CA2736087A1 - Oligonucleotide probe for the detection of trypanosoma. cruzi (chagas d isease) in biological samples - Google Patents
Oligonucleotide probe for the detection of trypanosoma. cruzi (chagas d isease) in biological samples Download PDFInfo
- Publication number
- CA2736087A1 CA2736087A1 CA2736087A CA2736087A CA2736087A1 CA 2736087 A1 CA2736087 A1 CA 2736087A1 CA 2736087 A CA2736087 A CA 2736087A CA 2736087 A CA2736087 A CA 2736087A CA 2736087 A1 CA2736087 A1 CA 2736087A1
- Authority
- CA
- Canada
- Prior art keywords
- cruzi
- detection
- oligonucleotide
- probe
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to oligonucleotide sequences for detection probe and its use in nucleic acid amplification methods for the selective and specific detection of Trypanosoma cruzi(Chagas) in biological samples. The invention also provides oligonucleotide probe in the form of kits for the detection and diagnosis of Trypanosoma cruzi. The inventive oligonucleotide probe can also be used in combination with other specific oligonucleotide primers and probe for the simultaneous detection of Trypanosoma cruzi and other target organisms, such as Hepatitis B, and could help determine ongoing parasitaemia in chagasic patients.
Description
Description Background Chagas disease is a tropical parasitic disease caused by the flagellate protozoan Trypanosoma cruzi. T. cruzi is commonly transmitted to humans and other mammals by an insect vector, the blood-sucking assassin bugs of the subfamily Triatominae (family Reduviidae) most commonly species belonging to the Triatoma, Rhodnius, and Panstrongylus genera. The disease may also be spread through blood transfusion and organ transplantation, ingestion of food contaminated with parasites, and from a mother to her fetus.
Chagas disease passes through two successive stages, the acute and the chronic phase.
After the acute clinical manifestations disappear, the infection rests with a long period of clinical latency, called the indeterminate form period, which may last throughout life or evolve to a chronic phase with cardiac or gastrointestinal involvement. The chronic phase is characterised by high specific IgG antibody production and low, intermittent parasitaemia, which results in the low sensitivity of the classic parasitological techniques. Diagnosis in this stage mainly relies on serological techniques, despite their lack of specificity when crude T.
cruzi antigens are used (Luquetti and Rassi, 2000). Also false-negative serological results have been reported, which may be related to the antigen used, the parasite strain involved in the infection, or poor immune response of the patient (Luquetti and Rassi, 2000). In addition, serology is not accurate enough in the evaluation of treatment efficacy, as it remains positive from 6 months to some years after successful treatment, particularly in adults, and has low positive predictive value in the diagnosis of congenital Chagas disease in the first months of life due to transfer of antibodies from mother to child. Molecular-based assays, in particular amplification by the polymerase chain reaction (PCR), provide a more sensitive alternative to traditional parasitological techniques. Some PCR protocols have been described, leading to unequal results, probably due to differences in the volume of blood processed, the DNA
extraction procedure, or the DNA region of T. cruzi amplified (Junqueira et al., 1996; Virreira et al., 2003). NestedPCR(N-PCR) provides higher sensitivity than single-run PCR
assay and has already been reported for supplementary diagnosis of Chagas disease (Marcon et al., 2002).
This technique is highly sensitive, but time consuming and entails a high risk of false positive results due to contaminating amplicons.
In contrast, real-time PCR technology uses fluorescent labels for continuous monitoring of amplification throughout the reaction. The main advantages are the rapid throughput of results (amplification and detection in one step) and reduced risk of carry-over contamination (minimal manipulation of samples and use of UNG). Real-timePCR can be optimised both as a qualitative and quantitative assay. The present invetion provides probe for the detection of T.
cruzi in biological samples. The probe generally hybridezed to a strand of an amplication product (or amplicon) to form an amplification prodect/probe hybrid, which can be detected Summary of the invention a genomic DNA sequence which had been previously described as specific for all T. cruzi lineages (Moser et al., 1989; Virreira et al., 2003). GenBank accession no.
As will be appreciated by one skilled in the art, any of the ologonucleotide sequences (or active fragements thereof) disclosed herein for amplification, detection or quantification of T. cruzi may be employed as detection probe or amplification primer, depending on the intended use and /or assay format.
