CA2569095A1 - Crystal structure of dipeptidyl peptidase iv (dpp-iv) and uses thereof - Google Patents

Abstract

A crystal structure of dipeptidyl peptidase IV (DPP-IV), and the three-dimensional atomic coordinates of the DPP-IV extracellular domain, as described and used for the identification of ligands, including DPP-IV
inhibitors, used for the treatment of diseases that are associated with proteins that are subject to processing by DPP-IV.

Description

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE I)E CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME DE _2 NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.

JUMBO APPLICATIONS / PATENTS

THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.

NOTE: For additional volumes please contact the Canadian Patent Office.

CRYSTAL STRUCTURE OF DIPEPTIDYL PEPTIDASE IV (DPP-IV) AND USES THEREOF

FIELD OF THE INVENTION

The present invention relates to crystalline compositions of mammalian dipeptidyl peptidase IV
(DPP-IV), methods of preparing said compositions, methods of determining the three-dimensional (3-D) X-ray atomic coordinates of said composition, methods of identifying ligands of DPP-IV using structure based drug design, the use of 3-D crystal structures to design, modify and assess the activity of potential inhibitors, and to the use of such inhibitors for the treatment of, for example, diabetes, glucose tolerance, obesity, appetite regulation, lipidemia, osteoporosis, neuropeptide metabolism and T-cell activation, among others.

BACKGROUND OF THE INVENTION
The serine peptidase dipeptidyl peptidase IV (DPP-IV) is a multifunctional type II cell surface glycoprotein, which is widely expressed in a variety of cell types, particularly on differential epithelial cells of the intestine, liver, prostate tissue, corpus luteum, and kidney proximal tubules (Thoma et al., Structure, 11, 947-959, 947 (2003) citing Hartel et al., Histochemistry 89, 151-161 (1988); McCaughan et al., Hepatology 11, 534-544 (1990) as well as leukocytes subsets (Thoma et al., (2003) citing Gorrell et al., Cell. Immunol. 134, 205-215 (1991)).
DPP-IV has roles in many biological processes including its ability to modulate the biological activity of several peptide hormones, chemokines and neuropeptides by specifically cleaving after a proline or alanine at amino acid position 2 from the N terminus, a rate-limiting step in the degradation of peptides (Mentlein, R. Regul Pept. 85, 9-24 (1999). Therefore, the natural substrates of DPP-IV include several chemokines, cytokines, neuropeptides, circulating hormones, and bioactive peptides which as those of skill in the art will appreciate, suggests a key regulatory role in the metabolism of peptide hormones and in amino acid transport ((Lambeir et al., FEBS Lett. 507, 327-330 (2001); (Hildebrandt et al., Clin. Sci. 99, 93-104)).
DPP-IV has been implicated in the control of glucose homeostasis because its substrates include the incretin peptides glucagon-like peptide 1 (GLP-1) and gastric inhibitory polypeptide (GIP). Cleavage of the N-terminal amino acids from these peptides renders them functionally inactive. As such, GLP-1 has been shown to be an effective anti-diabetic therapy in Type 2 diabetic patients and to reduce the meal-related insulin requirement in Type 1 diabetic patients. Moreover, GLP-1 and/or GIP are believed to regulate satiety, lipidemia and osteogenesis, and therefore exogenous GLP-1 has been proposed as a treatment for patients suffering from acute coronary syndrome, angina and ischemic heart disease.
As those of skill in the art will appreciate, several methods have been used in the past and continue to be used to discover selective inhibitors of biomolecular targets such as DPP-IV. The various approaches include ligand-directed drug discovery (LDD), quantitative structure activity relationship (QSAR) analyses; and comparative molecular field analysis (CoMFA). CoMFA is a particular type of QSAR method that uses statistical correlation techniques for the analysis of the quarititative relationship between the biological activity of a set of compounds with a specified alignment, and their three-dimensional electronic and steric properties. Other properties such as hydrophobicity and hydrogen bonding can also be incorporated into the analysis.

An invaluable component of these drug discovery approaches is structure based design, which is a design strategy for new chemical entities, or optimization of lead compounds identified by other methods, using the 3D structure of the biological macromolecule target obtained by for example, X-ray or nuclear magnetic resonance (NMR) studies, or from homology models. Analyzing 3-D structures of proteins provides crucial insights into the behavior and mechanics of drug binding and biological activity.
Coupled with computational techniques including modeling and simulation, the study of biomolecular interactions provides details of events that may be difficult to investigate experimentally in the laboratory, and can help reveal topological features important for determining molecular recognition. As those skilled in the art will recognize, this information can, in turn, be used for predicting ligand-receptor complex formation, and for designing ligands and protein mutations that produce desired ligand receptor interactions.
Although, crystal structures of DPP-IV have been previously disclosed, none have been able to solve a three-dimensional structure with only one molecule per asymmetric unit, in turn providing a greater advantage for iterative structure based design. (Aertgeets et al., Protein Science, 13:412-421 (2004) hDPP-IV complexed with a decapaptide; Engel et al., PNAS, 100:9:5063-5068 (2003) crystal structure of native porcine DPP-IV; Hiramatsu et al., BBRC, 302:849-854 (2003) crystal structure of hDPP-IV at 2.6A
resolution; Rasmussen et al., Nature Structural Biology, 10:19-25 (2003) 2.5A
structure of the extracellular region of DPP-IV in complex with the inhibitor valine-pyrrolidide; Thoma et al., Structure, 11:947-959 (2003) expressed and purified the ectodomain of human DPP-IV in Pichia pastoris and determined X-ray structure at 2.1 A resolution.) To that end, the quest for specific and potent DPP-IV inhibitors for use in physiological studies and therapeutic settings continues. Thus, obtaining three-dimensional (3D) structures of DPPs, such as DPP-IV as a single molecule of an asymmetric unit, by, for example, X-ray or NMR studies, or from homology models, and analyzing the structures using computational methods, facilitates such discovery efforts.

SUMMARY OF THE INVENTION

The present invention provides crystalline compositions of DPP-IV, and specifically of DPP-IV, having one molecule per asymmetric unit. The invention further provides methods of preparing said compositions, methods of determining the 3-D X-ray atomic coordinates of said crystalline compositions, methods of using the atomic coordinates in conjunction with computational methods to identify binding site(s), methods to elucidate the 3-D structure of homologues of DPP-IV, and methods to identify ligands which interact with the binding site(s) to agonize or antagonize the biological activity of DPP-IV, methods for identifying inhibitors of DPP-IV, pharmaceutical compositions of inhibitors, and methods of treatment of Type 2 diabetes, Type 1 diabetes, impaired glucose tolerance, hyperglycemia, metabolic syndrome (syndrome X
and/or insulin resistance syndrome), glucosuria, metabolic acidosis, arthritis, cataracts, diabetic neuropathy, diabetic nephropathy, diabetic retinopathy, diabetic cardiomyopathy, obesity, conditions exacerbated by obesity, hypertension, hyperlipidemia, atherosclerosis, osteoporosis, osteopenia, frailty, bone loss, bone fracture, acute coronary syndrome, short stature due to growth hormone deficiency, infertility due to polycystic ovary syndrome, anxiety, depression, insomnia, chronic fatigue, epilepsy, eating disorders, chronic pain, alcohol addiction, diseases associated with intestinal motility, ulcers, irritable bowel syndrome, inflammatory bowel syndrome; short bowel syndrome; and the prevention of disease progression in Type 2 diabetes, using said pharmaceutical compositions.
In a preferred embodiment the invention provides crystalline compositions of the extracellular domain of DPP-IV (residues 31-766 of SEQ ID NO:1), whereby the crystal structure is derived from mammal, preferably human.
One aspect of the present invention provides methods for crystallizing a DPP-IV polypeptide.
Preferably the methods for crystallizing the DPP-IV polypeptide comprising an amino acid sequence spanning the amino acids 31 to 766 listed in SEQ ID NO:1 comprise the steps of: (a) preparing solutions of the polypeptide and precipitant; (b) growing a crystal comprising molecules of the polypeptide from said mixture solution; and (c) separating said crystal from said solution. The crystallization growth can be carried out by various techniques known by those skilled in the art, such as for example, batch crystallization, liquid bridge, vapor diffusion, crystallization, or dialysis crystallization. Preferably, the crystallization growth is achieved using vapor diffusion techniques.
An embodiment of the present invention provides crystalline compositions of DPP-IV comprising a crystalline form of a polypeptide with an amino acid sequence spanning the amino acids GIy31 to Pro766 listed in SEQ ID NO:1, wherein the crystalline composition has a space group P43212 and unit cell dimensions a=b=68.7 A, c= 421.2 A.
In a second aspect, the present invention provides vectors useful in methods for preparing a substantially purified extracellular domain of DPP-IV comprising the polypeptide with an amino acid sequence spanning amino acids GIy31 to Pro766 listed in SEQ ID NO:1.
Yet another embodiment of the present invention provides a DPP-IV crystal of SEQ ID NO:2, or a homologue, analogue or variant thereof.
In a third aspect, the present invention provides methods for determining the X-ray atomic coordinates of the crystalline compositions at a 2.7A resolution.
In a fourth aspect, the present invention provides a molecule or molecular complex crystal, wherein the crystal has substantially similar atomic coordinates to the atomic coordinates listed in FIG. 2 or portions thereof, or any scalable variations thereof.
In a fifth aspect, the present invention provides a molecule or molecular complex crystal, wherein the crystal comprises a polypeptide with an amino acid sequence spanning the amino acids GIy31 to Pro766 listed in SEQ ID NO:1. A further embodiment of the invention provides a crystal comprising an amino acid sequence that is at least 98% or 95% homologous to a polypeptide with an amino acid sequence spanning the amino acids GIy31 to Pro766 listed in SEQ ID NO:1.
An even further embodiment of the invention provides a crystal comprising an amino acid sequence that is at least 98% or 95% homologous to a polypeptide with an amino acid sequence spanning the amino acids GIy31 to Pro766 listed in SEQ ID NO:1, and having the atomic coordinates listed in FIG. 2.
In a sixth aspect, the present invention provides a molecule or molecular complex crystal, wherein the crystal comprises a polypeptide, or a portion thereof, with atomic coordinates having a root mean square deviation from the protein backbone atoms (N, Ca, C, and 0) listed in FIG. 2 of less than 0.2, 0.5, 0.7, 1.0, 1.2, 1.5, 2.0 or 2.5 A.
40. In a seventh aspect, the present invention provides a scalable, or translatable, three dimensional configuration of points derived from structural coordinates of at least a portion of a DPP-IV molecule or molecular complex comprising a polypeptide with an amino acid sequence spanning the amino acids Gly3l to Pro766 listed in SEQ ID NO:1. In an embodiment of this aspect, the invention also comprises the structural coordinates of at least a portion of a molecule or a molecular complex that is structurally homologous to a DPP-IV molecule or molecular complex. On a molecular scale, the configuration of points derived from a homologous molecule or molecular complex has a root mean square deviation of less than about 0.2, 0.5, 0.7, 1.0, 1.2, 1.5, 2.0 or 2.5 A from the structural coordinates provided in FIG. 2.
In an eighth aspect, the invention provides computers for producing a three-dimensional respresentation of aspect eight of the present invention can be used to design and identify potential ligands or inhibitors of DPP-IV by, for example commercially available molecular modeling software in conjunction with structure-based drug design as provided herein.
In a further aspect, the present invention provides computer for producing three-dimensional representations of:
a. a molecule or molecular complex comprising a polypeptide with an amino acid sequence spanning amino acids GIy31 to Pro766 listed in SEQ ID NO:1, or a homologue, or a variant thereof;

