtccgaa tcgtgtgaca acaacagcct gttctcacac actcttttct 4320 tctaaccaag ggggtggttt agtttagtag aacctcgtga aacttacatt tacatatata 4380 taaacttgca taaattggtc aatgcaagaa atacatattt ggtottttct aattcgtagt 4440 ttttcaagtt cttagatgct ttctttttct cttttttaca gatcatcaag gaagtaatta 4500 tctacttttt acaacaaata tatctagact gcagaaaatg tctgaattga acgagaagtt 4560 ggctaccgct tgggaaggtt tcaccaaggg tgactggcaa aacgaagtta acgttagaga 4620 cttcatccaa aagaactaca ccccatacga aggtaacgaa tctttcttgg ctggtgctac 4680 cgaagctacc accaccttgt gggacaaggt tatggaaggt gttaagttgg aaaacagaac 4740 ccacgctcca gttgacttcg acaccgctgt tgcttctacc atcacctctc acgacgctgg 4800 ttacatcaac aagcaattgg aaaagatcgt tggtttacaa accgaagctc cattgaagag 4860 agctttgatc ccattcggtg gtatcaagat gatcgaaggt tcttgtaagg cttacaacag 4920 agaattggac ccaatgatca agaagatttt caccgaatac agaaagaccc acaaccaagg 4980 tgttttcgac gtttacactc cagacatctt gagatgtaga aagtctggtg ttttgactgg 5040 tttgccagac gcttacggta gaggtagaat catcggtgac tacagaagag ttgctttgta 5100 cggtatcgac tacttgatga aggacaagtt ggctcaattc acctctttgc aagctgactt 5160 ggaaaacggt gttaacttgg aacaaaccat cagattgaga gaagaaatcg ctgaacaaca 5220 cagagctttg ggtcaaatga aggaaatggc tgctaagtac ggttacgaca tctctggtcc 5280 agctaccaac gctcaagaag ctatccaatg gacctacttc ggttacttgg ctgctgttaa 5340 gtctcaaaac ggtgctgcta tgtctttcgg taggacctct accttcttgg acgtttacat 5400 cgaaagagac ttgaaggctg gtaagatcac cgaacaagaa gctcaagaaa tggttgacca 5460 cttggttatg aagttgagaa tggttagatt cttgagaacc ccagaatacg acgaattgtt 5520 ctctggtgac ccaatctggg ctaccgaatc tatcggtggt atgggtttgg acggtagaac 5580 cttggttacc aagaactctt tcagattctt gaacacctta tacaccatgg qtccatctcc 5640 agaaccaaac atgaccatct tgtggtctga aaagttacca ttgaacttca agaagttcgc 5700 tgctaaggtt tctatcgaca cctcttcttt gcaatacgaa aacgacgact tgatgagacc 5760 agacttcaac aacgacgact acgctatcgc ttgttgtgtt tctccaatga tcgttggtaa 5820 gcaaatgcaa ttcttcggtg ctagagctaa cttggctaag accatgttgt acgctatcaa 5880 cggtggtgtt gacgaaaagt tgaagatgca agttggtcca aagtctgaac caatcaaggg 5940 tgacgttztg aactacgacg aagttatgga aagaatggac cacttcatgg actggttggc 6000 taagcaatac atcaccgctt tgaacatcat ccactacatg cacgacaagt actcttacga 6060 agcatcattg atggctttgc acgacagaga cgtaatcaga accatggctt gtggtatcgc 6120 tggtttgtct gttgctgctg actctttgtc tqctatcaag tacgctaagg ttaagccaat 6180 cagagacgaa gacggtttgg ctatcgactt cgaaatcgaa ggtgaatacc ctcaattcgg 6240 taacaacgac ccaagagttg acgacttggc tgttgacttg gttgaaagat ttatgaagaa 6300 gatccaaaag ttgcacacct acagagacgc tatcccaacc caatctgttt tgactatcac 6360 atctaacgtt gtttacggta agaagactgg taacacccca gacggtagaa gagctggtgc 6420 tccattcggt ccaggtgcta acccaatgca cggtagagac caaaagggtg ctgtagcatc 6480 tttgacctct gttgctaagt tgccattcgc ttacgctaag gacggtatct cttacacctt 6540 ctctatcgtt ccaaacgctt tgggtaagga cgatgaagtt agaaagacca acttggctgg 6600 tttgatggac ggttacttcc accacgaagc atctatcgaa ggtggtcaac acttgaacgt 6660 aaatgttatg aacagagaaa tgttgttgga cgctatggaa aacccagaaa agtacccaca 6720 attgaccatc agagtttctg gttacgctgt tagattcaac tctttgacca aggaacaaca 6780 acaagacgtt atcaccagaa ccttcaccca atctatgtaa gtcgagacaa atcgctctta 6840 aatatatacc taaagaacat taaagctata ttataagcaa agatacgtaa attttgctta 6900 tattattata cacatatcat atttctatat ttttaagatt tggttatata atgtacgtaa 6960 tgcaaaggaa ataaatttta tacattattg aacagcgtcc aagtaactac attatgtgca 7020 ctaatagttt agcgtcgtga agactttatt gtgtcgcgaa aagtaaaaat tttaaaaatt 7080 agagcacctt gaacttgcga aaaaggttct catcaactgt ttaaaacgta cgtgtggaag 7140 aacgattaca acaggtqttg tcctctgagg acataaaata cacaccgaga ttcatcaact 7200 cattgctgga gttagcatat ctacaattgg gtgaaatggg gagcgatttg caggcatttg 7260 ctcggcatgc cggtagaggt gtggtcaata agagcgacct catgctatac ctgagaaagc 7320 aacctgacct acaggaaaga gttactcaag aataagaatt ttcgttttaa aacctaagag 7380 tcactttaaa atttgtatac acttattttt tttataactt atttaataat aaaaatcata 7440 aatcataaga aatLcgcgcg cttagaacat aaccttgtga ccgtattgtt ccaagatacc 7500 cttaactctt tccatggttt ccttctttgg tggcttaaca ccgtccaact tgtattcttc 7560 acccatagca acccacttgt gcttacccaa ttcgtggtat ggcaacaatt cgatcttttc 7620 aacgttaccc atgtctctgg tgaactcacc caatctgtga gcagagtcgt cgtcgtcaga 7680 ccaacctgga acaacaacgt atctgatcca aaccttaacg ttcttgttag ccaagtactt 7740 agcaaattcc aaggttctgt ggttagaaac accaaccaag ttttggtgga tttcqtcgtt 7800 catttgcttc aagtccaaca taaccaagtc ggtaacttcc aacaattcgt cgataactgg 7860 gtcgtatctt ctaacgaaac cgttggtgtc caaacaggtg tggatacctt ccttcttaca 7920 agctctgaac cagtctctaa caaattcagc ttgcaagata gcttcaccac cagaagcggt 7980 aacaccacct cctgaagcgt tcataaagtg tctgtaggta acaacttcct tcatcaagtc 8040 ttcaacagta acttccttac caccgtgggt gtoccaggtg totctgttgt gacagtacaa 8100 acatctcatc aaacaacctt ggaagaaggt gatgaatctg atacctggac cgtcaacagt 8160 accacaagat tcgaaagagt ggattctacc gataacagac attttaagct tctgcagctt 8220 agattagritt gctatgcttt ctttctaatg agcaagaagt aaaaaaagtt gtaatagaac 8280 aagaaaaatg aaactgaaac ttgagaaatt gaagaccgtt tattaactta aatatcaatg 8340 ggaggtcatc gaaagagaaa aaaatcaaaa aaaaaaattt tcaagaaaaa gaaacgtgat 8400 aaaaattttt attgcctttt tcgacgaaga aaaagaaacg aggcggtctc ttttttcttt 8460 tccaaacctt tagtacgggt aattaacgac accctagagg aagaaagagg ggaaatttag 8520 tatgctgtgc ttgggtgttt tgaagtggta cggcgatgcg cggagtccga gaaaatctgg 8580 aagagtaaaa aaggagtaga aacattttga agctatggtg tgtgggaccg gtcgaggggg 8640 ggcccggtac ccagcttttg ttccctttag tgagggttaa ttccgagctt ggcgtaatca 8700 tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga 8760 gccggaagca taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt 8820 gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 8880 atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 8940 actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 9000 gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 9060 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctcggc 9120 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 9180 ctataaagat accaggcgtt cccccctgga agctccctcg tgcgctctcc tgttccgacc 9240 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa 9300 tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct qqgctgtgtg 9360 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 9420 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 9480 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 9540 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 9600 ggtagctctt gatccggcaa acaaaccacc gctggtagcg qtggtttttt tgtttgcaag 9660 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatott ttctacgggg 9720 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 9780 aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat cLaaagtata 9840 tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 9900 atctgtctat ttcgttcatc catagttgcc tgactgcccg tcgtgtagat aactacgata 9960 cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 10020 gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 10080 gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 10140 tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 10200 tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 10260 tcccccatgt tgtgaaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 10320 aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 10380 atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 10440 tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 10500 catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 10560 aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 10620 tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 10680 gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 10740 tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 10800 tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc 10860 taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccrtt 10920 cgtctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct cccggagacg 10980 gtcacagctt gtctgtaagc ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg 11040 ggtgttggcg ggtgtcgggg ctggcttaac tatgcggcat cagagcagat tgtactgaga 11100 gtqcaccata tcgactacgt cgtaaggccg tttctgacag agtaaaattc ttgagggaac 11160 tttcaccatt atgggaaatg gttcaagaag gtattgactt aaactccatc aaatggtcag 11220 gtcattgagt gttttttatt tgttgtattt tttttttttt agagaaaatc ctccaatatc 11280 aaattaggaa tcgLagtttc atgattttct gttacaccta actttttgtg tggtgccctc 11340 ctccttgtca atattaatgt taaagtgcaa ttctttttcc ttatcacgtt gagccattaq 11400 tatcaatttg cttacctgta ttcctttact atcctccttt ttctccttct tgataaatgt 11460 atgtagattg cgtatatagt ttcgtctacc ctatgaacat attccatttt gtaatttcgt 11520 gtcgtttcta ttatgaattt catttataaa gtttatgtac gaattctatc cttttgttgt 11580 ttccgggtgt acaatatgga cttcctcttt tctggcaacc aaacccatac atcgggattc 11640 ctataatacc ttcgttggtc tccctaacat gtaggtggcg gaggggagat atacaataga 11700 acagatacca gacaagacat aatgggctaa acaagactac accaattaca ctgcctcatt 11760 gatggtggta cataacgaac taatactgta gccctagact tgatagccat catcatatcg 11820 aagtttcact accctttttc catttgccat ctattgaagt aataataggc gcatgcaact 11880 tcttttcttt ttttttcttt tctctctccc ccgttgttgt ctcaccatat ccgcaatgac 11940 aaaaaaatga tggaagacac taaaggaaaa aattaacgac aaagacagca ccaacagatg 12000 tcgttqttcc agagctgatg aqqqqtatct cgaagcacac gaaacttttt ccttccttca 12060 ttcacgcaca ctactctcta atgagcaacg gtatacggcc ttccttccag ttacttgaat 12120 ttgaaataaa aaaagtttgc tgtcttgcta tcaagtataa atagacctgc aattattaat 12180 cttttgtttc ctcgtcattg ttctcgttcc ctttcttcct tgtttctttt tctgcacaat 12240 atttcaagct ataccaagca tacaatcaac tccagctgca ttaaaatgag taatcctcaa 12300 aaagctctaa acgactttct gtccagtgaa tctgttcata cacatgatag ttctaggaaa 12360 caatctaata agcagtcatc cgacgaagga cgctattcat cacaaccttc acatcatcac 12420 tctggtggta ctaacaacaa taataacaat aataataata ataataacag taacaacaac 12480 aacaacggca acgatggggg aaatgatgac gactatgatt atgaaatgca agattataga 12540 ccttctccgc aaagtgcgcg gcctactccc acgtatgttc cacaatattc tgtagaaagt 12600 gggactgctt tcccgattca agaggttatt cctagcgcat acattaacac acaaqatata 12660 aaccataaag ataacggtcc gccgagtgca agcagtaata gagcattcag gcctagaggg 12720 cagaccacag tgtcggccaa cgtgcttaac attgaagatt tttacaaaaa tgcagacgat 12780 gcgcatacca tcccggagtc acatt_Latcg agaaggagaa gtaggtcgag ggctacgagt 12840 aatgctgggc acagtgccaa tacaggcgcc acgaatggca ggactactgg tgcccaaact 12900 aatatggaaa gcaatgaatc accacgtaac gtccccatta tggtgaagcc aaagacatta 12960 taccagaacc ctcaaacacc tacagtcttg ccctccacat accatccaat taataaatgg 13020 tcttccgtca aaaacactta tttgaaggaa tttttagccg agtttatggg aacaatggtt 13080 atgattattt tcggtagtgc tgttgtttgt caggtcaatg ttgctgggaa aatacagcag 13140 gacaatttca acgtggcttt ggataacctt aacgttaccg ggtcttctgc agaaacgata 13200 gacgctatga agagtttaac atccttggtt tcatccgttg cgggcggtac ctttgatgat 13260 gtggcattgg gctgggctgc tgccgtggtg atgggctatt tctgcgctgg tggtagtgcc 13320 atctcaggtg ctcatttgaa tccgtctatt acattagcca atttggtgta tagaggtttt 13380 cccctgaaga aagttcctta ttactttgct ggacaattga tcggtgcctt cacaggcgct 13440 ttgatcttqt ttatttggta caaaaggqtq ttacaagagg catatagcga ttggtggatg 13500 aatgaaagtg ttgcgggaat gttttgcgtt tttccaaagc cttatctaag ttcaggacgg 13560 caattuttt ccgaattttt atgtggagct atgttacaag caggaacatt tgcgctgacc 13620 gatccttata cgtgtttgtc ctctgatgtt ttcccattga tgatgtttat tttgattttc 13680 attatcaatg cttccatggc ttatcagaca qqtacagcaa tgaatttggc tcgtgatctg 13740 ggcccacgtc ttgcactata tgcagttgga tttgatcata aaatgctttg ggtgcatcat 13800 catcatttct tttgggttcc catggtaggc ccatttattg gtgcgttaat gggggggttg 13860 gtttacgatg tcLgtattta tcagggtcat gaatctccag tcaactggtc tttaccagtt 13920 tataaggaaa tgattatgag agcctggttt agaaggcctg gttggaagaa gagaaataga 13980 gcaagaagaa catcggacct gagtgacttc tcatacaata acgatgatga tgaggaattt 14040 ggagaaagaa tqqctcttca aaagacaaag accaagtcat ctatttcaqa caacgaaaat 14100 gaagcaggag aaaagaaagt gcaatttaaa tctgttcagc gcggcaaaag aacgtttgg 14159 <210> 35 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Primer FDHuf <400> 35 tcgaagactc cgaatgaaaa agacatgcca g 31 <210> 36 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Primer FDHur <400> 36 tccggatacc aagttcattt tcaatacacc cca 33 <210> 37 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Primer FDHdf <400> 37 atgcatgcag aatggttctt atgccac 27 <210> 38 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Primer FDHdr <400> 38 gaagacagtt ctgttattaa cgacgagcca 30 <210> 39 <211> 5577 <212> DNA
<213> Artificial Sequence <220>
<223> pRN621 00CE Dbobqbpeqq.
5ee6o5qPbu 3006404E04 23E5 40060 44444444e-4 eq44e64bob CPU eq4bqepeo4 peqqqqeqpq qbqq524bqq P4P-4-4144qq. b-equqbqqqp o4b44peebu 08TE PD4;44b440 qqubpeeeP4 ePoPb4o24,2 uoPe4oqe6 eoPoPoq6po obbooqboop OZTC ObOODD5DDD 366006.406e qp1q0e6060 6E0.6640446 566460E60e 0664066666 65006E0665 3540.60E.6.65 050.60600E0 24E5634060 66e50e0b4.0 000E 06054606E6 000eb0E2.00 0640E5604E 0450060.466 450be5EED4 40656e000e 066Z 5E5.64E0046 EE5406400E 000E0E4040 00E0040566 40E5604066 06E00E0650 08n 0E00040460 pqb45Ece53 4bEE,04600E 6640E53E40 050E2,06000 b5ee6b4000 6E66E05004 0e6205006E L60E460011 OOLZ 0E204660E0 6E60E6E604 E0e10E04PE 04601E0E60 .640466066o 664E0E6006 069Z 00500E0060 004.6004E6E 50.45600050 ubneebeopo 5p4bb5oopp 3PPP4POPP5 E0404.45E0E ge56Eq0644 04EEEP444:4 004102,4eqe 0444.044044 ozgz 55E540E006 44.4eb5e446 62PEelP42P Eh-26E46400 0050600602 00004.644EE
096Z 64450502,6e 0E04000040 boeuPbbbeo 6E506400E6 9054060400 40650E4:Tee onz 2220622606 0E50E06006 64E54444E0 v4E004E3.64 44E042E4E4 542.000042,0 0/7E3 24E0=8E44 4E0E4.60008 oq5qopfy4B4 pfqxobbbfie oqp6pobo5q 602614oqb2 oezz 3E54400400 024PPb2300 66E664E0E5 05E0066000 ED-46650060 0004604006 oz 6EE440EE50 4450E46040 6E65004E46 64.40e-ebqee eublge4.546 .66.644E44be 2E64064E0E. PE4bb4bbEE 50-24410445 6406444456 EEE.65.6eu.60 ETE6406E0E E4ErEE04EE E04EE4360E E.05.442.45E2 024442e0ee 01703 5beobepq4q 4P044Pqrn q44Dbqb4q2 qbqq244P42 354e-4222E4 60E444E04e 0861 qeqee446-2.4 446E2,2,6.5E6 q35q4a4T5p 5qeeqqq4qq .45-ebqqeee 2,02,06.65EEE
0Z61 eqeqeoeebe pepeeebTve ogePoqbqoP 3f)oqop,o.4 eebeb54-4bu upe40Eeqq5 0981 40e0T4e44u 15b4404qu40 E4e4Eu5505 424454E544 44e402pEE4 Eeq6E0064E
0081 Pb0p5EEET4 Eub004025E p.604400050 44E,E6b4064 645E00500h 50E24.6E402 0D,LT 004E650405 E600E45544 0.6220.4e0bi -2406E2340E 4e2.62,1e40e 02E456E444 0891 E40bEE0060 E-44eb4E002, 54e406E0EE E662,02,0E04 lqePpePlub ho6u54544e 0Z91 p.654.615qq5 quThowbbo oqqp6-4p4.4q 02024440H e0000e05bE 44E040E040 09ST 5eq45p5q54 eE4qPpo5oP upbobebqbe 0.66605E5 640E500044 466E0E50E0 OOST bbqo5Eob42 E44e044E60 0564460606 0000404005 00ETE050e4 P2000605E6 0661 2E660bEE.66 2505254520 462505E050 6E5002502E 6036E06006 340600E4E6 08ET 435E64.6264 44.00600E44 E4.600EE4E5 54640442,54. 00001E4460 6400444044 OZET 64E0E040.64.
lqqopb540.6 q44q065540 044E60E44q 440058050e Po5u0050Pe 09F1 Epebb4E-400 frebbobbbbb 5eo4534ob4 ebg5qq444P 6045062,544 0E540400E0 45430452,42, 44404E4564 op6oppe5b5 662004405p 556E60E060 0611 EIE6256E0pe 65345662.06 605E246600 4e46bEDEb5 0b5pee5ub5 5ee5000440 0801 50e00506ee 2,5E64.E-406e 54605E0E40 0e4e6E640E e5002,02,400 EboEE.60bE5 OZOT 64405E0005 E0E0E06450 446556660e pE,40556oq5 506E05066E e4E5b00E44 096 5egE50E6ue 040E664466 e00p4q345q 604bEE42.60 6545E00540 6405645E00 006 e4q6430Tee 4054040.504 002gEOP400 .600E05e45q 040PRErePO4 402,00E0066 E4.646E40.44 0045402422 E0024E6e0.6 06E6E05E34 40664.0eE46 08L 5EEE1004.414 404.0EE00E1 06E6E2,04E6 600_6444544 4E616505E0 0E10600E00 OZL EETEETE0ue E05440.64D5 404:Eu46060 5q347,T444q 3042,6E6440 44042.66EEE
099 oqebeeePbe qboopoebeo -4505E540E0 oqq.boqqqb Eb450ve440 004PP2e00E
009 5420404E-eq.
Eb44444034 252E6456E4 042,562EEE-4 442E444442 3440-22,E2,40 ebbeD5pbbe 600664.604.4 0E06460640 epobb00660 00E6060640 60E666545o 0.6205E5066 0.4E6260025 4E30660066 60040060E6 0E304.64604 56E6604554 6E60050E46 405E63E654 0066060545 09E 5b#45,5643 06154000E2e 20E5600515 5465E00E56 E0046.50605 E04E044543 E566004564 5456006044 0E60E65E65 460440E666 =404.45E6 0E6640446e 5346606266 0060;50E60 5060600E04 0546600446 445ee00664 E00e00.65.62 55E6460E05 Ele2,42.E04.4 054eee4E64 OZT 0002E42e0e 5E54E04050 o4E45-e4ve E044E0e4ee eq0qqqq4uq qqb4442430 4b4p.225666 o4-444oeobb 465E0E4E06 30E0E0444e 4660646404 6E <OOP>
TI

