CA2586486A1 - Leucine-rich repeat (lrr) motif containing proteins - Google Patents

Abstract

There are provided proteins, termed INSP168, INSP168-SV1, INSP149 and INSP169, herein identified as leucine-rich repeat (LRR) motif containing proteins, and the use of these proteins and nucleic acid sequences from the encoding gene in the diagnosis, prevention and treatment of disease.

Description

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

LEUCINE-RICH REPEAT (LRR) MOTIF CONTAINING PROTEINS

This invention relates to proteins, termed INSP168, INSP168-SV1, INSP149 and INSP169, herein identified as leucine-rich repeat (LRR) motif containing proteins, and to the use of these proteins and nucleic acid sequences from the encoding gene in the diagnosis, prevention and treatment of disease.

All publications, patents and patent applications cited herein are incorporated in full by reference.

BACKGROUND
The process of drug discovery is presently undergoing a fundamental revolution as the era of functional genomics comes of age. The term "functional genomics"
applies to an approach utilising bioinformatics tools to ascribe function to protein sequences of interest. Such tools are becoming increasingly necessary as the speed of generation of sequence data is rapidly outpacing the ability of research laboratories to assign functions to these protein sequences.

As bioinformatics tools increase in potency and in accuracy, these tools are rapidly replacing the conventional techniques of biochemical characterisation. Indeed, the advanced bioinformatics tools used in identifying the present invention are now capable of outputting results in which a high degree of confidence can be placed.

Various institutions and commercial organisations are examining sequence data as they become available and significant discoveries are being made on an on-going basis. However, there remains a continuing need to identify and characterise further genes and the polypeptides that they encode, as targets for research and for drug discovery.

Introduction to Secreted Proteins The ability of cells to make and secrete extracellular proteins is central to many biological processes. Enzymes, growth factors, extracellular matrix proteins and signalling molecules are all secreted by cells. This is through fusion of a secretory vesicle with the plasma membrane. In most cases, but not all, proteins are directed to the endoplasmic reticulum and into secretory vesicles by a signal peptide. Signal peptides are cis-acting sequences that affect the transport of polypeptide chains from the cytoplasm to a membrane bound compartrnent such as a secretory vesicle.
Polypeptides that are targeted to the secretory vesicles are either secreted into the extracellular matrix or are retained in the plasma membrane. The polypeptides that are retained in the plasma membrane will have one or more transmembrane domains. Examples of signal peptide contaiiiing proteins that play a central role in the functioning of a cell are cytokines, hormones, extracellular matrix proteins, adhesion molecules, receptors, proteases, and growth and differentiation factors.

Introduction to PAL

The photoreceptor-associated leucine-rich repeat (LRR) protein (abbreviated to PAL) is a membrane glycoprotein that is specifically expressed in the photoreceptor cells of the retina (Gomi et al., J. Neuroscience, 2000, 20(9):3206-3213).

Sequencing of the PAL gene revealed that the PAL protein contains an LRR
motif, an Ig C2-like domain and a fibronectin type III-like domain, all within its extracellular region. The LRR domain of PAL contains five contiguous LRRs. This combination of the three types of domain described above was identified as a new class of transmembrane protein, although some previously known proteins contain two of these three domains (e.g. Trk and NCAM) (Gomi et al., J. Neuroscience, 2000, 20(9):3206-3213).

The abundance of PAL mRNA was observed to increase over the time course of development of the rat retina. Northern blotting experiments revealed that the PAL
mRNA was specific to the photoreceptor cells within the retina. Western blotting and immunoprecipitation experiments with a PAL-specific polyclonal antibody showed that PAL forms a strong homodimer structure that is resistant to SDS and high temperature (Gomi et al., J. Neuroscience, 2000, 20(9):3206-3213).

A liuman homolog of PAL was also identified and was mapped to chromosome 10q23.2-23.3 by fluorescence in situ hybridisation (FISH). On the basis of experiments carried out on rat retinal cells, it was postulated that PAL may act as a receptor for a certain trophic factor or for an adhesion molecule participating in morphogenesis. The human-, PAL protein was therefore considered to be a_ potential candidate disease gene for inherited retinal disorders (Gomi et al., J.
Neuroscience, 2000, 20(9):3206-3213).

Other known retina-specific genes include rhodopsin, transducin, cGMP-gated ion channels, peripherin/rds and rom-1. Among these, a number of causative genes for inherited diseases of the retina have been identified. For example, mutations in rhodopsin or peripherin/rds contribute to autosomal dominant retinitis pigmentosa.

Introduction to the fibronectin type 3 domains Fibronectin Type III (FnIII) protein domains are formed by 80-100 amino acids included in several multimodular proteins, mostly associated to extracellular matrix such as tenascins (Joester A and Faissner A, Matrix Biol. 2001, 20:13-22), or Titins (Skeie GO, Cell Mol Life Sci. 2000, 57:1570-6) or to receptor proteins such as insulin receptor protein family (Marino-Buslje C et al., FEBS Lett. 1998, 441:331-6).

Despite remarkably similar tertiary structures, FnI1I modules share low sequence homology. Conversely, the sequence homology for the same FnIII module across multiple species is notably higher, suggesting that sequence variability is functionally significant. Amongst the residues that are conserved, Prolines are of particular importance since prevent aggregation in multi-modular proteins containing this domain (Craig D et al., Structure 2004, 12:21-30; Craig D et al., Proc Natl Acad Sci U S A.
2001, 98(10):5590-5; Cota E et al., J Mol Biol. 2001, 305:1185-94; Cota E et al., J Mol Biol. 2000, 302:713-25; Steward A et al., J Mol Biol. 2002, 318:935-40).

The paradigm of this protein module is human Fibronectin, a 2386-amino acid glycoprotein of the extracellular matrix containing several protein modules, usually categorized in tllree types: FnI, FnII, and FnIII (or Fl, F2, or F3; Potts JR
and Campbell ID, Matrix Biol. 1996, 15:313-20). Fibronectin circulates in a soluble form in the plasma and is also found in an insoluble, multimeric form within the extracellular matrix at appropriate sites. The formation and the degradation of these insoluble fibrils is a dynamic, cell-dependent process that is mediated by a series of events involving the actin cytoskeleton and integrin receptors. Fibronectin fibrils can bind the surfaces of mammalian and bacterial cells and various molecules including collagen, fibrin, heparin, DNA, and actin. Fibronectin is involved in cell adhesion/contractility/motility, opsonization, wound healing, and formation of fibrotic aggregates. For example, in certain chronic inflammatory diseases, including asthma, the loss of this regulation gives rise either to excess or to inappropriate fibronectin deposition that parallels the development of tissue fibrosis (Hocking DC, Chest. 2002, 122(6 Suppl):275S-278S).

Finally, isolated fibronectin domains of extracellular matrix proteins, that can be generated physiologically by limited proteolysis or mechanical stress of the fibronectin fibers, can modulate various biological and physiological responses, such as the neuronal regeneration, hippocampal learning and synaptic plasticity (Meiners S
and Mercado ML, Mol Neurobiol. 2003, 27:177-96; Strekalova T et al., Mol Cell Neurosci. 2002, 21:173-87), osteoblast adliesion, proliferation and differentiation (Kim TI et al., Biotechnol Lett. 2003, 25:2007-11), tissue degradation, inflammation and tumor progression (Labat-Robert J, Ageing Res Rev. 2004, 3:233-47).
Fragments or splicing variants of FnIIl domain-containing proteins may become target for antibodies and other proteins blocking them having important therapeutic or diagnostic applications, such as cancer (Ebbinghaus C et al., Curr Pharm Des.
2004, 10:1537-49), inflammatory arthritis (Barilla ML and Carsons SE, Semin Arthritis Rheum. 2000, 29:252-65), or organ transplantation (Coito AJ et al., Dev Immunol.
2000;7:239-48).

Introduction to the leucine-rich repeat (LRR) motif The LRR motif is a relatively short motif of around 22-28 residues, and is found in a variety of cytoplasmic, membrane and extracellular proteins. Proteins containing LRRs are associated with a very wide range of biological functions, although all are thought to be involved in protein-protein interaction or cell adhesion. The LRR motif is a repetitive motif made up of several copies of the sequence LxxLxxLxLxxNxLxxL xxxxFxx.
LRRs are often flanked by cysteine-rich repeat regions, an N-terminal LRR motif or a leucine-rich repeat C-terminal domain (LRRCT).

Introduction to Immunoglobulin Domains The immunoglobulin (Ig) domain is a well characterised domain present in hundreds of proteins of varying functions. The basic Ig domain structure is a tetramer of two light chains and two heavy chains linked by disulphide bonds. Immunoglobulin domain-containing cell surface recognition molecules have been shown to play a role in diverse physiological functions, many of which can play a role in disease processes. Alteration of their activity is a means to alter the disease phenotype and as such identification of novel immunoglobulin domain-containing cell surface recognition molecules is highly relevant as they may play a role in many diseases, particularly inflammatory disease, oncology, and cardiovascular disease.
Immunoglobulin domain-containing cell surface recognition molecules are involved 5 in a range of biological processes, including: embryogenesis, maintenance of tissue integrity, leukocyte extravasation/inflammation, oncogenesis, angiogenesis, bone resorption, neurological dysfunction, thrombogenesis, and invasion/adherence of bacterial pathogens to the host cell.

The detailed characterisation of the structure and function of several immunoglobulin-domain containing cell surface recognition molecule families has led to active programs by a number of pharmaceutical companies to develop modulators for use in the treatment of diseases involving inflamination, oncology, neurology, immunology and cardiovascular function. hninunoglobulin domain containing cell surface recognition molecules are involved in virtually every aspect of biology from embryogenesis to apoptosis. They are essential to the structural integrity and homeostatic functioning of most tissues. It is therefore not surprising that defects in immunoglobulin domain containing cell surface recognition molecules cause disease and that many diseases involve modulation of immunoglobulin domain containing cell surface recognition molecule function.

Immunoglobulin domain-containing cell surface recognition molecules are thus known to play a role in diverse physiological functions, many of which can play a role in disease processes. Alteration of their activity is a means to alter the disease phenotype and as such identification of novel immunoglobulin domain-containing cell surface recognition molecules is highly relevant as they may play a role in many diseases, particularly immunology, inflainmatory disease, oncology, cardiovascular disease, central nervous system disorders and infection.

In summary, cell surface recognition molecules, including those containing LRRs, Ig domains or fibronectin type 3 domains, have been shown to play a role in diverse physiological functions, many of which can play a role in disease processes.
Alteration of their activity is a means to alter the disease phenotype and as such identification of novel adhesion molecules is liighly relevant as they may play a role in many diseases, particularly inflammatory disease, oncology, cardiovascular disease and bacterial infection. The identification of further retina-specific cell surface recognition molecules, including paralogs of the human PAL protein (which will contain LRRs, Ig domains and fibronectin type 3 domains) is of great iinportance in the ongoing investigation of retinal developments and retinal pathologies. Their identification will allow the development of new methods for the treatment and diagnosis of retinal diseases and disorders. Accordingly, there remains a need for the identification of such proteins to enable new drugs to be developed for the treatment and prevention of human disease.

THE INVENTION

The invention is based on the discovery that the INSP168, INSP168-SV1, INSP149 and INSP169 proteins are splice variants of a leucine-rich repeat (LRR) motif containing sequence with similarity to PAL (SwissProt Acc. Code PALP HUMAN) and to a nogo receptor homolog (SwissProt Acc. Code Q6X814).

In particular, the invention is based on the finding that polypeptides of the present invention are PAL-like and/or nogo-receptor like molecules.

In a first aspect of the invention, there is provided a polypeptide, which polypeptide:
(i) comprises the amino acid sequence as recited in SEQ ID NO:2 (mature INSP 168);

(ii) is a fragment thereof which functions as a biologically active polypeptide and/or has an antigenic determinant in common with the polypeptides of (i); or (iii) is a functional equivalent of (i) or (ii).

A polypeptide according to part (i) of the first aspect of the invention may comprise the amino acid sequence as recited in SEQ ID NO:4 (mature INSP149), SEQ ID
NO:8 (mature INSP168-SV1) or SEQ ID NO:10 (mature INSP169).

Although the Applicant does not wish to be bound by this theory, it is postulated that the first 19 ainino acids of the INSP168, INSP168-SV1, INSP149 and INSP169 proteins forms a signal peptide, as shown in the scheinatic representation below:

MHLFACLCIVLSFLEGVGCLCPSQCTCDYHGRNDGSGSR...
Thus, a polypeptide according to part (i) of the first aspect of the invention may comprise the amino acid sequence as recited in SEQ ID NO:30 (full length INSP168), SEQ ID NO:32 (full length INSP149), SEQ ID NO:34 (full length INSP168-SV1), SEQ ID NO:36 (full lengtll INSP169) and SEQ ID NO:67 (INSP169 cloned extracellular region).

A polypeptide according to part (i) of the first aspect of the invention may comprise the extracellular portion of the amino acid sequence as recited in SEQ ID NO:4 (mature INSP149) or SEQ ID NO:10 (mature INSP169). Thus, a polypeptide according to part (i) of the first aspect of the invention may comprise the amino acid sequence as recited in SEQ ID NO:6 (INSP149 extracellular region) or SEQ ID
NO:12 (INSP 169 extracellular region). A polypeptide according to part (i) of the first aspect of the invention may comprise the amino acid sequence as recited in SEQ
ID
NO:67 (INSP 169 cloned extracellular region). The cloned extracellular region of INSP169 (SEQ ID NO:67) differs from the predicted extracellular region of at amino acid 524 (see Example 7 and Figure 8).

The INSP 168, INSP 168-SV l, INSP 149 and INSP 169 proteins each contain a leucine-rich repeat motif. The amino acid sequence of the leucine-rich repeat motif present in the INSP168, INSP168-SV1, INSP149 and INSP169 proteins is recited in SEQ ID
NO:14. Accordingly, preferred fragments of the INSP168, INSP168-SV1, INSP149 and INSP 169 proteins are fragments that comprise or consist of the amino acid sequence as recited in SEQ ID NO:14 (LRR motif).

A polypeptide according to part (i) of the first aspect of the invention may comprise the amino acid sequence as recited in SEQ ID NO:2 (mature 1NSP 168), SEQ ID
NO:4 (mature INSP 149), SEQ ID NO:6 (INSP 149 extracellular region), SEQ ID NO:8 (mature INSP168-SV1), SEQ ID NO:10 (mature INSP169), SEQ ID NO:12 (INSP169 extracellular region), SEQ ID NO:14 (LRR motif), SEQ ID NO:30 (full length INSP168), SEQ ID NO:32 (full length INSP149), SEQ ID NO:34 (full length INSP168-SV1), SEQ ID NO:36 (full length INSP169) or SEQ ID NO:67 (INSP169 cloned extracellular region) and a histidine tag. Preferably the histidine tag is located at the C-terminus of the polypeptide. Preferably the histidine tag comprises between 1 and 10 histidine residues (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 residues).
More preferably, the histidine tag comprises 6 residues. Thus, a polypeptide according to part (i) of the first aspect of the invention may comprise the amino acid sequence as recited in SEQ
ID NO:16 (his tag mature INSP168), SEQ ID NO:18 (his tag mature INSP149), SEQ

ID NO:20 (his tag INSP 149 extracellular region), SEQ ID NO:22 (his tag mature INSP168-SVl), SEQ ID NO:24 (his tag mature INSP169), SEQ ID NO:26 (his tag INSP169 extracellular region), SEQ ID NO:28 (his tag LRR motif), SEQ ID NO:38 (his tag full length INSP 168), SEQ ID NO:40 (his tag full length INSP 149), SEQ ID
NO:42 (his tag full length INSP 168-SV 1) or SEQ ID NO:44 (his tag full length INSP 169).

Thus, the first aspect of the present invention provides a polypeptide which comprises or consists of the amino acid sequence as recited in SEQ ID NO:2 (mature INSP168), SEQ ID NO:4 (mature INSP149), SEQ ID NO:6 (INSP149 extracellular region), SEQ
ID NO:8 (mature INSP168-SV1), SEQ ID NO:10 (mature INSP169), SEQ ID NO:12 (INSP 169 extracellular region), SEQ ID NO:14 (LRR moti fl, SEQ ID NO:16 (his tag mature INSP168), SEQ ID NO:18 (his tag mature INSP149), SEQ ID NO:20 (his tag INSP 149 extracellular region), SEQ ID NO:22 (his tag mature INSP 168-SV 1), SEQ
ID NO:24 (his tag mature INSP169), SEQ ID NO:26 (his tag INSP 169 extracellular region), SEQ ID NO:28 (his tag LRR motif), SEQ ID NO:30 (full length INSP168), SEQ ID NO:32 (full length INSP149), SEQ ID NO:34 (full length INSP168-SV1), SEQ ID NO:36 (fall length INSP169), SEQ ID NO:38 (his tag full length INSP168), SEQ ID NO:40 (his tag full length INSP149), SEQ ID NO:42 (his tag full length INSP168-SVl), SEQ ID NO:44 (his tag full length INSP169), or SEQ ID NO:67 (INSP 169 cloned extracellular region). The first aspect of the present invention also provides a polypeptide which is a fragrnent of such a polypeptide and which functions as a biologically active polypeptide and/or has an antigenic determinant in common with such a polypeptide or which is a functional equivalent of such a polypeptide.

The terms "the INSP 168 polypeptides" and "an INSP 168 polypeptide" as used herein include polypeptides comprising or consisting of the amino acid sequence as recited in SEQ ID NO:2 (mature INSP168), such as polypeptides comprising or consisting of the amino acid sequence as recited in SEQ ID NO:4 (mature INSP 149), SEQ ID
NO:6 (INSP149 extracellular region), SEQ ID NO:8 (mature INSP168-SV1), SEQ ID
NO:10 (mature INSP169), SEQ ID NO:12 (INSP169 extracellular region), SEQ ID
NO:16 (his tag mature INSP168), SEQ ID NO:18 (his tag mature INSP149), SEQ ID
NO:20 (his tag INSP149 extracellular region), SEQ ID NO:22 (his tag mature INSP168-SV1), SEQ ID NO:24 (his tag mature INSP169), SEQ ID NO:26 (his tag INSP169 extracellular region), SEQ ID NO:30 (full length INSP168), SEQ ID
NO:32 (full length INSP149), SEQ ID NO:34 (full length INSP168-SV1), SEQ ID NO:36 (full length INSP169), SEQ ID NO:38 (his tag full length INSP168), SEQ ID
NO:40 (his tag full length INSP149), SEQ ID NO:42 (his tag full length INSP168-SV1), SEQ ID NO:44 (his tag full length INSP169) or SEQ ID NO:67 (INSP169 cloned extracellular region).

INSP 149, INSP168 and INSP 169 were a set of predictions representing splice variants of a leucine rich repeat-containing sequence with similarity to the retina-specific protein PAL.

INSP149 was a prediction for a 595 amino acid (1785 bp) ORF encoded in 5 exons.
INSP 168 was a prediction for a 197 amino acid (591 bp) ORF encoded in 3 exons.
INSP169 was a prediction for a 679 amino acid (2037 bp) ORF encoded in 4 exons.
INSP 149 and INSP 169 were predicted to be type I transmembrane proteins comprising a leucine-rich repeat motif, an immunoglobulin domain and a fibronectin type 3 domain. The INSP 169 polypeptide is a splice variant of the INSP 149 polypeptide that is identical to INSP149 except for the longer final exon, which subsumes the final two exons of INSP149. The longer sequence encoded by has the same domain organisation as INSP149 but has a low complexity insert between the Ig and FN III domains. INSP168 was essentially a truncated splice variant of INSP149 and INSP169 and was predicted to represent a secreted protein.
The INSP168 polypeptide is a splice variant of the INSP149 polypeptide that comprises a stop codon at the start of its third exon. As a result of this truncation in the third exon, the INSP168 polypeptide lacks the transmembrane region found in exon 5 of INSP 149. A113 of the predictions contained 4 leucine rich repeat regions in the N-terminal portion (SEQ ID NO:14). INSP149 and INSP 169 also contained an immunoglobulin domain and a fibronectin type III domain in the predicted extracellular regions. An aligmnent of the 3 predicted amino acid sequences is shown in Figure 1. As noted above, a signal peptide was predicted spanning from residues 1 to 19.

The open reading frame (ORF) of the INSP168 prediction has been cloned using a pair of PCR primers (see Figures 2 and 3). The primer pair was tested on selected cDNA libraries derived from brain and retina and on brain and eye cDNA
templates using Platinum Taq DNA Polymerase High Fidelity (HiFi). PCR products were cloned and sequenced and a clone was identified, amplified from brain cDNA, which contained the expected INSP168 ORF. A second clone was identified, also amplified from brain cDNA, which contained a splice variant of the INSP168 ORF. This clone contained a 32 amino acid insertion towards the 3' end of the INSP168 ORF
which represented a new exon 3. The insertion also caused a fraineshift such that the new 5 exon 4 contained an extra 6 amino acids compared with the original INSP 168 exon 3.
This clone was called INSP168-SV1, and is also shown in the Figure 1 alignment.
The INSP 168 polypeptides are structurally related to the Retinal Specific Protein PAL
(SwissProt Acc. Code PALP HUMAN) and to a nogo receptor homolog (SwissProt Acc. Code Q6X814). An amino acid alignment between the INSP168, INSP168-SV1, 10 INSP 149 and INSP 169 polypeptides and PAL is shown in Figure 5, and the schematic representation of domains is shown in Figure 6.

As noted above, the cloned extracellular region of INSP 169 (SEQ ID NO:67) differs from the predicted extracellular region of INSP 169 at amino acid 524 (see Example 7 and Figure 8).

PAL may be implicated in diseases of the retina, retinal pigment epithelium (RPE), and clloroids (see for example JP2001128686). These include ocular neovascularization, ocular inflammation and retinal degenerations. Specific examples of these disease states include diabetic retinopathy, chronic glaucoma, retinal detachment, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization; rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis pigmentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, and retinal artery occlusion, and, neovascularization due to penetration of the eye or ocular injury. Additional relevant diseases include the neuropathies, such as Leber's, idiopathic, drug-induced, optic, and ischemic neropathies.

Nogo receptor-like proteins could be major inhibitors of CNS neuronal regeneration (Schwab ME. Curr Opin N6urobiol: 2004 Feb;14(l):118-24; Teng et al. J
Neurochem.
2004 May;89(4):801-6). Animals treated with antibodies targeted to Nogo-A
always showed a higher degree of recovery in various behavioural tests (e.g. IN-1 Fab' fragments or new purified IgGs against Nogo-A). In addition, a Nogo-66 antagonistic peptide (NEP 1-40) effected significantly axon growth of the corticospinal tract and improved functional recovery in rats inflicted with mid-thoracic spinal cord hemisections. Subcutaneous administration of NEP1-40 in spinal cord lesioned animals resulted in extensive growth of corticospinal axons, sprouting of serotonergic fibres, synapse formation and enhanced locomotor recovery. Soluble Fc fusion proteins of the Nogo receptor subunit NgR, which blocks Nogo, significantly reduce the inhibitory activity of myelin. Similar results were obtained after Nogo gene deletions and blockade of the downstream messengers Rho-A and ROCK in animal models.

The leucine-rich repeat domain of SLIT proteins is sufficient for guiding both axon projection and neuronal migration in vitro (the LRR region of SLIT is structurally related to the LRR region of INSP168, INSP168-SV1, INSP149 and INSP169). As such, the LRR region of INSP168, INSP168-SV1, INSP149 and INSP169 or fragments containing the LRR region might be useful in the treatment of the diseases listed herein. SLIT-like proteins are thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabaout homolog receptors (bind ROBOl and ROBO2 with high affinity).
During neural development, SLIT is involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. In spinal chord development, SLIT may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. SLIT may be implicated in spinal chord midline post-crossing axon repulsion. In the developing visual system, SLIT
appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, SLIT collapses and repels retinal ganglion cell growth cones. SLIT seems to play a role in branching and arborization of CNS
sensory axons, and in neuronal cell migration. In vitro, Slit homolog 2 protein N-product, but not Slit homolog 2 protein C-product, repells olfactory bulb (OB) but not dorsal root ganglia (DRG) axons, induces OB growth cones collapse and induces branching of DRG axons. SLIT seems to be involved in regu ating leukocyte migration.