b. a molecule or molecular complex, wherein the atoms of the molecule or molecular complex are represented by atomic coordinates that are substantially similar to, or are subsets of, the atomic coordinates listed in FIG. 2;

c. a molecule or molecular complex, wherein the molecule or molecular complex comprises atomic coordinates having a root mean square deviation of less than 0.2, 0.5, 0.7, 1.0, 1.2 , 1.5, 2.0 or even 2.5 A from the atomic coordinates for the carbon backbone atoms listed in FIG. 2; or d. a molecule or molecular complex, wherein the molecule or molecular complex comprises a binding pocket or site defined by the structure coordinates that are substantially similar to the atomic coordinates listed in FIG. 2, or a subset thereof, or more preferably the structural coordinates in FIG. 2 corresponding to one or more DPP-IV amino acids, or conservative replacements thereof, in SEQ ID
NO:1 selected from GIu205, GIu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740;

wherein said computer comprises:
(i) a computer-readable data storage medium comprising a data storage medium encoded with computer-readable data, wherein said data comprises the structure coordinates of FIG. 2, or portions thereof, or substantially similar coordinates thereof;
(ii) a working memory for storing instructions for processing said computer-readable data;
(iii) a central-processing unit coupled to said working memory and to said computer-readable data storage medium for processing said computer-machine readable data into said three-dimensional representation; and (iv) a display coupled to said central-processing unit for displaying said representation.
In a ninth aspect, the present invention provides methods involving molecular replacement to obtain structural information about a molecule or molecular complex of unknown structure. In one embodiment, the method includes crystallizing the molecule or molecular complex, generating an x-ray diffraction pattern from the crystallized molecule or molecular complex, and applying at least a portion of the structure coordinates set forth in FIG. 2 to the x-ray diffraction pattern to generate a three-dimensional electron density map of at least a portion of the molecule or molecular complex.

In yet another aspect, the present invention provides methods for generating 3-D atomic coordinates of protein homologues, analogues, or variants of DPP-IV using the x-ray coordinates of DPP-IV described in FIG. 2, comprising:

a. identifying one or more homologous polypeptide sequences to DPP-IV;

b. aligning said sequences with the sequence of DPP-IV which comprises a polypeptide with an amino acid sequence spanning amino acids GIy31 to Pro766 listed in SEQ ID
NO:1;

c identifying structurally conserved and structurally variable regions between said homologous sequence(s) and DPP-IV;

d. generating 3-D coordinates for structurally conserved residues of the said homologous sequence(s) from those of DPP-IV using the coordinates listed in FIG. 2;

e. generating conformations for the loops in the structurally variable regions of said homologous sequence(s);

f. building the side-chain conformations for said homologous sequence(s); and g. combining the 3-D coordinates of the conserved residues, loops and side-chain conformations to generate full or partial 3-D coordinates for said homologous sequences.

Embodiments of the ninth aspect provide methods which further comprise refining and evaluating the full or partial 3-D coordinates. These methods may thus be used, for example, to generate 3-dimensional structures for proteins for which 3-dimensional atomic coordinates have not been determined. As such, the newly generated structure can help to elucidate enzymatic mechanisms, or be used in conjunction with other molecular modeling techniques in structure based drug design.
In the tenth aspect, the present invention provides methods for identifying inhibitors, ligands, and the like, of DPP-IV by providing the coordinates of a molecule of DPP-IV to a computerized modeling system; identifying chemical entities that are likely to bind or interact with the molecule (e.g., by screening a small molecule library); and, optionally, procuring or synthesizing and assaying the compounds or analogues derived thereof for bioactivity. Further aspects of the present invention relate to methods for identifying potential ligands for DPP-IV or homologues, or analogue or variants thereof comprising:

a. displaying the three dimensional structure of DPP-IV enzyme or homologue or analogue or variant thereof, as defined by atomic coordinates that are substantially similar to the atomic coordinates listed in FIG. 2 on a computer display screen;

b. optionally replacing one or more the enzyme amino acid residues listed in SEQ ID NO:1, or preferably one or more amino acid residues selected from GIu205, GIu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740, in said three-dimensional structure with a different naturally occurring amino acid or an unnatural amino acid to display a variant structure;

c. optionally conducting ab intio, molecular mechanics or molecular dynamics calculations on the displayed three dimensional structure to generate a modified structure;

d. employing said three-dimensional structure, variant structure, or modified structure to design or select said ligand;

d. synthesizing or obtaining said ligand;

e. contacting said ligand with said enzyme in the presence of one or more substrates; and f. measuring the ability of said ligand to modulate the activity of said enzyme.

Those of skill in the art can appreciate that the information obtained by the methods for identifying inhibitors and ligands of DPP-IV, as described above, can be used to iteratively refine or modify the structure of original ligand. Thus, once a ligand is found to modulate the activity of said enzyme, the structural aspects of the ligand may be modified to generate a structural analog of the ligand. This analog can then be used in the above methods to identify binding ligands. One of ordinary skill in the art will know the various ways a structure may be modified.
In embodiments, the methods further comprise computationally modifying the structure of the ligand; computationally determining the fit of the modified ligand using the three-dimensional coordinates described in FIG. 2, or portions thereof; contacting said modified ligand with said enzyme, or homologue, or variant thereof in an in vitro or in vivo setting; and measuring the ability of said ligand to modulate the activity of said enzyme.
In an eleventh aspect, the present invention provides compositions, such as, pharmaceutical compositions comprising the inhibitors or ligands designed according to any of the methods of the present invention. In one embodiment, a composition is provided that includes an inhibitor or ligand designed or identified by any of the above methods. In another embodiment, the composition is a pharmaceutical composition.
The twelfth aspect of the present invention are methods for treating Type 2 diabetes, Type 1 diabetes, impaired glucose tolerance, hyperglycemia, metabolic syndrome (syndrome X and/or insulin resistance syndrome), glucosuria, metabolic acidosis, arthritis, cataracts, diabetic neuropathy, diabetic nephropathy, diabetic retinopathy, diabetic cardiomyopathy, obesity, conditions exacerbated by obesity, hypertension, hyperlipidemia, atherosclerosis, osteoporosis, osteopenia, frailty, bone loss, bone fracture, acute coronary syndrome, short stature due to growth hormone deficiency, infertility due to polycystic ovary syndrome, anxiety, depression, insomnia, chronic fatigue, epilepsy, eating disorders, chronic pain, alcohol addiction, diseases associated with intestinal motility, ulcers, irritable bowel syndrome, inflammatory bowel syndrome; short bowel syndrome; and the prevention of disease progression in Type 2 diabetes, comprising administering pharmaceutical compositions, identified by structure based design using the atomic coordinates, or portions thereof, listed in FIG. 2, effective in treating the disorders or conditions.

BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is an orthogonal view of an embodiment of DPP-IV shown in a ribbon representation.
The N- and C-termini of the polypeptide are also depicted.
Figure 2 is a list of the X-ray coordinates of a DPP-IV crystal as described in the Examples.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to crystalline compositions of DPP-IV, 3-D X-ray atomic coordinates of said crystalline compositions, methods of preparing said compositions, methods of determining the 3-D
X-ray atomic coordinates of said crystalline compositions, and methods of using said atomic coordinates in conjunction with computational methods to identify binding site(s), or identify ligands which interact with said binding site(s) to agonize or antagonize DPP-IV.
For convenience, certain terms employed in the specification, examples, and appendant claims are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the arts.
The term "affinity' as used herein refers to the tendency of a molecule to associate with another.
The affinity of a drug is its ability to bind to its biological target (receptor, enzyme, transport system, etc.) For pharmacological receptors, affinity can be thought of as the frequency with which the drug, when brought into the proximity of a receptor by diffusion, will reside at a position of minimum free energy within the force field of that receptor.
The term "agonist" as used herein refers to an endogenous substance or a drug that can interact with a receptor and initiate a physiological or a pharmacological response characteristic of that receptor (contraction, relaxation, secretion, enzyme activation, etc.) The term "analog" as used herein refers to a drug or chemical compound whose structure is related in some way to that of another drug or chemical compound, but whose chemical and biological properties may be quite different.
The term "antagonist" as used herein refers to a drug or a compound that opposes the physiological effects of another. At the receptor level, it is a chemical entity that opposes the receptor-associated responses normally induced by another bioactive agent.
The term "asymmetric unit" refers to the basic motif, which is repeated in 3-D
space by the symmetry operators of the crystallographic space group, of which the coordinated of the structure are determined. It is the smallest part of the crystal structure from which the complete structure can be built using space group symmetry.
As used herein the term "binding site" refers to a specific region (or atom) in a molecular entity that is capable of entering into a stabilizing interaction with another molecular entity. In certain embodiments the term also refers to the reactive parts of a macromolecule that directly participate in its specific combination with another molecule. In other embodiments, a binding site may be comprised or defined by the three dimensional arrangement of one or more amino acid residues within a folded polypeptide. In yet further embodiments, the binding site further comprises prosthetic groups, water molecules or metal ions which may interact with one or more amino acid residues. Prosthetic groups, water molecules, or metal ions may be apparent from X-ray crystallographic data, or may be added to an apo protein or enzyme using in silico methods.
The term "bioactivity' refers to DPP-IV activity that exhibits a biological property conventionally associated with a DPP-IV agonist or antagonist, such as a property that would allow treatment of one or more of the various diseases such as, for example, diabetes, glucose tolerance, obesity, appetite regulation, lipidemia, osteoporosis, neuropeptide metabolism and T-cell activation, among others.

The term "catalytic domain" as used herein, refers to the catalytic domain of the DPP-IV class of enzymes, which features a conserved segment of amino acids in the carboxy-terminal portion of the proteins, wherein this segment has been demonstrated to include the catalytic site of these enzymes.
This conserved catalytic domain extends approximately from residue 552 to 766 of the full-length enzyme of DPP-IV (SEQ ID NO:1).
"To clone" as used herein, means obtaining exact copies of a given polynucleotide molecule using recombinant DNA technology. Furthermore, "to clone into" may be meant as inserting a given first polynucleotide sequence into a second polynucleotide sequence, preferably such that a functional unit combining the functions of the first and the second polynucleotides results.
For example, without limitation, a polynucleotide from which a fusion protein may be translationally provided, which fusion protein comprises amino acid sequences encoded by the first and the second polynucleotide sequences.
Specifics of molecular cloning can be found in a number of commonly used laboratory protocol books such as Molecular Cloning: A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989).
The term "co-crystallization" as used herein is taken to mean crystallization of a preformed protein/ligand complex.
The term "complex" or "co-complex" are used interchangeably and refer to a DPP-IV molecule, or a variant, or homologue of DPP-IV in covalent or non-covalent association with a substrate, ligand, inhibitor.
The term "contacting" as used herein applies to in silico, in vitro, and/or in vivo experiments.
"Diseases" and particularly "diseases that are associated with proteins that are subject to processing by DPP-IV", include, but are not limited to, for example, Type 2 diabetes, Type 1 diabetes, impaired glucose tolerance, hyperglycemia, metabolic syndrome (syndrome X
and/or insulin resistance syndrome), glucosuria, metabolic acidosis, arthritis, cataracts, diabetic neuropathy, diabetic nephropathy, diabetic retinopathy, diabetic cardiomyopathy, obesity, conditions exacerbated by obesity, hypertension, hyperlipidemia, atherosclerosis, osteoporosis, osteopenia, frailty, bone loss, bone fracture, acute coronary syndrome, short stature due to growth hormone deficiency, infertility due to polycystic ovary syndrome, anxiety, depression, insomnia, chronic fatigue, epilepsy, eating disorders, chronic pain, alcohol addiction, diseases associated with intestinal motility, ulcers, irritable bowel syndrome, inflammatory bowel syndrome; short bowel syndrome; and the prevention of disease progression in Type 2 diabetes.
The term "extracellular domain" as used herein, refers to the extracellular domain of DPP-IV, which features a conserved segment of amino acids, whereby this segment has been demonstrated to include glycosylation sites, a cysteine-rich region and the catalytic active site. This conserved extracellular domain extends approximately from residue GIy31 to Pro766 of the full length enzyme (SEQ
ID NO:1).
As used herein, the terms "gene", "recombinant gene" and "gene construct"
refer to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences. The term "intron" refers to a DNA sequence present in a given gene which is not translated into protein and is generally found between exons.

"Human DPP-IV" (hDPP-IV) is a cell surface type-II membrane glycoprotein and is also called adenosine deaminase (ADA) binding protein or CD26, which is known as a T-cell activation antigen.

hDPP-IV is a single polypeptide chain of 766 amino acids, which consists if five regions: a cytoplasmic region (residues about 1-6), a transmembrane region (residues about 7-28), a highly gycosylated region (residues about 29-323), a cysteine-rich region (residues about 324-551), and a catalytic region (residues about 552-766) (Hiramatsu et al., (2003)).
The term "high affinity" as used herein means strong binding affinity between molecules with a dissociation constant KD of no greater than 1uM. In a preferred case, the KD
is less than 100 nM, 10 nM, 1 nM, 100 pM, or even 10 pM or less. In a most preferred embodiment, the two molecules can be covalently linked (Kp is essentially 0).
The term "homologue" as used herein means a protein, polypeptide, oligopeptide, or portion thereof, having preferably at least 95% amino acid sequence identity with DPP-IV enzyme as described in SEQ ID NO: 1 or SEQ ID NO:2 or with any extracellular domain described herein, or with any functional or structural domain of lipid binding protein. SEQ ID NO:1 is the full-length amino acid sequence of a wild-type human DPP-IV, while SEQ ID NO:2 is the hDPP-IV construct including residues 31-766 which, as described in the Examples, was purified, expressed and crystallized. Those of skill in the art understand that a set of structure coordinates determined by X-ray crystallography is not without standard error. As used herein, and for the purpose of this invention, the term "substantially similar atomic coordinates" or atomic coordinates that are "substantially similar" refers to any set of structure coordinates of DPP-IV or DPP-IV homologues, or DPP-IV variants, polypeptide fragments, described by atomic coordinates that have a root mean square deviation for the atomic coordinates of protein backbone atoms (N, Ca, C, and 0) of less than about 2.5, 2.0 1.5, 1.2, 1.0, 0.7, 0.5, or even 0.2 A when superimposed using backbone atoms of structure coordinates listed in FIG. 2. For the purpose of this invention, structures that have substantially similar coordinates as those listed in FIG. 2 shall be considered identical to the coordinates listed in FIG. 2. The term "substantially similar" also applies to an assembly of amino acid residues that may or may not form a contiguous polypeptide chain, but whose three dimensional arrangement of atomic coordinates have a root mean square deviation for the atomic coordinates of protein backbone atoms (N, Ca, C, and 0), or the side chain atoms, of less than about 2.5, 2.0, 1.5, 1.2, 1.0, 0.7, 0.5, or even 0.2 A
when superimposed-using backbone atoms, or the side chain atoms- of the atomic coordinates of similar or the same amino acids from the coordinates listed in FIG. 2. Those skilled in the art further understand that the coordinates listed in FIG. 2 or portions thereof may be transformed into a different set of coordinates using various mathematical algorithms without departing from the present invention. For example, the coordinates listed in Fig. 2, or portions thereof, may be transformed by algorithms which translate or rotate the atomic coordinates. Alternatively, molecular mechanics, molecular dynamics or ab intio algorithms may modify the atomic coordinates. Atomic coordinates generated from the coordinates listed in FIG. 2, or portions thereof, using any of the aforementioned algorithms shall be considered identical to the coordinates listed in FIG. 2.
The term "in silico" as used herein refers to experiments carried out using computer simulations.
In an embodiments, the in silico methods are molecular modeling methods wherein 3-dimensional models of macromolecules or ligands are generated. In other embodiments, the in silico methods comprise computationally assessing ligand binding interactions.
The term "ligand" describes any molecule, e.g., protein, peptide, peptidomimetics, oligopeptide, small organic molecule, polysaccharide, polynucleotide, etc., which binds or interacts, generally but not necessarily specifically to or with another molecule. In one aspect the ligand is an agonist, whereby the molecule upregulates (i.e., activates or stimulates, e.g., by agonizing or potentiating) activity, while in another aspect of the invention the ligand is an inhibitor or antagonist, whereby the molecule down regulates (i.e., inhibits or suppresses, e.g. by antagonizing, decreasing or inhibiting) the activity.
The term "modulate" as used herein refers to both upregulation (i.e., activation or stimulation, e.g., by agonizing or potentiating) and down-regulation (i.e., inhibition or suppression, e.g., by antagonizing, decreasing or inhibiting) of a bioactivity.
The term "pharmacophore" as used herein refers to the ensemble of steric and electronic features of a particular structure that is necessary to ensure the optimal supramolecular interactions with a specific biological target structure and to trigger (or to block) its biological response. In an embodiments, a pharmacophore is an abstract concept that accounts for the common molecular interaction capacities of a group of compounds towards their target structure. In yet a further embodiments, the term can be considered as the largest common denominator shared by a set of active molecules. Pharmacophoric descriptors are used to define a pharmacophore, including H-bonding, hydrophobic and electrostatic interaction sites, defined by atoms, ring centers and virtual points.
Accordingly, in the context of enzyme ligands, such as for example agonists or antagonists, a pharmacophore may represent an ensemble of steric and electronic factors which are necessary to insure supramolecular interactions with a specific biological target structure. As such, a pharmacophore may represent a template of chemical properties for an active site of a protein/enzyme representing these properties' spatial relationship to one another that theoretically defines a ligand that would bind to that site.
The term "precipitant" as used herein includes any substance that, when added to a solution, causes a precipitate to form or crystals to grow. Examples of suitable precipitants include, but are not limited to, alkali (e.g., Li, Na, or K), or alkaline earth metal (e.g., Mg, or Ca) salts, and transition metal (e.g., Mn, or Zn) salts. Common counter ions to the metal ions include, but are not limited to, halides, phosphates, citrates and sulfates.
The term "prodrug" as used herein refers to drugs that, once administered, are chemically modified by metabolic processes to become pharmaceutically active. In certain embodiments the term also refers to any compound that undergoes biotransformation before exhibiting its pharmacological effects. Prodrugs can thus be viewed as drugs containing specialized non-toxic protective groups used in a transient manner to alter or to eliminate properties, usually undesirable, in the parent molecule.
The term "receptor" as used here in refers to a protein or a protein complex in or on a cell that specifically recognizes and binds to a compound acting as a molecular messenger (neurotransmitter, hormone, lymphokine, lectin, drug, etc.). In a broader sense, the term receptor is used interchangeably with any specific (as opposed to non-specific, such as binding to plasma proteins) drug binding site, also including nucleic acids such as DNA.
The term "recombinant protein" refers to a polypeptide which is produced by recombinant DNA
techniques, wherein generally, DNA encoding a polypeptide is inserted into a suitable expression vector which is, in turn, used to transform a host cell to produce the polypeptide encoded by the DNA. This polypeptide may be one that is naturally expressed by the host cell, or it may be heterologous to the host cell, or the host cell may have been engineered to have lost the capability to express the polypeptide which is otherwise expressed in wild type forms of the host cell. The polypeptide may also be, for example, a fusion polypeptide. Moreover, the phrase "derived from", with respect to a recombinant gene, is meant to include within the meaning of "recombinant protein" those proteins having an amino acid sequence of a native polypeptide, or an amino acid sequence similar thereto which is generated by mutations, including substitutions, deletions and truncation, of a naturally occurring form of the polypeptide.
As used herein, the term "selective DPP-IV inhibitor" refers to a substance, such as for example, an organic molecule, that effectively inhibits an enzyme from the DDP-IV
family to a greater extent than any other DPP enzyme. A selective DPP-IV inhibitor is a substance, having a K;
for inhibition of DPP-IV
that is less than about one-half, one-fifth, or one-tenth the K; that the substance has for inhibition of any other DPP enzyme. In other words, the substance inhibits DPP-IV activity to the same degree at a concentration of about one-half, one-fifth, one-tenth or less than the concentration required for any other DPP enzyme. In general a substance is considered to effectively inhibit DPP-IV
if it has an IC50 or K; of less than or about 10 mM, 1 mM, 500 nM, 100 nM, 50 nM or 10 nM.
As used herein the term "small molecules" refers to drugs as they are orally available (unlike proteins which must be administered by injection, topically or inhalation).
The size of the small molecules is generally under 1000 Daltons, but many estimates seem to range between 300 to 700 Daltons.
The term "space group" refers to the lattice and symmetry of the crystal. In a space group designation the capital letter indicates the lattice type and the other symbols represent symmetry operations that can be carried out on the contents of the asymmetric unit without changing its appearance.
By "therapeutically effective" amount is meant that amount which is capable of at least partially reversing and/or treat the symptoms of the disease. A therapeutically effective amount can be determined on an individual basis and will be based, at least in part, on a consideration of the species of the mammal, the size of the mammal, the type of delivery system used, and the type of administration relative to the progression of the disease. A therapeutically effective amount can be determined by one of ordinary skill in the arts.
As used herein, the term "transfection" means the introduction of a nucleic acid, e.g., via an expression vector, into a recipient cell by nucleic acid-mediated gene transfer. "Transformation" refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA
and, for example, the transformed cell expresses a recombinant form of a polypeptide or, in the case of anti-sense expression from the transferred gene, the expression of a naturally-occurring form of the polypeptide is disrupted.
The term "variants" in relation to the polypeptide sequence in SEQ ID NO:1 or SEQ ID NO:2 include any substitution of, variation of, modification of, replacement of, deletion of, or addition of one or more amino acids from or to the sequence providing a resultant polypeptide sequence for an enzyme having DPP-IV activity. Preferably the variant, homologue, fragment or portion, of SEQ ID NO:1 or SEQ
ID NO:2, comprises a polypeptide sequence of at least 5 contiguous amino acids, preferably at least 10 contiguous amino acids, preferably at least 15 contiguous amino acids, preferably at least 20 contiguous amino acids, preferably at least 25 contiguous amino acids, or preferably at least 30 contiguous amino acids.

