CA2606011A1

CA2606011A1 - Pro-drugs of n-thiazol-2yl-benzamide derivatives

Info

Publication number: CA2606011A1
Application number: CA002606011A
Authority: CA
Inventors: Gitte Mikkelsen; Anette Graven Sams; Benny Bang-Andersen; Mogens Larsen
Original assignee: Individual
Current assignee: H Lundbeck AS
Priority date: 2005-04-25
Filing date: 2006-04-24
Publication date: 2006-11-02
Also published as: EP1877391A1; IL186143A0; AU2006239642A1; JP2008538772A; AR054032A1; BRPI0609565A2; KR20080000607A; EA200702332A1; MX2007012552A; WO2006114093A1; NO20076063L; TW200720264A

Abstract

The invention relates to compounds of the formula I wherein the variables are as defined in the claims. The compounds are pro-drugs of A2A-receptor ligands with improved aqueous solubility, and are useful in the treatment of neurological and psychiatric disorders where an A2A-receptor is implicated.

Description

FIELD OF THE INVENTION
The compounds of the present invention are pro-drugs of a class of N-thiazol-2-yl-benzamide derivatives having affinity for the adenosine 2A (A2A) receptor. The compounds revert into A2A-antagonists, which are useful in the treatment of neurological and psychiatric disorders where an A2A-receptor is implicated. Examples of diseases where an A2A-receptor is implicated are Parkinson's Disease (PD), Alzheimer's Disease, Huntington's disease (HD), epilepsies, cerebral ischemia, haemorrhagic stroke, neonatal ischemia and hypoxia, subarachnoid haemorrhage, traumatic brain injury, brain damage following cardiac arrest, and for the treatment of depression and psychosis disorders.

BACKGROUND OF THE INVENTION

Adenosine is present in all cells, including neurons and glia, of mammalian organisms where it modulates a variety of important physiological processes. The action of adenosine is mediated by specific receptors, which belong to the family of G protein-coupled receptors.
2o Four adenosine receptors have been cloned and characterized, A1, A2A, A2B
and A3 (Fredholm BB. et al., Pharmacol Rev., 1994, 46: 143-156). The main intracellular signaling pathways involve the formation of cAMP, with Al and A3 receptors causing inhibition of adenylate cyclase and A2A and A2B receptors activating it (Olah M., Stiles GL., Pharmacol. Ther., 2000, 85: 55-75).

All of the adenosine receptors have been located in the CNS (Impagnatiello F.
et al., Emerg.
Ther. Targets, 2000, 4: 635-644; Rosin DL. et al., J. Comp. Neurol., 1998, 401: 163-186).
The receptor of interest here, A2A, is predominantly found in dopamine-rich areas, such as the basal ganglia components; the striatum and the globus pallidus, in various mammals, including humans. The basal ganglia, with the striatum as a central component, are involved in integration of cortical, thalamic and limbic information to produce motor behaviours (for review see Svenningsson P. et al., Prog. Neurobiol., 1999, 59: 355-396).

In the striatum A2A and dopamine D2 receptors are found closely co-localized on the striatopallidal GABAergic neurons, forming the so-called indirect output pathway from the striatum, which is involved in motor inhibition. A2A receptors is believed to contribute to control of motor behaviour by modulating the neurotransmission of GABA, dopamine, acetylcholine and glutamate in various ways. Currently, the interactions between A2A and D2 receptors, and in particular the actions of A2A antagonists, are of great interest in the treatment for Parkinson's disease (PD), which involves a decrease in dopamine levels.
The A2A receptors interact tonically and antagonistically with the D2 receptors, causing a decrease in affinity of the D2 receptors for dopamine upon stimulation. Thus, A2A antagonists may be useful as monotherapy for the treatment of Parkinson's disease. Alternatively, A2A
antagonists may be capable of enhancing the effect of clinically used dopamine agonists and increase the time-period of dopaminergic drug response. (For details and references therein see e.g.: Richardson PJ. et al., Trends Pharmacol. Sci., 1997, 18: 338-344; Svenningsson P. et al., Prog.
Neurobiol., 1999, 59: 355-396; Fuxe K. et al., Parkinson's Dis. Adv., 2001, 86: 345-353).

Selective A2A receptor agonists and antagonists have been widely described in pharmacological, behavioural and neuroprotective experiments in rodents and non-human primates (for reviews see: Richardson PJ. et al., Trends Pharmacol. Sci., 1997, 18: 338-344;
Ribeiro JA. et al., Prog. Neurobiol., 2003, 68: 377-392; Ongini E. et al., Il Far=rnaco, 2001, 56: 87-90; Wardas J., Polish J. Pharmacology, 2003, 54: 313-326).

The close interaction of D2 and A2A receptors can be clearly exemplified in models of catalepsy, where D2 receptor antagonists as well as A2A receptor agonists induce catalepsy, which is counteracted by A2A receptor antagonists and D2 receptor agonists, respectively (see Svenningsson P. et al., Prog. Neurobiol., 1999, 59: 355-396 and Refs therein).

Promising anti-parkinsonian effects of A2A receptor antagonists have recently been reported by many investigators. For example, both SCH58261 (2-(2-furanyl)-7-(2-phenylethyl)-7H-pyrazolo[4,3-e][1,2,4]triazolo[1,5-c]pyrimidin-5-amine) and KW-6002 (8-[(lE)-2-(3,4-3o dimethoxyphenyl)ethenyl]-1,3-diethyl-3,7-dihydro-7-methyl-lH-purine-2,6-dione), enhance contralateral rotations, elicited by a subtreshold dose of levodopa, in unilateral 6-OHDA (6-hydroxydopamine) lesioned mice and rats (See Ongini E. et al., Drug Dev. Res., 2001, 52:
379-386 and references therein). Furthermore, KW-6002 significantly improves motor impairment induced in non-human primates by MPTP, without causing dyskinesias, that is commonly described for long-term treatment with the dopamine agonist L-dopa (Kanda T. et al., Ann. Neurol., 1998, 43: 507- 513; Grondin R. et al., Neurology, 1999, 52:
1673-1677;
Kanda T. et al., Exp. Neurol., 2000, 162: 321-327).
Thus, A2A receptor antagonists show great potential as future drugs for long-term medication of PD patients, since they seem not only to reverse the motor impairment but also to slow down or stop the progress of the disease by promoting cell survival.

io Neuroprotective effects by A2A receptor antagonists have recently been reported in in vivo and in vitro models of different neurodegenerative diseases (for review see:
Wardas J., Pol. J.
Pharmacol., 2002, 54: 313-26 and Stone TW., Adv. Exp. Med. Biol., 2002, 513:
249-80). A2A
antagonists have been shown to be neuroprotective in different PD models like in MPTP (1-methyl-4 phenyl-1,2,3,6-tetrahydropyridine) treated mice and 6-OHDA-lesioned rats. Here, KW-6002 prevented functional loss of dopaminergic nerve terminals in the striatum as well as prevented gliosis normally induced around degenerating neurons (Ikeda K. et al., J
Neurochem., 2002, 80: 262-270; Hirsch EC. et al., Adv. Neurol., 1999, 80: 9-18; Kanda T. et al., Ann. Neurology, 1998, 43 (4): 507-513; Lundblad M. et al.. J Neurochem., 2003, 84(6):
1398-410). Similar results have been obtained in experimental models of Huntington's 2o disease. In rat HD models quinolinic acid or kainate induced lesions were reduced after using adenosine A2A receptor antagonists, with a decrease in striatal cell loss and motor changes (Reggio R. et al., Brain Res., 1999, 831: 315-318; Popoli P. et al., J
Neurosci., 2002, 22:
1967-1975). In addition, A2A receptor antagonists have shown to decrease neuronal cell deatli after cerebral ischemia in neonatal and adult rats and gerbils (Gao Y., Phillis JW., Life Sci., 1994, 55(3): PL61-5; Monopoli A. et al., Neuroreport, 1998, 9(17): 3955-9).
A2A knock out animals have been reported to be protected from neonatal hypoxic ischemia and transient focal ischemia (Bona E. et al., Neuropharmacology, 1997, 36(9): 1327-1338;
Chen JF. et al., J Neurosci, 1999, 19(21): 9192-9200) and from 3NP (3- nitropropionic acid) induced, presynaptic, neurotoxic glutamate release (Blum D. et al., J. Neurosci, 2003, 23: 5361-5369).
3o The protective effect of A2A antagonists against neurodegeneration by glutamate release has already been shown in a rat model of ischemic damage to the cerebral cortex (Simpson RE., J
Neurochem, 1992, 58: 1683-1690 and O'Regan MH. et al., Brain Res, 1992, 582:
22-26).

Protection by A2A antagonists has also been reported in primary astrocytes, in a rat model of bFGF induced astrogliosis, an amyloid beta peptide 25-35 induced neurotoxicity in cerebral granule cells (CGCs) and model of QA induced neuronal cell death in rat organotypic slice cultures (Brambilla R. et al., Glia., 2003, 43: 190-194; Dall'Igna OP. et al., Br. J. Pharrnacol., 2003, 138: 1207-1209; Tebano MT,. et al., Eur. J. Pharmacol., 2002, 253-257).

Adenosine is involved in modulation of seizures (Dragunow M. et al., Epilepsia, 1985, 26:
480-487), and anti-convulsive effects are mainly mediated via Al. A2A-antagonist can modulate receptor interaction (O'Kane EM., Stone TW., Eur. J Pharrn., 1998, 362: 17-25) 1o and an A2A-antagonist could thereby unmask protective A1 activity in epilepsy (De Sarro G. et al., Eur. J. Pharmacol., 1999, 371(2-3): 137-145; Ongini E. et al., Ann N
YAcad Sci., 1997, 825: 30-48.) Collectively, A2A receptor antagonists can efficiently protect different neurons from various forms of insult induced neurodegeration (Abbracchio MP., Cattabeni F., Ann N
YAcad Sci., 1999, 890: 79-92; Ongini E. et al., Ann N YAcad Sci.,1997, 825: 30-48).

Adenosine and its analogues induce "depressant-like" effects in animal models of psychiatric disorders (Minor TR. et al., Behav Neurosci, 1994, 108: 265-276; Woodson JC.
et al., Behav 2o Neurosci., 1998, 112: 399-409). Moreover, these behavioural deficits were found to be reversed by adenosine A2A receptor antagonists (Minor TR. et al., Behav. Brain Res., 2001, 120: 203-212). Further studies have shown that treatment with adenosine or 2-chloroadenosine increased immobility time in the mouse forced swimming test, another animal model of depression generally considered reliable (Porsolt RD. et al., Arch Int Pharmacodyn Ther., 1977, 229: 327-336).

Several compounds with dual affinity for A2A and Al receptor subtypes, known as the 4-amino[1,2,3]triazolo[4,3-a]quinoxalines, has been shown to be active in the rat forced swimming test (Sarges R. et al., JMed Chem, 1990, 33: 2240-2254) indicating antidepressant 3o activity of the substances. Most recently, A2A receptor knockout mice were found to be less sensitive to "depressant" challenges than their wildtype littermates (El Yacoubi M. et al., Br J
Pharmacol., 2001, 134: 68-77). Consistent with this data, the A2A receptor antagonists SCH58261 and KW6002 reduced the total immobility time in the mouse tail suspension test (El Yacoubi M. et al., Br J Pharmacol., 2001, 134: 68-77). The antagonists SCH58261 and ZM241385 4-(2-[7-amino-2-(2-furyl)[1,2,4]triazolo[2,3-a][1,3,5]triazin-5-ylamino]-ethyl)phenol were also found to reduce immobility when administered to mice previously screened for having high immobility time, while SCH58261 reduced immobility of mice that 5 were selectively bred for their "helplessness" in this model (El Yacoubi M.
et al., Br. J
PharmacoL, 2001, 134: 68-77).

Studies using A2A knock-out mice suggest that these animals show a blunted response to psycho-stimulants such as amphetamine and cocaine, despite the fact that their expression and io binding affinities of Dl and D2 receptors are unaffected (Chen JF. et al., Neurosci., 2000, 97:
195-204). Moreover, inactivation of A2A receptors has been shown to selectively attenuate amphetamine-induced behavioural sensitisation (Chen JF. et al., Neuropsychopharmacol., 2003, 28: 1086-1095). In addition, A2A knockout mice show reduced startle and PPI of the acoustic startle (Wang JH. et al., Behav. Brain Res., 2003, 143: 201-207), measures often used to detect antipsychotic activity. Further support is found in studies where pharmacological blockade of A2A receptors with a selective antagonist completely abolished pre-pulse inhibition (PPI) (Nagel J. et al., Synapse, 2003, 49: 279-286).
Psychostimulants, such as MK-801 and amphetamine failed to disrupt startle and PPI in A2A KO mice (Wang JH.
et al., Behav. Brain Res., 2003, 143: 201-207).

Thus, the available evidence suggests that adenosine A2A receptor antagonists, by specifically modulating mesostriatal or mesocorticolimbic dopaminergic pathways, may possess antidepressant and/or antipsychotic properties.

Bastia et al. describes in Neurosci Lett. 2002 Aug 16;328(3):241-4 a study of the effects of A(1) and A(2A) adenosine receptor ligands in a mouse models of pain. Several publications concern the relating between the A2A receptor and sleep, e.g. Gallopin T. et al., 2005, Neuroscience 134, 1377-1390 and Huang Z.L. et al. 2005, Nat. Neurosci 8, 858-859, and Metllippara M.M. et al., 2005, Am.J Physiol Regul.Integr.Comp.Physio1289, R1715-R1723.
In the following, examples of publications concerning different uses of A2A
receptor antagonists are given. US 20040138235 suggests use of A2A receptor antagonists for treatment of restless leg syndrome (RLS). WO 02/055083 suggest use of A2A receptor antagonist for Attention Deficit Hyperactivity Disorder (ADHD). Benefits of Adenosine A2A
receptor antagonists for cognition is suggested in: Prediger R. D. S. et al., Behavioral Pharmacology 2005, Vol 16, No 4, 209-218 and Prediger R. D. S. et al. Behavioral Brain Research 2005, 159, 197-205. A review by Jacobson K.A. and Gao Z. Nature Reviews, Drug Discovery, 2006, Vol. 5, 247- 264 relates to adenosine receptors as therapeutic targets, and suggests among other the use of A2A receptor antagonist for migraine, alcohol abuse and RLS.
SUMMARY OF THE INVENTION

io The objective of the present invention is.to provide pro-drugs with improved aqueous solubility of compounds, which are antagonists at the A2A receptor.

Accordingly, the present invention relates to a compound with formula I
A-B-Z
I
wherein Z is a group with formula II

j S O Rl R~
R$ N \N ~ O

s II
or Z is a group with formula IIa o S O Rl R$ N R2 I O

IIa wherein Rl-R~ are independently selected from hydrogen, halogen, C1_6-alkyl and C1_6-alkoxy;
R5 is selected from the group consisting of C1_$-alkyl, C3_8-cycloalkyl-C1_6-alkyl, C3_8-cycloalkyl and C1_6-alkyl-phenyl;
R8 and R9 are independently selected from the group consisting of hydrogen, halogen and CI_ 6-alkyl;
* indicates the atom attached to B;
A is a solvating group;
B is a linking moiety or a bond;
io or pharmaceutically acceptable addition salts thereof.

The invention in further aspects relates to a compounds with formula I as defined above, which compound revert under physiological conditions into a compound with general formula 'r, R9 S O R

R N N R p H 3 ( 5 R N R

V
wherein R1-R5 and R8-R9 have the same meaning as defined herein for Compound I.

In a third aspect the present invention relates to the use of a compound with fonnula I as defined above, for the manufacture of a medicament for the treatment of a disease where an A2A-receptor is implicated.

In a fourth the present invention relates to a pharmaceutical composition comprising a compound with formula I as defined above.

In a further aspect the present invention relates to a method of treating a disease where an A2A-receptor is implicated, comprising administration of a therapeutically acceptable amount of a compound with formula I, as defined above.