Methods for labeling nucleic acid molecules are well-known in the art. For a review of labeling protocols, label detection techniques, and recent developments in the field, see, for example, L.J. Jricka, Ann. Clin. Biochem. 2002, 39: 114-129; R.P. van Gijlswijk et al., Expert Rev. Mol.
Diagn. 2001. Any of a wide variety of detectable aganents can be used in the practice of the present invention. Suitable detectable agents, various ligands, radionuclides, fluorescent dyes, chemiluminescent agents.
In certain embodiments, the inventive detection probe are fluorescently labeled. Numberous known fluorescent labeling moieties of a wide variety of chemical structures and physical characteristics are suitable for use in the practice of this invention.
Suitable fluorescent dyes include, but are not limited to, fluorescein and fluorescein dyes (e.g., fluorescein, 6-carboxyfluorescein or FAM), Carbocyanine, merocyanine, styryl dyes, oxonol dyes, phycoerythrin, erythrosin, eosin, rhodamine dyes (e.g., carboxytetramethyirhodamine or TAMRA, carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), lissamine rhodamine B, rhodamine 6G, rhodamine Green, rhodamine Red, tetramethylrhodamine or TMR), cournarin and coumarin dyes (e.g., methoxycoumarin, dialkylaminocoumarin, hyfroxycoumarin and aminomethylcoumarin or AMCA), Orgegon Green Dyes (e.g., Oregon Green 488, Oregon Green 500, Oregon Green 514), Texas Red, Texas Red-X, Spectrum Red, Spectrum Green, cyanine dyes, Alexa Fluor dyes, Bodipy dyes, IRDyes, and the like. For more example of suitable fluorescent dyes and methods for linking or incorporating fluorescent dyes to nucleic acid molecules see, for example, "The Handbook of Fluorescent Probes and Research Products", 9 Ed, Molecular Probes, Inc., Eugene, OR. Fluorescent dyes as well as labeling kits are commercially available from, for example, Molecular Probes In.
The use of physically linked fluorescent reporter/quencher molecule pairs is also within the scope of the invention. The use of such systems in TaqMan TM assay (as described, for example, in U.S. Pat. Nos. 5,210,015; 5,804,375;5487,792 and 6214,979) or as Molecular Beacons (as described, for example in, S. Tyagi and F.R.Kramer, Nature Biotechnol. 1996, 14:
303-308) is well-known in the art. With the TaqMan TM assay format, products of the amplification reaction can be detected as they are formed in a so-called "real-time" manner. As a result, amplification product/probe hybrides are formed and detected while the reaction mixture is under amplification conditions.
Test samples will often be obtained or isolated from patients suspected of being infected with T.
cruzi . As already mentioned, test sample may be used without further treatment after isolation or, alternativively, it may be processed before analysis. For example, test sample may be treated so as to release T. cruziB nucleic acids from cells that contain them.
Mothods of nucleic acid extraction are well-known in the airt and include chemical methods, temperature methods, and mechanical methods (see, for example, J. Sambrook et al., "Molecular Cloning: A
laboratory Manual", 1989, 2en Ed., Cold Spring Harbour Laboratory Press: New York, NY).
There are also numerous different and versatile kits that can be used to extract nucleic from biological samples that are commercially available from, for example, Qiagen Inc.(Valencia, CA).
As already mentioned, probe of the present invention are specific for T.
cruzi, Accordingly, the present invention also provides methods for simultaneously detectiong the presence of T. cruzi and another organism in a test sample using a combination of at least two primer sets or primer/probe sets.
Accordingly, the present invetion provides probe for the detection of T. cruzi in biological samples. The probe generally hybridezed to a strand of an amplication product (or amplicon) to form an amplification prodect/probe hybrid, which can be detected.
In another aspect, the present invention provides kits comprising materials useful for the detection of T. cruzi infection according to methods described herin. The inventive kits may be used by diagnostic laboratories, experimental laboratories, or practitioners.
Basic material and reagents required for the detection of T. cruzi according the the present invention may be assembled together in a kit. In certain embodiements, kits comprise at least one inventive primer set or primer/probe set, and optionally, amplification reaction reagents.
Each kit preferably comprises the reagents which render the procedure specific. Thus, a kit adapted for use with NASBA preferably contains primers with a RNA ploymersase promoter linked to the target binding sequence, while a kit adapted for use with SDA
preferalby contains primers including a restriction endonuclease recognition site 5' to the target binding sequence.
