CA2562162A1 - Human g-protein chemokine receptor hdgnr10 - Google Patents

Human g-protein chemokine receptor hdgnr10 Download PDF

Info

Publication number
CA2562162A1
CA2562162A1 CA002562162A CA2562162A CA2562162A1 CA 2562162 A1 CA2562162 A1 CA 2562162A1 CA 002562162 A CA002562162 A CA 002562162A CA 2562162 A CA2562162 A CA 2562162A CA 2562162 A1 CA2562162 A1 CA 2562162A1
Authority
CA
Canada
Prior art keywords
protein
polypeptide
polypeptides
receptor
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002562162A
Other languages
French (fr)
Inventor
Yi Li
Steven M. Ruben
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2562162A1 publication Critical patent/CA2562162A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7158Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for chemokines
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Wood Science & Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Human G-protein chemokine receptor polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptides for identifying antagonists and agonists to such polypeptides and methods of using the agonists and antagonists therapeutically to treat conditions related to the underexpression and overexpression of the G-protein chemokine receptor polypeptides, respectively. Also disclosed are diagnostic methods for detecting a mutation in the G-protein chemokine receptor nucleic acid sequences and detecting a level of the soluble form of the receptors in a sample derived from a host.

Description

fi~JiN G-PROTEIN CgB~SOICIlQS RFCBPTOR BaiGHRlO
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and, polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a human 7-transmembrane receptor which has been putatively identified as a chemokiae receptor, sometimes hereinafter referred to as "G-Protein Chemokine Receptor" or "HD~iRlO". The imrention also relates to inhibiting the action of such polypeptides.
It is well established that many medically significant biological processes are mediated by proteins participating in signa7~ transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 351:353-354 11991)). Herein these proteins are referred to as proteins participating in pathways with G-proteins or PPG
proteins . Some examcples of these proteins include the GPC
receptors, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al., PNA.S, 84:46-50 (1987); Kobilka, B.K., et al., Science. 238:650-656 11987); Bunzow, J.R., et al., Nature, 336:783-787 (ig88)), G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein -la-kinase A and protein kinase C (Simon, M.I., et al., Science, 252:802-8 X1991)).
For example, in one form of signal transduction, the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell. 8azyme activation by hormones is dependent on the presence of the nucleotide GTP, and GTP also influences hormone binding. A G-protein connects the hormone receptors to adenylate cyclase. G-protein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP
to GDP, catalyzed by the G-protein itself, returns-the.G-protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intexinediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.
The ~mbrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane do~ai.ns. The domains are believed to represent traasmembrane a-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a pride range of biologically active receptors , such as hormone , viral, growth factor and neuroreceptors. ,.
G-protein coupled receptors have been characterized as including these seven consezved hydrophobic stretches of about 20 -to 30 amino acids, connecting at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dopamine receptors which bind to neuroleptic drugs used for treating psychotic and neurological disorders. Other examples of members of this family include calcitonin, adrenergic, eadothelin; cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1 receptor and rhodopsins, odorant, cytanegalovirus receptors, etc.
G-protein coupled receptors can be intrace~lularly coupled by heterotrimeric G-proteins to various intracellular enzymes, ion criannels and transporters (see, Johnson et al., Bndoc., Rev., 10:317-331 (1989)). Different G-protein a-subuaits preferentially stimulate particular effectors to modulate various biological functions in a cell.
Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling. of some G-protein coupled receptors. G-protein coupled receptors are found in numerous sites within a mammalian host.
Chemokines, also referred to as intercriae cytokines, are a subfamily of structurally and functionally related cytokines . These molecules are 8-10 kd in size . In general, chemokines exhibit 20~c to 75~ homology at the amino acid level and are characterized by four conserved cysteine~
residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta.
In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C-g-C"
subfamily. In the beta subfamily, the two cysteines are in an adjacent position and are, therefore, referred to as the "C-C" subfamily. Thus far, at least nine different members of this family have been identified is humans.
The intercrine cytokines exhibit a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils and fibroblaets. Many chemokines have proinflammatory activity and are involved in multiple steps during an inflammatory reaction. These activities include stimulation of histaiaine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enhanced binding of coatplement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in inflam~aation, certain chemokines have bees shown to exhibit other activities . For examcple, macrophage inflanrcc~aatory protein 1 tMIP-1) is able to suppress hematopoietic stem cell proliferation, platelet factor-4 (PF-4 ) is a potent inhibitor of endothelial cell growth, Interleukin-8 (IL-8) promotes proliferation of keratinocytes, and GRO is an autocrine growth factor for melanoma cells .
In light of the diverse biological activities, it is not surprising that che~nokiaes have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis.
In accordance with one aspect of the present invention, there are provided novel mature receptor polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The receptor polypeptides of the present inveatioa'are of human origin.
In accordance with aaother~ aspect of the present invention, there are. provided isolated nucleic acid molecules encoding the receptor polypeptides of the present invention, including mRNAs, DNAs, cDNAs, genomic DNA as well as aatisense- analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.
In accordance with a further aspect of the present imreation, there are provided processes for producing such receptor polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequences encoding the receptor polypeptides of the present invention, under conditions promoting expression of said polypeptides and subsequent recovery of said polypeptides.