agaaagtaat atcatgcgtc aatcgtatgt gaatgctggt cgctatactg ctgtcgattc 3360 gatactaacg ccgccatcca gtgtcgacgg atcctaggtg tacagggccc aagggcgaat 3420 tctgcagata tccatcacac tqqcqgccgc tcgagcatgc atgcagaatg gttcttatgc 3480 caccagagct tatggacaga agaaataaga gtgattatga gtatttgtga gcagaagttt 3540 tccggtctcc ttttgttctt gttttggcgt attctccact attcgtccat agcacattta 3600 taccttagct aaatattttg taaagcaaaa ttttcgttat ctcttaaaaa atagaagagc 3660 ggtttattaa tatcaaataa ttgaaactgc tgatatggta gctatataca aaatctgctg 3720 tcaaaatttg gcagtaaacg atcttcacgg tagcggttca aataaagagg aaaagtcttt 3780 ctcccttact gtttttctgg aatttggctc gtcgttaata acagaactgt cttcgaaggg 3840 cgaattctgc agatatccat cacactggcg gccgctcgag catgcatcta gagggcccaa 3900 ttcgccctat agtgagtcgt attacaattc actggccgtc gttttacaac gtcgtgactg 3960 ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca catccccctt tcgccagctg 4020 gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa cagttgcgca gcctatacgt 4080 acggcagttt aaggtttaca cctataaaag agagagccgt tatcgtctgt ttgtggatgt 4140 acagagtgat attattgaca cgccggggcg acggatggtg atccccctgg ccagtgcacg 4200 tctgctgtca gataaagtct cccgtgaact ttacccggtg gtgcatatcg gggatgaaag 4260 ctggcgcatg atgaccaccg atatggccag tgtgccggtc tccgttatcg gggaagaagt 4320 ggctgatctc agccaccgcg aaaatgacat caaaaacgcc attaacctga tgttctgggg 4380 aatataaatg tcaggcatga gattatcaaa aaggatcttc acctagatcc ttttcacgta 4440 gaaagccagt ccgcagaaac ggtgctgacc ccggatgaat gtcagctact gggctatctg 4500 gacaagggaa aacgcaagcg caaagagaaa gcaggtagct tgcagtgggc ttacatggcg 4560 atagctagac tgggcggttt tatggacagc aagcgaaccg gaattgccag ctggggcgcc 4620 ctctggtaag gttgggaagc cctgcaaagt aaactggatg gctttctcgc cgccaaggat 4680 ctgatggcgc aggggatcaa gctctgatca agagacagga tgaggatcgt ttcgcatgat 4740 tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta 4800 tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc Lgtcagcgca 4860 ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg aactgcaaga 4920 cgaggcagcg cggctatcgt ggctggccac gacqggcgtt ccttgcgcag ctgtgctcga 4980 cgttgtcact gaagcgggaa gggactggct gctattgggc gaagtgccgg ggcaggatct 5040 cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg 5100 gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgdaac atcgcatcga 5160 gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca 5220 tcaggggctc gcgccagccg aactqttcgc caggctcaag gcgagcatgc ccgagggcga 5280 ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg 5340 cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc 5400 gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt 5460 gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga 5520 gttcttctga attattaacg cttacaattt cctgatgcgg tattttctcc ttacgca 5577 <210> 40 <211> 5830 <212> DNA
<213> Artificial Sequence <220>
<223> pRN622 <400> 40 tatttcacac cgcatacagg tggcactttt cggggaaatg tgcgcggaac ccctatttgt 60 ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg 120 cttcaataat agcacgtgag gaggqccacc atqgccaagt tgaccagtgc cgttccggtg 180 ctcaccgcgc gcgacgtcgc cggagcggtc gagttctgga ccgaccggct cgggttctcc 240 cgggacttcg tggaggacga cttcgccggt gtggtccggg acgacgtgac cctgttcatc 300 agcgcggtcc aggaccaggt ggtgccggac aacaccctgg cctgggtgtg ggtgcgcggc 360 ctggacgagc tgtacgccga gtggtcggag gtcgtgtcca cgaacttccg ggacgcctcc 420 =