The term 'Yector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Suitable host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strengths and specificities. As those depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA
loops which, in their vector form are not bound to the chromosome. In the present specification, "plasmid"
and "vector" are used interchangeably as the plasmid is the most commonly used form of vector.
However, the invention is intended to include such othErr forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
The following amino acid abbreviations are used throughout this disclosure:
A = Ala = Alanine T = Thr = Threonine V = Val = Valine C = Cys = Cysteine L = Leu = Leucine Y = Tyr = Tyrosine I= Ile = Isoleucine N = Asn = Asparagine P = Pro = Proline Q = Gln = Glutamine F = Phe = Phenylalanin D = Asp = Aspartic Acid W Trp = Tryptophan E = Glu = Glutamic Acid M Met = Methionine K = Lys = Lysine G Gly = Glycine R = Arg = Arginine S Ser = Serine H = His = Histidine A. Clones and Expressions As would be appreciated by those skilled in the art, the nucleotide sequence coding for a DPP-IV
polypeptide, or a functional fragment, including the C-terminal peptide fragment of the catalytic domain of DPP-IV protein, and/or derivatives or analogs thereof, including a chimeric protein, thereof, can be inserted into a suitable expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. The elements mentioned above are termed herein a "promoter." Thus, the nucleic acid encoding a DPP-IV
polypeptide of the invention or a functional fragment comprising the extracellular domain of of the DPP-IV
protein, or a homologue, an analog, or variant thereof, is operationally associated with a promoter in an expression vector of the invention. In preferred embodiments, the expression vector contains the nucleotide sequence coding for the polypeptide comprising the amino acid sequence spanning amino acids GIy31 to Pro766 listed in SEQ
ID NO:1. Both cDNA and genomic sequences can be cloned and expressed under the control of such regulatory sequences. An expression vector also preferably includes a replication origin. The necessary transcriptional and translational signals can be provided on a recombinant expression vector. As detailed below, all genetic manipulations described for the DPP-IV gene in this section, may also be employed for genes encoding a functional fragment, including the C-terminal peptide fragment of the catalytic domain of the DPP-IV protein, derivatives or analogs thereof, including a chimeric protein thereof.

Suitable host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus);
microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strengths and specificities. As those depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used.
A recombinant DPP-IV protein of the invention may be expressed chromosomally, after integration of the coding sequence by recombination. In this regard, any of a number of amplification systems may be used to achieve high levels of stable gene expression. (See Sambrook et al., 1989, infra).
A suitable cell for purposes of this invention is one into which the recombinant vector comprising the nucleic acid encoding DPP-IV protein is cultured in an appropriate cell culture medium under conditions that provide for expression of DPP-IV protein by the cell.
Any of the methods previously described for the insertion of DNA fragments into a cloning vector may be used to construct expression vectors containing a gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques, and in vivo recombination (genetic recombination).
Expression of the DPP-IV protein may be controlled by any promoter/enhancer element known in the art, provided that these regulatory elements must be functional in the host selected for expression, as would be appreciated by those of skill in the art.
Vectors containing a nucleic acid encoding a DPP-IV protein of the invention can be identified, for example, by four general approaches: (1) PCR amplification of the desired plasmid DNA or specific mRNA; (2) nucleic acid hybridization; (3) presence or absence of selection marker gene functions; and (4) expression of inserted sequences. The invention is further intended to include other forms of identification of vectors, containing a nucleic acid encoding a DPP-IV protein of the present invention, which serve equivalent functions and which become known in the art subsequently hereto. In the first approach, the nucleic acids can be amplified by PCR to provide for detection of the amplified product. In the second approach, the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted marker gene. In the third approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "selection marker" gene functions (e.g., beta-galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector. In another example, if the nucleic acid encoding DPP-IV protein is inserted within the "selection marker" gene sequence of the vector, recombinant vectors containing the DPP-IV protein insert can be identified by the absence of the DPP-IV
protein gene function. In the fourth approach, recombinant expression vectors can be identified by assaying for the activity, biochemical, or immunological characteristics of the gene product expressed by the recombinant vector, provided that the expressed protein assumes a functionally active conformation.
A wide variety of host/expression vector combinations may be employed in expressing the DNA
sequences of this invention as known by those of skill in the art.

Once a particular recombinant DNA molecule is identified and isolated, several methods known in the art may be used to propagate it. Once a suitable host system and growth conditions are established, recombinant expression vectors can be propagated and prepared in quantity. As noted above, the expression vectors which can be used include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus;
insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda); and plasmid and cosmid DNA vectors, to name but a few.
Vectors can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE
dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA
vector transporter (see, e.g., Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem.
263:14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,311, filed Mar. 15, 1990).