DETAILED DESCRIPTION OF THE INVENTION

WO 2005/039572 describes N-thiazol-2-yl-benzamide derivatives having affinity for the adenosine 2A (A2A) receptor. The inventors have now found that some N-thiazol-2-yl-benzamide derivatives having high affinity for the A2A receptor as A2A
antagonists, are characterized by low aqueous solubility and that these compounds can be prepared as bio-reversible pro-drugs with significantly improved aqueous solubility.

Limited aqueous solubility of potential drug candidates may severely hamper their io development into medicaments. For example, preclinical toxicology and safety studies of a drug candidate requires dose escalation to obtain high exposure levels, and therefore, these studies may by hampered by a low solubility of the drug candidate.

Derivatisation of a drug as a bio-reversible pro-drug is a means of overcoming various barriers for a drug to reach its site of action (for a general reference, see:
Design of Pro-drugs, ed. H. Bundgaard, Elsevier, Amsterdam, 1985; also see Ettmayer P. et al., J.
Med. Chem., 2004, 47: 2393-2404). Derivatisation of an insoluble drug as a water soluble, bio-reversible pro-drug is an example of this concept (Fleisher D. et al., Advanced Drug Delivery Reviews, 1996, 19: 115-130). Some drugs or drug candidates have been derivatised as esters of amino 2o acids or phosphoric acid, either via a linker (e.g. Varia S.A. and Stella V.J. J. Pharm. Sci.
1984, 73:8, 1080-87) or by direct attachment to the drug or drug candidate (see e.g. Chan H.
0. et al. Pharmaceutical Research 1998, 15:7, 1012-18) to improve their solubility and bioavailability. Likewise, glucose conjugates have been shown to have increased absorption characteristics (Mizuma T. et al Biochemical Pharmacology 1992, 43:9, 2037-39.
Also, an A2A antagonist has previously been derivatised as a prodrug (Sauer R. et al J
Med. Chem 2000, 43, 440-48).

Accordingly, the present invention relates to compounds with formula I as defined above.
In particular embodiments, the invention relates to coinpounds with formula I
as defined herein, wherein R' is hydrogen or a C1_6-alkoxy, e.g. methoxy. The invention also relates to compounds with formula I as defined herein, wherein Ra is selected from the group consisting of hydrogen, halogen, e.g. fluoro, chloro or bromo, C1_6-alkyl, e.g. C1_3-alkyl e.g. methyl, and C1_6-alkoxy, e.g. methoxy. The invention also relates to compounds with formula I as defined herein, wherein R3 is hydrogen. The invention further relates to compounds with formula I as defined herein, wherein R4 is hydrogen or halogen, e.g. fluoro or chloro.

In another particular embodiment, the present invention relates to compounds with formula I
as defined herein, wherein Rl-R4 are independently selected from hydrogen, halogen, e.g.
fluoro, chloro or bromo, C1_6-alkyl, e.g. C1_3-alkyl, e.g. methyl, and C1_6-alkoxy, e.g. methoxy.
In further embodiments, Rl and R3 are independently selected from the group consisting of jo hydrogen and C1_6-alkoxy, e.g. C1_3-alkoxy, e.g. methoxy. One embodiment of the invention relates to compounds of formula I as defined herein wherein both Rl and R3 are hydrogen. In further embodiments, one or both of R' and R3 is a C1_6-alkoxy, e.g. C1_3-alkoxy, e.g.
methoxy, while both Ra and R4 are hydrogen.

The invention also relates to compounds of the invention, characterised in that R2 and R4 are independently selected from the group consisting of hydrogen, halogen, e.g.
chloro or fluoro, and C1_6-alkyl, e.g. C1_3-alkyl, e.g. methyl. In further embodiments, R2 and R4 are independently selected from halogen, e.g. fluoro or chloro, and C1_6-alkyl, e.g. C1_3-alkyl, e.g.
methyl, and Rl and R3 are hydrogen. In further embodiments, both R2 and R4 are hydrogen.

In another particular embodiment the present invention relates to compounds with formula I
as defined herein, wherein R' is C1_6 alkoxy, e.g. C1_3 alkoxy, e.g. methoxy, and R4 is selected from the group consisting of halogen, e.g. fluoro or chloro, and C1_6-alkyl, e.g. C1_3-alkyl, e.g.
methyl. The invention also relates to compounds of formula I as defined herein, wherein Rl is a C1_6-alkoxy, e.g. C1_3-alkoxy, e.g. methoxy, and R4 is a halogen, e.g.
fluoro or chloro, or a C1_6-alkyl, e.g. a C1_3-alkyl, e.g. methyl, and R2 and R3 are hydrogen.

In another particular embodiment the present invention relates to compounds with formula I
as defined herein, wherein R' is C1_6-alkoxy, e.g. C1_3-alkoxy, e.g. methoxy and R2 is selected from the group consisting of halogen, e.g. fluoro or chloro, and C1_6-alkyl, e.g. C1_3-alkyl, e.g.
methyl.

In another particular embodiment the present invention relates to compounds with formula I
as defined herein, wherein Rl is C1_6-alkoxy, e.g. C1_3-alkoxy, e.g. methoxy and R2 and R4 are independently selected from the group consisting of halogen, e.g. fluoro or chloro, and C1_6-alkyl, e.g. C1_3-alkyl, e.g. methyl.

In a more particular embodiment the present invention relates to compounds with formula I as defined herein, wherein R5 is selected from the group consisting of C1_8-alkyl, preferably C3_8-alkyl and even more preferred C4_8-alkyl which, preferably, is branched at the (3-position, C3_8-cycloalkyl-C1_6-alkyl, preferably C3_$-cycloalkyl-methyl, C3_8-cycloalkyl and C1_6-alkyl-to phenyl, preferably methylphenyl. In further embodiments of the invention, R5 is a C4_8-alkyl branched at the (3-position, e.g. neopentyl or isobutyl.

In a particular embodiment the present invention relates to compounds with formula I as defined herein, wherein R8-R? are independently selected from the group consisting of hydrogen, halogen, preferably fluoro or chloro, and C1_6-alkyl, e.g. C1_3-alkyl, preferably methyl.

In another particular embodiment the present invention relates to compounds with formula I
as defined herein, wherein both R8 and R9 are hydrogen.
Within the invention is also a compound of formula I, wherein said compound is selected from the group of compounds I with Z having formula II, wherein:
R1=R2=R3=R4=R8=R9=HandRS=neopentyl;
R1= R3 = R4 = R8 = R9 = H, R2 = Cl and R5 = cyclopentylmethyl;
R1= R3 = R4 = R$ = R9 = H, R2 = Br and R5 = neopentyl;
R1=R3=R8=R9=H,R2=R4=FandR5=neopentyl;
R1= R3 = R4 = R8 = R9 = H, R~ = F and RS = neopentyl;
R1= R3 = R4 = R8 = R9 = H, Ra = methyl and R5 = neopentyl;
R1= R3 = R4 = R8 = R9 = H, R2 = methoxy and RS = neopentyl;
R2 = R3 = R4 = R8 = R9 = H, R1= methoxy and R5 = isopropyl;
R2 = R3 = R8 = R9 = H, R1= methoxy, R4 = Cl and R5 = phenylmethyl;
RZ = R3 = R8 = R9 = H, R1= methoxy, R4 = Cl and R5 = cyclopentyl;
R1= R3 = R4 = R8 = R9 = H, R2 = F and R5 = isobutyl; and R1=R3=R8=R9=H,R2=R4=C1andR5=neopentyl.
In preferred embodiments, the invention relates to compounds of formula I with Z having formula II, wherein R1= R2 = R3 = R4 = R$ = R9 = H and R5 = neopentyl. In further embodiments, the invention relates to compounds of formula I with Z having formula II, wherein R1= R3 = R8 = R9 = H, R2 = R4 = F and R5 = neopentyl.

In further embodiments, the invention relates to compounds of formula I with Z
having formula II, wherein R1= R3 = R8 = R9 = H, R2 = R4 = F and RS = neopentyl. The invention to also relates to compounds of formula I with Z having formula II, wherein R1= R3 = R4 = R8 =
R9 = H, R2 = F and R5 = neopentyl.

As indicated herein the solvating group A is a group capable of supplying improved aqueous solubility of said compound I compared to the corresponding compound with formula V as defined herein. As described herein B of Compound I is a linking moiety or a bond.

The invention also relates to compounds of the invention, wherein the construct A-B- of said prodrug of formula I is capable of providing improved aqueous solubility of said compound I, compared to the corresponding compound with formula V as defined herein, and in which construct A-B- in the context of Compound I, one or more bonds will be cleaved under physiological conditions, to release said compound with formula V.

In further embodiments of the invention, A-B- of formula I is a phosphoric acid mono methylenyl ester [i.e. a mono methylenyl ester of phosphoric acid, e.g. as A-B-in the following compound of formula I: "Phosphoric acid mono-{2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl} ester"] and Z of formula I is, e.g., a group with formula II as defined herein.

In another particular embodiment the present invention relates to compounds with formula I
as defined herein, wherein A is a solvating group selected from compounds containing at least two functionalities, wherein one of said functionalities is a ionisable functionality, and another of said functionalities is a functionality which can form a bond to B;
or A is selected from compounds containing a suitable number of hydroxy functionalities, and a functionality which can form a bond to B.

The invention also relates to compounds with formula I as defined herein, wherein A is a solvating group selected from the group consisting of: N-unsubstituted or N-mono-, N-di-, or IV-tri-substituted amino acids, di-amines, mono-, di- or tri-phosphates or esters thereof and/or salts thereof, sulfonic acids or salts thereof, di-carboxylic acids or salts thereof, 0- or 1V-glycosides, polyalcohols including alditols and ketols; or combinations thereof, such as glycosylated amino acids or glycosylated phosphates.
In another particular embodiment, the present invention relates to compounds with formula I
as defined herein, wherein A is a solvating group selected from N-unsubstituted, N-mono- or N-di-substituted amino acids (e.g. selected from the group consisting of the 20 naturally occurring biogenic amino acids or N- mono- or dialkylated analogues hereof, 4-carboxy-piperidine, or a-methyl valine), mono-phosphate mono esters, or salts thereof, or A is a polyalcohol (e.g. glycerol) or a carbohydrate (e.g. glucose).

In further embodiments the present invention relates to compounds with formula I as defined herein, wherein B is a linking moiety with formula III, IV or IVa R 6 R' R s R' i R 6 R' i O ~0~ J
# 10 III IV IVa wherein R6'7 are independently selected from hydrogen and C1_6-alkyl, and *
indicates the atom attached to Z, and # indicates the atom attached to A.

In a particular embodiment, the present invention relates to compounds with formula I as defined herein, wherein B is a linking moiety with formula III or IV.

Further embodiments of the present invention relates to compounds with formula I as defined herein, wherein Z is a group with formula II

S O R' Rz R$ N \N X O
~
)t""

II;
* indicating the atom attached to B, wherein R1-R5 and R8-R9 are as defined herein.

In a further embodiment, the present invention relates to compounds with formula I as defined herein, where B is a linking moiety with formula III or IV
R6 R' R6 R' O
~ O # \* 110 / #
III IV, * indicating the atom attached to Z, and # indicating the atom attached to A, preferably Z
being a group with formula II.

In particular embodiments, the present invention relates to compounds with formula I as defined herein, wherein Z is a group with formula II and B is a linking moiety with formula III or IV, provided that when B is a linking moiety with formula III, A is attached via a carbonyl or a hetero carbonyl group, or as an acetal or ketal; and provided that when B is a linking moiety with formula IV, A is attached via a nitrogen or an oxygen atom;
wherein R6"7 are independently selected from hydrogen and C1_6-alkyl, preferably methyl;
and * indicates the atom attached to Z, and # indicates the atom attached to A.

In yet another particular embodiment the present invention relates to compounds with formula I as defined herein, wlzerein B is a linking moiety with formula III or IV and both R6 and R7 are hydrogen or R6 is hydrogen and R7 is methyl.

In yet another particular embodiment the present invention relates to compounds with formula I as defined herein, wherein B is a linking moiety with formula III or IV and R6"7 are hydrogen.

In a further embodiment, the present invention relates to compounds with formula I as defined herein where B is a linking moiety with formula IVa 10J ~
\~

IVa, provided that A is attached via a nitrogen or an oxygen atom;
io wherein R6-7 are independently selected from hydrogen and C1_6-alkyl, e.g.
C1_3-alkyl, preferably methyl, provided that R6 and R7 are not both hydrogen;
and * indicates the atom attached to Z, and # indicates the atom attached to A.

In yet another particular embodiment the present invention relates to compounds with formula is I as defined herein, wherein B is a linking moiety with formula IVa and R6 is hydrogen and R7 is methyl.

In yet another particular embodiment the present invention relates to compounds with formula I as defined herein, wherein B is a bond, provided that A is a carbohydrate attached via the 2o anomeric carbon atom.

In a more particular embodiment the present invention relates to compounds with formula I as defined herein, wherein Z is a group with formula II and B is a bond, provided that A is a carbohydrate attached via the anomeric carbon atom.

In particular, the present invention relates to a compound with formula I as defined above, wherein one or more bonds of said compound are degraded, e.g. enzymatically or chemically, under physiological conditions, and that upon said degradation a compound with formula V, O R

R N \ R 2 O

R N R

V
wherein R1-R5 and R8-R9 have the same meaning as defined herein for compound I, will be io released.

In preferred embodiments, the compound of the invention with formula I as defined herein, revert under physiological conditions into a A2A receptor antagonist with the general formula V, preferably having a human A2A binding affinity (Ki) of 200 nM or less, more preferred of 15 50 nM or less, and most preferred of 10 nM or less.

In a broad aspect, the invention relates to compounds with formula I as defined herein, which revert under physiological conditions into A2A receptor ligands with the general formula V, preferably having a human A2A binding affinity (K;) of 200 nM or less, more preferred of 50 2o nM or less, and most preferred of 10 nM or less.

In specific embodiments, the compound I with formula I as defined herein has an aqueous solubility which is at least 2 or at least 5 or at least 10 or at least 20 times higher than compared to the corresponding compound V.

