CA2507563A1 - Plant regulatory element - Google Patents

Abstract

An nucleotide sequence and that exhibits regulatory element activity is disclosed. The nucleotide sequence may be defined by SEQ ID NO:22, a nucleotide sequence that hybridizes to the nucleic acid sequence of SEQ ID NO:22, or a compliment thereof. Also disclosed is a chimeric construct comprising the nucleotide sequence operatively linked with a coding region of interest. A method of expressing a coding region of interest within a plant by introducing the chimeric construct described above, into the plant, and expressing the coding region of interest is also provided. Also disclosed are plants, seed, or plant cells comprising the chimeric construct as defined above.

Description

Express 1V' Label No. EV2895101 ~SUS
PATENT APPLICA'f 10N
ATTORNEY DOCKET NO.: GOW-001 CP2 PLANT REGULATORY ELEMENT
[0001] This application is a continuation-in-part of U.S.S.N. 09/457,123, filed December 7, 1999, which is a continuation-in-part of U.S.S.N. 09/174,999, filed October 19, 1998, now abandoned, which is a continuation of U.S.S.N.
08/593,I2I, filed February 1, 1996, now U.S. Patent No. 5,824,872, issued October 20, 1998, the entire disclosures of each of which are incorporated herein by reference.
FIELD OF INVENTION

[0002] The present invention relates to regulatory elements obtained from a plant.
This invention further relates to the use of one or more than one regulatory eler.ent to control the expression of exogenous DNAs of interest in a desired host.
BACKGROUND OF THE INVENTION

(0003] Bacteria from the genus Agrobacterium have the ability to transfer specific segments of DNA (T-DNA) to plant cells; where they stably irte~~ ate i;,to t he r~aclear chromosomes. Analyses of plants harbouring the T-DNA have revealed that this genetic element may be integrated at numerous locations, and can occasionally be found within genes: One strategy which has been exploited to identify integration events within genes is to transform plant cells with specially designed T-DNA
vectors which contain a reporter gene, devoid of cis-acting transcriptional and translational expression signals (i.e. promoterless), located at the end of the T-DNA. Upon integration, the initiation codon of the promoterless gene (reporter gene) will be juxtaposed to plant sequences. The consequence of T-DNA insertion adjacent to, and downstream of, gene promoter elements may be the activation of reporter gene expression. The resulting hybrid genes, referred to as T-DNA-mediated gene fusions, consist of unknown and thus un-characterized plant promoters residing at their natural location within the chromosome, and the coding sequence of a marker gene located on the inserted T-DNA. (Fobert et al., 1991, Plant Mol. Biol. 17, 837-851 ).

[0004] It has generally been assumed that activation of promoterless or enhancerless marker genes result from T-DNA insertions within or immediately adjacent to genes.
The recent isolation of several T-DNA insertional mutants (Koncz et al., 1992, Plant Mol. Biol. 20, 963-976; reviewed in Feldmann, 1991, Plartt J. 1, 71-82; Van Lijsebettens et al., 1991, Plant Sci. 80, 27-37; Walden et al., 19915 Plant J.
1:
281-288; Yanofsky et al., 1990, Nature 346, 35-39), shows that this is the case for at least some insertions. However, other possibilities exist. One of these possibilities is that integration of the T-DNA activates silent regulatory sequences that are not associated with genes. Lindsey et al. (1993, Transgenic Res. 2, 33-47) referred to n ,a~ +~ v ,~ F,.,7 aL..a aL..__ t-,. o_t r_..
,iW a ~e~iW.ui.v.$ aJ YWuuv-yrvuivwrS aiiu Su~gcS~cu maW ,itcy 111~t)' UG
leJ~JU11J1U1e. lUI
activating marker genes in some transgenic lines. Fobert et al. (1994, Plant J. 6, 567-577) have cloned such sequences and have referred to these as "cryptic promoters".

[0005] Mandel et al (1995, Plant Molec. Biol. 29:995-1004) discloses a promoter which is active in leaves, stem, and apical meristem tissues. This promoter was obtained from translation initiation factor 4A (NeIF-4A), a house keeping gene found +.,1.,.,1 11. > +:..0 11 in Wemuvrl arty aCmv. CvllJ.