B. Crystal and Space Groups X-ray structure coordinates define a unique configuration of points in space.
Those skilled in the art understand that a set of structure coordinates for a protein or a protein/ligand complex, or a portion thereof, define a relative set of points that, in turn, define a configuration in three dimensions. A similar or identical configuration can be defined by an entirely different set of coordinates, provided the distances and angles between atomic coordinates remain essentially the same. In addition, a scalable configuration of points can be defined by increasing or decreasing the distances between coordinates by a scalar factor while keeping the angles essentially the same.
One aspect of the present invention relates to a crystalline composition comprising a polypeptide with an amino acid sequence spanning amino acids GIy31 to Pro766 listed in SEQ
ID NO:1.
In another embodiment, the crystallized complex is characterized by the structural coordinates listed in FIG. 2, or portions thereof. In yet a further embodiments, the atoms of the ligand are within about 5 angstroms of one or more DPP-IV amino acids in SEQ ID NO: 1 preferably selected from GIu205, GIu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740. One embodiment of the crystallized complex is characterized as belonging to the space group P43212 and unit cell dimensions a=b=68.7 A, c= 421.2 A, a=R=y=90.0 . This embodiment is encompassed by the structural coordinates of FIG. 2. The ligand may be a small molecule which binds to DPP-IV extracelluar domain defined by SEQ
ID NO:2, or portions thereof, with a K; of less than about 10 mM, 1 mM, 500 nM, 100 nM, 50 nM, or 10 nM.
Various computational methods can be used to determine whether a molecule or a binding pocket portion thereof is "structurally equivalent," defined in terms of its three-dimensional structure, to all or part of DPP-IV or its binding pocket(s). Such methods may be carried out in current software applications, such as the molecular similarity application of QUANTA (Accelrys Inc., San Diego, Calif.). The molecular similarity application permits comparisons between different structures, different conformations of the same structure, and different parts of the same structure. The procedure used in molecular similarity to compare structures is divided into four steps: (1) load the structures to be compared; (2) optionally define the atom equivalences in these structures; (3) perform a fitting operation;
and (4) analyze the results.
Each structure is identified by a name. One structure is identified as the target (i.e., the fixed structure), while all remaining structures are working structures (i.e., moving structures). Since atom equivalency within molecular similarity applications is defined by user input, for the purpose of this invention equivalent atoms are defined as protein backbone atoms (N, Ca, C, and 0) for all conserved residues between the two structures being compared. A conserved residue is defined as a residue that is structurally or functionally equivalent (See Table 4 infra). In further embodiments rigid fitting operations are considered.
In other embodiments, flexible fitting operations may be considered.
When a rigid fitting method is used, the working structure is translated and rotated to obtain an optimum fit with the target structure. The fitting operation uses an algorithm that computes the optimum translation and rotation to be applied to the moving structure, such that the root mean square deviation of the fit over the specified pairs of equivalent atoms is an absolute minimum.
This number, given in angstroms (A), is reported by the molecular similarity application.
Any molecule or molecular complex or binding pocket thereof, or any portion thereof, that has a root mean square deviation of conserved residue backbone atoms (N, Ca, C, and 0) of less than about 2.5, 2.0, 1.5 A, 1.0 A, 0.7 A, 0.5 A or even 0.2 A, when superimposed on the relevant backbone atoms described by the reference structure coordinates listed in FIG. 2, is considered "structurally equivalent" to the reference molecule. That is to say, the crystal structures of those portions of the two molecules are substantially identical, within acceptable error. Particularly preferred structurally equivalent molecules or molecular complexes are those that are defined by the entire set of structural coordinates listed in FIG. 2, plus or minus a root mean square deviation from the conserved backbone atoms of those amino acids of not more than 2.5 A. More preferably, the root mean square deviation is less than about 1.0 A.
The term "root mean square deviation" means the square root of the arithmetic mean of the squares of the deviations. It is a way to express the deviation or variation from a trend or object. For purposes of this invention, the "root mean square deviation" defines the variation in the backbone of a protein from the backbone of DPP-IV or a binding pocket portion thereof, as defined by the structural coordinates of DPP-IV described herein.
The refined x-ray coordinates of the extracellular domain of DDP-IV (amino acids 38 to 766 as listed in SEQ ID NO:2), Znz+, Mg2+, and 32 water molecules are as listed in FIG. 2.
One orthogonal view of the molecule is shown in FIG. 1.

The crystal structure of the extracellular domain (amino acids 31-766 of SEQ
ID NO:1) was solved to a resolution 2.7 A. The asymmetric unit is composed of one dimer. In the structure of the present invention the structure includes two domains, the f3-propeller domain (residues 55-497) and the catalytic domain (residues 508-766), together with a couple of linker regions (1-54 and 498-507). The propeller domain packs against the hydrolase domain, and the catalytic triad of DPP-IV composed of residues Ser630, His740 and Asp708, which are located which the last 140 residues of the C-terminal region is at the interface of the two domains.
The present invention provides a molecule or molecular complex that includes at least a portion of a DDP-IV and/or substrate binding pocket. In one embodiment, the DDP-IV
binding pocket includes the amino acids listed in Table 1, the binding pocket being defined by a set of points having a root mean square deviation of less than about 2.5, 2.0, 1.5, 1.2, 1.0, 0.7, 0.5, or even 0.2 A, from points representing the backbone atoms of the amino acids in Table 1. In another embodiment, the DPP-IV substrate binding pocket includes the amino acids selected from GIu205, GIu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740 from SEQ ID NO:1.

Table 1: Identified residues 5 A away from the binding pocket of the DPP-IV
crystal structure.
Arg125 His126 Trp201 G1u205 Glu206 Va1207 Phe208 Ser209 A1a210 Tyr256 Arg356 Phe357 Arg358 Tyr547 Gly549 Pro550 Ser551 Tyr558 Trp627 Trp629 Ser630 Tyr631 Va1653 A1a654 Va1656 Tyr662 Asp663 Tyr666 Asn710 Va171 1 GIn715 His740 G1y741 11e742 His748 Tyr752 C. Isolated Polypeptides and Variants One embodiment of the invention describes an isolated polypeptide consisting of a portion of DPP-IV which functions as the binding site when folded in a 3-D orientation.
One embodiment is an isolated polypeptide comprising a portion of DPP-IV, wherein the portion starts at about amino acid residue GIy31, and ends at about amino acid residue Pro766 as described in SEQ
ID NO:1, or a sequence that is at least 95% or 98% homologous to a polypeptide with an amino acid sequence spanning amino acids GIy31 to Pro766 as listed in SEQ ID NO:1.
Another embodiment comprises crystalline compositions comprising variants of DPP-IV. Variants of the present invention may have an amino acid sequence that is different by one or more amino acid substitutions to the sequence disclosed in SEQ ID NO:1 or SED ID NO:2.
Embodiments which comprise amino acid deletions and/or additions are also provided. The variant may, for example, have conservative changes (amino acid similarity), wherein a substituted amino acid has similar structural or chemical properties, for example, the replacement of leucine with isoleucine. Those skilled in the art will understand that determining which and how many amino acid residues may be substituted, inserted, or deleted without adversely affecting biological or pharmacological activity may be reasonably inferred in view of this disclosure, and may further be found using computer programs well known in the art, for example, DNAStar software (DNAStar Inc. Madison, WI).
As those silled in the art will appreciate, amino acid substitutions may be made, for instance, on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues provided that a biological and/or pharmacological activity of the native molecule is retained.
Negatively charged amino acids include aspartic acid and glutamic acid;
positively charged amino acids include lysine and arginine; amino acids, with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, and valine; amino acids with aliphatic head groups include glycine, alanine; asparagine, glutamine, serine; and amino acids with aromatic side chains include threonine, phenylalanine, and tyrosine.
Examples of conservative substitutions are set forth in Table 4 as follows:

Table 4:
Original Residue Example conservative substitutions Ala (A) Gly; Ser; Val; Leu; Ile; Pro Arg (R) Lys; His; Gln; Asn Asn (N) Gln; His; Lys; Arg Asp(D) Glu Cys (C) Ser Gln (Q) Asn Glu (E) Asp Gly (G) Ala; Pro His (H) Asn; Gln; Arg; Lys Ile (I) Leu; Val; Met; Ala; Phe Leu (L) Ile; Val; Met; Ala; Phe Lys (K) Arg; Gln; His; Asn Met (M) Leu; Tyr; Ile; Phe Phe (F) Met; Leu; Tyr; Val; Ile; Ala Pro (P) Ala; Gly Ser(S) Thr Thr(T) Ser Trp (W) Tyr; Phe Tyr (Y) Trp; Phe; Thr; Ser Val (V) Ile; Leu; Met; Phe; Ala "Homology" is a measure of the identity of nucleotide sequences or amino acid sequences. To characterize the homology, subject sequences are aligned so that the highest percentage homology (match) is obtained, after introducing gaps, if necessary, to achieve maximum percent homology. N- or C-terminal extensions shall not be construed as affecting homology. "Identity' per se has an art-recognized meaning and can be calculated using published techniques. Computer program methods to determine identity between two sequences, for example, include DNAStarO software; the GCGO program package (Devereux, J., et al. Nucleic Acids Research (1984) 12(1): 387); BLASTP, BLASTN, FASTA (Atschul, S.F.
et al., J. Molec Biol (1990) 215: 403). Homology (identity) as defined herein is determined conventionally using the well-known computer program, BESTFITO (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI, 53711).
When using BESTFITO or any other sequence alignment program (such as the Clustal algorithm from MegAlign software (DNAStarO)) to determine whether a particular sequence is, for example, about 95%
homologous to a reference sequence, according to the present invention, the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence or amino acid sequence and that gaps in homology of up to about 90% of the total number of nucleotides in the reference sequence are allowed.

