CA2517218A1 - Marker for psychosis or mood disorder - Google Patents

Abstract

An association of a genetic marker with psychosis, a mood disorder, or a combination thereof is provided. Polymorphisms in the GRIN2B gene or alteration in the levels of GRIN2B gene products can be used to diagnose or identify a susceptibility to psychosis, a mood disorder, or a combination thereof. In certain examples, polymorphisms in the 3'UTR of the GRIN2B can be associated with psychosis, a mood disorder, or psychosis and a mood disorder.

Description

MARKER FOR PSYCHOSIS OR MOOD DISORDER
FIELD OF INVENTION
[0001] The present invention relates to diagnosis or identifying a risk of developing psychosis, a mood disorder, or both psychosis and a mood disorder. More particularly, the present invention relates to association of a genetic marker with psychosis, a mood disorder, or both psychosis and a mood disorder.
BACKGROUND OF THE INVENTION

[0002] Mood disorders, for example, bipolar disorder or schizophrenia are common, chronic mental illnesses. Bipolar disorder manifests primarily as a disturbance of 1o mood, sometimes accompanied by psychotic symptoms, whereas the core features of schizophrenia are psychosis and cognitive impairment.

[0003] The N-methyl-D-aspartate receptor (NMDAR) has been hypothesized to play a crucial role in the pathophysiology of both psychotic symptoms and disease progression in schizophrenia. The ability of NMDAR antagonists to induce a 15 syndrome closely resembling schizophrenia suggests that dysfunction or dysregulation of NMDAR-mediated neurotransmission could play a role in schizophrenia.
Several investigators have examined mRNA expression patterns for individual NMDA
receptor subunits, including NR2B, in schizophrenia with somewhat conflicting results (Akbarian et al. 1996; Grimwood et al. 1999). These findings suggest that 2o further investigation of the role of NR2B in schizophrenia is needed.

[0004] In bipolar disorder, lithium and valproate are the most well established mood stabilizers used for tong-term treatment. Both of these drugs have a neuroprotective effect through reducing NMDAR-induced excitotoxicity, suggesting that alterations of glutamatergic transmission and/or of NMDARs may be involved in the symptoms of 25 bipolar disorder.

[0005] The gene encoding Glutamate Receptor Ionotropic, N-methyl-D-aspartate (GRIN2B), a subunit ofNR2B, has been localized to chromosome 12p12 . The full length GRIN2B cDNA has been cloned and sequenced in mouse, and has 90%
homology with the human gene sequence (Schito et al. 1997). Previous attempts to detect an association between GRIN2B and schizophrenia have produced inconsistent results (Nishiguchi et al. 2000; Ohtsuki et al. 2001, Di Maria et al, 2004).
More specific phenotypes have been studied in association with GRIN2B
polymorphisms: a positive association was found between the C2664T polymorphism and higher clozapine dosage in 100 Chinese treatment refractory patients (Hong et al.
2001).
These results were replicated in another sample consisting of 193 treatment-refractory schizophrenic patients and 176 normal subjects (Chiu et al. 2003).

[0006] Miyatake et al (2002) studied a T-to-G variant at nucleotide position -200 of the 5'UTR of GRIN2B. This substitution shortens the dinucleotide repeat to:
(GT)6(CT)(GT)6, and alters the putative Spl binding site. Luciferase reporter assays with transfected cell-lines demonstrated that the G-variant is associated with lower gene activity (Miyatake et al. 2002). A comparison between 100 Japanese schizophrenics and 100 Japanese controls showed that the frequency of the G
allele was significantly higher in schizophrenics.

[0007] In the rat and human, the NR2B subunit is primarily expressed in forebrain structures, such as the cortex, hippocampus, striatum, thalamus, and olfactory bulb.
Most of the studies on changes in expression levels of NMDAR subunits have focused on the subunit NRl (encoded by the GRIN 1 gene). A higher level of binding to NRl/NR2B receptors has been reported in superior temporal cortex in schizophrenia (Grimwood et a1.1999). Gao et al (2000) analyzed postmortem hippocampal tissue from schizophrenia and healthy individuals and showed that NMDAR mRNA levels for NRl were lower, and for NR2B higher in schizophrenia, in several hippocampal subregions (Gao et al. 2000).