In accordance with yet a further aspect of the present invention, there are provided antib.~dies against such receptor polypeptides.
In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptides of the present invention.
In accordance with still another embodiment of the present invention there are provided processes of administering compounds to a host which bind to and activate the receptor polypeptide of the present invention which are useful in stinn~lating haematopoiesis, around healing, coagulation, angiogenesis, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-imaname diseases, parasitic infections, psoriasis, and to stimulate growth factor activity.
In accordance with another aspect of the present invention there is provided a method of administering the receptor polypeptides of the present invention via gene therapy to treat conditions related to underexpression of the polypeptides or underexpression of a ligand for the receptor polypeptide_ In accordance with still another embodiment of the present invention there are provided processes of administering compounds to a host which bind to and inhibit activation of the receptor polypeptides of the present invention which are useful in the prevention and/or treatment of allergy, atherogenesis, anaphylaxis, malignancy, chronic and acute inflammation, histamine and Ig$-m;ediated allergic reactions; prostaglandin-independent fever, bone marrow failure, silicosis, sarcoidosis, rheumatoid arthritis, shock and hyper-eosinophilic syndrome.
In accordance with yet another aspect oft. the present invention, there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polynucleotide sequences of the present invention.
Tn accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the soluble form of the receptor polypeptides.
In accordance with yet a further aspect of the~present invention, there are provided processes for utilizing such receptor polypeptides, or polynucleotides encoding such polypepti.des, ~ for .in' vitro purposes related. ' to scientific research, synthesis of DNA and manufacture of DNA vectors.-These and other aspects of the present invention should be apparent to those skilled~in the art from the teachings herein.-The following drawings acre illustrative of embodiments of the invention and are not meant to limit the scope.of the invention as encompassed by the_claims.
Figure 1 shows the cDNA sequence and the. corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention. the tandard one-letter abbreviation for amino acids is used. Sequencing was performed using a 373 Automated DNA sequ~ncer (~..pplied Biosystems, Inc.).
Figure 2 illustrates an amino acid alignment of the G-protein chemokine receptor~of the present invention and the human MCP-I receptor.
In accordance with an aspect of the preser_t invention, there is provided an isoxated nucleic acid (polyizucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID N0:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97183 with the Rmerican Type Culture Collection, 12301 Parklawn Drive, Rockv?11e, Mary?and, 20852, United States of America, on June ~, 1995.
The polynucleot~~.de of this invention was discovered in a cDNA library derived from human monocytes. It is stiucturallv related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 352 amino acid residues. The protein exhibits the highest degree of homology to a human MCP-1 receptor with 70.1 %
identity and 82.9 % similarity over a 347 amino acid stretch.
The polynucleotide of the present invention may be is the form of RNA or in the forca of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DN~.1 may. be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (S$Q ID
NO:1) or that of the .deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the-same mature polypeptide as the DNA of Figure 1 (S8Q ID N0:1)~
or the deposited cDl~.
.The polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by~the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for- the mature palypeptide and additional-coding sequence such as a transmembraae (T1~1')- or intro-cellular domain; the coding sequence for the . mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence far the mature polypeptide. ' Thus, the term "polynucleotide encoding a polypeptide"
encooapasses a polynucleotide which includes only codir~g sequence for the polypeptide as well as-.a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the herei.nabove described polyaucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amigo acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. T~.
variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (S$Q ID N0:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as .variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SBQ~ID
NO:~) or the polypeptide encoded by the cDI~ of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the.polyaucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown is Figure 1 (S$Q ID-NO:~)_or of the coding sequence of the deposited clone. As known is the art, as allelic variant is as altezaate form of a polyaucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide_ ' The polyaucieotides'may also encode for a soluble form of the G-protein chemokine receptor polypeptide which is the extracellular portion of the polypeptide which has been cleaved froia the TM and intracellular domain of the full-leagth poiypeptide of the present invention.
The polynucleotides of the present~invention may also have the coding sequence fused~in frame to a marker sequence which allows for purification of the polypeptide of the present imrention_ The marker sequence may be a hexa-histidine tag supplied by a pQB-9 vector to provide far-purification of the mature polypeptide fused to the marker is the case of a~bacterial host, or, for example, the marker sequence may be a hemagglutinin~(HA) tag when'a-mammalian _g_ host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:76: (1984)y.
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (axons).
Fragments of the full length gene of the present invention may be used as a hybridization probe for a cDNA~
library to isolate the full length cDNA and to isolate other cDNAs which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases . The probe may also be used to identify a cD~~iA
clone corresponding to a full length transcript and a genomic ;
clone or clones that contain the complete gene including regulatory and pranotor regions, axons, and introns. An example of a screen coomprises isolating the coding region of the gene by using the laio~rn DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, ;.geaomic DATA or mR~ to determine which members of the library the probe hybridizes to.
The present invention further relates to polynucleotides which hybridize to the hereiaabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences. The-present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereiaabove-described polynucleotides. As herein used, the terra "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides _9-which hybridize to the herei.na.bave described polynucleotidE
in a preferred embodiment encode polypeptides which either retain substantially the same biological function yr activity as the mature polypeptide encoded by the cDl~s of Figure 1 (SBQ ID NO:1) or the deposited cDNA(s).
Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases, and awre preferaGbly at least 50 bases which hybridize to a polynucleotide'of the present imrention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SBQ ID I~IO:1, for ~ exan~le, for recovery of the polyaucleotide or as a diagnostic probe or as a PQ2 primer.
Thus, the present invention is directed to polynucleotides having at~ least a 70~ identity, preferably at Least 90~ and more preferably at least a 95~ identity to a polynucleotide which encodes the polypeptide of SBQ ID N0:2 as well as fraga~eats thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polyaucleotides.
The deposits) referred to herein will be maintained under the terms of, the Budapest Treaty on the International Recognition of the Deposit of Micro-organistas for purposes of Patent Procedure. These deposits ajre provided merely as convenience to those of skill ia-the art and are not an adatission that a deposit is required.
The segueace of the polynucleotides contained in the deposited materials, as well. as the axaino acid sequence of the polypeptides encoded thereby, are controlling in the event of nay conflict.
with~any description of~sequences herein. A license utay be required to make, or sell the deposited materials, and no such license is hereby granted..
_1Q_ The present invention further relates to a G-protein chemokine receptor polypeptide which has the deduced amino acid sequence of Figure 1 (SBQ ID N0:2) or which has the amino acid sequence encoded by the deposited'cDNA, as well as fragments, analogs and derivatives of such polypeptide.
The terns ~fragment," "derivative" and ~anaiog~ when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, means a polypeptide which either retains substantially the same biological function or activity as such polypeptide, i.e_ functions as a G-protein chemokine receptor, or retains the ability to bind the ligand or the receptor even though_the polypeptide does not function as a G-protein chemokine receptor, for example, a soluble form of the receptor. An analog includes a proprotein~which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polyQeptide of Figure 1 (SNQ ID N0:2) or that encoded by the deposited cDI~ may be (i) one in which one -or more of the am;.ao acid residues are substituted with a conserved or non-consezved amino acid residue (preferably a conserved amino acid residue)~and such substituted amino acid residue may or may not be one encoded by the genetic code, or <ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a comcpound to increase the half-life of the- polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide for purification of the polypeptide or (v) one in which a fragment of tie polypeptide is soluble, i.e. not membrane bound, yet still binds ligands to the membrane bound receptor. Such fragments, derivatives and analogs are deeated to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The polypeptides of the present invention include the polypeptide of SBQ ID N0:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70%
similarity (preferably a 70% identity) to the polypeptide of SBQ ID N0:2 and more preferably a 90% similarity (more .
preferably a 90% identity) to the polypeptide of SBQ ID N0:2 and still more preferably a 95% similarity (still more preferably a 90% identity) to the polypeptide of S$Q ID N0:2 and to portions of such polypeptide with such portion of the poiypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The tezm "geese" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer" as well as intervening sequences (introns) between individual coding segments (exons)_ The term "isolated° means that the material is removed from its original environment (e. g., the natural environment if it is naturally occurring). Por example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from s~aae or all of the coexisting ~aaterials is the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a co~o~position, and still be isolated in that such vector or composition is not part of its natural environment.
The polypeptides of the present invention include the polypeptide of SSQ ID N0:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70%
similarity (preferably at least 70% identity) to the polypeptide of S8Q ID N0:2 and more preferably at least 90%
similarity (more preferably at least 90% identity) to the polypeptide of S$Q ID N0:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SBQ ID N0:2 gad also iaciude portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amigo acids.
~ ~o~ ~ the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second po3ypeptide.
Frac~nents or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides: Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
The present invention also relates to vectors which include polyaucleotides of the present invention, host cells which are genetically engineered with vectors 'of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating.
promoters , selecting transfo~mants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by recombinant tec~iques. Thus, for example, the polyaucleotide may be included in nay one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of Sv40; bacterial plasmids; phage DNA;
bacuZovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral D1~ such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is replicabie and viable in the host.
The appropriate DNA seguence may be inserted into~the vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction endonuclease sites) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequences) (promoter) to direct mRNA synthesis. As representative examples of such pramoters, there may be mentioned: LTR or SV4Q promoter, the E. coli. lac or t~, the phage lambda P~
promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their vizuses.
The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for amplifying expression.
In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in B. coli.
The vector containing the appropriate DID sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to traasforar an appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, StreDtonHrces, SalaaonelZa tvnhimurium; fungal cells, such as yeast; insect cells such as Drosonhila and cetera animal cells such as CEO, COS or Hooves melanoma; adenovirus;
plant cells, etc. The selection of an appropriate host is deemed to.be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs co~ac~prise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably _Z~_ linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are comseercially available. The following vectors are provided by way of example. Bactei_al: pQ$70, pQB60, pQ$-9 (Qiagen), pbs, pDlO, phagescript, psiXi74; pbluescript SIC, pbsks, pl~8A, pNXl6a, pN818A, pNH46A (Stratagene); ptrc99a, pKR223-3, pKR233-3, pDR540, pRITS (Pharmacia). Bukaryotic: pWLN80, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3; pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable aad viable in the host.
Promoter regions can be selected from aay desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR, PL aad trp.
Bukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, aad mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level. of ordinary skill in the art.
In a further embodiment, the_present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaxyotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DSAB-Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (198x)).
The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from ' the Did constructs of the present invention.
Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989).
Transcription -of the DIZA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Bnhancers are cis-acting elements of DID,, usually about from 10 to 300 by that act on apromoter to increase its~transcription.
Examples including the SV40 eahancer on the late side of the replication origin by 100 to 270, a cytoa2egalovirus early promoter eahancer, the polyoma exl~ancer on the late side of the. replication origin, and adeziovirus enbancers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae T1ZP3 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and ter~aination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular meditaa. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization~or simplified purification of expressed . recombinant product.
Useful expression vectors for bacterial use are constxucted by inserting a structural DNA seguence encoding a desired protein together With suitable translation initiation and tezmination signals in operable reading phase with a functional promoter. The vector will.comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts' for transformation include B. coli, Bacillus subtilis, Salmonella tvahimurium and various species within the ~ genera Pseudomoaas, Streptomyces, and .Staphylococcus, although others may also be employed as a~
matter of choice. ~ ' As a representative but noalimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin~of replication derived from comsterczally available plasmids cocaprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such c~ercial vectors include, for eacample, pKK223-3 (Pbar<nacia Fine Chemicals, Uppsala, Sweden) and G8M1 (Promega Biotec, Madison, WI, tTSA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e. g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, diszupted by physical or chemical means, and the resulting crude extract retained for further purification.
_18_ Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
various mammalian cell culture systems can also be employed to express recombinant protein. fixamples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C12?, 3T3, C80, Fieha and BHK cell lines. Mammalian expression vectors will coa~rise an origin of replication, a suitable promoter and eahancer, and also any necessary ribosa~ne binding sites, polyadeaylation site, splice donor and acceptor sites, transcriptional termination segueaces, and 5' flanking nontranscribed sequences. D1~1 sequences derived from the SV40 splice, and polyadeaylation sites may be used to provide the required nontranscribed genetic elements.
The G-protein che~xaokine receptor polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial methionine amino acid residue.
The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.
The G-protein chemokine receptors of t3ie present im~ention may be employed in a process for screening for compounds which activate (agonists) or inhibit activation (antagonists) of the receptor polypeptide of the present invention .
In general, such screening procedures involve providing appropriate cells which express the receptor polypeptide of the present invention on the surface thereof. Such cells include cells from mammals, yeast, drosophila or E. Cola. In particular, a polynucleotide encoding the receptor of the present invention is employed to transfect cells to thereby express the G-protein chemokiae receptor. The expressed receptor is then contacted with a test compound to obse3cve binding, stimulation or inhibition of a functional response.
One such screening procedure involves the use of ~aelanophores which are traasfected to express the G-protein chemokine receptor of the present invention. Such a screening technique is described in PCT WO 92 / 01810 published February 6, 1992.
Thus, for example, such assay may be employed for screening for a compound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand and a compound to be screened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.