Ninety percent homology is therefore determined, for example, using the BESTFITO program with parameters set such that the percentage of identity is calculated over the full length of the reference sequence, e.g., SEQ ID NO:1, and wherein up to 5% of the amino acids in the reference sequence may be substituted with another amino acid. Percent homologies are likewise determined, for example, to identify preferred species, within the scope of the claims appended hereto, which reside within the range of about 95% to 100% homology to SEQ ID NO:1 as well as the binding site thereof. As noted above, N-or C-terminal extensions shall not be construed as affecting homology. Thus, when comparing two sequences, the reference sequence is generally the shorter of the two sequences. This means that, for example, if a sequence of 50 nucleotides in length with precise identity to a 50 nucleotide region within a 100 nucleotide polynucleotide is compared, there is 100% homology as opposed to only 50% homology.
Although the natural polypeptide of SEQ ID NO:1 and a variant polypeptide may only possess a certain percentage identity, e.g., 95%, they are actually likely to possess a higher degree of similarity, depending on the number of dissimilar codons that are conservative changes.
Conservative amino acid substitutions can frequently be made in a protein without altering either the conformation or function of the protein. Similarity between two sequences includes direct matches as well a conserved amino acid substitutes which possess similar structural or chemical properties, e.g., similar charge as described in Table 2.
Percentage similarity (conservative substitutions) between two polypeptides may also be scored by comparing the amino acid sequences of the two polypeptides by using programs well known in the art, including the BESTFIT program, by employing default settings for determining similarity.
A further embodiment of the invention is a crystal comprising the coordinates of FIG. 2, wherein the amino acid sequence is represented by SEQ ID NO:1. A further embodiment of the invention is a crystal comprising the coordinates of FIG.2, wherein the amino acid sequence is at least 95% or 98%
homologous to the amino acid sequence represented by SEQ ID NO:1.
Various methods for obtaining atomic coordinates of structurally homologous molecules and molecular complexes using homology modeling are disclosed in, for example, US
Patent No: 6,356,845.
D. Structure Based Drug Design Once the three-dimensional structure of a crystal comprising a DPP-IV protein, a functional domain thereof, homologue, analogue or variant thereof, is determined, a ligand (antagonist or agonist) may be examined through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK (See for example, Morris et al., J. Computational Chemistry, 19:1639-1662 (1998)). This procedure can include in silico fitting of potential ligands to the DPP-IV crystal structure to ascertain how well the shape and the chemical structure of the potential ligand will complement or interfere with the catalytic domain of DPP-IV. (Bugg et al., Scientific American, December:92-98 (1993);
West et al., TIPS, 16:67-74 (1995)). As those of skill in the art can appreciate, computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of the ligand to the binding site. Generally the tighter the fit (e.g., the lower the steric hindrance, and/or the greater the attractive force) the more potent the potential drug will be since these properties are consistent with a tighter binding constant. Furthermore, the more specificity in the design of a potential drug the more likely that the drug will not interfere with the properties of other proteins. This will minimize potential side-effects due to unwanted interactions with other proteins.

One embodiment of the present invention relates to methods of identifying agents that bind to a binding site on DPP-IV extracellular domain wherein the binding site comprises amino acid residues GIu205, GIu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740 of SEQ ID NO:1, comprising: contacting DPP-IV with a test ligand under conditions suitable for binding of the test compound to the binding site, and determining whether the test ligand binds in the binding site, wherein if binding occurs, the test ligand is an agent that binds in the binding site. In further embodiments, the testing may be carried out in silico using a variety of molecular modeling software algorithms including, but not limited to, DOCK, ALADDIN, CHARMM simulations, AFFINITY, C2-LIGAND FIT, Catalyst, LUDI, CAVEAT, and CONCORD. (Brooks, et al. CHARMM: a program for macromolecular energy, minimization, and dynamics calculations. J Comp.Chem 1983, 4:187-217; E.C. Meng, B.K. Shoichet & I.D.
Kuntz. Automated docking with grid-based energy evaluation. J Comp Chem 1992, 13:505-524.
In another embodiment, a potential ligand may be obtained by screening a random peptide library produced by a recombinant bacteriophage (Scott and Smith, Science, 249:386-390 (1990); Cwirla et al., Proc. Natl. Acad. Sci., 87:6378-6382 (1990); Devlin et al., Science, 249:404-406 (1990)) or a chemical library, or the like. A ligand selected in this manner can be then be systematically modified by computer modeling programs until one or more promising potential ligands are identified. Such analysis, for example, has been shown to be effective in the development of HIV protease inhibitors. (Lam et al., Science 263:380-384 (1994); Wlodawer et al., Ann. Rev. Biochem. 62:543-585 (1993); Appelt, Perspectives in Drug Discovery and Design 1:23-48 (1993); Erickson, Perspectives in Drug Discovery and Design 1:109-128 (1993)).
Computer modeling allows the selection of a finite number of rational chemical modifications, as opposed to the countless number of essentially random chemical modifications that could be made, of which any one might lead to a useful drug. Each chemical modification requires additional chemical steps, which while being reasonable for the synthesis of a finite number of compounds, quickly becomes overwhelming if all possible modifications needed to be synthesized are actually synthesized. Thus, through the use of the three-dimensional structure disclosed herein and computer modeling, a large number of these compounds can be rapidly screened on a computer monitor screen, and a few likely candidates can be determined without the laborious synthesis of untold numbers of compounds.
Once a potential ligand (agonist or antagonist) is identified, it can be either selected from a library of chemicals as are commercially available from most large chemical companies or, alternatively, the potential ligand may be synthesized de novo. As mentioned above, the de novo synthesis of one or even a relatively small group of specific compounds is reasonable in the art of drug design. The potential ligand can be placed into any standard binding assay as well known to those skilled in the art to test its effect on DPP-IV activity.
When a suitable drug is identified, a supplemental crystal can be grown comprising a protein-ligand complex formed between a DPP-IV protein and the drug. Preferably the crystal diffracts X-rays allowing the determination of the atomic coordinates of the protein-ligand complex to a resolution of less than 5.0 Angstroms, more preferably less than 3.0 Angstroms, and even more preferably less than 2.0 Angstroms. The three-dimensional structure of the supplemental crystal can be determined by Molecular Replacement Analysis. Molecular replacement uses a known three-dimensional structure as a search model to determine the structure of a closely related molecule or protein-ligand complex in a new crystal form. The measured X-ray diffraction properties of the new crystal are compared with the search model structure to compute the position and orientation of the protein in the new crystal. Computer programs that can be used include: X-PLOR and AMORE (J. Navaza, Acta Crystallographics ASO, 157-163 (1994)). As those of skill in the art can appreciate, once the position and orientation are known, an electron density map can be calculated using the search model to provide X-ray phases.
Thereafter, the electron density is inspected for structural differences, and the search model is modified to conform to the new structure.
Using this approach, it is possible to use the claimed structure of DPP-IV can be used to solve the three-dimensional structures of any such DPP-IV complexed with a ligand. Other suitable computer programs that can be used to solve the structures of such STAT crystals include:
QUANTA; CHARMM; INSIGHT;
SYBYL; MACROMODEL; and ICM.
Suitable in silico methods for screening, designing or selecting ligands are disclosed in, for example, U.S. Patent No. 6,356,845.

E. Ligands In one aspect, the present invention discloses binding agents which interact with a binding site of DPP-IV defined by a set of points having a root mean square deviation of less than about 2.5, 2.0, 1.7, 1.5, 1.2, 1.0, 0.7, 0.5, or even 0.2 A from points representing the backbone atoms of the amino acids represented by the structure coordinates listed in FIG. 2. Such embodiments represent variants of the DPP-IV crystal.
In another aspect, the present invention provides ligands which bind to a folded polypeptide comprising an amino acid sequence spanning amino acids 31 to 766 listed in SEQ
ID NO:1, or a homologue or variant thereof. In further embodiments, the ligand is a competitive or uncompetitive inhibitor of DPP-IV. In yet further embodiments the ligand inhibits DPP-IV
with an IC50 or K; of less than about 10 mM, 1 mM, 500 nM, 100 nM, 50 nM or 10 nM. In yet further embodiments, the ligand inhibits DPP-IV with a K; that is less than about one-half, one-fifth, or one-tenth the K; that the substance has for inhibition of any other DPP-IV enzyme. In other words, the substance inhibits DPP-IV activity to the same degree at a concentration of about one-half, one-fifth, one-tenth or less than the concentration required for any other DPP enzyme.
One embodiment of the present invention relates to ligands, such as proteins, peptides, peptidomimetics, small organic molecules, etc., designed or developed with reference to the crystal structure of DPP-IV as represented by the coordinates presented herein in FIG.
2, and portions thereof.
Such binding agents interact with the binding site of the DPP-IV represented by one or more amino acid residues selected from GIu205, GIu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740.

F. Machine Readable Storage Media Transformation of the structure coordinates for all or a portion of DPP-IV or one of its binding pockets, for structurally homologous molecules as defined below, or for the structural equivalents of any of these molecules or molecular complexes as defined above, into three-dimensional graphical representations of the molecule or complex can be conveniently achieved through the use of commercially-available software.