INSP168, INSP168-SV1, fNSP149 and INSP169 and other INSP168 polypeptides and/or fragments and functional equivalents thereof (e.g. fragments containing the LRR region) can be useful in the diagnosis and/or treatment of diseases for which other (e.g. above mentioned PAL- and Nogo receptor-like proteins) structurally related proteins demonstrate therapeutic activity.

In particular, polypeptides of the invention consisting of and/or comprising of the mature (lacking a signal peptide) forms and/or cleaved forms of INSP168, SV 1 and/or mature soluble forms of INSP 149 and/or INSP169, and/or agonists thereof are useful for the diagnosis and/or treatment of diseases. Preferably, the soluble forms of INSP149 and/or INSP169 consist of the mature extracellular part and/or cleaved fragments of INSP149 and/or INSP 169. Antagonists of membrane bound INSP149 and/or INSP169, for example antibodies, are useful for the diagnosis and/or treatment of diseases.

The INSP168, INSP168-SV1, INSP149 and INSP169 polypeptides maybe implicated in diseases of the retina, spinal cord injuries (e.g. paraplegia) and neurodegenerative disorders. These include disorders of the central nervous system as well as disorders of the peripheral nervous system. Neurodegenerative disorders include, but are not limited to, brain injuries, cerebrovascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease (including amyotrophic lateral sclerosis, ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post- traumatic brain injury, and small-vessel cerebrovascular disease.
Dementias, such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and Parkinsonism, frontotemporal dementias (including Pick's disease), progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoffs psychosis, as well as stroke and trauma.
In particular, the INSP168, INSP168-SV1, INSP149 and INSP169 polypeptides may be implicated in diseases of the retina, retinal pigment epithelium (RPE), and choroids; ocular neovascularization, ocular inflammation and retinal degenerations;
diabetic retinopathy, chronic glaucoma, retinal detachment, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization;
rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis pigmentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, retinal artery occlusion, neovascularization due to penetration of the eye or ocular injury, neuropathies;
Leber's, idiopathic, drug-induced, optic, and ischemic neropathies; spinal cord injuries, paraplegia, neurodegenerative disorders, disorders of the central nervous system, disorders of the peripheral nervous system, brain injuries, cerebrovascular diseases, Parkinson's disease, corticobasal degeneration, motor neuron disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post- traumatic brain injury, small-vessel cerebrovascular disease, dementias, Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia, Parkinsonism, frontotemporal dementias, Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, Korsakoffs psychosis, stroke and trauma.

Neuro-inflammation is a common feature of several neurological diseases, trauinatic situations (at central or peripheral level), stroke (brain, heart, renal), or infectious diseases (mediated by viral agents such as HIV or bacterial agents such as meningitis), leading to an excessive inflammatory response in central nervous system.
Many stimuli, originated by neuronal or oligodendroglial cells suffering due to these various conditions, can trigger neuro-inflammation. In particular, astrocytes can secrete various chemokines and cytokines, inducing a recruitment of additional leukocytes that in their turn will further stimulate astrocytes, leading to an exacerbated response. In chronic neurodegenerative diseases such as multiple sclerosis (MS), spinal muscular atrophies (SMA), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), or amylotrophic lateral sclerosis (ALS), the presence of persistent neuro-inflammation is thought to be involved in the progression of the disease and in the case of AD in the secondary events such as micro-hemorrhagic events (Cacquevel M et al., Curr Drug Targets. 2004, 5: 529-534;
Chavarria A et al., Autoimmun Rev. 2004, 3: 251-260; Ambrosini E and Aloisi F, Neurochem Res. 2004, 29: 1017-103 8).

Limited axon regeneration and plasticity is central to the pathophysiology of a range of neurological disorders, including stroke, head trauma, multiple sclerosis, and neurodegenerative disease.

In addition to its role in the pathophysiology of neurological disorders as well as in loss of sight or blindness, nogo-like molecules are implicated in cancer.
Without wishing to be bound to this theory, the polypeptides of the present invention are implicated in cancer through EGFR inhibition. Preferably, the cancer is lung cancer.
The biological properties of the INSP168, INSP168-SV1, INSP149 and INSP169 polypeptides related to neuroprotection, maintenance of axonal integrity, myelination and re-/generation of myelin producing cells, can be tested in various assays involving cell lines. For example, the neuroimmunodulatory effects of a compound can be evaluated in U373, a human astroglioma cell line in which the nuclear translocation of specific regulatory proteins involved in cytokine/chemokine expression can be quantified (Le Roy E et al., J Virol. 1999, 73: 6582-9; Jin Y et al., J Infect Dis. 1998, 177: 1629-1638; Acevedo-Duncan M et al., Cell Growth Differ. 1995, 6: 1353-1365).

A series of assays has been performed, and have indicated that the addition of a culture medium containing INSP168 stiinulates Stat-2 nuclear translocation in cells. This first series of experiments thus revealed that INSP168 has the capacity to stimulate intracellular signalling. by inducing Stat-2 nuclear translocation in U373 cells. Activation of Stat proteins signaling is known to be associated with immunomodulation and eventually cell proliferation (Pfitzner E et al., Curr Pharm Des. 2004, 10: 2839-2850).

A polypeptide according to the first aspect of the invention may thus function as an activator of cell proliferation, as a neuromodulator (neuroimmunomodulator), as a modulator of the inflammatory response in the CNS, as a regulator of astrocyte proliferation or as a regulator of axon projection, neuronal migration or leukocyte recruitment or migration.

Preferably, the activity of a polypeptide of the present invention can be confirmed in at least one of the following assays:

a) in the maintenance of neuronal cell survival, for example in the regeneration of injured adult neurons, or b) in the modulation of neurite growth in animal models of spinal cord injury (Fouad et al., Brain.Res.Rev. 2001, Vol. 36, pp.204-212; Bareyre et al., J.Neurosci. 2002, Vol.22, pp.7097-7110; GrandPre et al. Nature 2002, Vol.417, pp.547-551; Li and Strittmatter, J.Neurosci. 2003, Vol.23, pp.4219-5 4227; Liebscher et al. Ann.Neurol. 2005, Vol.58, pp.706-719), for example in the modulation of myelin inhibition of neurite outgrowth, and other CNS
lesions such as cortical lesions or cerebral ischemia induced by middle cerebral artery occlusion (Yu Hsuan Teng and Luen Tang, Journal of Neurochemistry 2005, Vol.94, pp.865-874; Papadopoulos et al. Ann.Neurol.
10 2002, Vol.51, pp.433-441; Emerick et al. J.Neurosci. 2003, Vol.23, pp.4826-4830), or c) in the modulation of axonal growth of many neuron types, for example of corticospinal tract (CST) axons, corticofugal, retinal, superior cervical ganglion, spinal or hippocampal neurons, dorsal column axons, for example, 15 in the modulation of axonal plasticity of unlesioned cortical neurons (with enhanced behavioural recovery), or d) in the translocation of Stat2 as described in Example 6, or e) in the up-regulation of growth factors or growth-related proteins, for example of Brain-derived neurotrophic factor (BDNF), Vascular Endothelial Growth Factor (VEGF) and/or Growth-associated protein 43 (GAP-43), or f) in the regeneration of nerve fibers, for example of raphespinal, rubrospinal or corticospinal fibers, or in the regeneration of injured optic nerve fibers (for example in an optic nerve crush model), or g) in the improvement of locomotor function, or h) in the regulation of secretases, for example of P-secretases, or i) in the modulation of apoptosis, for example by modulating pro-apoptotic proteins of the Bcl-2 family and/or mitochondrial proteins, or j) in the modulation of Rho and/or Rho-associated kinase (ROCK), or k) in the modulation of (3-secretases, for example of BACE1 activity, and/or amyloid-(3 peptide generation and/or formation of amyloid plaques, or 1) in the regulation of ocular dominance (OD) plasticity, or m) in the modulation of the phosphorylation of the epidermal growth factor receptor (EGFR), or n) in the stabilization of neural circuitry, or o) in the modulation of dendritic plasticity.

As regards the Nogo receptor (NgR), the myelin inhibitory proteins Nogo, myelin-associated glycoprotein (MAG) and oligodendrocyte myelin glycoprotein (Omgp) all bind to the extracellular leucine-rich repeat (LRR) domain of NgR. Thus, polypeptides of the invention comprising and/or consisting of the LRR domain can at least display activity in one of the above-mentioned assays.

Polypeptides of the invention consisting of and/or comprising of the mature (lacking a signal peptide) forins and/or cleaved forms of INSP168, INSP168-SV1 and/or mature soluble forms of INSP149 and/or INSP169, and/or agonists thereof are preferably used in the above-mentioned assays. Preferably, the soluble forms of INSP149 and/or INSP169 consist of the mature extracellular part aiid/or cleaved fragments of INSP 149 and/or INSP 169. Alternatively, antagonists of ineinbrane bound INSP

and/or INSP169, for example antibodies, can be used in the above-mentioned assays.
Preferred epitopes of the polypeptides of the present invention can be detected by "affinity fingerprinting" as described in Schimmele and Pli.ickthun (Journal of Molecular Biology 2005, Vol.352, Issue 1, pp.229-241).

Polypeptides of the present invention may undergo cleavage by metalloendopeptidase and/or proprotein convertases such as zinc metalloproteinases, N-Arginine dibasic (NDR) convertase or subtilisin-like proprotein convertases. NDR cleavage sites and PCSK cleavage sites have been detected in the polypeptides of the present invention.
The skilled artisan will appreciate that such resulting cleaved fraginents of the polypeptides of the present invention can be used for the diagnosis and/or treatment of diseases. Cleavage of membrane-bound INSP 149 and/or INSP 169 can yield soluble N- and C- terminal fragments useful on their own or as components of fusion proteins such as Fc fusion.

A NDR cleavage site has been detected in the full length polypeptides of the present invention at position 70-72 (RRI), located after the first LRR motif.
Surprisingly, PCSK cleavage sites have been detected at position 207-209 (KRT) of full length INSP168-SV1 and at positions 439-441 (KRS) and 449-451 (KRN) of full length membrane bound INSP169. Interestingly, the PCSK cleavage site in INSP168-SV1 is located just after the LRR motifs and for INSP169 between the LRR motifs and the fibronectin domain. The polypeptides of the present invention also encompass the resulting cleaved N-fragments and/or C-fragments or mature forms thereof.
Preferably, the resulting cleaved fragments are soluble fragments. Preferably, the resulting fragments consist of:

(i) the first 208 amino acids of INSP168-SV1 or the mature form thereof, or (ii) the first 440 amino acids of INSP 169 or the mature form thereof, or (iii) the first 450 amino acids of INSP 169 or the mature form thereof.

This aspect of the invention also includes fusion proteins that incorporate the polypeptides of the first aspect of the invention.

An "antigenic determinant" of the present invention may be a part of a polypeptide of the present invention, which binds to an antibody-combining site or to a T-cell receptor (TCR). Alternatively, an "antigenic determinant" may be a site on the surface of a polypeptide of the present invention to which a single antibody molecule binds.
Generally an antigen has several or many different antigenic determinants and reacts with antibodies of many different specificities. Preferably, the antibody is immunospecific to a polypeptide of the invention. Preferably, the antibody is immunospecific to a polypeptide of the invention, which is not part of a fusion protein. Preferably, the antibody is immunospecific to INSP168, INSP168-SV1, INSP 149 or INSP 169 or a fragment thereof. Antigenic determinants usually consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three dimensional structural characteristics, as well as specific charge characteristics. Preferably, the "antigenic determinant"
refers to a particular chemical group on a polypeptide of the present invention that is antigenic, i.e. that elicit a specific immune response.

The polypeptides AA104038 (SEQ ID NO:68), XP_853150 (SEQ ID NO:69) and ENSCAFP00000016927 (SEQ ID NO:70), and their encoding nucleic acid sequences are specifically excluded from the scope of this invention. .-In a second aspect, the invention provides a purified nucleic acid molecule which encodes a polypeptide of the first aspect of the invention.

The term "purified nucleic acid molecule" preferably refers to a nucleic acid molecule of the invention that (1) has been separated from at least about 50 percent of proteins, lipids, carbohydrates, or other materials with which it is naturally found when total nucleic acid is isolated from the source cells, (2) is not linked to all or a portion of a polynucleotide to which the "purified nucleic acid molecule" is linked in nature, (3) is operably linked to a polynucleotide which it is not linked to in nature, or (4) does not occur in nature as part of a larger polynucleotide sequence. Preferably, the isolated nucleic acid molecule of the present invention is substantially free from any other contaminating nucleic acid molecule(s) or other contaminants that are found in its natural environment that would interfere with its use in polypeptide production or its therapeutic, diagnostic, prophylactic or research use. In a preferred embodiment, genomic DNA are specifically excluded from the scope of the invention.
Preferably, genomic DNA larger than 10 kbp (kilo base pairs), 50 kbp, 100 kbp, 150 kbp, kbp, 250 kbp or 300 kbp are specifically excluded from the scope of the invention.
Preferably, the "purified nucleic acid molecule" consists of cDNA only.

Preferably, the purified nucleic acid molecule comprises or consists of the nucleic acid sequence as recited in the nucleic acid sequence as recited in SEQ ID NO:
1, SEQ
ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO: 9, SEQ ID NO:l l, SEQ ID
NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID
NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID
NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41 , SEQ ID
NO: 43 and/or SEQ ID NO:66, or is a redundant equivalent or fragment of those sequences.

Preferably, the purified nucleic acid molecule consists of the nucleic acid sequence as recited in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO: 43 and/or SEQ ID NO:66, or is a redundant equivalent or fragment of those sequences.

In a third aspect, the invention provides a purified nucleic acid molecule which hybridizes under high stringency conditions with a nucleic acid molecule of the second aspect of the invention. High stringency hybridisation conditions are defined as overnight incubation at 42 C in a solution comprising 50% formamide, 5XSSC
(150mM NaC1, 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5x Denhardts solution, 10% dextran sulphate, and 20 microgram/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1X SSC at approximately 65 C.

In a fourth aspect, the invention provides a vector, such as an expression vector, that contains a nucleic acid molecule of the second or third aspect of the invention.

In a fifth aspect, the invention provides a host cell transformed with a vector of the fourth aspect of the invention.

In a sixth aspect, the invention provides a ligand which binds specifically to, and which preferably inhibits the activity of, a leucine-rich repeat motif containing polypeptide of the first aspect of the invention.

In a seventh aspect, the invention provides a compound that is effective to alter the expression of a natural gene which encodes a polypeptide of the first aspect of the invention or to regulate the activity of a polypeptide of the first aspect of the invention.

Such compounds may be identified using the assays and screening methods disclosed herein.

A compound of the seventh aspect of the invention may either increase (agonise) or decrease (antagonise) the level of expression of the gene or the activity of the polypeptide.

Importantly, the identification of the domain organisation and function of the INSP168, INSP168-SV1, INSP149 and INSP169 polypeptides allows for the design of screening methods capable of identifying coinpounds that are effective in the treatment and/or diagnosis of disease. Ligands and compounds according to the sixth and seventh aspects of the invention may be identified using such methods.
These methods are included as aspects of the present invention. Using these methods, it will now be possible to identify inhibitors or antagonists of INSP168, INSP168-SV1, INSP149 and INSP169, such as, for example, monoclonal antibodies, which may be of use in modulating INSP168, INSP168-SV1, INSP149 and INSP169 activity in vivo in clinical applications. Such compounds are likely to be useful in counteracting the biological activity of the INSP 168, 1NSP 168-SV l, INSP 149 and INSP 169 polypeptides.

Another aspect of this invention resides in the use of an INSP168, INSP168-SV1, INSP149 or INSP169 gene or polypeptide as a target for the screening of candidate 5 drug modulators, particularly candidate drugs active against leucine-rich repeat (LRR) motif containing protein related disorders.

A further aspect of this invention resides in methods of screening of compounds for therapy of leucine-rich repeat (LRR) motif containing protein related disorders, comprising determining the ability of a compound to bind to an INSP168, 10 SV1, INSPI49 or INSP169 gene or polypeptide, or a fragment thereof.

A further aspect of this invention resides in methods of screening of compounds for therapy of leucine-rich repeat (LRR) motif containing protein related disorders, comprising testing for modulation of the activity of an INSP168, INSP168-SV1, INSP 149 or INSP 169 gene or polypeptide, or a fragment thereof.

15 In an eighth aspect, the invention provides a polypeptide of the first aspect of the invention, or a nucleic acid molecule of the second or third aspect of the invention, or a vector of the fourth aspect of the invention, or a host cell of the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention, for use in therapy or diagnosis of diseases in which 20 leucine-rich repeat motif containing proteins are implicated. Such diseases include, but are not limited to, diseases of the retina, retinal pigment epithelium (RPE), and choroids; ocular neovascularization, ocular inflammation and retinal degenerations;
diabetic retinopathy, chronic glaucoma, retinal detachment, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization;
rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis piginentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, retinal artery occlusion, neovascularization due to penetration of the eye or ocular injury, neuropathies;
Leber's, idiopathic, drug-induced, optic, and ischemic neropathies; spinal cord injuries, paraplegia, neurodegenerative disorders, disorders of the central nervous system, disorders of the peripheral nervous system, brain injuries, cerebrovascular diseases, Parkinson's disease, corticobasal degeneration, motor neuron disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post- traumatic brain injury, small-vessel cerebrovascular disease, dementias, Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia, Parkinsonism, frontotemporal dementias, Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, Korsakoffs psychosis, stroke and trauma.

The moieties of the first, second, third, fourth, fifth, sixth or seventh aspect of the invention may also be used in the manufacture of a medicament for the treatment of such diseases.

In a ninth aspect, the invention provides a method of diagnosing a disease in a patient, comprising assessing the level of expression of a natural gene encoding a polypeptide of the first aspect of the invention or the activity of a polypeptide of the first aspect of the invention in tissue from said patient and comparing said level of expression or activity to a control level, wherein a level that is different to said control level is indicative of disease. Such a method will preferably be carried out in vitro.
Similar methods may be used for monitoring the therapeutic treatment of disease in a patient, wherein altering the level of expression or activity of a polypeptide or nucleic acid molecule over the period of time towards a control level is indicative of regression of disease.

A preferred method for detecting polypeptides of the first aspect of the invention comprises the steps of: (a) contacting a ligand, such as an antibody, of the sixth aspect of the invention with a biological sample under conditions suitable for the formation of a ligand-polypeptide complex; and (b) detecting said complex.

A number of different such methods according to the ninth aspect of the invention exist, as the skilled reader will be aware, such as metliods of nucleic acid hybridization with short probes, point mutation analysis, polymerase chain reaction (PCR) amplification and methods using antibodies to detect aberrant protein levels.
Similar methods may be used on a short or long term basis to allow therapeutic treatment of a disease to be monitored in a patient. The invention also provides kits that are useful in these methods for diagnosing disease.

Preferably, the disease diagnosed by a method of the ninth aspect of the invention is a disease in which leucine-rich repeat motif containing polypeptides are implicated, as described above.

In a tenth aspect, the invention provides for the use of the polypeptide of the first aspect of the invention as an activator of cell proliferation, as a neuromodulator (neuroimmunomodulator), as a modulator of the inflammatory response in the CNS, as a regulator of astrocyte proliferation or as a regulator of axon projection, neuronal migration or leukocyte recruitment or migration. INSP168 and INSP168-SV1, or truncated fonns of INSP 149 and INSP 169 (for example, lacking the transmembrane region) could be used as recombinant soluble antagonists of the endogenous activity of INSP149 and INSP169. Another suitable use of the INSP168 polypeptides is use in the screening of drug compounds that are effective against the diseases and conditions in which the INSP168 polypeptides are implicated.

In an eleventh aspect, the invention provides a pharmaceutical coinposition comprising a polypeptide of the first aspect of the invention, or a nucleic acid molecule of the second or third aspect of the invention, or a vector of the fourth aspect of the invention, or a host cell of the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention, in conjunction with a pharmaceutically-acceptable carrier.

In a twelfth aspect, the present invention provides a polypeptide of the first aspect of the invention, or a nucleic acid molecule of the second or third aspect of the invention, or a vector of the fourth aspect of the invention, or a host cell of the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention, for use in the manufacture of a medicament for the diagnosis or treatment of a disease in which leucine-rich repeat motif containing polypeptides are implicated. Such diseases include those described above in connection with the eighth aspect of the invention.

In a thirteenth aspect, the invention provides a method of treating a disease in a patient comprising administering to the patient a polypeptide of the first aspect of the invention, or a nucleic acid molecule of the second or third aspect of the invention, or a vector of the fourth aspect of the invention, or a host cell of the fifth aspect of the invention, or a ligand of the sixth aspect of the invention, or a compound of the seventh aspect of the invention.

For diseases in which the expression of a natural gene encoding a polypeptide of the first aspect of the invention, or in which the activity of a polypeptide of the first aspect of the invention, is lower in a diseased patient when compared to the level of expression or activity in a healthy patient, the polypeptide, nucleic acid molecule, vector, host cell, ligand or compound administered to the patient should be an agonist.
Conversely, for diseases in which the expression of the natural gene or activity of the polypeptide is higher in a diseased patient when compared to the level of expression or activity in a healthy patient, the polypeptide, nucleic acid molecule, vector, host cell, ligand or compound administered to the patient should be an antagonist.
Examples of such antagonists include antisense nucleic acid molecules, ribozymes and ligands, such as antibodies.

In a fourteenth aspect, the invention provides transgenic or knockout non-human animals that have been transformed to express higher, lower or absent levels of a polypeptide of the first aspect of the invention. Such transgenic animals are very useful models for the study of disease and may also be used in screening regimes for the identification of compounds that are effective in the treatment or diagnosis of such a disease.

As used herein, "functional equivalent" refers to a protein or nucleic acid molecule that possesses functional or structural characteristics that are substantially similar to a polypeptide or nucleic acid molecule of the present invention. A functional equivalent of a protein may contain modifications depending on the necessity of such modifications for the perforinance of a specific function. The term "functional equivalent" is intended to include the fragments, mutants, hybrids, variants, analogs, or chemical derivatives of a molecule.

Preferably, the "functional equivalent" may be a protein or nucleic acid molecule that exhibits any one or more of the functional activities of the polypeptides of the present invention.

Preferably, the "functional equivalent" may be a protein or nucleic acid molecule that displays substantially similar activity compared with INSP168, INSP168-SV1, INSP149 or INSP169 or fragments thereof in a suitable assay for the measurement of biological activity or function. Preferably, the "functional equivalent" may be a protein or nucleic acid molecule that displays identical or higher activity compared with INSP168, INSP168-SV1, INSP149 or INSP169 or fragments thereof in a suitable assay for the measurement of biological activity or function.
Preferably, the "functional equivalent" may be a protein or nucleic acid molecule that displays 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 100% or more activity compared with INSP168, INSP168-SV1, INSP149 or INSP169 or fragments thereof in a suitable assay for the measurement of biological activity or function.

Preferably, the "functional equivalent" may be a protein or polypeptide capable of exhibiting a substantially similar in vivo or in vitro activity as the polypeptides of the invention. Preferably, the "functional equivalent" may be a protein or polypeptide capable of interacting with other cellular or extracellular molecules in a manner substantially similar to the way in which the corresponding portion of the polypeptides of the invention would. For example, a "functional equivalent"
would be able, in an immunoassay, to diminish the binding of an antibody to the corresponding peptide (i.e., the peptide the amino acid sequence of which was modified to achieve the "functional equivalent") of the polypeptide of the invention, or to the polypeptide of the invention itself, where the antibody was raised against the corresponding peptide of the polypeptide of the invention. An equimolar concentration of the functional equivalent will diminish the aforesaid binding of the corresponding peptide by at least about 5%, preferably between about 5% and 10%, more preferably between about 10% and 25%, even more preferably between about 25% and 50%, and most preferably between about 40% and 50%.