As indicated above it is understood that the various embodiments of compound I
described herein with respect to R1-RS and R8-R9 also applies to compound V. In specific embodiments of Compound I, V is selected from the group consisting of:
4-(3,3-Dimethyl-butyrylamino)-N-thiazol-2 yl-benzamide;
3o 3-Chloro-4-(2-cyclopentyl-acetylamino)-N-thiazol-2 yl-benzamide;
3-Bf omo-4-(3,3-dimethyl-butyrylamino)-N-thiazol-2 yl-benzamide;
4-(3, 3-Dimethyl-butyylamino)-3, 5-difluoro-N-thiazol-2 yl-benzamide;
4-(3,3-Dimethyl-butyrylamino)-3 fluof o-N-thiazol-2 yl-benzamide;

4-(3,3-Dimethyl-butyrylamino)-3-methyl-N-thiazol-2 yl-benzamide;
5-Chloro-2-methoxy-4-(2-methyl-benzoylamino)-N-thiazol-2 yl-benzamide;
5-Chlor=o-4-(cyclopentanecarbonyl-amino)-2-methoxy-N-thiazol-2 yl-benzamide;
3-Fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2-yl-benzamide;
4-(3, 3-Dimethyl-butyrylamino)-3-methoxy-N-thiazol-2 yl-benzamide;
4-Isobutyrylamino-2-methoxy-N-thiazol-2-yl-benzamide; and 4-(3, 3-Dimethyl-butyrylamino)-3, 5-dichloro-N-thiazol-2yl-benzamide, or a salt thereof.
Particular compounds of the invention are a compound of formula I or a salt thereof selected jo from the group consisting of:
Amino-acetic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester, 2-Amino-3-methyl-butyric acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (S)-2-Arnino-3-methyl-butyric acid 2-[(E/Z)-3-1s chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Amino-3-metlzyl-butyric acid 2-[(E/Z)-3-bromo-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-2o benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluof o-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino) -3 fluoro-benzoyliminoJ-thiazol-3ylmethyl ester, e.g. (S)-2-Amino-3-methyl-butyic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyr ylamino) 25 -3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyt ylamino)-3-methyl-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3-methyl-benzoyliminoJ-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoyliminoJ-30 thiazol-3-ylmethyl ester, e.g. (S)-2 Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;

2-Amino-3-methyl-butyric acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-benzoyliminoJ-thiazol-3ylmethyl ester, e.g. (S)-2-Amino-3-methyl-butyrAic acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-rnethyl-benzoylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-5-chloro-4-(cyclopentanecarbonyl-amino)-methoxy-benzoyliminoJ-thiazol-3 ylrnethyl ester, e.g. (S)-2 Amino-3-rnethyl-butyr ic acid 2-[(E/Z)-5-chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-benzoyl iminoJ-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3ylmethyl ester, e.g. (2S, 3S)-2 Amino-3-methyl pentanoic acid 2-io [(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3-ylmethyl ester;
2-Amino-3-methyl pentanoic acid 2-[(E/Z)-3-br omo-4-(3, 3-dirnethyl-butyf ylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (2S,3S)-2 Arnino-3-methyl pentanoic acid 2-[(E/Z)-3-br omo-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;
2 Amino-3-methyl pentanoic acid 2-[(E/Z)-3 fluor o-4-(3-methyl-butyr ylamino)-1s benzoyliminoJ-thiazol-3ylmethyl ester, e.g. (2S,3S)-2-Amino-3-methylpentanoic acid 2-[(E/Z)-3 fluor o-4-(3-methyl-butyrylamino)-benzoylimino]-thiazol-3 ylmethyl ester;
2 Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluor o-benzoyliminoJ-thiazol-3 ylrnethyl ester, e.g. (2S, 3S)-2 Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-benzoylimino]-thiazol-3 ylmethyl ester;
20 2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (2S, 3S)-2-Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-AnZino )-3-methyl pentanoic acid 2-[(E/Z)-4-(3, 3-dimethyl-buty>"ylamino)-benzoyliminoJ-thiazol-3 ylrnethyl ester, e.g. (2S, 3S)-2 Amino )-3-methyl pentanoic acid 2-[(E/Z)-4-(3, 3-2s dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Arnino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (2S, 3S)-2 Arnino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyr ylamino)-3-methoxy-benzoyliminoJ-thiazol-3ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-3o benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (S)- Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-bromo-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino) benzoyliminoJ-s thiazol-3-ylmethyl ester, e.g. (S)- Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-fluoro-4-(3-methyl-butyrylamino) benzoyliminoJ-thiazol-3 ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-thiazol-3ylmethyl ester, e.g. (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl ester;
io Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoyliminoJ-thiazol-3ylmethyl ester, e.g. (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3-methoxy-benzoyliminoJ-thiazol-3 ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3-methyl-benzoyliminoJ-thiazol-3 ylmetliyl ester, e.g. (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-15 (3,3-dimethyl-butyrylamino)-3-methyl-benzoyliminoJ-thiazol-3 ylmethyl ester;
Amino-2-methyl-propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. 2 Amino-2-methyl propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Amino-2-methyl propionic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino)-2o benzoyliminoJ-thiazol-3ylmethyl ester;
2-Amino-2-methyl-propionic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-4-isobutyrylamino-2-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
25 Piperidine-4-carboxylic acid 2-[(E/Z)-3-bromo-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-3-chloro-4-(3-ethyl-hexanoylamino-benzoyliminoJ-thiazol-3 ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino)-benzoyliminoJ-3o thiazol-3-ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methyl-benzoyliminoJ-thiazol-3 ylmethyl ester;

Piperidine-4-carboxylic acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-benzoyliminoJ-thiazol-3 ylrnethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-5-chloNo-4-(cyclopentanecarbonyl-amino)-2-rnethoxy-benzoyliminoJ-thiazol-3ylmethyl ester;
3 Amino propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyNylarnino)-3,5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Methylamino-propionic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-enzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (S)-2-Methylamino-propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3, 5-difluoro-enzoyliminoJ-thiazol-3 ylmethyl ester;
to 2 Anaino-2, 3-dimethyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoNo-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (R,S)-2 Amino-2,3-dimethyl-butyr=ic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl ester;
2-Dimethylamino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (2S, 3S)-2-Dimethylamino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoyliminoJ-thiazol-3-ylrnethyl ester;
Phosphoric acid mono-{2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3-ylmethyl} ester;
Phosphoric acid mono-{2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-2o tlziazol-3 ylmethyl} ester;
Phosphoric acid mono-{2-[(E/Z)-3, 5-dichloro-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl} ester;
Phosphoric acid mono-{2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl} ester;
Carbonic acid 2, 3-dihydroxy propyl ester 2-[(E/Z)-4-(3, 3-dimethyl-butyf ylamino)-3, 5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl ester, e.g. (R,S)-Carbonic acid 2,3-dihydroxy-propyl ester 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-benzoyliminoJ-thiazol-3-ylmethyl ester;
4-(3, 3-Dimethyl-butyrylamino)-3, 5-difluoro-N-{3-[3, 4, 5-trihydroxy-6-((R)-hydroxymethyl)-3o tetrahydro pyran-2 yloxymethylJ-3H-thiazol-2 ylidene}-benzamide, e.g. 4-(3,3-Dimethyl-butyrylamino)-3, 5-difluoro-N-{3-[(1 S, 3S, 4S, 5R)-3, 4, 5-trihydroxy-6-((R)-hydroxymethyl)-tetrahydro pyf an-2yloxymethylJ-3H-thiazol-2 ylidene}-benzamide; and 4-(3, 3-Dimethyl-butyr ylamino)-3, 5-difluoNo-N-[3-(3, 4, 5-trihydroxy-6-hydroxymethyl-tetrahydro pyran-2 yl)-3H-thiazol-2 ylidene]-benzamide, e.g. 4-(3,3-Dimethyl-butyrylamino)-3, 5-difluoro-N-[3-((2R, 3R, 4S, 5S, 6R)-3, 4, 5-trihydroxy-6-hydroxymethyl-tetrahydro pyran-2-yl)-3H-thiazol-2 ylideneJ-benzamide.

One embodiment of the invention relates to the use of a compound according to the present invention for the manufacture of a medicament for the treatment of a disease where an A2A-receptor is implicated, e.g. a disease described herein.

to Further embodiments relates to the use of a compound according to the present invention for the manufacture of a medicament for the treatment of a disease or disorder selected from the group consisting of Parkinson's Disease, Alzheimer's Disease, Huntington's disease, epilepsies, cerebral ischemia, haemorrhagic stroke, neonatal ischemia and hypoxia, subarachnoid haemorrhage, traumatic brain injury, brain damage following cardiac arrest, 15 depression, Restless Leg Syndrome (RLS), abuse, e.g. alcohol abuse, migraine, somnolence, narcolepsy, pain, Attention Deficit Hyperactivity Disorder (ADHD), neurodegenerative diseases, cognitive deficits, memory problems and psychosis disorders, e.g.
schizophrenia or for enhancement of cognition or as a neuroprotective.

2o The invention also relates to the use of a compound of the invention for the manufacture of a medicament for the treatment in a patient with Parlcinson's disease of a condition selected from the group consisting of RLS, depression, cognitive deficits and memory problems.

The invention further relates to a method of treating or preventing a disease or disorder where an A2A-receptor is implicated, comprising administration of a therapeutically acceptable amount of a compound of the invention.

In particular, the invention relates to a method of treating a disease or a disorder selected from the group consisting of Parkinson's Disease, Alzheimer's Disease, Huntington's disease, 3o epilepsies, cerebral ischemia, haemorrhagic stroke, neonatal ischemia and hypoxia, subarachnoid haemorrhage, traumatic brain injury, brain damage following cardiac arrest, depression, somnolence, narcolepsy, pain, Attention Deficit Hyperactivity Disorder (ADHD), and psychosis disorders, e.g. schizophrenia, comprising administration of a therapeutically acceptable amount of a compound of the invention.

In particular, the invention relates to a method of treating or preventing Parkinson's Disease comprising administration of a tlierapeutically acceptable amount of a compound of the invention.

Further embodiment of the invention relates to the use of a compound of the invention for symptomatic treatment of early Parkinson's disease as monotherapy. The invention further io relates to the use of a Compound of the invention as adjunct to another medicament for Parkinson disease, e.g. levodopa, in advanced Parkinson's disease, thereby, e.g., increasing the time-period of dopaminergic drug response.

A further aspect of the invention relates to the use of a compound V, wherein V, i.e. including 1s Rl-RS and R8-R9, is as defined herein for compound I, t S 0 R1 R N N \ R 2 p H 3 I ~ ~

V
for the manufacture of a medicament for the treatment of a disease selected from the group 25 consisting of RLS, schizophrenia, abuse, e.g. alcohol abuse, migraine, pain, somnolence, narcolepsy, ADHD, neurodegenerative diseases, and cognitive deficits, memory problems or for enhancement of cognition or as a neuroprotective.

The invention also relates to the use of compound V as defined above for the manufacture of a 30 medicament for the treatment in a patient with Parkinson's disease of a condition selected from the group consisting of RLS, depression, cognitive deficits and memory problems.

Further embodiment of the invention relates to the use of a use of a compound V as defined herein for symptomatic treatment of early Parkinson's disease as monotherapy.
The invention further relates to the use of a Compound of the invention as adjunct to another medicament for Parkinson disease, e.g. levodopa (L-dopa), at advanced Parkinson's disease, thereby, e.g., increasing the time-period of dopaminergic drug response.

In specific embodiments of the invention described herein for the medical use of compound V, the compound V is selected from the group consisting of 4-(3, 3-Dimethyl-butyrylamino)-N-thiazol-2yl-benzamide;
3-Chloro-4-(2-cyclopentyl-acetylamino)-N-thiazol-2yl-benzamide;
3-Bromo-4-(3, 3-dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide;
4-(3, 3-Dimethyl-butyrylamino)-3, 5-difluoro-N-thiazol-2 yl-benzamide;
4-(3, 3-Dimethyl-butyNylamino)-3 fluoro-N-thiazol-2yl-benzamide;
4-(3, 3-Dimethyl-butyrylamino)-3-methyl-N-thiazol-2 yl-benzamide;
5-Chloro-2-methoxy-4-(2-methyl-benzoylamino)-N-thiazol-2 yl-benzamide;
5-Chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-N-thiazol-2 yl-benzamide;
3-Fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2 yl-benzamide;
4-(3, 3-Dimethyl-butyrylamino)-3-methoxy-N-thiazol-2 yl-benzamide;
4-Isobutyrylamino-2-methoxy-N-thiazol-2 yl-benzamide; and 2o 4-(3, 3-Dimethyl-butyrylamino)-3, 5-dichloro-N-thiazol-2 yl-benzamide;
or a salt thereof.

As used herein the term treatment include prevention or treatment or relief as the case may be.
Also the term disease may mean a disorder or disease as the case may be.

When referring to the uses of the compound of the invention it is understood that the Compound may, e.g., be in the form of a salt.

The compounds of the general formula I and V may exist as enantiomers thereof and such 3o enantiomers are also embraced by the invention. Throughout the specification and claims, reference to specific compounds with formula V refers to the racemates unless otherwise indicated.

The term C1_6-alkyl refers to a branched or unbranched alkyl group having from one to six carbon atoms inclusive, such as methyl, ethyl, 1-propyl, 2-propyl, 1-butyl, 2-butyl, 2-methyl-2-propyl, and 2-methyl-l-propyl. The term C1_$-alkyl refers similarly to branched or unbranched alkyl group having from one to eight carbon atoms inclusive.

The term C3_8-cycloalkyl designates a monocyclic or bicyclic carbocycle having three to eight C-atoms, such as cyclopropyl, cyclopentyl, cyclohexyl, etc.

Halogen means fluoro, chloro, bromo or iodo.
The terms C1_6-alkoxy, C3_8-cycloalkyl-C1_6-alkyl, designate such groups in which the C1_6-alkyl and the C3_g-cycloalkyl group are as defined above.

The acid addition salts of the compounds of the invention are pharmaceutically acceptable salts formed with non-toxic acids. Exemplary of such organic salts are those with maleic, fumaric, benzoic, ascorbic, succinic, oxalic, bis-methylenesalicylic, methanesulfonic, ethanedisulfonic, acetic, propionic, tartaric, salicylic, citric, gluconic, lactic, malic, mandelic, cinnamic, citraconic, aspartic, stearic, palmitic, itaconic, glycolic, p-aminobenzoic, glutamic, benzenesulfonic and theophylline acetic acids, as well as the 8-halotheophyllines, for example 8-bromotheophylline. Exemplary of such inorganic salts are those with hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric and nitric acids.

The base addition salts of the compounds of the invention are pharmaceutically acceptable salts formed with non-toxic bases. Exemplary of such base addition salts include salts with alkali metals (e.g. sodium, potassium);' salts with alkaline earth metals (e.g. calcium, magnesium); ammonium salts; salts with organic amines and the like.

The term solvating group means any group, which can supply improved aqueous solubility to a compound with formula V, upon conjugation to a compound with formula V as described 3o above.

The term linking moiety means any construct, which can serve to connect A and Z as defined above, characterized in that upon conversion of a pro-drug with formula I
under physiological conditions, a compound with formula V will be released.

The term physiological conditions means any set of chemical or enzymatic conditions, which can be encountered in a living mammalian organism. Exemplary of such chemical or enzymatic conditions are the chemical and enzymatic conditions of the gastro-intestinal tract, i.e. the stomach, intestinal lumen and at the gut wall; in blood; or various tissues or organs such as the liver.
The term amino acid means any chemical compound, which contains a carboxylic acid functionality and an amino functionality, such as an a-cyclic or cyclic alkyl-amine, or an aromatic ring containing a nitrogen atom.

The term di-amine means any compound, which contains an amino functionality, which can form a bond to B, and an ionisable amino functionality.

The term hetero carbonyl means any equivalent of the carbonyl group; such as a carbon atom connected to a heteroatom other than oxygen via a double bond; or a heteroatom, such as phosphorous or sulphur, connected to an oxygen atom via a double bond.

The term (E/Z), wherein E and Z have the standard meanings "entgegen" and "zusammen", means a pure double bond stereo isomer of unknown geometry, or a mixture of stereoisomers in any ratio.

The pharmaceutical compositions of this invention, may be administered by any suitable route, for example orally in the form of tablets, capsules, powders, syrups, etc., or parenterally in the form of solutions for injection. For preparing such compositions, methods well known in the art may be used, and any pharmaceutically acceptable carriers, diluents, excipients or other additives normally used in the art may be used.

Conveniently, the compounds of the invention are administered in unit dosage form containing said compounds in an amount of about 0.01 to 100 mg. The total daily dose is usually in the range of about 0.05 - 500 mg, and most preferably about 0.1 to 50 mg of the active compound of the invention.

The pharmaceutical formulations of the invention may be prepared by conventional methods 5 in the art.

For example: Tablets may be prepared by mixing the active ingredient with ordinary adjuvants and/or diluents and subsequently compressing the mixture in a conventional tabletting machine. Examples of adjuvants or diluents comprise: Corn starch, potato starch, lo talcum, magnesium stearate, gelatine, lactose, gums, and the like. Any other adjuvants or additives usually used for such purposes such as colourings, flavourings, preservatives etc.
may be used provided that they are compatible with the active ingredients.

Solutions for injections may be prepared by dissolving the active ingredient and possible 15 additives in a part of the solvent for injection, preferably sterile water, adjusting the solution to the desired volume, sterilising the solution and filling it in suitable ampoules or vials. Any suitable additive conventionally used in the art may be added, such as tonicity agents, preservatives, antioxidants, etc.