Similarly, when the kit is adapted for use in a 5' nuclease assay, such as the TaqMan assay, the detection probes preferably contain at least one fluorescent reporter moiety and at least one quencher moiety.
Examples The following examples describes some of the preferred modes of making and practicing the present invention. However, it should be understood that this example is for illustrative purposes only and is not meant to limit the scope of the invention.
Table 3 shows the results of a TaqMan PCR assay using primers and the inventive specific oligonucleotide. The set of primers and the probe was found to be efficient at detecting T. cruzi.
i .. . w .. :... .
A"
.! T f. .p _ . _, _, ...aim ~...M..+.. ..., Brief Description of The Drawing Table 1 shows oligonudeotide sequence of the 195-bp satellite DNA in Trypanosoma cruzi (the GenBank accession no. AY520036).
Table 2 shows inventive specific oligonudeotide sequence derived from the 195-bp satellite DNA
in Tiypanosoma cruzi (the GenBank accession no. AY520036).
Table 3 shows the results of a TaqMan PCR assay using primers and the inventive specific oligonucleotide. The set of primers and the probe was found to be efficient at detecting T. cruzi.
Definitions The terms "probe" and "detection probe" are used herein interchangeably and refer to an oligonucleotide capable of selectively hybridizing to at least a portion of a target sequence under appropriate conditions (e.g., a portion of a target sequence that has been amplified). In certain embodiments, a detection probe is labeled with a detectable moiey.
The terms "fluorophore", "fluorescent moiety", and " fluorescent dye" are used herein interchchangeably. They refer to a molecule that absobs a quantum of electromagnetic radiation at one wavelength, and emits one or more photons at a different, typically longer, wavelength in response. Numerous fluorescent dyes of a wide variety of structures and characteristics are suitable for use in the practive of the invention. Methods and materials are known for fluorescently labeling nucleic acid molecules. Prefeably, a fluorescent moiety absorbs and emits light with high efficiency, and is photostable. Rather than being directly detactable themselves, some fluorescent duyes transfer energy to another fluorescent dye in a process called fluorescent resonance energy transfer(FRET), and the second dye produces the detected signal. Such FRET fluorescent dye pairs are also encompassed by the term "fluorescent moiety". The use of physically linked fluorescent reporter/quencher moeety is also within the scope of the present invention. In these embodiments, when the fluorescent reporter and quencher moiety are held in close promimity, such as at the ends of a nucleic acid probe, the quencher moiety prevents detction of a luorescent signal from the reporter moiety. When the two moieties are physically separated, such as, for example, after cleavage by a DNA
polymerase, the fluorescent signal form the erporter moiety becomes detectable.
The term 'TagMan" assay, also known as fluorogenic 5' nuclease assay, is a powerful and versatile PCR-based detection system for nucleic acid targets. Analysis is performed in conjunction with thermal cycling by monitoring the generation of fluorescence signals. The assay system has the capability of generating quantitative data allowing the determination of target copy numbers. For example, standard curves can be generated using serial dilutions of previously quantified suspensions of Trypanosoma cruzi , against which unknown samples can be caompared. The TaqMan assay is conveniently performed using, for example, AmpliTaq Gold DNA
polymerrase, which has endogenous 5' nuclease activity, to digest an oligonucleotide probe labeled with both a fluorescent reporter dye and a quencher moiety, as described above.
Assay results are obtained by measuring changes in fluorescence that occur during the amplification cycle as the probe is digested, uncouping the flurorescent and quencher moieties and causing an increase in the flurorescence signal that is proportional to the amplification of the target sequence.
The term "isolated" when referring to an oligonudeotide means an oligonucleotide, which by virtue of its origin or manipulation, is esparated from at least some of the components with which it is naturally associated or with which it is associated when initially obtained or prepared.
By "isolated", it is alternatively or additionally meant that the oligonucleotide of interest is produced or synthesized by the hand of man.
The Drawing Table 1 shows oligonudeotide sequence of the 195-bp satellite DNA In Trypanosome cruzi (the GenBank accession no. AY520036).
GAGCTCTTGCCCACACGGGTGCTGCACTCGGCTGATCGTTTTCGAGCGGCTGCTGCATC
ACACGTTGTGGTCCAAATTTTTGTTTCCGATTGTGAATGGTGGGAGTCAGAGGCACTCTC
TGTCAATATCTGTTTGCGTGTTCACACACTGGACACCAAACAACCCTGAACTATCCGCTG
C TTGGAGGAATTTCGC
Table 2 shows inventive specific oligonucleotide sequence derived from the 195-bp satellite DNA in Trypanosoma cruzi (the GenBank accession no. AY520036).