For example, functional equivalents can be fully functional or can lack function in one or more activities. Thus, in the present invention, variations can affect the function, for example, of the activities of the polypeptide that reflect its possession of a leucine-rich repeat (LRR) motif.

A summary of standard techniques and procedures which may be employed in order to utilise the invention is given below. It will be understood that this invention is not limited to the particular methodology, protocols, cell lines, vectors and reagents described. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and it is not intended that this terminology should limit the scope of the present invention. The extent of the invention is limited only by the terms of the appended claims.

Standard abbreviations for nucleotides and amino acids are used in this specification.
The practice of the present invention will employ, unless otherwise indicated, 5 conventional techniques of molecular biology, microbiology, recombinant DNA
technology and immunology, which are within the skill of those working in the art.
Such techniques are explained fully in the literature. Examples of particularly suitable texts for consultation include the following: Sambrook Molecular Cloning; A
Laboratory Manual, Second Edition (1989); DNA Cloning, Volumes I and II (D.N
10 Glover ed. 1985); Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. 1984); Transcription and Translation (B.D. Haines & S.J. Higgins eds. 1984); Animal Cell Culture (R.I. Freshney ed.
1986); Immobilized Cells and Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide to Molecular Cloning (1984); the Methods in Enzymology series (Academic 15 Press, Inc.), especially volumes 154 & 155; Gene Transfer Vectors for Mammalian Cells (J.H. Miller and M.P. Calos eds. 1987, Cold Spring Harbor Laboratory);
Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds.
1987, Academic Press, London); Scopes, (1987) Protein Purification: Principles and Practice, Second Edition (Springer Verlag, N.Y.); and Handbook of Experimental 20 Immunology, Volumes I-IV (D.M. Weir and C. C. Blackwell eds. 1986).

As used herein, the term "polypeptide" includes any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e. peptide isosteres. This term refers both to short chains (peptides and oligopeptides) and to longer chains (proteins).

25 The polypeptide of the present invention may be in the form of a mature protein or may be a pre-, pro- or prepro- protein that can be activated by cleavage of the pre-, pro- or prepro- portion to produce an active mature polypeptide. In such polypeptides, the pre-, pro- or prepro- sequence may be a leader or secretory sequence or may be a sequence that is employed for purification of the mature polypeptide sequence.

As noted above, the polypeptide of the first aspect of the invention may form part of a fusion protein. For example, it is often advantageous to include one or more additional amino acid sequences which may contain secretory or leader sequences, pro-sequences, sequences which aid in purification, or sequences that confer higher protein stability, for example during recombinant production. Alternatively or additionally, the mature polypeptide may be fused with another compound, such as a compound to increase the half-life of the polypeptide (for exainple, polyethylene glycol).

Polypeptides of the invention are useful on their own, as components of fusion proteins such as Fc fusion, and/or in combination with another agent.
Preferably, the Fc fusion comprises the mature form of INSP168, the mature form of INSP168-SVl or the mature form of the extracellular part of INSP 169 or INSP 149.

Preferably the agent is selected among interferon-beta, soluble NgR (e.g. Nogo-66), antibodies targeted to NgR, antibodies targeted to myelin inhibitors (e.g.
Nogo, MAG
or Omgp), CXCL10, agonists of serotonin receptors (e.g. 5-HT1A/2A/7), LIF, EGFR
blockers such as Erlotinib, and/or methylprednisolone.

In a further preferred embodiment, a polypeptide of the invention, that may comprise a sequence having at least 85% of homology with INSP168, INSP168-SV1, INSP149 or INSP 169, is a fusion protein.

These fusion proteins can be obtained by cloning a polynucleotide encoding a polypeptide comprising a sequence having at least 85% of homology with INSP168, INSP168-SVl, INSP149 or INSP169 in frame to the coding sequences for a heterologous protein sequence.

The term "heterologous", when used herein, is intended to designate any polypeptide other than a human INSP168, INSP168-SV1, INSP149 or INSP169 polypeptide.
Examples of heterologous sequences, that can be comprised in the fusion proteins either at the N- or C-terminus, include: extracellular domains of membrane-bound protein, immunoglobulin constant regions (Fc regions), multimerization domains, domains of extracellular proteins, signal sequences, export sequences, and sequences allowing purification by affinity chromatography.

Many of these heterologous sequences are commercially available in expression plasmids since these sequences are commonly included in fusion proteins in order to provide additional properties without significantly impairing the specific biological activity of the protein fused to them (Terpe K, 2003, Appl Microbiol Biotechnol, 60:523-33). Examples of such additional properties are a longer lasting half-life in body fluids, the extracellular localization, or an easier purification procedure as allowed by the a stretch of Histidines forming the so-called "histidine tag"
(Gentz et al. 1989, Proc Natl Acad Sci USA, 86:821-4) or by the "HA" tag, an epitope derived from the influenza hemagglutinin protein (Wilson et al. 1994, Cell, 37:767-78). If needed, the heterologous sequence can be eliminated by a proteolytic cleavage, for example by inserting a proteolytic cleavage site between the protein and the heterologous sequence, and exposing the purified fusion protein to the appropriate protease. These features are of particular importance for the fusion proteins since they facilitate their production and use in the preparation of pharmaceutical compositions.
For example, the INSP168, INSP168-SV1, INSP149 or INSP169 polypeptide may be purified by means of a hexa-histidine peptide fused at the C-terminus of INSP168, INSP168-SV1, INSP149 or INSP169. When the fusion protein comprises an immunoglobulin region, the fusion may be direct, or via a short linker peptide wlzich can be as short as 1 to 3 amino acid residues in lengtli or longer, for example, 13 amino acid residues in length. Said linker may be a tripeptide of the sequence E-F-M
(Glu-Phe-Met), for example, or a 13-amino acid linker sequence comprising Glu-Phe-Gly-Ala-Gly-Leu-Val-Leu-Gly-Gly-Gln-Phe-Met (SEQ ID NO:71) introduced between the sequence of the substances 'of the invention and the immunoglobulin sequence. The resulting fusion protein has improved properties, such as an extended residence time in body fluids (i.e. an increased half-life), increased specific activity, increased expression level, or the purification of the fusion protein is facilitated.

In a preferred embodiment, the protein is fused to the constant region of an Ig molecule. Preferably, it is fused to heavy chain regions, like the CH2 and CH3 domains of liuman IgG1, for example. Other isoforms of Ig molecules are also suitable for the generation of fusion proteins according to the present invention, such as isofonns IgG2 or IgG4, or other Ig classes, like IgM or IgA, for example.
Fusion proteins may be monomeric or multimeric, hetero- or homomultimeric.

In a further preferred embodiment, the functional derivative comprises at least one moiety attached to one or more functional groups, which occur as one or more side chains on the amino acid residues. Preferably, the moiety is a polyethylene (PEG) moiety. PEGylation may be carried out by known methods, such as the ones described in W099/55377, for example.

Polypeptides may contain amino acids other than the 20 gene-encoded amino acids, modified either by natural processes, such as by post-translational processing or by chemical modification techniques which are well known in the art. Among the known modifications which may commonly be present in polypeptides of the present invention are glycosylation, lipid attachment, sulphation, gamma-carboxylation, for instance of glutamic acid residues, hydroxylation and ADP-ribosylation. Other potential modifications include acetylation, acylation, amidation, covalent attachment of flavin, covalent attachment of a haeme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, disulphide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, GPI anchor formation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

Modifications can occur anywhere in a polypeptide, including the peptide backbone, the ainino acid side-chains and the amino or carboxyl termini. In fact, blockage of the amino or carboxyl terminus in a polypeptide, or both, by a covalent modification is common in naturally-occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention.

The modifications that occur in a polypeptide often will be a function of how the polypeptide is made. For polypeptides that are made recombinantly, the nature and extent of the modifications in large part will be determined by the post-translational modification capacity of the particular host cell and the modification signals that are present in the amino acid sequence of the polypeptide in question. For instance, glycosylation patterns vary between different types of host cell.

The polypeptides of the present invention can be prepared in any suitable manner.
Such polypeptides include isolated naturally-occurring polypeptides (for example purified from cell culture), recombinantly-produced polypeptides (including fusion proteins), synthetically-produced polypeptides or polypeptides that are produced by a combination of these methods.

The functionally-equivalent polypeptides of the first aspect of the invention may be polypeptides that are homologous to the INSP 168 polypeptides. Two polypeptides are said to be "homologous", as the term is used herein, if the sequence of one of the polypeptides has a high enough degree of identity or similarity to the sequence of the other polypeptide. "Identity" indicates that at any particular position in the aligned sequences, the amino acid residue is identical between the sequences.
"Similarity"
indicates that, at any particular position in the aligned sequences, the amino acid residue is of a similar type between the sequences. Degrees of identity and similarity can be readily calculated (Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing. Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994;
Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987;
and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Preferably, percentage identity, as referred to herein, is as determined using BLAST version 2.1.3 using the default parameters specified by the NCBI (the National Center for Biotechnology Information;
http://www.ncbi.nlm.nih.gov/) [Blosum 62 matrix; gap open penalty=ll and gap extension penalty=l ].

Homologous polypeptides therefore include natural biological variants (for example, allelic variants or geographical variations within the species from which the polypeptides are derived) and mutants (such as mutants containing amino acid substitutions, insertions or deletions) of the INSP168 polypeptides. Such mutants may include polypeptides in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code. Typical such substitutions are among Ala, Val, Leu and Ile;
among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gln;
among the basic residues Lys and Arg; or among the aromatic residues Phe and Tyr.
Particularly preferred are variants in which several, i.e. between 5 and 10, 1 and 5, 1 and 3, 1 and 2 or just 1 amino acids are substituted, deleted or added in any combination. Especially preferred are silent substitutions, additions and deletions, which do not alter the properties and activities of the protein. Also especially preferred in this regard are conservative substitutions. Such mutants also include polypeptides in which one or more of the amino acid residues includes a substituent group.

In accordance with the present invention, any substitution should be preferably a "conservative" or "safe" substitution, which is commonly defined a substitution introducing an amino acids having sufficiently similar chemical properties (e.g. a 5 basic, positively charged amino acid should be replaced by another basic, positively charged amino acid), in order to preserve the structure and the biological function of the molecule.

The literature provide many models on which the selection of conservative ainino acids substitutions can be performed on the basis of statistical and physico-chemical 10 studies on the sequence and/or the structure of proteins (Rogov SI and Nekrasov AN, 2001). Protein design experiments have shown that the use of specific subsets of amino acids can produce foldable and active proteins, helping in the classification of ainino acid "synonyinous" substitutions which can be more easily accommodated in protein structure, and which can be used to detect functional and structural homologs 15 and paralogs (Murphy LR et al., 2000). The groups of synonymous ainino acids and the groups of more preferred synonymous amino acids are shown in Table 1.

Specific, non-conservative mutations can be also introduced in the polypeptides of the invention with different purposes. Mutations reducing the affinity of the protein may increase its ability to be reused and recycled, potentially increasing its therapeutic 20 potency (Robinson CR, 2002). Immunogenic epitopes eventually present in the polypeptides of the invention can be exploited for developing vaccines (Stevanovic S, 2002), or eliminated by modifying their sequence following known methods for selecting mutations for increasing protein stability, and correcting them (van den Burg B and Eijsink V, 2002; WO 02/05146, WO 00/34317, WO 98/52976).

25 Preferred alternative, synonymous groups for amino acids derivatives included in peptide mimetics are those defined in Table 2. A non-exhaustive list of ainino acid derivatives also include aminoisobutyric acid (Aib), hydroxyproline (Hyp), 1,2,3,4-tetrahydro-isoquinoline-3-COOH, indoline-2carboxylic acid, 4-difluoro-proline, L-thiazolidine-4-carboxylic acid, L-homoproline, 3,4-dehydro-proline, 3,4-dihydroxy-30 phenylalanine, cyclohexyl-glycine, and phenylglycine.

By "amino acid derivative" is intended an amino acid or amino acid-like chemical entity other than one of the 20 genetically encoded naturally occurring amino acids. In particular, the amino acid derivative may contain substituted or non-substituted, linear, branched, or cyclic alkyl moieties, and may include one or more heteroatoms.
The amino acid derivatives can be made de novo or obtained from commercial sources (Calbiochem-Novabiochem AG, Switzerland; Bachem, USA).

Various methodologies for incorporating unnatural amino acids derivatives into proteins, using both in vitro and in vivo translation systems, to probe and/or improve protein structure and function are disclosed in the literature (Dougherty DA, 2000).
Techniques for the synthesis and the development of peptide mimetics, as well as non-peptide mimetics, are also well known in the art (Golebiowski A et al., 2001;
Hruby VJ and Balse PM, 2000; Sawyer TK, in "Structure Based Drug Design", edited by Veerapandian P, Marcel Dekker Inc., pg. 557-663, 1997).

Such mutants also include polypeptides in which one or more of the amino acid residues includes a substituent group.

Typically, greater than 80% identity between two polypeptides is considered to be an indication of functional equivalence. Preferably, functionally equivalent polypeptides of the first aspect of the invention have a degree of sequence identity with the INSP 168 polypeptides, or with active fragments thereof, of greater than 80%.
More preferred polypeptides have degrees of identity of greater than 90%, 95%, 98%
or 99%, respectively.

The functionally-equivalent polypeptides of the first aspect of the invention may also be polypeptides which have been identified using one or more techniques of structural alignment. For example, the Inpharmatica Genome Threader technology that forms one aspect of the search tools used to generate the Biopendium search database may be used (see PCT application published as WO 01/69507) to identify polypeptides of presently-unknown function which, while having low sequence identity as compared to the INSP168 polypeptides, are predicted to be cell surface recognition molecules by virtue of sharing significant structural homology with the INSP168 polypeptide sequences. By "significant structural homology" is meant that the Inpharmatica Genome Threader predicts two proteins to share structural homology with a certainty of 10% and above.

The polypeptides of the first aspect of the invention also include fragments of the INSP168 polypeptides and fragments of the functional equivalents of these polypeptides, provided that those fragments retain the biological activity of the INSP 168 polypeptides, or have an antigenic determinant in common with these polypeptides.

As used herein, the term "fragment" refers to a polypeptide having an amino acid sequence that is the same as part, but not all, of the amino acid sequence of the INSP168 polypeptides or one of their functional equivalents. The fragments should comprise at least n consecutive amino acids from the sequence and, depending on the particular sequence, n preferably is 7 or more (for example, 8, 10, 12, 14, 16, 18, 20 or more). Small fragments may form an antigenic determinant.

Nucleic acids according to the invention are preferably 10-2000 nucleotides in length, preferably 100-1750 nucleotides, preferably 500-1500, preferably 600-1200, preferably 750-1000 nucleotides in length. Polypeptides according to the invention are preferably 10-700 amino acids in length, preferably 50-600, preferably 100-500, preferably 200-400, preferably 300-375 amino acids in length.

Fragments of the full length INSP168, INSP168-SVl, INSP149 and INSP169 exon polypeptides and the INSP168, INSP168-SV1, INSP149 and INSP169 polypeptides may consist of combinations of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 of neighbouring exon sequences in the INSP168, INSP168-SV1, 1NSP149 and INSP169 polypeptides, respectively.

Such fragments may be "free-standing", i.e. not part of or fused to other amino acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region. When coinprised within a larger polypeptide, the fragment of the invention most preferably forms a single continuous region. For instance, certain preferred embodiments relate to a fragment having a pre- and/or pro-polypeptide region fused to the amino terminus of the fragment and/or an additional region fused to the carboxyl terminus of the fragment. However, several fragments may be comprised within a single larger polypeptide.

The polypeptides of the present invention or their immunogenic fragments (comprising at least one antigenic determinant) can be used to generate ligands, such as polyclonal or monoclonal antibodies, that are immunospecific for the polypeptides.
Such antibodies may be employed to isolate or to identify clones expressing the polypeptides of the invention or to purify the polypeptides by affinity chromatography. The antibodies may also be employed as diagnostic or therapeutic aids, amongst other applications, as will be apparent to the skilled reader.

The term "immunospecific" means that the antibodies have substantially greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art. As used herein, the term "antibody" refers to intact molecules as well as to fragments thereof, such as Fab, F(ab')2 and Fv, which are capable of binding to the antigenic determinant in question. Such antibodies thus bind to the polypeptides of the first aspect of the invention.

By "substantially greater affinity" we mean that there is a measurable increase in the affinity for a polypeptide of the invention as compared with the affinity for known cell-surface receptors.

Preferably, the affinity is at least 1.5-fold, 2-fold, 5-fold 10-fold, 100-fold, 103-fold, 104-fold, 105-fold, 106-fold or greater for a polypeptide of the invention than for known cell surface recognition molecules.

Preferably, there is a measurable increase in the affinity for a polypeptide of the invention as compared with known leucine-rich repeat (LRR) motif containing proteins.

If polyclonal antibodies are desired, a selected mammal, such as a mouse, rabbit, goat or horse, may be immunised with a polypeptide of the first aspect of the invention.
The polypeptide used to immunise the animal can be derived by recombinant DNA
technology or can be synthesized chemically. If desired, the polypeptide can be conjugated to a carrier protein. Commonly used carriers to which the polypeptides may be chemically coupled include bovine seruin albumin, thyroglobulin and keyhole limpet haemocyanin. The coupled polypeptide is then used to immunise the animal.
Serum from the iinmunised animal is collected and treated according to known procedures, for example by immunoaffinity chromatography.

Monoclonal antibodies to the polypeptides of the first aspect of the invention can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies using hybridoma technology is well known (see, for example, Kohler,_ G. and Milstein, C., Nature 256: 495-497 (1975);_Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985).

Panels of monoclonal antibodies produced against the polypeptides of the first aspect of the invention can be screened for various properties, i.e., for isotype, epitope, affinity, etc. Monoclonal antibodies are particularly useful in purification of the individual polypeptides against which they are directed. Alternatively, genes encoding the monoclonal antibodies of interest may be isolated from hybridomas, for instance by PCR techniques known in the art, and cloned and expressed in appropriate vectors.
Chimeric antibodies, in which non-human variable regions are joined or fused to human constant regions (see, for example, Liu et al., Proc. Natl. Acad. Sci.
USA, 84, 3439 (1987)), may also be of use.

The antibody may be modified to make it less immunogenic in an individual, for example by humanisation (see Jones et al., Nature, 321, 522 (1986); Verhoeyen et al., Science, 239, 1534 (1988); Kabat et al., J. Immunol., 147, 1709 (1991); Queen et al., Proc. Natl Acad. Sci. USA, 86, 10029 (1989); Gorman et al., Proc. Natl Acad.
Sci.
USA, 88, 34181 (1991); and Hodgson et al., Bio/Technology, 9, 421 (1991)). The term "humanised antibody", as used herein, refers to antibody molecules in which the CDR amino acids and selected other amino acids in the variable domains of the heavy and/or light chains of a non-human donor antibody have been substituted in place of the equivalent amino acids in a human antibody. The humanised antibody thus closely resembles a human antibody but has the binding ability of the donor antibody.

In a further alternative, the antibody may be a "bispecific" antibody, that is an antibody having two different antigen-binding domains, each domain being directed against a different epitope.

Phage display technology may be utilised to select genes which encode antibodies with binding activities towards the polypeptides of the invention either from repertoires of PCR amplified V-genes of lymphocytes from huinans screened for possessing the relevant antibodies, or from naive libraries (McCafferty, J. et al., (1990), Nature 348, 552-554; Marks, J. et al., (1992) Biotechnology 10, 779-783).
The affinity of these antibodies can also be improved by chain shuffling (Clackson, T.
et al., (1991) Nature 352, 624-628).

Antibodies generated by the above techniques, whether polyclonal or monoclonal, have additional utility in that they may be employed as reagents in immunoassays, radioimmunoassays (RIA) or enzyme-linked immunosorbent assays (ELISA). In these applications, the antibodies can be labelled with an analytically-detectable reagent such as a radioisotope, a fluorescent molecule or an enzyme.

Preferred nucleic acid molecules of the second and third aspects of the invention are those which encode a polypeptide sequence as recited in SEQ ID NO:2, SEQ ID
5 NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID
NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID
NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID
NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID
NO:44 and/or SEQ ID NO:67, and functionally equivalent polypeptides. These 10 nucleic acid molecules may be used in the methods and applications described herein.
The nucleic acid molecules of the invention preferably comprise at least n consecutive nucleotides from the sequences disclosed herein where, depending on the particular sequence, n is 10 or more (for example, 12, 14, 15, 18, 20, 25, 30, 35, 40 or more).
The nucleic acid molecules of the invention also include sequences that are 15 complementary to nucleic acid molecules described above (for example, for antisense or probing purposes).

Nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance cDNA, synthetic DNA or genomic DNA. Such nucleic acid molecules may be obtained by cloning, by chemical 20 synthetic techniques or by a combination tliereof. The nucleic acid molecules can be prepared, for example, by chemical synthesis using techniques such as solid phase phosphoramidite chemical synthesis, from genomic or cDNA libraries or by separation from an organism. RNA molecules may generally be generated by the in vitro or in vivo transcription of DNA sequences.

25 The nucleic acid molecules may be double-stranded or single-stranded.
Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.

The term "nucleic acid molecule" also includes analogues of DNA and RNA, such as those containing modified backbones, and peptide nucleic acids (PNA). The term 30 "PNA", as used herein, refers to an antisense molecule or an anti-gene agent which comprises an oligonucleotide of at least five nucleotides in length linked to a peptide backbone of amino acid residues, which preferably ends in lysine. The terminal lysine confers solubility to the composition. PNAs may be pegylated to extend their lifespan in a cell, where they preferentially bind complementary single stranded DNA
and RNA and stop transcript elongation (Nielsen, P.E. et al. (1993) Anticancer Drug Des.
8:53-63).

A nucleic acid molecule which encodes the polypeptide of SEQ ID NO:2 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ ID
NO: 1.
A nucleic acid molecule which encodes the polypeptide of SEQ ID NO:4 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ ID
NO:3.
A nucleic acid molecule which encodes the polypeptide of SEQ ID NO:6 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ ID
NO:5.
A nucleic acid molecule which encodes the polypeptide of SEQ ID NO:8 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ ID
NO:7.
A nucleic acid molecule which encodes the polypeptide of SEQ ID NO:10 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ ID
NO:9.
A nucleic acid molecule which encodes the polypeptide of SEQ ID NO:12 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ ID
NO:11. A nucleic acid molecule which encodes the polypeptide of SEQ ID NO:14 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:13. A nucleic acid molecule wllich encodes the polypeptide of SEQ ID
NO:16 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:15. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:18 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:17. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:20 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO: 19. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:22 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:21. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:24 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:23. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:26 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:25. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:28 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:27. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:30 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:29. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:32 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:3 1. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:34 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:33. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:36 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:35. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:38 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:37. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:40 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:39. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:42 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:41. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:44 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:43. A nucleic acid molecule which encodes the polypeptide of SEQ ID
NO:67 may be identical to the coding sequence of the nucleic acid molecule shown in SEQ
ID NO:66.

These molecules also may have a different sequence which, as a result of the degeneracy of the genetic code, encodes a polypeptide of SEQ ID NO:2, SEQ ID
NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID
NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID
NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID
NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID
NO:44 or SEQ ID NO:67. Such nucleic acid molecules may include, but are not limited to, the coding sequence for the mature polypeptide by itself; the coding sequence for the mature polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pro-, pre- or prepro-polypeptide sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with further additional, non-coding sequences, including non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription (including termination signals), ribosome binding and mRNA stability. The nucleic acid molecules may also include additional sequences which encode additional amino acids, such as those which provide additional functionalities.