[0006] Other regulatory elements are located within the 5' and 3' untranslated regions (UTR) of genes. These regulatory elements can modulate gene expression in plants through a number of mechanisms including translation, transcription and RNA
stability. For example, some regulatory elements are known to enhance the translational efficiency of mRNA, resulting in an increased accumulation of recombinant protein by many folds. Some of those regulatory elements contain translational enhancer sequences or structures, such as the Omega sequence of the 5' leader of the tobacco mosaic virus (Gallie and Walbot, 1992, Nucleic Acid res.
20, 4631-4638), the 5' alpha-beta leader of the potato virus X (Tomashevskaya et al, 1993, J. Gen. Virol. 74, 2717-2724), and the 5' leader of the photosystem I gene psaDb of Nicotiana sylvestris (Yamamoto et al., 1995, J. Biol. Chem 270, 12466-12470).
Other 5' regulatory elements affect gene expression by quantitative enhancement of transcription, as with the UTR of the thylakoid protein genes PsaF, PetH and PetE

from pea (Bone et al., 199, Plant J. 6, 513-523), or by repression of transcription, as for the S' UTR of the pollen-specific LATS9 gene from tomato (Curie and McCormick, 1997, Plant Cell 9, 2025-2036). Some 3' regulatory regions contain sequences that act as mRNA instability determinants, such as the DST element in the Small Auxin-Up RNA (SAUR) genes of soybean and Arabidopisis (Newman et al., .
' 1993, Plant Cell S, 701-714). Other translational enhancers are also well documented in the literature (e.g. Helliwell and Gray 1995, Plant Mol. Bio. vol 29, pp.
621-626;
Dickey L.F. al. 1998, Plant Cell vol 10, 475-484; Dunker B.P. et al. 1997 Mol.
Gen. ~ ' Gent. vol 254, pp. 291-296).
SUi~Ii~IARY OF THE INVENTION

[0007) The present invention relates to regulatory elements obtained from a plant.
This invention further relates to the use of one or more than one regulatory element to control the expression of exogenous DNAs of inteiest in a desired host.

[0008] It is an obect of the irwention to provide an improved constitutive regulatory element.

[0009] The transgenic tobacco plant, T127S, contained a 4.38 kb EcoRIlXbaI
fragment containing the 2.1 S kb promoterless GUS-nos gene and 2.23 kb of 5' flanking tobacco DNA (2225 bp). This 5' flanking DNA shows no homology to known sequences, and exhibits constitutive regulatory element activity.
Analysis of the S' flanking DNA revealed the occurrence of several additional regulatory elements, and that this DNA is a member of a large family of repetitive elements.

[0010] The present invention relates in part to an isolated plant constitutive regulatory element that directs expression in at least ovary, flower, immature embryo, mature embryo, seed, stem, leaf, root and cultured tissues of a plant. preferably, the regulatory element is not obtained from a IFA-4A gene. The isolated plant -, J