The invention thus further provides a machine-readable storage medium comprising a data storage material encoded with machine readable data which, when using a machine programmed with instructions for using said data, is capable of displaying a graphical three-dimensional representation of any of the molecule or molecular complexes of this invention that have been described above. In a preferred embodiment, the machine-readable data storage medium comprises a data storage material encoded with machine readable data which, when using a machine programmed with instructions for using said data, is capable of displaying a graphical three-dimensional representation of a molecule or molecular complex comprising all or any parts of a DPP-IV binding pocket, as defined above. In another preferred embodiment, the machine-readable data storage medium is capable of displaying a graphical three-dimensional representation of a molecule or molecular complex defined by the structure coordinates of the amino acids listed in FIG. 4, plus or minus a root mean square deviation from the backbone atoms of said amino acids of not more than 2.0 A.
In an alternative embodiment, the machine-readable data storage medium comprises a data storage material encoded with a first set of machine readable data which comprises the Fourier transform of the structural coordinates set forth in FIG. 2, and which, when using a machine programmed with instructions for using said data, can be combined with a second set of machine readable data comprising the X-ray diffraction pattern of a molecule or molecular complex to determine at least a portion of the structural coordinates corresponding to the second set of machine readable data.
For example, a system for reading a data storage medium may include a computer comprising a central processing unit ("CPU"), a working memory which may be, e.g., RAM
(random access memory) or "core" memory, mass storage memory (such as one or more disk drives or CD-ROM
drives), one or more display devices (e.g., cathode-ray tube ("CRT") displays, light emitting diode ("LED") displays, liquid crystal displays ("LCDs"), electroluminescent displays, vacuum fluorescent displays, field emission displays ("FEDs"), plasma displays, projection panels, etc.), one or more user input devices (e.g., keyboards, microphones, mice, touch screens, etc.), one or more input lines, and one or more output lines, all of which are interconnected by a conventional bidirectional system bus. The system may be a stand-alone computer, or may be networked (e.g., through local area networks, wide area networks, intranets, extranets, or the internet) to other systems (e.g., computers, hosts, servers, etc.). The system may also include additional computer controlled devices such as consumer electronics and appliances.
Input hardware may be coupled to the computer by input lines and may be implemented in a variety of ways. Machine-readable data of this invention may be inputted via the use of a modem or modems connected by a telephone line or dedicated data line. Alternatively or additionally, the input hardware may comprise CD-ROM drives or disk drives. In conjunction with a display terminal, a keyboard may also be used as an input device.
Output hardware may be coupled to the computer by output lines and may similarly be implemented by conventional devices. By way of example, the output hardware may include a display device for displaying a graphical representation of a binding pocket of this invention using a program such as QUANTA as described herein. Output hardware might also include a printer, so that hard copy output may be produced, or a disk drive, to store system output for later use.
In operation, a CPU coordinates the use of the various input and output devices, coordinates data accesses from mass storage devices, accesses to and from working memory, and determines the sequence of data processing steps. A number of programs may be used to process the machine-readable data of this invention. Such programs are discussed in reference to the computational methods of drug discovery as described herein. References to components of the hardware system are included as appropriate throughout the following description of the data storage medium.
Machine-readable storage devices useful in the present invention include, but are not limited to, magnetic devices, electrical devices, optical devices, and combinations thereof. Examples of such data storage devices include, but are not limited to, hard disk devices, CD
devices, digital video disk devices, floppy disk devices, removable hard disk devices, magneto-optic disk devices, magnetic tape devices, flash memory devices, bubble memory devices, holographic storage devices, and any other mass storage peripheral device. It should be understood that these storage devices include necessary hardware (e.g., drives, controllers, power supplies, etc.) as well as any necessary media (e.g., disks, flash cards, etc.) to enable the storage of data.

G. Pharmaceutical Compositions The present invention provides methods for treating certain diseases in a mammal, preferably a human being, in need of such treatment using the ligands, and preferably the inhibitors, as described herein.
The ligand can be advantageously formulated into pharmaceutical compositions comprising a therapeutically effective amount of the ligand, a pharmaceutically acceptable carrier and other compatible ingredients, such as adjuvants, Freund's complete or incomplete adjuvant, suitable for formulating such pharmaceutical compositions as is known to those skilled in the art. Pharmaceutical compositions containing the ligand can be used for treatment of diseases that are associated with proteins that are subject to processing by DPP-IV, such as Type 2 diabetes, Type 1 diabetes, impaired glucose tolerance, hyperglycemia, metabolic syndrome (syndrome X and/or insulin resistance syndrome), glucosuria, metabolic acidosis, arthritis, cataracts, diabetic neuropathy, diabetic nephropathy, diabetic retinopathy, diabetic cardiomyopathy, obesity, conditions exacerbated by obesity, hypertension, hyperlipidemia, atherosclerosis, osteoporosis, osteopenia, frailty, bone loss, bone fracture, acute coronary syndrome, short stature due to growth hormone deficiency, infertility due to polycystic ovary syndrome, anxiety, depression, insomnia, chronic fatigue, epilepsy, eating disorders, chronic pain, alcohol addiction, diseases associated with intestinal motility, ulcers, irritable bowel syndrome, inflammatory bowel syndrome; short bowel syndrome; and the prevention of disease progression in Type 2 diabetes.
The pharmaceutical composition is administered to the mammal in a therapeutically effective amount such that treatment of the disease occurs.
The present invention is further illustrated by the following examples, which should not be construed as limiting in any way. The contents of all cited references (including literature references, patents, published patent applications as cited throughout this application) are hereby expressly incorporated by reference in their entireties.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, microbiology and recombinant DNA, X-ray crystallography, and molecular modeling which are within the skill of the art.
As those of skill in the art will understand, such techniques are explained fully in the literature. See, for example, Molecular Cloning: A
Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985);
Oligonucleotide Synthesis (M. J.

Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J.
Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); B. Perbal, A
Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Crystallography Made Clear: A Guide For Users Of Macromolecular Models (Gales Rhodes, 2"d Ed. San Diego: Academic Press, 2000).
EXAMPLES
Example 1: Cloning and Expression of human DPP-IV in Sf21 insect cells A. Construction of hDPP-IV:

Residues 31 to 766 of homo sapien (human) wild type DPP-IV (SEQ ID NO:1) were amplified by PCR using the following primers DPPIV-Fc31- BamF (5'-TTAAGGATCCTGGCACAGATGATGCTACAGCTGAC-3' (SEQ ID NO: 3)), which introduced a Bam HI site at the N-terminus, and DPPIV-ChisT-XhoR (5'-AATTCTCGAGTTACTAGTGAT
GATGGTGGTGATGGCTGCCGCGCGGCACCAGAGGTAAAGAGAAACATTGTTTTATGAAGTGGC-3' (SEQ ID NO: 4)), which introduced His6-tag, thrombin cleavage site and Xho I
site at the C-terminus. The spin-column (Roche Applied Sciences Indianapolis, IN) purified PCR product (2208 bp) was digested with BamHI and Xhol restriction enzymes and subcloned into a baculovirus transfer vector treated with the corresponding enzymes. The vector contained a polyhedrin promoter and the honeybee melittin secretion signal for efficient, high-level secretion of the recombinant protein.
B. Production of recombinant baclovirus Cloning steps were monitored by restriction endonuclease mapping and sequencing analysis. E. coli clones with recombinant bacmid were obtained after transformation of E. coli DH10Bac cells (Invitrogen Corp., Frederick, MD) with 5 ng of the final construct that encodes hDPP-IV
residues 31-766 in pMCG243 (baculovirus transfer vector) (DPPIV-HBM31 -HT plasmid DNA) and blue/white-screening according to manufacturer's protocol (Invitrogen Corp.). Monolayers of Sf9 cells (20 X 106 cells in a 162 cmZ culture flask) were transfected by overlaying 20 ml of transfection mixture containing 100 l of mini-prep bacmid DNA and 100 l of CeIIFECTIN reagent (Gibco BRL Gaithersburg, MD) in Sf-900 II
SFM. The transfection mixture was removed after 5 h of incubation (27 C) and the cells were overlaid with 25 ml of Sf-900 II SFM.
The recombinant virus were harvested at 72h post-transfection and further amplification of the virus was achieved by infecting 100 ml of Sf-9 cells (1.2 X 106 cells/ml) with 2 ml of the recombinant virus for 65-72 h.
Baculo Infected Insect Cells (BIIC) stocks were prepared as follows; when the cell diameter increases by 2-4 ~m above the baseline (usually 65-72h) and while the cell viability is still >
80%, the BIIC's were gently spun down and re-suspended in a freezing medium (90% SF900 II, 1% w/v BSA, 10% v/v DMSO) at 1 X 10' viable cells/ml. The BIIC's were frozen down as 1 ml aliquots using normal cryopreservation methods and stored in -709C or liquid nitrogen for long-term storage.
C. Expression of recombinant DPP-IV
Cloning steps were monitored by restriction endonuclease mapping and sequencing analysis. E. coli clones with recombinant bacmid were obtained after transformation of E. coli DH10Bac cells (Invitrogen Corp., Frederick, MD) with 5 ng of DPPIV-HBM31 -HT plasmid DNA and blue/white-screening according to manufacturer's protocol (Invitrogen). Monolayers of Sf9 cells (20 X 106 cells in a 162 cm2 culture flask) were transfected by overlaying 20 ml of transfection mixture containing 100 NI of mini-prep bacmid DNA and 100 NI of CeIIFECTIN reagent (Gibco BRL) in Sf-900 II SFM. The transfection mixture was removed after 5 h of incubation (27 C) and the cells were overlaid with 25 ml of Sf-900 II SFM. The recombinant virus were harvested at 72h post-transfection and further amplification of the virus was achieved by infecting 100 ml of Sf-9 cells (1.2 X 106 cells/ml) with 2 ml of the recombinant virus for 65-72 h. Baculo Infected Insect Cells (BIIC) stocks were prepared as follows; when the cell diameter increases by 2-4 pm above the baseline (usually 65-72h) and while the cell viability is still > 80%, the BIIC's were gently spun down and re-suspended in a freezing medium (90% SF900 II, 1% w/v BSA, 10% v/v DMSO) at 1 X
107 viable cells/ml.
The BIIC's were frozen down as 1 ml aliquots using normal cryopreservation methods and stored in -70 C
or liquid nitrogen for long-term storage.
Example 2: Purification of His6-tagged DPP-IV wild type extracellular domain After clarification by centrifugation and filtration, 10 liters of culture media containing secreted human DPP-IV-31-766-C-his6 was concentrated 10-20 fold using a hollow fiber filter unit which had been washed with exchange Buffer A (50 mM Tris, 0.3 M NaCI, 1 mM TCEP, pH 8). The concentrated media was exchanged with 5 volumes of Buffer A. After clarification by filtration, imidazole was added to 10 mM by addition of Buffer B (50 mM TrisCl, 0.3 M NaCI, 0.25 M imidazole, 1 mM TCEP, pH 8). The sample was applied to a 40 mL immobilized metal affinity column (Ni-NTA Superflow, Qiagen), which had been equilibrated in Buffer A (50 mM TrisCl, 0.3 M NaCI, 1 mM TCEP, pH 8) at 6-8 mLJmin. The column was washed with Buffer A to achieve a stable baseline at 280 nm. Bound protein was eluted at a lower flow rate in a linear gradient from 0 - 20%B in 4 column volumes (cv) (5%B / cv) followed by a step to 100% B, held isocratic ally for 4 cv. Fractions were analyze by SDS-PAGE on 4-12% bis-tris in MOPS buffer using the NuPAGE system (Invitrogen). Fractions containing DPP-IV were pooled and dialyzed at 4 degrees C
against 2 changes of dialysis buffer (50 mM TrisCl, 0.1 M NaCI, 1 mM TCEP, pH
8. After dialysis, the sample was concentrated to 6-10 mg/mL and fractionated by size exclusion chromatography on Superdex 200 prep grade HiLoad 16/60 (Amersham Biosciences). DPP-IV eluted as an apparent dimer. Fractions were analyze by SDS-PAGE on 4-12% bis-tris in MOPS buffer using the NuPAGE
system (Invitrogen).
DPP-IV isolated in this manner was used for crystallization.
Example 3: Crystallization of DPP-IV