The nucleic acid molecules of the second and third aspects of the invention may also encode the fragments or the functional equivalents of the polypeptides and fragments of the first aspect of the invention. Such a nucleic acid molecule may be a naturally-occurring variant such as a naturally-occurring allelic variant, or the molecule may be a variant that is not known to occur naturally. Such non-naturally occurring variants of the nucleic acid molecule may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells or organisms.

Among variants in this regard are variants that differ from the aforementioned nucleic acid molecules by nucleotide substitutions, deletions or insertions. The substitutions, deletions or insertions may involve one or more nucleotides. The variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or insertions.

The nucleic acid molecules of the invention can also be engineered, using methods generally known in the art, for a variety of reasons, including modifying the cloning, processing, and/or expression of the gene product (the polypeptide). DNA
shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides are included as techniques which may be used to engineer the nucleotide sequences. Site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations and so fortlz.

Nucleic acid molecules which encode a polypeptide of the first aspect of the invention may be ligated to a heterologous sequence so that the combined nucleic acid molecule encodes a fusion protein. Such combined nucleic acid molecules are included within the second or third aspects of the invention. For example, to screen peptide libraries for inhibitors of the activity of the polypeptide, it may be useful to express, using such a combined nucleic acid molecule, a fusion protein that can be recognised by a commercially-available antibody. A fusion protein may also be engineered to contain a cleavage site located between the sequence of the polypeptide of the invention and the sequence of a heterologous protein so that the polypeptide may be cleaved and purified away from the heterologous protein.

The nucleic acid molecules of the invention also include antisense molecules that are partially complementary to nucleic acid molecules encoding polypeptides of the present invention and that therefore hybridize to the encoding nucleic acid molecules (hybridization). Such antisense molecules, such as oligonucleotides, can be designed to recognise, specifically bind to and prevent transcription of a target nucleic acid encoding a polypeptide of the invention, as will be known by those of ordinary skill in the art (see, for example, Cohen, J.S., Trends in Phann. Sci., 10, 435 (1989), Okano, J. Neurochem. 56, 560 (1991); O'Connor, J. Neurochem 56, 560 (1991); Lee et al., Nucleic Acids Res 6, 3073 (1979); Cooney et al., Science 241, 456 (1988);
Dervan et al., Science 251, 1360 (1991).

The term "hybridization" as used here refers to the association of two nucleic acid molecules with one another by hydrogen bonding. Typically, one molecule will be fixed to a solid support and the other will be free in solution. Then, the two molecules may be placed in contact with one another under conditions that favour hydrogen bonding. Factors that affect this bonding include: the type and volume of solvent;
reaction temperature; time of hybridization; agitation; agents to block the non-specific attachment of the liquid phase molecule to the solid support (Denhardt's reagent or BLOTTO); the concentration of the molecules; use of compounds to increase the rate of association of molecules (dextran sulphate or polyethylene glycol); and the stringency of the washing conditions following hybridization (see Sambrook et al.
[supra]).

The inhibition of hybridization of a completely complementary molecule to a target molecule may be examined using a hybridization assay, as known in the art (see, for example, Sambrook et al [supra]). A substantially homologous molecule will then compete for and inllibit the binding of a completely homologous molecule to the target molecule under various conditions of stringency, as taught in Wahl, G.M. and S.L. Berger (1987; Methods Enzymol. 152:399-407) and Kimmel, A.R. (1987;
Methods Enzymol. 152:507-511).

"Stringency" refers to conditions in a hybridization reaction that favour the association of very similar molecules over association of molecules that differ. High stringency hybridisation conditions are defined as overnight incubation at 42 C in a solution comprising 50% formamide, 5XSSC (150mM NaC1, 15mM trisodium citrate), 50mM sodium phosphate (pH7.6), 5x Denhardts solution, 10% dextran sulphate, and 20 microgram/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1X SSC at approximately 65 C. Low stringency conditions 5 involve the hybridisation reaction being carried out at 35 C (see Sambrook et al.
[supra]). Preferably, the conditions used for hybridization are those of high stringency.

Preferred embodiments of this aspect of the invention are nucleic acid molecules that are at least 70% identical over their entire length to nucleic acid molecules encoding 10 the INSP 168 polypeptides (such as SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO: 44, or SEQ ID NO:67) and nucleic acid molecules that 15 are substantially complementary to such nucleic acid molecules. Preferably, a nucleic acid molecule according to this aspect of the invention comprises a region that is at least 80% identical over its entire length to the nucleic acid molecules having the sequence recited in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ
ID NO:9, SEQ ID NO:11, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID
20 NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:31, SEQ ID
NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID
NO:43 or SEQ ID NO:66 or a nucleic acid molecule that is compleinentary thereto. In this regard, nucleic acid molecules at least 90%, preferably at least 95%, more preferably at least 98% or 99% identical over their entire length to the same are 25 particularly preferred. Preferred einbodiments in this respect are nucleic acid molecules that encode polypeptides which retain substantially the same biological function or activity as the INSP 168 polypeptides.

The invention also provides a process for detecting a nucleic acid molecule of the invention, comprising the steps of: (a) contacting a nucleic probe according to the 30 invention with a biological sample under hybridizing conditions to form duplexes;
and (b) detecting any such duplexes that are formed.

As discussed additionally below in connection with assays that may be utilised according to the invention, a nucleic acid molecule as described above may be used as a hybridization probe for RNA, cDNA or genomic DNA, in order to isolate full-length cDNAs and genomic clones encoding the INSP164 polypeptides and to isolate cDNA and genomic clones of homologous or orthologous genes that have a high sequence similarity to the gene encoding this polypeptide.

In this regard, the following techniques, among others known in the art, may be utilised and are discussed below for purposes of illustration. Methods for DNA
sequencing and analysis are well known and are generally available in the art and may, indeed, be used to practice many of the embodiments of the invention discussed herein. Such methods may employ such enzymes as the Klenow fragment of DNA
polymerase I, Sequenase (US Biochemical Corp, Cleveland, OH), Taq polymerase (Perkin Elmer), thermostable T7 polymerase (Amersham, Chicago, IL), or combinations of polymerases and proof-reading exonucleases such as those found in the ELONGASE Amplification System marketed by Gibco/BRL (Gaithersburg, MD).
Preferably, the sequencing process may be automated using machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno, NV), the Peltier Thermal Cycler (PTC200; MJ Research, Watertown, MA) and the ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer).

One method for isolating a nucleic acid molecule encoding a polypeptide with an equivalent function to that of the INSP168 polypeptides is to probe a genoinic or cDNA library with a natural or artificially-designed probe using standard procedures that are recognised in the art (see, for example, "Current Protocols in Molecular Biology", Ausubel et al. (eds). Greene Publishing Association and John Wiley Interscience, New York, 1989,1992). Probes comprising at least 15, preferably at least 30, and more preferably at least 50, contiguous bases that correspond to, or are coinpleinentary to, nucleic acid sequences from the appropriate encoding gene (such as SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ
ID NO:11, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID
NO:23, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID
NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 or SEQ ID
NO:66) are particularly useful probes. Such probes may be labelled with an analytically-detectable reagent to facilitate their identification. Useful reagents include, but are not limited to, radioisotopes, fluorescent dyes and enzymes that are capable of catalysing the formation of a detectable product. Using these probes, the ordinarily skilled artisan will be capable of isolating complementary copies of genomic DNA, eDNA or RNA polynucleotides encoding proteins of interest from human, mammalian or other animal sources and screening such sources for related sequences, for example, for additional members of the family, type and/or subtype.

In many cases, isolated cDNA sequences will be incomplete, in that the region encoding the polypeptide will be cut short, normally at the 5' end. Several methods are available to obtain full length cDNAs, or to extend short cDNAs. Such sequences may be extended utilising a partial nucleotide sequence and employing various methods known in the art to detect upstream sequences such as promoters and regulatory elements. For example, one method which may be employed is based on the method of Rapid Amplification of cDNA Ends (RACE; see, for example, Frohman et al., PNAS USA 85, 8998-9002, 1988). Recent modifications of this teclmique, exemplified by the MarathonTM teclmology (Clontech Laboratories Inc.), for example, have significantly simplified the search for longer cDNAs. A slightly different technique, termed "restriction-site" PCR, uses universal primers to retrieve unknown nucleic acid sequence adjacent a known locus (Sarkar, G. (1993) PCR
Methods Applic. 2:318-322). Inverse PCR may also be used to amplify or to extend sequences using divergent primers based on a known region (Triglia, T. et al.
(1988) Nucleic Acids Res. 16:8186). Another method whicll may be used is capture PCR
which involves PCR amplification of DNA fragments adjacent a known sequence in human and yeast artificial chromosome DNA (Lagerstrom, M. et al. (1991) PCR
Methods Applic., 1, 111-119). Another method which may be used to retrieve unknown sequences is that of Parker, J.D. et al. (1991); Nucleic Acids Res.
19:3055-3060). Additionally, one may use PCR, nested primers, and PromoterFinderTM
libraries to walk genomic DNA (Clontech, Palo Alto, CA). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.

When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Also, random-primed libraries are preferable, in that they will contain more sequences that contain the 5' regions of genes.
Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries may be useful for extension of sequence into 5' non-transcribed regulatory regions.

In one embodiment of the invention, the nucleic acid molecules of the present invention may be used for chromosome localisation. In this technique, a nucleic acid molecule is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome. The mapping of relevant sequences to chromosomes according to the present invention is an important step in the confirmatory correlation of those sequences with the gene-associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins University Welch Medical Library). The relationships between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes). This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques. Once the disease or syndrome has been crudely localised by genetic linkage to a particular genomic region, any sequences mapping to that area may represent associated or regulatory genes for further investigation. The nucleic acid molecule may also be used to detect differences in the chromosomal location due to translocation, inversion, etc.
among nonnal, carrier, or affected individuals.

The nucleic acid molecules of the present invention are also valuable for tissue localisation. Such techniques allow the determination of expression patterns of the polypeptide in tissues by detection of the mRNAs that encode them. These techniques include in situ hybridization techniques and nucleotide amplification techniques, such as PCR. Results from these studies provide an indication of the normal functions of the polypeptide in the organism. In addition, comparative studies of the normal expression pattern of mRNAs with that of mRNAs encoded by a mutant gene provide valuable insights into the role of mutant polypeptides in disease. Such inappropriate expression may be of a temporal, spatial or quantitative nature.

Gene silencing approaches may also be undertaken to down-regulate endogenous expression of a gene encoding a polypeptide of the invention. RNA interference (RNAi) (Elbashir, SM et al., Nature 2001, 411, 494-498) is one method of sequence specific post-transcriptional gene silencing that may be employed. Short dsRNA
oligonucleotides are synthesised in vitro and introduced into a cell. The sequence specific binding of these dsRNA oligonucleotides triggers the degradation of target mRNA, reducing or ablating target protein expression.

Efficacy of the gene silencing approaches assessed above may be assessed through the measurement of polypeptide expression (for example, by Western blotting), and at the RNA level using TaqMan-based methodologies.

The vectors of the present invention comprise nucleic acid molecules of the invention and may be cloning or expression vectors. The host cells of the invention, which may be transformed, transfected or transduced with the vectors of the invention may be prokaryotic or eukaryotic.

The polypeptides of the invention may be prepared in recombinant form by expression of their encoding nucleic acid molecules in vectors contained within a host cell. Such expression methods are well known to those of skill in the art and many are described in detail by Sambrook et al (supra) and Fernandez & Hoeffler (1998, eds.
"Gene expression systems. Using nature for the art of expression". Academic Press, San Diego, London, Boston, New York, Sydney, Tokyo, Toronto).

Generally, any system or vector that is suitable to maintain, propagate or express nucleic acid molecules to produce a polypeptide in the required host may be used. The appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those described in Sambrook et al., (supra). Generally, the encoding gene can be placed under the control of a control element such as a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator, so that the DNA sequence encoding the desired polypeptide is transcribed into RNA in the transformed host cell.

Examples of suitable expression systems include, for example, chromosomal, episomal and virus-derived systems, including, for example, vectors derived from:
bacterial plasmids, bacteriophage, transposons, yeast episomes, insertion elements, yeast chromosomal elements, viruses such as baculoviruses, papova viruses such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, or combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, including cosmids and phagemids. Human artificial chromosomes (HACs) may also be employed to deliver larger fragments of DNA
than can be contained and expressed in a plasmid.

The pCR4-TOPO-INSP168, pCR4-TOPO-INSP168-SV1, pEAK12d INSP168-6HIS, pENTR INSP168-6HIS, and pDEST12.2 INSP168-6HIS vectors are preferred examples of suitable vectors for use in accordance with this invention.

Particularly suitable expression systems include microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid or cosmid DNA expression 5 vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (for example, baculovirus); plant cell systems transformed with virus expression vectors (for example, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (for example, Ti or pBR322 plasmids); or animal cell systems. Cell-free translation 10 systems can also be employed to produce the polypeptides of the invention.

Introduction of nucleic acid molecules encoding a polypeptide of the present invention into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al., Basic Methods in Molecular Biology (1986) and Sambrook et al.,[supra]. Particularly suitable methods include calcium phosphate 15 transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection (see Sambrook et al., 1989 [supra];
Ausubel et al., 1991 [supra]; Spector, Goldman & Leinwald, 1998). In eukaryotic cells, expression systems may either be transient (for example, episomal) or permanent (chromosomal 20 integration) according to the needs of the system.

The encoding nucleic acid molecule may or may not include a sequence encoding a control sequence, such as a signal peptide or leader sequence, as desired, for example, for secretion of the translated polypeptide into the lumen of the endoplasmic reticuluin, into the periplasmic space or into the extracellular environment.
These 25 signals may be endogenous to the polypeptide or they may be heterologous signals.
Leader sequences can be removed by the bacterial host in post-translational processing.

In addition to control sequences, it may be desirable to add regulatory sequences that allow for regulation of the expression of the polypeptide relative to the growth of the 30 host cell. Examples of regulatory sequences are those which cause the expression of a gene to be increased or decreased in response to a chemical or physical stimulus, including the presence of a regulatory compound or to various temperature or metabolic conditions. Regulatory sequences are those non-translated regions of the vector, such as enhancers, promoters and 5' and 3' untranslated regions. These interact with host cellular proteins to carry out transcription and translation. Such regulatory sequences may vary in their strength and specificity. Depending on the vector system and host utilised, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ
promoter of the Bluescript phagemid (Stratagene, LaJolla, CA) or pSportlTm plasmid (Gibco BRL) and the like may be used. The baculovirus polyhedrin promoter may be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (for example, heat shock, RUBISCO and storage protein genes) or from plant viruses (for example, viral promoters or leader sequences) may be cloned into the vector. In inammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of the sequence, vectors based on SV40 or EBV may be used with an appropriate selectable marker.

An expression vector is constructed so that the particular nucleic acid coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the regulatory sequences being such that the coding sequence is transcribed under the "control" of the regulatory sequences, i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence. In some cases it may be necessary to modify the sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the reading fraine.

The control sequences and other regulatory sequences may be ligated to the nucleic acid coding sequence prior to insertion into a vector. Alternatively, the coding sequence can be cloned directly into an expression vector that already contains the control sequences and an appropriate restriction site.

For long-term, high-yield production of a recombinant polypeptide, stable expression is preferred. For example, cell lines which stably express the polypeptide of interest may be transformed using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells that successfully express the introduced sequences. Resistant clones of stably transformed cells may be proliferated using tissue culture techniques appropriate to the cell type.

Mammalian cell lines available as hosts for expression are known in the art and include many immortalised cell lines available from the American Type Culture Collection (ATCC) including, but not limited to, Chinese hamster ovary (CHO), HeLa, baby hamster kidney (BHK), monkey kidney (COS), C127, 3T3, BHK, HEK
293, Bowes melanoma and human hepatocellular carcinoma (for example Hep G2) cells and a number of other cell lines.

In the baculovirus system, the materials for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia, Invitrogen, San Diego CA (the "MaxBac" kit). These techniques are generally known to those skilled in the art and are described fully in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). Particularly suitable host cells for use in this system include insect cells such as Drosophila S2 and Spodoptera Sf9 cells.

There are many plant cell culture and whole plant genetic expression systems known in the art. Examples of suitable plant cellular genetic expression systems include those described in US 5,693,506; US 5,659,122; and US 5,608,143. Additional examples of genetic expression in plant cell culture have been described by Zenk, Phytochemistry 30, 3861-3863 (1991).

In particular, all plants from which protoplasts can be isolated and cultured to give whole regenerated plants can be utilised, so that whole plants are recovered which contain the transferred gene. Practically all plants can be regenerated from cultured cells or tissues, including but not limited to all major species of sugar cane, sugar beet, cotton, fruit and other trees, legumes and vegetables.

Examples of particularly preferred bacterial host cells include streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells.

Examples of particularly suitable host cells for fungal expression include yeast cells (for example, S. cerevisiae) and Aspergillus cells.

Any number of selection systems are known in the art that may be used to recover transformed cell lines. Examples include the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, I. et al. (1980) Cell 22:817-23) genes that can be employed in tk- or aprt cells, respectively.

Also, antimetabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dihydrofolate reductase (DHFR) that confers resistance to methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77:3567-70);
npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin, F.
et al (1981) J. Mol. Biol. 150:1-14) and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively. Additional selectable genes have been described, examples of which will be clear to those of skill in the art.

Although the presence or absence of marker gene expression suggests that the gene of interest is also present, its presence and expression may need to be confirmed. For example, if the relevant sequence is inserted within a marker gene sequence, transformed cells containing the appropriate sequences can be identified by the absence of marker gene fiuiction. Alternatively, a marker gene can be placed in tandem with a sequence encoding a polypeptide of the invention under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the tandem gene as well.

Alternatively, host cells that contain a nucleic acid sequence encoding a polypeptide of the invention and which express said polypeptide may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassays, for example, fluorescence activated cell sorting (FACS) or immunoassay techniques (such as the enzyme-linked immunosorbent assay [ELISA] and radioimmunoassay [RIA]), that include membrane, solution, or cliip based technologies for the detection and/or quantification of nucleic acid or protein (see Hampton, R. et al.
(1990) Serological Methods, a Laboratory Manual, APS Press, St Paul, MN) and Maddox, D.E. et al. (1983) J. Exp. Med, 158, 1211-1216).

A wide variety of labels and conjugation techniques are known by those skilled in the art and may be used in various nucleic acid and amino acid assays. Means for producing labelled hybridization or PCR probes for detecting sequences related to nucleic acid molecules encoding polypeptides of the present invention include oligolabelling, nick translation, end-labelling or PCR amplification using a labelled polynucleotide. Alternatively, the sequences encoding the polypeptide of the invention may be cloned into a vector for the production of an mRNA probe.
Such vectors are known in the art, are commercially available, and may be used to synthesise RNA probes izz vitro by addition of an appropriate RNA polymerase such as T7, T3 or SP6 and labelled nucleotides. These procedures may be conducted using a variety of commercially available kits (Pharmacia & Upjohn, (Kalamazoo, MI);
Promega (Madison WI); and U.S. Biochemical Corp., Cleveland, OH)).

Suitable reporter molecules or labels, which may be used for ease of detection, include radionuclides, enzymes and fluorescent, chemiluminescent or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.

Nucleic acid molecules according to the present invention may also be used to create transgenic animals, particularly rodent animals. Such transgenic animals form a further aspect of the present invention. This may be done locally by modification of somatic cells, or by germ line therapy to incorporate heritable modifications.
Such transgenic animals may be particularly useful in the generation of animal models for drug molecules effective as modulators of the polypeptides of the present invention.

The polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammoniuin sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. High performance liquid chromatography is particularly useful for purification. Well known techniques for refolding proteins may be employed to regenerate an active conformation wlien the polypeptide is denatured during isolation and or purification.

Specialised vector constructions may also be used to facilitate purification of proteins, as desired, by joining sequences encoding the polypeptides of the invention to a nucleotide sequence encoding a polypeptide domain that will facilitate purification of soluble proteins. Examples of such purification-facilitating domains include metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilised metals, protein A domains that allow purification on immobilised immunoglobulin, and the domain utilised in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, WA). The inclusion of cleavable linker sequences such as those specific for Factor XA or enterokinase (Invitrogen, San 5 Diego, CA) between the purification domain and the polypeptide of the invention may be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing the polypeptide of the invention fused to several histidine residues preceding a thioredoxin or an enterokinase cleavage site.
The histidine residues facilitate purification by IMAC (immobilised metal ion affinity 10 chromatography as described in Porath, J. et al. (1992), Prot. Exp. Purif.
3: 263-281) while the thioredoxin or enterokinase cleavage site provides a means for purifying the polypeptide from the fusion protein. A discussion of vectors which contain fusion proteins is provided in Kroll, D.J. et al. (1993; DNA Cell Biol. 12:441-453).

If the polypeptide is to be expressed for use in screening assays, generally it is 15 preferred that it be secreted into the culture medium of the host cell in which it is expressed. In this event, the polypeptides of the invention may be purified from the culture medium may be harvested prior to use in the screening assay, for example using standard protein purification techniques such as gel exclusion chromatography, ion-exchange chromatography or affinity chromatography. Examples of suitable 20 methods of protein purification are provided in the Examples herein. If polypeptide is produced intracellularly, the cells must first be lysed before the polypeptide is recovered.

Alternatively, it may be preferred that the polypeptides of the invention be expressed as cell-surface fusion proteins. In this event, the host cells may be harvested prior to 25 use in the screening assay, for example using techniques such as fluorescence activated cell sorting (FACs) or immunoaffinity techniques.

As indicated above, the present invention also provides novel targets and methods for the screening of drug candidates or leads. These screening methods include binding assays and/or functional assays, and may be performed in vitro, in cell systems or in 30 animals.

In this regard, a particular object of this invention resides in the use of an polypeptide as a target for screening candidate drugs for treating or preventing disorders in which leucine-rich repeat (LRR) motif containing proteins are implicated.
Another object of this invention resides in methods of selecting biologically active compounds, said methods comprising contacting a candidate compound with a INSP 168 gene or polypeptide, and selecting compounds that bind said gene or polypeptide.

A further other object of this invention resides in methods of selecting biologically active compounds, said method comprising contacting a candidate compound with recombinant host cell expressing a INSP 168 polypeptide with a candidate compound, and selecting compounds that bind said INSP168 polypeptide at the surface of said cells and/or that modulate the activity of the INSP 168 polypeptide.

A "biologically active" compound denotes any compound having biological activity in a subject, preferably therapeutic activity, more preferably a compound that can be used for treating disorders in which leucine-rich repeat (LRR) motif containing proteins are implicated, or as a lead to develop drugs for treating disorders in which leucine-rich repeat (LRR) motif containing proteins are implicated. A
"biologically active" compound preferably is a compound that modulates the activity of a polypeptide.

The above methods may be conducted in vitro, using various devices and conditions, including with immobilized reagents, and may further comprise asi additional step of assaying the activity of the selected compounds in a model of a disorder in which leucine-rich repeat (LRR) motif containing proteins are implicated, such as an animal model.

Binding to a target gene or polypeptide provides an indication as to the ability of the compound to modulate the activity of said target, and thus to affect a pathway leading to disorder in a subject. The determination of binding may be performed by various techniques, such as by labelling of the candidate compound, by competition with a labelled reference ligand, etc. For in vitro binding assays, the polypeptides may be used in essentially pure form, in suspension, immobilized on a support, or expressed in a membrane (intact cell, membrane preparation, liposome, etc.).

Modulation of activity includes, without limitation, stimulation of the surface expression of a receptor, and modulation of multimerization of said receptor (e.g., the formation of multimeric complexes with other sub-units), etc. The cells used in the assays may be any recombinant cell (i.e., any cell comprising a recombinant nucleic acid encoding a INSP168 polypeptide) or any cell that expresses an endogenous INSP168 polypeptide. Examples of such cells include, without limitation, prokaryotic cells (such as bacteria) and eukaryotic cells (such as yeast cells, mammalian cells, insect cells, plant cells, etc.). Specific examples include E.coli, Pichia pastoris, Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces or Saccharomyces yeasts, mammalian cell lines (e.g., Vero cells, CHO cells, 3T3 cells, COS cells, etc.) as well as primary or established mammalian cell cultures (e.g., produced from fibroblasts, einbryonic cells, epithelial cells, nervous cells, adipocytes, etc.).