constitutive regulatory element may also be characterised by lacking an intron in its 5'UTR and a TATA box.
[0011 ] The constitutive regulatory element could not be detected in soybean, potato, sunflower, Arabidopsis, B. napus, B. oleracea, corn, wheat or black spruce by Southern blot analysis. However, expression of a coding region of interest, under control of the regulatory element, or a fragment thereof, was observed in transgenic tobacco, N. tabacum c.v. Petit Havana, SRI, transgenic B. napus c.v. Westar, transgenic alfalfa, and transgenic Arabidopsis, and Was observed in leaf, stem, root, developing seed and flower. In transient expression analysis, GUS activity was also ' observed ir~ leaf tissue of soybean, alfalfa, Arabidopsis, tobacco, B. napus, pea, potato, peach, Ginseng and suspension cultured cells of white spruce, oat, cern,~~Nheat and barley.
[0012] Thus this invention also provides for a regulatory element that is a constitutive regulatory element. Furthermore, this regulatory element functions in diverse plant species when introduced on a cloning vector, and maybe used to drive the expression of a coding region of interest within a range of plant species.
[0013] The present invention also relates to an isolated plant regulatory element that directs expression in at least ovary, flower, immature embryo, mature embryo, seed, stem, leaf, root and cultured tissues of a plant, wherein the regulatory element, or a fragment thereof, is a repetitive element. Preferably, the isolated plant regulatory element is a member of the RENT family of repetitive elements.
[0014] This invention pertains to a regulatory element characterized in that it comprises at least an 18 by contiguous sequence of any one of SEQ ID NO's:l, 5, 6, 7, 8, 9, 21 and 22.
[0015] The present invention also embraces a regulatory element having a nucleotide sequence that hybridizes to a nucleotide sequence, or a fragment thereof, as defined by the nucleotide sequence of any one of SEQ ID NO: 1, ~, 6, 7, 8, 9, 21 and 22 under the following hybridization conditions: 4XSSC at 65°C overnight, followed by washing in O.1XSSC at 65°C for one hour, or twice for 30 minutes each, wherin the nucleotide sequence exhibits regulatory element activity.
[0016] The transcription start site for the introduced GUS gene in transgenic tobacco was located in the plant DNA upstream of the insertion site. It was the same in leaf, ~ ~ , ' stem, root, seeds and flower. Furthermore; the .native site was silent in both , ' untransformed and transgenic tobacco. ' ' , ~ ' ' ' , [0019] This invention also relates to a chimeric construct comprising a coding region .
F:.,+Q..o + F -. .1.:,.1. +:+_,+:~.~ - a.-.-._--a a - ~ ' W mwW~ m ~vmvu witJW uuW . 2Ailli~JJ1V11, 1J lLGJ11G11, cL11C1 Q
I~UIl~LllltllV~ ~C~LIIaLUTy element, comprising at least an 18 by contiguous sequenYe of ar~y one SEQ ID
NO's:
1, 5; 6, 7, 8, 9, 2i and 22. This invention further relates to a cloning vector containing the chimeric gene construct. ' , [0018] This invention also includes a plant cell which has been transformed with the chimeric gene, or cloning vector as defined above: Furthermore, this invention a ),rarac tranogaroir~ p1."-,t$~ ~rld seeds, voiltaiiling t~le 1. hi111Gr1C
geile, Or tile 1:1V111I1g ri'..u. uvv.. u.p ...aw. iuia vector as defined above.
[0019] This invention further relates to any transgenic host, for example, but not limited to a transgenic plant, containing a nucleotide sequence selected from the group consisting of SEQ ID NO's: 1, 5, 6, 7, 8, 9, 21 and 22 or nucleic acid sequence that hybridizes to the nucleotide sequence, a complement, or a fragment thereof, as defined by the nucleotide sequence of any one of SEQ ID NO's: 1, 5, 6, 7, 8, 9, 21 and under the following hybridization conditions: 4XSSC at 65°C overnignt, followed by washing in O.1XSSC at 65°C for one hour, or twice for 30 minutes each.
The nucleotide sequence may also be operatively linked to a coding region of interest that is transcribed into RNA. Preferably, the coding region is heterologous with respect to the regulatory region.