The screen may be employed for determining a compound which activates the receptor by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor.
Other screening techniques include the use of cells which express the G-protein chemokine receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, volume 246, pages 181-296 (October 1989). For example, compounds may be contacted with a cell which expresses the receptor polypeptide of the present imrention and a second messenger response, e.g.-signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
Another such screening technique involves introducing RtsA encoding the G-protein chemokiae receptor into 8enopus oocytes to transiently express the receptor.. The receptor oocytes may then be contacted with the receptor ligand and a cooa~pound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for caa~pounds which are thought to inhibit activation of the receptor.
Another screening technique involves expressing the G-protein chemokine receptor in which the receptor is linked to a phospholipase C or D. As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cells, embzyonic kidney cells, etc. The screening may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase second signal.
Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by determining inhibition binding of labeled ligand to cells which have the receptor on the surface thereof. Such a method involves transfecting .a eukaryotic cell with DNA encoding the G-protein chemokine receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the coarpound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
An antibody may antagonize a G-protein chemokine receptor of the present invention, or in so~e cases an oligopeptide, which bind to the G-protein chemokiae receptor but does not elicit a second messenger response such that the activity of the G-protein chemokine receptors is prevented.
Antibodies include anti-idiotypic antibodies which recognize unique determinants generally associated with the antigen-binding site of as antibody. Potential antagonist compounds also include proteins which are closely related- to the Iigaad of the G-protein chemokine receptors, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein chemokine receptor elicit no response.
An aatisease construct prepared through the use of aatisense technology, may be used to control gene expression through triple-helix formation or aatisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DTiA or RIB. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an aatisease RNA oligoaucleotide of frost about 1f to 40 base pairs in length. A DNA oligonucleotide is designed to be coanplemeatary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988):

and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of G-protein chemokine receptor. The antisense RNA oligonucleotide hybridizes to the ~aaRNA in vivo and blocks translation of mRNA
molecules into G-protein coupled receptor (antisense - Okano, J. Neurochem.. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Baton, FI: (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA
may be expressed ~En vivo to inhibit production of G-protein chemokine receptor.
A small molecule which binds to the G-protein chemokine receptor, making it inaccessible to ligands such that nozmal biological activity is prevented, for example small peptides or peptide-like molecules, may also be used to inhibit activation of the receptor polypeptide of the present invention.
A soluble f ozln of the G-protein chemokiae receptor, a . g .
a fragment of the receptors, may be used to inhibit activation of the receptor by binding to the ligand to a polypeptide of the present invention and preventing the ligand from interacting with membrane bound G-protein chemokiae receptors.
The com~pouads which bind to and activate the G-protein chempkine receptors of the present invention may be employed to stite haematopoiesis, wound healing, coagulation, aagiogenesis, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-im~awae diseases, parasitic affections, psoriasis, and to stimulate growth factor activity.
The compounds which bind to and inhibit the G-protein chemokine receptors of the present invention may be employed to treat allergy, atherogenesis, anaphylaxis, malignancy, chronic and acute inflammation, histamine and Ig$-mediated allergic reactions, prostaglandin-independent fever, bone marrow failure, silicosis, sarcoidosis, rheumatoid arthritis shock and hyper-eosinophilic syndrome.
The compounds may be employed in combination with a suitable pharmaceutical carrier. Such'compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should ~ suit the mode of administration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of. the pharmaceutical compositions of the invention. Associated with such containers) can be a notice in the fozm prescribed by a governmental agency regulating the manufacture, use or sale. of pharmaceuticals or biological products, which not~.ce reflects approval by the agency of _asanufacture, use or sale for human administration_ In additio'~n, the co~apouads. of the present invention may be employed in conjunction with other therapeutic coxapounds.
The pharmaceutical ,cocapositions may be ac~ainistered in a convenient manner such as by the topical, intravenous, iatraperitoaeal, iatramuseular, subcutaneous, iatraaasal or 3atradermal (applicable) routes. The pharmaceutical compositions are administered in as amount which is effective for treating and/or prophylaxis of the specific indication.
In general, the phaanaceutical compositions will be administered in an amount of at least about ZO ~eg/kg body weight and in nmost cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day.
In most cases, the dosage is from about 10 ,ug/kg to about 1 mg/kg body weight daily, taking into account the routes of adnttnistratioa, symptoms, etc., The G-protein chemokine receptor polypeptides and antagonists or agonists which are polypeptides, may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as ~gene therapy.~
Thus, for example, cells from a patient may be engineered with a polyaucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA
encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide is vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the preseat invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
R,etraviruses frown which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloaey Marine Leukemia Vizus, spleen necrosis vizus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis vines, gibbon age leukemia virus, human immunodeficiency virus, adenovirus;
Myeloproliferative Sarcoma Virus, and mammary tumor virus.
In one embodiment, the retroviral plasmid vector is derived from Moloney Marine Leukemia Virus.