Preferred selected compounds are agonists of INSP 168, i.e., compounds that can bind to INSP 168 and mimic the activity of an endogenous ligand thereof.

A further object of this invention resides in a method of selecting biologically active coinpounds, said method comprising contacting in vitro a test compound with a INSP168 polypeptide according to the present invention and determining the ability of said test compound to modulate the activity of said INSP 168 polypeptide.

A further object of this invention resides in a method of selecting biologically active compounds, said method comprising contacting in vitro a test compound with a 1NSP 168 gene according to the present invention and determining the ability of said test compound to modulate the expression of said INSP168 gene, preferably to stimulate expression thereof.

In another embodiment, this invention relates to a method of screening, selecting or identifying active compounds, the method comprising contacting a test compound with a recombinant host cell comprising a reporter construct, said reporter construct comprising a reporter gene under the control of a INSP168 gene promoter, and selecting the test compounds that modulate (e.g. stimulate or reduce, preferably stimulate) expression of the reporter gene.

The polypeptide of the invention can be used to screen libraries of compounds in any of a variety of drug screening techniques. Such compounds may activate (agonise) or inhibit (antagonise) the level of expression of the gene or the activity of the polypeptide of the invention and form a further aspect of the present invention.
Preferred compounds are effective to alter the expression of a natural gene which encodes a polypeptide of the first aspect of the invention or to regulate the activity of a polypeptide of the first aspect of the invention.

Agonist or antagonist compounds may be isolated from, for example, cells, cell-free preparations, chemical libraries or natural product mixtures. These agonists or antagonists may be natural or modified substrates, ligands, enzymes, receptors or structural or functional mimetics. For a suitable review of such screening techniques, see Coligan et al., Current Protocols in Immunology 1(2):Chapter 5 (1991).
Compounds that are most likely to be good antagonists are molecules that bind to the polypeptide of the invention without inducing the biological effects of the polypeptide upon binding to it. Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to the polypeptide of the invention and thereby inhibit or extinguish its activity. In this fashion, binding of the polypeptide to normal cellular binding molecules may be inhibited, such that the normal biological activity of the polypeptide is prevented.

The polypeptide of the invention that is employed in such a screening technique may be free in solution, affixed to a solid support, borne on a cell surface or located intracellularly. In general, such screening procedures may involve using appropriate cells or cell membranes that express the polypeptide that are contacted with a test compound to observe binding, or stimulation or inhibition of a functional response.
The functional response of the cells contacted with the test compound is then compared with control cells that were not contacted witli the test compound.
Such an assay may assess whether the test compound results in a signal generated by activation of the polypeptide, using an appropriate detection system.
Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist in the presence of the test compound is observed.

Methods for generating detectable signals in the types of assays described herein will be known to those of skill in the art. A particular example is cotransfecting a construct expressing a polypeptide according to the invention, or a fragment such as the LBD, in fusion with the GAL4 DNA binding domain, into a cell together with a reporter plasmid, an example of which is pFR-Luc (Stratagene Europe, Amsterdam, The Netherlands). This particular plasmid contains a synthetic promoter with five tandem repeats of GAL4 binding sites that control the expression of the luciferase gene. When a potential ligand is added to the cells, it will bind the GAL4-polypeptide fusion and induce transcription of the luciferase gene. The level of the luciferase expression can be monitored by its activity using a luminescence reader (see, for example, Lehman et al. JBC 270, 12953, 1995; Pawar et al. JBC, 277, 39243, 2002).

A preferred method for identifying an agonist or antagonist compound of a polypeptide of the present invention comprises:

(a) contacting a cell expressing on the surface thereof a polypeptide according to the first aspect of the invention, the polypeptide being associated with a second component capable of providing a detectable signal in response to the binding of a compound to the polypeptide, with a compound to be screened under conditions to permit binding to the polypeptide; and (b) determining whether the compound binds to and activates or inhibits the polypeptide by measuring the level of a signal generated from the interaction of the compound with the polypeptide.

A further preferred method for identifying an agonist or antagonist of a polypeptide of the invention comprises:

(a) contacting a cell expressing on the surface thereof the polypeptide, the polypeptide being associated with a second component capable of providing a detectable signal in response to the binding of a compound to the polypeptide, with a compound to be screened under conditions to permit binding to the polypeptide; and (b) determining whether the compound binds to and activates or inhibits the polypeptide by comparing the level of a signal generated from the interaction of the compound with the polypeptide with the level of a signal in the absence of the compound.

For example, a method such as FRET detection of a ligand bound to the polypeptide in the-presence of peptide co-activators (Norris et al., Science 285, 744, 1999) might be used.

In further preferred embodiments, the general methods that are described above may further comprise conducting the identification of agonist or antagonist in the presence of labelled or unlabelled ligand for the polypeptide.

In another embodiment of the method for identifying agonist or antagonist of a 5 polypeptide of the present invention comprises:

determining the inhibition of binding of a ligand to cells which have a polypeptide of the invention on the surface thereof, or to cell membranes containing such a polypeptide, in the presence of a candidate compound under conditions to permit binding to the polypeptide, and determining the ainount of ligand bound to the 10 polypeptide. A compound capable of causing reduction of binding of a ligand is considered to be an agonist or antagonist. Preferably the ligand is labelled.

More particularly, a method of screening for a polypeptide antagonist or agonist compound comprises the steps of (a) incubating a labelled ligand with a whole cell expressing a polypeptide according 15 to the invention on the cell surface, or a cell membrane containing a polypeptide of the invention, (b) measuring the amount of labelled ligand bound to the whole cell or the cell membrane;

(c) adding a candidate compound to a mixture of labelled ligand and the whole cell or 20 the cell membrane of step (a) and allowing the mixture to attain equilibrium;

(d) measuring the amount of labelled ligand bound to the whole cell or the cell membrane after step (c); and (e) comparing the difference in the labelled ligand bound in step (b) and (d), such that the compound which causes the reduction in binding in step (d) is considered to be an 25 agonist or antagonist.

The polypeptides may be found to modulate a variety of physiological and pathological processes in a dose-dependent manner in the above-described assays.
Thus, the "functional equivalents" of the polypeptides of the invention include polypeptides that exhibit any of the same modulatory activities in the above-described 30 assays in a dose-dependent manner. Although the degree of dose-dependent activity need not be identical to that of the polypeptides of the invention, preferably the "functional equivalents" will exhibit substantially similar dose-dependence in a given activity assay compared to the polypeptides of the invention.

In certain of the embodiments described above, simple binding assays may be used, in which the adherence of a test compound to a surface bearing the polypeptide is detected by means of a label directly or indirectly associated with the test compound or in an assay involving competition with a labelled competitor. In another embodiment, competitive drug screening assays may be used, in which neutralising antibodies that are capable of binding the polypeptide specifically compete with a test compound for binding. In this manner, the antibodies can be used to detect the presence of any test compound that possesses specific binding affinity for the polypeptide.

Persons skilled in the art will be able to devise assays for identifying modulators of a polypeptide of the invention. Of interest in this regard is Lokker NA et aL, J. Biol.
Chem., 1997, Dec 26;272(52):33037-44, which reports an example of an assay to identify antagonists (in this case neutralizing antibodies).

Assays may also be designed to detect the effect of added test compounds on the production of mRNA encoding the polypeptide in cells. For example, an ELISA
may be constructed that measures secreted or cell-associated levels of polypeptide using monoclonal or polyclonal antibodies by standard methods known in the art, and this can be used to search for compounds that may inhibit or enhance the production of the polypeptide from suitably manipulated cells or tissues. The formation of binding complexes between the polypeptide and the compound being tested may then be measured.

Another technique for drug screening which may be used provides for high throughput screening of compounds having suitable binding affinity to the polypeptide of interest (see International patent application W084/03564). In this method, large numbers of different small test compounds are synthesised on a solid substrate, which may then be reacted with the polypeptide of the invention and washed. One way of immobilising the polypeptide is to use non-neutralising antibodies. Bound polypeptide may then be detected using methods that are well known in the art. Purified polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques.

Assay methods that are also included within the terms of the present invention are those that involve the use of the genes and polypeptides of the invention in overexpression or ablation assays. Such assays involve the manipulation of levels of these genes/polypeptides in cells and assessment of the impact of this manipulation event on the physiology of the manipulated cells. For example, such experiments reveal details of signalling and metabolic pathways in which the particular genes/polypeptides are implicated, generate information regarding the identities of polypeptides with which the studied polypeptides interact and provide clues as to methods by which related genes and proteins are regulated.

Another technique for drug screening which may be used provides for high throughput screening of compounds having suitable binding affinity to the polypeptide of interest (see International patent application W084/03564). In this method, large numbers of different small test compounds are synthesised on a solid substrate, which may then be reacted with the polypeptide of the invention and washed. One way of immobilising the polypeptide is to use non-neutralising antibodies. Bound polypeptide may then be detected using methods that are well known in the art. Purified polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques.

The polypeptide of the invention may be used to identify membrane-bound or soluble receptors, through standard receptor binding techniques that are known in the art, such as ligand binding and crosslinking assays in which the polypeptide is labelled with a radioactive isotope, is chemically modified, or is fused to a peptide sequence that facilitates its detection or purification, and incubated with a source of the putative receptor (for example, a composition of cells, cell membranes, cell supernatants, tissue extracts, or bodily fluids). The efficacy of binding may be measured using biophysical techniques such as surface plasmon resonance (supplied by Biacore AB, Uppsala, Sweden) and spectroscopy. Binding assays may be used for the purification and cloning of the receptor, but may also identify agonists and antagonists of the polypeptide, that compete with the binding of the polypeptide to its receptor.
Standard methods for conducting screening assays are well understood in the art.

In anotlier embodiment, this inventionrelates to the use of a INSP168, INSP168-SV1, INSP149 or INSP169 polypeptide or fragment thereof, whereby the fragment is preferably a INSP168, INSP168-SV1, INSP149 or INSP169 gene-specific fragment, for isolating or generating an agonist or stimulator of the INSP168, 1NSP168-SV1, INSP 149 or INSP 169 polypeptide for the treatment of a disorder, wherein said agonist or stimulator is selected from the group consisting of:

1. a specific antibody or fragment thereof including: a) a chimeric, b) a humanized or c) a fully human antibody, as well as;

2. a bispecific or multispecific antibody, 3. a single chain (e.g. scFv) or 4. single domain antibody, or 5. a peptide- or non-peptide mimetic derived from said antibodies or 6. an antibody-mimetic such as a) an anticalin or b) a fibronectin-based binding molecule (e.g. trinectin or adnectin).

The generation of peptide- or non-peptide mimetics from antibodies is known in the art (Saragovi et al., 1991 and Saragovi et al., 1992).

Anticalins are also known in the art (Vogt et al., 2004). Fibronectin-based binding molecules are described in US6818418 and W02004029224.

Furthermore, the test compound may be of various origin, nature and composition, such as any small molecule, ilucleic acid, lipid, peptide, polypeptide including an antibody such as a chimeric, humanized or fully human antibody or an antibody fragment, peptide- or non-peptide mimetic derived therefrom as well as a bispecific or multispecific antibody, a single chain (e.g. scFv) or single domain antibody or an antibody-mimetic such as an anticalin or fibronectin-based binding molecule (e.g.
trinectin or adnectin), etc., in isolated form or in mixture or combinations.

The invention also includes a screening kit useful in the methods for identifying agonists, antagonists, ligands, receptors, substrates, enzymes, that are described above.

The invention includes the agonists, antagonists, ligands, receptors, substrates and enzymes, and other compounds which modulate the activity or antigenicity of the polypeptide of the invention discovered by the methods that are described above.

As mentioned above, it is envisaged that the various moieties of the invention (i.e. the polypeptides of the first aspect of the invention, a nucleic acid molecule of the second or third aspect of the invention, a vector of the fourth aspect of the invention, a host cell of the fifth aspect of the invention, a ligand of the sixth aspect of the invention, a compound of the seventh aspect of the invention) may be useful in the therapy or diagnosis of diseases. To assess the utility of the moieties of the invention for treating or diagnosing a disease one or more of the following assays may be carried out. Note that although some of the following assays refer to the test compound as being a protein/polypeptide, a person skilled in the art will readily be able to adapt the following assays so that the other moieties of the invention may also be used as the "test compound".

The invention also provides pharmaceutical compositions comprising a polypeptide, nucleic acid, ligand or compound of the invention in combination with a suitable pharmaceutical carrier. These compositions may be suitable as therapeutic or diagnostic reagents, as vaccines, or as other immunogenic compositions, as outlined in detail below.

According to the terminology used herein, a composition containing a polypeptide, nucleic acid, ligand or compound [X] is "substantially free of' impurities [herein, Y]
when at least 85% by weight of the total X+Y in the composition is X.
Preferably, X
comprises at least about 90% by weight of the total of X+Y in the composition, more preferably at least about 95%, 98% or even 99% by weight.

The pharmaceutical compositions should preferably comprise a therapeutically effective amount of the polypeptide, nucleic acid molecule, ligand, or compound of the invention. The term "therapeutically effective amount" as used herein refers to an amount of a therapeutic agent needed to treat, ameliorate, or prevent a targeted disease or condition, or to exhibit a detectable therapeutic or preventative effect. For any coinpound, the therapeutically effective dose can be estimated initially either in cell culture assays, for example, of neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs. The animal model may also be used to determine the appropriate concentration range and route of adininistration. Such information can then be used to determine useful doses and routes for administration in humans.

The precise effective amount for a human subject will depend upon the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. This amount can be determined by routine experimentation and is within the judgement of the clinician. Generally, an effective dose will be from 0.01 mg/kg to 50 mg/kg, preferably 0.05 mg/kg to 10 mg/kg.
Compositions may be administered individually to a patient or may be administered in 5 combination with other agents, drugs or hormones.

A pharmaceutical coinposition may also contain a pharmaceutically acceptable carrier, for administration of a therapeutic agent. Such carriers include antibodies and other polypeptides, genes and other therapeutic agents such as liposomes, provided that the carrier does not itself induce the production of antibodies harmful to the 10 individual receiving the composition, and which may be administered without undue toxicity. Suitable carriers may be large, slowly metabolised macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, ainino acid copolymers and inactive virus particles.

Pharmaceutically acceptable salts can be used therein, for example, mineral acid salts 15 such as hydrochlorides, hydrobromides, phosphates, sulphates, and the like;
and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
A thorough discussion of pharmaceutically acceptable carriers is available in Remington's Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991).

Pharmaceutically acceptable carriers in therapeutic compositions may additionally 20 contain liquids such as water, saline, glycerol and ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such compositions. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.

25 Once formulated, the compositions of the invention can be administered directly to the subject. The subjects to be treated can be animals; in particular, human subjects can be treated.

The pharmaceutical compositions utilised in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, 30 intra-arterial, intramedullary, intrathecal, intraventricular, transdermal or transcutaneous applications (for example, see W098/20734), subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, intravaginal or rectal means.

Gene guns or hyposprays may also be used to administer the pharmaceutical compositions of the invention. Typically, the therapeutic compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared.

Direct delivery of the compositions will generally be accomplished by injection, subcutaneously, intraperitoneally, intravenously or intramuscularly, or delivered to the interstitial space of a tissue. The compositions can also be administered into a lesion. Dosage treatinent may be a single dose schedule or a multiple dose schedule.

If the activity of the polypeptide of the invention is in excess in a particular disease state, several approaches are available. One approach comprises administering to a subject an inhibitor compound (antagonist) as described above, along with a pharmaceutically acceptable carrier in an amount effective to inhibit the function of the polypeptide, such as by blocking the binding of ligands, substrates, enzymes, receptors, or by inhibiting a second signal, and thereby alleviating the abnormal condition. Preferably, such antagonists are antibodies. Most preferably, such antibodies are chimeric and/or humanised to minimise their immunogenicity, as described previously.

In another approach, soluble forms of the polypeptide that retain binding affinity for the ligand, substrate, enzyme, receptor, in question, may be administered.
Typically, the polypeptide may be administered in the form of fragments that retain the relevant portions.

In an alternative approach, expression of the gene encoding the polypeptide can be inhibited using expression blocking techniques, such as the use of antisense nucleic acid molecules (as described above), either internally generated or separately administered. Modifications of gene expression can be obtained by designing complementary sequences or antisense molecules (DNA, RNA, or PNA) to the control, 5' or regulatory regions (signal sequence, promoters, enhancers and introns) of the gene encoding the polypeptide. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules. Recent therapeutic advances using triplex DNA have been described in the literature (Gee, J.E. et al.
(1994) In: Huber, B.E. and B.I. Carr, Molecular and Immunologic Approaches, Futura Publishing Co., Mt. Kisco, NY). The complementary sequence or antisense molecule may also be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. Such oligonucleotides may be administered or may be generated in situ from expression in vivo.

In addition, expression of the polypeptide of the invention may be prevented by using ribozymes specific to its encoding mRNA sequence. Ribozymes are catalytically active RNAs that can be natural or synthetic (see for example Usman, N, et al., Curr.
Opin. Struct. Biol (1996) 6(4), 527-33). Synthetic ribozymes can be designed to specifically cleave mRNAs at selected positions thereby preventing translation of the mRNAs into functional polypeptide. Ribozymes may be synthesised with a natural ribose phosphate backbone and natural bases, as normally found in RNA
molecules.
Alternatively the ribozymes may be synthesised with non-natural backbones, for exainple, 2'-O-methyl RNA, to provide protection from ribonuclease degradation and may contain modified bases.

RNA molecules may be modified to increase intracellular stability and half-life.
Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' 0-methyl rather than phospliodiesterase linkages within the backbone of the molecule. This concept is inherent in the production of PNAs and can be extended in all of these molecules by the inclusion of non-traditional bases such as inosine, queosine and butosine, as well as acetyl-, methyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine and uridine which are not as easily recognised by endogenous endonucleases.

For treating abnormal conditions related to an under-expression of the polypeptide of the invention and its activity, several approaches are also available. One approach comprises administering to a subject a therapeutically effective amount of a compound that activates the polypeptide, i.e., an agonist as described above, to alleviate the abnormal condition. Alternatively, a therapeutic amount of the polypeptide in combination with a suitable pharmaceutical _carrier may be administered to restore the relevant physiological balance of polypeptide.

Gene therapy may be employed to effect the endogenous production of the polypeptide by the relevant cells in the subject. Gene therapy is used to treat permanently the inappropriate production of the polypeptide by replacing a defective gene with a corrected therapeutic gene.

Gene therapy of the present invention can occur in vivo or ex vivo. Ex vivo gene therapy requires the isolation and purification of patient cells, the introduction of a therapeutic gene and introduction of the genetically altered cells back into the patient.
In contrast, in vivo gene therapy does not require isolation and purification of a patient's cells.

The tllerapeutic gene is typically "packaged" for administration to a patient.
Gene delivery vehicles may be non-viral, such as liposomes, or replication-deficient viruses, such as adenovirus as described by Berkner, K.L., in Curr. Top.
Microbiol.
Immunol., 158, 39-66 (1992) or adeno-associated virus (AAV) vectors as described by Muzyczka, N., in Curr. Top. Microbiol. Imtnunol., 158, 97-129 (1992) and U.S.
Patent No. 5,252,479. For example, a nucleic acid molecule encoding a polypeptide of the invention may be engineered for expression in a replication-defective retroviral vector. This expression construct may then be isolated and introduced into a packaging cell transduced with a retroviral plasmid vector containing RNA
encoding the polypeptide, such that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo (see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics (1996), T Strachan and A
P
Read, BIOS Scientific Publishers Ltd).

Another approach is the administration of "naked DNA" in which the therapeutic gene is directly injected into the bloodstream or muscle tissue.

In situatioiis in which the polypeptides or nucleic acid molecules of the invention are disease-causing agents, the invention provides that they can be used in vaccines to raise antibodies against the disease causing agent.

Vaccines according to the invention may either be prophylactic (ie. to prevent infection) or therapeutic (ie. to treat disease after infection). Such vaccines comprise immunising antigen(s), immunogen(s), polypeptide(s), protein(s) or nucleic acid, usually in combination with pharmaceutically-acceptable carriers as described above, which include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Additionally, these carriers may function as immunostimulating agents ("adjuvants"). Furthermore, the antigen or iinmunogen may be conjugated to a bacterial toxoid, such as a toxoid from diphtheria, tetanus, cholera, H. pylori, and other pathogens.

Since polypeptides may be broken down in the stomach, vaccines comprising polypeptides are preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection). Formulations suitable for parenteral adininistration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the fonnulation isotonic with the blood of the recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents.

The vaccine formulations of the invention may be presented in unit-dose or multi-dose containers. For example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.

Genetic delivery of antibodies that bind to polypeptides according to the invention may also be effected, for example, as described in International patent application W098/55607.

The technology referred to as jet injection (see, for example, www.powderject.com) may also be useful in the formulation of vaccine compositions.

A number of suitable methods for vaccination and vaccine delivery systems are described in International patent application W000/29428.

This invention also relates to the use of nucleic acid molecules according to the present invention as diagnostic reagents. Detection of a mutated form of the gene characterised by the nucleic acid molecules of the invention which is associated with a dysfunction will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, or susceptibility to adisease, which results from under-expression, over-expression or altered spatial or temporal expression of the gene. Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques.

Nucleic acid molecules for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA
may be used directly for detection or may be amplified enzymatically by using PCR, ligase chain reaction (LCR), strand displacement amplification (SDA), or other 5 amplification techniques (see Saiki et al., Nature, 324, 163-166 (1986);
Bej, et al., Crit. Rev. Biochem. Molec. Biol., 26, 301-334 (1991); Birkenmeyer et al., J.
Virol.
Meth., 35, 117-126 (1991); Van Brunt, J., Bio/Technology, 8, 291-294 (1990)) prior to analysis.

In one embodiment, this aspect of the invention provides a method of diagnosing a 10 disease in a patient, comprising assessing the level of expression of a natural gene encoding a polypeptide according to the invention and comparing said level of expression to a control level, wherein a level that is different to said control level is indicative of disease. The method may comprise the steps of:

a) contacting a sample of tissue from the patient with a nucleic acid probe under 15 stringent conditions that allow the formation of a hybrid complex between a nucleic acid molecule of the invention and the probe;

b) contacting a control sample with said probe under the same conditions used in step a);

c) and detecting the presence of hybrid complexes in said samples;

20 wherein detection of levels of the hybrid complex in the patient sample that differ from levels of the hybrid complex in the control sample is indicative of disease.

A further aspect of the invention comprises a diagnostic method comprising the steps of:

a) obtaining a tissue sainple from a patient being tested for disease;

25 b) isolating a nucleic acid molecule according to the invention from said tissue sample; and c) diagnosing the patient for disease by detecting the presence of a mutation in the nucleic acid molecule which is associated with disease.

To aid the detection of nucleic acid molecules in the- above-described methods, an 30 amplification step, for example using PCR, may be included.

Deletions and insertions can be detected by a change in the size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labelled RNA of the invention or alternatively, labelled antisense DNA sequences of the invention. Perfectly-matched sequences can be distinguished from mismatched duplexes by RNase digestion or by assessing differences in melting temperatures. The presence or absence of the mutation in the patient may be detected by contacting DNA with a nucleic acid probe that hybridises to the DNA under stringent conditions to fonn a hybrid double-stranded molecule, the hybrid double-stranded molecule having an unhybridised portion of the nucleic acid probe strand at any portion corresponding to a mutation associated with disease; and detecting the presence or absence of an unhybridised portion of the probe strand as an indication of the presence or absence of a disease-associated mutation in the corresponding portion of the DNA strand.