[0008] In bipolar disorder, there has been relatively little investigation of the hippocampal glutamatergic system. Law and Deakin (2001) report a decrease in NRl mRNA in subjects with bipolar disorder. While Benes et al. (2001) showed no change in the lowaffinity kainate receptor subunits in subjects with bipolar disorder. A third study reported a decrease of activated hippocampal NMDAR but no change in the expression of kainate or AMPA in eight subjects with Bipolar Disorder (Scam et al.
2003).

[0009] There is a need to further clarify the association between mood disorders and GRIN2B or GRIN2B variants.
SUMMARY OF THE INVENTION

[0010] The present invention relates to diagnosis or identifying a risk of developing psychosis, a mood disorder, or both psychosis and a mood disorder. More particularly, the present invention relates to association of a genetic marker with psychosis, a mood disorder, or both psychosis and a mood disorder.

[0011] It is an object of the invention to provide an improved method of diagnosing psychosis, a mood disorder, or psychosis and a mood disorder, or identifying a risk of 1o developing psychosis, a mood disorder, or psychosis and a mood disorder based on testing of the GRIN2B gene or related gene products.

[0012] According to the present invention there is provided a method (A) of diagnosing or identifying susceptibility of a subject to a mood disorder comprising, testing a sample obtained from the subject for the presence of a polymorphism in the 15 NMDAR subunit gene GR1N2B, wherein the presence of allele C of the T/C
polymorphism at nucleotide position 5988 indicates that the patient is susceptible to a mood disorder. A non-limiting example of a mood disorder is Bipolar Disorder.

[0013] The present invention also provides a method (B) of diagnosing or identifying susceptibility of a subject to psychosis comprising, testing a sample obtained from the 2o subject for the presence of a polymorphism in the NMDAR subunit gene GRIN2B, wherein the presence of allele C of A/C polymorphism at nucleotide position indicates that the patient is susceptible to psychosis. Furthermore, psychosis is a set of symptoms that may be associated with a variety of illnesses including, but not limited to, Schizophrenia, Alzheimer's Disease, Major Depressive Disorder, 25 Schizoaffective Disorder, or Bipolar Disorder.

[0014] The present invention also pertains to a method (C) of diagnosing or identifying susceptibility of a subject to a mood disorder comprising, testing a sample obtained from the subject for the presence of a haplotype in the NMDAR subunit gene GRIN2B, wherein the combined presence of allele T of T/G polymorphism at the nucleotide position -200 (minus 200), allele C of A/C polymorphism at nucleotide position 5806, and allele C of the T/C polymorphism at nucleotide position indicates that the patient is susceptible to a mood disorder. A non-limiting example of a mood disorder is Bipolar Disorder.

[0015] This summary of the invention does not necessarily describe all features of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS

[0016] These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:

[0017] FIGURE 1 shows a schematic diagram of the location of polymorphisms in GR1N2B in accordance with an embodiment of the present invention.
DETAILED DESCRIPTION

[0018] The present invention relates to diagnosis or identifying a risk of developing psychosis, a mood disorder, or both psychosis and a mood disorder. More particularly, the present invention relates to association of a genetic marker with psychosis, a mood disorder, or both psychosis and a mood disorder.

[0019] The following description is of a preferred embodiment.

[0020] The present invention provides a genetic marker that may be used to diagnose a mood disorder or identify a susceptibility to a mood disorder. As described in more detail below, specific polymorphisms in the GRIN2B gene may be used as an indicator of a mood disorder, for example, but not limited to bipolar disorder.
Additionally, altered levels of GRIN2B mRNA or altered levels of NR2B protein may be used as an indicator of a mood disorder, for example, but not limited to bipolar disorder. Furthermore, a genetic marker is provided that may be used to diagnose psychosis or identify susceptibility to psychosis. Polymorphisms in the GRIN2B
gene, altered levels of GRIN2B gene products, or a combination thereof, may be used as an indicator for psychosis.