CGTGTTCACACACTGGACACCAAAC
Table 3 shows the results of a TaqMan PCR assay using primers and the inventive specific oligonucleotide. The set of primers and the probe was found to be efficient at detecting T. cruzi.
)WW
Chagas disease passes through two successive stages, the acute and the chronic phase.
After the acute clinical manifestations disappear, the infection rests with a long period of clinical latency, called the indeterminate form period, which may last throughout life or evolve to a chronic phase with cardiac or gastrointestinal involvement. The chronic phase is characterised by high specific IgG antibody production and low, intermittent parasitaemia, which results in the low sensitivity of the classic parasitological techniques. Diagnosis in this stage mainly relies on serological techniques, despite their lack of specificity when crude T.
cruzi antigens are used (Luquetti and Rassi, 2000). Also false-negative serological results have been reported, which may be related to the antigen used, the parasite strain involved in the infection, or poor immune response of the patient (Luquetti and Rassi, 2000). In addition, serology is not accurate enough in the evaluation of treatment efficacy, as it remains positive from 6 months to some years after successful treatment, particularly in adults, and has low positive predictive value in the diagnosis of congenital Chagas disease in the first months of life due to transfer of antibodies from mother to child. Molecular-based assays, in particular amplification by the polymerase chain reaction (PCR), provide a more sensitive alternative to traditional parasitological techniques. Some PCR protocols have been described, leading to unequal results, probably due to differences in the volume of blood processed, the DNA
extraction procedure, or the DNA region of T. cruzi amplified (Junqueira et al., 1996; Virreira et al., 2003). NestedPCR(N-PCR) provides higher sensitivity than single-run PCR
assay and has already been reported for supplementary diagnosis of Chagas disease (Marcon et al., 2002).
This technique is highly sensitive, but time consuming and entails a high risk of false positive results due to contaminating amplicons.
In contrast, real-time PCR technology uses fluorescent labels for continuous monitoring of amplification throughout the reaction. The main advantages are the rapid throughput of results (amplification and detection in one step) and reduced risk of carry-over contamination (minimal manipulation of samples and use of UNG). Real-timePCR can be optimised both as a qualitative and quantitative assay. The present invetion provides probe for the detection of T.
cruzi in biological samples. The probe generally hybridezed to a strand of an amplication product (or amplicon) to form an amplification prodect/probe hybrid, which can be detected Summary of the invention a genomic DNA sequence which had been previously described as specific for all T. cruzi lineages (Moser et al., 1989; Virreira et al., 2003). GenBank accession no.
As will be appreciated by one skilled in the art, any of the ologonucleotide sequences (or active fragements thereof) disclosed herein for amplification, detection or quantification of T. cruzi may be employed as detection probe or amplification primer, depending on the intended use and /or assay format.
Methods for labeling nucleic acid molecules are well-known in the art. For a review of labeling protocols, label detection techniques, and recent developments in the field, see, for example, L.J. Jricka, Ann. Clin. Biochem. 2002, 39: 114-129; R.P. van Gijlswijk et al., Expert Rev. Mol.
Diagn. 2001. Any of a wide variety of detectable aganents can be used in the practice of the present invention. Suitable detectable agents, various ligands, radionuclides, fluorescent dyes, chemiluminescent agents.
In certain embodiments, the inventive detection probe are fluorescently labeled. Numberous known fluorescent labeling moieties of a wide variety of chemical structures and physical characteristics are suitable for use in the practice of this invention.
Suitable fluorescent dyes include, but are not limited to, fluorescein and fluorescein dyes (e.g., fluorescein, 6-carboxyfluorescein or FAM), Carbocyanine, merocyanine, styryl dyes, oxonol dyes, phycoerythrin, erythrosin, eosin, rhodamine dyes (e.g., carboxytetramethyirhodamine or TAMRA, carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), lissamine rhodamine B, rhodamine 6G, rhodamine Green, rhodamine Red, tetramethylrhodamine or TMR), cournarin and coumarin dyes (e.g., methoxycoumarin, dialkylaminocoumarin, hyfroxycoumarin and aminomethylcoumarin or AMCA), Orgegon Green Dyes (e.g., Oregon Green 488, Oregon Green 500, Oregon Green 514), Texas Red, Texas Red-X, Spectrum Red, Spectrum Green, cyanine dyes, Alexa Fluor dyes, Bodipy dyes, IRDyes, and the like. For more example of suitable fluorescent dyes and methods for linking or incorporating fluorescent dyes to nucleic acid molecules see, for example, "The Handbook of Fluorescent Probes and Research Products", 9 Ed, Molecular Probes, Inc., Eugene, OR. Fluorescent dyes as well as labeling kits are commercially available from, for example, Molecular Probes In.