gggccggcca tgaccgagat cggcgagcag ccgtgggggc gggagttcgc cctgcgcgac 480 ccggccggca actgcgtgca cttcgtggcc gaggagcagg actgacacgt gctaaaactt 540 catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc 600 ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct 660 tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta 720 ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc 780 ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac 840 ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct 900 gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 960 aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg 1020 acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa 1080 gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 1140 gagCttCCag ggggaaacgc ctggtatctt tatagtcCtg tcgggtttcg ccacctCtga 1200 cttgagcgtc gatttttgtg atgctcqtca gqgqggcgga gcctatggaa aaacgccagc 1260 aacgcggcct ttttacggtt cctgggcttt tgctggcctt ttgctcacat gttctttcct 1320 gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct 1380 cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgccca 1440 atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg gcacgacagg 1500 tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta gctcactcat 1560 taggcaCCcc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc 1620 ggataacaat ttcacacagg aaacagctat gaccatgatt acgccaagct atttaggtga 1680 cactatagaa tactcaagct atgcatcaag cttggtaccg agctcggatc cactagtaac 1740 ggccgccagt gtgctggaat tcgccctttc gaagactccg aatgaaaaag acatgccagt 1800 aataaaaata attgatgtta tgcggaatat actattcttg gattattcac tgttaactaa 1860 aaqttggaga aatcactctg cactgtcaat cattgaaaaa aagaacatat aaaagggcac 1920 aaaatcgagt cttttttaat gagttcttgc tgaggaaaat ttagttaata tatcatttac 1980 ataaaacatg catattattg tgttgtactt tctttattca tttzaagcag gaataattac 2040 aagtattgca acgctaatca aatcgaaata acagctgaaa attaatatgt cgaagggaaa 2100 ggttttgctg gttctttatg aaggtggtaa gcatgctgaa gagcaggaaa agttattggg 2160 gtgtattgaa aatgaacttg gtatccggag ctcgtacgtt cgaacttaag gcctcgtccc 2220 cgccgggtca cccggccagc gacatggagg cccagaatac cctccttgac agtcttgacg 2280 tgcgcagctc aggggcatga tgtgactgtc gcccgtacat ttagcccata catccccatg 2340 tataatcatt tgcatccata cattttgatg gccgcacggc gcgaagcaaa aattacggct 2400 cctcgctgca gacctgcgag cagggaaacg ctcccctcac agacgcgttg aattgtcccc 2460 acgccgcgcc cctgtagaga aatataaaag gttaggattt gccactgagg ttcttctttc 2520 atatacttcc ttttaaaatc ttgctaggat acagttctca catcacatcc gaacataaac 2580 aaccatgggt aaggaaaaga ctcacgtttc gaggccgcga ttaaattcca acatggatgc 2640 tgatttatat gggtataaat gggctcgcga taatgtcggg caatcaggtg cgacaatcta 2700 tcgattgtat gggaagCCCg atgcgccaga gttgtttctg aaacatggca aaggtagcgt 2760 tgccaatgat gttacagatg agatggtcag actaaactgg ctgacggaat ttatgcctct 2820 tccgaccatc aagcatttta tccgtactcc tgatgatgca tggttactca ccactgcgat 2880 ccccggcaaa acagcattcc aggtattaga agaaLatcct gattcaggtg aaaatattgt 2940 tgatgcgctg gcagtgttcc tgcgccggtt gcattcgatt cctgtttgta attgtccttt 3000 taacagcgat cgcgtatttc gtctcgctca ggcgcaatca cgaatgaata acggtttggt 3060 tgatgcgagt gattttgatg acgagcgtaa tggctggcct gttgaacaag tctggaaaga 3120 aatgcataag cttttgccat tctcaccgga ttcagtcgtc actcatggtg atttctcact 3180 tgataacctt atttttgacg aggggaaatt aataggttgt attgatgttg gacgagtcgg 3240 aatcgcagac cgataccagg atcttgccat cctatggaac tgcctcggtg agttttctcc 3300 ttcattacag aaacggcttt ttcaaaaata tggtattgat aatcctgata tgaataaatt 3360 gcagtttcat ttgatgctcg atgagttttt ctaatcagta ctgacaataa aaagattctt 3420 gttttcaaga acttgtcatt tgtatagttt ttttatattg tagttgttct attttaatca 3480 aatgttagcg tgatttatat tttttttcgc ctCgaCatCa tctgcccaga tgcgaagtta 3540 agtgcgcaga aagtaatatc atgcgtcaat cgtatgtgaa tgctggtcgc tatactgctg 3600 tcgattcqat actaacgccg ccatccagtg tcgacggatc ctaggtgtac agggcccaaa 3660 agggCgaatt ctgcagatat ccatcacact ggcggccgct cgagcatgca gaatggttct 3720 tatgccacca gagcttatgg acagaagaaa taagagtgat tatgagtatt tgtgagcaga 3780 agttttccgg tctccttttg ttcttgtttt ggcgtattct ccactattcg tccatagcac 3840 atttatacct tagctaaata ttttgtaaag caaaattttc gttatctctt aaaaaataga 3900 agagcggttt attaatatca aataattgaa actgctgata tggtagctat atacaaaatc 3960 tgctgtcaaa atttggcagt aaacgatctt cacggtagcg gttcaaataa agaggaaaag 4020 tccttctccc ttactgtttt tctggaattt ggctcgtcgt taataacaga actgtcttca 4080 agggcgaatt ctgcagatat ccatcacact ggcggccgct cgagcatgca tctagagggc 4140 ccaattcgcc ctatagtgag tcgtattaca attcactggc cgtcgtttta caacgtcgtg 4200 actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca 4260 gctgqcgtaa tagcgaagag qcccgcaccg atcgcccttc ccaacagttg cgcagcctat 4320 acgtacggca gtttaaggtt tacacctata aaagagagag ccgttatcgt ctgtttgtgg 4380 atgtacagag tgatattatt gacacgccgg ggcgacggat ggtgatcccc ctggccagtg 4440 cacgtctgct gtcagataaa gtctcccgtg aactttaccc ggtggtgcat atcggggatg 4500 aaagctggcg catgatgacc accgatatgg ccagtgtgcc ggtctccgtt atcggggaag 4560 aagtggctga tctcagccac cgcgaaaatg acatcaaaaa cgccattaac ctgatgttct 4620 ggggaatata aatgtcaggc atgagattat caaaaaggat cttcacctag atccttttca 4680 cgtagaaagc cagtccgcag aaacggtgct gaccccggat gaatgtcagc tactgggcta 4740 tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt agcttgcagt gggcttacat 4800 ggcgatagct agactgggcg gttttatgga cagcaagcga accggaattg ccagctgggg 4860 cgccctctgg taaggttggg aagccctgca aagtaaactg gatggctttc tcgccgccaa 4920 ggatctgatg gcgcagggga tcaagctctg atcaagagac aggatgagga tcgtttcgca 4980 tgattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag aggctattcg 5040 gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc cggctgtcag 5100 cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc 5160 aagacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc 5220 tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg ccggggcagg 5280 atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct gatgcaatgc 5340 ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg aaacatcgca 5400 tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat ctggacgaag 5460 agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgagc atgcccgacg 5520 gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg gtggaaaatg 5580 gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc tatcaggaca 5640 tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct gaccgcttcc 5700 tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat cgccttcttg 5760 acgagttctt ctgaattatt aacgcttaca atttcctgat gcggtatttt ctccttacgc 5620 atctgtgcgg 5830 <210> 41 <211> 7690 <212> DNA
<213> Artificial Sequence <220>
<223> pRN558 <400> 41 tcgcgcqttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataattc cgttttaaga gcttggtgag cgctaggagt cactgccagg tatcgtttga 240 acacggcatt agtcagggaa gtcataacac agtcctttcc cgcaattttc tttttctatt 300 actcttggcc tcctctagta cactctatat ttttttatgc ctcggtaatg attttcattt 360 ttttttttcc acctagcgga tgactctttt tttttcttag cgattggcat tatcacataa 420 tgaattatac attatataaa gtaatgtgat ttcttcgaag aatatactaa aaaatgagca 480 ggcaagataa acgaaggcaa agatgacaga gcagaaagcc ctagtaaagc gtattacaaa 540 tgaaaccaag attcagattg cgatctcttt aaagggtggt cccctagcga tagagcactc 600 gatcttccca gaaaaagagg cagaagcagt agcagaacaq gccacacaat cgcaagtgat 660 taacgtccac acaggtatag ggtttctgga ccatatgata catgctctgg ccaagcattc 720 cggctggtcg ctaatcqttg agtqcattgq tgacttacac atagacgacc atcacaccac 780 tgaagactgc gggattgctc tcggtcaagc ttttaaagag gccctactgg cgcgtggagt 840 aaaaaggttt ggatcaggat ttgcgccttt ggatgaggca ctttccagag cggtggtaga 900 tctttcgaac aggccgtacg cagttgtcga acttggtttg caaagggaga aagtaggaga 960 tctctcttgc gagatgatcc cgcattttct tgaaagcttt gcagaggcta gcagaattac 1020 cctccacqtt qattgtctgc gaggcaagaa tgatcatcac cgtagtgaga gtgcgttcaa 1080 ggctcttgcg gttgccataa gagaagccac ctcgcccaat ggtaccaacg atgttccctc 1140 caccaaaggt gttcttatgt agtgacaccg attatttaaa gctgcagcat acgatatata 1200 tacatgtgta tatatgtata cctatgaatg tcagtaagta Lgtatacgaa cagtatgata 1260 ctgaagatga caaggtaatg catcattcta tacgtgtcat tctgaacgag gcgcgctttc 1320 cttttttctt tttgcttttt cttttttttt ctcttgaact cgacggatca tatgcggugt 1380 gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta aacgttaata 1440 ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 1500 aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 1560 cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 1620 ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 1680 cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 1740 ggggaaagcc ggcattgcga ataccgcttc cacaaacatt gctcaaaagt atctctttgc 1800 tatatatctc tgtgctatat ccctatataa cctacccatc cacctttcgc tccttgaact 1860 tgcatctaaa ctcgacctct acatttttta tgtttatctc tagtattact ctttagacaa 1920 aaaaattgta gtaagaacta ttcatagagt gaatcgaaaa caatacgaaa atgtaaacat 1980 ttcctatacg tagtatatag agacaaaata gaagaaaccg ttcataattt tctgaccaat 2040 gaagaatcat caacgctatc actttctgtt cacaaagtat gcgcaatcca catcggtata 2100 gaatataatc ggggatgcct ttatcttgaa aaaatgcacc cgcagcttcg ctagtaatca 2160 gtaaacgcgg gaagtggagt caggcttttt ttatggaaga gaaaatagac accaaagtag 2220 ccttcttcta accttaacgg acctacagtg caaaaagtta tcaagagact gcattataga 2280 gcgcacaaag gagaaaaaaa gtaatctaag atgctttgtt agaaaaatag cgctctcggg 2340 atgcattttt gtagaacaaa aaagaagtat agattctttg ttggtaaaat agcgctctcg 2400 cgttgcatti ctgttctgta aaaatgcagc tcagattctt tgtttgaaaa attagcgctc 2460 tcgtcgcgtt gcatttttgt tttacaaaaa tgaagcacag attcttcgtt ggtaaaatag 2520 cgctttcgcg ttgcatttct gttctgtaaa aatgcagctc agattctttg tttgaaaaat 2580 tagcgctctc gcgttgcatt tttgttctac aaaatgaagc acagatgctt cgttaacaaa 2640 gatatgctat tgaagtgcaa gatggaaacg cagaaaatga accggggatg cgacgtgcaa 2700 gattacctat gcaatagatg caatagtttc tccaggaacc gaaatacata cattgtcttc 2760 cgtaaagcgc tagactatat attattatac aggttcaaat atactatctg tttcagggaa 2820 aactcccagg ttcggatgtt caaaattcaa tgatgggtaa caagtacgat cgtaaatctg 2880 taaaacagtt tgtcggatat taggctgtat ctcctcaaag cgtattcgaa tatcattgag 2940 aagctgcagc gtcacatcgg ataataatga tggcagccat tgtagaagtg ccttttgcat 3000 ttctagtctc tttctcggtc tagctagttt tactacatcg cgaagataga atcttagatc 3060 acactgcctt tgctgagctg gatcaataga gtaacaaaag agtggtaagg cctcgttaaa 3120 ggacaaggac ctgagcggaa gtgtatcgta cagtagacgg agtatctagt atagtctata 3180 gtccgtggaa ttaattctca tctttgacag cttatcatcg ataatccgga gctagcatgc 3240 ggccgccagt gtgatggata totgcagaat tcgccctttt aagcttcgta cgtgtggaag 3300 aacgattaca acaggtgttg toctotgagg acataaaata cacaccgaga ttcatcaact 3360 cattgctgga gttagcatat ctacaattgg gtgaaatggg gagcgatttg caggcatutg 3420 ctcggcatgc cggtagaggt gtggtcaata agagcgacct catgctatac ctgagaaagc 3480 aacctgacct acaggaaaga gttactcaag aataagaatt ttcgttttaa aacctaagag 3540 tcactttaaa atttgtatac acttattttt tttataactt atttaataat aaaaatcata 3600 aatcataaga aattcgcgcg cttaagcagc ttcaccagcc tttctagcca aagattgagc 3660 catcttttca gcggtagcca aagcagaaga ggtcataatg tccaagttac cagcgtaagc 3720 tggcaagtag tgagcagcac cttcaacttc caaccaaaca gcggtcttca aaccagagaa 3780 ttgaccaaca cctggcaagt taactggctt gtcttgtggg ataacttcga attgaactct 3840 ttgcttcaat ctgtaacctg gaacgtatgc ttgaacagct tcagccattt cgttgattga 3900 agcttcgatg tcgtcttgag atgcttcgtc agacaaaacg taaacggtgt ctctcatcat 3960 caatggtggt tcagctgggt tcaaaacgat gatagcctta ccattagcag caccaccaac 4020 aacttcgata gccctagagg tggtttcggt gaattcgtcg atgttagctc tggtacctgg 4080 accagcagac ttagaagcga tagaagcgat gatttcagcg tagtgaactc tagcaactct 4140 tgaaacagca gcaaccattg ggatggtagc ttgaccacca caggtaacca tgttaacgtt 4200 taattggtca acgttagctt ccaagLtaac aactggaaca cagtatggac cgatagcagc 4260 tggggtcaag tcgatcaatc tgatgtctgg cttagcttct ctcaaagcag cgtcgttctt 4320 aacgtgagca ccagcagagg tagcgtcgaa aacgatqtcg atgtcagcga attctggcat 4380 gttcatcaaa ccgataacac cttcgtgggt ggtagcaaca cccattottc tagctctagc 4440 caaaccgtca gattgtgggt cgataccaac cataacagcc atttccaagt gttgaccgtg 4500 tcttaggatc ttgatcatca agtcagtacc aatgttacca gaaccgatga tagcaacctt 4560 tctcttagac atctgcagtc tagatatatt tgttgtaaaa agtagataat tacttcattg 4620 atgatctgta aaaaagagaa aaagaaagca tctaagaact tgaaaaacta cgaattagaa 4680 aagaccaaat atgtatttct tgcattgacc aatttatgca agtttatata tatgtaaatg 4740 taagtttcac gaggttctac taaactaaac cacccccttg gttagaagaa aagagtgtgt 4800 gagaacaggc tgttgttgtc acacgattcg gacaattctg tttgaaagag agagagtaac 4860 agtacgatcg aacgaacttt gctctggaga tcacagtggg catcatagca tgtggtacta 4920 aaccctttcc cgccattcca gaaccttcga ttgcttgtta caaaacctgt gagccgtcgc 4980 taggaccttg ttgtgtgaCg aaattggaag ctgcaatcaa taggaagaca ggaagtcgag 5040 cgtgtctggg ttttttcagt tttgttcttt ttgcaaacaa atcacgagcg acggtaattt 5100 ctttctcgat aagaggccac gtgctttatg agggtaacat caattcaaga aggagggaaa 5160 cacttccttt ttctggccct gataatagta tgagggtgaa gccaaaataa aggattcgcg 5220 cccaaatogg catcrttaaa tgcaggtatg cgataattcc tcactotttc cttactcacg 5280 agtaattctt gcaaatgcct attatgcaga tgttataata tctgtgcgtc ttgagttgaa 5340 gagctcgaga ctagtggatc ccccgggctg caggaattcg atatcaagct tatcgatacc 5400 gtcgacctcg agggggggcc cggtacccag cttttgttcc ctttagtgag ggttaattcc 5460 gagcttggcg taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat 5520 tccacacaac ataggagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgaq 5580 gtaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg 5640 ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc 5700 ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc 5760 agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa 5820 catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt 5880 tttccatagg ctcggccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 5940 gcgaaacccg acaggactat aaagatacca ggcgttcccc cctggaagct ccctcgtgcg 6000 ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 6060 cgtggcgctt tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 6120 caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 6180 ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 6240 taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 6300 taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac 6360 cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 6420 tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 6480 gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt 6540 catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa 6600 atcaatctaa aqtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga 6660 ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tgcccgtcgt 6720 gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg 6780 agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga 6840 gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga 6900 agctagagta agtagttcgc cagttaatag tttgcgcaac gttqttgcca ttgctacagg 6960 catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc 1020 aaggcgagtt acatgatccc ccatgttgtg aaaaaaagcg gttagctcct tcggtcctcc 7080 gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca 7140 taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac 7200 caagtcattc tgagaatagt gtatgaggcg accgagttgc tattgaccgg cgtcaatacg 7260 ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc 7320 ggggcgaaaa ctctcaagga tottaccgct gttgagatcc agttcgatgt aacccactcg 7380 tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac 7440 aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat 7500 actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata 7560 catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa 7620 agtgccacct gacgtcttat tatcatgaca ttaacctata aaaataggcg tatcacgagg 7680 ccctttcgtc 7690 <210> 42 <211> 9416 <212> DNA
<213> Artificial Sequence <220>
<223> pRN595 <400> 42 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataagacgtc 60 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 120 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 180 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 240 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 300 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 360 ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 420 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 480 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 540 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 600 gacaacgatc ggaggaccga aggagctaac cgcttttttt cacaacatgg gggatcatgt 660 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 720 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 780 tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 840 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga 900 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt 960 agttatctac acgacgggca gtcaggcaac tatggatgaa cgaaatagac agatcgctga 1020 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact 1080 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 1140 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 1200 agaaaagatc aaaggatctt cttgagatcc LLaLtttctg cgcgtaatct gctgcttgca 1260 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 1320 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 1380 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 1440 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc 1500 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 1560 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga 1620 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 1680 aacaggagag cgcacgaggg agcttccagg ggggaacgcc tggtatcttt atagtcctgt 1740 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggccgag 1800 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 1860 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 1920 tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 1980 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 2040 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 2100 tgtgagttac ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcctat 2160 gttgtgtgga attqtgagcg gataacaatt tcacacagga aacagctatg accatgatta 2220 cgccaagctc ggaattaacc ctcactaaag ggaacaaaag ctgggtaccg ggccccccct 2280 cgaggtcgac ggtatcgata agcttgatat cgaattcctg cagcccgggg gatccactag 2340 tctcgagctc ttcaactcaa gacgcacaga tattataaca tctgcataat aggcatttgc 2400 aagaattact cgtgagtaag gaaagagtga ggaactatcg catacctgca tttaaagatg 2460 ccgatttggg cgcgaatcct ttattttggc ttcaccctca tactattatc agggccagaa 2520 aaaggaagtg tttccctcct tcttgaattg atgttaccct cataaagcac gtggcctctt 2580 atcgagaaag aaattaccgt cgctcgtgat ttgtttgcaa aaagaacaaa actgaaaaaa 2640 cccagacacg ctcgacttcc tgtcttccta ttgattgcag cttccaattt cgtcacacaa 2700 caaggtccta gcgacggctc acaggttttg taacaagcaa tcgaaggttc tggaatggcg 2760 ggaaagggtt tagtaccaca tgctatgatg cccactgtga totccagagc aaagttcgtt 2820 cgatcgtact gttactctct ctctttcaaa cagaattgtc cgaatcgtgt gacaacaaca 2880 gcctgttctc acacactctt ttcttctaac caagggggtg gtttagttta gtagaacctc 2940 gtgaaactta catttacata tatataaact tgcataaatt ggtcaatgca agaaatacat 3000 atttggtctt ttctaattcg tagtttttca agttcttaga tgctttcttt ttctcttttt 3060 tacaqatcat caaggaagta attatctact ttttacaaca aatatatcta gaaaatggct 3120 gttaccaacg ttgctgaatt gaacgctttg gttgaaaggg ttaagaaggc tcaaagagaa 3180 tacgcttctt tcacccaaga acaagttgac aagatcttca gagctgctgc tttggctgct 3240 gctgacgcta gaatcccatt ggctaagatg gctgttgctg aatctggtat gggtatcgtt 3300 gaagacaagg ttatcaagaa ccactrcgct tctgaataca tctacaacgc ttacaaggac 3360 gaaaagacct gtggtgtttt gtcagaagac gacaccttcg gtaccatcac catcgctgaa 3420 ccaatcggta tcatctgtgg tatcgttcca accaccaacc caacctctac cgctatcttc 3480 aagtctttga tctctttgaa gaccagaaac gctatcatct tctctccaca cccaagagct 3540 aaagacgcta ccaacaaggc tgctgacatc gttttgcaag ctgctatcgc tgctggtgct 3600 ccaaaggact tgatcggttg gatcgaccaa ccatctgttg aattgtctaa cgctttgatg 3660 caccacccag acatcaactt gatcttggct accggtggtc caggtatggt taaggctgct 3720 tactcttctg gtaagccagc tatcggtgtt ggtgctggta acaccccagt tgttatcgac 3780 gaaaccgctg acatcaagag agctgttgct tctgttttga tgtctaagac cttcgacaac 3840 ggtgttatct gtgcttctga acaatctgtt qttgttgttg actctgttta cgacgctgtt 3900 agagaaagat tcgctaccca cggtggttac ttgttgcaag gtaaggaatt gaaggctgtt 3960 caagacgtta tcttgaagaa cggtgctttg aacgctgcta tcgttggtca accagcttac 4020 aagatcgctg aattagctgg tttctctgtt ccagaaaaca ccaagatctt gatcggtgaa 4080 gttaccgttg ttgacgaatc tgaaccattc gctcacgaaa agttgtctcc aaccttggct 4140 atgtacagag ctaaggactt cgaagacgct gttgaaaaag ctgaaaagtt ggttgctatg 4200 ggtggtattg gtcacacctc ttgtttgtac accgaccaag acaaccaacc agctagagtt 4260 tcttacttcg gtcaaaagat gaagaccgct agaatcttga tcaacacccc agottctcaa 4320 ggtggtatcg gtgacttgta caacttcaag ttggctccat ctttgacctt gggttgtggt 4380 tcttggggtg gtaactctat ctctgaaaac gttggtccaa agcacttgat caacaagaag 4440 accgttgcta agagagctga aaacatgttg tggcacaagt tgccaaaatc tatctacttc 4500 agaagaggtt ctttgccaat cgctttggac gaagttatca ccgacggtca caagagagct 4560 ttgatcgtta ccgacagatt cttgttcaac aacggttacg ctgaccaaat cacctctgtt 4620 ttgaaggctg ctggtgttga aaccgaagtt ttcttcgaag ttgaagctga cccaaccttg 4680 tctatcgtta gaaagggtgc tgaattggct aactctttca agccagacgt tatcatcgct 4740 ttgggtggtg gttctccaat ggacgctgct aagatcatgt gggttatgta cgaacaccca 4800 gaaacccact tcgaagaatt ggctttgaga ttcatggaca tcagaaagag aatctacaag 4860 ttcccaaaga tgggtgttaa ggctaagatg atcgctgtta ccaccacctc tggtaccggt 4920 tctgaagtta ccccattcgc tgttgttacc gacgacgcta ccggtcaaaa gtacccattg 4980 gctgactacg ctttgacccc agacatggct atcgttgacg ctaacttggt tatggacatg 5040 ccaaagtctt tgtgtgcttt cggtggtttg gacgctgtta cccacgctat ggaagcttac 5100 gtttctgttt tggcttctga attctctgac ggtcaagctt tgcaagcttt gaagttgttg 3160 aaggaatact tgccagcttc ttaccacgaa ggttctaaga acccagttgc tagagaaaga 5220 gttcactctg ctgctaccat cgctggtatc gctttcgcta acgctttctt gggtgtttgt 5280 cactctatgg ctcacaagtt gggttctcaa ttccacatcc cacacggttt ggctaacgct 5340 ttgttgatct gtaacgttat cagatacaac gctaacgaca acccaaccaa gcaaaccgct 5400 ttctctcaat acgacagacc acaagctaga agaagatacg ctgaaatcgc tgaccacttg 5460 ggtttgtctg ctccaggtga cagaaccgct gcaaagatcg aaaagttgtt ggcttggttg 5520 gaaaccttga aggctgaatt gggtatccca aagtctatca gagaagctgg tgttcaagaa 5580 gctgacttct tggctaacgt tgacaagttg tctgaagacg ctttcgacga ccaatgtacc 5640 ggtgctaacc caagataccc attgatctct gaattgaagc aaatcttgtt ggacacctac 5700 tacggtagag actacgttga aggtgaaacc gctgctaaga aggaagctgc tccagctaag 5760 gctgaaaaqa aggctaagaa gtatgottag cttaagcgcg cgaatttctt atgatttatg 5820 atttttatta ttaaataagt tataaaaaaa ataagtgtat acaaatttta aagtgactct 5880 taggttttaa aacgaaaatt cttattcttg agtaactctt tcctgtaggt caggttgctt 5940 tctcaggtat agcatgaggt cgctcttatt gaccacacct ctaccggcat gccgagcaaa 6000 tgcctgcaaa tcgctcccca tttcacccaa ttgtagatat gctaactcca gcaatgagtt 6060 gatgaatctc ggtgtgtatt ttatgtcctc agaggacaac acctgttgta atcgttcttc 6120 cacacgtacg aagcttaaaa gggcgaattc tgcagatatc catcacactg gcggccgcat 6180 gctagctccg gattatcgat gataagctgt caaagatgag aattaattcc acggactata 6240 gactatacta gatactccgt ctactgtacg atacacttcc gctcaggtcc ttgtccttta 6300 acgaggcctt accactcttt tgttactcta ttgatccagc tcagcaaagg cagtgtgatc 6360 taagattcta tcttcgcgat gtagtaaaac tagctagacc gagaaagaga ctagaaatqc 6420 aaaaggcact tctacaatgg ctgccatcat tattatccga tgtgacgctg cagottctca 6480 atgatattcg adLacgcttt gaggagatac agactaataL ccgacaaact gttttacaga 6540 tttacgatcg tacttgttac ccatcattga attttgaaca tccgaacctg ggagttttcc 6600 ctgaaacaga tagtatattt gaaCctgtat aataatatat agtctagcgc tttacggaag 6660 acaatgtatg tatttcggtt cctggagaaa ctattgcatc tattgcatag gtaatcttgc 6720 acgtcgcatc cccggttcat tttctgcgtt tccatcttgc acttcaatag catatctttg 6780 ttaacgaagc atctgtgctt cattttgtag aacaaaaatg caacgcgaga gcgctaattt 6840 ttcaaacaaa gaatctgagc tgcattttta cagaacagaa atgcaacgcg aaagcgctat 6900 tttaccaacg aagaatctgt gcttcatttt tgtaaaacaa aaatgcaacg cgacgagagc 6960 gctaattttt caaacaaaga atctgagctg catttttaca qaacagaaat gcaacgcgag 7020 agcgctattt taccaacaaa gaatctatac ttcttttttg ttctacaaaa atgcatcccg 7080 agagcgctat Ltttctaaca aagcatctta gattactttt tttctccttt gtgcgctcta 7140 taatgcagtc tcttgataac tttttgcact gtaggtccgt taaggttaga agaaggctac 7200 tttggtgtct attttctott ccataaaaaa agcctgactc cacttcccgc gtttactgat 7260 tactagcgaa gctgcgggtg cattttttca agataaaggc atccccgatt atattctata 7320 ccgatgtgga ttgcgcatac tttgtgaaca gaaagtgata gcgttgatga ttcttcattg 7380 gtcagaaaat tatgaacggt ttcttctatt ttgtctctat atactacgta taggaaatgt 7440 ttacattttc gtattgtttt cgattcactc tatgaatagt tcttactaca atttttttgt 7500 ctaaagagta atactagaga taaacataaa aaatgtagag gtcgagttta gatgcaagtt 7560 caaggagcga aaggtggatg ggtaggttat atagggatat agcacagaga tatatagcaa 7620 agagatactt ttgagcaatg tttgtggaag cggtattcgc aatgccggct ttccccgtca 7680 agctctaaat cgggggctcc cUtagggtt ccgatttagt gctttacggc acctcgaccc 7740 caaaaaactt gattagggtg atggttcacg tagtgggcca tcgccctgat agacggtttt 7800 tcgccotttg acgttggaqt ccacgttctt taatagtgga ctcttgttcc aaactggaac 7860 aacactcaac cctatctcgg totattottt tgatttataa gggattttgc cgatttcggc 7920 ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaatttta acaaaatatt 7980 aacgttLaca atttcctgat gcggtattzt ctccttacgc atctgtgcgg tatttcacac 8040 cgcatatgat ccgtcgagtt caagagaaaa aaaaagaaaa agcaaaaaga aaaaaggaaa 8100 gcgcgcctcg ttcagaatga cacgtataga atgatgcatt accttgtcat cttcagtatc 8160 atactgttcg tatacatact tactgacatt cataggtata catatataca catgtatata 8220 tatcgtatgc tgcagcttta aataatcggt gtcactacat aagaacacct ttggtggagg 8280 gaacatcgtt ggtaccattg ggcgaggtgg cttctcttat ggcaaccgca agagccttga 8340 acgcactctc actacggtga tgatcattct tgcctcgcag acaatcaacg tggagggtaa 8400 ttctgctagc ctctgcaaag ctttcaagaa aatgcgggat catctcgcaa gagagatctc 8460 ctactttctc cctttgcaaa ccaagttcga caactgcgta cggcctgttc gaaagatcta 8520 ccaccgctct ggaaagtgcc tcatccaaag gcgcaaatcc tgatccaaac ctttttactc 8580 cacgcgccag tagggcctct ttaaaagctt gaccgagagc aatcccgcag tcttcagtgg 8640 tgtgatggtc gtctatgtgt aagtcaccaa tgcactcaac gattagcgac cagccggaat 8700 gcttggccag agcatgtatc atatggtcca gaaaccctat acctgtgtgg acgttaatca 8760 cttgcgattg tgtggcctgt tctgctactg cttctgcctc tttttctggg aagatcgagt 8820 gctctatcgc taggggacca ccctttaaag agatcgcaat ctgaatcttg gtttcatttg 8880 taatacgctt tactagggct ttctgctctg tcatctttgc cttcgtttat cttgcctgct 8940 cattttttag tatattcttc gaagaaatca cattacttta tataatgtat aattcattat 9000 08ZZ goopoopobb boDeqbbbqo beepeopebb bepegoeogo oopeqqeebb oqobeepobo OZZZ eqqebgeope bgegobeoee ebbepeoepq qgpeopegeb bobebqb44e ebbqbqbqqb 09TZ -4eqopob6p p-44D5quqq.4. oppe.rna5.6 ppoopeobbe qleolpeolo 3eqq6ebqbq 00-EZ eeqgeepboe eobobebqlle obbboBeepb bloeb000qg lbbeoeboeo bbqobecbqe 060Z e4qeD4Te6o off,qqbp6ob oppoqoqopb opeueoboeq eepoobobeb eebbobeebb 0861 ebobebgbuo qbebobeobo bebooebope boobeoboob p4oboop4eb 4obe5qbebq OZ61 -aqoobooegq pqboopequb bqbqoqqpbq opoogegq.bo bqooqqqoqq bqeopogobq 0981 qggoobbqob qqq4opbb4o 3.43bboem qqopbbobop poopoo6ope peebbqegoo 0081 bPboobabb beolbDqobq ebqbqqqqqe boqbobebq oeblowoeo ofmqqqbbbo 06L1 qbqopqbeqe qqqoquqbbq opboeebbbb bbeopqqobe bbbeboeobo bebebbepee 0891 bboqbbbuab bobeegbboo q24bbeoebb obbeeebebb beeb000qqo bopoobobee OZ9T ebeb4qpobe bqbobepeqo oe4pbeb4oP eboo eboeebobeb bqgobeopob 09S1 popoppfigbo qqbbbbbbpe ebwbbEoqb babeobabbe egebbopell begeboebee 00ST olcebbqqbb booeqqoqbq boqbeeqebo 561bepobqo bqob645eop ellbloo4pe 06DT qo6q04p5oq opeqeopq= Boopobpqbq oqoppbepoq qopoopoobb eT4beqboob HET eq645p4o44 ooq64oeque poDpqpbeob obebeo5voq 4o6B4opeqb beebooqqqq.
OZET qoqopponpq 0.6e6ppoqpb 6no6T446.44 46845538pp opqabooppo peeeeeepep 093T po64.4ob1.ob qoqeeq5p53 6qoqqqqqqi. poqububqqo qq.oebbepe oqubeeeebe 00u gbooDoebeo qbobebgoeo oq4boqq44.6 26q6opeqqo 004UPP2OOP bqnoaoqueq 061T ebqqqqqop4 ebeebgbbeq oqebbeeeei qqppqqq-44e ogqoeppeqq. qebT7A_Pb-ega 0801 qoeqeqeqpo qop.444beeo oPbeolb4op eqbbqgpobe eqqebqoppq onb4bbeleb 0Z01 ebqpboqube pebe4eepbo epbqebbqpq peeobbea46 upbbboeboe peqoqeqlbe 096 '4baq.eboo3 qopobeegbb 4ebeo3666.5 lorobeobqq epleqbbobo qoqbbbz6o6 006 efigfiboofre6 figoqeepqeb 3o5qqe4qq5 bqobbqobbo o;qopobbo4 obobqoqgoe 068 opeb5eob44 beepqebbob bebbqebbqo ebegepggee opeobboopq qobegolopq 08L qopqoppbo5 bqopeqqpqo PPeobobqqb oPeoppobbq peobeqbqop bqeboeopeo OZL ublbobefoe boeeeppege pobeebqeub gobebbopee bbbqq.boqeb llopboqope 099 qbquoqebbb bbqeoeeopo qqqqqqqpbo oeeqobebbe eboopbbebb o4eboeeppb 009 qpq4oe44oe poobbobqop oeeqeb4beb 4eopep4poo bqobqbeobq p4eebebee 06S qbeoebgeob bqebboeqqo qeobeepebe oeogbeopeo goeqbebqqb bqqoeb4Peb 086 poqoqq.eqoe opqeoboobo qbbolopeob ebepabbfioo boebTleqbo poqeqqp455 OZ6 obobbqbqe4 obqoqqbeee qqqqopobub qebquepogq 145peebeeb oppoboglqq 09E bebebqqopq ebeeqbbobe Dueoqoqebb weebogeop qq5b5qbe5o ep6q5Eybqqb 00E eogebeefigo bgebeepeqb Peebgbbqob peeebeoppe oqpb4443,f) ipoqqopbqq 06Z ggeobbobqq 44qqopoqqe gwooboqbq booqqqeopp oggeqbebqe 4.6ebee5bee 081 eepbqqp;pe qppoqlobqe eegebqopop egpeop6Pbq eoqobooqpq bqeqeeep4;
OZT epeqeeewq qqqqe4-4-46q qqelopopep 55o5o5qbge uebbbboql 1peobbqbbe 09 oqboebee4e uquf)q.2346q Puqqbbpmeq qqqqeqoobo eqebiLoino bbbeepboeb ED' <006>
96SMId <EZZ>
<OZZ>
pouanbas TuToTgT4.1V <ETZ>
<Z1Z>
3E6 <11Z>
EV <01Z>
9166 efipbob opeeboopoq eoqboopoqg -44bbebeo4b 4b4pobqobp bbbooqoqbo 09E6 opfpqbgobee opbepeqqa5 opgeobbpop 1:36q.D15q43 6bboeblopo boboebqpbo 006 0=220060 oopoeboopo bepobeeqqb eqeobooble bqpi.obwqe eoeqbeoqpq 0f,z6 peobgbbqeq que6boeeee qqoqobeepo powbobeqo oqopbqbeob bqopeqebou 0816 peoqqbqboo .6peqoubqo poqqoPbqp4 qb4eqoubbp uebbbobq4p peebppepeb 0Z16 eqpeqbebee pobbebbebe qoeqbqbebe 4eqepeepee qpobbpboop 4.4e.o7,peeeb 0906 q2P2EPPPEE
eebbqbbew 5oo4eoqbab eepeeeeeeb epqobolepo obqe-eqebqb cgaggtcgac ggtatcgata agcttgatat cgaattcctg cagcccgggg gatccactag 2340 tctcgagctc ttcaactcaa gacgcacaga tattataaca tctgcataat aggcatttgc 2400 aagaattact cgtgagtaag gaaagagtga ggaactatcg catacctgca tttaaagatg 2460 ccgatttggg cgcgaatcct ttattttggc ttcaccctca tactattatc agggccagaa 2520 aaaggaagtg tttccctcct tcttgaattg atgttaccct cataaagcac gtggcctctt 2580 atcgagaaag aaattaccgt cgctcgtgat ttgtttgcaa aaagaacaaa actgaaaaaa 2640 cccagacacg ctcgacttcc tgtcttccta ttgattgcag cttccaattt cgtcacacaa 2700 caaggtccta gcgacggctc acaggttttg taacaagcaa tcgaaggttc tggaatggcg 2760 ggaaagggtt tagtaccaca tgctatgatg cccactgtga tctccagagc aaagttcgtt 2820 cgatcgtact gttactctct ctctttcaaa cagaattgtc cgaatcgtgt gacaacaaca 2880 gcctgttctc acacactctt ttcttctaac caagggggtg gtttagttta qtagaacctc 2940 gtgaaactta catttacata tatataaact tgcataaatt ggtcaatgca agaaatacat 3000 atttggtctt ttctaattcg tagtttttca agttcttaga tgatttattt ttctcttttt 3060 tacagatcat caaggaagta attatctact ttttacaaca aatatatcta gaaaatgtct 3120 acccaacaaa ccatgaccgt tgacgaacac atcaaccaat tagttagaaa ggctcaagtt 3180 gctttgaagg aatacttgaa gccagaatac acccaagaaa agatcgacta catcgttaag 3240 aaggcttctg ttgctgcttt ggaccaacac tgtgctttgg ctgctgctgc tgttgaagaa 3300 accggtagag gtatcttcga agacaaggct accaagaaca tcttcgcttg tgaacacgtt 3360 acccacgaaa tgagacacgc taagaccgtt ggtatcatca acgttgaccc attgtacggt 3420 atcaccgaaa tcgctgaacc agttggtgtt gtttgtggtg ttaccccagt taccaaccca 3480 acctctaccg ctatcttcaa gtctttgatc tctatcaaga ccagaaaccc aatcgttttc 3540 tctttccacc catctgcttt gaagtgttct attatggctg ctaaaatcgt tagagacgct 3600 gctatcgctg ctggtgctcc agaaaactgt atccaatgga tcgaattcgg tggtatcgaa 3660 gcttctaaca agttgatgaa ccacccaggt gttgctacta tcttggctac cggtggtaac 3720 gctatggtta aggctgcata ctcttctggt aagccagctt tgggtgttgg tgctggtaac 3780 gttccaacct acatcgaaaa gacctgtaac atcaagcaag ctgctaacga cgttgttatg 3840 tctaagtctt tcgacaacgg tatgatctgt gcttctgaac aagctgctat catcgacaag 3900 gaaatctacg accaagttgt tgaagaaatg aagaccttgg gtgoltactt catcaacgaa 3960 gaagaaaagg ctaagttgga aaagttcatg ttcggtgtta acgcttactc tgctgacgtt 4020 aacaacgcta gattgaaccc aaagtgtcca ggtatgtctc cacaatqqtt cgctgaacaa 4080 gttggtatca aggtaccaga agactgtaac atcatctgtg ctgtttgtaa ggaagttggt 4140 ccaaacgaac cattgaccag agaaaagttg tctccagttt tggctatctt gaaagctgaa 4200 aacacccaag acggtatcga caaggctgaa gctatggttg aatttaacgg tagaggtcac 4260 tctgctgcta tccactctaa cgacaaggct gttgttgaaa agtacgcttt gaccatgaag 4320 gcttgtagaa tcttgcacaa caccccatct tctcaaggtg gtatcggttc tatctacaac 4380 tacatctggc catctttcac cttgggttgt ggttcttacg gtggtaactc tgtttctgct 4440 aacgttacct accacaactt gttgaacatc aagagattgg ctgacagaag aaacaacttg 4500 caatggttca gagttccacc aaagatcttc ttcgaaccac actctatcag atacttggct 4560 gaattgaagg aattgtctaa gatcttcatc gtttctgaca gaatgatgta caagttgggt 4620 tacgttgaca gagttatgga cgttttgaag agaagatcta acgaagttga aatcgaaatc 4680 ttcatcgacg ttgaaccaga cccatctatc caaaccgttc aaaagggttt ggctgttatg 4740 aacaccttcg gtccagacaa catcatcgct atcggtggtg gttctgctat ggacgctgct 4800 aagatcatgt ggttgttgta cgaacaccca gaagctgact tcttcgctat gaagcaaaag 4860 ttcatcgact tgagaaagag agctttcaag ttcccaacca tgggtaagaa ggctagattg 4920 atctgtatcc caaccacctc tggtaccggt tctgaagtta ccccattcgc tgttatctct 4980 gaccacgaaa ccggtaagaa gtacccattg gctgactact ctttgacccc atctgttgct 5040 atcgttgacc caatgttcac catgtctttg ccaaagagag ctatcgctga caccggtttg 5100 gacgttttgg ttcacgctac cgaagcttac gtttctgtta tggctaacga atacaccgac 5160 ggtttggcta gagaagctgt taagttggtt tttgaaaact tgttgaagtc ttacaacggt 5220 gacttggaag ctagagaaaa gatgcacaac gctgctacca tcgctggtat ggctttcgct 5280 tctgctttct tgggtatgga ccactctatg gctcacaagg ttggtgctgc tttccacttg 5340 ccacacggta gatgtgttgc tgttttgttg ccacacgtta tcagatacaa cggtcaaaag 5400 ccaagaaagt tggctatgtg gccaaagtac aacttctaca aggctgacca aagatacatg 5460 gaattggctc aaatggttgg tttgaagtgt aacaccccag ctgaaggtgt tgaagctttc 5520 gctaaggctt gtgaagaatt gatgaaggct accgaaacca tcaccggttt caagaaggct 5580 aacatcgacg aagctgcttg gatgtctaag gttccagaaa tggctttgtt ggctttcgaa 5640 gaccaatgtt ctccagctaa cccaagagtt ccaatggtta aggacatgga aaagatottg 5700 aaggctgott actacccaat cgcttagctt aagcgcgcga atttcttatg atttatgatt 5760 tttattatta aataagttat aaaaaaaata agtgtataca aattttaaag tgactcttag 5820 gttttaaaac gaaaattctt attcttgagt aactctttcc tgtaggtcag gttgctttct 5880 caggtatagc atgaggtcgc tcttattgac cacacctcta ccggcatgcc gagcaaatgc 5940 ctgcaaatcg ctccccattt cacccaattg tagatatgct aactccagca atgagttgat 6000 gaatctcggt gtgtatttta tgtcctcaga ggacaacacc tgttgtaatc gttattccac 6060 acgtacgaag ctaaaagggc gaattctgca gatatccatc acactggcgg ccgcatgcta 6120 gctccggatt atcgatgata agctgtcaaa gatgagaatt aattccacgg actatagact 6180 atactagata ctccgtctac tgtacgatac acttccgctc aggtccttgt cctttaacga 6240 ggccttacca ctcttttgtt actctattga tccagctcag caaaggcagt gtgatctaag 6300 attctatctt cgcgatgtag taaaactagc tagaccgaga aagagactag aaatgcaaaa 6360 ggcacttcza caatggctgc catcattatt atccgatgtg acgctgcagc ttctcaatga 6420 tattcgaata cgctttgagg agatacagcc taatatccga caaactgttt tacagattta 6480 cgatcgtact tgttacccat cattgaattt tgaacatccg aacctgggag ttttccctga 6540 aacagatagt atatttgaac ctgtataata atatatagtc tagcgcttta cggaagacaa 6600 tgtatgtatt tcggttcctg gagaaactat tgcatctatt gcataggtaa tcttgcacgt 6660 cgcatccccg gttcattttc tgcgtttcca tcttgcactt caatagcata tctttgttaa 6720 cgaagcatct gtgcttcatt ttgtagaaca aaaatgcaac gcgagagcgc taatttttca 6780 aacaaagaat ctgagctgca tttttacaga acagaaatgc aacgcgaaag cgctatttta 6840 ccaacgaaga atctgtgctt catttttgta aaacaaaaat gcaacgcgac gagagcgcta 6900 atttttcaaa caaagaatct gagctgcatt tttacagaac agaaatgcaa cgcgagagcg 6960 ctattttacc aacaaagaat ctatacttct tttttgttct acaaaaatgc atcccgagag 7020 cgctattttt ctaacaaagc atcttagatt actttttttc tcctttgtgc gctctataat 7080 gcagtctctt gataactttt tgcactgtag gtccgttaag gttagaagaa ggctactttg 7140 gtgtctattt tctcttccat aaaaaaagcc tgactccact tcccgcgttt actgattact 7200 agcgaagctg cgggtgcatt ttttcaagat aaaggcatcc ccgattatat tctataccga 7260 tgtggattgc gcatactttg tgaacagaaa gtgatagcgt tgatgattct tcattggtca 7320 gaaaattatg aacggtttct tctattttgt ctctatatac tacgtatagg aaatgtttac 7380 attttcgtat tgttttcgat tcactctatg aatagttctt actacaattt ttttgtctaa 7440 agagtaatac tagagataaa cataaaaaat gtagaggtcg agtttagatg caagttcaag 7500 gagcgaaagg tggatgggta ggttatatag ggatatagca cagagatata tagcaaagag 7560 atacttttga gcaatgtttg tggaagcggt attcgcaatg ccggctttcc ccgtcaagct 7620 ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa 7680 aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc 7740 cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca 7800 ctcaacccta totcggtota ttcttttgat ttataaggga ttttgccgat ttcggcctat 7860 tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg 7920 tttacaattt cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca 7980 tatgatccgt cgagttcaag agaaaaaaaa agaaaaagca aaaagaaaaa aggaaagcgc 8040 gcctcgttca gaatgacacg tatagaatga tgcattacct tgtcatcttc agtatcatac 8100 tgttcgtata catacttact gacattcata ggtatacata tatacacatg tatatatatc 8160 gtatgctgca gctttaaata atcggtgtca ctacataaga acacctttgg tggagggaac 8220 atcgttggta ccattgggcg aggtggcttc tcttatggca accgcaagag ccttgaacgc 8280 actctcacta cggtgatgat cattcttgcc tcgcagacaa tcaacgtgga gggtaattct 8340 gctagcctct gcaaagcttt caagaaaatg cgggatcatc tcgcaagaga gatctcctac 8400 tttctccctt tgcaaaccaa gttcgacaac tgcgtacggc ctgttcgaaa gatctaccac 8460 cgctctggaa agtgcctcat ccaaaggcgc aaatcctgat ccaaaccttt ttactccacg 8520 cgccagtagg gcctctttaa aagcttgacc gagagcaatc ccgcagtctt cagtggtgtg 8580 atggtcgtct atgtgtaagt caccaatgca ctcaacgatt agcgaccagc cggaatgctt 8640 ggccagagca tgtatcatat ggtccagaaa ccctatacct gtgtggacgt taatcacttg 8700 cgattgtgtg gcctgttctg ctactgcttc tgcctctttt tctgggaaga tcgagtgctc 8760 tatcgctagg ggaccaccct ttaaagagat cgcaatctga atcttggttt catttgtaat 8820 acgctttact agggctttct gctctgtcat ctttgccttc gtttatcttg cctgctcatt 8880 ttttggtata ttcttcgaag aaatcacatt actttatata atgtataatt cattatgtga 8940 taatgccaat cgctaagaaa aaaaaagagt catccgctag gtggaaaaaa aaaaatgaaa 9000 atcattaccg aggcataaaa aaatatagag tgtactagag gaggccaaga gtaatagaaa 9060 aagaaaattg cgggaaagga ctgtgttatg acttccctga ctaatgccgt gttcaaacga 9120 tacctggcag tgactcctag cgctcaccaa gctcttaaaa cggaattatg gtgcactctc 9180 agtacaatct gctctgatgc cgcatagtta agccagcccc gacacccgcc aacacccgct 9240 gacgcgccct gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc 9300 tccgggagct gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc ga 9352 <210> 44 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Primer GPD2uf <400> 44 ggtaccagat cttttgcggc gaggtgccg 29 <210> 45 <211> 42 <212> DNA
<213> Artificial Sequence <220>
<223> Primer GPD2ur <400> 45 tctagactta aggaatgtgt atcttgttaa tcttctgaca gc 42 <210> 46 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Primer GPD2df <400> 46 ctcgagatag tctacaacaa cgtccgca 28 <210> 47 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Primer GPD2dr <400> 47 ccatggagat ctgcagtgaa aaagctcgaa gaaacagct 39 <210> 48 <211> 4397 <212> DNA
<213> Artificial Sequence <220>
<223> pRN594 <400> 48 gacgacggcg acctggcggg cttcgtggtc gtctcgtact ccggctggaa ccgccggctg 60 accgtcgagg acatcgaggt cgccccggag caccgggggc acggggtcgg gcgcgcgttg 120 atggggctcg cgacggagtt cgcccgcgag cggggcgccg ggcacctctg gctggaggtc 180 accaacgtca acgcaccggc gatccacgcg taccggcgga tggggttcaC cctctgcggc 240 ctggacaccg ccctgtacga cggcaccgcc tcggacggcg agcaggcgct ctacatgagc 300 atgccctgcc cctagtactg acaataaaaa gattcttgtt ttcaagaact tgtcatttgt 360 atagtttttt tatattgtag ttgttctatt ttaatcaaat gttagcgtga tttatatttt 420 ttttcgcctc gacatcatCt gcccagatqc gaagttaagt gcgcagaaag taatatcatg 480 cgtcaatcgt atgtgaatgc tggtcgctat actgctgtcg attcgatact aacgccgcca 540 tccagtgtcg acggatccta ggtgtaCagg gcccaaaagg gcgaattctg cagatatcca 600 tcacactggc ggccgctcga gatagtctac aacaacgtcc gcatggaaga cctaccggag 660 atgattgaag agCtagacat cgatgaCgaa tagacaCtCt ccccccccct ccccctctga 720 tctttcctgt tgcctctttt tcccccaacc aatttatcat tatacacaag ttctacaact 780 actactagta acattactac agttattata attttctatt ctctttttct ttaagaatct 840 atcattaacg ttaatttcta tatatacata actaccatta tacacgctat tatcgtttac 900 atatcacatc accgtzaatg aaagatacga caccctgtac actaacacaa ttaaataatc 960 gccataacct tttctgttat ctatagccct taaagctgtt tcttcgagct ttttcactgc 1020 agatctccat ggcgatgcct gattgccgaa tatcatggtg gaaaatggcc gcttttctgg 1080 attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac 1140 ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg 1200 tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg 1260 aattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt 1320 gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct 1380 gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc 1440 cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta 1500 tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac 1560 tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc 1620 atgacagtaa gagaattatg cagtgctgCC ataaccatga gtgataacac tgcggccaac 1680 ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgCa caacatgggg 1740 gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac 1800 gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc 1860 gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt 1920 gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga 1980 gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccatcc 2040 cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag 2100 atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca 2160 tatatacttt agattgattt aaaacttcat tzttaattta aaaggatcta ggtgaagatc 2220 ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 2280 gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 2340 tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 2400 ccaactcttt ttCcgaaggt aaCtggcttc agcagagcgc aaataccaaa tactgttctt 2460 ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 2520 gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 2580 ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 2640 tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 2700 ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 2760 agggtoggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 2820 agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 2880 gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 2940 tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 3000 accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 3060 gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg 3120 attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 3180 gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg 3240 gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 3300 catgattacg ccaagctatt taggtgacac tatagaatac tcaagctatg catcaagatt 3360 ggtaccagat cttttgcggc gaggtgccga tgggttgctg aggggaagag tgtttagctt 3420 acggacctat tgccattgtt attccgatta atctattgtt cagcagctct tctctaccct 3480 gtcattctag tatttttttt tttttttttt ggttttactt ttttttcttc ttgccttttt 3540 ttcttgttac tttttttcta gttttttttc cttccactaa gctttttcct tgatttatcc 3600 ttgggttctt ctttctactc ctttagattt tttttttata tattaatttt taagtttatg 3660 tattttggta gattcaattc tctttccctt tccttttcct tcgctcccct tccttatcaa 3720 tgcttgctgt cagaagatta acaagataca cattccttaa ggcctcgtcc ccgccgggtc 3780 acccggccag cgacatggag gcccagaata ccctccttga cagtcttgac gtgcgcagct 3840 caggggcatg atgtgactgt cgcccgtaca tttagcccat acatccccat gtataatcat 3900 ttgcatccat acattttgat ggccgcacgg cgcgaagcaa aaattacggc tcctcgctgc 3960 agacctgcga gcagggaaac gctcccctca cagacgcgtt gaattgtccc cacgccgcgc 4020 ccctgtagag aaatataaaa ggttaggatt tgccactgag gttcttcttt catatacttc 4080 cttttaaaat cttgctagga tacagttctc acatcacatc cgaacataaa caaccatgta 4140 aaatgaccac tcttgacgac acggcttacc ggtaccgcac caotgtcccg ggggacgccg 4200 aggccatcga ggcactggat gggtccttca ccaccgacac cgtcttccgc gtcaccgcca 4260 ccggggacgg cttcaccctg cgggaggtgc cggtggaccc gcccctgacc aaggtgttcc 4320 ccgacgacga atcggacgac gaatcggacg ccggggagga cggcgacccg gactcccgga 4380 cgttcgtcgc gtacggg 4397 <210> 49 <211> 367 <212> PRT
<213> Escherichia coil <400> 49 Met Asp Arg Ile Tie Gin Ser Pro Gly Lys Tyr Tie Gin Gly Ala Asp Val Ile Asn Arg Leu Gly Glu Tyr Leu Lys Pro Leu Ala Glu Arg Trp Leu Val Val Gly Asp Lys Phe Val Leu Gly Phe Ala Gin Ser Thr Val Glu Lys Ser Phe Lys Asp Ala Gly Leu Val Val Glu Ile Ala Pro Phe Gly Gly Glu Cys Ser Gin Asn Glu Ile Asp Arg Leu Arg Gly Ile Ala Glu Thr Ala Gin Cys Gly Ala Ile Leu Gly Ile Gly Gly Gly Lys Thr Leu Asp Thr Ala Lys Ala Leu Ala His Phe Met Gly Val Pro Val Ala Ile Ala Pro Thr Ile Ala Ser Thr Asp Ala Pro Cys Ser Ala Leu Ser Val Ile Tyr Thr Asp Glu Gly Glu Phe Asp Arg Tyr Leu Leu Leu Pro Asn Asn Pro Asn Met Val Ile Val Asp Thr Lys Ile Val Ala Gly Ala Pro Ala Arg Leu Leu Ala Ala Gly Ile Gly Asp Ala Leu Ala Thr Trp Phe Glu Ala Arg Ala Cys Ser Arg Ser Gly Ala Thr Thr Met Ala Gly Gly Lys Cys Thr Gin Ala Ala Leu Ala Leu Ala Glu Leu Cys Tyr Asn Thr Leu Leu Glu Glu Gly Glu Lys Ala Met Leu Ala Ala Glu Gin His Val Val Thr Pro Ala Leu Glu Arg Val Ile Glu Ala Asn Thr Tyr Leu Ser Gly Val Gly Phe Glu Ser Gly Gly Leu Ala Ala Ala His Ala Val His Asn Gly Leu Thr Ala Ile Pro Asp Ala His His Tyr Tyr His Gly Glu Lys Val Ala Phe Gly Thr Leu Thr Gin Leu Val Leu Glu Asn Ala Pro Val Glu Glu Ile Glu Thr Val Ala Ala Leu Ser His Ala Val Gly Leu Pro Ile Thr Leu Ala Gin Leu Asp Tie Lys Glu Asp Val Pro Ala Lys Net Arg Ile Val Ala Glu Ala Ala Cys Ala Glu Gly Glu Thr Ile His Asn Met Pro Gly Gly Ala Thr Pro Asp Gln Val Tyr Ala Ala Leu Leu Val Ala Asp Gin Tyr Gly Gin Arg Phe Leu Gin Glu Trp Glu <210> 50 <211> 1120 <212> DNA
<213> Artificial Sequence <220>
<223> nucleotide segeunce encoding E.coli gldA codon-optimised for yeast <400> 50 ctgcagaaaa tggacagaat catccaatct ccaggtaagt acatccaagg tgctgacgtt 60 atcaacagat tgggtgaata cttgaagcca ttggctgaaa gatggttggt tgttggtgac 120 aagttcgttt tgggtttcgc tcaatctacc gttgaaadgt ctttcaagga cgctggtttg 180 gttgttgaaa tcgctccatt cggtggtgaa tgttctcaaa acgaaatcga cagattgaga 240 ggtatcgctg aaaccgctca atgtggtgct atcttgggta tcggtggtgg taagaccttg 300 gacaccgcta aggctttggc tcacttcatg ggtgttccag ttgctatcgc tccaaccatc 360 gcttctaccg acgctccatg ttctgctttg tctgttatct acaccgacga aggtgaattc 420 gacagatact tgttgttgcc aaacaaccca aacatggtta tcgttgacac caagatcgtt 480 gctggtgctc cagctagatt gttggcagct ggtatcggtg acgctttggc tacctggttc 540 gaagctagag cttgttctag atctggtgct accaccatgg ctggtggtaa gtgtacccaa 600 gctgctttgg ctttggctga attgtgttac aacaccttgt tggaagaagg tgaaaaggct 660 atgttggctg ctgaacaaca cgttgttacc ccagctttgg aaagagttat cgaagctaac 720 acctacttgt ctggtgttgg tttcgaatct ggtggtttgg ctgctgctca cgctgttcac 780 aacggtttga ccgctatccc agacgctcac cactactacc acggtgaaaa ggttgctttc 840 ggtaccttga cccaattggt tttggaaaac gctccagttg aagaaatcga aaccgttgct 900 gctttgtctc acgctgttgg tttgccaatc accttggctc aattggacat caaggaagac 960 gttccagcta agatgagaat cgttgctgaa gctgcttqtg ctgaaggtga aaccatccac 1020 aacatgccag gtggtgctac cccagaccaa gtttacgctg ctttgttggt tgctgaccaa 1080 tacggtcaaa gattcctaca agaatgggaa taaggcgcgc 1120 <210> 51 <211> 1949 <212> DNA
<213> Artificial Sequence <220>
<223> pRNgldA
<400> 51 actagtaaat gtgtggggaa gcgggtaagc tgccacagca attaatgcac aacatttaac 60 ctacattctt ccttatcgga tectcaaaac ccttaaaaac atatgcctca ccctaacata 120 ttttccaatt aaccctcaat atttctctgt caccoggcct ctattttcca ttttottctt 180 tacccgccac gcgttttttt ctttcaaatt tttttcttcc ttcttctttt tcttccacgt 240 cctcttgcat aaataaataa accgttttga aaccaaactc gcctctctct ctcctttttg 300 aaatattttt gggtttgttt gatcctttcc ttcccaatct ctcttgttta atatatattc 360 atttatatca cgctctcttt ttatcttcct ttttttcctc tctcttgtat tcttccttcc 420 cctttctact caaaccaaga agaaaaagaa aaggtcaatc tttgttaaag aataggatct 480 tctactacat cagcttttag atttttcacg cttactgctt ttttcttccc aagatcgaaa 540 atttactgaa ttaactgcag aaaatggaca gaatcatcca atctccaggt aagtacatcc 600 aaggtgctga cgttatcaac agattgggtg aatacttgaa gccattggct gaaagatggt 660 tggttgttgg tgacaagttc gttttgggtt tcgctcaatc taccgttgaa aagtctttca 720 aggacgctgg tttggttgtt gaaatcgctc cattcggtgg tgaatgttct caaaacgaaa 780 tcgacagatt gagaggtatc gctgaaaccg ctcaatgtgg tgctatcttg ggtatcggtg 640 gtggtaagac cttggacacc gctaaggctt tggctcactt catgggtgtt ccagttgcta 900 tcgctccaac catcgcttct accgacgctc catgttctgc tttgtctgtt atctacaccg 960 acgaaggtga attcgacaga tacttgttgt tgccaaacaa cccaaacatg gttatcgttg 1020 acaccaagat cgttgctggt gctccagcta gattgttggc agctggtatc ggtgacgctt 1080 tggctacctg gttcgaagct agagcttgtt ctagatctgg tgctaccacc atggctggtg 1140 gtaagtgtac ccaagctgct ttggctttgg ctgaattgtg ttacaacacc ttgttggaag 1200 aaggtgaaaa ggctatgttg gctgctgaac aacacgttgt taccccagct ttggaaagag 1260 ttatcgaagc taacacctac ttgtctggtg ttggtttcga atctggtggt ttggctgctg 1320 ctcacgctgt tcacaacggt ttgaccgcta tcccagacgc tcaccactac taccacggtg 1380 aaaaggttgc tttcggtacc ttgacccaat tggttttgga aaacgctcca gttgaagaaa 1440 tcgaaaccgt tgctgctttg tctcacgctg ttggtttgcc aatcaccttg gctcaattgg 1500 acatcaagga agacgttcca gctaagatga gaatcgttgc tgaagctgct tgtgctgaag 1560 gtgaaaccat ccacaacatg ccaggtggtg ctaccccaga ccaagtttac gctgctttgt 1620 tggttgctga ccaatacggt caaagattcc tacaagaatg ggaataaggc gcgccccttt 1680 tcctttgtcg atatcatgta attagttatg tcacgcttac attcacgccc tcctcccaca 1740 tccgctctaa ccgaaaagga aggagttaga caacctgaag tctaggtccc tatttatttt 1800 ttttaatagt tatgttagta ttaagaacgt tatttatatt tcaaattttt cttttttttc 1860 tgtacaaacg cgtgtacgca tgtaacatta tactgaaaac cttgcttgag aaggttttgg 1920 gacgctcgaa ggcttcctag gcgtacgtt 1949 <210> 52 <211> 552 <212> PRT
<213> Citrobacter freundii <400> 52 Met Ser Gin Phe Phe Phe Asn Gin Arg Thr His Leu Val Ser Asp Val Ile Asp Gly Thr Ile Ile Ala Ser Pro Trp Asn Asn Leu Ala Arg Leu Glu Ser Asp Pro Ala Ile Arg Ile Val Val Arg Arg Asp Leu Asn Lys Asn Asn Val Ala Val Ile Ser Gly Gly Gly Ser Gly His Glu Pro Ala His Val Gly Phe Ile Gly Lys Gly Met Leu Thr Ala Ala Val Cys Gly Asp Val Phe Ala Ser Pro Ser Val Asp Ala Val Leu Thr Ala Ile Gin 85 90 95 =
Ala Val Thr Gly Glu Ala Gly Cys Leu Leu Ile Val Lys Asn Tyr Thr Gly Asp Arg Leu Asn Phe Gly Leu Ala Ala Glu Lys Ala Arg Arg Leu Gly Tyr Asn Val Glu Met Leu Ile Val Gly Asp Asp Ile Ser Leu Pro Asp Asn Lys His Pro Arg Gly Ile Ala Gly Thr Ile Lou Val His Lys Ile Ala Gly Tyr Phe Ala Glu Arg Gly Tyr Asn Lou Ala Thr Val Leo Arg Glu Ala Gin Tyr Ala Ala Asn Asn Thr Phe Ser Leu Gly Val Ala Leu Ser Ser Cys His Leu Pro Gin Glu Ala Asp Ala Ala Pro Arg His His Pro Gly His Ala Glu Leu Gly Met Gly Ile His Gly Glu Pro Gly Ala Ser Val Ile Asp Thr Gin Asn Ser Ala Gin Val Val Asn Leu Met Val Asp Lys Leu Met Ala Ala Leo Pro Glu Thr Gly Arg Lou Ala Val Met Ile Asn Asn Leu Gly Gly Val Ser Val Ala Glu Met Ala Ile Ile Thr Arg Glu Leu Ala Ser Ser Pro Leu His Pro Arg lie Asp Trp Leo Ile Gly Pro Ala Ser Leu Val Thr Ala Leu Asp Met Lys Ser Phe Ser Leu Thr Ala Ile Val Lou Glu Glu Ser Ile Glu Lys Ala Leu Leu Thr Glu Val Glu Thr Ser Asn Trp Pro Thr Pro Val Pro Pro Arg Glu Ile Ser Cys Val Pro Ser Ser Gin Arg Ser Ala Arg Val Glu Phe Gin Pro Ser Ala Asn Ala Met Val Ala Gly Ile Val Glu Leu Val Thr Thr Thr Leu Ser Asp Leu Glu Thr His Leu Asn Ala Leu Asp Ala Lys Val Gly Asp Gly Asp Thr Gly Ser Thr Phe Ala Ala Gly Ala Arg Glu Ile Ala Ser Lou Leu His Arg Gin Gin Leu Pro Leu Asp Asn Lou Ala Thr Lou Phe Ala Leu Ile Gly Glu Arg Leu Thr Val Val Met Gly Gly Ser Ser Gly Val Leu Met Ser Ile Phe Phe Thr Ala Ala Gly Gin Lys Leu Glu Gin Gly Ala Ser Vol Ala Glu Ser Lou Asn Thr Gly Leu Ala Gin Met Lys Phe Tyr Gly Gly Ala Asp Glu Gly Asp Arg Thr Met Ile Asp Ala Lou Gln Pro Ala Leu Thr Ser Leu Leu Thr Gin Pro Gin Asn Leu Gin Ala Ala Phe Asp Ala Ala Gln Ala Gly Ala Glu Arg Thr Cys Leu Ser Ser Lys Ala Asn Ala Gly Arg Ala Ser Tyr Leu Ser Ser Glu Ser Leu Leu Gly Asn Met Asp Pro Gly Ala His Ala Val Ala Met Val Phe Lys Ala Leu Ala Glu Ser Glu Leu Gly <210> 53 <211> 1678 <212> DNA