[0021] In examples of the present invention a subject's GRIN2B gene or related gene products is assayed or tested to diagnose a mood disorder or identify a susceptibility to a mood disorder. An example of a mood disorder includes, without limitation, bipolar disorder, major depressive disorder (unipolar depression), dysthymia, cyclothymia, or depression co-morbid with another illness.

[0022] In certain examples of the present invention a subject's GRIN2B gene or related gene products is assayed or tested to diagnose psychosis or identify a 1o susceptibility to psychosis. Psychosis is a set of symptoms that may be associated with a variety of illnesses including, but not limited to, Schizophrenia, Alzheimer's Disease, Major Depressive Disorder, Schizoaffective Disorder, or Bipolar Disorder.

[0023] In certain examples, specific polymorphisms in the GRIN2B gene are used as an indicator of psychosis, a mood disorder, or psychosis and a mood disorder.
In other 15 examples, altered levels of GRIN2B mRNA are used as an indicator. In still other examples, altered levels of NR2B protein are used as an indicator.

[0024] The results of assaying the GRIN2B gene or related gene products may be used alone or in conjunction with other clinical tests. In one example, a susceptibility to Bipolar Disorder can be identified by assaying for a T5988C polymorphism in the 3' 2o UTR of the GRIN2B gene. In another example, susceptibility to psychosis may be identified by assaying for an A5806C polymorphism in the 3'UTR of the GRIN2B
gene. In still another example, results of a clinical psychiatric test, such as without limitation SC>I7 (Structured Clinical Interview for Diagnostic and Statistical Manual Diagnosis) or FIGS (Family Interview for Genetic Studies), may be considered in

25 conjunction with the results of assaying for a GRIN2B polymorphism.
[0025] Any tissue sample may be used for genotyping GRIN2B polymorphisms, including but not limited to, saliva or blood. In certain examples, blood is obtained from a subject for assaying with respect to GRIN2B polymorphisms. In an example, venous blood is obtained from a subject using standard venipuncture techniques.

[0026] A subject's DNA is assayed for GRIN2B polymorphisms DNA. The method of obtaining and analyzing DNA is not critical to the present invention and any methods may be used (e.g. Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3, or Maniatis et al., in Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982, p. 387-389). For example, which is not to be considered limiting in any manner, DNA may be extracted using a non-enzymatic high-salt procedure (Lahiri and Nurnberger 1991). Alternatively, the DNA
may be analyzed in situ. Other methods of DNA analysis that are known to persons skilled in the art may also be used.