The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (HIV) promoter described in Miller, et al., $~otechnioues, Vol. 7, No. 9, 980-990 (1989) , or any other promoter (e. g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a. suitable promoter. Suitable, prou~ot~rs which may be employed include, but are not limited to, adeaoviral promoters, such as the adenovirai major late proafoter; or hetorologous promoters, such as the cytomegalovirus (City) propaoter; the respiratory syncytial virus (RSV) praanoter; inducibie~promoters, such as the MMT promoter, the metallothionein proiaoter; heat. shock promoters; the alhumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thyad.dine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described).; the ~B-actin promoter; and human growth hormone promoters . The proutoter also ~ may be the native proamoter which controls the genes encoding the polypeptides.
The retroviral plas=aid vector is employed to transduce packaging cell lines to foza~ producer cell lines. Bx,amples of packaging cells which may be transfected include, but are not limited to, the PSSOl, PA337, ~-2, ~-AM, PA12, T19-14X, VT-39-I7-Fi2, s~CRB, ~C'RIP, GP+E-.86, GP+eavAml2, and DAN cell lines as described in Miller, Human Gene Theratw, vol. 1, pgs. 5-14 (1990) .

The vector may transduce the packaging cells through any means laiown in the art. Such means include, but are not limited to, electroporation; the use of liposomes, and CaP04 precipitation. In one alternative, the retroviral 'plasmz.d vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequences) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either za vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequences) encoding the polypeptide. 8ukaryotic cells which may be transduced include, but are not limited to, embryoaic stem cells, embryonic carcinoma . cells, as well as hema_topo~:etic. stem . cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, aad bronchial epithelial cells.
The present invention also provides a method for determining whether a ligand not kaown to be capable of binding to a G-protein cheruokine receptor can bind to such receptor which comprises contacting a mammalian cell which expresses a, G-protein chemokine receptor-,with the ligand under conditions percaitting binding of ligands to . the G-protein chemokine receptor, detecting the presence of .a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein chemokine receptor.
The systems hereinabove described-for determining agonists and/or antagonists may also 'be employed for determining ligaads which bind to the receptor.
This invention also provides a method of detecting expression of a G-protein chemokine receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA coding for the receptor which comprises obtaining total mRHA from the cell and contacting the mRNA so obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA
hybridized to the probe, and thereby detecting the expression of the receptor by the cell.
The present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention. . These related receptors .rnay be identif led by hortnology to a G-protei a chemokine receptor polypeptide of the present invention,-by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the chemokine receptor.polypeptides of the present invention.
Fragments of the genes may, be ~ used as a hybridization probe for a cDi~.1 library to isolate other genes which have a high sequence similarity to the genes of- the present invention, or which have similar biological activity. Probes of this type are at least 20 bases, preferably at least. 3.0 bases and angst preferably at least 50 bases or more. The probe may also be used to identify a cDI~1 clone corresponding to a full length'transcript and a genomic clone or clones that contain the caa~plete gene of the present invention including .regulatory and promoter regions, exons and introas .
An example of a screen of tb.is type comprises isolating the coding region of the gene by using the known DNA sequence to syathesize~ an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the. genes of the present invention are used to screen a library of human cDNA, genosaic DNA or mRNA to deter~ni.ae which members of the library the probe hybridizes to.
The present invention also contecuplates, the use of the genes of the present invention as a diagnostic, for example, score diseases result from inherited defective genes. .These genes can be detected by cooaparing the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene is associated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system (e. g., colorimetric assay, expression on MacConkey plates, c~rplementation experiments, in a receptor deficient strain of ~IC293 cells) as yet another means to verify or identify mutations. Once "mutant" genes have been identified, one can they screen population for carriers of the "mutant" receptor gene.
Individuals carrying mutations in the gene of the present invention may be detected at the DNA level by a variety of techaigues. Nucleic acids used for diagnosis may be obtained froaa a patient' s cells, including but not limited to such as from blood, urine, saliva, tissue biopsy and autopsy material_ The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR
(Saiki, et al., N~.tu~, 324:163-166 1986) prior to analysis.
RNA or cDNA may also be used for the same purpose. As an example, PCR primers como~plimentazy to the nucleic acid of the instant invention can be used to identify and analyze mutations in the gene of the present invention. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to. radio labeled RNA of the invention or alternatively, radio labeled aatisense DNA sequences of the invention. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting te~peratures. Such a diagnostic would be particularly useful for prenatal or eves neonatal testing.
Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA seqeiencing method. in addition, cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For exa~aa~ple, a sequence primer is used with double stranded PCR
product or a single stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radio labeled nucleotide or h:
an autoioaatic sequencing procedure With fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alterations in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Sequences changes at specific locations may also be revealed by nucleus protection assays, such RNase and S1 protection or the chemical cleavage method (e.g. Cotton, et al. , PI~~~g. USA, 85:4397-4401 1985) .
In addition, sane diseases are a result of, or are characterized by changes in gene expression which can be detected by changes in the mRNA. Alternatively, the genes of the present invention can be used as a reference to identify individuals expressing a decrease of functions associated with receptors of this type.
The present invention also relates to a diagnostic assay for detecting altered levels of soluble forms of the G-proem chemokiae receptor polypeptides of the present invention in various tissues. Assays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well kaoarn to those of skill in the art and include radioimmvaoassays, competitive-binding assays, Western blot analysis and preferably as BLISA assay.
An BLISA assay initially coa~rises preparing an antibody specific to antigens of the G-protein chemokine receptor polypeptides, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzycae. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any G-protein chemokine receptor proteins attached to the polystyrene dish. All unbound monoclonal antibody'is washed ou~ with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to G-protein chemokine receptor proteins. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of G-protein chec~okine receptor proteins present in a given volume of patient sample when cort~ared against a standard curve.
The seguences of the present invention are also valuable for chroancso~ne identification. The sequence is specifically targeted to and can hybridize with a particular location on as individual human chromoso~ane.. Moaceover, there is a current need for identifying particular sites on the chromosome . Few chro~some marking reagents based on actual sequence data (repeat polymo~cphisms) are presently available for marking chro~nosoma,,l location. The mapping of DNAs to chromosomes according to the present invention is an important f first step in corzelating those sequences with genes associated with disease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from' the cDNA.
Computer analysis of the cDNA is used to rapidly select primers that do not span more than one axon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell -3~-hybrids containing iadividtial human chro~awsomes. Oniy.those hybrids containing the human gene corresponding to the primer will yield an amplified fragaaent.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large geaomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in s~ttu hybridization, prescreening With labeled flow-sorted chromosomes and preselection by hybridization to construct chromaosome specific-cDl~ libraries.
Fluorescence ~fn situ hybridization (FISH) of a cDN~I
clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York ( 1988 ) .
Once a sequence has been mapped to a precise chromosomal location, the physical position, of the sequence on the chroaaosome can be correlated with genetic map data. Such data are found, for example, in v. McRusick, Meadelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have bees mapped to the same chromosomal region are they identified through linkage analysis (coinheritarice of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals . If a mutation is observed in sa~ae or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes z megabase mapping resolution and one gene per 20 kb) .
The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an im~nuaogen to produce antibodies thereto. These 'antibodies can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be~
obtained by direct injection of the polypeptides into an animal or by ad~ainisterinc the polvpeptides to an animal, preferably a nonhuman . The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment,of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human E-cell hybridama. technique (Rozbor et al : , 1983 , Imaaunology Today 4 : 72 ) , and the BBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