<213> Artificial Sequence <220>
<223> nucleotide sequence encoding the C. freundii dhaK codon-optimised for yeast <400> 53 tctagaaaaa tgtctcaatt cttcttcaac cagagaaccc acttggtttc tgacgttatc 60 gacggtgcta tcatcgcttc accatggaac aatttggcta gattggaatc tgacccagct 120 atcagaatcg ttgttagaag agacttgaac aagaacaacg ttgctgttat ctctggtggt 180 ggttctggtc acgaaccagc tcacgttggt ttcatcggta agggtatgtt gaccgctgct 240 gtttgtggtg acgttttcgc ttctccatct gttgacgctg ttttgactgc tatccaagct 300 gttaccggtg aagctggttg tttgttgatc gttaagaact acaccggtga cagattgaac 360 ttcggtttgg ctgctgaaaa ggctagaaga ttgggttaca acgttgaaat gttgatcgtt 420 ggtgacgaca tctctttgcc agacaacaag cacccaagag gtatcgctgg taccatcttg 480 gttcacaaga tcgctggtta cttcgctgaa agaggttaca acttagctac cgttttgaga 540 gaagctcaat acgctgcttc taacaccttc tctttgggtg ttgctttgtc ttcttgtcac 600 ttgccacaag aaaccgacgc tgctccaaga caccacccag gtcacgctga attgggtatg 660 ggtatccacg gtgaaccagg tgcttctgtt atcgacaccc aaaactctgc tcaagttgtt 720 aacttgatgq ttgacaagtt gttggctgct ttgccagaaa ccggtagatt ggctgttatg 780 atcaacaact tgggtggtgt ttctgttgct gaaatggcta tcatcaccag agaattggct 840 tcttctccat tgcactcaag aatcgactgg ttgatcggtc cagcttcttt ggtaaccgct 900 ttggacatga agygtttctc tttgaccgct atcgttttgg aagaatcLat cgaaaaggct 960 ttgttgaccg aagttgaaac ctctaactgg ccaaccccag ttccaccaag agaaatcacc 1020 tgtgttgttt cttctcacgc ttctgctaga gttgaattcc aaccatctgc taacgctttg 1080 gttgctggta tcgttgaatt ggttaccgct accttgtctg acttggaaac ccacttgaac 1140 gctttggacg ctaaggttgg tgacggtgac accggttcta ccttcgctgc tgctgctaga 1200 gaaatcgctt ctttgttgca cagacaacaa ttgccattga acaacttggc taccttgttc 1260 gctttgatcg gtgaaagatt gaccgttgtt atgggtggtt cttctggtgt tttgatgtct 1320 atcttcttca ccgctgctgg tcaaaagttg gaacaaggtg ctaacgttgt tgaagctttg 1380 aacaccggtt tggctcaaat gaagttctac ggtggtgctg acgaaggtga cagaaccatg 1440 atcgacgctt tgcaaccagc tttgacctct ttgttggctc aaccaaagaa cttgcaagct 1500 gctttcgacg ctgctcaagc tggtgctgaa agaacctgtt tgtcttctaa ggctaacgct 1560 ggtagagctt cttacttgtc ttctgaatct ttgttgggta acatggaccc aggtgctcaa 1620 agattggcta tggttttcaa ggctttggct gaatctgaat tgggttaata aggtcgac 1678 <210> 54 <211> 2951 <212> DNA
<213> Artificial Sequence <220>
<223> pRNdhaK
<400> 54 ggatccacta gtaacggccg ccagtgtgct ggaattcgcc cttctcgagc ttaagacgcg 60 tttcttcttc agattccctc atggagaaag tgaggcagat gtatatgaca gagtcgccag 120 Lttccaagag actttattca ggcacttcca tgataggcaa gagagaagac ccagagatgt 180 tgttgtccta gttacacatg gtatttattc cagagtattc ctgatgaaat ggtttagatg 240 gacatacgaa gagtttgaat cgtttaccaa tgttcctaac gggagcgtaa tggtgatgga 300 actggacgaa tccatcaata gatacgtcct gaggaccgtg ctacccaaat ggactgattg 360 tgagggagac ctaactacat agtgtttaaa gattacggat atttaactta cttagaataa 420 tgccattttt ttgagttata ataatcctac gttagtgtga gcgggattta aactgtgagg 480 accttaatac attcagacac ttctgcggta tcaccctact tattcccttc gagattaaat 540 ctaggaaccc atcaggttgg tggaagatta cccgttctaa gacttttcag cttcctctat 600 tgatgttaca cctggacacc ccttttctgg catccagttt ttaatcttca gtggcatgtg 660 agattctccg aaattaatta aagcaatcac acaattctct cggataccac ctcggttgaa 720 actgacaggt ggtttgttac gcatgctaat gcaaaggagc ctatatacct ttggctcggc 780 tgctgtaaca gggaatataa agggcagcat aatttaggag tttagtgaac ttgcaacatt 840 tactattttc ccttcttacg taaatatttt tctttttaat tctaaatcaa tctttttcaa 900 ttttttgttt gtattctttr cttgcttaaa tctataacta caaaaaacac atacataaat 960 ctagaaaaat gtctcaattc ttcttcaacc agagaaccca cttggtttct gacgttatcg 1020 acggtgctat catcgcttca ccatggaaca atttggctag attggaatct gacccagcta 1080 tcagaatcgt tgttagaaga gacttgaaca agaacaaggt tgctgttatc tctggtggtg 1140 gttctggtca cgaaccagct cacgttggtt tcatcggtaa gggtatgttg accgctgctg 1200 tttgtggtga cgttttcgct tctccatctg ttgacgctgt tatgactgct atccaagctg 1260 ttaccggtga agctggttgt ttgttgatcg ttaagaacta caccggtgac agattgaact 1320 tcggtttggc tgctgaaaag gctagaagat tgggttacaa cgttgaaatg ttgatcgttg 1380 gtgacgacat ctctttgcca gacaacaagc acccaagagg tatcgctggt accatcttgg 1440 ttcacaagat cgctggttac ttcgctgaaa gaggttacaa cttagctacc gttttgagag 1500 aagctcaata cgctgcttct aacaccttct ctttgggtgt tgctttgtct tcttgtcact 1560 tgccacaaga aaccgacgct gctccaagac accacccagg tcacgctgaa ttgggtatgg 1620 gtatccacgg tgaaccaggt gcttctgtta tcgacaccca aaactctgct caagttgtta 1680 acttgatggt tgacaagttg ttggctgctt tgccagaaac cggtagattg gctgttatga 1740 tcaacaactt gggtggtgtt tctqttgctg aaatggctat catcaccaga gaattggctt 1800 cttctccatt gcactcaaga atcgactggt tgatcggtcc agcttctttg gtaaccgctt 1860 tggacatgaa gggtttctct ttgaccgcta tcgttttgga agaatctatc gaaaaggctt 1920 tgttgaccga agttgaaacc tctaactggc caaccccagt tccaccaaga gaaatcacct 1980 gtgttgtttc ttgtcacgct tctgctagag ttgaattcca accatctgct aacgctttgg 2040 ttgctggtat cgttgaattg gttaccgcta ccttgtctga cttggaaacc cacttgaacg 2100 gtttggacgc taaggttggt gacggtgaca cgggttctac cttcgctggt gctggtagag 2160 aaatcgcttc ttLgttgcac agacaacaat tgccattgaa gaacttggct accttgttcg 2220 ctttgatcgg tgaaagattg accgttgtta tgggtggttc ttctggtqtt ttgatgtcta 2280 tcttcttcac cgctgctggt caaaagttgg aacaaggtgc taacgttgtt gaagctttga 2340 acaccggttt ggctcaaatg aagttctacg gtggtgctga cgaaggtgac agaaccatga 2400 tcgacgcttt gcaaccagct ttgacctctt tgttggctca accaaagaac ttgcaagctg 2460 ctttcgacgc tgctcaagct ggtgctgaaa gaacctgttt gtcttctaag gctaacgctg 2520 gtagagcttc ttacttgtct tctgaatctt tgttgggtaa catggaccca ggtgctcaaa 2580 gattggctat ggttttcaag gctttggctg aatctgaatt gggttaataa ggtcgagaca 2640 aatcgctctt aaatatatac ctaaagaaca ttaaagctat attataagca aagatacgta 2700 aattttgctt atattattat acacatatca tatttctata tttttaagat ttggttatat 2760 aatgtacgta atgcaaagga aataaatttt atacattatt gaacagcgtc caagtaacta 2820 cattatgtgc actaatagtt tagcgtcgtg aagactttat tgtgtcgcga aaagtaaaaa 2880 ttttaaaaat tagagcacct tgaacttgcg aaaaaggttc tcatcaactg tttaaaacgt 2940 acgaagctta a 2951 <210> 55 <211> 14200 <212> DNA
<213> Artificial Sequence <220>
<223> pRN957 <400> 55 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataagacgtc 60 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 120 ttcaaatatg tatccgctca tgagacaata accctgataa atgottcaat aatattgaaa 180 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 240 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 300 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 360 ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 420 ggtattatcc cgtattgacg ccgggcaaga gcaactcqgt cgccgcatac actattctca 480 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 540 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 600 gacaacgatc ggaggaccga aggagctaac cgcttLtttt cacaacatgg gggatcatgt 660 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 720 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 780 tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 840 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga 900 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt 960 agttatctac acgacgggca gtcaggcaac tatggatgaa cgaaatagac agatcgctga 1020 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact 1080 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 1140 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 1200 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 1260 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 1320 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 1380 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 1440 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc 1500 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 1560 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga 1620 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 1680 aacaggagag cgcacgaggg agcttccagg ggggaacgcc tggtatcttt atagtcctgt 1740 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggccgag 1800 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 1860 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 1920 tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 1980 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 2040 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 2100 tgtgagttac ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcctat 2160 gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta 2220 cgccaagctc ggaattaacc ctcactaaag ggaacaaaag ctgggtaccg ggccccccct 2280 cgaggtcgag cttaagacgc gtttcttctt cagattccct catggagaaa gtgcggcaga 2340 tgtatatgac agagtcgcca giAtccaaga gactttattc aggcacttcc atgataggca 2400 agagagaaga cccagagatg ttgttgtcct agttacacat ggtatttatt ccagagtatt 2460 cctgatgaaa tggtttagat ggacatacga agagtttgaa tcgtttacca atgttcctaa 2520 cgggagcgta atggtgatgg aactggacga atccatcaat agatacgtcc tgaggaccgt 2580 gctacccaaa tggactgatt gtgagggaga cctaactaca tagtgtttaa agattacgga 2640 tatttaactt acttagaata atgccatttt tttgagttat aataatccta cgttagtgtg 2700 agcgggattt aaactgtgag gaccttaata cattcagaca cttctgcggt atcaccctac 2760 ttattccctt cgagattata tctaggaacc catcaggttg gtggaagatt acccgttcta 2620 agacttttca gcttcctcta ttgatgttac acctggacac cccttttctg gcatccagtt 2880 tttaatcttc agtggcatgt gagattctcc gaaattaatt aaagcaatca cacaattctc 2940 tcggatacca cctcggttga aactgacagg tggtttgtta cgcatgctaa tgcaaaggag 3000 cctatatacc tttggctcgg ctgctgtaac agggaatata aagggcagca taatttagga 3060 gtttagtgaa cttgaaacat ttactatttL cccttcttac gtaaatattt ttctttttaa 3120 ttctaaatca atctttttca attttttgtt tgtattcttt tcttgcttaa atctataact 3180 acaaaaaaca catacataaa tctagaaaaa tgtctcaatt cttcttcaac cagagaaccc 3240 acttggtttc tgacgttatc gacggtgcta tcatcgcttc accatggaac aatttggcta 3300 gattggaatc tgacccagct atcagaatcg ttgttagaag agacttgaac aagaacaacg 3360 ttgctgttat ctctggtggt ggttctggtc acgaaccagc tcacgttggt ttcatcggta 3420 agggtatgtt gaccgctgct gtttgtggtg acgttttcgc ttctccatct gttgacgctg 3480 ttttgactgc tatccaagct gttaccggtg aagctggttg tttgttgatc gttaagaact 3540 acaccggtga cagattgaac ttaggrttgg ctgctgaaaa ggctagaaga ttgggttaca 3600 acgttgaaat gttgatcgtt ggtgacgaca tctctttgcc agacaacaag cacccaagag 3660 gtatcgctgg taccatcttg gttcacaaga tcgctggtta cttcgctgaa agaggttaca 3720 acttagctac cgttttgaga gaagctcaat acgctgcttc taacaccttc tctttgggtg 3780 ttgctttgtc ttcttgtcac ctgccacaag aaaccgacgc tgctccaaga caccacccag 3840 gtcacgctga attgggtatg ggtatccacg gtgaaccagg tgcttctgtt atcgacaccc 3900 aaaactctgc tcaagttgtt aacttgatgg ttgacaagtt gttggctgct ttgccagaaa 3960 ccggtagatt ggctgttatg atcaacaact tgggtggtgt ttctgttgct gaaatggcta 4020 tcatcaccag agaattggct tcttctccat tgcactcaag aatcgactgg ttgatcggtc 4080 cagcttcttt ggtaaccgct ttggacatga agggtttctc tttgaccgct atcgttttgg 4140 aagaatctat cgaaaaggct ttgttgaccg aagttgaaac ctctaactgg ccaaccccag 4200 ttccaccaag agaaatcacc tgtgttgttt cttctcacgc ttctgctaga gttgaattcc 4260 aaccatctgc taacgctttg gttgctggta tcgttgaatt ggttaccgct accttgtctg 4320 acttggaaac ccacttgaac gctttggacg ctaaggttgg tgacggtgac accggttcta 4380 ccttcgctgc tgctgctaga gaaatcgctt ctttgttgca cagacaacaa ttgccattga 4440 acaacttggc taccttgttc gctttgatcg gtgaaagatt gaccgttgtt atgggtqgtt 4500 cttctggtgt tttgatgtct atcttcttca ccgctgctgg tcaaaagttg gaacaaggtg 4560 ctaacgttgt tgaagctttg aacaccggtt tggctcaaat gaagttctac ggtggtgctg 4620 acgaaggtga cagaaccatg atcgacgctt tgcaaccagc ttLgacctct ttgttggctc 4680 aaccaaagaa cttgcaagct gctttcgacg ctgctcaagc tggtgctgaa agaacctgtt 4740 tgtcttctaa ggctaacgct ggtagagctt cttacttgtc ttctgaatct ttattaggta 4800 acatggaccc aggtgctcaa agattggcta tggttttcaa ggctttggct gaatctgaat 4860 tgggttaata aggtcgagac aaatcgctct taaatatata cctaaagaac attaaagcta 4920 Lattataagc aaagatacgt aaattttgct tatattatta tacacaLatc atatttctat 4980 atttttaaga tttgqttata taatgtacgt aatgcaaagg aaataaattt tatacattat 5040 tgaacagcgt ccaagtaact acattatgtg cactaatagt ttagcgtcgt gaagacttta 5100 ttgtgtcgcg aaaagtaaaa attttaaaaa ttagagcacc ttgaacttgc gaaaaaggtt 5160 ctcatcaact gtttaaaacg tacgcctagg aagccttcga gcgtcccaaa accttctcaa 5220 gcaaggtttt cagtataatg ttacatgcgt acacgcgttt qtacagaaaa aaaagaaaaa 5280 tttgaaatat aaataacgtt cttaatacta acataactat taaaaaaaat aaatagggac 5340 ctagacttca ggttgtctaa ctccttcctt ttcggttaga gcggatgtgg gaggagggcg 5400 tgaatgtaag cgtgacataa ctaattacat gatatcgaca aaggaaaagg ggcgcgcctt 5460 attcccattc ttgtaggaat ctttgaccgt attggtcagc aaccaacaaa gcagcgtaaa 5520 cttggtctgg ggtagcacca cctggcatgt tgtggatggt ttcaccttca gcacaagcag 5580 cttcagcaac gattctcatc ttagctggaa cgtcttcctt gatgtccaat tgagccaagg 5640 tgattggcaa accaacagcg tgagacaaag cagcaacggt ttcgatttct tcaactggag 5700 cgttttccaa aaccaattgg gtcaaggtac cgaaagcaac cttttcaccg tggtagtagt 5760 ggtgagcgtc tgggatagcg gtcaaaccgt tgtgaacagc gtgagcagca gccaaaccac 5820 cagattcgaa accaacacca gacaagtagg tgttagcttc gataactctt tccaaagctg 5880 gggtaacaac gtgttqttca gcagccaaca tagccttttc accttcttcc aacaaggtgt 5940 tgtaacacaa ttcagccaaa gccaaagcag cttgggtaca cttaccacca gccatggtgg 6000 tagcaccaga tctagaacaa gctctagctt cgaaccaggt agccaaagcg tcaccgatac 6060 cagctgccaa caatctagct ggagcaccag caacgatctt ggtgtcaacg ataaccatgt 6120 ttgggttgtt tggcaacaac aagtatctgt cgaattcacc ttcgtcggtg tagataacag 6180 acaaagcaga acatggagcg tcggtagaag cgatggttgg agcgatagca actggaacac 6240 ccatgaagtg agccaaagcc ttagcggtgt ccaaggtctt accaccaccg atacccaaga 6300 tagcaccaca ttgagcggtt tcagcgatac ctctcaatct gtcgatttcg ttttgagaac 6360 attcaccacc gaatggagcg atttcaacaa ccaaaccagc gtccttgaaa gacttttcaa 6420 cggtagattg agcgaaaccc aaaacgaact tgtcaccaac aaccaaccat ctttcagcca 6480 atggcttcaa gtattcaccc aatctgttga taacgtcagc accttggatg tacttacctg 6540 gagattggat gattctgtcc attttctgca gttaattcag taaattttcg atcttgggaa 6600 gaaaaaagca gtaagcgtga aaaatctaaa agctgatgta gtagaagatc ctattcttta 6660 acaaagattg accttttctt tttottottg gtttgagtag aaaggggaag gaagaataca 6720 agagagagga aaaaaaggaa gataaaaaga gagcgtgata taaatgaata tatattaaac 6780 aagagagatt gggaaggaaa ggatcaaaca aacccaaaaa tatttcaaaa aggagagaga 6840 gaggcgagtt tggtttcaaa acggtttatt tatttatgca agaggacgtg gaagaaaaag 6900 aagaaggaag aaaaaaattt gaaagaaaaa aacgcgtggc gggtaaagaa gaaaatggaa 6960 aatagaggcc gggtgacaga gaaatattga gggttaattg gaaaatatgt tagggtgagg 7020 catatgtttt taagggtttt gaggatccga taaggaagaa tgtaggttaa atgttgtgca 7080 ttaatLgctg tggcagctta cccgcttccc cacacattta cLagtctcga gctcttcaac 7140 tcaagacgca cagatattat aacatctgca taataggcat ttgcaagaat tactcgtgag 7200 taaggaaaga gtgaggaact atcgcatacc tgcatttaaa gatgccgatt tgggcgcgaa 7260 tcctttattt tggcttcacc ctcatactat tatcagggcc agaaaaagga agtgtttccc 7320 tccttcttga attgatgtta ccctcataaa gcacgtggcc tcttatcgag aaagaaatta 7380 ccgtcgctcg tgatttgttt gcaaaaagaa caaaactgaa aaaacccaga cacgctcgac 7440 ttcctgtctt cctattgatt gcagcttcca atttcgtcac acaacaaggt cctagcgacg 7500 gctcacaggt tttgtaacaa gcaatcgaag gttctggaat ggcgggaaag ggtttagtac 7560 cacatgctat gatgcccact gtgatctcca gagcaaagtt cgttcgatcg tactgttact 7620 ctctctcttt caaacagaat tgtccgaatc gtgtgacaac aacagcctgt tctcacacac 7680 tcttttcttc taaccaaggg ggtggtttag tttagtagaa cctcgtgaaa cttacattta 7740 catatatata aacttgcata aattggtcaa tgcaagaaat acatatttgg tcttttctaa 7800 ttcgtagttt ttcaagttct tagatgcttt ctttttctct tttttacaga tcatcaagga 7860 agtaattatc tactttttac aacaaatata tctagaaaat ggctgttacc aacgttgctg 7920 aattgaacgc tttggttgaa agggttaaga aggctcaaag agaatacgct tctttcaccc 7980 aagaacaagt tgacaagatc ttcagagctg ctgct_ttggc tgctgctgac gctagaatcc 8040 cattggctaa gatggctgtt gctgaatctg gtatgggtat cgttgaagac aaggttatca 8100 agaaccactt cgcttctgaa tacatctaca acgcttacaa ggacgaaaag acctgtggtg 8160 ttttgtcaga agacgacacc ttcggtacca tcaccatcgc tgaaccaatc ggtatcatct 8220 gtggtatcgt tccaaccacc aacccaacct ctaccgctat cttcaagtct ttgatctctt 8280 tgaagaccag aaacgctatc atcttctctc cacacccaag agctaaagac gcaccaaca 8340 aggctgctga catcgttttg caagctgcta tcgctgctgg tgctccaaag gacttgatcg 8400 gttggatcga ccaaccatct gttgaattgt ctaacgcttt gatgcaccac ccagacatca 8460 acttgatctt ggctaccggt ggtccaggta tggttaaggc tgcttactct tctggtaagc 8520 cagctatcgg Lgttggtgct ggtaacaccc cagttgttat cgacgaaacc gctgacatca 8580 agagagctgt tgcttctgtt ttgatgtcta agaccttcga caacggtgtt atctgtgctt 8640 ctgaacaatc tqttgttgtt gttgactctg tttacgacgc tgttagagaa agattcgcta 8700 cccacggtgg ttacttgttg caaggtaagg aattgaaggc tgttcaagac gttatcttga 8760 agaacggtgc tttgaacgct gctatcgttg gtcaaccagc ttacaagatc gctgaattag 8820 ctggtttctc tgttccagaa aacaccaaga tcttgatcgg tgaagttacc gttgttgacg 8880 aatctgaacc attcgctcac gaaaagttgt ctccaacctt ggctatgtac agagctaagg 8940 acttcgaaga cgctgttgaa aaagctgaaa agttggttgc tatgggtggt attggtcaca 9000 cctcttgttt gtacaccgac caagacaacc aaccagctag agtttcttac ttcggtcaaa 9060 agatgaagac cgctagaatc ttgatcaaca ccccagcttc tcaaggtggt atcggtgact 9120 tgtacaactt caagttggct ccatctttga ccttgggttg tggttcttgg ggtggtaact 9180 ctatctctga aaacgttggt ccaaagcact tgatcaacaa gaagaccgtt gctaagagag 9240 ctgaaaacat gttgtggcac aagttgccaa aatctatcta cttcagaaga ggttctttgc 9300 caatcgcLLt ggacgaagtt atcaccgacg gtcacaagag agctttgatc gttaccgaca 9360 gattcttgtt caacaacggt tacgctgacc aaatcacctc tgttttgaaq gctgctggtg 9420 ttgaaaccga agttttcttc gaagttgaag ctgacccaac cttgtctatc gttagaaagg 9480 gtgctgaatt ggctaactct ttcaagccag acgttatcat cgctttgggt ggtggttctc 9540 caatggacgc tgctaagatc atgtgggtta tgtacgaaca cccagaaacc cacttcgaag 9600 aattggcttt gagattcatg gacatcagaa agagaatcta caagttccca aagatgggtg 9660 ttaaggctaa gatgatcgct gttaccacca cctctggtac cqqttctgaa gttaccccat 9720 tcgctgttgt taccgacgac gctaccggtc aaaagtaccc attgcctgac tacgctttga 9780 ccccagacat ggctatcgtt gacgctaact tggttatgga catgccaaag tctttgtgtg 9840 ctttcggtgg tttggacgct gttacccacg ctatggaagc ttacgtttct gttttggctt 9900 ctgaattctc tgacggtcaa gctttgcaag ctttgaagtt gttgaaggaa tacttgccag 9960 cttcttacca cgaaggttct aagaacccag ttgctagaga aagagttcac tctgctgcta 10020 ccatcgctgg tatcgctttc gctaacgctt tcttgggtgt ttgtcactct atggctcaca 10080 agttgggttc tcaattccac atcccacacg gtttggctaa cgctttgttg atctgtaacg 10140 ttatcagata caacgctaac gacaacccaa ccaagcaaac cgctttctct caatacgaca 10200 gaccacaagc tagaagaaga tacgctgaaa tcgctgacca cttgggtttg tctgctccag 10260 gtgacagaac cgctgcaaaq atcgaaaagt tattggcttg gttggaaacc ttgaaggctg 10320 aattgggtat cccaaagtct atcagagaag ctggtgttca agaagctqac ttcttggcta 10380 acgttgacaa gttgtctgaa gacgctttcg acgaccaatg taccggtgct aacccaagat 10440 acccattgat ctctgaattg aagcaaatct tgttggacac ctactacggt agagactacg 10500 ttgaaggtga aaccgctgct aagaaggaag ctgctccagc taagactgaa aagaaggcta 10560 agaagtctgc ttagcttaag cgcgcgaatt tcttatgatt tatgattttt attattaaat 10620 aagttataaa aaaaataagt gtatacaaat tttaaagtga ctcttaggtt ttaaaacgaa 10680 aattcttatt cttgagtaac tctttcctgt aggtcaggtt gctttctcag gtatagcatg 10740 aggtcgctct tattgaccac acctctaccg gcatgccgag caaatgcctg caaatcgctc 10800 cccatttcac ccaattgtag atatgctaac tccagcaatg agttgatgaa tctcggtgtg 10860 tattttatgt cctcagagga caacacctgt tgtaatcgtt cttccacacg tacgaagctt 10920 aaaaggqcga attc-cgcaga tatccatcac actggcggcc gcatgctagc tccggattat 10980 cgatgataag ctgtcaaaga tgagaattaa ttccacggac tatagactat actagatact 11040 ccgtctactg tacgatacac ttccgctcag gtccttgtcc tttaacgagg ccttaccact 11100 cttttgttac tctattgatc cagctcagca aaggcagtgt gatctaagat tctatcttcg 11160 cgatgtagta aaactagcta gaccgagaaa gagactagaa atgcaaaagg cacttctaca 11220 atggctgcca tcattattat ccgatgtgac gctgcagctt ctcaatgata ttcgaatacg 11280 ctttgaggag atacagccta atatccgaca aactgtttta cagatttacg atcgtacttg 11340 ttacccatca ttgaattttg aacatccgaa cctgggagtt ttccctgaaa cagatagtat 11400 atttgaacct gtataataat atatagtcta gcgctttacg gaagacaatg tatgtatttc 11460 ggttcctgga gaaactattg catctattqc ataggtaatc ttqcacgtcg catcaccggt 11520 tcattttctg cgtttccatc ttgcacttca atagcatatc tttgttaacg aagcatctgt 11580 gcttcatttt gtagaacaaa aatgcaacgc gagagcgcta atttttcaaa caaagaatct 11640 gagctgcatt tttacagaac agaaatgcaa cgcgaaagcg ctattttacc aacgaagaat 11700 ctgtgcttca tttttgtaaa acaaaaatgc aacgcgacga gagcgctaat ttttcaaaca 11760 aagaatctga gctgcatttt tacagaacag aaatgcaacg cgagagcgct attttaccaa 11820 caaagaatct atacttcttt tttgttctac aaaaatgcat cccgagagcg ctatttttct 11880 aacaaagcat cttagattac LttLtttctc cUtgtgcgc tctataatgc agtotattga 11940 taactttttg cactgtaggt ccgttaaggt tagaagaagg ctactttggt gtctattttc 12000 tottccataa aaaaagcctg actccacttc ccgcgtttac tgattactag cgaagctgcg 12060 ggtgcatttt ttcaagataa aggcatcccc gattatattc tataccgatg tggattgcgc 12120 atactttgtg aacagaaagt gatagcgttg atgattcttc attggtcaga daattatgaa 12180 cggtttcttc tattttgtct ctatatacta cgtataggaa atgtttacat tttcgtattg 12240 ttttcgattc actctatgaa tagttcttac tacaattttt ttgtctaaag agtaatacta 12300 gagataaaca taaaaaatgt agaggtcgag tttagatqca agttcaagga gcgaaaggtg 12360 gatgggtagg ttatataggg atatagcaca gagatatata gcaaagagat acttttgagc 12420 aatgtttgtg gaagcggtat tcgcaatgcc ggctttcccc gtcaagctct aaatcggggg 12480 ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa acttgattag 12540 ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc tttgacgttg 12600 gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact caaccctatc 12660 tcggtctatt cttttgattt ataagggatt ttgccgattt cggcctattg gttaaaaaat 12720 gagctgattt aacaaaaatt taacgcgaat tttaacaaaa tattaacgtt tacaatttcc 12780 tqatgaggta ttttctcctt acgcatctgt gcggtatttc acaccgcata tgatccgtcg 12840 agttcaagag aaaaaaaaag aaaaagcaaa aagaaaaaag gaaagcgcgc ctcgttcaga 12900 atgacacgta tagaatgatg cattaccttg tcatcttcag tatcatactg ttcgtataca 12960 tacttactga cattcatagg tatacatata tacacatgta tatatatcgt atgctgcagc 13020 tttaaataat cggtgtcact acataagaac acctttggtg gagggaacat cgttggtacc 13080 attgggcgag gtggcttctc ttatggcaac cgcaagagcc ttgaacgcac tctcactacg 13140 gtgatgatca ttattgcctc gcagacaatc aacgtggagg gtaattctgc tagcctctgc 13200 aaagctttca agaaaatgcg ggatcatctc gcaagagaga tctcctactt tctacctttg 13260 caaaccaagt tcgacaactg cgtacggcct gttcgaaaga tctaccaccg ctctggaaag 13320 tgcctcatcc aaaggcgcaa atcctgatcc aaaccttttt actccacgcg ccagtagggc 13380 ctctttaaaa gcttgaccga gagcaatccc gcagtcttca gtggtgtgat ggtcgtctat 13440 gtgtaagtca ccaatgcact caacgattag cgaccagccg gaatgcttgg ccagagcatg 13500 tatcatatgg tccagaaacc ctatacctgt gtggacgtta atcacttgcg attgtgtggc 13560 ctgttctgct actgattctg cctctttttc tgggaagatc gagtgctcta tcgctagggg 13620 accacccttt aaagagatcg caatctgaat cttggtttca tttgtaatac qctttactag 13680 ggctttctgc tctgtcatct ttgccttcgt ttatcttgcc tgctcatttt ttagtatatt 13740 cttcgaagaa atcacattac tttatataat gtataattca ttatgtgata atgccaatcg 13800 ctaagaaaaa aaaagagtca tccgctaggt ggaaaaaaaa aaatgaaaat cattaccgag 13860 gcataaaaaa atatagagtg tactagagga ggccaagagt aatagaaaaa gaaaattgcg 13920 ggaaaggact gtgttatgac ttccctgact aataccgtgt tcaaacgata cctggcagtg 13980 actcctagcg ctcaccaagc tcttaaaacg gaattatggt gcactctcag tacaatctgc 14040 tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga 14100 cgggcttgtc tgatccaggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 14160 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 14200 <210> 56 <211> 11289 <212> DNA
<213> Artificial Sequence <220>
<223> pR1958 <400> 56 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataagacgtc 60 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 120 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat_ aatattgaaa 180 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 240 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 300 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tcattgagag 360 tiattcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 420 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 480 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 540 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 600 gacaacgatc ggaggaccga aggagctaac cgcttttttt cacaacatgg gggatcatgt 660 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 720 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 780 tactctagct tccaggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 840 acttctgcgc taggccattc cggctggctg gtttattgct gataaatctg gagccggtga 900 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt 960 agttatctac acgacgggca gtcaggcaac tatggatgaa cgaaatagac agatcgctga 1020 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact 1080 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 1140 taatctcatg accaaaatcc cttaacqtga gttttcgttc cactgagcgt cagaccccgt 1200 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 1260 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 1320 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 1380 gccgtagtta ggccaccact tcaagaactc tqtagcaccg cctacatacc tcgctctgct 1440 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtottaccg ggttggactc 1500 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 1560 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga 1620 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 1680 aacaggagag cgcacgaggg agcttccagg ggggaacgcc tggtatcttt atagtcctgt 1740 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggccgag 1800 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 1860 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 1920 tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 1980 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 2040 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 2100 tgtgagttac ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcctat 2160 gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta 2220 cgccaagctc ggaattaacc ctcactaaag ggaacaaaag ctgggtaccg ggccctagga 2280 agccttcgag cgtcccaaaa ccttctcaag caaqqttttc agtataatgt tacatgcgta 2340 cacgcgtttg tacagaaaaa aaagaaaaat ttgaaatata aataacgttc ttaatactaa 2400 cataactatt aaaaaaaata aatagggacc tagacttcag gttgtctaac tccttccttt 2460 tcggttagag cggatgtggg aggagggcgt gaatgtaagc gtgacataac taattacatg 2520 atatcgacaa aggaaaaggg gcgcgcctta ttcccattct tgtaggaatc tttgaccgta 2580 ttggtcagca accaacaaag cagcgtaaac ttggtctggg gtagcaccac ctggcatgtt 2640 gtggatggtt tcaccttcag cacaagcagc ttcagcaacg attctcatct tagctggaac 2700 gtcttccttg atgtccaatt gagccaaggt gattggcaaa ccaacagcgt gagacaaagc 2760 agcaacggtt tcgatttctt caactggagc gttttccaaa accaattggg tcaaggtacc 2820 gaaagcaacc ttttcaccgt ggtagtagtg gtgagcgtct gggatagcgg tcaaaccgtt 2880 gtgaacagcg tgagcagcag ccaaaccacc agattcgaaa ccaacaccag acaagtaggt 2940 gttagcttcg ataactcttt ccaaagctgg ggtaacaacg tgttgttcag cagccaacat 3000 agccttttca ccttcttcca acaaggtgtt gtaacacaat tcagccaaag ccaaagcagc 3060 ttgggtacac ttaccaccag ccatggtggt agcaccagat ctagaacaag ctctagcttc 3120 gaaccaggta gccaaagcgt caccgatacc agctgccaac aatctagctg gagcaccagc 3160 aacgatcttg gtgtcaacga taaccatgtt tgggttgttt ggcaacaaca agtatctgtc 3240 gaattcacct tcgtcggtgt agataacaga caaagcagaa catggagcgt cggtagaagc 3300 gatggttgga gcgatagcaa ctggaacacc catgaagtga gccaaagcct tagcggtgtc 3360 caaggtctta ccaccaccga tacccaagat agcaccacat tgagcggttt cagcgatacc 3420 tctcaatctg tcgatttcgt tttgagaaca ttcaccaccg aatggagcga tttcaacaac 3480 caaaccagcg tccttgaaag acttttcaac ggtagattga gcgaaaccca aaacgaactt 3540 gtcaccaaca accaaccatc tttcagccaa tggcttcaag tattcaccca atctgttgat 3600 aacgtcagca ccttggatgt acttacctgg agattggatg attctgtcca ttttctgcag 3660 ttaattcagt aaattttcga tcttgggaag aaaaaagcag taagcgtgaa aaatctaaaa 3720 gctgatgtag tagaagatcc tattctttaa caaagattga ccttttcttt ttcttcttgg 3780 tttgagtaga aaggggaagg aagaatacaa gagagaggaa aaaaaggaag ataaaaagag 3840 agcgtgatat aaatgaatat atattaaaca agagagattg ggaaggaaag gatcaaacaa 3900 acccaaaaat atttcaaaaa ggagagagag aggcgagttt ggtttcaaaa cggtttattt 3960 atttatgcaa gaggacgtgg aagaaaaaga agaaggaaga aaaaaatttg aaagaaaaaa 4020 acqcgtggcg ggtaaagaag aaaatggaaa atagaggccg ggtgacagag aaatattgag 4080 ggttaattgg aaaatatgtt agggtgaggc atatgttttt aagggttttg aggatccgat 4140 aaggaagaat gtaggttaaa tgttgtgcat taattgctgt ggcagcttac ccgcttcccc 4200 acacatttac tagtctcgag ctcttcaact caagacgcac agatattata acatctgcat 4260 aataggcatt tgcaagaatt actcgtgagt aaggaaagag tgaggaacta tcgcatacct 4320 gcatttaaag atgccgattt gggcgcgaat cctttatttt ggcttcaccc tcatactatt 4380 atcagggcca gaaaaaggaa gtgtttccct ccttcttgaa ttgatgttac cctcataaag 4440 cacgtggcct cttatcgaga aagaaattac cgtcgctcgt gatttgtttg caaaaagaac 4500 aaaactgaaa aaacccagac acgctcgact tcctgtcttc ctattgattg cagcttccaa 4560 tttcgtcaca caacaaggtc ctagcgacgg ctcacaggtt ttgtaacaag caatcgaagg 4620 ttctggaatg gcgggaaagq gtttagtacc acatgctatg atgcccactg tgatctccag 4680 agcaaagttc gttcgatcgt actgttactc tctctctttc aaacagaatt gtccgaatcg 4740 tgtgacaaca acagcctgtt ctcacacact ctLttottot aaccaagggg gtggtttagt 4800 ttagtagaac ctcgtgaaac ttacatttac atatatataa acttgcataa attggtcaat 4860 gcaagaaata catatttggt cttttctaat tcgtagtttt tcaagttctt agatgctttc 4920 tttttctctt ttttacagat catcaaggaa gtaattatct actttttaca acaaatatat 4980 ctagaaaatg gctgttacca acgttgctga attgaacgct ttggttgaaa gggttaagaa 5040 ggctcaaaga gaatacgctt ctttcaccca agaacaagtt gacaagatct tcagagctgc 5100 tgctttggct gctgctgacg ctagaatccc attggctaag atggctgttg ctgaatctgg 5160 tatgggtatc gttgaagaca aggttatcaa gaaccacttc gcttctgaat acatctacaa 5220 cgcttacaag gacgaaaaqa cctgtggtgt tttgtcagaa gacgacacct tcggtaccat 5280 caccatcgct gaaccaatcg gtatcatctg tggtatcgtt ccaaccacca acccaacctc 5340 taccgctatc ttcaagtctt tgatctcttt gaagaccaga aacgctatca tcttctctcc 5400 acacccaaga gctaaagacg ctaccaacaa ggctgctgac atcgttttgc aagctgctat 5460 cgctgctggt gctccaaagg acttgatcgg ttggatcgac caaccatctg ttgaattgtc 5520 taacgctttg atgcaccacc cagacatcaa cttgatcttg gctaccggtg gtccaggtat 5580 ggttaaggct gcttactctt ctggtaagcc agctatcggt gttggtgctg gtaacacccc 5640 agttgttatc gacgaaaccg ctgacatcaa gagagctgtt gcttctgttt tgatgtctaa 5700 gaccttcgac aacggtgtta tctgtgcttc tgaacaatct gttgttgttg ttgactctgt 5760 ttacgacgct gttagagaaa gattcgctac ccacggtggt tacttgttqc aaggtaagga 5820 attgaaggct gttcaagacg ttatcttgaa gaacggtgct ttgaacgctg ctatcgttgg 5880 tcaaccagct tacaagatcg ctgaattagc tggtttctct gttccagaaa acaccaagat 5940 cttgatcggt gaagttaccg ttgttgacga atctgaacca ttcgctcacg aaaagttgtc 6000 tccaaccttg gctatgtaca gagctaagga cttcgaagac gctgttgaaa aagctgaaaa 6060 gttggttgct atgggtggta ttggtcacac ctcttgtttg tacaccgacc aagacaacca 6120 accagctaga gtttcttact tcggtcaaaa gatgaagacc gctagaatct tgatcaacac 6180 cccagcttct caaggtggta tcggtgactt gtacaacttc aagttggctc catctttgac 6240 cttgggttgt ggttcttggg gtggtaactc tatctctgaa aacgttggtc caaagcactt 6300 gatcaacaag aagaccgttg ctaagagagc tgaaaacatg ttgtggcaca agttgccaaa 6360 atctatctac ttcagaagag gttctttgcc aatcgctttg gacgaagtta tcaccgacgg 6420 tcacaagaga gctttgatcg ttaccgacag attcttgttc aacaacggtt acgctgacca 6480 aatcacctct gttttgaagg ctgctggtgt tgaaaccgaa gttttcttcg aagttgaagc 6540 tgacccaacc ttgtctatcq ttagaaaggg tgctgaattg gctaactctt tcaagccaga 6600 cgttatcatc gctttgggtg gtggttctcc aatggacgct gctaagatca tgtgggttat 6660 gtacgaacac ccagaaaccc acttcgaaga attggctttg agattcatgg acatcagaaa 6720 gagaatctac aagttcccaa agatgggtgt taaggctaag atgatcgctg ttaccaccac 6780 ctctggtacc ggttctgaag ttaccccatt cgctgttgtt accgacgacg ctaccggtca 6840 aaagtaccca ttggctgact acgctttgac cccagacatg gctatcgttg acgctaactt 6900 ggttatggac atgccaaagt ctttgtgtgc tttcggtggt ttggacgctg ttacccacgc 6960 tatggaagct tacgtttctg ttttggcttc tgaattctct gacggtcaag ctttgcaagc 7020 tttgaagttg ttgaaggaat acttgccagc ttcttaccac gaaggttcta agaacccagt 7080 tgctagagaa agagttcact ctgctgctac catcgctggt atcgctttcg ctaacgcttt 7140 cttgggtgtt tgtcactcta tggctcacaa gttgggttct caattccaca tcccacacgg 7200 tttggctaac gctttqttqa tctgtaacgt tatcagatac aacgctaacg acaacccaac 7260 caagcaaacc gctttctctc aatacgacag accacaagct agaagaagat acgctgaaat 7320 cgctgaccac ttgggtttgt ctgctccagg tgacagaacc gctgcaaaga tcgaaaagtt 7380 gttggcttgg ttggaaacct tgaaggctga attgggtatc ccaaagtcta tcagagaagc 7440 tggtgttcaa gaagctgact tcttggctaa cgttgacaag ttgtctgaag acgctttcga 7500 cgaccaatgt accggtqcta acccaagata cccattgatc tctgaattga agcaaatctt 7560 gttggacacc tactacggta gagactacgt tgaaggtgaa accgctgcta agaaggaagc 7620 tgctccagct aaggctgaaa agaaggctaa gaagtctgct tagcttaagc gcgcgaattt 7680 cttatgattt atgattttta ttattaaata agttataaaa aaaataagtg tatacaiaLL 7740 ttaaagtgac tcttaggttt taaaacgaaa attcttattc ttgagtaact ctttcctgta 7800 ggtcaggttg ctttctcagg tatagcatga ggtcgctctt attgaccaca cctctaccgg 7860 catgccgagc aaatgcctgc aaatcgctcc ccattLcacc caattgtaga tatgctaact 7920 ccagcaatga gttgatgaat ctcggtgtgt attttatgtc ctcagaggac aacacctgtt 7980 gtaatcgttc ttccacacgt acgaagctta aaagggcgaa ttctgcagat atccatcaca 8040 ctggcggccg catgctagct ccggattatc gatgataagc tgtcaaagat gagaattaat 8100 tccacggact atagactata ctagatactc cgtctactgt acgatacact tccgctcagg 8160 tccttgtcct ttaacgaggc cttaccactc ttttgttact ctattgatcc agctcagcaa 8220 aggcagtgtg atctaagatt ctatcttcgc gargtagtaa aactagctag accgagaaag 8260 agactagaaa tgcaaaaggc acttctacaa tggctgccat cattattatc cgatgtgacg 8340 ctgcagcttc tcaatgatat tcgaatacgc tttgaggaga tacagcctaa tatccgacaa 8400 actgttttac agatttacga tcgtacttgt tacccatcat tgaattttga acatccgaac 8460 ctgggagttt tccctgaaac agatagtata tttgaacctg tataataata tatagtCtag 8520 cgctttacgg aagacaatgt atgtatttcg gttcctggag aaactattgc atctattgca 8580 taggtaatct tgcacgtcgc atccccggtt cattttctgc gtttccatct tgcacttcaa 8640 tagcatatct ttgttaacga agcatctgtg cttcattttg tagaacaaaa atgcaacgcg 8700 agagcgctaa tttttcaaac aaagaatctg agctgcattt ttacagaaca gaaatgcaac 8760 gcgaaagcgc tattttacca acgaagaatc tgtgcttcat ttttgtaaaa caaaaatgca 8820 acgcgacgag agcgctaatt tttcaaacaa agaatctgag ctgcattttt acagaacaga 8880 aatgcaacgc gagagcgcta ttttaccaac aaagaatcta tacttctttt ttgttctaca 8940 aaaatgcatc ccgagagcgc tatttttcta acaaagcatc ttagattact ttttttctcc 9000 tttgtgcgct ctataatgca gtctcttgat aactttttgc actgtaggtc cgttaaggtt 9060 agaagaaggc tactttggtg tctattttct cttccataaa aaaagcctga ctccacttcc 9120 cgcgtttact gattactagc gaagctgcgg gtgcattttt tcaagataaa ggcatccccg 9180 attatattct ataccgatgt ggattgcgca tactttgtga acagaaagtg atagcgttga 9240 tgattcttca ttggtcagaa aattatgaac ggtttcttct attttgtctc tatatactac 9300 gtataggaaa tgtttacatt ttcgtattgt Lttcgattca ctctatgaat agttcttact 9360 acaatttttt tgtctaaaga gtaatactag agataaacat aaaaaatgta gaggtcgagt 9420 ttagatgcaa gttcaaggag cgaaaggtgg atgggtaggt tatataggga tatagcacag 9480 agatatatag caaagagata cttttgagca atgtttgtgg aagcggtatt cgcaatgccg 9540 gatttocccg tcaagetcta aatcgggggc tccctttagg gttccgattt agtgctttac 9600 ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct 9660 gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt 9720 tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta taagggattt 9780 tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt 9840 ttaacaaaat attaacgttt acaatttcct gatgcggtat tttctcctta cgcatctgtg 9900 cggtatttca caccgcatat gatccgtcga gttcaagaga aaaaaaaaga aaaagcaaaa 9960 agaaaaaagg aaagcgcgcc tcgttcagaa tgacacgtat agaatgatgc attaccttgt 10020 catattcagt atcatactgt tcgtatacat acttactgac attcataggt atacatatat 10080 acacatgtat atatatcgta tgctgcagct ttaaataatc ggtgtcacta cataagaaca 10140 cctttggtgg agggaacatc gttggtacca ttgggcgagg tggcttctct tatggcaacc 10200 gcaagagcct tgaacgcact ctcactacgg tgatgatcat tcttgcctcg cagacaatca 10260 acgtggaggg taattctgct agcctctgca aagctttcaa gaaaatgcgg gatcatctcg 10320 caagagagat ctcctacttt ctccctttgc aaaccaagtt cgacaactgc gtacggcctg 10380 ttcgaaagat ctaccaccgc tctggaaagt gcctcatcca aaggcgcaaa tcctgatcca 10440 aaccttttta ctccacgcgc cagtagggcc tctttaaaag cttgaccgag agcaatcccg 10500 cagtcttcag tggtgtgatg gtcgtctatg tgtaagtcac caatgcactc aacgattagc 10560 gaccagccgg aatgcttggc cagagcatgt atcatatggt ccagaaaccc tatacctgtg 10620 tggacgttaa tcacttgcga ttgtgtggcc tgttctgcta ctgcttctgc ctctttttct 10680 gggaagatcg agtgctctat cgctagggga ccaccctrta aagagatcgc aatctgaatc 10740 ttggtttcat ttgtaatacg ctttactagg gctttctgct ctgtcatctt tgccttcgtt 10800 tatottgcct gctcattttt tagtatattc ttcgaagaaa tcacattact ttatataatg 10860 tataattcat tatgtqataa tgccaatcgc taagaaaaaa aaagagtcat ccgctaggtg 10920 gaaaaaaaaa aatgaaaatc attaccgagg cataaaaaaa tatagagtgt actagaggag 10980 gccaagagta atagaaaaag aaaattgcgg gaaaggactg tgttatgact tccctgacta 11040 atgccgtgtt caaacgatac ctggcagtga ctcctagcgc tcaccaagct cttaaaacgg 11100 aattatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagccccgac 11160 acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca 11220 gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg tcatcaccga 11280 aacgcgcga 11269 <210> 57 <211> 11102 <212> DNA
<213> Artificial Sequence <220>
<223> pRN607 <400> 57 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 60 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 120 gatacctaca gcgtgagcat tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 180 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagatt ccagggggga 240 acgcctggta tctttataqt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 300 tgtgatgctc gtcagggggg ccgagcctat ggaaaaacgc cagcaacgcg gcctttttac 360 ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta tcccctgatt 420 ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc agccgaacga 480 ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cccaatacgc aaaccgcctc 540 tccccgcgcg ttggccgatt cattaatqca gctggcacga caggtttccc gactggaaag 600 cgggcagtga gcgcaacgca attaatgtga gttacctcac tcattaggca ccccaggctt 660 tacactttat gcttccggct cctatgttgt gtggaattgt gagcggataa caatttcaca 720 caggaaacag ctatgaccat gattacgcca agctcggaat taaccctcac taaagggaac 780 aaaagctggg tacgttttaa acagttgatg agaacctttt tcgcaagttc aaggtgctct 840 aatttttaaa atttttactt ttcgcgacac aataaagtct tcacgacgct aaactattag 900 tgcacataat gtagttactt ggacgctgtt caataatgta taaaatttat ttcctttgca 960 ttacgtacat tatataacca aatcttaaaa atatagaaat atgatatgtg tataataata 1020 taagcaaaat ttacgtatct ttgcttataa tatagcttta atgttcttta ggtatatatt 1080 taagagcgat ttgtctcgac ttacaaggcg ctttgaaccc ccttcaaaaa ctcacatagg 1140 cctactgcac caqqatcttc tacttgagat gaatcgccga catacgaagc tctgccaaat 1200 ttggcctcga atgtagcagt ggatttagca ccttcctctg cagcttttac cgccttattg 1260 aaatccttag atgcagtaaa ttctttaacg aatggttcta aagcatcaat catggtggat 1320 gatcccttcc ttgcctttgt atatttgtat aaagtatcca atgcaattcc gagtgactta 1380 gccacaattt ccttagtgac gggttcatcc tttgatttac aaacctgaat taatccgtgt 1440 gaaaaacccg acaaaagaat agaatataaa ccaccagaag tacctcccat tgagccttca 1500 atgaaatctg aaatttgggc aaccgcctga gataatgagt ccttcgacag cttgtcaagg 1560 ttttcggtga tgcctttaac tcctgccact aaagtgtaac cacdatcacc atcaccaact 1620 tgattgtcta gttccgtaat gtgcggttcg ctcttgataa cttgttcagc accactcttc 1680 atccactcag caaacttgtc aaagtcatag gtaccgacgg cctttgctgt tacttcatta 1740 tgtaacaagt catcgttaac agatggggca gaagtctttt caaaatctgc aattggccag 1800 cccggtgcgt tcgtaaatgc gttcaacaag tctagtactg atttgatctc ctcaaaatca 1860 gattgcaaag cctttgtagc cttagtggcg tttagtaatg tgatactgaa cccattacca 1920 ttgaaggagg tcatcaatgt gccagcaatt gtttgaaccg gggttatgtt gtaattttcc 1980 tttaagaaat ccgtagtttt ggaagtgata gaactaataa caaaattaga aacaccgccg 2040 agattgttaa ctaacaagac aacttcatca tcttcatcaa actttacaaa agctctatcc 2100 ttatcgtttg gatccaatag ttttggtagc atatacttgg agatcaagtc ttcggtagaa 2160 ggaatagggt ctaaaacttt cacaccaggt tcgttatgaa tacccatacc caattccatt 2220 tgtttttcqt ttaattcact ttcgaatttc ctgccaggaa ctttacaatg gtctaaagaa 2280 gatccaatgg tcaccaaatc gtcgttgata attttagcca ctttagctgt accgtctaag 2340 ccatacttac tagaatattc ttctgcgaag gcacctacaa tcttatgaac caaaacggta 2400 cctgccaatg ctcttctacc aaccatacca cccttttctc tgccaactgc aacatcatca 2460 cctatgacag caacgcggca gttaataccc aaggctcttg ctctctcagc ggacagacca 2520 aaatgcaaaa catcacctgt gtagttcttc acaatcaata aaacgccaga cgcattttca 2580 ttgactaaac ggattgcatt taaaatctgt tttgttgaag gggatgcaaa aatttcgcca 2640 accacggcgc cactcaacat acccttacca atgaaaccgg cgtgtgtagg ttcatgtcca 2700 ctaccaccac cagaaattaa tgcgatcttg tcggaatcgg tctttctgaa gagaattttt 2760 tcttcaggga ccagcgtaat ggaggggtta gcaagggcaa accctttgag acttgaattg 2820 actggatctg tgacttcaaa cgatttagcg gacattttct agatttatgt atgtgttttt 2880 tgtagttata gatttaagca agaaaagaat acaaacaaaa aattgaaadd gattgattta 2940 gaattaaaaa gaaaaatatt tacgtaagaa gggaaaatag taaatgttgc aagttcacta 3000 aactcctaaa ttatgctgcc ctttatattc cctgttacag cagccgagcc aaaggtatat 3060 aggctccttt qcattagcat gcgtaacaaa ccacctgtca gtttcaaccg aggtggtatc 3120 cgagagaatt gtgtgattgc tttaattaat ttcggagaat ctcacatgcc actgaagatt 3180 aaaaactgga tgccagaaaa ggggtgtcca ggtgtaacat caatagagga agctgaaaag 3240 tcttagaacg ggtaatcttc caccaacctg atgggttcct agatataatc tcgaagggaa 3300 taagtagggt gataccgcag aagtgtctga atgtattaag gtcctcacag tttaaatccc 3360 gctcacacta acgtaggatt attataactc aaaaaaatgg cattattcta agtaagttaa 3420 atatccgtaa tctttaaaca ctatgtagtt aggtctccct cacaatcagt ccatttgggt 3480 agcacggtcc tcaggacgta tctattgatg gattcgtcca gttccatcac cattacgctc 3540 ccgttaggaa cattggtaaa cgattcaaac tottcgtatg tccatctaaa ccatttcatc 3600 aggaatactc tggaataaat accatgtgta actaggacaa caacatctct gggtcttctc 3660 tcttgcctat catggaagtg cctgaataaa gtctcttgga aactggcgac tctgtcatat 3720 acatctgccg cactttctcc atgagggaat ctgaagaaga aaccggttta tcattatcaa 3780 tactgccatt tcaaagaata cgtaaataat taatagtagt gattttccta actttattta 3840 gtcaaaaaat tagcctttta attctgctgt aacccgtaca tgcccaaaat agggggcggg 3900 ttacacagaa tatataacat cgtaggtgtc tgggtgaaca gtttattcct ggcatccact 3960 aaatataatg gagcccgctt tttaagctgg catccagaaa aaaaaagaat cccagcacca 4020 aaatattgtt ttcttcacca accatcagtt cataggtcca ttctcttagc gcaactacag 4080 agaacagggg cacaaacagg caaaaaacgg gcacaacctc aatggagtga tgcaacctgc 4140 ctggagtaaa tgatgacaca aggcaattga cccacgcatg tatctatctc attttcttac 4200 accttctatt accttctgct ctctctgatt tggaaaaagc tgaaaaaaaa ggttgaaacc 4260 agttccctga aattattccc ctacttgact aataaqtata taaagacggt aggtattgat 4320 tgtaattctg taaatctatt tcttaaactt cttaaattct acttttatag ttagtctttt 4380 ttttagtttt aaaacaccaa gaacttagtt tcgaataaac acacataaag aattcaaaat 4440 gtcgctgatc agcatcctgt ctcccctaat tacttccgag ggcttagatt caagaatcaa 4500 accttcacca aaaaaggatg cctctactac cactaagcca tcactatgga aaactactga 4560 gttcaaattc tactacattg catttctggt cgtggttccc ttgatgttct atgctgggtt 4620 acaagctagt tcgcccgaaa atccaaacta tgcaagatac gaacgtctcc tatctcaagg 4680 ttggttattt ggcagaaaag tagacaatag tgattctcaa tataggtttt tcagggacaa 4740 ttttgcgcta ttgtcagttt taatgctagt ccacacttct ataaaacgca ttgtacttta 4800 ttcaacaaat atcactaaat tgaggtttga tctgatattt ggtttgatct ttttagtggc 4860 cgctcatggt gtcaattcga taagaatttt agcccatatg ctaattttat atgccatcgc 4920 ccatgtacta aagaacttta gaagaatagc caccatcagc atttggattt atggtatttc 4980 tacgcttttt attaacgaca acttcagagc atatccattt ggtaatattt gctctttttt 5040 aagcccattg gaccattggt atagaggtat cattccaaga tgggatgtct ttttcaattt 5100 tactcttttg agagtcttaa gttacaactt ggacttctta gagaggtggg agaatttaca 5160 aaagaagaaa agtccatcct atgaatcaaa agaagctaaa tcagccattt tgctcaatga 5220 acgtgctaga ttaactgctg cacaccccat acaggactac agcttaatga attatattgc 5280 atatgttact tacacgccac ttttcattgc cggccccatt ataacattca atgattatgt 5340 ttaccaatcg aaacatacct tgccatcaat aaatttcaaa ttcatttttt actatgcggt 5400 gagattcgtt attgctctct tatctatgga gttcatttta cactttctcc acgttgtggc 5460 aatctcaaaa accaaagcgt gggaaaatga cacacctttc cagatttcca tgattggctt 5520 atttaatttg aatattattt ggctaaaact actgattccg tggaggctgt ttaggctgtg 5580 ggctttgcta gacggaatcg atacacctga aaatatgatc aggtgtgttg ataacaatta 5640 cagttcacta gcattctgga gagcttggca tagaagctac aataagtggg ttgtccgtta 5700 catatatatt cctctaggtg gttcaaaaaa tagagttttg acatcactag cagtcttttc 5760 cttcgtagct atatggcatg acatcgaact aaagttatta ttatggggtt ggctaatagt 5820 tttgttcctc ttaccagaaa tttttgctac ccaaattttc tctcattata ccgacgcagt 5880 ctggtacaga cacgtttgcg ctgtcggtgc tgttttcaac atatgggtta tgatgatcgc 5940 taatcttttt ggattctgCt tgggctctga cggtactaaa aaattactaa gcgatatgtt 6000 ctgtaccgta tctggtttca aatttgtaat tttggcaagc gttagtttat tcatcgcagt 6060 acaaataatg tttgaaatca gagaagaaga aaagaggcac ggaatttacc taaaatgctg 6120 aggatcccct tttcctttgt cgatatcatg taattagtta tgtcacgctt acattcacgc 6180 cctcctccca catccgctct aaccgaaaag gaaggagtta gacaacctga agtctaggtC 6240 CCtatttatt ttttttaata gttatgttag tattaagaac gttatttata tttcaaattt 6300 ttattttttt tctgtacaaa cgcgtgtacg catgtaacat tataCtgaaa acCttgcttg 6360 agaaggtttt gggacgctcg aaggcttcct agttCtagag cggcCgccac cgcggtggag 6420 ctccaattcg ccctatagtg agtcgtatta caattcactg gccgtcgttt tacaacgtcg 6480 tgactgggaa aaCCCtggcg ttacccaact taatcgcctt gcagcacatc cCCCcttcgc 6540 cagctggcgt aatagcgaag aggcccgcac Cgatcgccct tcccaacagt tgCgCagCCt 6600 gaatggcgaa tggCgCgacg cgcCCtgtag cggCgCatta agcgcggCgg gtgtggtggt 6660 tacgCgCagc gtgaCCgcta cacttgCcag cgccctagcg cccgctcctt tcgctttctt 6720 CCcttccttt CtCgccacgt tcgccggtag tgttagacct gaaCaaggtt taCtaaaaat 6780 ccgtaaagaa CttCaattgt aCgCCaaCtt aaggcctcgt cccCgccggg tCaCCCggCc 6840 agcgacatgg aggcccagaa taccctcctt gaCagtcttg acgtgcgcag ctcaggggca 6900 tgatgtgact gtCgcccgta catttagccc atacatcccc atgtataatc atttgCatcc 6960 atacattttg atggccgCaC ggcgcgaagc aaaaattacg gCtcctcgct gcagacctgC 7020 gagcagggaa acgctccCCt Cacagacgcg tgaattgtcc Ccacgccgcg Cccctgtaga 7080 gaaatataaa aggttaggat ttgCCaCtga ggttcttctt tcatatactt CCttttaaaa 7140 tcttgctagg atacagttct CaCatcacat ccgaacataa acaacCatgg gtaaaaagCC 7200 tgaactCaCc gcgaCgtCtg tcgagaagtt tctgatcgaa aagttcgaca gcgtctccga 7260 cctgatgcag ctCtcggagg gcgaagaatc tcgtgctttc agcttcgatg taggagggcg 7320 tggatatgtc ctgCgggtaa atagCtgcgc cgatggtttc tacaaagatc gttatgttta 7380 tcggCacttt gcatCggccg cgCtCCCgat tccggaagtg cttgacattg gggaattcag 7440 cgagagcctg acctattgca tctcccgccg tgcacagggt gtcacgttgc aagacctgcc 7500 tgaaaccgaa ctgcccgctg ttCtgcagcc ggtcgcggag gcCatggatg cgatcgctgc 7560 ggccgatCtt agcCagacga gcgggttcgg cccattCgga ccgcaaggaa tcggtcaata 7620 cactaCatgg cgtgatttca tatgcgCgat tgctgatCCc catgtgtatC actggcaaaC 7680 tgtgatggaC gacaccgtCa gtgcgtccgt cgcgcaggct ctcgatgagc tgatgctttg 7740 ggccgaggac tgccccgaag tccggcacct Cgtgcacgcg gatttcggct CCaaCaatgt 7800 cctgaCggac aatggCCgCa taacagCggt cattgactgg agcgaggCga tgttcgggga 7860 ttCCCaatac gaggtCgCca acatcttctt ctggaggccg tggttggCtt gtatggagCa 7920 gcagacgCgC tacttCgagC ggaggcatcc ggagcttgca ggatCgccgc ggCtCCgggc 7980 gtatatgctc cgCattggtc ttgaCCaaCt ctatcagagc ttggttgacg gcaatttcga 8040 tgatgcagct tgggcgcagg gtcgatgcga cgcaatcgtc cgatccggag ccgggactgt 8100 cgggcgtaca caaatCgccc gcagaagCgc ggccgtCtgg accgatggct qtqtagaagt 8160 actcgccgat agtggaaacc gacgccccag CaCtcgtccg agggcaaagg aataatcagt 8220 actgacaata aaaagattCt tgttttcaag aacttgtcat ttgtatagtt tttttatatt 8280 gtagttgttc tattttaatc aaatgttagc gtgatttata tilttttttcg cctcgacatc 8340 atctgcccag atgcgaagtt aagtgcgcag aaagtaatat catgcgtcaa tcgtatgtga 8400 atgctggtcg ctatactgct gtcgattcga tactaacgcc gccatccagt gtcgacggat 8460 cctaggtgta cataaacttt ataaatgaaa ttcataatag aaacgacacg aaattacaaa 8520 atggaatatg ttcatagggt agacgaaact atatacgcaa tctacataca tttatcaaga 8580 aggagaaaaa ggaggatagt aaaggaatac aggtaagcaa attgatacta atggctpaac 8640 gtgataagga aaaagaattg CaCtttaaCa ttaatattga caaggaggag ggCaCCaCaC 8700 aaaaagttag gtgtaacaga aaatcatgaa actacgattc ctaatttgat attggaggat 8760 tttCtCtaaa aaaaaaaaaa taCaaCaaat aaaaaaCaCt Caatgacctg accatttgat 8820 ggagtttaag tcaatacctt cttgaacCat ttcccataat ggtgaaagtt CCCtCaagaa 8860 ttttaCtctg tcagaaaCgg ccttaCgaCg tagtcgatat ggtgcactct Cagtacaatc 8940 tgctctgatg ccgcatagtt aagccagCCC cgacacccgC Caacacccgc tgaCgCgccc 9000 tgacgggctt gtctgctccC ggcatccgct taCagacaag ctgtgaccgt ctccgggagc 9060 tgcatgtgtc agaggttttc accgtcatca cCgaaacgcg cgagaCgaaa gggcctCgtg 9120 ataCgCCtat ttttataggt taatgtcatg ataataatgg tttcttagga cggatcgctt 9180 gcctgtaact tacaCgCgCc tcgtatCttt taatgatgga ataatttggg aatttactct 9240 gtgtttattt atttttatgt tttgtatttg gattttagaa agtaaataaa gaaggtagaa 9300 1_44 gagttacgga atgaagaaaa aaaaataaac aaaggtttaa aaaatttcaa caaaaagcgt 9360 actttacata tatatttatt agacaagaaa agcagattaa atagatatac attcgattaa 9420 cgataagtaa aatqtaaaat cacagqattt tcgtgtgtgg tcttctacac agacaagatg 9460 aaacaattcg gcattaatac ctgagagcag gaagagcaag ataaaaggta gtatttgttg 9540 gcgatccccc tagagtcttt tacatcttcg gaaaacaaaa actatttttt cLttaatttc 9600 ttttLttact ttctattttt aatttatata tttatattaa aaaatttaaa ttataattat 9660 ttttatagca cgtgatgaaa aggacccagg tggcactttt cggggaaatg tgcgcggaac 9720 ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc 9780 ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt 9840 cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct 9900 ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 9960 tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag 10020 cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca 10080 actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga 10140 aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag 10200 tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc 10260 tttttttcac aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 10320 tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt 10380 gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg 10440 gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt 10500 tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg cagcactggg 10560 gccagatggt aagccctccc gtatcgtagt tatctacacg acgggcagtc aggcaactat 10620 ggatgaacga aatagacaga tcqctqaqat aggtgcctca ctgattaagc attggtaact 10680 gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 10740 aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagLL 10800 ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 10860 ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 10920 tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 10980 gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt 11040 agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 11100 ta 11102