Such diagnostics are particularly useful for prenatal and even neonatal testing.

Point mutations and other sequence differences between the reference gene and "mutant" genes can be identified by other well-known techniques, such as direct DNA
sequencing or single-strand conformational polymorphism, (see Orita et al., Genomics, 5, 874-879 (1989)). For example, a sequencing primer may be used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabelled nucleotides or by automatic sequencing procedures with fluorescent-tags. Cloned DNA segments may also be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. Further, point inutations and other sequence variations, such as polymorphisms, can be detected as described above, for example, through the use of allele-specific oligonucleotides for PCR amplification of sequences that differ by single nucleotides.

DNA sequence differences may also be detected by alterations in the electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (for example, Myers et al., Science (1985) 230:1242). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (see Cotton et al., Proc.
Natl. Acad. Sci. USA (1985) 85: 4397-4401).

In addition to conventional gel electrophoresis and DNA sequencing, mutations such as microdeletions, aneuploidies, translocations, inversions, can also be detected by in situ analysis (see, for example, Keller et al., DNA Probes, 2nd Ed., Stockton Press, New York, N.Y., USA (1993)), that is, DNA or RNA sequences in cells can be analysed for mutations without need for their isolation and/or immobilisation onto a membrane. Fluorescence in situ hybridization (FISH) is presently the most coinmonly applied method and numerous reviews of FISH have appeared (see, for example, Trachuck et al., Science, 250, 559-562 (1990), and Trask et al., Trends, Genet., 7, 149-154 (1991)).

In another embodiment of the invention, an array of oligonucleotide probes comprising a nucleic acid molecule according to the invention can be constructed to conduct efficient screening of genetic variants, mutations and polymorphisms.
Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability (see for example: M.Chee et al., Science (1996), Vo1274, pp 610-613).

In one embodiment, the array is prepared and used according to the methods described in PCT application W095/11995 (Chee et al); Lockhart, D. J. et al.
(1996) Nat. Biotech. 14: 1675-1680); and Schena, M. et al. (1996) Proc. Natl. Acad.
Sci. 93:
10614-10619). Oligonucleotide pairs may range from two to over one million.
The oligomers are synthesized at designated areas on a substrate using a light-directed chemical process. The substrate may be paper, nylon or other type of membrane, filter, chip, glass slide or any other suitable solid support. In another aspect, an oligonucleotide may be synthesized on the surface of the substrate by using a cheinical coupling procedure and an ink jet application apparatus, as described in PCT
application W095/25116 (Baldeschweiler et al). In another aspect, a "gridded"
array analogous to a dot (or slot) blot may be used to arrange and link cDNA
fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array, such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536 or 6144 oligonucleotides, or any other number between two and over one million which lends itself to the efficient use of commercially-available instrumentation.

In addition to the methods discussed above, diseases may be diagnosed by methods comprising determining, from a sample derived from a subject, an abnormally decreased or increased level of polypeptide or mRNA. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, nucleic acid amplification, for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods.

Assay techniques that can be used to determine levels of a polypeptide of the present invention in a sample derived from a host are well-known to those of skill in the art and are discussed in some detail above (including radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays). This aspect of the invention provides a diagnostic method which comprises the steps of: (a) contacting a ligand as described above with a biological sample under conditions suitable for the formation of a ligand-polypeptide coinplex; and (b) detecting said complex.

Protocols such as ELISA, RIA, and FACS for measuring polypeptide levels may additionally provide a basis for diagnosing altered or abnormal levels of polypeptide expression. Normal or standard values for polypeptide expression are established by coinbining body fluids or cell extracts taken from normal mammalian subjects, preferably humans, with antibody to the polypeptide under conditions suitable for complex formation The amount of standard complex formation may be quantified by various methods, such as by photometric means.

Antibodies which specifically bind to a polypeptide of the invention may be used for the diagnosis of conditions or diseases characterised by expression of the polypeptide, or in assays to monitor patients being treated with the polypeptides, nucleic acid molecules, ligands and other compounds of the invention. Antibodies useful for diagnostic purposes may be prepared in the same maimer as those described above for therapeutics. Diagnostic assays for the polypeptide include methods that utilise the antibody and a label to detect the polypeptide in human body fluids or extracts of cells or tissues. The antibodies may be used with or without modification, and may be labelled by joining them, either covalently or non-covalently, with a reporter molecule. A wide variety of reporter molecules known in the art may be used, several of which are described above.

Quantities of polypeptide expressed in subject, control and disease samples from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
Diagnostic assays may be used to distinguish between absence, presence, and excess expression of polypeptide and to monitor regulation of polypeptide levels during therapeutic intervention. Such assays may also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials or in monitoring the treatment of an individual patient.

A diagnostic kit of the present invention may comprise:
(a) a nucleic acid molecule of the present invention;

(b) a polypeptide of the present invention; or (c) a ligand of the present invention.

In one aspect of the invention, a diagnostic kit may comprise a first container containing a nucleic acid probe that hybridises under stringent conditions with a nucleic acid molecule according to the invention; a second container containing primers useful for amplifying the nucleic acid molecule; and instructions for using the probe and primers for facilitating the diagnosis of disease. The kit may further comprise a third container holding an agent for digesting unhybridised RNA.

In an alternative aspect of the invention, a diagnostic kit may comprise an array of nucleic acid molecules, at least one of which may be a nucleic acid molecule according to the invention.

To detect polypeptide according to the invention, a diagnostic kit may comprise one or more antibodies that bind to a polypeptide according to the invention; and a reagent useful for the detection of a binding reaction between the antibody and the polypeptide.

Such kits will be of use in diagnosing a disease or susceptibility to disease, particularly diseases in which leucine-rich repeat motif containing proteins are implicated. Such diseases include, but are not limited to, diseases of the retina, retinal pigment epithelium (RPE), and choroids; ocular neovascularization, ocular inflammation and retinal degenerations; diabetic retinopathy, chronic glaucoma, retinal detachment, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization; rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy 5 and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis pigmentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, retinal artery occlusion, neovascularization due to penetration of the eye or ocular injury, neuropathies; Leber's, idiopathic, drug-10 induced, optic, and ischemic neropathies; spinal cord injuries, paraplegia, neurodegenerative disorders, disorders of the central nervous system, disorders of the peripheral nervous system, brain injuries, cerebrovascular diseases, Parkinson's disease, corticobasal degeneration, motor neuron disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-15 traumatic brain injury, small-vessel cerebrovascular disease, dementias, Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia, Parkinsonism, frontotemporal dementias, Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob deinentia, HIV dementia, schizophrenia with dementia, Korsakoffs psychosis, 20 stroke and trauma.

Various aspects and embodiments of the present invention will now be described in more detail by way of example, with particular reference to INSP168, INSP168-SV1, INSP 149 and INSP 169.

It will be appreciated that modification of detail may be made without departing from 25 the scope of the invention.

Brief description of the Figures Figure 1: Amino acid aligmnent of INSP168, INSP168-SV1, INSP149 and INSP169 ORFs. The predicted transmembrane region is in bold. The predicted internal LRR
region is boxed.

30 Fi ug re 2: Nucleotide sequence with translation of the PCR product INSP168 cloned using primers INSP168-CP1 and INSP168-CP2. The predicted signal peptide is in bold. The predicted internal LRR region is boxed. The position and sense of the SUBSTITUTE SHEET (RULE 26) primers are indicated by arrows.

Figure 3: Nucleotide sequence with translation of the PCR product INSP 168-SV

cloned using primers fNSP168-CP1 and INSP168-CP2. The predicted signal peptide is in bold. The predicted internal LRR region is boxed. The position and sense of the primers are indicated by arrows.

Figure 4: Genomic organisation of the PCR product INSP168-SV1.

Figure 5: Amino acid alignment between INSP168, INSP168-SV1, INSP149 and INSP 169 and Retinal Specific Protein PAL (SwissProt Acc. Code PALP HUMAN).
Fi ug re 6: Schematic domain representation of INSP168, INSP168-SV1, INSP149, INSP 169, Retinal Specific Protein PAL (SwissProt Acc. Code PALP HUMAN) and nogo receptor homolog (SwissProt Acc. Code Q6X814).

Fi ug re 7: Effect of INSP168 on Stat-2 nuclear translocation in U373 in two distinct experiments. The two left hand columns illustrate the effect of addition of medium only, the two middle columns illustrate the effect of addition of the positive control IFN-beta, and the two right hand columns illustrate the effect of addition of to the medium.

Fi , ru cDNA coding sequence and deduced peptide sequence of the cloned INSP 169 extracellular domain. The position and orientation of primers used for cloning and sequencing are indicated by arrows. The sequence in bold corresponds to the centrally located BamHI site used in the assembly of the full length clone.

Fi ug re 9: Nucleotide sequence of the cloned INSP169 extracellular domain.

Figure 10: Peptide sequence of the cloned cDNA from the N teriuinus to the TM
domain. Signal sequence is in italic; the leucine rich repeat region is in bold; the immunoglubulin C-2 domain is underlined; the fibronectin type3 domain is in bold Z5 italic.

SUBSTITUTE SHEET (RULE 26) Amino Acid Synonymous Groups More Preferred Synonymous Groups Ser Gly, Ala, Ser, Thr, Pro Thr, Ser Arg Asn, Lys, Gln, Arg, His Arg, Lys, His Leu Phe, Ile, Val, Leu, Met Ile, Val, Leu, Met Pro Gly, Ala, Ser, Thr, Pro Pro Thr Gly, Ala, Ser, Thr, Pro Thr, Ser Ala Gly, Thr, Pro, Ala, Ser Gly, Ala Val Met, Phe, Ile, Leu, Val Met, Ile, Val, Leu Gly Ala, Thr, Pro, Ser, Gly Gly, Ala Ile Phe, Ile, Val, Leu, Met Ile, Val, Leu, Met Phe Trp, Phe,Tyr Tyr, Phe Tyr Trp, Phe,Tyr Phe, Tyr Cys Ser, Thr, Cys Cys His Asn, Lys, Gln, Arg, His Arg, Lys, His Gln Glu, Asn, Asp, Gln Asn, Gln Asn Glu, Asn, Asp, Gln Asn, Gln Lys Asn, Lys, Gln, Arg, His, Arg, Lys, His Asp Glu, Asn, Asp, Gln Asp, Glu Glu Glu, Asn, Asp, Gln Asp, Glu Met Phe, Ile, Val, Leu, Met Ile, Val, Leu, Met Trp Trp, Phe,Tyr Trp Amino Acid Synonymous Groups Ser D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met, Met(O), D-Met(O), L-Cys, D-Cys Arg D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg, Met, Ile, D-.Met, D-Ile, Orn, D-Orn Leu D-Leu, Val, D-Val, AdaA, AdaG, Leu, D-Leu, Met, D-Met Pro D-Pro, L-I-thioazolidine-4-carboxylic acid, D-or L-1-oxazolidine-4-carboxylic acid Thr D-Thr, Ser, D-Ser, allo-Thr, Met,D-Met, Met(O), D-Met(O), Val, D-Val Ala D-Ala, Gly, Aib, B-Ala, Acp, L-Cys, D-Cys Val D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met, AdaA, AdaG
Gly Ala, D-Ala, Pro, D-Pro, Aib, .beta.-Ala, Acp Ile D-Ile, Val, D-Val, AdaA, AdaG, Leu, D-Leu, Met, D-Met Phe D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, D-Trp, Trans-3,4, or 5-phenylproline, AdaA, AdaG, cis-3,4, or 5-phenylproline, Bpa, D-Bpa Tyr D-Tyr, Phe, D-Phe, L-Dopa, His, D-His Cys D-Cys, S--Me--Cys, Met, D-Met, Thr, D-Thr Gln D-Gln, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp Asn D-Asn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln Lys D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg, Met, D-Met, Ile, D-Ile, Orn, D-Orn Asp D-Asp, D-Asn, Asn, Glu, D-Glu, Gln, D-Gln Glu D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln Met D-Met, S--Me--Cys, Ile, D-Ile, Leu, D-Leu, Val, D-Val Examples Example 1: Cloning of INSP 168 and INSP 168-SV 1 Preparation of human cDNA templates First strand cDNA was prepared from a variety of normal human tissue total RNA
sainples (Clontech, Stratagene, Ambion, Biochain Institute and in-house preparations) using Superscript II RNase H- Reverse Transcriptase (Invitrogen) according to the manufacturer's protocol. Oligo (dT)15 primer (1 l at 500 g/ml) (Promega), 2 g human total RNA, 1 l 10 mM dNTP mix (10 mM each of dATP, dGTP, dCTP and dTTP at neutral pH) and sterile distilled water to a final volume of 12 l were combined in a 1.5 ml Eppendorf tube, heated to 65 C for 5 min and then chilled on ice. The contents were collected by brief centrifugation and 4 l of 5X First-Strand Buffer, 2 l 0.1 M DTT, and 1 l RnaseOUT Recombinant Ribonuclease Inhibitor (40 units/ l, Invitrogen) were added. The contents of the tube were mixed gently and incubated at 42 C for 2 min; then 1 1 (200 units) of SuperScript II enzyme was added and mixed gently by pipetting. The mixture was incubated at 42 C for 50 min and then inactivated by heating at 70 C for 15 min. To remove RNA
complementary to the cDNA, 1 l (2 units) of E. coli RNase H (Invitrogen) was added and the reaction mixture incubated at 37 C for 20 min. The final 21 l reaction mix was diluted by adding 179 l sterile water to give a total volume of 200 l. The cDNA
templates used for the amplification of INSP 168 were derived from brain and eye RNA.

cDNA libraries Human cDNA libraries (in bacteriophage lambda (k) vectors) were purchased from Stratagene or Clontech or prepared at the Serono Pharmaceutical Research Institute in k ZAP or k GT10 vectors according to the manufacturer's protocol (Stratagene).
Bacteriophage k DNA was prepared from small scale cultures of infected E. coli host strain using the Wizard Lambda Preps DNA purification system according to the manufacturer's instructions (Promega, Corporation, Madison WI.). cDNA library templates used for the amplification of INSP168 were derived from brain, fetal brain, retina, and a mixed brain-lung-testis library.

Gene specific cloning primers for PCR

A pair of PCR primers having a length of between 18 and 25 bases was designed for amplifying the predicted coding sequence of the virtual cDNA using Primer Designer Software (Scientific & Educational Software, PO Box 72045, Durham, NC 27722-2045, USA). PCR primers were optimized to have a Tm close to 55 + 10 C and a GC
content of 40-60%. Primers were selected which had high selectivity for the target sequence (INSP 168) with little or no none specific priming.

5 PCR amplification of INSP168 f~~om human cDNA templates Gene-specific cloning primers (INSP168-CP1 and INSP168-CP2, Figure 2, Figure 3 and Table 3) were designed to amplify a cDNA fragment of 614 bp covering the entire of the predicted INSP 168 cds. The primer pair was used with the human cDNA
samples and cDNA libraries listed above as PCR templates. PCR was performed in a 10 final volume of 50 l containing 1X Platinum Taq High Fidelity (HiFi) buffer, 2 mM MgSO4, 200 M dNTPs, 0.2 M of each cloning primer, 1 unit of Platinum Taq DNA Polymerase High Fidelity (HiFi) (Invitrogen), and approximately 20 ng of template cDNA. Cycling was performed using an MJ Research DNA Engine, programmed as follows: 94 C, 2 inin; 40 cycles of 94 C, 30 sec, 55 C, 30 sec, and 15 68 C, 1 min; followed by 1 cycle at 68 C for 7 min and a holding cycle at 4 C.

30 l of each ainplification product was visualized on a 0.8 % agarose gel in buffer (Invitrogen). Products of approximately the expected molecular weight were seen in the PCR products amplified from brain and eye cDNA templates. These products was purified from the gel using the Promega Wizard PCR Preps DNA
20 Purification System, eluted in 50 l of water and subcloned directly.

Subcloning of PCR Products The PCR products were subcloned into the topoisomerase I modified cloning vector (pCR4-TOPO) using the TA cloning kit purchased from the Invitrogen Corporation using the conditions specified by the manufacturer. Briefly, 4 l of gel purified PCR
25 product was incubated for 15 min at room temperature with 1 l of TOPO
vector and 1 l salt solution. The reaction mixture was then transformed into E. coli strain TOP10 (Invitrogen) as follows: a 50 l aliquot of One Shot TOP10 cells was thawed on ice and 2 l of TOPO reaction was added. The mixture was incubated for 15 min on ice and then heat shocked by incubation at 42 C for exactly 30 s. Samples were 30 returned to ice and 250 l of warm (room temperature) SOC media was added.
Samples were incubated with shaking (220 rpm) for 1 h at 37 C. The transformation mixture was then plated on L-broth (LB) plates containing ampicillin (100 g/ml) and incubated overnight at 37 C.

Colony PCR

Colonies were inoculated into 50 l sterile water using a sterile toothpick. A
10 l aliquot of the inoculum was then subjected to PCR in a total reaction volume of 20 l containing 1X AmpliTaqTM buffer, 200 M dNTPs, 20 pmoles of T7 primer, 20 pmoles of T3 primer, 1 unit of AmpliTaqTM (Applied Biosystems) using an MJ
Research DNA Engine. The cycling conditions were as follows: 94 C, 2 min; 30 cycles of 94 C, 30 sec, 48 C, 30 sec and 72 C for 1 min. Samples were maintained at 4 C (holding cycle) before further analysis.

PCR reaction products were analyzed on 1 % agarose gels in 1 X TAE buffer.
Colonies which gave PCR products of approximately the expected molecular weight (614 bp or 267 bp + 105 bp due to the multiple cloning site (MCS)) were grown up overnight at 37 C in 5 ml L-Broth (LB) containing ampicillin (100 g /ml), with shaking at 220 rpm.

Plasmid DNA preparation and sequencing Miniprep plasmid DNA was prepared from the 5 ml culture using a Biorobot 8000 robotic system (Qiagen) or Wizard Plus SV Minipreps kit (Promega cat. no.
1460) according to the manufacturer's instructions. Plasmid DNA was eluted in 80 l of sterile water. The DNA concentration was measured using a Spectramax 190 photometer (Molecular Devices). Plasmid DNA (200-500 ng) was subjected to DNA
sequencing with the T7 and T3 primers using the BigDye Terminator system (Applied Biosystems cat. no. 4390246) according to the manufacturer's instructions. The primer sequences are shown in Table 3. Sequencing reactions were purified using Dye-Ex columns (Qiagen) or Montage SEQ 96 cleanup plates (Millipore cat. no.
LSKS09624) then analyzed on an Applied Biosystems 3700 sequencer.

Sequence analysis identified a clone, amplified from brain cDNA, which matched the expected INSP168 sequence. The plasmid map of the cloned PCR product is pCR4-TOPO-INSP168. The nucleotide sequence with translation of the PCR product INSP168 is shown in Figure 2.

'30 A second clone was identified, also amplified from brain, which contained the INSP168 cds with a 77 bp insertion towards the 3' end of the sequence. This led to an insertion of 32 amino acids and a frameshift such that an ORF of 229 amino acids was produced. The insertion represented an additional exon, giving an ORF encoded in 4 exons. A stop codon was not identified but one present 2 bp downstream of the 3' end of the new sequence in genomic DNA was assumed to be functional. The nucleotide sequence with translation of the PCR product INSP168-SV1 is shown in Figure 3.
This clone was named pCR4-TOPO-INSP168-SV1. The genomic organisation of the INSP168-SV1 cds is shown in Figure 4. The plasmid map of the cloned PCR
product is pCR4-TOPO-INSP 168-SV 1. The position of the INSP 168-CP 1 amplification primer meant that the final base of the cds was missing - this base was added during transfer into the Gateway entry vector pDONR 221 (see below).

Table 3: INSP168 cloning and sequencing primers Primer Sequence (5'-3') INSP168-CPl GAG CAA TGC ATC TCT TTG CAT GTC

GCP Forward G GGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GCC ACC

GGG GAC CAC TTT GTA CAA GAA AGC TGG GTT TCA ATG GTG ATG
GCP Reverse GTG ATG GTG

pEAK12F GCC AGC TTG GCA CTT GAT GT
pEAK12R GAT GGA GGT GGA CGT GTC AG

Underlined sequence = Kozak sequence Bold = Stop codon Italic sequence = His tag Example 2: Construction of Mammalian Cell Expression Vectors for INSP 168 pCR4-TOPO-INSP168 was used as PCR template to generate pEAK12d and pDEST12.2 expression clones containing the INSP168 ORF sequence with a 3' sequence encoding a 6HIS tag using the Gatewaym cloning methodology (Invitrogen).

Generation of Gateway compatible INSP168 ORF fused to an in fi=afne 6HIS tag sequence The first stage of the Gateway cloning process involves a two step PCR
reaction which generates the ORF of INSP 168 flanked at the 5' end by an attBl recombination site and Kozak sequence, and flanked at the 3' end by a sequence encoding an in frame 6 histidine (6HIS) tag, a stop codon and the attB2 recoinbination site (Gateway compatible cDNA). The first PCR reaction (in a final volume of 50 l) contains respectively: 1 l (40 ng) of plasmid pCR4-TOPO-INSP168, 1.5 gi dNTPs (10 mM), 10 g1 of lOX Pfx polymerase buffer, 1 l MgSO4 (50 mM), 0.5 l each of gene specific primer (100 M) (INSP168-EXI and INSP168-EX2), and 0.5 l Platinum Pfx DNA polymerase (Invitrogen). The PCR reaction was performed using an initial denaturing step of 95 C
for 2 min, followed by 12 cycles of 94 C for 15 s; 55 C for 30 s and 68 C
for 2 min;
and a holding cycle of 4 C. The amplification product was directly purified using the Wizard PCR Preps DNA Purification System (Promega) and recovered in 50 1 sterile water according to the manufacturer's instructions.

The second PCR reaction (in a final volume of 50 gl) contained 10 l purified product, 1.5 gl dNTPs (10 mM), 5 l of lOX Pfx polymerase buffer, 1 g1 MgSO4 (50 mM), 0.5 l of each Gateway conversion primer (100 M) (GCP forward and GCP
reverse) and 0.5 1 of Platinuin Pfx DNA polymerase. The conditions for the 2nd PCR
reaction were: 95 C for 1 min; 4 cycles of 94 C, 15 sec; 50 C, 30 sec and 68 C for 2 min; 25 cycles of 94 C, 15 sec; 55 C , 30 sec and 68 C, 2 min; followed by a holding cycle of 4 C. PCR product was visualized on 0.8 % agarose gel in 1 X TAE
buffer (Invitrogen) and the band migrating at the predicted molecular mass (661 bp) was purified from the gel using the Wizard PCR Preps DNA Purification System (Promega) and recovered in 50 l sterile water according to the manufacturer's instructions.

Subcloning of Gateway compatible INSPI68 ORF into Gateway entry vector pDONR221 and expression vectors pEAK12d and pDEST12. 2 The second stage of the Gateway cloning process involves subcloning of the Gateway modified PCR products into the Gateway entry vector pDONR221 (Invitrogen) as follows: 5 l of purified product from PCR2 were incubated with 1.5 l pDONR221 vector (0.1 g/ l), 2 l BP buffer and 1.5 l of BP clonase enzyme mix (Invitrogen) in a final volume of 10 l at RT for 1 h. The reaction was stopped by addition of proteinase K 1 l (2 g/ l) and incubated at 37 C for a further 10 min. An aliquot of this reaction (1 l) was used to transform E. coli DH10B cells by electroporation as follows: a 25 1 aliquot of DH10B electrocompetent cells (Invitrogen) was thawed on ice and I
g1 of the BP reaction mix was added. The mixture was transferred to a chilled 0.1 cm electroporation cuvette and the cells electroporated using a BioRad Gene-PulserTM
according to the manufacturer's recommended protocol. SOC media (0.5 ml) which had been pre-warmed to room temperature was added immediately after electroporation. The mixture was transferred to a 15 ml snap-cap tube and incubated, with shaking (220 rpm) for 1 h at 37 C. Aliquots of the transformation mixture (10 l and 50 g1) were then plated on L-broth (LB) plates containing kanamycin (40 g/ml) and incubated overnight at 37 C.