2o Typical examples of recipes for the formulation of the invention are as follows:
1) Tablets containing 5.0 mg of a compound of the invention calculated as the free base or free acid:
Compound I 5.0 mg Lactose 60 mg 25 Maize starch 30 mg Hydroxypropylcellulose 2.4 mg Microcrystalline cellulose 19.2 mg Croscarmellose Sodium Type A 2.4 mg Magnesium stearate 0.84 mg 3o 2) Tablets containing 0.5 mg of a compound of the invention calculated as free base or free acid:
Compound I 0.5 mg Lactose 46.9 mg Maize starch 23.5 mg Povidone 1.8 mg Microcrystalline cellulose 14.4 mg Croscarmellose Sodium Type A 1.8 mg Magnesium stearate 0.63 mg 3) Syrup containing per millilitre:
Compound I 25 mg Sorbitol 500 mg Hydroxypropylcellulose 15 mg Glycerol 50 mg Methyl-paraben 1 mg Propyl-paraben 0.1 mg Ethanol 0.005 mL
Flavour 0.05 mg Saccharin sodium 0.5 mg Water ad 1 mL
4) Solution for injection containing per millilitre:
Compound I 0.5 mg Sorbitol 5.1 mg Acetic Acid 0.05 mg Saccharin sodium 0.5 mg Water ad 1 mL

The compounds of the invention may be prepared by the following general methods:
a) Deprotection of a compound with formula VIII
A'-B-Z
VIII
wherein Z and B have the same meaning as described above, A' is a suitably protected form of A, and A is as described above, to release a compound with formula I as described above.

Deprotection of compounds with formula VIII may be performed by standard procedures known to chemists skilled in the art. This includes deprotection of compounds with formula VIII, in which said suitable protecting group(s) are acid labile, by treatment with a suitable acid in a suitable solvent at a suitable temperature, such as i.e. HCl in diethyl ether at 20-40 C, or trifluoroacetic acid in dichloromethane at 20-40 C, followed by evaporation of solvent and excess acid. Alternatively, deprotection of coinpounds with formula VIII, in which said suitable protecting group(s) are base labile, includes treatment with a suitable base such as sodium methoxide in methanol at 20-40 C, followed by neutralization with a suitable acid, such as acidic ion exchange resins.

b) Reaction of a compound with formula I
A-B-Z
I
wherein Z and B are as described above, and A is an N-unsubstituted or N-mono-substituted amino acid, with an alkylating agent such as an aldehyde in the presence of a reducing agent such as sodium cyanoborohydride (NaCNBH4), in a suitable solvent such as methanol (MeOH), at a suitable temperature such as room temperature.

Compounds with formula VIII may be prepared by the following general methods:
a) Reaction of a compound with formula V

O R' R N//~N R 2 O

H R N~RS

V
wherein R' - R5 and R8 - R9 are as described above, with a compound A'-B-E
under basic conditions, wherein A' is a suitably protected from of A, and A and B are as defined above, and where E is attached to the atom in B with label *, and E is a leaving group such as e.g, chloride.
The reaction of compounds with formula V with a compound A'-B-E may be performed by standard procedures known to chemists skilled in the art. This includes deprotonation of compounds with formula V by reaction with a suitable base such as sodium llydride (NaH) in a suitable solvent such as dimethyl forinamide (DMF) at a suitable temperature such as 20-60 C, or 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in tetrahydrofurane (THF) at 60 C, followed by addition of A'-B-E.

b) Reaction of a compound with formula VII

S 0 R' "' RZ
R N/\\N I
Ci R N)~ R5 I

VII
wherein Rl - R5 and R8 - R9 are as described above, with a compound A'-H, wlierein A' is a suitably protected form of A, and A is as defined above and H is a proton.

The reaction of compounds with formula VII with a compound A'-H may be performed by standard procedures known to chemists skilled in the art. This includes deprotonation of compounds A'-H by reaction with a suitable base such as diisopropylethylamine, in a suitable solvent such as THF, followed by addition of a compound with formula VII, at a suitable temperature such as 20-50 C, or by reaction of compounds A'-H with a compound with formula VII in the presence of a suitable catalyst such as silver trifluorosulphonate (AgOTf), in a suitable solvent such as dichloromethane, at a suitable temperature, such as -78 C - 20 oc.

c) Reaction of a compound with formula V

O R
R z R N N \ O
H R / NRS
~ V, wherein R' - RS and R$ - R9 are as described above, with a compound A'-E
wherein A' is a suitably protected form of A, and A is as defined above, and E is a leaving group such as e.g.
chloride.
The reaction of compounds with formula V with a compound A'-E may be performed by standard procedures known to chemists skilled in the art. This includes reaction of compounds A'-E with a compound with formula V in the presence of a suitable catalyst such as AgOTf, in a suitable solvent such as dichloromethane, at a suitable temperature, such as -78 C-20 C.
Compounds with formula V were prepared according to the following general procedure as outlined below.

Coupling of a compound with formula VI

O R

I
H R / NH

VI
wherein Rl - R4 and R8 - R9 are as described above, with a carboxylic acid R5-COOH or carboxylic acid chloride RS-COCI, wherein R5 is as defined above.

The coupling of compounds with formula VI with carboxylic acids R5-COOH may be performed by standard procedures known to chemists skilled in the art. This includes coupling in the presence of a uronium salt coupling reagent and diisopropyethylamine (DIPEA), at temperatures between 20-80 C, in a suitable polar or apolar solvent such as N-methyl pyrrolidinone (NMP) or 1,2-dichloroethane. The coupling of compounds with formula VI
with carboxylic acid chlorides R5-COCI may be performed by standard procedures known to chemists skilled in the art. This includes coupling of starting materials with formula VI with 5 carboxylic acid chlorides R5-COCI in the presence of a suitable base such as pyridine at temperatures between 20-60 C in a suitable solvent such as 1,2-dichloroethane.

Compounds with formula VI were prepared according to standard procedures known to chemists skilled in the art as outlined below. Suitably substituted 4-nitro benzoic acid lo chlorides were either commercially available or prepared by chlorination of the corresponding carboxylic acids with oxalyl chloride or sulfonyl chloride, and were coupled with suitably substituted 2-aminothiazoles in a suitable solvent such as 1,2-dichloroethane in the presence of a suitable base such as pyridine, at a suitable temperature between 20-60 C. The products were then reduced to the corresponding anilines by procedures known to chemists skilled in 15 the art, such as catalytic hydrogenation using hydrogen and a suitable catalyst such as 10%
Pd/C in a suitable solvent such as ethanol. Alternatively, suitably substituted 4-amino benzoic acids were coupled with suitably substituted 2-aminothiazoles in the presence of a carbodiimide coupling reagent such as 1-(3-dimethylaminopropyl)-3-ethyl-carbodiimide hydrochloride in the presence of a suitable additive such as 1-hydroxybenzotriazole in a 20 suitable solvent such as 1,2-dichloroethane in the presence of a suitable base such as DIPEA, at a suitable temperature between 20-60 C.

Compounds A'-B-E in which A' is a suitably protected amino acid, E is chlorine, and B is a structure with formula III, wherein E is attached to the atom with label *, and R6"' is 25 hydrogen, were prepared according to standard procedures known to chemists skilled in the art as outlined below. Suitably N- and side chain protected amino acids were saponified using a suitable base such as cesium carbonate in a suitable solvent such as mixed water and ethanol, or tetrabutyl ammonium hydrogen sulphate in a suitable solvent mixture such as a mixture of water and dichloromethane. The amino acid salt thus formed is next reacted with a 30 suitable reagent such as bromochloromethane or chloromethylene chlorosulfonic acid in a suitable solvent such as dimethoxyethane at a suitable temperature such as room temperature, or under phase transfer conditions in a suitable solvent mixture such as a mixture of water and dichloromethane, at a suitable temperature such as room temperature.

Compounds A'-B-E in which A' is a suitably protected poly-alcohol, E is chlorine, and B is a structure with formula IV, wherein E is attached to the atom with label *, and R6-' is hydrogen, were prepared according to standard procedures known to chemists skilled in the art as outlined below. Suitably protected poly-alcohols were reacted with a suitably substituted chloroalkyl chloroformate in a suitable solvent such as chloroform in the presence of a suitable base such as pyridine, at a suitable temperature between 20-60 C.
Compounds of formula VII, wherein R' - R4 and R8 - R9 are as described above, were prepared according to standard procedures known to chemists skilled in the art. This includes reaction of a compound with formula V, wherein R' - R5 and R8 - R9 are as described above, with chloromethylchloroformate in the presence of a suitable base such as NaH
in a suitable solvent such as DMF at a suitable temperature such as 20-60 C.
Alternatively, the compounds of formula VII, wherein Rl - R4 and R8 - R9 are as described above, can be prepared by reaction of a compound with formula V, wherein R' -RS and R8 -R9 are as described above, with a substance C1CH2-E, wherein E is a suitable leaving group, for example bromine or chlorosulfonate, in the presence of a suitable base such as NaH in a suitable solvent such as DMF at a suitable temperature such as 20-60 C.

EXAMPLES
Analytical methods Analytical LC-MS data were obtained by either of two methods: (method A): on a PE Sciex API 150EX instrument equipped with an IonSpray source and a Shimadzu LC-8A/SLC-l0A
LC system. Column: 30 X 4.6 mm Waters Symmetry C18 column with 3.5 m particle size;
solventsystem: A = water/trifluoroacetic acid (100:0.05) and B =
water/acetonitrile/trifluoroacetic acid (5:95:0.03); method: Linear gradient elution with 90%
A to 100% B in 4 min and with a flow rate of 2 ml/min. or (method B): on a Micromass LCT
instrument equipped with a 4-way MUX ElectroSpray source, a Micromass Waters MUX-2488 UV-detector, a Sedex 754 4-channels LT-ELS-detector, a CTC Analytics HTS-PAL

autosampler equipped with 4 injection valves, and 4 Waters 1525 Binary HPLC
pumps.
Column: 30 X 4.6 mm Waters Symmetry C18 column with 3.5 m particle size;
solventsystem: A = water/trifluoroacetic acid (100:0.05) and B =
water/acetonitrile/trifluoroacetic acid (5:95:0.03); method: Linear gradient elution with 90%
A to 100% B in 4 min and with a flow rate of 2 ml/min. Purity was determined by integration of the UV (254 nm) and ELSD traces. The retention times (RT) are expressed in minutes.

'H NMR spectra were recorded at 500.13 MHz on a Bruker Avance DRX500 instrument or at 250.13 MHz on a Bruker AC 250 instrument. Deuterated dimethyl sulfoxide (99.8%D) was lo used as solvent unless otlzerwise specified. TMS was used as internal reference standard.
Chemical shift values are expressed in ppm. The following abbreviations are used for multiplicity of NMR signals: s= singlet, d= doublet, t = triplet, q = quartet, qui = quintet, h=
heptet, dd = double doublet, dt = double triplet, dq = double quartet, tt =
triplet of triplets, m=
multiplet, br s= broad singlet and br = broad signal.

For column chromatographX silica gel of the type Kieselgel 60, 40-60 mesh ASTM
was used.

Chloromethylen chlorosulphonic acid was prepared as described in Binderup, E. and Hansen, E.T. Synthetic Communications 1984, 14, 857-64.
Preparation of compounds with formula A'-B-E

A compound A'-B-E in which A is a suitably protected mono phosphate, E is chlorine and B
is a structure with formula III, wherein E is attached to the atom with label *, and R6-7 is hydrogen, was prepared as described by J.P.Krise et al. J. Med. Chem. 1999, 42, pp. 3094-3100. (Di-tert-butyl chloromethyl phosphate).

Compounds A'-B-E in which A' is an N-blocked, and optionally side chain protected amino acid, E is chlorine and B is a structure with formula III, wherein E is attached to the atom with label *, and R6-7 is hydrogen, were prepared as described by P. Gomes et al.
Synthetic Comnaunications, 2003, 33, (10), pp.1683-1693, or alternatively as described by Harada, N. et al. in Synthetic Communications, 1994, 24, 767-772. (N-blocked amino acid chloro methylene esters) The following were prepared analogously:
3-tert-Butoxycarbonylamino-propionic acid chloyomethyl ester:
1H NMR (D6-DMSO): 1.37 (s, 9H); 2.54 (t, 2H); 3.18 (dt, 2H); 5.83 (s, 2H);
6.88 (br t, 1H).
(S)-2-tert-Butoxycarbonyl-methyl-amino propionic acid chloNomethyl ester:
1H NMR (D6-DMSO): 1.35 (s, 9H);1.40 (s, 3H); 2.74-2.82 (3H); 4.35-4.66 (114);
5.84-5.94 (2H).

(R,S)-Z-tert-Butoxycarbonylamino-2,3-dimethyl-butyf ic acid chlof omethyl ester:
1H NMR (D6-DMSO): 0.82 (d, 3H); 0.89 (d, 3H); 1.29 (s, 311); 1.36 (s, 9H);
1.99 (m, 1H);
5.85 (br s, 211); 7.19 (br, 11-1).

(R, S)-Carbonic acid chloromethyl ester 2, 2-dimethyl-[], 3Jdioxolan-4 ylmethyl ester:
(R,S)-(2,2-Dimethyl-[1,3]dioxolan-4-yl)-inethanol (8 mmol) was dissolved in chloroform (100 mL) and pyridine (8 mmol) was added. Chloromethyl chloroformate (15 mmol) was added dropwise, and the reaction mixture was stirred at ambient temperature for 4h. The reaction mixture was washed with water, the organic phase was dried over MgSO4 and evaporated. The crude product was purified by flash chromatography on silica using 10%
ethylacetate in heptane as eluent.
Yield: 30%
1H NMR (D6-DMSO): 1.28 (s, 3H); 1.34 (s, 3H); 3. 72 (dd, 1H); 4.05 (dd, 1H);
4.18 (m, 1H);
4.30-4.35 (m, 211); 5.93 (s, 2H).

Preparation of the intermediates with structure VII

li N-(3-Chloromethyl-3H-thiazol-2 ylidene)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-benzamide NaH (20 mmol) was suspended in DMF (100 mL) and 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide (17 mmol) was added and stirred at ambient temperature for 1.5 h, then chloromethylene chloroformate (51 inmol) was added and the reaction mixture was stirred overnight at room temperature. The solvent was removed by evaporation and the crude reaction product was partitioned between ethyl acetate and water. The organic phase to was washed with NH4C1(aq., sat.) x 2 and water x 1, dried over MgSO4, filtered and evaporated. The crude product was purified by flash chromatography on silica using a gradient from 10% to 20% ethyl acetate in heptane as eluent.
Yield: 86%
1H NMR (D6-DMSO): 1.05 (s, 9H); 2.26 (s, 2H); 6.30 (s, 2H); 7.18 (d, 1H); 7.75 (d, 1H);
7.92 (d, 2H); 9.75 (s, 1 H).
LC/MS (m/z) 402 (MH+).