Claims (15)

CLAIMS:
1. A yeast cell comprising:
a) an exogenous gene coding for a enzyme with the ability to convert pyruvate and coenzyme-A into formate and acetyl-CoA;
b) a genetic modification that reduces specific NAD+-dependent formate dehydrogenase activity in the cell;
c) an exogenous gene coding for an enzyme with acetaldehyde dehydrogenase activity, which gene confers to the cell the ability to reduce acetylCoA into acetaldehyde; and, d) a genetic modification that increases the specific activity of NAD~-linked glycerol dehydrogenase.
2. A yeast cell according to claim 1, wherein the cell further comprises a genetic modification selected from the group consisting of:
a) a genetic modification that increases the specific activity of dihydroxyacetone kinase;
b) a genetic modification that increases transport of glycerol into the cell; an exogenous gene coding for an enzyme for activation of the pyruvate formate lyase;
c) a genetic modification that increases the specific acetyl-CoA synthetase activity in the cell; and, d) a genetic modification that reduces specific NAW-dependent glycerol 3-phosphate dehydrogenase activity in the cell, while the yeast cell comprises a functional high-osmolarity glycerol response pathway.
3. A yeast cell according to claim 1 or 2, wherein the cell comprises at least one of:
i) an exogenous xylose isomerase gene, which gene confers to the cell the ability to isomerise xylose into xylulose; and, ii) exogenous genes coding for a L-arabinose isomerase, a L-ribulokinase and a L-ribulose-5-phosphate 4-epimerase, which genes together confer to the cell the ability to convert L-arabinose into D-xylulose 5-phosphate.
4. A yeast cell according to any one of claims 1 - 3, wherein at least one of:
a) the genetic modification that reduces specific NAD+ -dependent formate dehydrogenase activity in the cell comprises the inactivation of at least one endogenous copy of a gene encoding a formate dehydrogenase in the cell's genome;
b) the genetic modification that increases the specific activity of the NAD3+-linked glycerol dehydrogenase is expression of a heterologous gene encoding an NAD+-linked glycerol dehydrogenase;
c) the genetic modification that increases transport of glycerol into the cell is overexpression of a nucleotide sequence encoding at least one of a glycerol uptake protein and a glycerol channel;
d) the genetic modification that reduces specific NAD+-dependent glycerol 3-phosphate dehydrogenase activity in the cell comprises the inactivation of at least one endogenous copy of a gene encoding a glycerol 3-phosphate dehydrogenase in the cell's genome e) the genetic modification that increases the specific acetyl-CoA
synthetase activity is overexpression of a nucleotide sequence encoding an acetyl-CoA
synthetase; and, f) the genetic modification that increases the specific activity of dihydroxyacetone kinase is overexpression of a nucleotide sequence encoding a dihydroxyacetone kinase.
5. A yeast cell according to any one of claims 1 - 4, wherein:
a) the exogenous gene coding for an enzyme with pyruvate formate lyase activity comprises a nucleotide sequence coding for an amino acid sequence with at least 57%
amino acid sequence identity with SEQ ID NO: 1;