[0027] With reference to examples pertaining to assaying GRIN2B polymorphisms, examples of single nuclear polymorphism (SNP) indicators are at position -located in the 5' UTR of GR1N2B, at position 5806A/C or 5988T/C located in the 3' UTR of GRIN2B (see Figure 1).
15 [0028] Polymorphisms may be genotyped using conventional techniques. For example, PCR using primers incorporating fluorescent probes is one suitable technique. For example, which is not to be considered limiting, primers having the following sequences:
forward primer: 5'-TCGCAGGCACTATTCTAACTACTTTAC (SEQ ID NO:1) 2o reverse primer: 3'GCATTCCTGAAAAGAGAGATCATGTG (SEQ ID N0:2) may be used for the G-200T marker;
for the A5806C marker the following sequences may be used:
forward primer: 5'-GCTACAGAGCAGACAGTTAAGAGAA (SEQ ID N0:3) reverse primer: 3'TCATGGAGTGCAGCTCATTTCT (SEQ ll~ N0:4); and 25 for the T5988C marker, the following sequences may be used:
forward primer: 5'-CTTGAGCCCAGAGTGAACACT SEQ ID NO:S) reverse primer: 3'ACCCTCATCCCTGGAGTTTTATACA (SEQ iD N0:6).
[0029] A sample from a subject can be assayed for comparing or quantifying mRNA levels, NR2B protein, or both GRIN2B mRNA levels and NR2B protein levels. Samples may be obtained from a variety of tissue sources. For example, in post-mortem analysis brain tissue, such as without limitation, hipoocampus, superior temporal cortex, or dorsolateral prefrontal cortex (Brodmann's area 46) may be assayed. In living subjects, if brain tissue is unavailable then other samples such as white blood cells can be assayed.
[0030] Expression levels of GRIN2B mRNA may be measured using any standard to technique, for example without limitation, Northern analysis, quantitative PCR using Cyclophilin A levels as a control comparison and calculating expression levels of GR1N2B as a ratio of GRIN2B/cyclophilin threshold cycle (Tc) values, and the like.
[0031] Levels of NR2B protein may also be measured using any variety of techniques known to the skilled person, for example without limitation, ELISA, 15 immunodiffusion, or other methods that are known to one of skill in the art.
[0032] The subject may be a human or an animal subject. For example, other mammals that may be tested include, but are not limited to a dog, cat, horse, mouse, rat, or cow.
[0033] The present invention will be further illustrated in the following examples.
20 Examples Example 1: Genotynin~ of living subiects [0034] Subjects were recruited with fully informed written consent, and in accordance with University of Toronto and Canadian Institutes of Health Research (C1HR) guidelines for the ethical treatment of human subjects.
25 [0035] A total of 86 nuclear families consisting of probands with schizophrenia and at least one first degree relative were collected from hospitals in Toronto, Ontario. In addition, 192 schizophrenia case-control pairs were recruited. All patients had an independent clinical DSMIIIR / DSM-N diagnosis of schizophrenia from their referring psychiatrist. (American Psychiatric Association 1994) A SC>D
(Structured Clinical Interview for DSM diagnosis) was administered by trained research assistants to each proband to confirm a DSM-IIIR diagnosis of schizophrenia. After review of all clinical information, consensus between two experienced psychiatrists was the final decision for diagnosis. Controls were screened using the FIGS (Family Interview for Genetic Studies) and screening questions from the SCID, and excluded if there was any personal or family history of major mental illness or alcohol/substance abuse.
Patients and control subjects were matched for age +/- 5 years, sex, and self reported ethnicity to reduce the potential stratification that might result from ethnically 1o heterogeneous case and control groups. The average age was 37 years; with a male:
female ratio of 162:180; greater than 95% of the subjects were Caucasian. The case-control sample is 100% Caucasian, so as to avoid issues of population stratification.
[0036] Venous blood was obtained from subjects using standard venipuncture techniques. DNA was extracted using a non-enzymatic high-salt procedure (Lahiri and 15 Nurnberger 1991 ).
[0037] The bipolar trio sample consisted of 318 nuclear families from the Toronto area. The SCID interview and the same diagnostic procedures were used as above.
The average age of the probands was 41; the male: female ratio was 565:479;
and greater than 95% were Caucasian. The sample is further divided in two groups:
triads 2o with psychotic probands (N=158) and triads with non-psychotic probands (N=160).
[0038] Three SNP markers in the GRIN2B gene were studied: G-200T, A5806C and T5988C. The G-200T marker is located in the S'UTR, whereas the A5806C and the T5988C markers are located in the 3'UTR (see figure 1). The A5806C marker and T5988C are in partial linkage disequilibrium. All three polymorphisms were in Hardy-25 Weinberg equilibrium.
[0039] Polymorphisms were genotyped using fluorescent TaqMan~ probes as part of commercial Assays-on-DemandTM SNP Genotyping assays on the ABI PRISM 7000 sequence detection system, according to the manufacturer's protocol (Applied Biosystems Inc., Foster City, CA). The primer sequences were used:
3o for the G-200T marker (ABI catalogue # 4332072):