[0020] Also included in the present invention is a method of conferring expression of a coding region of interest in a plant, comprising: operatively linking an exogenous coding region of interest, for which constitutive expression is desired, with a regulatory element comprising at least an 18 by contiguous sequence of any one of SEQ ID NO's:l, 5, 6, 7, 8, 9, 21 and 22 to produce a chimeric construct and introducing the chimeric construct into a plant ; and expressing the coding region of interest.
[0021 J The present invention also provides an isolated nucleotide sequence comprising the nucleic acid sequence defined by SEQ ID N0:22, a nucleotide . ' sequence that hybridizes to the nucleic acid sequence of SEQ ID N0:22, or a nucleotide sequence that hybridizes to a cor~.pliment of the nucleotide sequence of SEQ ID N0:22, wherein hybridi?ation condition is selected from the group c~nsisting of hybridizing overnight in a solution comprising 7% SDS, O.SM NaP04 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing fbr one hour at 60°C in a solution comprising 0.1 X SSC and 0.1% SDS;
hybridizing overnight in a solution comprising 7% SDS, O.SM NaP04 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 65°C in a solution comprising 2 X SSC and 0.1% SDS; and hybridizing overnight in a solution comprising 4 X SSC of 65°C and washing one hour in 0.1 X SSC at 65°C, and wherein the nucleotide sequence exhibits regulatory element activity and is capable of mediating transcriptional efficiency of a transcript encoding a gene of interest.
[0022] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region of interest. Furthermore, the present invention provides a method of expressing a coding region of interest within a plant comprising introducing the chimeric construct just defined, into a plant, and expressing the coding region of interest. The invention also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from the group consisting of: a monocot plant, a dicot plant, , a gymnosperm, an angiosperm, a hardwood tree, a softwood treep a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.
[0023] The present invention pertains to the isolated nucleotide sequence a just defined, wherein the nucleotide sequence is defined by SEQ ID NO:1, 5,~6, 7,8, 9, 21 Or 22, a nucleic acid sequence that hybridizes to the nucleotide sequence of SEQ ID
NO:1, 5, 6, 7, 8, 9, 21 or 22, or a nucleic acid sequence that hybridizes to a compliment of the nucleotide sequence of SEQ ID,NO:1, 5, 6, 7, 8, 9, 21_ or 22.
[0024] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region of interest. Furthermore, the present invention provides a method of expressing a coding region of interest within a plant comprising introducing the chirr~eric construct just defined, into a plant, and expressing the coding region of interest. The invention also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree; a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.
[0025] The present invention also provides an isolated nucleotide sequence comprising the nucleic acid sequence defined by nucleotides 1660-1875 of SEQ
ID
NO:1, a nucleotide sequence that hybridizes to nucleotides 1660-1875 of SEQ ID
NO:1, or a nucleotide sequence that hybridizes to a compliment of nucleotides 1875 of SEQ ID NO:l, wherein hybridization condition is 65°C over night in 7%

SDS; O.SM NaP04; l OmM EDTA, followed by two washes at 50°C in 0.1 X SSC, 0.1 % SDS for 30 minutes each, wherein the nucleotide' sequence exhibits regulatory element activity and is capable of mediating transcriptional efficiency, of a transcript encoding a gene of interest.
[0026] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with.a coding region ' of interest. Furthermore, the present invention provides a method of expressing a ' '. , , coding region of interest within a plant comprising introducing the chimeric construct just defined, into a plant, and expressing the coding region of interest. The invention also includes a plant comprising the c_h_imeric construct, a seed comprising the chim2ric canstruct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from tle group consisting of: a monacot plant, a divot pla:~t, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce. ' [0027] The present invention pertains to the isolated nucleotide s,:quer~c;, just defined, wherein the nucleotide sequence is defined by nucleotides 1660-1992 of SEQ ID
NO:1.
[0028] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region of interest. Furthermore, the present invention provides a method of expressing a coding region of interest within a plant comprising introducing the chimeric construct just defined, into a plant, and expressing the coding region of interest. The invention also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from the group consisting o~ a monocot plant, a divot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean; pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce. ' ~ ~ , , [0029] The lpresent invention relates to an isolated nucleotide sequence comprising the nucleic acid sequence defined by nucleotides 2091-2170 of SEQ ID NO:l, a nucleotide sequence that hybridizes to nucleotides 2091-2170 of SEQ ID NO:1;
or a nucleotide sequence that hybridizes to a compliment of nucleotides 209.1-2170 of SEQ ID NO:1, wherein hybridization condition is 65°C over night in 7%
SDS;.O.SM
NaP04; lOrriM EDTA, followed by two washes at 5f°C in 0.1 X SSC, 0.1%
SDS for 30 minutes each, wherein the nucleotide sequence exhibits regulatory element activity and is capable of mediating transcriptional efficiency of a transcript encoding a gene of iraerest.
[0030] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region of interest. Furthermore, the present invention provides a method of expressing a 1 coding region of interest within a plant comprising 'introducing the chimeric construct just defined, into a plant, and exprPssir;g the coding region of interest. The invention also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from the group consisting of: a monocot plant, a dicot plant;
a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.
[0031] The present invention also pertains to the isolated nucleotide sequence as just described, wherein the nucleotide sequence is defined by nucleotides 1660-2224 of SEQ ID NO:I, 1723-2224 of SEQ ID NO:1, 415-2224 of SEQ ID NO:1, 1040-2224 of SEQ ID NO:1, 1370-2224 of SEQ ID NO:1, 2084-2224 of SEQ ID NO:1, or 2042-2224 of SEQ ID NO:1.