The use of physically linked fluorescent reporter/quencher molecule pairs is also within the scope of the invention. The use of such systems in TaqMan TM assay (as described, for example, in U.S. Pat. Nos. 5,210,015; 5,804,375;5487,792 and 6214,979) or as Molecular Beacons (as described, for example in, S. Tyagi and F.R.Kramer, Nature Biotechnol. 1996, 14:
303-308) is well-known in the art. With the TaqMan TM assay format, products of the amplification reaction can be detected as they are formed in a so-called "real-time" manner. As a result, amplification product/probe hybrides are formed and detected while the reaction mixture is under amplification conditions.
Test samples will often be obtained or isolated from patients suspected of being infected with T.
cruzi . As already mentioned, test sample may be used without further treatment after isolation or, alternativively, it may be processed before analysis. For example, test sample may be treated so as to release T. cruziB nucleic acids from cells that contain them.
Mothods of nucleic acid extraction are well-known in the airt and include chemical methods, temperature methods, and mechanical methods (see, for example, J. Sambrook et al., "Molecular Cloning: A
laboratory Manual", 1989, 2en Ed., Cold Spring Harbour Laboratory Press: New York, NY).
There are also numerous different and versatile kits that can be used to extract nucleic from biological samples that are commercially available from, for example, Qiagen Inc.(Valencia, CA).
As already mentioned, probe of the present invention are specific for T.
cruzi, Accordingly, the present invention also provides methods for simultaneously detectiong the presence of T. cruzi and another organism in a test sample using a combination of at least two primer sets or primer/probe sets.
Accordingly, the present invetion provides probe for the detection of T. cruzi in biological samples. The probe generally hybridezed to a strand of an amplication product (or amplicon) to form an amplification prodect/probe hybrid, which can be detected.
In another aspect, the present invention provides kits comprising materials useful for the detection of T. cruzi infection according to methods described herin. The inventive kits may be used by diagnostic laboratories, experimental laboratories, or practitioners.
Basic material and reagents required for the detection of T. cruzi according the the present invention may be assembled together in a kit. In certain embodiements, kits comprise at least one inventive primer set or primer/probe set, and optionally, amplification reaction reagents.
Each kit preferably comprises the reagents which render the procedure specific. Thus, a kit adapted for use with NASBA preferably contains primers with a RNA ploymersase promoter linked to the target binding sequence, while a kit adapted for use with SDA
preferalby contains primers including a restriction endonuclease recognition site 5' to the target binding sequence.
Similarly, when the kit is adapted for use in a 5' nuclease assay, such as the TaqMan assay, the detection probes preferably contain at least one fluorescent reporter moiety and at least one quencher moiety.
Examples The following examples describes some of the preferred modes of making and practicing the present invention. However, it should be understood that this example is for illustrative purposes only and is not meant to limit the scope of the invention.
Table 3 shows the results of a TaqMan PCR assay using primers and the inventive specific oligonucleotide. The set of primers and the probe was found to be efficient at detecting T. cruzi.
i .. . w .. :... .
A"
.! T f. .p _ . _, _, ...aim ~...M..+.. ..., Brief Description of The Drawing Table 1 shows oligonudeotide sequence of the 195-bp satellite DNA in Trypanosoma cruzi (the GenBank accession no. AY520036).
Table 2 shows inventive specific oligonudeotide sequence derived from the 195-bp satellite DNA
in Tiypanosoma cruzi (the GenBank accession no. AY520036).
Table 3 shows the results of a TaqMan PCR assay using primers and the inventive specific oligonucleotide. The set of primers and the probe was found to be efficient at detecting T. cruzi.