Forward primer: 5'-TCGCAGGCACTATTCTAACTACTTTAC SEQ ID NO:1 Reverse primer: 3'GCATTCCTGAAAAGAGAGATCATGTG (SEQ ID N0:2);
for the A5806C marker (ABI catalogue # 4332072):
forward primer: 5'-GCTACAGAGCAGACAGTTAAGAGAA (SEQ ID N0:3) reverse primer: 3'TCATGGAGTGCAGCTCATTTCT (SEQ m N0:4); and for the T5988C marker (ABI catalogue # 4332072):
forward primer: 5'-CTTGAGCCCAGAGTGAACACT (SEQ ID NO:S), reverse primer: 3'ACCCTCATCCCTGGAGTTTTATACA (SEQ m N0:6).
[0040] The PCR protocol was as follows: DNA lpl; TaqMan MasterMix Spl; Assay 10 0.25p1; dH20 3.75p1. Cycling conditions were as follows: after 10 min at 95°C, the samples were submitted to 40 cycles, each consisting of a step at 95°C
for 15 s, followed by a step at 60°C for 1 min. The PCR product was detected as an increase in fluorescence during the PCR extension phase when the probe was cleaved by the 5' exonuclease activity of the Taq DNA polymerase. This cleavage interrupts the fluorescence resonance energy transfer and the reporter dye starts to fluoresce in proportion to the level of PCR product generated.
[0041] The informative polymorphisms and the haplotype distribution were tested in the schizophrenia and bipolar nuclear family samples using the family based association tests (FBAT; Laird et al. 2000). Differences in the allele frequencies 2o between the patients and healthy controls were tested using the chi-square association test. Haplotype distributions in our case-control sample were obtained using Cocaphase.
[0042] Eighty six nuclear families (triads) composed of father, mother and schizophrenia proband, as well as a sample of 192 schizophrenia case-control pairs, matched for age, gender, and ethnic background were genotyped for the GRIN2B (-200)G/T, (5806)A/C and (5988)T/C markers. The allele count for each marker in this sample is listed in Table 1. Markers were also tested for association with bipolar disorder in a sample of 318 nuclear families composed of father, mother and bipolar proband. The size of this bipolar sample allowed subdivision and testing of the markers for association with the specific subphenotype of psychotic symptoms in the proband.
Table 1: Genotype counts and results for the case-control sample Cases T/T=19 A/A=16 TrT=9 T/G=74 A/C=82 TIC=40 G/G=71 C/C=54 C/C=94 Controls TIT=31 A/A=19 T/T=7 T/G=93 A/C=55 TIC=47 GIG=34 C/C=55 C/C=86 Xz (df=2) 17.9 2.373 0.849 p-value (corrected)_ ~ p= ~ P=
0.0003 0.305 0.654 [0043] Markers were found to be in Hardy-Weinberg Equilibrium. For the T-2006 polymorphism: a significant association of the G allele with the disease in the 1 o schizophrenia case- control sample was found; for the G/G genotype (data not shown) as well as for the presence of the G allele. The result is still significant after correcting for multiple testing. The nuclear families were tested for association using FBAT, showing no preferential transmission of either allele. Combining the z scores from the nuclear families and the Case-Control (zl+z2/~2) (Hedges 1985), an overall 15 significant result was obtained (See table 2 and table 3).
Table 2: P-value results for the combined SCZ samples.
T-2006 GIG GenotypeG allele Case-Control p<0.0001 P<0.0001 Corrected for muIt. =0.0003 P=0.0003 test.

Case-Contr. + triad ~p=0.0009 P=0.0027 [0044] The bipolar nuclear families were also tested using FBAT; no significant 2o association was found between the GltIN2B gene -200T/G marker and the entire bipolar sample, or with the subphenotype samples, that is, presence of psychotic symptoms (See table 3).

Table 3: Chi-square, and FBAT results for the Case Control, schizophrenia (SCZ) and bipolar disorder (BP) triad samples for all markers.(S): observed transmission;E(S): expected transmission.