[0032] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region of interest. furthermore, the present invention provides a method of expressing a ' , coding region of interest within a plant comprising introducing the ehimeric construct just defined, into a plant, and expressing the ,coding region of interest.
'the invention , ' also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or ' ~ ' ~ i I
plant cell may be selected from the group consisting of: ,a monocot plant, a dicot plant;
a gyrranosperm, an angiosperm, a hardwood tree, a. Softwood tree, a cereal plant, wllPat_ barlPV, oat. corr~~ tnb~r.rn5 ~rcrc~trn etwhPan~ YP~~ alf~lfa~ ~n~a~v~
gin~nvrig~ ,' Arabia'opsis, a peach, a plum and a spruce. , ', ~. ~ , [00331 The present invention provides an isolated nucleotide sequence co~nprising the nucleic acid sequence defined by nucleotides 1875-1992 of SEQ ID NO:1, a nucleotide~sequence that hybridizes to nucleotides' 1875-1992 of SEQ ID NO:1, or a nucleotide sequence that hybridizes to a compliment of nucleotides 1875-1'992 of $F.Q ID NQ:I w_h_Prei__n_ ltylJrjrli_Zatinn ~Cnditinn ~~~ HS°lv' C:'er night 1T'. ~~~ SDS; ~.~l~i NaPO~; IOmM EDTA, followed by two mashes at 50°O in 0.1 X SSC, 0.1%
SDS for 30 minutes each, wherein the nucleotide sequence exhibits regulatory element activity and is capable of mediating transcriptional efficiency of a transcript encoding a gene of interest.
[0034] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region of interest. Furthermore, the present invention provides a method of expressing a coding region of interest within a plant comprising introducing the chimeric construct just defined, into a plant, and expressing the coding region of interest. The invention also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from the group consisting of: a monocot plant, a dieot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean,~pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce. ' ~ . , ~ , [0035] The present invention pertains to an isolated nucleotide sequence as just described, wherein the nucleotide sequence is defined by nucleotides 1875-2084 of SEQ ID NO:l . Furthermore, the nucleotide sequence defined by nucleotides 1875-2084 of SEQ ID NO:1 may be present in tandem.
[0036] The present invention also pertains to a chirr~eric construct comprising the isolated nucleotide sequence as just described operatively linked with~a coding region ~;,~+oroc.+ T.".-+1-,ovw",.-A +l.,o ov.+' +:,... '.a,.~. +1....,.7 1 ~..-~..
V1 111WLWV. 1 UW 11v1111V11.r, 111v pluJV111. 111Ve11L1V11 ~J1V VllilJd Q
111~L11VU 1J1 V11f.11ev1J111~,' Q
coding region of interest within a plant comprisir_g introducing the chimeric construct just defined, into a plant, and expressing the coding region of interest. The invention also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from the group consisting of: a monocot plant; a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.
(0037] The present invention also provides an isolated nucleotide sequence comprising the nucleic acid sequence defined by nucleotides 1-1660 of SEQ ID
NO:l, a nucleotide sequence that hybridizes to nucleotides 1875-1660 of SEQ ID~NO:1, or a nucleotide sequence that hybridizes to a compliment of nucleotides 1-1660 of SEQ ID
NO:1, wherein hybridization condition is 65°C over night in 7% SDS;
O.SM NaP04;
lOmM EDTA, followed by two washes at 50°C in 0.1 X SSC, 0.1% SDS for 30 minutes each, wherein the nucleotide sequence exhibits regulatory element activity and is capable of mediating transcriptional efficiency of a transcript encoding a gene of interest.