DPP-IV of Example 2 was concentrated into buffer containing 50 mM TrisCi, 25 mM NaCI, 1 mM
TCEP, pH 8, to 8-10 mg/mL. Leads were obtained through sparse matrix screening at 22 . Optimized crystals grew in drops made from 1.5 pL of protein + 1.5 pL of reservoir solution (0.1 M TrisCl, pH 8.5, 0.2 M
sodium acetate, 10-16% PEG 4000) equilibrating over the same reservoir solution. Crystals were transferred to a solution containing 0.1 M TrisCl, pH 8.5, 0.2 M sodium acetate, 14-16% PEG 4000, and 20% ethylene glycol. Crystals were flash frozen in gaseous or liquid nitrogen for data collection.
Example 4: X-ray data collection, structure determination and refinement of DPP-IV

The crystals prepared in Example 3 were transferred to a cryoprotectant,solution, made up of the reservoir solution, with 15-25% ethylene glycol, and then flash-frozen in a stream of cold nitrogen gas at 100K. A full data set was collected from one crystal frozen in this manner at the Advanced Photon Sources of Argonne National Laboratory on a on a ADSC Quantum 210 CCD detector. Data was processed using the HKL2000 suite of software (Otwinowski, Z. & Minor, W. Methods Enzymology 276, 307-326 (1997). Data collection statistics are summarized in Table 5a.

The crystals belong to space group P43212 with unit cell dimensions a=b=68.7 A, (-- 421.2 A, a= R=
y= 90 . They contain one molecule of the polypeptide per asymmetric unit.
The structure was solved by the method of molecular replacement, using the program AMORE
(Navaza, J., Acta Cryst., 157-163 (1994)). The crystal mosaicity is 0.6 A. The data is 96.5% complete to 2.7 A resolution with an Rmer9e of 0.062 and an average redundancy of 4.4. The final model was built with manual rebuilding on the graphics screen, using the program XtalView (McRee, D. E., Practical Protein Crystallography, Academic Press, San Diego, 1993). Refinement in Refmac was carried out using all data in the resolution range 50.0-2.7A. The R-factor for the current model is 0.257 (free R-factor, 5% of the data, 0.340). The refinement statistics are summarized in Table 5b.
The current model contains residues 38-766 (others are disordered in the crystal), 12 sugar and 32 water molecules.
Table 5a -Data statistics Resolution range 50-2.7 Number of observations Total 124470 Unique 28252 Com leteness % 96.5(96.9) 1/5(1) 23.5(2.0) Rsym 0.062(0.544) ' ' Numbers in parentheses refer to the highest resolution range (2.80-2.70A) Rsym = F(I-<I>)/~ <I>

Table 5b- Refinement statistics Nr. of reflections used 23609 Nr. of reflections used for 1269 Rtree Rcrys,/Rfree 0.257/0.340 Number of atoms 6169 ' R = 7_I1Fobs1 - MF.el.11/11Fabs1 Equivalents While specific embodiments of the subject invention have been discussed, the above specification is illustrative and not restrictive. Many variations of the invention will become apparent to those skilled in the art upon review of this specification. The appended claims should be interpreted by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.

NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.

JUMBO APPLICATIONS / PATENTS

THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.

NOTE: For additional volumes please contact the Canadian Patent Office.

Claims (15)

-26-What is claimed is:

1. A crystalline composition of the extracellular domain of mammalian dipeptidyl peptidase IV (DPP-IV) comprising one molecule per crystal asymmetric unit.

2. A crystal of claim 1, wherein said extracellular domain has a three dimensional structure characterized by the atomic structure coordinates of Fig 2.

3. The DPP-IV crystal comprising SEQ ID NO 2, or a homologue, analogue or variant thereof.

4. A crystal having one molecule per asymmetric unit comprising a polypeptide with an amino acid sequence spanning amino acids Gly31 to Pro766 listed in SEQ ID NO
1, or a homologue, analogue or variant thereof.

5. The crystal of claim 4, wherein the homologue or variant has an amino acid identity of at least 95% with a polypeptide having an amino acid sequence spanning amino acids Gly31 to Pro766 listed in SEQ ID NO 1.

6. The crystal of claim 4 or 5, wherein the homologue or variant thereof has a protein backbone comprising the atomic coordinates, or portions thereof, that are within a root mean square deviation of less than 2.5, 2.0, 1.5, 1.2, 1.0, 0.7, 0.5, or 0.2 .ANG. of the atomic coordinates, or portions thereof, listed in FIG 2.

7. A polypeptide comprising the amino acid sequence set forth in SEQ ID NO. 1 or a homologue, or variant thereof, wherein the molecules are arranged in a crystalline manner in a space group of P4 3 2 1 2 so as to form a unit cell of dimensions a=b=68.7 .ANG., c=
421.2 .ANG. and which effectively diffracts X-rays for determination of the atomic coordinates of DPP-IV
polypeptide to a resolution of about 27.ANG..

8. A crystal of a protein-ligand molecule or molecular complex comprising (a) a polypeptide with an amino acid sequence from Asp38 to Pro766 listed in SEQ ID NO 1, or a homologue, or variant thereof, (b) a ligand, (c) and the crystal effectively diffracts X-rays for the determination of atomic coordinates of the protein-ligand complex to a resolution of greater than 2 7 Angstroms.

9. A method of designing a compound that binds to DPP-IV comprises the amino acid sequence spanning amino acids Gly31 to Pro766 listed in SEQ ID NO-1, or a homologue, or variant thereof using the crystal of claim 1, comprising selecting a compound by performing structure-based drug design with the atomic coordinates determined for the crystal, wherein said selecting is performed in conjunction with computer modeling.

10. A method for crystallizing a DPP-IV polypeptide molecule or molecular complex comprising (a) preparing a mixture of an aqueous solution comprising a polypeptide with an amino acid sequence spanning amino acids Gly31 to Pro766 listed in SEQ ID NO:1, or a homologue, or a variant thereof; (b) mixing said aqueous solution with a reservoir solution comprising a precipitant to from a mixed volume; and (c) crystallizing said mixed volume.

11 The method of claim 10 wherein step (c) is carried out by vapor diffusion crystallization, batch crystallization, liquid bridge crystallization, or dialysis crystallization

12. A computer for producing a three-dimensional representation of a polypeptide with an amino acid sequence spanning amino acids Gly31 to Pro766 listed in SEQ ID
NO:1, or a homologue, or a variant thereof, comprising: a computer-readable data storage medium comprising a data storage material encoded with computer-readable data, wherein said data comprises the structure coordinates of FIG. 2, or portions thereof; a working memory for storing instructions for processing said computer-readable data; a central-processing unit coupled to said working memory and to said computer-readable data storage medium for processing said computer-machine readable data into said three-dimensional representation;
and a display coupled to said central-processing unit for displaying said representation.

13. A computer for producing a three-dimensional representation of a molecule or molecular complex comprising the atomic coordinates having a root mean square deviation of less than 2.5, 2.0, 1.7, 1.5, 1.2, 1.0, 0.7, 0.5, or 0.2 .ANG. from the atomic coordinates for the carbon backbone atoms listed in FIG.2 comprising: a computer-readable data storage medium comprising a data storage material encoded with computer-readable data, wherein said data comprises the structure coordinates of FIG. 2, or portions thereof; a working memory for storing instructions for processing said computer-readable data; a central-processing unit coupled to said working memory and to said computer-readable data storage medium for processing said computer-machine readable data into said three-dimensional representation; and a display coupled to said central-processing unit for displaying said representation.

14. A computer for producing a three-dimensional representation of a molecule or molecular complex comprising: a binding site defined by the structure coordinates in FIG. 2, or a the structural coordinates of a portion of the residues in FIG. 2, or the structural coordinates of one or more DPP-IV
amino acids in SEQ ID NO:1 selected from Glu205, Glu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740 wherein said computer comprises; a computer-readable data storage medium comprising a data storage material encoded with computer-readable data, wherein said data comprises the structure coordinates of FIG. 2, or portions thereof; a working memory for storing instructions for processing said computer-readable data; a central-processing unit coupled to said working memory and to said computer-readable data storage medium for processing said computer-machine readable data into said three-dimensional representation; and a display coupled to said central-processing unit for displaying said representation.

15. A method for identifying potential ligands for DPP-IV, or homologues, analogues or variants thereof, comprising: displaying three dimensional structure of DPP-IV
enzyme, or portions thereof, as defined by atomic coordinates in FIG. 2, on a computer display screen; optionally replacing one or more DPP-IV enzyme amino acid residues listed in SEQ ID NO:1, or one or more of the amino acids listed in Table 1, or one or more amino acid residues selected from Glu205, Glu206, Tyr547, Ser630, Tyr631, Tyr662, Tyr666, Asp708, Asn710 and His740, in said three-dimensional structure with a different naturally occurring amino acid or an unnatural amino acid; employing said three-dimensional structure to design or select said ligand; contacting said ligand with DPP-IV, or variant thereof, in the presence of one or more substrates; and measuring the ability of said ligand to modulate the activity DPP-IV.