Preparation of the intermediates with structure VI
1 a: 4-Amino-N-thiazol-2-yl-benzamide:
2-Aminothiazole (100 mmol) was suspended in 1,2-dichloroethane (200 mL) and pyridine (100 mmol) was added. The mixture was added portion wise to a suspension of 4-nitro benzoic acid chloride (150 mmol) in 1,2-dichloroethane (500 mL) and stirred at 60 C over night. The reaction mixture was cooled and filtered. The filtrate was washed with 1,2-dichloroethane and dried in vacuo to give 4-nitro-N-thiazol-2-yl-benzamide.
Yield: 96%
1H NMR (D6-DMSO): 7.33 (d, 1H); 7.60 (d, 1H); 8.26-8.41 (4H); 12.96 (br s, 1H).
4-Nitro-N-thiazol-2-yl-benzamide (28 mmol) was suspended in abs. EtOH (400 mL) and ethyl acetate (200 mL) and glacial acetic acid (50 mL) was added followed by 10%
Pd/C (0.5 g).
3o The mixture was hydrogenated for 72h at 3 bar H2. The hydrogenation mixture was filtered, and the solvent was removed under reduced pressure. The crude product was added NaHCO3 (sat.) and ethyl acetate, the remaining solid fraction was removed by filtration and dried in vacuo. The liquid phases were separated, the organics were washed with brine, dried over MgSO4, filtered and evaporated to yield a solid. The solid fractions were combined.
Yield: 83% (80% overall).
1H NMR (D6-DMSO): 5.93 (s, 2H); 6.50 (d, 2H); 7.18 (d, 1H); 7.49 (d, 1H); 7.84 (d, 2H);
5 12.05 (br s, 1H).

lb: 4 Amino-3-methyl-N-thiazol-2 yl-benzamide:
4-Nitro-3-methyl-benzoic acid (83 mmol) was suspended in 1,2-dichloroethane (500 mL) and dimethylformamide (DMF) (5 mL) under an argon atmosphere. Oxalylchloride (2M
in to dichloromethane, 62.3 mL) was added slowly to the stirred suspension. After stirring at room temperature for lh, the solvent was removed by evaporation under reduced pressure, and the reaction mixture was re-dissolved in 1,2-dichloroethane (400 mL). A suspension of 2-aminothiazole (83 mmol) and pyridine (83 mmol) in 1,2-dichloroethane (100 mL) was added portion wise. The reaction mixture was stirred at 50 C over night. The solvent was removed is under reduced pressure and the solids were re-suspended in ethyl acetate (500 mL) and NaHCO3 (sat.) (500 mL). The solids were removed by filtration and the liquid phases were separated. The organic phase was washed with NaHCO3 (sat.), dried over MgSO4, filtered and evaporated. The crude product was re-crystallized from ethyl acetate and the product fractions were combined to give 4-nitro-3-methyl-1V thiazol-2-yl-benzamide.
20 Yield: 76%.
1H NMR (D6-DMSO): 2.58 (s, 3H); 7.33 (d, 1H); 7.60 (d, 1H); 8.10 (d, 2H); 8.20 (d, 2H);
12.92 (br s, 1H).

4-Nitro-3-methyl-N-thiazol-2-yl-benzamide (63 mmol) was suspended in abs. EtOH
(200 mL) 25 and ethyl acetate (100 mL) and glacial acetic acid (10 mL) was added followed by 10% Pd/C
(1 g). The mixture was hydrogenated over night at 3 bar H2. The hydrogenation mixture was filtered and the solvent was removed under, reduced pressure. The crude product was added NaHCO3 (sat.) and ethyl acetate, the remaining solid fraction was removed by filtration and dried in vacuo. The liquid phases were separated, the organics were washed with brine, dried 30 over MgSO4, filtered and evaporated to yield the product as a solid.
Yield: 95% (72% overall) 1H NMR (D6-DMSO): 2.09 (s, 3H); 5.71 (s, 2H); 6.63 (d, 1H); 7.17 (d, 1H); 7.39 (d, 1H);
7.69-7.81 (m, 2H); 11.96 (br s, 1H).

The following compounds were prepared analogously:
lc: 4 Amino-3-methoxy-N-thiazol-2yl-benzamide:
Yield: 17%
1H NMR (D6-DMSO): 3.85 (s, 3H); 5.59 (s, 2H); 6.67 (d, 1H); 7.19 (d, 1H); 7.48-7.65 (3H);
12.17 (br s, 1 H).
ld: 4-Amino-3 fluoro-N-thiazol-2yl-benzamide:
4-Nitro-3-fluoro benzoic acid (535 mmol) was dissolved in toluene (500 mL) and tetrahydrofuran (THF) (75 mL). SOC12 (930 mmol) was added and the mixture was heated at 65 C for 5h. The reaction mixture was cooled and the solvent removed by evaporation. The residue was re-dissolved in 1,2-dichloroethane. This solution was added dropwise to a suspension of 2-aminothiazole (480 mmol) and DIPEA (370 mmol) in 1,2-dichloroethane (1L) with mechanical stirring, while the temperature was kept at 45 C. Upon complete addition the reaction mixture was heated at 60 C for 1.5h, then allowed to cool to room temperature and stirred over night. The reaction mixture was filtered, the solids were washed with 1,2-dichloroethane and dried in vacuo to give 4-nitro-3-fluoro-N-thiazol-2-yl-benzamide.
Yield: 35%
1H NMR (D6-DMSO): 7.34 (d, 1H); 7.61 (d, 1H); 8.10 (m, 1H); 8.23 (m, 1H); 8.31 (m, 1H);
13.00 (br, 1 H).
4-Nitro-3-fluoro-N-thiazol-2-yl-benzamide (7.5 mmol) was suspended in EtOH
(abs., 60 mL) and ethyl acetate (30 mL), glacial acetic acid (5 mL) and 10 % Pd/C (300 mg) was added, and the mixture was hydrogenated for 12 days under 3 bar H2. The reaction mixture was filtered and evaporated, and re-dissolved in etliyl acetate (100 mL) and NaHCO3 (sat., 60 mL). The aqueous phase was adjusted to basic pH with NaOH (1M) and the phases were separated. The organic phase was washed with brine, dried over MgSO4, filtered and evaporated.
Yield: 85% (30% overall) 1H NMR (D6-DMSO): 6.00 (s, 2H); 6.80 (t, 1 H); 7.21 (d, 1 H); 7.51 (d, 1H);
7.74 (m, 1H);
7.81 (m, 1 H); 12.19 (s, 1 H).

le: 4 Amino-3-chloro-N-thiazol-2 yl-benzamide:
4-Amino-3-chloro-benzoic acid methyl ester (21.6 mmol) was saponified in EtOH
(25 ml) and NaOH (1M, 25 ml) at reflux for 2h. The organic solvent was evaporated and pH adjusted to 4. The product was removed by filtration, washed with water and dried in vacuo to give 4-amino-3-chloro-benzoic acid.
Yield: 92%
1H NMR (D6-DMSO): 6.15 (s, 2H); 6.79 (d, 1H); 7.59 (dd, 1H); 7.71 (d, 1H);
12.37 (br s, 111).
to 4-Amino-3-chloro-benzoic acid (19.8 mmol) was dissolved in DMF (10 mL) and 1,2-dichloroethane (80, mL). DIPEA (19.8 mmol), 1-(3 -dimethylaminopropyl)-3 -ethyl-carbodiimide hydrochloride (19.8 mmol), 1-hydroxybenzotriazole (19.8 mmol) and aminothiazole (19.8 mmol) was added, and the reaction mixture was stirred at 60 C over night. The volume was reduced in vacuo, and water (60 mL) was added. The mixture was is extracted with ethyl acetate, the organic phase was washed with NH4Cl (aq., sat.), dried over MgSO4, filtered and evaporated. The crude product was purified by flash chromatography on silica using gradient elution (heptane/ethyl acetate).
Yield: 42% (39% overall) 1H NMR (D6-DMSO): 6.19 (s, 2H); 6.83 (d, 1H); 7.21 (d, 1H); 7.52 (d, 1H); 7.83 (dd, 1H);
2o 8.07 (d, 1 H), 12.24 (br s, 1 H).

lf: 4-Amino-3-bromo-N-thiazol-2 yl-benzamide:
4-Amino-benzoic acid (100 minol) was dissolved in DMF (50 mL) and N-bromosuccinimide (100 mmol) was added. Stirred at ambient temperature for 18h, the reaction mixture was then 25 poured into water (100 mL). The product was removed by filtration, washed with water and dried in vacuo to give 4-amino-3-bromo-benzoic acid.
Yield: 70%
1H NMR (D6-DMSO): 6.10 (s, 2H); 6.78 (d, 1H); 7.63 (dd, 1H); 7.89 (d, 1H);
12.39 (br s, 1H).
3o 4-Amino-3-bromo-benzoic acid (18.5 mmol) was dissolved in DMF (10 mL) and 1,2-dichloroethane (80 mL). DIPEA (18.5 mmol), 1-(3 -dimethylaminopropyl)-3 -ethyl-carbodiimide hydrochloride (18.5 mmol), 1-hydroxybenzotriazole (18.5 mmol) and aminothiazole (18.5 mmol) was added and the reaction mixture was stirred at 60 C over night. The volume was reduced in vacuo, and water (60 mL) was added. The mixture was extracted with ethyl acetate, the organic phase was washed with NH4C1 (aq., sat.), dried over MgSO4, filtered and evaporated. The crude product was purified by flash chromatography on silica using gradient elution (heptane/ethyl acetate).
Yield: 33% (23% overall) 1H NMR (D6-DMSO): 6.14 (s, 2H); 6.82 (d, 1H); 7.21 (d, 1H); 7.51 (d, 1H); 7.86 (dd, 1H);
8.22 (d, 1H); 12.24 (br s, 1H).

lg: 4-Amino-5-chloro-2-methoxy-N-thiazol-2 yl-benzamide:
4-Amino-5-chloro-2-methoxy-benzoic acid (19.8 mmol) ) was dissolved in DMF (10 mL) and 1,2-dichloroethane (80 rnL). DIPEA (19.8 mmol), 1-(3 -dimethylaminopropyl)-3 -ethyl-carbodiimide hydrochloride (19.8 mmol), 1-hydroxybenzotriazole (19.8 mmol) and aminothiazole (19.8 mmol) was added and the reaction mixture was stirred at 60 C over night. The volume was reduced in vacuo, and water (60 mL) was added. The mixture was extracted with ethyl acetate, the organic phase was washed with NH4C1 (aq., sat.), dried over MgSO4, filtered and evaporated. The crude product was re-crystallized from ethyl acetate.
Yield: 32%
1H NMR (D6-DMSO): 3.94 (s, 3H); 6.30 (s, 2H); 6.56 (s, 1H); 7.23 (d, 1H); 7.49 (d, 1H);
2o 7.76 (s, 1 H); 11.05 (br s, 114).

The following compound was prepared analogously:
lh: 4 Amino-3, 5-difluoro-N-thiazol-2 yl-benzamide:
Yield: 27%
LC/MS (m/z) 256 (MH+); RT = 1.9 (method A).

EXAMPLE 2 Preparation of the A2A ligands with formula V
3o Examples 2a: 4-(3,3-Dimethyl-butyylamino)-3-methoxy-N-thiazol-2 yl-benzamide To 200 L of a 0.2 M stock solution of 4-amino-3-methoxy-N-thiazol-2-yl-benzamide in 1,2-dichloroethane/DMF, containing 1.2 mmol pyridine per mmol 4-amino-3-methoxy-N-thiazol-2-yl-benzamide, was added 0.05 mmol of 3,3-dimethyl-butyric acid chloride. The reaction mixture was incubated at ambient temperature for 2h. Purification was performed by preparative HPLC-MS.
1H NMR (D6-DMSO): 1.03 (s, 9H); 2.35 (s, 2H); 3.95 (s, 3H); 7.26 (d, 1H); 7.56 (d, 1H);
7.71 (dd, 1H); 7.79 (d, 1 H); 8.19 (d, 1H); 9.14 (s, 1H); 12.5 5(br s, 1 H).
LC/MS (m/z) 348 (MH+); RT = 2.68 (method A).

The following compounds were prepared analogously:
2b: 4-(3, 3-Dimethyl-butyrylamino)-N-thiazol-2 yl-benzamide:
LC/MS (m/z) 318 (MH+); RT = 2.54 (method A).
2c: 4-(3, 3-Dimethyl-butyrylamino)-3-methyl-N-thiazol-2 yl-benzamide:
LC/MS (m/z) 332 (MH+); RT = 2.44 (method A).
2d: 3-Bromo-4-(3, 3-dimethyl-butyrylamino)-N-thiazol-2 yl-benzamide:
LC/MS (m/z) 397 (MH+); RT = 2.85 (method A).
2e: 4-Isobutyrylamino-2-methoxy-N-thiazol-2 yl-benzamide:
LC/MS (m/z) 320 (MH+); RT = 2.20 (method A).
2f: 3-Fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2yl-benzamide:
LC/MS (m/z) 322 (MH+); RT = 2.41 (method A).
2g: 4-(3,3-Dimethyl-butyrylamino)-3 fluoro-N-thiazol-2yl.-benzamide:
LC/MS (m/z) 336 (MH+); RT = 2.74 (method A).
2h: 4-(3, 3-Dimethyl-butyNylamino)-3, 5-difluoro-N-thiazol-2 yl-benzamide:
LC/MS (m/z) 354 (MH+); RT = 2.5 (method A).
2i: S-Chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-N-thiazol-2 yl-benzamide:
LC/MS (m/z) 381 (MH+); RT = 3.09 (method A).
2j: S-Chloro-2-methoxy-4-(2-methyl-benzoylamino)-N-thiazol-2yl-benzamide:
LC/MS (m/z) 403 (MH+); RT = 3.15 (method A).
2k: 3-Chloro-4-(2-cyclopentyl-acetylamino)-N-thiazol-2 yl-benzamide:
LC/MS (m/z) 365 (MH+); RT = 2.92 (method A).
21: 3, S-Dichlor=o-4-(3, 3-dimethyl-butyrylamino)-N-thiazol-2 yl-benzamide:
The reaction mixture was heated in a microwave oven at 120 C for 2.5h.

LC/MS (m/z) 387 (MH+); RT = 2.76 (method A).

General procedure for the preparation of compounds with formula I
5 Examples:
3a: Amino-acetic acid 2-[(E/Z)-4-(3,3-dimethyl-butyNylamino)-benzoyliminoJ-thiazol-3-ylmethyl ester hydrochloNide:

p / NN
i~N ~ I Q
H /j~

10 p I
N
NaH (3 mmol) was weighed into a flamedried flask in an argon atmosphere and suspended in DMF (12 mL). 4-(3,3-Dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide (2,5 mmol) was added and the mixture stirred for 1 h at room temperature. tert-Butylcarbonylamino-glycine 15 choromethylene ester (2,5 mmol) was added and the reaction mixture was stirred at room temperature over night. The solvent was evaporated and the product was purified by flash chromatography on silica gel using 20% - 50% EtOAc in heptane as eluent.

Yield: 59%
1H NMR (D6-DMSO): 1.02 (s, 9H); 1.33 (s, 9H); 2.22 (s, 2H); 3.73 (d, 2H); 6.24 (s, 2H);
2o 7.00 (d, 1H); 7.27 (t, 1H); 7.57 (d, 1H); 7.69 (d, 2H); 8.12 (d, 2H); 10.03 (s, 1H).
tef t-Butoxycarbonylamino-acetic acid { [4-(3,3-dimethyl-butyrylamino)-benzoyl]-thiazol-2-yl-amino}-methyl ester was suspended in ether saturated with HCl gas and allowed to react for 15 min. The solvent was removed and the product was dried in vacuo.
25 Yie1d:100%
1H NMR (D6-DMSO): 1.02 (s, 9H); 2.22 (s, 2H); 3.91 (m, 2H); 6.35 (s, 2H); 7.03 (d, 1H);
7.60 (d, 1H); 7.71 (d, 2H); 8.14 (d, 2H); 8.32 (m, 2H); 10.11 (s, 1H).

The following were prepared analogously:
3b: (S)-2Amino-3-rnethyl-butyric acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester hydNochloyide:

o / I NN
~N ~
cl o N

Prepared from 3-chloro-4-(2-cyclopentyl-acetylamino-N-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 493 (MH+); RT = 2.13 (method B).

3c: 2-(S)-Amino-3-methyl-butyric acid 2-[(E/Z)-3-bromo-4-(3, 3-dimethyl-butyNylamino)-benzoyliminoJ-thiazol-3ylmethyl ester hydrochloride:

Br / I NN
H.N ~
N
p O

Prepared from 3-bromo-4-(3,3-dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 525 (MH}); RT = 2.1 (method A).

3d: 2-(S)-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluof o-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

NN
N ~ O
H F O N
Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 483 (MH+); RT = 1.92 (method A).

3e: 2-(S)-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino) -3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

p / NN
H'N
N
O O

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-fluoro-N-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 465 (MH+); RT = 2.14 (method A).

3f: 2-(S)-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3-methyl-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

o s-~
r' v ' N ~O
H O N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methyl-N-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 461 (MH}); RT = 1.88 (method A).

3o 3g: 2-(S)-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester hydyochloride:

o s~
O NN
o N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methyl-N-thiazol-2-yl-benzamide and (S)-2-ter't-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection.

LC/MS (m/z) 447 (MH}); RT = 1.83 (method A).