Case-ControlXz=17.974; Xz=2.373; p=0.305Xz=0.849; p=0.654 p=0.0003 N=200 airs SCZ Triadsz=0.775 p=0.44z=0.349; p=0.73z=0.6; p= 0.56;
S=25/11;

(N=86 S=26/25; S=15/25; E(S)=23.6/12.3;
IT=16 edi rees E S =26.7/27.21T=26E S =15.8/24.1;
IT=18 BP TriadsZ=0.898; p=0.37z= 0.395; p=0.69;z=2.332; p=0.02 (N=318 S=163/157 S=140/172 S=60/144;

pedigrees)E(S)=167.66/153.33E(S)=137.1/174.9E(S)=70.7/133.21T=98 IT=154 IT=150 After correction for mutt.

Test. p=0.04 BP Psychoticz= 0.101; p=0.9z= 2.892; p=0.0038z=1.945; p=0.051 (N=158 S=80/66; S=60/104; S=27/45; E(S)=34.9/67.1;

pedigrees)E(S)=76.5/69.5E(S)=75.7/88.2;IT=48 IT=70 IT=74 After correction for mutt.

Test. p=0.008 [0045] No association was found between the A5806C polymorphism and our schizophrenia samples (both triads and case-control). The overall analysis of the bipolar sample with A5806C gave negative results. However, an over transmission of allele C was detected in bipolar patients with psychotic symptoms, even after to correction for multiple testing (Table 3).
[0046] For the T5988C polymorphism: no association was found between the marker and schizophrenia in case control and both nuclear family samples. The analysis of the bipolar sample showed a preferential transmission of allele C in the complete bipolar sample, but with either one of the subgroups the level of significance drops to a trend.
15 The significance is lost after correction for multiple testing. (Table 3).
[0047] Haplotype analyses was performed for these markers with results listed in tables 4 and 5. A preferential transmission of haplotype T-C-C in the bipolar sample was detected.
Table 4: BP sample haplotype analyses using FBAT.

HAP Haplotype AI. Z scorep-value ObservedExpected freq. (S) E(S) H 1 T C C 2 2 0.2182.411 0.01589991.752 80.402 H2 T A C 1 2 0.209-0.995 0.31995769.888 74.627 1 ) H3 G C C 2 2 0.202-1.103 0.26982966.696 71.862 2) H4 G A C 1 2 0.1531.326 0.18487663.664 58.275 2) H5 T C T (2 1 0.100-1.742 0.08757328.208 33.852 1) H6 G C T 2 1 0.072-0.758 0.44866518.344 20.555 2) H7 T A T (1 1 0.026***** *****
1 ) H8 ~ G A T (1 0.021***** *****
1 2) ~ ~ ~

Table 5: SCZ trio sample haplotype analyses using FBAT.
HAP Haplotype AI. Z scorep-valueObservedExpected freq. (S) E(S) H1 T A C (1 0.239 1.169 0.24245221.579 18.655 1 2) H2 T C C (1 0.218 -0.031 0.97519017.421 17.503 2 2) H3 G A C (2 0.200 0.986 0.32421318.421 16.512 1 2) H4 G C C (2 0.172 -0.453 0.65071416.579 17.497 2 2) H5 T C T 1 0.096 -1.633 0.1024516.000 9.842 2 1) H6 G C T (2 0.075 0.006 0.9953958.000 7.991 2 1 ) ~ ~

[0048] Haplotype analyses on the schizophrenia case control sample also showed significant increase of haplotype G-C-T in cases, and of haplotype T-C-C in controls (Table 6).
Table 6: schizophrenia case-controls sample haplotype analysis.
HaplotypeCases Controls p value*

EM Frequency**HaplotypeEM Frequency**

T A T 0.000279 TAC 0.2119 1,1,2 0.1782 0.116 T C T 0.1539 1,2,1 0.1229 0.271 T C C 0.2026 1,2,2 0.2751 0.01 G A T 0.008576 G A C 0.1366 2,1,2 0.1978 0.013 G C T 0.114 2,2,1 0.05462 0.008 G C C 0.1405 ( 2,2,2 0.1703 0.104 ~