Definitions The terms "probe" and "detection probe" are used herein interchangeably and refer to an oligonucleotide capable of selectively hybridizing to at least a portion of a target sequence under appropriate conditions (e.g., a portion of a target sequence that has been amplified). In certain embodiments, a detection probe is labeled with a detectable moiey.
The terms "fluorophore", "fluorescent moiety", and " fluorescent dye" are used herein interchchangeably. They refer to a molecule that absobs a quantum of electromagnetic radiation at one wavelength, and emits one or more photons at a different, typically longer, wavelength in response. Numerous fluorescent dyes of a wide variety of structures and characteristics are suitable for use in the practive of the invention. Methods and materials are known for fluorescently labeling nucleic acid molecules. Prefeably, a fluorescent moiety absorbs and emits light with high efficiency, and is photostable. Rather than being directly detactable themselves, some fluorescent duyes transfer energy to another fluorescent dye in a process called fluorescent resonance energy transfer(FRET), and the second dye produces the detected signal. Such FRET fluorescent dye pairs are also encompassed by the term "fluorescent moiety". The use of physically linked fluorescent reporter/quencher moeety is also within the scope of the present invention. In these embodiments, when the fluorescent reporter and quencher moiety are held in close promimity, such as at the ends of a nucleic acid probe, the quencher moiety prevents detction of a luorescent signal from the reporter moiety. When the two moieties are physically separated, such as, for example, after cleavage by a DNA
polymerase, the fluorescent signal form the erporter moiety becomes detectable.
The term 'TagMan" assay, also known as fluorogenic 5' nuclease assay, is a powerful and versatile PCR-based detection system for nucleic acid targets. Analysis is performed in conjunction with thermal cycling by monitoring the generation of fluorescence signals. The assay system has the capability of generating quantitative data allowing the determination of target copy numbers. For example, standard curves can be generated using serial dilutions of previously quantified suspensions of Trypanosoma cruzi , against which unknown samples can be caompared. The TaqMan assay is conveniently performed using, for example, AmpliTaq Gold DNA
polymerrase, which has endogenous 5' nuclease activity, to digest an oligonucleotide probe labeled with both a fluorescent reporter dye and a quencher moiety, as described above.
Assay results are obtained by measuring changes in fluorescence that occur during the amplification cycle as the probe is digested, uncouping the flurorescent and quencher moieties and causing an increase in the flurorescence signal that is proportional to the amplification of the target sequence.
The term "isolated" when referring to an oligonudeotide means an oligonucleotide, which by virtue of its origin or manipulation, is esparated from at least some of the components with which it is naturally associated or with which it is associated when initially obtained or prepared.
By "isolated", it is alternatively or additionally meant that the oligonucleotide of interest is produced or synthesized by the hand of man.
The Drawing Table 1 shows oligonudeotide sequence of the 195-bp satellite DNA In Trypanosome cruzi (the GenBank accession no. AY520036).
GAGCTCTTGCCCACACGGGTGCTGCACTCGGCTGATCGTTTTCGAGCGGCTGCTGCATC
ACACGTTGTGGTCCAAATTTTTGTTTCCGATTGTGAATGGTGGGAGTCAGAGGCACTCTC
TGTCAATATCTGTTTGCGTGTTCACACACTGGACACCAAACAACCCTGAACTATCCGCTG
C TTGGAGGAATTTCGC
Table 2 shows inventive specific oligonucleotide sequence derived from the 195-bp satellite DNA in Trypanosoma cruzi (the GenBank accession no. AY520036).
CGTGTTCACACACTGGACACCAAAC
Table 3 shows the results of a TaqMan PCR assay using primers and the inventive specific oligonucleotide. The set of primers and the probe was found to be efficient at detecting T. cruzi.
)WW
Claims (3)
1. The oligonucleotide of an nucleic acid sequence, wherein the detectable label comprises a fluorescent moiety attached at the 5' end of the oligonucleotide and comprises a quencher moiety attached at its 3' end.
2. A method for detecting T. cruzi in a test sample, the method comprising steps of:
providing a test sample suspected of containing a T. cruzi nucleic acid;
contacting the test sample with at least one isolated oligonucleotide such that the at least one oligonucleotide can hybridize to the T. cruzi nucleic acid, if present in the test sample; and detecting any oligonucleotide hybridized to the T. cruzi nucleic acid, where detection of an oligonucleotide hybridized to the T. cruzi nucleic acid indicates the presence of T. cruzi in the test sample.
providing a test sample suspected of containing a T. cruzi nucleic acid;
contacting the test sample with at least one isolated oligonucleotide such that the at least one oligonucleotide can hybridize to the T. cruzi nucleic acid, if present in the test sample; and detecting any oligonucleotide hybridized to the T. cruzi nucleic acid, where detection of an oligonucleotide hybridized to the T. cruzi nucleic acid indicates the presence of T. cruzi in the test sample.