Techniques described for the production of single chain antibodies tll.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, tram~Anic mice may be used to express humanized antibodies to imvanunogenic polypeptide products of this imrention.
The present i~m~ention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following examples certain freguently occurring methods and/or terms will be described.
"Plasmids~ are designated by a lower case p preceded aad/or followed by capital letters and/or numbers. The starting plasmids herein are either co~mmnercially available, publicly available on an unrestricted. basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~cg of plasmid or DNA
fragment is used with about 2 units,of enzyme in about 20 ~cl of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~cg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzyr~aes are specified by the manufacturer . Incubation times of about 1 hour at 3 7~' C are ordinarily used, but may vary in accordance with the supplier s instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide geI described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be che~aically synthesized. Such synthetic oligonucieotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP is the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomaplished using known buffers and conditions with 10 units to T4 DNA lipase ("lipase") per 0.5 ycg of approximately equimolar amounts of the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Bb, A., Virology,.52:456-457 (1973).
Exa~le 1 Bacterial Bxflression and Purification of HDGNR10 The DNA sequence encoding for 5Z~R10, ATCC # _ is initially amplified using PCR oligonucleotide primers corresponding to theca 5' and sequences of the processed ~RlO protein (minus the signal peptide sequence) and the vector sequences 3' to the F~GNR10 geese. Additional r nucleotides corresponding to FmGYRIO were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence S' CGGAATTCCTCCATGGATTATCAAGTGTCA 3' contains an BcoRI restriction enzyme site followed by 18 nucleotides of H~N'RIO coding sequence starting from the presumed terminal amino acid of the processed protein codon. The 3' sequence 5~' CGGAAGCTTCGTCACAAGCCCACAGATAT 3' contains complementary sequences to ~ HindIII site and-is followed by z8 nucleotides of F~GNR10 coding sequence. The restriction enzyme sites correspond to the restr~.ctioa enzyme sites on the bacterial expression vector pQE-9 .(Qiagen, inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQB-9 encodes antibiotic resistance (A~up') , a bacterial origin of replication (ori) , as IPTG
regulatable promoter operator (P/0), a ribosome~binding site (RBS), a 6-His tag_and restriction enzyme sites. pQE-9 Gras then digested- with EcoRI and HindIII. The amplified t"
sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding.for the histidine tag and the RBS. The ligation mixture was then used to transforiu E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described zn Saiabrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (3989). M15/rep4 contains paultiple copies of~the plasmid pRFP4, which expresses the lacl repressor and also confers kanaa~ycin resistance (Xan°) .
Tzansfortaants are identified by their ability to grow on L8 plates and an~picillin/kanamycin resistant colonies were selected. Plasaaid , DNA was isolated and confizzaed by restriction analysis. - Clones containing the desired constnzcts were grown overnight (0/N) in liquid culture in Ia8 media supple~oaented with both Amp (Z00 ug/zal) and Kan (25 ug/ZN.). The O/N culture is used to inoculate a large culture at a ratio of 1.100 to- 1:250. The cells were grown tq an optical density 600 (0.D.°°°) of between 0.4 and 0.6.
IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing. the ?/0 leading to increased gene expression. Cells were grown an extra 3 to 4 hours .
-36=

Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCi. After clarification, solubilized HDGNR10 was purified from this solution by chromatography on a Nickel-Chelate~
column under conditions that allow for tight binding by groteins containing.the 6-His tag. Hochuli, E. et al., J.
Chromatography x11:17?-I84 (198x). HDGNR10 was eluted from the column in 6 molar guanidine HC1 pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine KC1, lO.OmM.sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione ~ (oxidized) . After incubation iri this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.
example 2 The expression .of plasrnid, HDGNR10 Iii is :derived front a vector pcDNAI/AmpM(Invitrogen) containing: 1) ~SV40 origin of replication, 2) ampicillin resistance gene, 3) E_coli.
replication origin, a) CMV promoter followed by a polylinker region, a SVaO intron and polyadenylation site. A DNA
fragment encoding the entire HDGNR10 precursor and a HA tag fused=in frame to its 3~ end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H.
.Niman, R. I~eighten,. A Cherenson, M. Connolly; and R. Lerner, 198x, Cell 37, 7~7) . The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction, strategy is described as follows:
The DNA sequence encoding for HDGNR10, ATCC No. 97L83, was constructed by PCFt using two primers: the S~ primer 5' GTCC

AAGCTTGCCACCATGGATTATCAAGTGTCA 3' and contains a HindIIT sit~-followed by 18 nucleotides of HDGNR10 coding sequence starting from the initiation colon; the 3' sequence 5' CTAGCTCGAGTCAAGCGTAGTt:TGGGACGTC~TATGGGTAGCACA.AGCCCACAGATATTTC
3' contains complementary ' sequences to an XhoI site, translation stop colon, HA tag and the last l8 nucleotides of the F~GNR10 coding sequence (not including the stop.codon).
Therefore, the PCR product contains a HindIII site F~GNR10 coding sequence followed by. HA tag fused in frame, a translation termination stop colon next to the HA tag, and an XhoI.site. The PCR amplified DNA fragment and the vector, pcDl~tAI/Amp, were digested with HindIII and Xhol restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning' Systems, 11099 North Torrey Pines Road, La Jolla, CA 92437) the transformed culture was - plated on atapicillin media plates and resistant ~ colonies were selected. Plasraid DNA was isolated from transfozmants and PYam~ned by restriction analysis for the presence of the correct fragment. For expression of the recoiabinant ~GNR~.O, COS cells were transfected 'with the expression vector by DBAE-DEXTRAN
method. (J. Sambrook, F. Pritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory press, (3989)). The expression of the HDGNR10 HA protein was detected by radiolabelling and iman:noprecipitation method.
(8. Harlow, D. Lane, Antibodies:. A Laboratory Manual, Cold Spring Harbor Laboratory Press, (i988)). Cells were labelled for 8 hours with '~S-cysteine two days past transfection.
Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 :nM NaCI, 1~ NP-40, 0.1~ SDS, i~~
NP-40, 0.5$ DOC, 50mM Tris, pH 7.5). (Wilson, I. et al " Id.
37:767 (1984)x. Both cell lysate and culture media were precipitated with a EA specific monoclonal antibody:
Proteins precipitated were analyzed on 15~c SDS-PAGE gels.