[0038] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region ' , n , i S
of interest. Furthermore, the present invention provides a method of expressing. a , coding region of interest within a plant comprising introducing the chimeric construct just defined, into a plant, and expressing the coding region of interest. The invention a , also includes a plant comprising the chimeric construct, a seed comprising the ' chimeric construct, a plant cell comprising tl~e chimeri~ construct. The plant,' seed or , ' plant cell may be selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, ~a softwood tree, a cereal plant, ~~ ~ , n , wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, ~ '' Arabi,dopsis, a peach, a plum and a spruce.
, . ,.
[Ot~39] The present invention provides an isolated nucleotide sequence comprising the following nucleic acid sequence: ' TTATAATTAC AAAATTGATT MTAGTWYYTT TAATTTAATR YTTWTACATT ,' ATTAATTAAY TTAGHWSTTT,YAATTYDTTT TCARAAAYYA TTTTACTATK:
KTT(T/-)RT AAAAWMAAAR GGR~AAARTG GYTATTTAAA TACYAAC(M/-) . , CTATTTYATT TCAATTWTAR CCTAAAATCA,R(M/-)CCC(C/-) ARTTARCGCC ~
(W/-)(A/-) (T/-)(T/-) (Y/-)(C/-) (A/-)(A/-) (A/-)(T/-) (T/-)(C/-) AAAYGGBMYA KCCCARTTCC TAAA(A/-)Y RACYCDCYCC
TAACCC (K/-) (C/-) (T/-) (T/-) (W/-) (T/-) (C/-) (C/-) (A/-) (A/-)(C/-) (C/-)(C/-) RCCCKRTTYC CYCTTTTGAT CCAGGYYGTT
GATCATTTTG ATCAACGVCC ARAATTTCCC CYTTYC(Y/-) (K/-)TTTT
TMATTCCCAA ACACC(S/-) CCYAAMYYTA TCCCRTTTCT CACCAACCGC
CAGATMT(R/-)(W/-)(A/-)(T/-)CCTCT TATCTCTCAA ACTCTCTCGA
ACCTTCCCCT AACCCTAGCA GCCTCTCATC ATCCTCACCT CAAAACCCAC
CGGMMWMCAT GGCYTCTMRA G(S/-)(M/-)(K/-)(Y/-) (G/-)(R/-) (W/-)(M/-) (M/-)(C/-) (C/-)(K/-) (K/-)(R/-1 (T/-)(R/-) (S/-)(T/-) (C/-)(A/-)( S/-)(Y/-) YCCYYD(T/-)(G/-)(Y/-) (N/-)(M/-) (T/-)(T/-) (A/-)~
a nucleotide sequence that hybridizes to the nucleic acid sequence, or a nucleotide sequence that hybridizes to a compliment of the nucleotide sequence, where R
is G or .
A;YisTqrC;MisAorC;KisGorT;SisGorC;WisAorT;BisGorCorT;
DisAorGorT;HisAorCorT;andNisAorCorTorG,andwherein hybridization is selected from the group consisting of : ' hybridizing overnight in a solution comprising 7% SDS, 0.5M NaP04 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 60~°C~in a solution i , .
comprising 0.1 X SSC and 0.1% SDS; ~ ' . , ~~ ' .
hybridizing overnight in a solution cpmprising 7Q/o SDS, O.SM NaP04 .buffer , at pH 7.2, and 10 mM EDTA at.65°C and washing for one hour at 65°C in a solution comprising 2 X SSC and 0.1% SDS; and hybridizing overnight in a solution comprising 4 X SSC at 65°C and washing , one hour in 0.1 X SSC at 65°C, and wherein the nucleotide sequence exhibits regulatory element activity and is capable of a:..+:~~+_..~,.,._:_+:.._...~ rr:..:~_.._. r..4_........_..:._4 .~:_._ r:._+._...._.+
Wcmamy uaiiaciiriiviiai cmncmy W a uamcty 2iiCOum~ a gene of mucicm.
[0040] The present invention also pertains to a chimeric construct comprising the isolated nucleotide sequence as just described operatively linked with a coding region of interest. Furthermore, the present invention provides a method of expressing a coding region of interest within a plant comprising introducing the chimeric construct just defined, into a plant, and expressing the coding region of interest. The invention also includes a plant comprising the chimeric construct, a seed comprising the chimeric construct, a plant cell comprising the chimeric construct. The plant, seed or plant cell may be selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.