3.The method of claim 2, wherein the amplification reaction is carried out using polymerase chain reaction (PCR), Reverse-Transcriptase PCR (RT-PCR), a Taq-Man, NSBA, or SDA
assay.
assay.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2736087A CA2736087A1 (en) | 2011-03-31 | 2011-03-31 | Oligonucleotide probe for the detection of trypanosoma. cruzi (chagas d isease) in biological samples |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2736087A CA2736087A1 (en) | 2011-03-31 | 2011-03-31 | Oligonucleotide probe for the detection of trypanosoma. cruzi (chagas d isease) in biological samples |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2736087A1 true CA2736087A1 (en) | 2012-09-30 |
Family
ID=46964757
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA2736087A Abandoned CA2736087A1 (en) | 2011-03-31 | 2011-03-31 | Oligonucleotide probe for the detection of trypanosoma. cruzi (chagas d isease) in biological samples |
Country Status (1)
| Country | Link |
|---|---|
| CA (1) | CA2736087A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017009347A1 (en) * | 2015-07-13 | 2017-01-19 | Kann Simone | Oligonucleotides and use thereof |
-
2011
- 2011-03-31 CA CA2736087A patent/CA2736087A1/en not_active Abandoned
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017009347A1 (en) * | 2015-07-13 | 2017-01-19 | Kann Simone | Oligonucleotides and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Oscorbin et al. | Comparison of fluorescent intercalating dyes for quantitative loop-mediated isothermal amplification (qLAMP) | |
| Reslova et al. | xMAP technology: applications in detection of pathogens | |
| Monis et al. | Nucleic acid amplification-based techniques for pathogen detection and identification | |
| Deb et al. | Development of a multiplexed PCR detection method for Barley and Cereal yellow dwarf viruses, Wheat spindle streak virus, Wheat streak mosaic virus and Soil-borne wheat mosaic virus | |
| Divis et al. | A TaqMan real-time PCR assay for the detection and quantitation of Plasmodium knowlesi | |
| Beck et al. | Molecular diagnosis of respiratory viruses | |
| EP2167691B1 (en) | Method for the simultaneous detection of multiple nucleic acid sequences in a sample | |
| JP2007535945A (en) | Combined detection of biological factors | |
| KR102098772B1 (en) | Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR | |
| CN112626272B (en) | Novel coronavirus SARS-CoV-2 detection and molecular typing method and kit | |
| AU2020100696A4 (en) | LAMP-TaqMan ASSAY KIT FOR PIGEON NEWCASTLE DISEASE VIRUS | |
| JP7105553B2 (en) | Dual-probe assay for target nucleic acid detection | |
| US20180265936A1 (en) | Compositions and methods for detection and discrimination of influenza viruses | |
| Criado-Fornelio et al. | Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp. | |
| US20080090224A1 (en) | Nucleic acid detection | |
| JP6538668B2 (en) | Detection of single nucleotide polymorphism using hydrolysis probe with 3 'hairpin structure | |
| JP2020533974A (en) | Respiratory syncytial virus species nicking and elongation amplification reaction (NEAR) | |
| Mutton et al. | Laboratory techniques for human viral encephalitis diagnosis | |
| JP7036595B2 (en) | Compositions and Methods for Detection of Drug-Resistant M. Tuberculosis | |
| US20150099654A1 (en) | Real time pcr detection of respiratory syncytial virus | |
| CA2736087A1 (en) | Oligonucleotide probe for the detection of trypanosoma. cruzi (chagas d isease) in biological samples | |
| Pian et al. | Sandwich hybridization-based loop-mediated isothermal amplification (SHB-LAMP) for high-throughput detection of malaria RNA from asymptomatic infections | |
| Tan et al. | Diagnostic value of real-time capillary thermal cycler in virus detection | |
| AU2014237563B2 (en) | Detection of neisseria gonorrhoeaes | |
| WO2021094661A1 (en) | Method for determining the presence of intestinal parasites |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |
Effective date: 20140402 |