F.~s.~~.~tl a 3 n th v' g~grP~sion svstem The DNA, sequence encoding the full length HDGNR10 protein, ATCC No. 97183, 'was amplified using PCR
oligonucleotide primers corresponding to the 5' .and 3' sequences of the gene : ' The S' primer has the sequence 5' CGGGATCCCTCCATGGATTAT
CAAGTGTCA 3' and contains a BamHI restriction enzyme. site followed by 4 nucleotides resembling-anlefficient signal for the initiation of translation in eukaryotic cells (J. Mol.
Biol. 1987,-196, 9Q7-950, Kozak, M.), and just behind the first 18 nucleotides of the HDGNR10 gene (the initiation codon for translation is "ATG"). ' The 3' primer has the sequence 5' CGGGATCCCGCT
CACAAGCCCACAGATAT 3' and container the cleavage site for the restriction endonuclease BamHI and- 18nucleotides complementary- to the 3' non-translated sequence of the HDGNRIO gene. The amplified 'sequences were isolated from a I% agarose gel using a commercially available kit ( "Geneclean, " BIO 10I Inc . , La -Jolla, Ca . ) . The fragment was then digested with the endonuclease BarnFII -and purified as described above. This fragment is designated F2.
The vector .pRGl (modification. of pvL9~1 'vector, discussed below) is used for the expression of the HDGNR10 protein using the baculovirus expression system (for revie~r see: Summers, M.D, and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural- Experimental Statiori Bulletin No. 1555) .
This expression vector contains the stroizg polyhedrin promoter of the Autographs californica nuclear polyhedrosis virus (AcMNPV) -followed by the recognition sites for the restriction endonuclease BamFiI. The polyadenylation site of the simian virus (SV}40 is used for efficient polyadenylation. For an easy selection of recomb~~nant viruses the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed ' by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. aad Suaaners, M.D. , Virology, 170:31-39) . .
The plasmid was digested With the restriction enzyme BamHI and then dephosphorylated usiag calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1~ agarose gel as described above. This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA lipase. ls.coli HS101 cells were then transformed and bacteria identified that contained the plasmid (pBacBDGrTRIO ) with the HDC;NR10 gene using the eazyn~e BamHI. The sequence of the cloned fragment was confirmed by DNA sequencing.
~Cg of the plas-.nid pBac~GNRlO were co-transfected with i.0 ~cg of a caaamercially available liaearized baculovirus ("BaculoGold" baculovirus DNA°, Phazmingen, Saa Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
leg of BaculoGold'"' virus DNA and 5 ~g of the plasmid pBacBDGrTRIO were mixed in a sterile well of a microtiter plate containing 50 ~ul of serum free Grace's meditma (Z.ife Technologies Inc., Gaithersburg, MD). Afterwards 10 girl Lipofectin plus 90 ~Cl Grace's median were added, mixed and incubated for 15 miautes at room t~perature. Then the..
transfection mixture Was added drop wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 n~ tissue culture plate with 1 ml Grace' medium without serum. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After S hours .the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf senun was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.
After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows as easy isolation of blue stained plaques. ~ (A
detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life_Technologies Inc., Gaithersburg, page 9-10) _ Four days after the serial dilution, the viruses were added to the cells, blue stained plaques were picked with the tip of an Eppendarf pipette. T3~e agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing~200 ~.l of Grace's medium.. The agar was removed by a brief centrifugation and the supernatant containing. the recombinant baculoviruses was used to infect Sf9 cells seeded in 35 moa dishes. Four days later the supernatants of these culture dishes were harvested and~then stored at 4°C.
Sf9 cells were grown in Grace's anedium~supplemented~with 10% heat=inactivated FBS_ The cells were infected with the recombinant baculovinxs V-~GNR10 at a multiplicity of infection tMOI) of 2. Six hours later the medium Was removed and replaced with SF900 II mediuui minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later S ~cCi of ~S-methionine and 5 ~.Ci 'sS cysteine (Amersham) were added. The cells were further incubated for i6 hours before they were harvested by centrifugation and the Zabelled proteins visualized by SDS-PAGE and autoradiography.
Exatrmle 4 - ExoressiQn via Gene Therap~r Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37°C for approximately one week.
At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayex is trypsinized and scaled into larger flasks.
pMV-7 (Rirsctmneier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloaey marine sarcoma virus, is digested with BcoRI and HiadII2 and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using PCR prisoners which correspond to the 5' and 3' end sequences respectively: The 5' primer ccntains an $coRI sits and the 3' primer contains a HindIII site. $qual quantities of the Moloney murinE sarcoma virus linear backbone and the BcoRI and HindIII fragment are added together, in the presence of T4 DNA lipase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.

The amphotropic pA3l~ or GP+aml2 packaging cells are grown in tissue culture' to confluent density in Dulbecco~s Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin arid streptomycin. The.MSV vector containing the ' gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (.the packaging cells are now referred to as producer cells).
Fresh ~aedia is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the_media from the producer cells. This media is removed and replaced with fresh med~,a. ~ If the titer of vixus is high, then virtually all fibroblasts will be infected and no~selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or hid.
The engineered fibroblasts are then infected into the ho$t, either alone or after~~having been grows to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.
Numerous modifications and variations of the present invention are possible in light of the above~teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: HUMAN GENOME SCIENCES, INC. .

ROCKVILLE, MD 20850 UNITED STATES OF AMERICA
APPLICANT/INVENTOR: LI, Yi RUBEN, Steven M.
_, (ii) TITLE OF INVENTION: IiUMAN G-PROTEIN CHEMOKINE RECEPTOR HDGNRIO
(iii) NUMBER OF SEQUENCES: 9 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
(B) STREET: 1100 NEW YORK AVE., NW, SUITE 600 (C) CITY: WASHINGTON
(D) STATE: DC
(E) COUNTRY: USA
(F) ZIP: 20005 (v) COMPtTTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible - .
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release X1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,216,912 (B) FILING DATE: 06-JUN-1995 (C) CLASSIFICATIdN:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/US95/07173 (8)- FILING DATE: 06-JUN-1995 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: STEFFE, ERIC K.
(B) REGISTRATION NUMBER: 36,688 (C) REFERENCE/DOCKET NUMBER: 1488.I15CA00 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (202) 371-2600 (B)..TELEFAX: (202) 371-2540 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1419 base pairs (B) TYPE: nucleic acid (C). STRANDEDNESS: double ~ .
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATDRE:
(A) NAME/FEEY: CDS
(B) LOCATION: 259._131!
(xi) SEQUE1~TCE DESCRIPTION: SEQ ID NO:1: _ GGAAGCTAGC AGCAAAGCTT CCCTTCACTA CGAAACTTCA TTGCTTGGCC CAAAAGAGAG z20 GCATTCATGG AGGGCAAC2A'AATACFsTTCT AGGACTTTAT AAAAGATCAG TTTTTATTTA 240 Met Asp Tyr 61~x Val Ser Ser Pro Ile Tyr Asp ATC AAT TAT TAT gCA TCG 6AG CCC ~'GC CCA AAA ATC AAT GTG AAG CAA . 339 Ile Asn Tyr Tyr Thr Ser Glu Pro Cys Pro hys Ile Asn Val Lys~ Gln 15 20 ~ 25 IIe~Ala Ala'Arg Leu he~u Pro Pro heu Tyr Ser Leu Val Phe Ile Phe 30 35 - . 40 GGT TTT GTG GGC AAC ATG CTG GTC ATC CTC _AT~C CTG ATA AFiC TGC CAA ~ ' 435 Gly Phe Val Gly Asa Met Leu Val_ Ile ~.eu Ile Leu Ile Asa Cys Gln 45 54 ~ SS
AGG CTG GAG AGC ATG ACT GAC ATC TAC CTG CTC AAC CTG GCC.ATC TCT 9S3 Arg beu GIu Ser Met Thr Asg I1e Tyr Z.eu F.eu Asia Le3~ Ala Ile Ser 6f? 65 70 75 .
GAC CTG TTT TTC CTT CTT ACT GTC CCC TTC TGG ~GCT CAC 1'l~lT GCT GCC 53I
Asp Leu Phe Phe.heu l.eu- Thr VaI Pro Phe Trp Ala 8is Tyr Ala Ala '. 80 85 90 GCC CAG TGG GAC TTT GGA AAT ACA. 1$TG T'GT CAA CTC T~'G' ACA. GGG CTC ' 579' Ala Gln Trp Asp Phe Gly Asn Thr Met Cys GIr~ _ F~e~x Few TY~rr Gly heu Tyr Phe Ile Gly Phe Phe Ser Gly Tle Phe Phe IIe Ile Ixtz beu Thr lla ~~.s ~ 120 . . ~ .
ATe c~T AGG~TAC eT~ GCT ATC GTC C~~ GCT.GTG TTT GCS TTA AAA cce _. s7s ..
I2e Asp Arg Tyr Lew Rla Ile Val F~is ~ Ala ~i'af Phe F~a~ ~ ~eu ~.ys P~.a 12S ~ 134 . 135 AGG ACG GTC ACC TT'F GGG GTG GTG~ACA AGT GTG ATC ACT TG6 6TG GTG 723 Arg Thr Val Thr Phe Gly Val Val Thr Ser Val Ile Thr Trp Pal Val Ala Va2 Phe Ala Sec heu Pro Gly Ile fle Phe Thr Arg Ser Gln Lys 16c~ lss ~ loo GAA~GGT CTT CAT TAC ACC TGC AGC TCT CAT TTT CCA TAC AGT CAG TAT 819 Glu Gly Leu His Tyr Thr Cys Ser Sex ~~is.Phe Pro Tyr Ser Gln Tyr z~7s . zeo 18s -q.s-CAA TTC TGG AAG AAT TTC CAG ACA TTA AF~G ATA GTC ATC TTG GGG CTG 867 Gln Phe Trp Lys Asn Phe Gln.Thr Leu Lys Ile Val Ile heu Gly Leu Val Leu Pro Leu leu Val Met Val Ile Cys Tyr Ser Gly Ile Leu Lys ACT"CTG CTT CGG TGT CGA AAT GAG AAG AAG AGG CAC AGG GCT GTG AGG 963 Thr Leu f~eu Arg Cys Arg Asn Glu r.ys Lys Arg His Arg~ Ala Val Arg CTT ATC TTC ACC ATC ATG ATT GTT TAT TTT CTC TTC TGG GCT CCC TAC ' 1011 Leu Ile Phe Thr Ire Met Ile Val Tyr Phe Leu Phe Trp Ala Pro Tyr .
24'O 245 250 Asn Ile Val Leu Leu Leu Asn Thr Phe Gln Glu Phe Phe~ Gly Leu Asn AGC AGG TTG
GAC CAA
GCT ATG