3h: 2-(S) Amino-3-methyl-butyt=ic acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

o Ns N

N
1 ~ H CI N

Prepared from 5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-N-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection. LC/MS (m/z) 531 (MH+); RT = 2.2 (method A).

3i: (S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-5-chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-benzoyliminoJ-thiazol-3 ylmethyl ester hydf=ochloride:

o N~ N

hl OI O

Prepared from 5-chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-lV-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonylamino-3-methyl-butyric acid chloromethyl ester followed by deprotection. LC/MS (m/z) 509 (MH+); RT = 2.09 (method A).

3j: (2S,3S)-2-Amino-3-methyl pentanoic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3ylmethyl ester hydrochloride:

O ~
~ i N \ I ~
CI N
O

Prepared from 3-chloro-4-(2-cyclopentyl-acetylamino)-N-thiazol-2-yl-benzamide and (2S, 3S)-2-tert-Butoxycarbonylamino-3-methyl-pentanoic acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 507 (MH+); RT = 2.17 (method B).

3k: (2S, 3S)-2-Amino-3-methyl pentanoic acid 2-[(E/Z)-3-bromo-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylrnethyl ester hydrochloride:
o Br NN
H,N ~ I \
N
O O

Prepared from 3-bromo-4-(3,3-dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide and (2S,3S)-2- tert -Butoxycarbonylamino-3-methyl-pentanoic acid chloromethyl ester followed 2o by deprotection.
LC/MS (m/z) 539 (MH+); RT = 2.16 (method A).

31: (2S, 3S)-2 Amino-3-methylpentanoic acid 2-[(E/Z)-3 fluoro-4-(3-inethyl-butyr ylamino)-benzoylimino]-thiazol-3ylmethyl ester hydrochloride:

O NN
N~~
H F
O N
Prepared from 3-fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2-yl-benzamide and (2S, 3S)-2-tert -Butoxycarbonylamino-3-methyl-pentanoic acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 465 (1VIH+); RT = 1.88 (inethod B).
3m: (2S, 3S)-2 Amino-3-tnethyl pentanoic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyNylainino)-3, 5-difluor o-benzoylimino]-thiazol-3-ylmethyl ester hydrochloride:

o N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide and (2S,3S)-2- tert -Butoxycarbonylamino-3 -methyl-pentanoic acid chloromethyl ester followed io by deprotection.
LC/MS (m/z) 497 (MH+); RT = 1.98 (method A).

3n: (2S, 3S)-2 Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyNylamino)-3-15 fluoro-benzoylimino]-thiazol-3-ylmethyl ester hydrochloride:

O
F / N~ ) N
H, N ~ I O
O O N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-fluoro-N-thiazol-2-yl-benzamide and (2S, 3S)-2- tert -Butoxycarbonylamino-3-methyl-pentanoic acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 479 (MH+); RT = 1.97 (method B).

3o: (2S, 3S)-2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyNylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

) N~
N
e i~~N
H N
O

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methyl-N-thiazol-2-yl-benzamide and (2S, 3S)-2- tert -Butoxycarbonylamino-3-methyl-pentanoic acid chloromethyl ester followed by deprotection.

LC/MS (m/z) 461 (MH+); RT = 1.91 (method A).

3p: (2S, 3S)-2-Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoyliminoJ-thiazol-3ylrnethyl ester hydrochloride:

0 s~
O N~N
e~N \
O
H O N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methoxy-N-thiazol-2-yl-benzamide and (2S, 3S)-2- tert -Butoxycarbonylamino-3-methyl-pentanoic acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 491 (MH+); RT = 2.05 (method A).

2o 3q: (S)- Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-bromo-4-(3, 3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3 ylmethyl ester hydrochloride:
o Br / N N,N 0 0 o,~j=..,,, N

Prepared from 3-bromo-4-(3,3-dimethyl-butyrylainino)-N-thiazol-2-yl-benzamide and (S)-pyrrolidine- 1,2-dicarboxylic acid 1-tef t-butyl ester 2-chloromethyl ester followed by deprotection.
LC/MS (m/z) 525 (MH+); RT = 2.02 (method A).

3r: (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoyliminoJ-thiazol-3-ylrnethyl ester hydrochloride:

o ) O / I N~N

N ~ ~O
ci 0-)1-.,.
N

Prepared from 3-chloro-4-(2-cyclopentyl-acetylamino)-N-thiazol-2-yl-benzamide and (S)-pyrrolidine-1,2-dicarboxylic acid 1 -tert-butyl ester 2-chloromethyl ester followed by deprotection.
LC/MS (m/z) 491 (MH+); RT = 2.04 (method B).

3s: (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino) benzoyliminoJ-thiazol-3ylmethyl ester hydrochloride:

lo 0 O NN
H F O/===.., N
Prepared from 3-fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2-yl-benzamide and (S)-pyrrolidine- 1,2-dicarboxylic acid 1 -tert-butyl ester 2-chloromethyl ester followed by deprotection.
2o LC/MS (m/z) 449 (MH+); RT = 1.93 (method A).

3t: (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

0 \
F N~N
H, N O

N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-fluoro-N-thiazol-2-yl-benzamide and (S)-pyrrolidine-1,2-dicarboxylic acid 1-tert-butyl ester 2-chloromethyl ester followed by deprotection.
LC/MS (m/z) 463 (MH+); RT = 1.86 (method B).

3u: (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoyliminoJ-thiazol-3 yltnethyl ester hydrochloride:

o s O N' m~N \
H O %..=.
NO
Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methoxy-N-thiazol-2-yl-benzamide and (S)-pyrrolidine-1,2-dicarboxylic acid 1-tert-butyl ester 2-chloromethyl ester followed by deprotection.
io LC/MS (m/z) 475 (MH+); RT = 1.9 (method B).

3v: (S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3-methyl-benzoyliminoJ-thiazol-3 ylmethyl ester 1zydNochloride:

N
I
H O ,/~
~N~/) Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methyl-N-thiazol-2-yl-benzamide and (S)-pyrrolidine-1,2-dicarboxylic acid 1-tert-butyl ester 2-chloromethyl ester followed by deprotection.
LC/MS (m/z) 459 (MH+); RT = 1.81 (method A).

3w: 2 Amino-2-methyl propionic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyr ylamino)-3-methoxy-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

N~N
rO~ \N O
e N

H oll Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methoxy-N-thiazol-2-yl-benzamide and 2-tert-butoxycarbonylamino-2-methyl-propionic acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 463 (MH+); RT =1.92 (method A).

3x: 2-Amino-2-methyl-propionic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

o ~

N~N
N
I

Prepared from 3-fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2-yl-benzamide and 2-tert-butoxycarbonylamino-2-methyl-propionic acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 437 (MH+); RT = 1.76 (method A).

3y: 2 Amino-2-methyl propionic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3 fluof o-benzoyliminoJ-thiazol-3-ylmethyl ester hydrochloride:

F N~N
H, N

C C~
N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-fluoro-N-thiazol-2-yl-benzamide and 2-tert-butoxycarbonylamino-2-methyl-propionic acid chloromethyl ester followed by deprotection.
LC/MS (m/z) 451 (MH+); RT = 1.84 (method B).

3o 3z: Piperidine-4-carboxylic acid 2-[(E/Z)-4-isobutyrylamino-2-methoxy-benzoylimino]-thiazol-3 ylmethyl ester hydrochloride:

o NN
YIH p N

Prepared from 4-isobutyrylamino-2-methoxy-N-thiazol-2-yl-benzamide and piperidine-1,4-dicarboxylic acid 1-tert-butyl ester 4-chloromethyl ester followed by deprotection.

LC/MS (m/z) 461 (MH+); RT = 1.91 (method A).

4a: Piperidine-4-carboxylic acid 2-[(E/Z)-3-bromo-4-(3,3-ditnethyl-butyrylamino)-5 benzoylifnino]-thiazol-3yln7ethyl ester hydrochloride:
~
Br N~N
H~N \ I ~

Prepared from 3-bromo-4-(3,3-dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide and piperidine- 1,4-dicarboxylic acid 1-tes=t-butyl ester 4-chloromethyl ester followed by 15 deprotection.
LC/MS (m/z) 537 (MH+); RT = 2.06 (method A).

4b: Piperidine-4-carboxylic acid 2-[(E/Z)-3-chloro-4-(3-ethyl-hexanoylamino-benzoyliminoJ-20 thiazol-3 ylmethyl ester hydrochloride:

O
O / I NN
\ \1O

25 Ci o N

Prepared from 3-chloro-4-(2-cyclopentyl-acetylamino)-N-thiazol-2-yl-benzamide and piperidine- 1,4-dicarboxylic acid 1-teNt-butyl ester 4-chloromethyl ester followed by 3o deprotection.
LC/MS (m/z) 505 (MH}); RT = 2.04 (metliod B).

4c: Piperidine-4-carboxylic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

35 O s N ~_ O
O
O N
F

Prepared from 3-fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2-yl-benzamide and piperidine-1,4-dicarboxylic acid 1 -tert-butyl ester 4-chloromethyl ester followed by deprotection.
LC/MS (m/z) 463 (MH+); RT = 1.81 (method A).

4d: Piperidine-4-carboxylic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3-methyl-benzoyliminoJ-thiazol-3ylmethyl ester hydrochloride:

N \ O~~~N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-methyl-N-thiazol-2-yl-benzamide and piperidine- 1,4-dicarboxylic acid 1-tert-butyl ester 4-chloromethyl ester followed by deprotection.
LC/MS (m/z) 473 (MH+); RT = 1.77 (method A).

4e: Piperidine-4-carboxylic acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-2o benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

o N
0 1 ~ O

CI /~~N
e H

Prepared from 5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-N-thiazol-2-yl-benzamide and piperidine- 1,4-dicarboxylic acid 1-tert-butyl ester 4-chloromethyl ester followed by 3o deprotection.
LC/MS (m/z) 543 (MH+); RT = 1.89 (method A).

4f: Piperidine-4-carboxylic acid 2-[(E/Z)-5-chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

-_ N~
N

N O'~N
H cl Prepared from 5-chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-N-thiazol-2-yl-benzamide and piperidine-1,4-dicarboxylic acid 1-tert-butyl ester 4-chloromethyl ester followed by deprotection.
LC/MS (m/z) 521 (MH+); RT = 1.76 (method B).

4g: 3-Amino-propionic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:
0 S ~
~ N ~ ~
O F 1 ~
N
4-,'-\~
H F N

Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide and 3-tert-butoxycarbonylamino-propionic acid chloromethyl ester followed by deprotection.
1H NMR (D6-DMSO): 1.05 (s, 9H); 2.25 (s, 2H); 2.75 (t, 2H); 3.03 (m, 2H); 6.31 (s, 2H);
7.14 (d, 1H); 7.70 (d, 1H); 7.86 (d, 2H); 9.76 (s, 1H).

2o 4h: (S)-2-Methylamino-propionic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylainino)-3, 5-difluoro-enzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

s~

/ N
F N
\-O

N

F

Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide and (S)-2-tert-butoxycarbonyl-methyl-amino-propionic acid chloromethyl ester followed by deprotection.
1H NMR (D6-DMSO): 1.05 (s, 9H); 1.42 (d, 3H); 2.26 (s, 2H); 2.54 (m, 3H); 4.20 (m, 1H);
3o 6.42 (m, 2H); 7.16 (d, 1H); 7.76 (d, 1H); 7.86 (d, 2H); 9.83 (br s, 1H).

4i: (R, S)-2-Amino-2, 3-dimethyl-butyric acid 2-[(E/Z)-4-(3, 3-dimethyl-butyNylarnino)-3, 5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl ester hydrochloride:

o F ~~
N N

N
H F O~

Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide and (R,S)-2-tert-butoxycarbonylamino-2,3-dimethyl-butyric acid chloromethyl ester followed by deprotection.
1H NMR (D6-DMSO): 0.83 (d, 3H); 0.85 (d, 3H); 1.05 (s, 9H); 1.43 (s, 3H); 2.04 (m, 1H);
to 2.25 (s, 2H); 6.42 (dd, 2H); 7.16 (d, 1H); 7.75 (d, 1H); 7.86 (d, 2H); 8.63 (br, 3H); 9.79 (s, 114).

4j: (2S, 3S)-2-Dimethylamino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3 ylmethyl ester:
o s~
F / I N~N
H\N \
F
O O
(2S, 3S)-2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester hydrochloride (3.3 mmol) was dissolved in MeOH (100 mL), and sodium cyanoborohydride (7.4 mmol) was added followed by formaldehyde (37% in water, 8.3 mmol). Stirred at room temperature for h. The reaction mixture was evaporated and the residue partitioned between ethyl acetate and water. The organic phase was washed with water, dried over MgSO4, filtered and evaporated. The crude product was purified by flash chromatography on silica usig 40% EtOAc in heptane as eluent.
Yield: 26%
1H NMR (D6-DMSO): 0.73 (d, 3H); 0.77 (t, 3H); 1.05 (s, 9H); 1.28 (m, 1H); 1.57 (m, 1H);
1.75 (m, 1H); 2.13 (s, 6H); 2.25 (s, 2H); 4.30 (d, 1H); 6.32 (m, 2H); 7.13 (d, 1H); 7.75 (d, 1H); 7.86 (d, 2H); 7.92 (s, 1H).

4k: Phosphoric acid inono-{2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3, 5-difluof o-benzoyliminoJ-thiazol-3 ylmethyl} ester:

o1:~-PO
( 0 \

N% s F
H~ I ~ o N ~
O

Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide and phosphoric acid di-tert-butyl ester chloromethyl ester followed by deprotection using 5eq.
trifluoroacetic acid in dichloromethane at ambient temperature over night, followed by lyophilisation.
LC/MS (m/z) 464 (MH+); RT = 1.91 (method A).

41: Phosphoric acid mono-{2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3-ylmethyl} ester o o\P
o 10 Ni \g H, N C o O

Prepared from 4-(3,3-dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide and phosphoric acid di-tert-butyl ester chloromethyl ester, followed by deprotection using 5eq.
trifluoroacetic acid in dichloromethane, at ambient temperature over night, followed by lyophilisation.
1 H NMR (D6-DMSO): 1.03 (s, 9H); 2.23 (s, 2H); 5.99 (d, 2H); 7.02 (d, 1 H);
7.55 (d, 1 H);
7.70 (d, 2H); 8.18 (d, 2H); 10.05 (s, 1H).

4m: Phosphoric acid mono-{3-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3 fluoro-benzoyliminoJ-thiazol-3 ylmethyl} ester P
o 0 N"S
F
H\ O

Prepared from 4-(3,3-dimethyl-butyrylamino)-3-fluoro-N-thiazol-2-yl-benzamide and phosphoric acid di-tert-butyl ester chloromethyl ester, followed by deprotection using 5eq.
io trifluoroacetic acid in dichloromethane, at ambient temperature over night, followed by lyophilisation.
1H NMR (D6-DMSO): 1.04 (s, 9H); 2.32 (s, 2H); 6.01 (d, 2H); 7.06 (d, 1H); 7.59 (d, 1H);
7.98-8.10 (3H); 9.74 (s, 1H).

15 4n: Phosphoric acid mono-{2-[(E/Z)-3,5-dichloro-4-(3,3-dimethyl-butyrylamino)-benzoyliminoJ-thiazol-3 ylmethyl} ester O"
P
p \O
Q N

N% \~
20 cl H\ O
--~Io CI

25 Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-chloro-N-thiazol-2-yl-benzamide and phosphoric acid di-tert-butyl ester chloromethyl ester, followed by deprotection using 5eq.
trifluoroacetic acid in dichloromethane, at ambient temperature over night, followed by lyophilisation.
1H NMR (D6-DMSO): 1.08 (s, 9H); 2.26 (s, 2H); 5.92 (d, 2H); 7.04 (d, 1H); 7.69 (d, 1H);
30 8.18 (s, 2H); 9.81 (s, 1H).