Plasmid mini-prep DNA was prepared from 5 ml cultures from 6 of the resultant colonies using a Qiaprep BioRobot 8000 system (Qiagen). Plasmid DNA (150-200 ng) was subjected to DNA sequencing with 21M13 and M13Rev primers using the BigDyeTerminator system (Applied Biosystems cat. no. 4336919) according to the manufacturer's instructions. The primer sequences are shown in Table 3.
Sequencing reactions were purified using Montage SEQ 96 cleanup plates (Millipore cat.
no.
LSKS09624) then analyzed on an Applied Biosystems 3700 sequencer.

Plasmid eluate (2 1 or approx. 150 ng) from one of the clones which contained the correct sequence (pENTR INSP 168-6HIS) was then used in a recombination reaction containing 1.5 1 of either pEAK12d vector or pDESTl2.2 vector (0.1 g / l), 2 l LR
buffer and 1.5 l of LR clonase (Invitrogen) in a final volume of 10 1. The mixture was incubated at RT for 1 h, stopped by addition of proteinase K (2 g) and incubated at 37 C for a further 10 min. An aliquot of this reaction (1 ul) was used to transform E. coli DH10B cells by electroporation as follows: a 25 l aliquot of DH10B
electrocompetent cells (Invitrogen) was thawed on ice and 1 l of the LR reaction mix was added. The mixture was transferred to a chilled 0.1 cm electroporation cuvette and the cells electroporated using a BioRad Gene-PulserTM according to the manufacturer's recommended protocol. SOC media (0.5 ml) which had been pre-warmed to room temperature was added immediately after electroporation. The mixture was transferred to 5 a 15 mi snap-cap tube and incubated, with shaking (220 rpm) for 1 h at 37 C. Aliquots of the transformation mixture (10 l and 50 l) were then plated on L-broth (LB) plates containing ampicillin (100 g/ml) and incubated overnight at 37 C.

Plasmid mini-prep DNA was prepared from 5 ml cultures from 6 of the resultant colonies subcloned in eacll vector using a Qiaprep Bio Robot 8000 (Qiagen).
Plasmid 10 DNA (200-500 ng) in the pEAK12d vector was subjected to DNA sequencing witli pEAK12F and pEAK12R primers as described above. Plasmid DNA (200-500 ng) in the pDEST12.2 vector was subjected to DNA sequencing with 21M13 and M13Rev primers as described above. Primer sequences are shown in Table 3.

CsCl gradient purified maxi-prep DNA was prepared from a 500 ml culture of the 15 sequence verified clone (pEAK12d INSP168-6HIS) using the method described by Sambrook J. et al., 1989 (in Molecular Cloning, a Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press). Plasmid DNA was resuspended at a concentration of 1 g/ l in sterile water (or 10 mM Tris-HCl pH 8.5) and stored at -20 C.

Endotoxin-free maxi-prep DNA was prepared from a 500 ml culture of the sequence 20 verified clone (pDEST12.2 INSP168-6HIS) using the EndoFree Plasmid Mega kit (Qiagen) according to the manufacturer's instructions. Purified plasmid DNA
was resuspended in endotoxin free TE buffer at a final concentration of at least 3 g/ l and stored at -20 C.

Example 3: Tissue Distribution and Expression Levels of INSP168 25 Further experiments may now be performed to determine the tissue distribution and expression levels of the 1NSP168 polypeptide in vivo, on the basis of the nucleotide and amino acid sequence disclosed herein.

The presence of the transcripts for 1NSP168 may be investigated by PCR of cDNA
from different human tissues. The INSP 168 transcripts may be present at very low 30 levels in the samples tested. Therefore, extreme- care is needed in the design of experiments to establish the presence of a transcript in various human tissues as a small amount of genomic contamination in the RNA preparation will provide a false positive result. Thus, all RNA should be treated with DNAse prior to use for reverse transcription. In addition, for each tissue a control reaction may be set up in which reverse transcription was not undertaken (a -ve RT control).

For example, 1 g of total RNA from each tissue may be used to generate cDNA
using Multiscript reverse transcriptase (ABI) and random hexamer primers. For each tissue, a control reaction is set up in which all the constituents are added except the reverse transcriptase (-ve RT control). PCR reactions are set up for each tissue on the reverse transcribed RNA samples and the minus RT controls. INSP168-specific primers may readily be designed on the basis of the sequence information provided herein.
The presence of a product of the correct molecular weight in the reverse transcribed sample together with the absence of a product in the minus RT control may be taken as evidence for the presence of a transcript in that tissue. Any suitable cDNA
libraries may be used to screen for the INSP 168 transcripts, not only those generated as described above.

The tissue distribution pattern of the INSP 168 polypeptides will provide further useful information in relation to the function of those polypeptides.

Example 4: Expression and Purification of INSP168 Further experiments may now be performed using expression vectors.
Transfection of mammalian cell lines with these vectors may enable the high level expression of the INSP 168 polypeptides and thus enable the continued investigation of the functional characteristics of the INSP168 polypeptides. The following material and methods are an example of those suitable in such experiments.

Cell Culture Human Embryonic 1,,'-idney 293 cells expressing the Epstein-Barr virus Nuclear Antigen (HEK293-EBNA, Invitrogen) are maintained in suspension in Ex-cell VPRO
serum-free medium (seed stock, maintenance medium, JRH). Sixteen to 20 hours prior to transfection (Day-1), cells are seeded in 2x T225 flasks (50m1 per flask in DMEM / F12 (1:1) containing 2% FBS seeding medium (JRH) at a density of 2x105 cells/ml). The next day (transfection day 0) transfection takes place using the JetPEITM reagent (2 1/ g of plasmid DNA, PolyPlus-transfection). For each flask, plasmid DNA is co-transfected with GFP (fluorescent reporter gene) DNA. The transfection mix is then added to the 2xT225 flasks and incubated at 37 C
(5%CO2) for 6 days. Confirmation of positive transfection may be carried out by qualitative fluorescence examination at day 1 and day 6 (Axiovert 10 Zeiss).

On day 6 (harvest day), supernatants from the two flasks are pooled and centrifuged (e.g. 4 C, 400g) and placed into a pot bearing a unique identifier. One aliquot (500 1) is kept for QC of the 6His-tagged protein (internal bioprocessing QC).

Scale-up batches may be produced by following the protocol called "PEI
transfection of suspension cells", referenced BP/PEI/HH/02/04, with PolyEthylenelmine from Polysciences as transfection agent.

Purification pyocess The culture medium sample containing the recombinant protein with a C-terminal 6His tag is diluted with cold buffer A (50mM NaH2PO4; 600mM NaCI; 8.7 % (w/v) glycerol, pH 7.5). The sample is filtered then through a sterile filter (Millipore) and kept at 4 C in a sterile square media bottle (Nalgene).

The purification is performed at 4 C on the VISION workstation (Applied Biosystems) connected to an automatic sample loader (Labomatic). The purification procedure is composed of two sequential steps, metal affinity chromatography on a Poros 20 MC (Applied Biosystems) column charged with Ni ions (4.6 x 50 mm, 0.83m1), followed by gel filtration on a Sephadex G-25 medium (Amersham Pharmacia) column (1,0 x 10cm).

For the first chromatography step the metal affinity column is regenerated with 30 column volumes of EDTA solution (100mM EDTA; 1M NaCl; pH 8.0), recharged with Ni ions througli washing with 15 column volumes of a 100mM NiSO4 solution, washed with 10 column volumes of buffer A, followed by 7 column volumes of buffer B (50mM NaH2PO4; 600mM NaCl; 8.7 % (w/v) glycerol, 400mM; imidazole, pH 7.5), and finally equilibrated with 15 column volumes of buffer A
containing 15mM imidazole. The sample is transferred, by the Labomatic sample loader, into a 200ml sample loop and subsequently charged onto the Ni metal affinity column at a flow rate of 10m1/min. The column is washed with 12 column volumes of buffer A, followed by 28 column volumes of buffer A containing 20mM imidazole. During the 20mM imidazole wash loosely attached contaminating proteins are eluted from the column. The recombinant His-tagged protein is finally eluted with 10 column volumes of buffer B at a flow rate of 2ml/min, and the eluted protein is collected.

For the second chromatography step, the Sephadex G-25 gel-filtration colunm is regenerated with 2m1 of buffer D(1.137M NaCI; 2.7mM KC1; 1.5mM KH2PO4; 8mM
Nk,HPO4i pH 7.2), and subsequently equilibrated with 4 column volumes of buffer C
(137mM NaCI; 2.7mM KCI; 1.5mM KH2PO4i 8mM Na2HPO4; 20% (w/v) glycerol;
pH 7.4). The peak fraction eluted from the Ni-column is automatically loaded onto the Sephadex G-25 column through the integrated sample loader on the VISION and the protein is eluted with buffer C at a flow rate of 2 ml/min. The fraction was filtered through a sterile centrifugation filter (Millipore), frozen and stored at -80 C. An aliquot of the sainple is analyzed on SDS-PAGE (4-12% NuPAGE gel; Novex) Western blot with anti-His antibodies. The NuPAGE gel may be stained in a 0.1 %
Coomassie blue R250 staining solution (30% methanol, 10% acetic acid) at room temperature for lh and subsequently destained in 20% methanol, 7.5% acetic acid until the background is clear and the protein bands clearly visible.

Following the electrophoresis the proteins are electrotransferred from the gel to a nitrocellulose membrane. The membrane is blocked with 5% milk powder in buffer E
(137mM NaCI; 2.7mM KCI; 1.5mM KH2PO4; 8mM Na2HPO4; 0.1 % Tween 20, pH
7.4) for lh at room temperature, and subsequently incubated with a mixture of rabbit polyclonal anti-His antibodies (G-18 and H-15, 0.2gghnl each; Santa Cruz) in 2.5% milk powder in buffer E overnight at 4 C. After a further 1 hour incubation at room temperature, the membrane is washed with buffer E (3 x 10min), and then incubated with a secondary HRP-conjugated anti-rabbit antibody (DAKO, HRP
0399) diluted 1/3000 in buffer E containing 2.5% milk powder for 2 hours at room temperature. After washing with buffer E(3 x 10 minutes), the membrane is developed with the ECL kit (Amersham Pharmacia) for 1 min. The membrane is subsequently exposed to a Hyperfilm (Amersham Pharmacia), the film developed and the western blot image visually analysed.

For samples that showed detectable protein bands by Coomassie staining, the protein concentration may be determined using the BCA protein assay kit (Pierce) with bovine serum albumin as standard.

Furthermore, overexpression or knock-down of the expression of the polypeptides in ce111ines_may be used to determine the effect on transcriptional activation of the host cell genome. Dimerisation partners, co-activators and co-repressors of the polypeptides may be identified by immunoprecipitation combined with Western blotting and immunoprecipitation combined with mass spectroscopy.

Example 5: Biological Significance of INSP168 INSP168-SV1, INSP149 and As explained above, INSP168, INSP168-SV1, INSP149 and INSP169 are structurally related to the Retinal Specific Protein PAL (SwissProt Acc. Code PALP HUMAN) and to a nogo receptor homolog (SwissProt Acc. Code Q6X814). An amino acid alignment between INSP168, INSP168-SV1, INSP149 and INSP169 and PAL is shown in Figure 5, and the schematic representation of domains is shown in Figure 6.

PAL may be implicated in diseases of the retina, retinal piginent epithelium (RPE), and choroids (see for example JP2001128686). These include ocular neovascularization, ocular inflammation and retinal degenerations. Specific examples of these disease states include diabetic retinopathy, chronic glaucoma, retinal detachment, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization; rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis pigmentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, and retinal artery occlusion, and, neovascularization due to penetration of the eye or ocular injury. Additional relevant disease include the neuropathies, such as Leber's, idiopathic, drug-induced, optic, and ischemic neropathies.

Nogo receptor-like proteins could be major inliibitors, of CNS neuronal regeneration (Schwab ME. Curr Opin Neurobiol. 2004 Feb;14(1):l 18-24; Teng et al. J
Neurochem.
2004 May;89(4):801-6). Animals treated with antibodies targeted to Nogo-A
always showed a higher degree of recovery in various behavioural tests (e.g. IN-1 Fab' fragments or new purified IgGs against Nogo-A). In addition, a Nogo-66 antagonistic peptide (NEP1-40) effected significantly axon growth of the corticospinal tract and improved functional recovery in rats inflicted with mid-thoracic spinal cord hemisections. Subcutaneous administration of NEP1-40 in spinal cord lesioned animals resulted in extensive growth of corticospinal axons, sprouting of serotonergic fibres, synapse formation and enhanced locomotor recovery. Soluble Fc fusion proteins of the Nogo receptor subunit NgR, which blocks Nogo, significantly reduce the inhibitory activity of myelin. Similar results were obtained after Nogo gene 5 deletions and blockade of the downstream messengers Rho-A and ROCK in animal models.

The leucine-rich repeat domain of SLIT proteins is sufficient for guiding both axon projection and neuronal migration in vitro (the LRR region of SLIT is structurally related to the LRR region of INSP168, INSP168-SV1, INSP149 and INSP169). SLIT-10 like proteins are thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabaout homolog receptors (bind ROBO1 and ROBO2 with high affinity). During neural development, SLIT are involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. In spinal chord development, SLIT may play a role in 15 guiding commissural axons once they reached the floor plate by modulating the response to netrin. SLIT may be implicated in spinal chord midline post-crossing axon repulsion. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, SLIT
20 collapses and repels retinal ganglion cell growth cones. SLIT seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. In vitro, Slit homolog 2 protein N-product, but not Slit homolog 2 protein C-product, repells olfactory bulb (OB) but not dorsal root ganglia (DRG) axons, induces OB
growth cones collapse and induces branching of DRG axons. SLIT seeins to be 25 involved in regulating leukocyte migration.

INSP168, INSP168-SVl, INSP149 and INSP169 and/or fragments thereof (e.g.
fragments containing the LRR region) can be useful in the diagnosis and/or treatment of diseases for which other (e.g. above mentioned PAL- and Nogo receptor-like proteins) structurally related proteins demonstrate therapeutic activity.

30 As such, INSP168, INSP168-SV1, INSP149 and INSP169 may be implicated in diseases of the retina, spinal cord injuries (e.g. paraplegia) and neurodegenerative disorders. These include disorders of the central nervous system as well as disorders of the peripheral nervous system. Neurodegenerative disorders include, but are not limited to, brain injuries, cerebrovascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease (including amyotrophic lateral sclerosis, ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post- traumatic brain injury, and small-vessel cerebrovascular disease.
Dementias, such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and Parkinsonism, frontotemporal dementias (including Pick's disease), progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoffs psychosis, as well as stroke and trauma.

Thus, INSPI49, INSP168, INSP168-SV1 and INSP169 may be implicated in diseases of the retina, retinal piginent epithelium (RPE), and choroids; ocular neovascularization, ocular inflammation and retinal degenerations; diabetic retinopathy, chronic glaucoma, retinal detaclunent, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization;
rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal throinbosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis pigmentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, retinal artery occlusion, neovascularization due to penetration of the eye or ocular injury, neuropathies;
Leber's, idiopathic, drug-induced, optic, and ischemic neropathies; spinal cord injuries, paraplegia, neurodegenerative disorders, disorders of the central nervous systein, disorders of the peripheral nervous system, brain injuries, cerebrovascular diseases, Parkinson's disease, corticobasal degeneration, motor neuron disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post- traumatic brain injury, small-vessel cerebrovascular disease, dementias, Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia, Parkinsonism, frontotemporal dementias, Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, Korsakoffs psychosis, stroke and trauma.

Example 6: Neuroprotective activities of INSP 168 Neuro-inflammation is a common feature of several neurological diseases, traumatic situations (at central or peripheral level), stroke (brain, heart, renal), or infectious diseases (mediated by viral agents such as HIV or bacterial agents such as meningitis), leading to an excessive inflammatory response in central nervous system.
Many stimuli, originated by neuronal or oligodendroglial cells suffering due to these various conditions, can trigger neuro-inflammation. In particular, astrocytes can secrete various chemokines and cytokines, inducing a recruitment of additional leukocytes that in their turn will further stimulate astrocytes, leading to an exacerbated response. In chronic neurodegenerative diseases such as multiple sclerosis (MS), spinal muscular atrophies (SMA), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), or amylotrophic lateral sclerosis (ALS), the presence of persistent neuro-inflammation is thought to be involved in the progression of the disease and in the case of AD in the secondary events such as micro-hemorrhagic events (Cacquevel M et al., Curr Drug Targets. 2004, 5: 529-534;
Chavarria A et al., Autoimmun Rev. 2004, 3: 251-260; Ambrosini E and Aloisi F, Neurochem Res. 2004, 29: 1017-1038).

The biological properties of INSP168 related to neuroprotection, maintenance of axonal integrity, myelination and re-/generation of myelin producing cells, can be tested in various assays involving cell lines. For example, the neuroimmunodulatory effects of a compound can be evaluated in U373, a human astroglioma cell line in which the nuclear translocation of specific regulatory proteins involved in cytokine/chemokine expression can be quantified (Le Roy E et al., J Virol.
1999, 73:
6582-9; Jin Y et al., J Infect Dis. 1998, 177: 1629-1638; Acevedo-Duncan M et aL, Cell Growth Differ. 1995, 6: 1353-1365).

A series of assays was performed on the human astroglioma cell line U373 to check whether INSP 168 can affect the translocation of transcription factors such as Stat-2 (Signal transducer and activator of transcription-2, a transcription factor induced by cytokines and modulating IFNbeta response; Banninger G and Reich NC, J Biol Chem. 2004, 279: 39199-39206; Leonard WJ, Int J Hematol. 2001, 73: 271-277) from the cytoplasm to the nucleus.

U373 cells (ECACC ref no: 89081403) were seeded at the density of 4000 cells/well in 96-well-plates (Packard ViewPlate-96, black; Cat. No. 6005225) in 80 l of DMEM containing 10% FCS (Fetak Calf Serum) and left overnight at 37 C in a humidified 5% C02 incubator. The following day, 20 l of culture medium alone, or containing the protein to test (medium added with 1000 IU/ml of recombinant IFNbeta, or medium from His-tagged INSP168 expressing cells) was added to the cells. Thirty minutes after, the medium was removed and cells were fixed with 3.7%
formaldehyde (Sigma; Cat. No. 25,254-9) and processed for immunostaining using commercial kits (for c-Jun immunostaining, Cellomics c-Jun activation HitKit, Cat.
No. K01-0003-1; for Stat-2, Cellomics Stat-2 activation HitKit, Cat. No. K01-0005-1) according to the manufacturer's instructions. After staining, plates were read on an image analysis system (ArrayScan II HCS System; Cellomics).

Results were expressed as "nuclear translocation units". The nuclear translocation unit is the measure of the fluorescence intensity of the target in the nuclear region minus that of the cytoplasm region, reported as an average for all analyzed cells in the well (approx. 100 cells/well). In order to compare several experiments, results were also expressed as the percentage of maximal stimulation calculated with the positive control (IFNbeta). Statistics were performed using Student's T test or measure analysis of variance (ANOVA) and one-way ANOVA, followed by Dunnett's test depending of the number of groups per experiments. The level of significance was set at p < 0.05. The results were expressed as mean :L standard error of the mean (s.e.m.).
The addition of a culture medium containing INSP 168 was found to stimulate Stat-2 nuclear translocation in U373 cells, as indicated by the statistically significant increase of fluorescence intensity in the nuclei. The response corresponds to 20-30%
of the maximal level achieved with IFNbeta, the positive control (Fig. 7; **
means p<0.005, *** means p<0.0005).

This first series of experiments revealed that INSP168 has the capacity to stimulate intracellular signaling by inducing Stat-2 nuclear translocation in U373 cells.
Activation of Stat proteins signaling is known to be associated with immunomodulation and eventually cell proliferation (Pfitzner E et al., Curr Pharm Des. 2004, 10: 2839-2850).

Example 7: Cloning of the INSP 169 extracellular domain (INSP 169ec) INSP169 is a re-prediction of INSP149 which encodes a protein of 679 ainino acids spanning 4 coding exons. A transmembrane (TM) domain is predicted near the C-terminus. The N-terminal extracellular domain extends over 580 amino acids and includes a cluster of 4 Leucine rich repeats (LRR) flanked by Cys-rich domains, an IgC-2 domain and a fibronectin type 3 domain. The extracellular domain of this prediction has been cloned.

The cloning strategy used was to prepare an initial pool of RNAs from a wide variety of human tissues (see below) and from this to make a single preparation of multi-tissue polyA+ mRNA as template for reverse transcription. Gene specific cDNA
primers were designed for a small set of the predictions (typically 5-10 sequences), and aliquots of the resulting cDNA mix provided templates for separate PCR
reactions using primers designed to obtain the corresponding coding region.
Amplified fragments were then purified by gel electorphoresis and cloned into the Bluescript cloning vector by virtue of specific restriction sites added to the ends of the PCR primers.

In the case of INSP169ec, a two step strategy was employed which makes use of a unique BamHI restriction site in the central part of this sequence. A first RT-PCR was performed to obtain the 1063nt sequence between the TM domain to the BamH1 site;
a second RT-PCR was performed to obtain the remaining 683nt sequence upstream of the BamHI site as far as the initiator methionine codon. These two fragments were then assembled following BamHI digestion and ligation.

The gene specific priiners used are described below and in Table 4 below. A
cDNA of 1740 nucleotides was obtained and sequence analysis of this insert revealed the predicted cDNA sequence for the complete extracellular domain of INSP169. The coding region and position of the oligonucleotide primers used in the cloning of INSP169ec are shown in Figure S.

7.1 Preparation of a human multi-tissue cDNA template A preparation of human RNA was prepared by mixing approximately 10 g total RNA from each of the following sources:

Brain (Clontech), Heart (Clontech), Kidney (Clontech), Liver (Clontech), Lung (Clontech), Placenta (Clontech), Skeletal Muscle (Clontech), Small Intestine (Clontech), Spleen (Clontech), Thymus (Clontech), Uterus (Clontech) Bone Marrow (Clontech) Thyroid (Clontech), Ovary (Ambion), Testis (Ambion), Prostate 5 (Ambion), Skin (Resgen), Pancreas (Clontech), Salivary gland (BD
Biosciences), Adrenal gland (BD Biosciences), Breast (Ambion), Pituitary gland (BioChain Institut), Stomach (Ambion), Mammary gland (Clontech), Lymph Node (BioChain Institut), Adipose tissue (BioChain Institut), Bladder (BioChain Institut), Appendix (BioChain Institut), Artery (BioChain Institut), Throat (BioChain Institut), Universal 10 Human Reference (Stratagene), Foetal Kidney (Stratagene), Foetal Brain (BioChain Institut), Foetal Spleen (BioChain Institut), Foetal Liver (BioChain Institut), Foetal Heart (BioChain Institut), Foetal Lung (BioChain Institut), Peripheral blood monocytes (prepared in-house from buffy coat).

The resulting pool of total RNA was fractionated by chromatography on a pre-packed 15 oligo-dT column (Stratagene) according to the protocol supplied by the manufacturer.
Approximately 400 g total RNA yielded 16 g polyA+ mRNA which was aliquotted and frozen at -80 C.

7.2 RT-PCR cloning of INSP169ec 7.2.1 Stage 1: Cloning of nucleotides 678-1740 20 7.2.1.1 cDNA synthesis In the first stage of cloning, a gene specific cDNA primer for INSP169 (AS502) located in the TM domain, was pooled with gene specific cDNA primers for 9 other predictions, each at a final concentration of 1pM. The pooled cDNA primer set was diluted 10 fold into 50 l of a mixutre containing 1 x RT buffer, 500 M each dNTPs, 25 l0U/ l RNAguard (Pharmacia) and 1 g denatured polyA+ RNA prepared as described above. cDNA synthesis was initiated by addition of l0U Omniscript reverse transcriptase (Qiagen) and allowed to proceed for 1h at 37 C. At the end of the reaction, 5 1 of the cDNA mix was used for PCR amplification as described below.