Asn Cys Ser Ser Asn Leu Asp Gln Ala Gln Val Thr Glu Ser Arg Met 270 ~ 275 280 ACT CTT GGG ACG CAC TGC ATC AAC CCC ATC TAT~GCC TTT lass ATG TGC ATC

Thr Leu Gly Thr 8is Cys Ile Asn Pro Ile Tyr AIa Phe Met Cys Ile 285 ~ 290 295 GTC GGG GAG TTC AGA TliC CTC TTA GTC TTC CAA AAG CAC I203 AAG AAC TTC ' Val Gly Glu Phe Arg Tyr heu Leu Val Phe G,ln Lys I:ys Asn Phe 8is-300 305 . 310 315 ATT C,CC AAA TTC TGC TGC TGT TCT ATT CA6i CA1~~ GA6 I25I
CfC AAF1 ' TTC GCT

Ile AIa Zys Fhe Cys Cys Cys Ser Lle 61r~ Gln Glue Arg Lys Phe Ala CCC GAG C6A AGG TCA TAC ACC.CGA TCC GGG GAG CAG GAPS1299 GCA GTT ACT .

Pro Glu~Arg Ser Ser Tyr Thr Arg Ser GIg Glu GI~i Ala Va3. Thr Glu ATA TCT GTG GGC TTG~ TGAC~CGGAC TCAAGTGGGG TGGTGA~CC1~ GTCA6'AGTTG ~~x354 Ile Ser Val Gly Leu . ' TGCl~CATGGC TTAG~'TTTCA, TACACAGCCT GGGCTGGGGG TGGGGTGGAA GAGGTCTTTT 1414 (21' INP~5R2~tFtTION FCR SEø IET ~tQ:2':
( i a SEQUENCE CF~tPtCTERISTICS
(A) LENGTI#: 352 amino acid (B~ TYPE: amino acid (D) TOPi'~Ltt'~GY: linear ( ii ) MO1.ECDLE TYPE : protein (xi~ SEQQE1~ICE DESCRIPTION: SEQ ID N0:2:
Met Asp Tyr Gln Va3. Sex Ser Pro Ile Tyr Asp Ile Asn Tyr Tyr Thx 1 S 10 ' 15 -t~T_ .
Ser Glu Pro Cys Pro Lys Ile Asn Val Lys Gln Ile Ala Ala Arg Leu Leu Pro Pro Leu Tyr Ser Leu Val Phe~Ile Phe Gly Phe Val Gly.Asn 35 40 . 45 Met Leu Val Ile Leu Ile Leu Ile Asn Cys Gln Arg Leu GIu Ser Met Thr Asp Ile Tyr Leu Leu l~sn Leu Ala Ile Ser Asp Leu Phe Phe Leu 65 70 . '- 75 80 Leu Thr Val Pro Phe Trp Ala Bis Tyr Ala Ala Ala Gln Trp Asp Phe 85 90 .95 Gly Asn Thr Met Cys Gln Leu Leu Thr Gly ?~eu Tyr Phe Ile GZy Phe 100 105 ~ 110 ' Phe Ser Gly Ile Phe Phe Ile Ile Leu Leu Thr Ile Asp Arg Tyr Leu Ala Ile Val 8is RIa Val Phe Ala Leu Lys Ala Arg Thr Val Thr Phe Gly Yal Val Thr Ser Val Ile Thr Txp Val Val Ala Val Phe A'La Ser ?~eu Pro Gly Ile Ile phe Thr Arg Ser Gln Lys Glu Gly Leu 8is Tyr 165 I70 . 175 Thr Cys Sex Ser Iiis Phe Pro Tyr Ser GIn Tyr Gln Phe~Trg Lys Asr~
180 185 ' 190 Phe Gln Thr Leu T.ys IIe Val Ile Leu Gly Leu Val Leu Pra~ Leu Leu X95 ~ 200 205 Yal Met Val Ile Cys Tys Ser GIy Ile Leu Lys Thr Leu Leu Arg Cys 210 21~ 22E? .
Arg Asn Glur ~ys Lys Arg 8is Arg Ala VaEI ArQ feu 31e Phe Thr Ile 225 230 235 244' Met IIe Val Tyr Phe Leu Phe Trp Ala Pro Tyr Asn Ile Val Leu Leu . 245 250 255 .
Leu .~~s~x Thr Phe Gln Glu PFse Phe Gly Leu Asn Asn Cys Ser Ser Ser Ast~ l~rg Leu asp Gln AIa Met G~.n t~'al Thr Glu Tar. Leu Gly Met Thr 2'15 . 28~T 285 ibis Cys Cys IIe Asn Pro Ile Ile Tyr Ala Phe Val fly 6Iu Lys Phe Arg-Asn Tyr Leu Leu Val Phe Phe Gln Lys His Ile AIa I:ys Arg Phe Cys Lys Cys Cys Ser I'le Phe Gln Gln Glu Ala Pro Glu Arg Ala Ser Ser Val Tyr Thr Arg Ser Thr Gly Glu Gin Glu Ile Ser Val G1_y Leu 3~0 - . 345 350 (2) INFORMATION FOR SEQ ID N0:3:
'(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

(2) INFORMATION
FOR SEQ
ID N0:4:

(i) SEQUENCE
CHARACTERISTICS

(A) LENGTH: 29 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4.