*overall p-value= 0.00516 (between cases & controls) **EM Frequency: Estimation Maximisation algorithm.
[0049] A significant increase of the G allele of the G(-200)T polymorphism in an schizophrenia (SCZ) case-control sample; this and the SCZ triad sample combined show association of the G allele with the disease. This result was not replicated in the schizophrenia triad sample alone. However, of the two groups, the case control one is by far the largest. Therefore, the lack of replication in the triad sample could be due to lack of power or to the inherent differences between the two sampling methods, such as bias towards earlier age at onset in triad design.
[0050] The 3'UTR marker T5988C was associated with bipolar (BP) disorder in the BP triad sample, whereas the A5806C marker showed positive association with those among the bipolar patients who had psychotic symptoms. The haplotype analyses also showed preferential transmission of haplotype G-C-T in SCZ whereas haplotype T-CC was found to be protective in a SCZ case control sample but associated with bipolar disorder in a BP sample. The analysis of the case control sample showed to marked differences between cases and controls in the overall haplotype frequencies in schizophrenia.
[0051] The 5'UTR thus appears to be associated with schizophrenia, whereas the 3'UTR is associated with psychosis, mood disorder, or a combination thereof.
[0052] The 5' UTR/SCZ association support a role of the promoter region of 15 in the pathophysiology of SCZ. In addition, the present work and results have identified a different region of the same gene as playing a role in bipolar disorder.
This suggests that the two disorders may share some elements of etiology or pathophysiology.
[0053] Refining the phenotype, including examination of symptom clusters (such as 2o psychotic symptoms or cognitive impairment), rather than diagnostic classifications, may provide further results.
[0054] All citations are hereby incorporated by reference.
25 [0055] Akbarian, S., N. J. Sucher, et al. (1996). "Selective alterations in gene expression for NMDA receptor subunits in prefrontal cortex of schizophrenics."
J
Neurosci 16(1): 19-30.

[0056] Benes, F. M., M. S. Todtenkopf, et al. (2001). "GluR5,6,7 subunit immunoreactivity on apical pyramidal cell dendrites in hippocampus of schizophrenics and manic depressives." Hippocampus 11(5): 482-91.
[0057] Chiu, H. J., Y. C. Wang, et al. (2003). "Association analysis of the genetic 5 variants of the N-methyl D-aspartate receptor subunit 2b (NR2b) and treatment-refractory schizophrenia in the Chinese." Neuropsychobiology 47(4): 178-81.
[0058] Di Maria, E., Gulli, R., et al (2004) "Variations in the NMDA Receptor subunit 2B Gene (GRIN2B) and Schizophrenia: A Case-Control Study". American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 128B:27-29.
to [0059] Gao, X. M., K. Sakai, et al. (2000). "Ionotropic glutamate receptors and expression of N-methyl-D-aspartate receptor subunits in subregions of 21 human hippocampus: effects of schizophrenia." Am J Psychiatry 157(7): 1141-9.
[0060] Grimwood, S., P. Slater, et al. (1999). "NR2B-containing NMDA receptors are up-regulated in temporal cortex in schizophrenia." Neuroreport 10(3): 461-5.
15 [0061] Hedges, L. V. a. O., I (1985). Statistical methods for meta-analysis. Orlando (Flor), Academic Press.
[0062] Hong, C. J., Y. W. Yu, et al. (2001). "Association analysis for NMDA
receptor subunit 2B (GRIN2B) genetic variants and psychopathology and clozapine response in schizophrenia." Psychiatr Genet 11(4): 219-22.
[0063] Lahiri, D. K. and J. I. Nurnberger, Jr. (1991). "A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies." Nucleic Acids Res 19(19): 5444.
[0064] Laird, N. M., S. Horvath, et al. (2000). "Implementing a unified approach to family-based tests of association." Genet Epidemiol 19 Suppl 1: 536-42.
[0065] Law, A. J. and J. F. Deakin (2001). "Asymmetrical reductions of hippocampal NMDAR1 glutamate receptor mRNA in the psychoses." Neuroreport 12(13): 2971-4 [0066] Miyatake, R., A. Furukawa, et al. (2002). "Identification of a novel variant of the human NR2B gene promoter region and its possible association with schizophrenia." Mol Psychiatry 7(10): 1101-6.
[0067] Nishiguchi, N., O. Shirakawa, et al. (2000). "Novel polymorphism in the gene region encoding the carboxyl-terminal intracellular domain of the NMDA
receptor 2B
subunit: analysis of association with schizophrenia." Am J Psychiatry 157(8):