[0041] The present invention discloses transgenic plants generated by tagging with a promoterless GUS (13-glucuronidase) T-DNA vector and the isolation and . , characterization of a regulatory element identified usirig~this protocol.
Cloning and characterization of this insertion site uncovered a unique regulatory element not conserved among related species. The novel constitutive regulatory element is .
expressed in tissues throughout a plant and across a broad range of plant species. The novel constitutive regulatory element as described herein comprises additional regulatory elements, and is a member of a large family of repetitive elements that also exhibit regulatory element activity. Therefore, the present invention also describes nnP nr mnrP than yP _n_pvP.l rPaapla_tnr~r PlemPnt ayd itc hnmning~, FprthPrm~rP~ n~~rPl non-translated 5' sequences have been identified within the regulatory element that function as post transcriptional regulatory elements.
[0042] This summary of the invention does not necessarily describe all features of the invention. , BRIEF DESCRIPTION OF THE DRAWINGS
[0043] These and other featares of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
[0044] FIGURE 1 shows the constitutive expression of GUS in all tissues of plant T1275, including leaf segments (a), stem cross-sections (b), roots (c), flower cross-sections (d), ovary cross-sections (e), immature embryos (fJ, mature embryos (g), and seed cross-sections (h).
[0045] FIGURE 2 shows GUS specific activity within a variety of tissues throughout the plant T 1275, including leaf (L), stem (S), root (R), anther (A), petal (P), ovary (O), sepal (Se), seeds 10 days post anthesis (Sl), and seeds, 20 days post anthesis (S2).
[0046] FIGURE 3 is the Southern blot analysis of Eco RI digested T1275 DNA
with a GUS gene coding region probe (lane 1) and a nptll gene coding region probe (lane 2) revealing a single T-DNA insertion site in plant T1275.