b) the exogenous gene coding for the pyruvate formate lyase activating enzyme comprises a nucleotide sequence coding for an amino acid sequence with at least 70% amino acid sequence identity with SEQ ID NO: 3;
c) the gene encoding a formate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention is a gene encoding a formate dehydrogenase having an amino acid sequence with at least 70% sequence identity to at least one of SEQ
ID NO: 5 and 6;
d) the exogenous gene coding for the enzyme with acetaldehyde dehydrogenase activity comprises a nucleotide sequence coding for an amino acid sequence with at least one of:
i) at least 64% amino acid sequence identity with SEQ ID NO: 7, ii) at least 76% amino acid sequence identity with SEQ ID NO: 9 and iii) at least 61% amino acid sequence identity with SEQ ID NO: 11;
e) the nucleotide sequence encoding the NAD+ -linked glycerol dehydrogenase comprises a nucleotide sequence coding for an amino acid sequence with at least 50% amino acid sequence identity with SEQ ID NO: 49, f) the nucleotide sequence encoding the dihydroxyacetone kinase comprises a nucleotide sequence coding for an amino acid sequence with at least 50% amino acid sequence identity with at least one of SEQ ID NO: 14, 15 and 52;
g) the nucleotide sequence encoding the glycerol uptake protein comprises a nucleotide sequence coding for an amino acid sequence with at least 50% amino acid sequence identity with at least one of SEQ ID NO: 16 and 17, and wherein the nucleotide sequence encoding the glycerol channel comprises a nucleotide sequence coding for an amino acid sequence with at least 30% amino acid sequence identity with the amino acid sequence between amino acids 250 and 530 of SEQ ID NO: 18;