4o: (R,S)-CaNbonic acid 2, 3-dihydroxy propyl ester 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3,5-difluoro-benzoyliminoJ-thiazol-3 ylmethyl ester:

O" O N
N%\s F
I ~
H, N o i o F

Prepared from 4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide and (R,S)-carbonic acid chloromethyl ester 2,2-dimethyl-[1,3]dioxolan-4-ylmethyl ester, followed by deprotection by gently shaking an ethanol/water (1:1) solution of the protected product in 1o the presence of acidic ion-exchange resin DOWEX 50 WX2-100 at 30 C for 3 h. The mixture was filtered and evaporated to give the product.
1H NMR (D6-DMSO): 1.05 (s, 9H); 2.26 (s, 2H); 3.28-3.32 (m, 1H); 3.33-3.38 (m, 1H); 3.62-3.70 (m, 1H); 4.02-4.09 (m, 1H); 4.18-4.24 (m, 1H); 6.30 (s, 2H); 7.13 (d, 1H); 7.69 (d, 1H);
7.88 (m, 2H); 9.76 (s, 1H).

4p: 4-(3, 3-Dimethyl-butyylamino)-3, 5-difluoro IV-{3-[(1 S, 3S, 4S, 5R)-3, 4, 5-trihydf oxy-6-((R)-hydroxymethyl)-tetrahydro pyran-2 yloxymethylJ-3H-thiazol-2 ylidene}-benzamide O
O
O \ I
N' F g h1~ ~ \ O

_~10 F
N-(3-Chloromethyl-3H-thiazol-2-ylidene)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzamide (1.2 mmol) and acetic acid (2R, 3R, 4S, 5R, 6R)-4,5-diacetoxy-6-acetoxymethyl-2-hydroxy-tetrahydro-pyran-3-yl ester (1.5 mmol) was coinbined in a flamedried flask in an Argon atmosphere and suspended in dry dichloromethane (15 mL). The mixture was cooled to -60 C and AgOTf (2.9 inmol) was added. The reaction mixture was allowed to slowly heat to -20 C and stirred for lh, then the mixture was slowly heated to room temperature and stirred overnight. The crude reaction mixture was cooled to 0 C and NaHCO3 (aq., sat.) (15 mL) was added with stirring. The mixture was filtered and water and ethyl acetate was added.
The organic phase was separated and washed with NaHCO3 (aq., sat.) until the washing were basic, dried on MgSO4, filtered and evaporated.
The crude product was purified by flash chromatography using a gradient of 1-10% MeOH in 1:1 ethylacetate/heptane as eluent.
Yield: 11 %
The product (0.14 mmol) was deprotected by dissolution in MeOH (3 mL) and addition of NaOMe (0.56 mmol). The reaction mixture was stirred overnight at room temperature. Acidic io DOWEX 50W ion exchange resin was added and the mixture was stirred until the reaction mixture was neutralized. The resin was removed by filtration and the product was recovered by evaporation of the solvent. The isolated product was of the beta configuration.
Yield: 98%
1H NMR (D6-DMSO): 1.05 (s, 9H); 2.26 (s, 2H); 2.97-3.18 (4H); 3.49 (m, 1H);
3.62 (m, 1 H); 4.51 (d, 1H); 5.74 (d, 1 H); 6.07 (d, 1 H); 7.10 (d, 1 H); 7.71 (d, 1H);
7. 8 5(d, 2H); 9.84 (s, 111).

4q: 4-(3, 3-Dimethyl-butyrylamino)=3, 5-difluoro-N-[3-((2R, 3R, 4S, 5S, 6R)-3, 4, 5-trihydroxy-6-hydroxymethyl-tetrahydro pyf an-2 yl)-3H-thiazol-2 ylideneJ-benzamide 0.

F NS
H, 0 N
F
O

4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide (1.4 mmol) was suspended in hexamethyldisilazane (8.1 mmol) and chlorotrimethylsilane (1.7 mmol) in a sealed container, and stirred at 160 - C for 14h. The excess silylating agent was then removed under reduced pressure, and the crude was used directly without further purification. The crude silylation product and acetic acid (2R, 3R, 4S, 5R, 6R)-4,5-diacetoxy-6-acetoxymethyl-2-hydroxy-tetrahydro-pyran-3-yl ester (1.4 mmol) were combined in a flamedried flask in an Argon atmosphere and dichloromethane (4 mL) was added. The mixture was cooled on ice, and trimethylsilyltriflate (1.7 mmol) was added. The reaction mixture was allowed to warm to room temperature, and stirred overnight. The crude mixture was diluted with dichloromethane (2 mL) and cold NaHCO3 (aq., sat.) was added. Ethyl acetate was added to separate the phases and the organic layer was washed with water, dried over MgSO4, filtered and evaporated. The product was purified by flash chromatography on silica using 7% MeOH in 7:3 heptane/ethyl acetate as eluent.
Yield: 15%
io The purified product was deprotected by suspension in MeOH (3 mL) and addition of NaOMe (4 eq.). The mixture was stirred overnight at room temperature, then acidic ion exchange resin DOWEX 50W was added to neutralize the reaction mixture. When neutral the resin was filtered off and the product was recovered by evaporation of the solvent.
Yield: 98%
1H NMR (D6-DMSO): 1.04 (s, 9H); 2.25 (s, 2H); 3.27 (m, 1H); 3.45-3.57 (2H);
3.64-3.75 (3H); 6.05 (d, 1H); 7.10 (d, 1H); 7.71 (d, 1H); 7.86 (d, 2H); 9.76 (s, 1H).

List of reagents Reagents used for the preparation of compounds la - 4q:

Name CAS no. Supplier Catalog no.
2-aminothiazole 96-50-4 AVOCADO 12026 4-Nitro benzoic acid chloride 122-04-3 AVOCADO A12543-OB
4-Nitro-3-methyl benzoic acid 3113-71-1 ALDRICH M6,060-0 4-Nitro-3-methoxy benzoic acid 5081-36-7 ALDRICH 18,430-6 4-Nitro-3-fluoro benzoic acid 403-21-4 SYNCHEM-INC SH-10091 3o 4-Amino-3-chloro benzoic acid methyl ester 84228-44-4 AVOCADO 22519 4-Amino benzoic acid 150-13-0 AVOCADO A12673-0B
4-Amino-5-chloro-2-methoxy benzoic acid 7206-70-4 ALDRICH 34,087-1 4-Amino-3,5-dichloro benzoic acid 56187-37-2 ALDRICH 54,598-8 4-Amino-3,5-difluoro benzoic acid - BUTTPARK 35/03-09 3,3-Dimethyl-butyric acid chloride 7065-46-5 ALDRICH B8,880-2 3-Methylbutyryl chloride 108-12-3 ALDRICH 15,742-2 Cyclopentanecarbonyl chloride 4524-93-0 ALDRICH 32,831-6 2-Methylpropanoyl chloride 79-30-1 AVOCADO B24472.22 2-Methyl benzoyl chloride 933-88-0 ALDRICH 12,201-7 N-tert-Butyloxycarbonyl L-valine 13734-41-3 ALDRICH 35,972-6 N-tert-Butyloxycarbonyl L-isoleucine 13139-16-7 ALDRICH 35,965-3 to N-tert-Butyloxycarbonyl L-proline 15761-39-4 ALDRICH 13,457-0 N-tert-Butyloxycarbonyl glycine 4530-20-5 ALDRICH 13,453-8 N-tert-Butyloxycarbonyl Piperidine-4-carboxylic acid 84358-13-4 APOLLO OR5410 N-tert-Butyloxycarbonyl-2-amino 1s isobutyric acid 30992-29-1 NOVABIOCHEM 0412-0203 N-tert-Butyloxycarbonyl beta-Alanine 3303-84-2 NOVABIOCHEM 04-12-0100 N-methyl-N-tert-Butyloxycarbonyl Alanine 16948-16-6 FLUKA 15549 2o N-tert-Butyloxycarbonyl a-methyl valine 139938-00-4 BACHEM A-4145.0005 Phosphorous acid di-tert-butyl ester 13086-84-5 JOHNSON - X00455G0025 MATTHEY
Glycerol dimethylketal 100-79-8 ALDRICH 12,269-6 25 Chloromethyl chloroformate 22128-62-7 JOHNSON- X09527G0010 MATTHEY
Caesium carbonate 534-17-8 ALDRICH 44,190-2 Tetrabutylammonium hydrogensul-phate 32503-27-8 30 Chlorosulfonic acid 7790-94-5 ALDRICH 18,630-9 Bromochloromethane 74-97-5 ACROS 15913-0010 Chloroiodomethane 593-71-5 ALFA 31155 Tetramethylammonium hydroxide 75-59-2 ALDRICH 33,163-5 Sodium hydride 7646-69-7 ALDRICH 45,291-2 N-bromo succinimide 128-08-5 ALDRICH B8,125-5 1-Hydroxy benzotriazole 2592-95-2 FLUKA 54802 5 1-(3 -Dimethylaminopropyl)-3 -ethyl-carbodiimide hydrochloride 25952-53-8 ALDRICH 16,146-2 Formaldehyde (37% aq.) 50-00-0 ALDRICH 25,254-9 Sodium cyano borohydride 25895-60-7 ALDRICH 29,681-3 Thionyl chloride 7719-09-7 ACROS 16949-0010 io Oxalyl chloride 79-37-8 ALDRICH 32,042-0 Trifluoroacetic acid 76-05-1 ALDRICH T6,220-0 1,2-Dimethoxyethane 110-71-4 ALDRICH 30,743-2 Hexamethyldisilazane 999-97-3 ALDRICH 37,921-2 Chloromethylsilane 75-77-4 ALDRICH C7,285-4 15 Trimethylsilyl trifluoromethane-sulfonate 27607-77-8 ALDRICH 22,564-9 Silver trifluoromethanesulfonate 2923-28-6 ALDRICH 17,643-5 2, 3,4, 6-Tetra- O-acetyl-D-gluco-pyranose 10343-06-3 TORONTO T280000 2o DOWEX 50 W 12612-37-2 ALDRICH 27,881-5 25 The ability of a compound with formula I to release a compound with formula V under physiological conditions can, e.g., be assessed by administering a compound with formula I to a mammal and subsequently analysing the blood of said mammal for the corresponding compound with formula V.

30 In the following a general method is exemplified of assessing the conversion under physiological conditions of a compound with formula I, to release a compound with forinula V, i.e. verification of the conversion of pro-drug to parent compound in vivo in rats.

ASSESSING THE CONVERSION OF PRO-DRUG TO PARENT COMPOUND IN
VIVO IN RATS
Dosing_2 mg/kg of the pro-drug dissolved in saline or 10% HP-beta cyclodextrin is administered by oral gavage to cannulated SD rats.
Blood samplina: Blood samples is drawn at the following time points, relative to time of dosing: pre-dose, 5 min, 20 min, 50 min, 2 h, 4 h, 7 h, 11 h, 15 h, and 20 h.
Sample preparation: At the end of the experiment, the blood samples is centrifuged at 15000 x g for 10 min, and the plasma subsequently transferred to fresh vials and frozen at -80 C until quantitative analysis.
io Bio analysis: The blood samples are analysed for pro-drug and parent compound. Analysis of plasma samples may be performed by liquid chromatography separation /tandem mass spectrometry (LC-MS/MS).

The compounds with formula V may be characterised in vitro according to the following methods:

Cloning of the human cDNA encoding the A2a receptor:
cDNA was obtained by random primed reverse transcription of human fetal brain RNA
(Clonetech). A subsequent polymerase chain reaction (PCR) was performed using the cDNA
as template and the oligonucleotides TTTACGCGTGGCCATGCCCATCATGGGCTCCTC
and TTTCTAGAATCAGGACACTCCTGCTCCATC as primers for the amplification. The amplification was performed using Pfu polymerase (Stratagene, in accordance with the manufactures recommendation) with an annealing temperature of 54 C. The reaction mixture was analyzed by an agarose gel electrophoresis and a band of 1.2 kb was excised and the DNA eluted. The eluted DNA was digested with the restriction enzymes M1uI and Xbal and ligated into a vector, pCIneo, cut with the same enzymes. DNA was isolated and sequenced.
CHO cells was transfected with the pCIneo clone expressing the A2a receptor and cells with stable integration of the plasmids were isolated after 2-3 weeks growth in the presence of 3o either 5 mg/ml or 10mg/ml G418.

CHO cells transfected with A2A receptors as described above were grown in F12 nutrient mixture (kaighs modification, Life technologies) with 10% FCS, 1% glutamin and 1%
penicillin/streptomycin and 1 mg/mL G418.

24 h prior to assay performance, 10000 cells/well were seeded in costar 96-well plates in media without G418 to 60-80% confluence. The cells were stimulated with NECA
(00-9498, final concentration 75 nM) corresponding to about 80% agonist efficacy.

The cell media was removed and the cells washed 3 times in 37 C pre-equilibrated PBS and to incubated (on shaker) with 10 L of a suspension of acceptor beads and 10 L
of a solution of test compound or standard compound (0-10 M) in darkness for 30 min at 25 C
before addition of 30 l of a suspension of donor beads and further incubation 60-120 min in darkness. The plates were analysed according to manufacturers instruction (Alpha screen, Perkin Elmer (Pachard Biosciense)).

The acceptor beads were suspended in a stimulation buffer (5 mM HEPES, 0.1 %
BSA in Hanks balanced salt pH 7.4 w/o phenol red (Gibco). The donor beads were suspended in a lysis buffer (the stimulation buffer with 0,3% Tween 20 and biotinylated cAMP) according to manufacturers instruction (Alpha screen, Perkin Elmer (Pachard Biosciense)).

The data were fitted with non-linear regression, and IC50 and K; values were calculated from the equations:
IC50 = ( [ I ]/ (100/(100-%INH))/(1+([ag]/ECs0) and K; = IC50/(1-[ag]/ECs0), where [ I] is the inhibitor concentration, [ag] is the assay agonist concentration and EC50 is the agonist concentration required for half maximal effect.

Membrane preparations for A,a bindinganalysis:

Expression in insect cells The human A2a encoding DNA were excised from the pCIneo constructs by M1uI and Xbal and subcloned into the pFASTBAC2 vector cut with XbaI and BssHII. The inserts were recombined into the baculo vector using the Bac-to-Bac system (Invitrogen).
The generation and isolation of baculo virus was performed as described by the distributor (Invitrogen). High Five cells (Invitrogen) was grown at 27 C in suspension to a density of 1* 106 and infected with a MOI of 0.5. The cells are harvested 72 h post infection and membranes prepared.

High five cells expressing A2A receptors were homogenized in 50 mM tris-buffer pH 7.4 in an io ultra Turrax homogenisator. The membranes were diluted to a concentration of 0.6 mg/ml and 2U Adenosine deaminase (Roche)/ml membrane suspension was added. The solution was preincubated 30 min at 37 C before use.

A2A binding analysis:
Binding assay was performed in 96 well flat bottom plate and initiated by mixing 10.6 g protein/well with solutions of standard compounds or test compounds (final concentrations 0-10 M) and 1 nM final concentration of 3H-ZM241385 (R1036 from Tocris). All test compounds were diluted in 50 nM trisbuffer from DMSO-stocks (2 mM or 10 mM).
The reactions (final volume = 200 L) were incubated for 30 min at 25 C and washed on Unifilter-GF/B with water. The filters were dried 20 min (37 C) before addition of 35 l Microscient-0 or Optiphase supermix and counting in a Trilux counter for 1 min.

The data were fitted with non-linear regression, and IC50 and K; values were calculated from the equations :
IC50 = ( [ I ]/ (100/(100-%INH))/(1+([L]/KD) and K; = IC50/(1-[L]/KD), where [ I] is the inhibitor concentration, and [L] and KD are concentration and dissociation equilibrium constant of the radiotracer, respectively.

The exemplified compounds with structure V are A2A receptors antagonists having a human A2A binding affinity (K;) of 200 nM or less.