(2) INFORMATION FOR SEQ ID NO:S: , . (i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 34 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) ' MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:S: .

(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 61 BASE PAIRS ..., (B) TYPE: NUCLEIC ACID _ (C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
CTAGCTCGAG TCAAGCGTAG TCTGGGACGT.CGTATGGGTA GCACAAGCCC ACAGATATTT 60 C . 6I

(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:

(2) INFORMATION FOR SEQ ID N0:8:
(i.) SEQUENCE CHARACTERISTICS
(A) LENGTH: 29 BASE PAIRS
($) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: B:

(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 344 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single .
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
Glu Glu Val Thr Thr Phe Phe Asp Tyr Asp Tyr Gly A1a Pro Cys His Lys Phe Asp Val Lys Gln Ile Gly Ala Gln Leu Leu Pro Pro 20 25 30 ..
Leu Tyr Ser Leu Val Phe Ile Phe Gly Phe Val Gly Asn Met Leu Val Val Leu Ile Leu Ile Asn Cys Lys Lys Leu Lys Cys Leu Thr Asp Ile Tyr Leu Leu Asn Leu Ala Ile Ser Asp Leu Leu Phe Leu Ile Thr Leu Pro Leu Trp AlawHis Ser Ala Ala Asn Glu Trp Val 80 ~ 85 90 Phe Gly Asn Ala Met Cys Lys Leu Phe Thr Gly Leu Tyr His Ile Gly Tyr_Phe Gly Gly Ile Phe Phe Ile Ile Leu Leu Thr Ile Asp 110' 115 ~ 120 Arg Tyr Leu Ala Ile Val His Ala Val Phe Ala Leu Lys Ala Arg ' CA 02562162 2006-10-20 -5 ~-Thr Val ValThr SerVal IleThr TrpLeu Val Thr Phe Gly Va1 Ala Val Val ProGly IleIle PheThr LysCys Gln Phe Ala Ser 155 I60 ~ 165 Lys Glu SerVal Tyr ValCys GlyPro TyrPhe ProArg Gly Asp 1~0 I75 180 Trp Asn PheHis Thr IleMet ArgAsn IleLeu GlyLeu Val Asn Leu Pro LeuIle Met ValIle CysTyr SerGly IleLeu Lys Leu 200 ~ 205 - 210 Thr Leu ArgCys Arg AsnGlu LysLys ArgHis ArgAla Val Leu Arg Val PheThr Ile MetIle ValTyr PheLeu PheTrp Thr Ile Pro Tyr IleVal Ile LeuLeu AsnThr PheGln GluPhe Phe Asn Gly Leu AsnCys Glu SerThr SerGln LeuAsp GlnAla Thr Ser Gln Val GluThr Leu GlyMet ThrHis CysCys IleAsn Pro Thr rle Ile AlaPhe Val GlyGlu LysPhe ArgSer LeuPhe Eiis Tyr Ile Ala GlyCys Arg IleAla ProLeu GlnLys ProVal Cys Leu Gly Gly GlyVal Arg ProGly LysAsn ValLys ValThr Thr Pro 320 _ 325 330 Gln Gly LeuAsp Gly ArgGly LysGly LysSer IleGly Leu . 340

Claims (9)

1. An antibody that specifically binds a human G-protein chemokine receptor HDGNR10 polypeptide.
2. The antibody of claim 1, wherein said HDGNR10 polypeptide comprises an amino acid sequence at least 90% identical to the amino acid sequence as set forth in SEQ ID NO:2.
3. The antibody of claim 1, wherein said HDGNR10 polypeptide comprises an amino acid sequence at least 95% identical to the amino acid sequence as set forth in SEQ ID NO:2.
4. The antibody of claim 1, wherein said HDGNR10 polypeptide comprises an amino acid sequence as set forth in SEQ ID NO:2.
5. The antibody of any one of claims 1 to 4, wherein said antibody antagonizes an activity of said HDGNR10 polypeptide.
6. Use of the antibody of any one of claims 1 to 4 to detect expression of a human G-protein chemokine receptor protein.
7. A process for detecting expression of a human G-protein chemokine receptor protein, said method comprising:
(a) contacting a protein sample isolated from a subject with the antibody of any one of claims 1 to 4; and (b) monitoring specific binding of said antibody, wherein detection of specific binding is indicative of expression of said human G-protein chemokine receptor protein.
8. A pharmaceutical composition comprising the antibody of any one of claims 1 to and a pharmaceutically acceptable carrier.
9. Use of the antibody of claim 5 in the treatment of chronic inflammation, acute inflammation, or rheumatoid arthritis.
CA002562162A 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10 Abandoned CA2562162A1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CA002216912A CA2216912A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CA002216912A Division CA2216912A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10

Publications (1)

Publication Number Publication Date
CA2562162A1 true CA2562162A1 (en) 1996-12-12

Family

ID=4161544

Family Applications (3)

Application Number Title Priority Date Filing Date
CA002562211A Abandoned CA2562211A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10
CA002216912A Abandoned CA2216912A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10
CA002562162A Abandoned CA2562162A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10

Family Applications Before (2)

Application Number Title Priority Date Filing Date
CA002562211A Abandoned CA2562211A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10
CA002216912A Abandoned CA2216912A1 (en) 1995-06-06 1995-06-06 Human g-protein chemokine receptor hdgnr10

Country Status (1)

Country Link
CA (3) CA2562211A1 (en)

Also Published As

Publication number Publication date
CA2216912A1 (en) 1996-12-12
CA2562211A1 (en) 1996-12-12

Similar Documents

Publication Publication Date Title
US6800729B2 (en) Human G-Protein chemokine receptor HDGNR10 (CCR5 receptor)
US6743594B1 (en) Methods of screening using human G-protein chemokine receptor HDGNR10 (CCR5)
US20080241124A1 (en) Human G-Protein Chemokine Receptor (CCR5) HDGNR10
CA2289046A1 (en) Human g-protein coupled receptors
CA2216990A1 (en) Human g-protein chemokine receptor hdgnr10
US20050266527A1 (en) Human G-protein receptor HIBEF51
EP0886643A1 (en) Human g-protein chemokine receptor hsatu68
EP1145721A2 (en) Human G-protein chemokine receptor HDGNR10 (CCR5 receptor)
EP1149582A2 (en) Human G-protein chemokine receptor HDGNR10 (CCR5 receptor). Uses thereof
US6338951B1 (en) G-protein parathyroid hormone receptor HLTDG74
US20020106741A1 (en) G protein receptor HTNAD29
US20080312178A1 (en) Human G-Protein Receptor HGBER32
CA2562162A1 (en) Human g-protein chemokine receptor hdgnr10
US20060014243A1 (en) Human G-protein chemokine receptor HSATU68
CA2224094A1 (en) Human amine receptor
US20020086362A1 (en) Human amine receptor
AU760468B2 (en) G-protein receptor HTNAD29
CA2221616A1 (en) Human g-protein receptor hibef51
CA2307709A1 (en) Two human g-protein coupled receptors: ebv-induced gpcr 2(ebi-2) and edg-1-like gpcr
JP2007130021A (en) Human g protein chemokine receptor hdgnr10
JP2008086324A (en) Human g protein chemokine receptor hdgnr10
AU2003235001A1 (en) G-Protein Receptor HTNAD29
CA2210471A1 (en) Human chemokine beta-11 and human chemokine alpha-1

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued
FZDE Discontinued

Effective date: 20121130