h) the nucleotide sequence encoding the acetyl-CoA synthetase comprises an amino acid sequence with at least 70% amino acid sequence identity with at least one of SEQ ID NO's: 19 and 20; and, i) the gene encoding a glycerolphosphate dehydrogenase whose activity is to be reduced or inactivated in the cell of the invention is a gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70% sequence identity to SEQ ID
NO: 21, while the cell has at least one functional copy of a endogenous gene encoding a glycerolphosphate dehydrogenase having an amino acid sequence with at least 70% sequence identity to SEQ ID NO: 22.
6. A yeast cell according to any one of claims 1-5, wherein the yeast cell comprises at least one further genetic modification that results in a characteristic selected from the group consisting of:
a) increased xylulose kinase specific activity;
b) increased flux of the pentose phosphate pathway c) reduced unspecific aldose reductase specific activity d) increased transport of at least one of xylose and arabinose into the host cell;
e) decreased sensitivity to catabolite repression;
f) increased tolerance to ethanol, osmolarity or organic acids; and, g) reduced production of by-products.
7. A yeast cell according to any one of claims 1-6, wherein the yeast cell is of a genus selected from the group consisting of Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, and Yarrowia.
8. A yeast cell according to claim 7, wherein the yeast cell belongs to a species selected from the group consisting of S. cerevisiae, S. exiguus, S. bayanus, K. lactis, K.
marxianus and Schizosaccharomyces pombe.
9. A yeast cell according to any one of claims 1-8 wherein at least one of the nucleotide sequences coding for the enzyme with pyruvate formate lyase activity, the pyruvate formate lyase activating enzyme, the enzyme with acetaldehyde dehydrogenase activity, the xylose isomerase, the L-arabinose isomerase, the L-ribulokinase and the L-ribulose-5-phosphate 4-epimerase is a nucleotide sequence the codon usage of which has been optimised for expression in the yeast cell.
10. A process for producing a fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, 1,3-propane-diol, a butanol and an isoprenoid-derived product, whereby the process comprises fermenting a medium with a yeast cell as defined in any one of claims 1 - 9, whereby the medium contains or is fed with a source of glycerol and with a source of at least one of a hexose and a pentose, whereby the yeast cell ferments the glycerol and the at least one of the hexose and pentose to the fermentation product and formate.
11. A process according to claim 10, wherein the fermentation product is ethanol.
12. A process according to claim 10 or 11, wherein the medium contains or is fed with a lignocellulosic hydrolysate.
13. A process according to any one of the claims 10-12, wherein the yeast cell ferments under anaerobic conditions.
1 4. A process according to any one of the claims 10-12, wherein the pH of the medium is regulated during the fermentation process to maintain a concentration of undissociated formic acid that is not higher than 20.0 mM.
15. A process according to any one of claims 10-14, further comprising recovering at least one of the fermentation product and formate.
CA2834053A 2010-11-18 2011-11-18 Yeast strains engineered to produce ethanol from glycerol Active CA2834053C (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US41505410P 2010-11-18 2010-11-18
US61/415,054 2010-11-18
EP10191736.7 2010-11-18
EP10191736 2010-11-18
US201161471836P 2011-04-05 2011-04-05
US61/471,836 2011-04-05
PCT/NL2011/050787 WO2012067510A1 (en) 2010-11-18 2011-11-18 Yeast strains engineered to produce ethanol from glycerol