31.
[0068] Ohtsuki, T., K. Sakurai, et al. (2001). "Mutation analysis of the (GRIN2B) gene in schizophrenia." Mol Psychiatry 6(2): 211-6.
to [0069] Scarr, E., G. Pavey, et al. (2003). "Decreased hippocampal NMDA, but not kainate or AMPA receptors in bipolar disorder." Bipolar Disord 5(4): 257-64.
[0070] Schito, A. M., A. Pizzuti, et al. (1997). "mRNA distribution in adult human brain of GRIN2B, a N-methyl-D-aspartate (NMDA) receptor subunit." Neurosci Lett 239(1): 49-53.
IS
[0071] The present invention has been described with regard to one or more embodiments. However, it will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the 2o invention as defined in the claims.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Centre for Addiction and Mental Health (B) STREET: 250 College St. R-30 (C) CITY: Toronto (D) STATE: Ontario (E) COUNTRY: Canada (F) POSTAL CODE (ZIP): M5T 1R8 (ii) TITLE OF INVENTION: Marker for Psychosis or Mood Disorder (iii) NUMBER OF SEQUENCES: 6 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0: l:

(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 2:

(2) INFORMATION FOR SEQ ID N0: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

(2) INFORMATION FOR SEQ ID N0: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 4:

(2) INFORMATION FOR SEQ ID N0: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 5:

(2) INFORMATION FOR SEQ ID N0: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

Claims (12)

WHAT IS CLAIMED IS:

1. A method of diagnosing or identifying susceptibility of a subject to a mood disorder comprising:
testing a sample obtained from the subject for the presence of a polymorphism in the NMDAR subunit gene GRIN2B, wherein the presence of allele C of the T/C
polymorphism at nucleotide position 5988 indicates that the patient is susceptible to a mood disorder.

2. The method of claim 1, wherein the sample is blood.

3. The method of claim 1, wherein the mood disorder is selected from the group consisting of Depression co-morbid with another illness, Major Depressive Disorder, Dysthymia, Cyclothymia, and Bipolar Disorder.

4. The method of claim 1, wherein the step of testing comprises DNA extraction and PCR analysis.

5. A method of diagnosing or identifying susceptibility of a subject to psychosis comprising:
testing a sample obtained from the subject for the presence of a polymorphism in the NMDAR subunit gene GRIN2B, wherein the presence of allele C of A/C
polymorphism at nucleotide position 5806 indicates that the patient is susceptible to psychosis.

6. The method of claim 5, wherein the sample is blood.

7. The method of claim 5, wherein the psychosis is associated with an illness selected from the group consisting of Schizophrenia, Alzheimer's Disease, Major Depressive Disorder, Schizoaffective Disorder and Bipolar Disorder.

9. The method of claim 5, wherein the step of testing comprises DNA extraction and PCR analysis.

9. A method of diagnosing or identifying susceptibility of a subject to a mood disorder comprising:
testing a sample obtained from the subject for the presence of a haplotype in the NMDAR subunit gene GRIN2B, wherein the combined presence of allele T of T/G polymorphism at the nucleotide position -200 (minus 200), allele C of A/C
polymorphism at nucleotide position 5806, and allele C of the T/C polymorphism at nucleotide position 5988 indicates that the patient is susceptible to a mood disorder.

10. The method of claim 9, wherein the sample is blood.

11. The method of claim 9, wherein the mood disorder is selected from the group consisting of Depression co-morbid with another illness, Major Depressive Disorder, Dysthymia, Cyclothymia, and Bipolar Disorder.

12. The method of claim 9, wherein the step of testing comprises DNA
extraction and PCR analysis.