7.2.1.2 PCR afnplification fof I1NSP169 nucleotides 678-1740 Top strand (AS503) and bottom strand (AS504) PCR primers (see Table 4) were designed to span the predicted coding sequence between an internal BamHI site and the TM domain. EcoRI restrictions sites were added at the 5' end of each primer. A

reaction mixture was set up containing 1 x PCR buffer, 0.2mM each dNTP, 0.5 M
each PCR primer, 5 1 cDNA above, and the PCR reaction was initiated by addition of 5U PfuTurbo (Stratagene). Cycling conditions for 'touchdown' PCR were: 94 C 2 min (I cycle); 94 C 30 sec, 64 C (decreasing by 1 C each cycle) 30 sec, 72 sec (14 cycles); 94 C 30 sec, 50 C 30 sec, 72 C 90 see (25 cycles); 72 C 7 min (1 cycle). An aliquot of the PCR reaction was analysed by electrophoresis in a 0.8%
agarose gel and the remainder was purified using the Wizard PCR Cleanup System (Promega) as recommended by the manufacturer, prior to subcloning of the PCR
products.

7.2.1.3 Subcloning PCR products An aliquot of the purified PCR reation was digested with EcoRI (New England Biolabs) for 2h at 37 C using the enzyme buffer supplied by the manufacturer.

In parallel, an appropriate amount of the Bluescript BSK- cloning vector was digested with EcoRI and dephosphorylated using calf intestinal alkaline phosphatase (Roche Diagnostics) according to the supplier's recommendations. The full length linearized and dephosphorylated cloning vector was separated on a 0.8% agarose gel, excised and purified using the Wizard Cleanup System (Promega) according to the protocol provided by the manufacturer. The purified vector DNA and PCR products were mixed in a molar ratio of 1:3 and precipitated overnight at -20 C in the presence of 2.5 volumes ethanol. The precipitated DNA was recovered by centrifugation, washed in 70% ethanol, dried under vacuum and ligated in a final volume of l0 1 using the Rapid Ligation Kit (Roche Diagnostics) according to the protocol supplied by the manufacturers.

The ligation mixture was then used to transform E. coli strain JM101 as follows: 50 l aliquots of competent JM101 cells were thawed on ice and 1 1 or 5 1 of the ligation mixture was added. The cells were incubated for 40 min on ice and then heat shocked by incubation at 42 C for 2min. lml of warm (room temperature) L-Broth (LB) was added and samples were incubated for a further 1 h at 37 C. The transformation mixture was then plated on LB plates containing ampicillin (100 g/ml) IPTG
(0.1 M) and X-gal (50 g/ml) and incubated overnight at 37 C. Single white colonies were chosen for plasmid isolation.

7.2.1.4 Plasmid DNA preparation, restriction digestion and sequence analysis.
Miniprep plasmid DNA was prepared from 5 ml cultures using a Biorobot 8000 robotic system (Qiagen) according to the manufacturer's instructions. Plasmid DNA
was eluted in 80 l sterile water. The DNA concentration was measured using an Eppendorf BO photometer or Spectramax 190 photometer (Molecular Devices).
Aliquots of miniprep plasmid DNAs (100-200ng) were digested with EcoRI for 2h at 37 C and analysed by electrophoresis in 0.8% agarose gels. Plasmids with inserts of the expected size of about 1.lkb were selected for DNA sequence analysis.
Inserts were sequenced from either end by mixing 200-500 ng plasmid DNA with the either the T7 or T3 sequencing primers (see Table 4). Sequencing reactions were processed using the BigDye Terminator system (Applied Biosystems cat. no. 4390246) according to the manufacturer's instructions. Products were purified using Dye-Ex columns (Qiagen) or Montage SEQ 96 cleanup plates (Millipore cat. no.
LSKS09624) and analyzed on an Applied Biosystems 3700 sequencer.

7.2.1.5 Results of cloning and sequence analysis of nucleotides 678-1740.

The predicted mRNA coding sequence for the region spanning the internal BainHI
site to the TM domain was confirmed. The DNA miniprep #14 was taken as a representative clone for further work.

7.2.2 Stage 2: Cloning of nucleotides 1-683 7.2.2.1 cDNA synthesis In the second stage of cloning, a gene specific cDNA primer for INSP169 (AS515) located immediately downstream of the internal BamHI site, was pooled with gene specific cDNA primers for 6 other predictions, each at a final concentration of 1pM.
The pooled cDNA primer set was diluted 10 fold into 40 1 of a mixutre containing 1 x RT buffer, 500 M each dNTPs, 10U/ l RNAguard (Pharmacia) and 1 g denatured polyA+ RNA prepared as described above. cDNA synthesis was initiated by addition of l0U Omniscript reverse transcriptase (Qiagen) and allowed to proceed for lh at 37 C. At the end of the reaction, 5 1 of the cDNA mix was used for PCR
amplification as described below.

7.2.2.2 PCR amplification for INSP169 nucleotides 1-683 Top strand (AS516) and bottom strand (AS517) PCR primers (see Table 4) were designed to span the predicted coding sequence between the initiator methionine and the internal BamHI site. A BamH1 restriction site was added at the 5' end of AS516.

A reaction mixture was set up containing 1 x PCR buffer, 0.2mM each dNTP, 0.5 M
each PCR primer, 5 l cDNA above, and the PCR reaction was initiated by addition of 5U PfuTurbo (Stratagene). Cycling conditions for 'touchdown' PCR were: 94 C 2 min (I cycle); 94 C 30 sec, 64 C (decreasing by 1 C each cycle) 30 sec, 72 sec (14 cycles); 94 C 30 sec, 50 C 30 sec, 72 C 80 sec (25 cycles); 72 C 7 min (1 cycle). An aliquot of the PCR reaction was analysed by electrophoresis in a 0.8%
agarose gel and the remainder was purified using the Wizard PCR Cleanup System (Promega) as recommended by the manufacturer, prior to subcloning of the PCR
products.

7.2.2.3 Subcloning PCR products An aliquot of the purified PCR reation was digested with BamHI (New England Biolabs) for 2h at 37 C using the enzyme buffer supplied by the manufacturer.

In parallel, an appropriate amount of the Bluescript BSK- cloning vector was digested with BamH1 and dephosphorylated using calf intestinal alkaline phosphatase (Roche Diagnostics) according to the supplier's recommendations. The full length linearized and dephosphorylated cloning vector was separated on a 0.8% agarose gel, excised and purified using the Wizard Cleanup System (Promega) according to the protocol provided by the manufacturer. The purified vector DNA and PCR products were mixed in a molar ratio of 1:3 and precipitated overnight at -20 C in the presence of 2.5 volumes ethanol. The precipitated DNA was recovered by centrifugation, washed in 70% ethanol, dried under vacuum and ligated in a final volume of 10 1 using the Rapid Ligation Kit (Roche Diagnostics) according to the protocol supplied by the manufacturers.

The ligation mixture was then used to transform E. coli strain JM101 as follows: 50 l aliquots of competent JM101 cells were thawed on ice and l l or 5 l of the ligation mixture was added. The cells were incubated for 40 min on ice and then heat shocked by incubation at 42 C for 2min. lml of warm (room temperature) L-Broth (LB) was added and samples were incubated for a further 1 h at 37 C. The transformation mixture was then plated on LB plates containing ampicillin (100 g/ml) IPTG
(0.1 M) and X-gal (50 g/ml) and incubated overnight at 37 C. Single white colonies were chosen for plasmid isolation.

7.2.2.4 Plasfnid DNA preparation, restriction digestion and sequence analysis.
Miniprep plasmid DNA was prepared from 5 ml cultures using a Biorobot 8000 robotic system (Qiagen) according to the manufacturer's instructions. Plasmid DNA
was eluted in 80 1 sterile water. The DNA concentration was measured using an Eppendorf BO photometer or Spectramax 190 photometer (Molecular Devices).
Aliquots of miniprep plasmid DNAs (100-200ng) were digested with BamHI for 2h at 37 C and analysed by electrophoresis in 0.8% agarose gels. Plasmids with inserts of the expected size of about 0.7kb were selected for DNA sequence analysis.
Inserts were sequenced from either end by mixing 200-500 ng plasmid DNA with the either the T7 or T3 sequencing primers (see Table 4). Sequencing reactions were processed using the BigDye Terminator system (Applied Biosystems cat. no. 4390246) according to the manufacturer's instructions. Products were purified using Dye-Ex columns (Qiagen) or Montage SEQ 96 cleanup plates (Millipore cat. no.
LSKS09624) and analyzed on an Applied Biosystems 3700 sequencer.

7.2.2.5 Results of cloning and sequence analysis of nucleotides 1-683 The predicted mRNA coding sequence for the region between the initiator methionine and the internal BamHI site was confirmed. The DNA miniprep #15 was taken as a representative clone for further work.

7.3 Assembly of t/te complete INSP169 extracellular clomain Aliquots of the DNA miniprep #14 from stage 1 and DNA miniprep#15 from stage 2 were digested with BamHI (New England Biolabs) for 2h at 37 C using the enzyme buffer supplied by the manufacturer. The full-length, linearized plasmid from 5 miniprep#14 and the 0.7kb excised fragment from miniprep#15 were separated on 0.8% agarose gel, excised and purified using the Wizard Cleanup System (Promega) according to the protocol provided by the manufacturer. The two purified DNAs were mixed in a molar ratio of 1:3 respectively, and precipitated overnight at -20 C in the presence of 2.5 volumes ethanol. The precipitated DNA was recovered by 10 centrifugation, washed in 70% ethanol, dried under vacuum and ligated in a final volume of 10 1 using the Rapid Ligation Kit (Roche Diagnostics) according to the protocol supplied by the manufacturers.

Transformation of competent JM101with aliquots of the ligation mix, plasmid isolation and sequence analysis were performed as described in sections 7.2.1.3 and 15 7.2.1.4 above.

7.4 Results of sequence analysis of full length INSPI69ec Sequence analysis of 12 miniprep DNAs allowed identification of clones in which the fragment corresponding to nucleotides 1-683 was inserted in the correct orientation upstream of the sequence correponding to nucleotides 678-1740 and in which the 20 junction between the two fraginents is the correctly religated BamHI site (position 678-683).

DNA miniprep #11 was selected and the complete sequence was verified using sequencing primers T3, T7, AS515 and AS599 (see Table 4). Compared to the prediction, a single SNP was found, G524A, which results in a codon change from 25 Ser>Asn (underlined in Fig 8).

Table 4: Primers used for cloning and sequencing of INSP169ec Oligonucleotide Description DNA Sequence (5'-3') AS502 RT primer (in TM) caccacgagaaggagagacc AS503 5' PCR internal primer gcgaattcgctatagtgcttctggatcc AS504 3' PCR primer gcgaattctcattgagaatcatctccttcaac AS515 internal RT primer gaggcgctcaggttcactgc AS516 5' PCR primer gcggatccatgcatctctttgcatgtctg AS517 3' PCR internal primer catcagtggatccagaagcac AS599 internal sequencing primer caatccttggttctgtgactg T7 seq primer taatacgactcactatagg T3 seq primer attaaccctcactaaagg DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Claims (51)

1. A polypeptide, which polypeptide:

(i) comprises the amino acid sequence as recited in SEQ ID NO:2 (mature INSP168);

(ii) is a fragment thereof which functions as a biologically active polypeptide and/or has an antigenic determinant in common with the polypeptides of (i); or (iii) is a functional equivalent of (i) or (ii).

2. A polypeptide according to part (i) of claim 1, which polypeptide consists of the amino acid sequence as recited in SEQ ID NO:4 (mature INSP149), SEQ ID
NO:6 (INSP149 extracellular region), SEQ ID NO:8 (mature INSP168-SV1), SEQ ID NO:10 (mature INSP169), SEQ ID NO:12 (INSP169 extracellular region) and/or SEQ ID NO:67 (INSP169 cloned extracellular region).

3. A polypeptide which is a functional equivalent according to part (iii) of claim 1, characterised in that it is homologous to the amino acid sequence as recited in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, and/or SEQ ID NO:67.

4. A fragment or functional equivalent according to part (ii) of claim 1, which has greater than 50% sequence identity with the amino acid sequence recited in SEQ

ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ
ID NO:12, and/or SEQ ID NO:67 or with active fragments thereof, preferably greater than 60%, 70%, 80%, 90%, 95%, 98% or 99% sequence identity.

5. A fragment according to claim 4, which consists of the amino acid sequence as recited in SEQ ID NO:14 (LRR motifs).

6. A functional equivalent according to any one of the preceding claims, which exhibits significant structural homology with a polypeptide having the amino acid sequence given in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID
NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 and/or SEQ ID NO:67.

7. A fragment as recited in any one of the preceding claims, having an antigenic determinant in common with the polypeptide of part (i) of claim 1 which consists of 7 or more (for example, 8, 10, 12, 14, 16, 18, 20 or more) amino acid residues from the sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, and/or SEQ ID
NO:67.

8. A fusion protein comprising the polypeptide according to any one of the preceding claims.

9. The polypeptide of claim 8, wherein said polypeptide comprises a histidine tag.

10. The polypeptide of claim 9, whose sequence is recited in SEQ ID NO: 16, SEQ
ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 and/or SEQ ID NO:28.

11. The polypeptide of any one of the preceding claims, wherein said polypeptide comprises a signal peptide.

12. The polypeptide of claim 11, whose sequence is recited in SEQ ID NO:30, SEQ
ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44 and/or SEQ ID NO:67.

13. A purified nucleic acid molecule which encodes a polypeptide according to any one of the preceding claims.

14. A purified nucleic acid molecule according to claim 13, which comprises or consists of the nucleic acid sequence as recited in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID
NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ
ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 and/or SEQ ID NO:66.

15. A purified nucleic acid molecule according to claim 13 or claim 14 which consists of the nucleic acid sequence as recited in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID
NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ
ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 and/or SEQ ID NO:66, or is a redundant equivalent or fragment thereof.

16. A purified nucleic acid molecule which hybridizes under high stringency conditions with a nucleic acid molecule according any one of claims 13 to 15.

17. A vector comprising a nucleic acid molecule as recited in any one of claims 13-16.

18. A host cell transformed with a vector according to claim 17.

19. A ligand which binds specifically to, and which preferably inhibits the cell surface recognition molecule activity of, a polypeptide according to any one of claims 1-12.

20. A ligand according to claim 19, which is an antibody.

21. A compound that either increases or decreases the level of expression or activity of a polypeptide according to any one of claims 1-12.

22. A compound according to claim 21 that binds to a polypeptide according to any one of claims 1-12 without inducing any of the biological effects of the polypeptide.

23. A compound according to claim 21 or claim 22, which is a natural or modified substrate, ligand, enzyme, receptor or structural or functional mimetic.

24. A polypeptide according to any one of claims 1-12, a nucleic acid molecule according to any one of claims 13-16, a vector according to claim 17, a host cell according to claim 18, a ligand according to claim 19 or claim 20, or a compound according to any one of claims 21-23, for use in therapy or diagnosis of disease.

25. A method of diagnosing a disease in a patient, comprising assessing the level of expression of a natural gene encoding a polypeptide according to any one of claims 1-12, or assessing the activity of a polypeptide according to any one of claims 1-12, in tissue from said patient and comparing said level of expression or activity to a control level, wherein a level that is different to said control level is indicative of disease.

26. A method according to claim 25 that is carried out in vitro.

27. A method according to claim 25 or claim 26, which comprises the steps of:
(a) contacting a ligand according to claim 19 or claim 20 with a biological sample under conditions suitable for the formation of a ligand-polypeptide complex;
and (b) detecting said complex.

28. A method according to claim 25 or claim 26, comprising the steps of:

(a) contacting a sample of tissue from the patient with a nucleic acid probe under stringent conditions that allow the formation of a hybrid complex between a nucleic acid molecule according to any one of claims 13-16 and the probe;

(b) contacting a control sample with said probe under the same conditions used in step a); and (c) detecting the presence of hybrid complexes in said samples; wherein detection of levels of the hybrid complex in the patient sample that differ from levels of the hybrid complex in the control sample is indicative of disease.

29. A method according to claim 25 or claim 26, comprising:

(a) contacting a sample of nucleic acid from tissue of the patient with a nucleic acid primer under stringent conditions that allow the formation of a hybrid complex between a nucleic acid molecule according to any one of claims 13-16 and the primer;

(b) contacting a control sample with said primer under the same conditions used in step a); and (c) amplifying the sampled nucleic acid; and (d) detecting the level of amplified nucleic acid from both patient and control samples; wherein detection of levels of the amplified nucleic acid in the patient sample that differ significantly from levels of the amplified nucleic acid in the control sample is indicative of disease.

30. A method according to claim 25 or claim 26 comprising:

(a) obtaining a tissue sample from a patient being tested for disease;

(b) isolating a nucleic acid molecule according to any one of claims 13-16 from said tissue sample; and (c) diagnosing the patient for disease by detecting the presence of a mutation which is associated with disease in the nucleic acid molecule as an indication of the disease.

31. The method of claim 30, further comprising amplifying the nucleic acid molecule to form an amplified product and detecting the presence or absence of a mutation in the amplified product.

32. The method of either claim 30 or 31, wherein the presence or absence of the mutation in the patient is detected by contacting said nucleic acid molecule with a nucleic acid probe that hybridises to said nucleic acid molecule under stringent conditions to form a hybrid double-stranded molecule, the hybrid double-stranded molecule having an unhybridised portion of the nucleic acid probe strand at any portion corresponding to a mutation associated with disease; and detecting the presence or absence of an unhybridised portion of the probe strand as an indication of the presence or absence of a disease-associated mutation.

33. A method according to any one of claims 25-32, wherein said disease is selected from diseases of the retina, retinal pigment epithelium (RPE), and choroids;
ocular neovascularization, ocular inflammation and retinal degenerations;
diabetic retinopathy, chronic glaucoma, retinal detachment, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization; rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma;
neovascularization resulting following a combined vitrectomy and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis pigmentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, retinal artery occlusion, neovascularization due to penetration of the eye or ocular injury, neuropathies; Leber's, idiopathic, drug-induced, optic, and ischemic neropathies; spinal cord injuries, paraplegia, neurodegenerative disorders, disorders of the central nervous system, disorders of the peripheral nervous system, brain injuries, cerebrovascular diseases, Parkinson's disease, corticobasal degeneration, motor neuron disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post- traumatic brain injury, small-vessel cerebrovascular disease, dementias, Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia, Parkinsonism, frontotemporal dementias, Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV
dementia, schizophrenia with dementia, Korsakoffs psychosis, stroke and trauma.

34. Use of a polypeptide according to any one of claims 1-12 as a cell surface recognition molecule or as an antagonist of a cell surface recognition molecule.

35. A pharmaceutical composition comprising a polypeptide according to any one of claims 1-12, a nucleic acid molecule according to any one of claims 13-16, a vector according to claim 17, a host cell according to claim 18, a ligand according to claim 19 or 20, or a compound according to any one of claims 21-23.

36. A vaccine composition comprising a polypeptide according to any one of claims 1-12 or a nucleic acid molecule according to any one of claims 13-16.

37. A polypeptide according to any one of claims 1-12, a nucleic acid molecule according to any one of claims 13-16, a vector according to claim 17, a host cell according to claim 18, a ligand according to claim 19 or 20, a compound according to any one of claims 21-23, or a pharmaceutical composition according to claim 35, for use in the manufacture of a medicament for the treatment of a disease selected from diseases of the retina, retinal pigment epithelium (RPE), and choroids; ocular neovascularization, ocular inflammation and retinal degenerations; diabetic retinopathy, chronic glaucoma, retinal detachment, sickle cell retinopathy, senile macular degeneration, retinal neovascularization, subretinal neovascularization; rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy and lensectomy, vascular diseases retinal ischemia, choroidal vascular insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, retinitis pigmentosa, retinal vein occlusion, proliferative vitreoretinopathy, angioid streak, retinal artery occlusion, neovascularization due to penetration of the eye or ocular injury, neuropathies; Leber's, idiopathic, drug-induced, optic, and ischemic neropathies; spinal cord injuries, paraplegia, neurodegenerative disorders, disorders of the central nervous system, disorders of the peripheral nervous system, brain injuries, cerebrovascular diseases, Parkinson's disease, corticobasal degeneration, motor neuron disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-traumatic brain injury, small-vessel cerebrovascular disease, dementias, Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia, Parkinsonism, frontotemporal dementias, Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, Korsakoffs psychosis, stroke and trauma.

38. A method of treating a disease in a patient, comprising administering to the patient a polypeptide according to any one of claims 1-12, a nucleic acid molecule according to any one of claims 13-16, a vector according to claim 17, a host cell according to claim 18, a ligand according to claim 19 or 20, or a compound according to any one of claims 21-23, or a pharmaceutical composition according to claim 35.

39. A method according to claim 38, wherein, for diseases in which the expression of the natural gene or the activity of the polypeptide is lower in a diseased patient when compared to the level of expression or activity in a healthy patient, the polypeptide, nucleic acid molecule, vector, ligand, compound or composition administered to the patient is an agonist.

40. A method according to claim 38, wherein, for diseases in which the expression of the natural gene or activity of the polypeptide is higher in a diseased patient when compared to the level of expression or activity in a healthy patient, the polypeptide, nucleic acid molecule, vector, ligand, compound or composition administered to the patient is an antagonist.

41. A method of monitoring the therapeutic treatment of disease in a patient, comprising monitoring over a period of time the level of expression or activity of a polypeptide according to any one of claims 1-12, or the level of expression of a nucleic acid molecule according to any one of claims 13-16 in tissue from said patient, wherein altering said level of expression or activity over the period of time towards a control level is indicative of regression of said disease.

42. A method for the identification of a compound that is effective in the treatment and/or diagnosis of disease, comprising contacting a polypeptide according to any one of claims 1-12, or a nucleic acid molecule according to any one of claims 13-16 with one or more compounds suspected of possessing binding affinity for said polypeptide or nucleic acid molecule, and selecting a compound that binds specifically to said nucleic acid molecule or polypeptide.

43. A kit useful for diagnosing disease comprising a first container containing a nucleic acid probe that hybridises under stringent conditions with a nucleic acid molecule according to any one of claims 13-16; a second container containing primers useful for amplifying said nucleic acid molecule; and instructions for using the probe and primers for facilitating the diagnosis of disease.

44. The kit of claim 43, further comprising a third container holding an agent for digesting unhybridised RNA.

45. A kit comprising an array of nucleic acid molecules, at least one of which is a nucleic acid molecule according to any one of claims 13-16.

46. A kit comprising one or more antibodies that bind to a polypeptide as recited in any one of claims 1-12; and a reagent useful for the detection of a binding reaction between said antibody and said polypeptide.

47. A transgenic or knockout non-human animal that has been transformed to express higher, lower or absent levels of a polypeptide according to any one of claims 1-12.

48. A method for screening for a compound effective to treat disease, by contacting a non-human transgenic animal according to claim 47 with a candidate compound and determining the effect of the compound on the disease of the animal.

49. A method according to any one of claims 38-44 or claim 48, wherein said disease is one of the diseases set forth in claim 33.

50. The use of an INSP168, INSP168-SV1, INSP149 or INSP169 polypeptide as a target for screening candidate drugs for treating or preventing a disorder in which leucine-rich repeat (LRR) motif containing proteins are implicated.

51. Method of selecting biologically active compounds comprising:

(i) contacting a candidate compound with recombinant host cells expressing an INSP168, INSP168-SV1, INSP149 or INSP169 polypeptide;

(ii) selecting compounds that bind said INSP168, INSP168-SV1, INSP149 or INSP 169 polypeptide at the surface of said cells and/or that modulate the activity of the INSP168, INSP168-SV1, INSP149 or INSP169 polypeptide.