Publications (2)

Publication Number Publication Date
CA2834053A1 CA2834053A1 (en) 2012-05-24
CA2834053C true CA2834053C (en) 2019-03-26

Family

ID=43838239

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2834053A Active CA2834053C (en) 2010-11-18 2011-11-18 Yeast strains engineered to produce ethanol from glycerol

Country Status (6)

Country Link
EP (1) EP2663645B1 (en)
CA (1) CA2834053C (en)
DK (1) DK2663645T3 (en)
ES (1) ES2532508T3 (en)
PL (1) PL2663645T3 (en)
WO (1) WO2012067510A1 (en)

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2694662B1 (en) 2011-04-05 2020-01-08 Lallemand Hungary Liquidity Management LLC Methods for the improvement of product yield and production in a microorganism through the addition of alternate electron acceptors
CN104024419A (en) 2011-10-24 2014-09-03 丰田自动车株式会社 Method for producing ethanol using recombinant yeast
MX2014006446A (en) 2011-11-30 2014-09-01 Dsm Ip Assets Bv Yeast strains engineered to produce ethanol from acetic acid and glycerol.
ES2717682T3 (en) 2012-10-16 2019-06-24 Dsm Ip Assets Bv Cells with improved pentose conversion
CA2889890C (en) * 2012-11-09 2023-03-28 Lallemand Hungary Liquidity Management Llc Method for acetate consumption during ethanolic fermentation of cellulosic feedstocks
EP2935596A2 (en) 2012-12-21 2015-10-28 Dow Global Technologies LLC Process for producing n-propanol and propionic acid using metabolically engineered propionibacteria
CN105073990A (en) * 2013-02-27 2015-11-18 丰田自动车株式会社 Method for producing ethanol using recombinant yeast
US11753656B2 (en) 2013-08-15 2023-09-12 Lallemand Hungary Liquidity Management Llc Methods for the improvement of product yield and production in a microorganism through glycerol recycling
AR097479A1 (en) * 2013-08-29 2016-03-16 Dsm Ip Assets Bv GLYCEROL AND ACETIC ACID CONVERTER CELLS WITH AN IMPROVED GLYCEROL TRANSPORT
AR097480A1 (en) * 2013-08-29 2016-03-16 Dsm Ip Assets Bv GLYCEROL AND ACETIC ACID CONVERTER YEAST CELLS WITH AN IMPROVED ACETIC ACID CONVERSION
KR102255306B1 (en) * 2013-11-15 2021-05-25 삼성전자주식회사 Genetically engineered yeast cell producing lactate comprising acetaldehyde dehydrogenase, method of producing yeast cell and method of producing lactate using the same
DE112015003261B4 (en) * 2014-07-14 2025-04-10 Constructor University Bremen Ggmbh Genetically modified yeast with improved glycerol catabolism
HUE053810T2 (en) * 2014-12-19 2021-07-28 Dsm Ip Assets Bv Fermentation process with improved glycerol and acetic acid conversion
US10689670B2 (en) * 2016-06-14 2020-06-23 Dsm Ip Assets B.V. Recombinant yeast cell
JP6879111B2 (en) 2017-08-02 2021-06-02 トヨタ自動車株式会社 Recombinant yeast and method for producing ethanol using it
CA3073329A1 (en) 2017-09-26 2019-04-04 Dsm Ip Assets B.V. Improved process for ethanol production
MX2020007914A (en) * 2018-01-29 2020-10-28 Novozymes As Microorganisms with improved nitrogen utilization for ethanol production.
JP7078900B2 (en) 2018-10-05 2022-06-01 トヨタ自動車株式会社 Transformed yeast and method for producing ethanol using it
WO2023285297A1 (en) * 2021-07-12 2023-01-19 Dsm Ip Assets B.V. Recombinant yeast cell

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2679920A1 (en) 1991-08-02 1993-02-05 Rhone Poulenc Rorer Sa Highly stable recombinant yeasts for the production of recombinant proteins, their preparation and their use
ATE418616T2 (en) 2002-01-23 2009-01-15 Royal Nedalco B V FERMENTATION OF PENTOSE SUGAR
SE0202090D0 (en) 2002-05-08 2002-07-04 Forskarpatent I Syd Ab A modified yeast consuming L-arabinose
JP4711955B2 (en) 2003-05-02 2011-06-29 ネイチャーワークス・エル・エル・シー Genetically modified yeast and fermentation method using genetically modified yeast
SE0302421D0 (en) 2003-09-11 2003-09-11 Forskarpatent I Syd Ab Construction of new xylose utilizing Saccharomyces cerevisiae strain
SE0400815D0 (en) 2004-03-26 2004-03-26 Forskarpatent I Syd Ab Traits in recombinant xylose-growing Saccharomyces cerevisiae strains using genome-wide transcription analysis
SE0401303D0 (en) 2004-05-19 2004-05-19 Forskarpatent I Syd Ab Ethanol productivities of microbial strains in fermentation of dilute-acid hydrolyzates depending on their furan reduction capacities
PL1781772T3 (en) 2004-07-16 2017-03-31 Dsm Ip Assets B.V. Metabolic engineering of xylose fermenting eukaryotic cells
CA2693365A1 (en) 2007-07-19 2009-01-22 Royal Nedalco B.V. Novel arabinose-fermenting eukaryotic cells
JP5625199B2 (en) 2008-03-07 2014-11-19 ディーエスエム アイピー アセッツ ビー.ブイ. Pentose sugar fermentation cell
WO2009143495A2 (en) * 2008-05-22 2009-11-26 President And Fellows Of Harvard College Fast-growing yeast
WO2010019882A1 (en) * 2008-08-15 2010-02-18 Edeniq, Inc. Genetically-engineered yeast and methods of making and using
CA2746818A1 (en) 2008-12-24 2010-07-01 C5 Yeast Company B.V. Xylose isomerase genes and their use in fermentation of pentose sugars

Also Published As

Publication number Publication date
ES2532508T3 (en) 2015-03-27
WO2012067510A1 (en) 2012-05-24
CA2834053A1 (en) 2012-05-24
EP2663645B1 (en) 2014-12-17
DK2663645T3 (en) 2015-03-23
PL2663645T3 (en) 2015-05-29
EP2663645A1 (en) 2013-11-20

Similar Documents

Publication Publication Date Title
DK2663645T3 (en) Yeast strains modified for the production of ETHANOL FROM GLYCEROL
KR20210149060A (en) RNA-induced DNA integration using TN7-like transposons
AU2022200903B2 (en) Engineered Cascade components and Cascade complexes
KR101982360B1 (en) Method for the generation of compact tale-nucleases and uses thereof
CN101939434B (en) Dgat genes from yarrowia lipolytica for increased seed storage lipid production and altered fatty acid profiles in soybean
CN101365788B (en) Delta-9 elongases and their use in making polyunsaturated fatty acids
AU2016203445B2 (en) Integration of a polynucleotide encoding a polypeptide that catalyzes pyruvate to acetolactate conversion
KR20140092759A (en) Host cells and methods for production of isobutanol
KR20140099224A (en) Keto-isovalerate decarboxylase enzymes and methods of use thereof
AU2010258955B2 (en) Expression cassettes derived from maize
DK2324120T3 (en) Manipulating SNF1 protein kinase OF REVISION OF OIL CONTENT IN OLEAGINOUS ORGANISMS
DK2785849T3 (en) Yeast strains modified to produce ethanol from acetic acid and glycerol
KR20140113997A (en) Genetic switches for butanol production
US20040003420A1 (en) Modified recombinase
BRPI0806354A2 (en) transgender oilseeds, seeds, oils, food or food analogues, medicinal food products or medicinal food analogues, pharmaceuticals, beverage formulas for babies, nutritional supplements, pet food, aquaculture feed, animal feed, whole seed products , mixed oil products, partially processed products, by-products and by-products
KR20130032897A (en) Production of alcohol esters and in situ product removal during alcohol fermentation
KR20100037031A (en) Gene knockout mesophilic and thermophilic organisms, and methods of use thereof
KR20220012327A (en) Methods and cells for production of phytocannabinoids and phytocannabinoid precursors
KR20140015136A (en) Method for producing 3-hydroxypropionic acid and other products
KR20140146616A (en) Acetate supplemention of medium for butanologens
DK2623594T3 (en) Antibody against human prostaglandin E2 receptor EP4
KR20120136349A (en) Microorganism production of high-value chemical products, and related compositions, methods and systems
AU2018386002B2 (en) CAS9 variants and methods of use
KR20240029020A (en) CRISPR-transposon system for DNA modification
AU2023412590A1 (en) Fusion and use thereof

Legal Events

Date Code Title Description
EEER Examination request

Effective date: 20161118

MPN Maintenance fee for patent paid

Free format text: FEE DESCRIPTION TEXT: MF (PATENT, 13TH ANNIV.) - STANDARD

Year of fee payment: 13

U00 Fee paid

Free format text: ST27 STATUS EVENT CODE: A-4-4-U10-U00-U101 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE REQUEST RECEIVED

Effective date: 20241107

U11 Full renewal or maintenance fee paid

Free format text: ST27 STATUS EVENT CODE: A-4-4-U10-U11-U102 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE FEE PAYMENT DETERMINED COMPLIANT

Effective date: 20241107

Free format text: ST27 STATUS EVENT CODE: A-4-4-U10-U11-U102 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE FEE PAYMENT PAID IN FULL

Effective date: 20241107

W00 Other event occurred

Free format text: ST27 STATUS EVENT CODE: A-4-4-W10-W00-W200 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: REQUEST OR RESPONSE SUBMITTED ONLINE

Effective date: 20250404

W00 Other event occurred

Free format text: ST27 STATUS EVENT CODE: A-4-4-W10-W00-W111 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: CORRESPONDENT DETERMINED COMPLIANT

Effective date: 20250409

R14 Transfer of ownership recorded

Free format text: ST27 STATUS EVENT CODE: A-4-4-R10-R14-R129 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: TRANSFER REQUIREMENTS DETERMINED COMPLIANT

Effective date: 20250510

R17 Change to representative recorded

Free format text: ST27 STATUS EVENT CODE: A-4-4-R10-R17-R117 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: APPOINTMENT OF AGENT REQUIREMENTS DETERMINED COMPLIANT

Effective date: 20250514

Free format text: ST27 STATUS EVENT CODE: A-4-4-R10-R17-R121 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: REVOCATION OF AGENT REQUIREMENTS DETERMINED COMPLIANT

Effective date: 20250514

W00 Other event occurred

Free format text: ST27 STATUS EVENT CODE: A-4-4-W10-W00-W100 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: LETTER SENT

Effective date: 20250514

MPN Maintenance fee for patent paid

Free format text: FEE DESCRIPTION TEXT: MF (PATENT, 14TH ANNIV.) - STANDARD

Year of fee payment: 14

U00 Fee paid

Free format text: ST27 STATUS EVENT CODE: A-4-4-U10-U00-U101 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE REQUEST RECEIVED

Effective date: 20250930

U11 Full renewal or maintenance fee paid

Free format text: ST27 STATUS EVENT CODE: A-4-4-U10-U11-U102 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE FEE PAYMENT PAID IN FULL

Effective date: 20250930