Claims

1. A compound with formula I

A-B-Z

I

wherein Z is a group with formula II

or Z is a group with formula IIa wherein R1-R4 are independently selected from hydrogen, halogen, C1-6-alkyl and C1-6-alkoxy;
R5 is selected from the group consisting of C1-8-alkyl, C3-8-cycloalkyl-C1-6-alkyl, C3-8-cycloalkyl and C1-6-alkyl-phenyl;
R8 and R9 are independently selected from the group consisting of hydrogen, halogen and C1-6-alkyl;
* indicates the atom attached to B;
A is a solvating group; and B is a linking moiety or a bond.

2. A compound according to claim 1, characterised in that one or more bonds of said compound are degraded enzymatically or chemically under physiological conditions, and that upon said degradation a compound with formula V, wherein R1-R5 and R8-R9 have the same meaning as in claim 1, will be released.

3. A compound according to claim 1 or 2, characterised in that R5 is selected from the group consisting of C1-8-alkyl, e.g. C3-8-alkyl or C4-8-alkyl branched at the .beta.-position, C3-8-cycloalkyl-C1-6-alkyl, e.g. C3-8-cycloalkyl-methyl, C3-8-cycloalkyl and C1-6-alkyl-phenyl, e.g.
methylphenyl.

4. A compound according to claim 3, wherein R5 is a C4-8-alkyl branched at the .beta.-position, e.g. neopentyl or isobutyl.

5. A compound according to any of claims 1-4, characterised in that R1 and R3 are independently selected from the group consisting of hydrogen and C1-6-alkoxy, e.g. methoxy.

6. A compound according to claim 5, wherein R1 and R3 is a C1-6-alkoxy, e.g.
methoxy and both R2 and R4 are hydrogen.

7. A compound according to any of claims 1-5, characterised in that R2 and R4 are independently selected from the group consisting of hydrogen, halogen, and C1-6-alkyl, e.g.
methyl.

8. A compound according to claim 7, wherein R2 and R4 are independently selected from halogen, fluoro or chloro, and C1-6-alkyl, e.g. methyl and wherein R1 and R3 are hydrogen.

9. A compound according to any of claims 1-8, characterised in that R8-R9 are independently selected from the group consisting of hydrogen, halogen, e.g.
fluoro or chloro, and C1-6-alkyl, e.g. methyl.

10. A compound according to claim 9, characterised in that both R8 and R9 are hydrogen.

11. A compound according to any of claims 1-10, wherein Z is the group with formula II.

12. A compound according to claim 1 or 2, wherein said compound is selected from the group of compounds I with Z having formula II wherein:

R1 = R2 = R3 = R4 = R8 = R9 = H and R5 = neopentyl;
R1 = R3 = R4 = R8 = R9 = H, R2 = Cl and R5 = cyclopentylmethyl;
R1 = R3 = R4 = R8 = R9 = H, R2 = Br and R5 = neopentyl;
R1 = R3 = R8 = R9 = H, R2 = R4 = F and R5 = neopentyl;
R1 = R3 = R4 = R8 = R9 = H, R2 = F and R5 = neopentyl;
R1 = R3 = R4 = R8 = R9 = H, R2 = methyl and R5 = neopentyl;
R1 = R3 = R4 = R8 = R9 = H, R2 = methoxy and R5 = neopentyl;
R2 = R3 = R4 = R8 = R9 = H, R1 = methoxy and R5 = isopropyl;
R2 = R3 = R8 = R9 = H, R1 = methoxy, R4 = Cl and R5 = phenylmethyl;
R2 = R3 = R8 = R9 = H, R1 = methoxy, R4 = Cl and R5 = cyclopentyl;
R1 = R3 = R4 = R8 = R9 = H, R2 = F and R5 = isobutyl; and R1 = R3 = R8 = R9 = H,R2 = R4 = Cl and R5 = neopentyl.

13. A compound according to any of claims 1-12, wherein the solvating group A
is a group capable of supplying improved aqueous solubility of said compound I
compared to the corresponding compound with formula V as defined in claim 2.

14. A compound according to any of claims 1-12, wherein the construct A-B- of said prodrug of formula I is capable of providing improved aqueous solubility of said compound I
compared to the corresponding compound with formula V as defined in claim 2 and in which construct A-B- capable in the context of Compound I of having one or more bond cleaved under physiological conditions to release a compound with the corresponding formula V as defined in claim 2.

15. A compound according to any of claims 1-14, characterised in that A is a solvating group selected from compounds containing at least two functionalities, wherein one of said functionalities is a ionisable functionality, and another of said functionalities is a functionality which can form a bond to B; or A is selected from compounds containing a suitable number of hydroxy functionalities, and a functionality which can form a bond to B.

16. A compound according to any of claims 1-15, characterised in that A is a solvating group selected from the group consisting of: N-unsubstituted or N-mono-, N-di-, or N-tri-substituted amino acids, di-amines, mono-, di- or tri-phosphates or esters and/or salts thereof, sulfonic acids or salts thereof, di-carboxylic acids or salts thereof, aldonic acids, ketoaldonic acids, O- or N-glycosides, polyalcohols including alditols and ketols; or combinations thereof, such as glycosylated amino acids or glycosylated phosphates.

17. A compound according to claim 16, characterised in that A is a solvating group selected from N-unsubstituted or N-mono- or N-di- substituted amino acids or salts thereof, mono-phosphates or salts thereof, polyalcohol or O- or N-glycosides.

18. A compound according to any of claims 1-17, wherein Z is a group with formula II, characterised in that B is a linking moiety with formula III or IV, wherein R6-7 are independently selected from hydrogen and C1-6-alkyl, e.g.
methyl;
and * indicates the atom attached to Z, and # indicates the atom attached to A.

19. A compound according to claim 18, characterised in that B is a linking moiety with formula III or IV, provided that when B is a linking moiety with formula III, A is attached via a carbonyl or a hetero carbonyl group, or as an acetal or ketal; and provided that when B is a linking moiety with formula IV, A is attached via a nitrogen or an oxygen atom.

20. A compound according to claim 18 or 19, characterised in that both R6 and R7 are hydrogen or R6 is hydrogen and R7 is methyl.

21. A compound according to claim 18 or 19, characterised in that B is a linking moiety with formula III or IV and R6-7 are hydrogen.

22. A compound according to any of claims 1-17, wherein B is a bond.

23. A compound according to claim 22, wherein A is a carbohydrate attached via the anomeric carbon atom.

24. A compound according to claim 2, wherein V is selected from the group consisting of:
4-(3,3-Dimethyl-butyrylamino)-N-thiazol-2 yl-benzamide;
3-Chloro-4-(2-cyclopentyl-acetylamino)-N-thiazol-2-yl-benzamide;
3-Bromo-4-(3,3-dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide;
4-(3,3-Dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2yl-benzamide;
4-(3,3-Dimethyl-butyrylamino)-3-fluoro-N-thiazol-2yl-benzamide;
4-(3,3-Dimethyl-butyrylamino)-3-methyl-N-thiazol-2-yl-benzamide;
5-Chloro-2-methoxy-4-(2-methyl-benzoylamino)-N-thiazol-2-yl-benzamide;
5-Chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-N-thiazol-2-yl-benzamide;
3-Fluoro-4-(3-methyl-butyrylamino)-N-thiazol-2-yl-benzamide;
4-(3,3-Dimethyl-butyrylamino)-3-methoxy-N-thiazol-2-yl-benzamide;

4-Isobutyrylamino-2-methoxy-N-thiazol-2yl-benzamide; and 4-(3,3-Dimethyl-butyr ylamino)-3,5-dichloro-N-thiazol-2-yl-benzamide;

25. A compound according to claim 2, wherein V is 4-(3,3-Dimethyl-butyrylamino)-N-thiazol-2-yl-benzamide.

26. A compound according to claim 2, wherein V is 4-(3,3-Dimethyl-butyrylamino)-3,5-difluoro-N-thiazol-2-yl-benzamide.

27. A compound according to claim 2, characterised in that V is 4-(3,3-Dimethyl-butyrylamino)-3-fluoro-N-thiazol-2-yl-benzamide.

28 A compound according to claim 2, characterised in that V is 4-(3,3-Dimethyl-butyrylamino)-3,5-dichloro-N-thiazol-2-yl-benzamide.

29. A compound according to any of the claims 13-28, characterised in that Z
is a group with formula II.

30. A compound according to any of claims 1-29, wherein A-B- of formula I is a phosphoric acid monomethylenyl ester.

31. A compound according to claim 1, characterised in that it is selected from the group consisting of:
2 Amino-3-methyl-butyric acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
2 Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino) -3-fluoro-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methyl-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-butyric acid 2-[(E/Z)-5-chloro-4-(cyclopentanecarbonyl-amino)-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;

2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(2 Amino-3-methyl pentanoic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
2 Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-fluoro-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-)-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino) benzoylimino]-thiazol-3-ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3, 3-dimethyl-butyrylamino)-3 fluoro-benzoylimino]-thiazol-3-ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methyl-benzoylimino]-thiazol-3-ylmethyl ester;
2-Methylamino-propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-enzoylimino]-thiazol-3-ylmethyl ester;
2 Amino-2,3-dimethyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
2-Dimethylamino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;

Carbonic acid 2,3-dihydroxy-propyl ester 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
4-(3,3-Dimethyl-butyrylamino)-3,5-difluoro-N-(3-[3,4,5-trihydroxy-6-((R)-hydroxymethyl)-tetrahydro-pyran-2yloxymethyl]-3H-thiazol-2-ylidene}-benzamide; and 4-(3,3-Dimethyl-butyrylamino)-3,5-difluoro-N-[3-(3,4,5-trihydroxy-6-hydroxymethyl-tetrahydro-pyran-2-yl)-3H-thiazol-2-ylidene]-benzamide.

32. A compound according to claim 1,characterised in that it is selected from the group consisting of:
Amino-acetic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2 Amino-3-methyl-butyric acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3ylmethyl ester;
(S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino) -3 fluoro-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methyl-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2-Amino-3-methyl-butyric acid 2-[(E/Z)-5-chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
(2S,3S)-2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(2S,3S)-2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(2S,3S)-2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-3 fluoro-4-(3-methyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;

(2S,3S)-2 Amino-3-methyl pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-ylmethyl ester;
(2S,3S)-2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-fluoro-benzoylimino]-thiazol-3-ylmethyl ester;
(2S,3S)-2-Amino)-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(2S,3S)-2-Amino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-3-chloro-4-(2-cyclopentyl-acetylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-fluoro-4-(3-methyl-butyrylamino) benzoylimino]-thiazol-3-ylmethyl ester;
(S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-fluoro-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-Pyrrolidine-2-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methyl-benzoylimino]-thiazol-3-ylmethyl ester;
2 Amino-2-methyl propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
2 Amino-2-methyl-propionic acid 2-[(E/Z)-fluoro-4-(3-methyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
2-Amino-2-methyl-propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-fluoro-benzoylimino]-thiazol-3-ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-4-isobutyrylamino-2-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-3-bromo-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-3-chloro-4-(3-ethyl-hexanoylamino-benzoylimino]-thiazol-3-ylmethyl ester;

Piperidine-4-carboxylic acid 2-[(E/Z)-3-fluoro-4-(3-methyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3-methyl-benzoylimino]-thiazol-3-ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-5-chloro-2-methoxy-4-(2-methyl-benzoylamino)-benzoylimino]-thiazol-3-ylmethyl ester;
Piperidine-4-carboxylic acid 2-[(E/Z)-5-chloro-4-(cyclopentanecarbonyl-amino)-2-methoxy-benzoylimino]-thiazol-3-ylmethyl ester;
3-Amino propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
(S)-2-Methylamino-propionic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-enzoylimino]-thiazol-3-ylmethyl ester;
(R,S)-2-Amino-2,3-dimethyl-butyric acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
(2S,3S)-2-Dimethylamino-3-methyl-pentanoic acid 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
Phosphoric acid mono-{2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl} ester;
Phosphoric acid mono-{2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl} ester;
Phosphoric acid mono-{2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3 fluoro-benzoylimino]-thiazol-3-ylmethyl} ester;
Phosphoric acid mono-{2-[(E/Z)-3,5-dichloro-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl} ester;
(R,S)-Carbonic acid 2,3-dihydroxypropyl ester 2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl ester;
4-(3,3-Dimethyl-butyrylamino)-3,5-difluoro-N-{3-[(1S,3S,4S,5R)-3,4,5-trihydroxy-6-((R)-hydroxymethyl)-tetrahydro-pyran-2-yloxymethyl]-3H-thiazol-2-ylidene}-benzamide; and 4-(3,3-Dimethyl-butyrylamino)-3,5-difluoro-N-[3-((2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-hydroxymethyl-tetrahydro-pyran-2-yl)-3H-thiazol-2ylidene]-benzamide.

33. A compound according to claim 1 selected from the group consisting of:
- Phosphoric acid mono-{2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,5-difluoro-benzoylimino]-thiazol-3-ylmethyl} ester;

- Phosphoric acid mono-{2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl} ester;
- Phosphoric acid mono-{2-[(E/Z)-4-(3,3-dimethyl-butyrylamino)-3,fluoro-benzoylimino]-thiazol-3-ylmethyl} ester; and - Phosphoric acid mono-{2-[(E/Z)-3,5-dichloro-4-(3,3-dimethyl-butyrylamino)-benzoylimino]-thiazol-3-ylmethyl} ester.

34. A compound according to any of claims 1-33, which is in the form of a salt.

35. A compound according to claim 34, wherein the salt is a pharmaceutically acceptable addition salt.

36. A compound according to any of claims 1-35 for use in medicine.

37. Use of a compound according to any of the claims 1-35 for the manufacture of a medicament for the treatment of a disease where an A2A-receptor is implicated.

38. Use of a compound according to any of the claims 1-35 for the manufacture of a medicament for the treatment of a disease selected from the group consisting of Parkinson's Disease, Alzheimer's Disease, Huntington's disease, epilepsia, cerebral ischemia, haemorrhagic stroke, neonatal ischemia and hypoxia, subarachnoid haemorrhage, traumatic brain injury, brain damage following cardiac arrest, depression and psychosis disorders.

39. Use according to claim 37 or 38, wherein the disease is Parkinson's disease.

40. Use of a compound according to any of the claims 1-35 for the manufacture of a medicament for the treatment of a disease selected from the group consisting of Restless Leg Syndrome (RLS), schizophrenia, abuse, e.g. alcohol abuse, migraine, somnolence, narcolepsy, pain, Attention Deficit Hyperactivity Disorder (ADHD), neurodegenerative diseases, cognitive deficits, and memory problems.

41. Use of a compound according to any of the claims 1-35 for the manufacture of a medicament for the treatment of one or more of the following conditions in patients with Parkinson's Disease: RLS, depression, cognitive deficits and memory problems.

42. A pharmaceutical composition comprising a compound according to any of claims 1-35.

43. A method of treating a disease where an A2A-receptor is implicated comprising administration of a therapeutically acceptable amount of a compound according to any of claims 1-35.

44. A method of treating a disease selected from the group consisting of Parkinson's Disease, Alzheimer's Disease, Huntington's disease, epilepsia, cerebral ischemia, haemorrhagic stroke, neonatal ischemia and hypoxia, subarachnoid haemorrhage, traumatic brain injury, brain damage following cardiac arrest, depression and psychosis disorders, comprising administration of a therapeutically acceptable amount of a compound according to any of claims 1-35.

45. A method of treating Parkinson's Disease comprising administration of a therapeutically acceptable amount of a compound according to any of claims 1-35.

46. A method of treating a disease selected from the group consisting of Restless Leg Syndrome (RLS), schizophrenia, abuse, e.g. alcohol abuse, migraine, somnolence, narcolepsy, pain, Attention Deficit Hyperactivity Disorder (ADHD), neurodegenerative diseases, cognitive deficits, and memory problems comprising administration of a therapeutically acceptable amount of a compound according to any of claims 1-35.

47. A method of treating one or more of the following conditions in patients with Parkinson's disease: RLS, depression, cognitive deficits and memory problems comprising administration of a therapeutically acceptable amount of a compound according to any of claims 1-35.