. n' , S
[0047] FIGURE 4 shows the cloned GUS gene fusion from pT1275. Figure 4 (A) shows a restriction map of the plant DNA sequence fused with GUS. Figure 4(B) .
' , shows the restriction map of the plant DNA. The arrow indicates the GUS mRNA
~' i start site within the plant DNA sequence. ' ' , [0048] FIGURE 5 shows deletion constructs of the T1275 (tCUP) regulatory , ' element, and several results obtained with these constructs. Figure ~ (A) shows the ' ' restriction map of the plant DNA of pT1275 upstteam firom the GUS insertion site. ' ': , ,, Figure 5 (B) shows further deletion constructs of -62-GUS=nos, -12-GUS-nos, -62(-tsr)-GUS-nos and +30-GUS-nos, relative to ,-197-GUS-nos (see Figure 5 (A)).
'Figure (C) shows the 5' endpoints of each construct as indicated by the restriction endonuclease site, relative to the full l~ngtr.,T1275 (tCUI~) regulatory element, tr~e arrow indicates the transcriational start sites Plant DNA is indicated by the solid ~i~e, the promoterless GUS-nos gene is indicated by the open box and the shaded box , indicates the region coding for the amino terminal' peptide fused to, GUS. The XbaI , fragment in pT1275 was subcloned to create pT1275-GUS-nos. Deletion constructs ' :~ , trmc_a_ted at t_he ,SphI, _ _ _Pstl .c YT~ RctYT~ and rJrwl sites were also subcloned to create =
1639-GUS-nos, -1304-GUS-nos, -684-GUS-nos, -394-GUS-nos, and -197-GUS-nos, respectively. Figure 5 (D) shows modified constructs of the T1275 regulatory elements. T1275 is indicated by the open box, the CaMV35S promoter element is indicated by the black box. The activity of these constructs is also indicated. GUS
activity was determined in tobacco leaves following transient expression using microparticle bombardment. TA30-GUS: a TATATAA element was inserted into the -30 position of -62-GUS; TA35S-GUS: the -62 to -20 fragment of -62-GUS was substituted with the -46 to -20 fragment of the 35S promoter; GCC-62-GUS: a GCC
box was fused with -62-GUS; DRA2-GUS: the -197 to -62 fragment was repeated;
BST2-GUS: the -394 to -62 fragment was repeated; -46-35S: 35S minimal promoter;
DRAI-355: the -197 to -62 fragment of T1275 was fused with -46-355; BSTI-355:
the -394 to -62 fragment of T1275 was fused with -46-355; BST2-355: two copies of the -394 to -62 fragment of T1275 were fused with -46-355. Figure 5 (E) shows constructs of the -197 to -62 fragment fused with the 35S minimal promoter. -46-355:
35S minimal promoter; DRAI-355: the -197 to -62~frxgment of T1275 was fused with -46-35S; DRA1R-355: the -197 to -62 fragment ofT1275 was fused with -46-35S in a' reversed orientation; DRA2-355: two copies of the -197 to -62 fragment of were fused with -46-355. Figure 5 (F) shows GUS specific activity of transgenic Arabidopsis plants. Leaf tissues from Arabidopsis plants transformed with -47-355, DRAM -3 5 S, DRA 1 R-3 5 S and DRA2-3 5 S constructs were used for GUS assay.
Figure 5 (G) shows the constitutive expression of GUS in Arabidopsis plants transformed with DRA1-355. From top to bottom (i.e. Figures SG(i), SG(ii) and SG(iii), respectively): flower, silque and seedling. 'Figure 5 (H) shows the schematic diagram of the chimerical constructs. The numbers on the top indicate deletion end points relative tc tr~e trarscripticr~ ir~itiatior~ site (+1) cf the tCUP. The position of transcription start site is i~?dicated by an arrow. The dot line indicates the sequence been deleted. These constructs include (see Figure 5 (B) for more information): "-62"
(-62T1275-GUS-nosy; "-12" (-12T1275-GUS-nosy; "-62-tsr" (-61(-tsr)-GUS-nosy;
TA30 (sequence -30 to -24 of T1275 is replaced with TATATAA); GC'C-62 (addition of (~'.C~'(''-hnx cPn»anrPCl T11a111'P ~ !Tl chn~arc tha rPlativa artivitv of tha r~nnctr"~tc ..._ ... ~ ~ _ .._.1..._........~. s .b...~ ., ~. ~~~ "..., .... ...,.
....,...,.... .....~.....) ...~ ...... ...~..,m......w outlined in Figure 5 (Hl within tomato protoplasts. Each value _represents the average of four independent experiments. Error bars indicate SE values. Figure 5 (~
shows schematic diagrams of the 5' deletions chimerical constructs. -394(2X)-GUS and -197(2X)-GUS are the two constructs to test the effect of reiteration of the tCUP
upstream regions (-394 to -62 and -197 to -62) on promoter activity. The numbers on the top indicate deletion end points relative to the transcription initiation site (+1) of the tCUP promoter. Figure 5 (K), shows the average GUS specific activity (pmol MU /min/ mg protein) in transgenic Arabidopsis plants containing constructs shown in Figure 5 (J). 15-20 independent transgenic plants were tested for each construct.
Figure 5 (L) shows the schematic diagram of chimerical constructs to study the effect of the tCUP upstream region -197 to -62 on -46 minimal CaMV 35S promoter activity. The numbers on the top indicate deletion end points relative to the transcription initiation site. Open-boxes represent the tCUP sequence and filled-boxes represent the CaMV 35S promoter sequence. Figure 5 (M) shows the verage GUS
specific activity (pmol MU /min/ mg protein) in trans~enic Arabidopsis plants , containing constructs shown in A. 15-20 independent transgenic plants were tested for each construct. ~ ' [0049] FIGURE 6 shows the GUS specific activity, mRNA, and protein levels in , ~ ' leaves of individual, regenerated, greenhouse-grown transgenic tobaGCO plants ' ' containing T1275-GUS-nos (T plants), or 35S-BUS-nos (S plants). Figure 6 (A) ' '; , ,, shows the levels of GUS expression in leaves from~r~ndomly selected plants , containing either T1275-GUS-nos (left-hand side)'or 35S-GUS-nos (right=hand'side).
Figure 6 (B) shows the level of accumulated G[IS mRNA measured by RNase protection assay and den sito:retry of autoradiogra.-ns in l;,aves frorr~ the same randomly selected plants containing either T1275-C=T,JS-nos (left-hand side) or 35,5-GUS-nos (right-hand side). Figure 6 (C) shows a Western blot of GUS fusion protein obtained from T1275-GUS-nos and 35S-GUS-rios plants. Leaf extracts were equally loaded onto gels and GUS was detected using anti=GUS antibodies. The molecular-' wei_aht marlcerc are indicated nn the riaht_hanwl Bide nfthP ~rPl~
,~ntrangfnrme~l ~rnntrnl , (SR1) and GUS produced in E. coli (Ec).
[0050] FIGURE 7 shows deletion and insertion constructs of the 5' untranslated leader region of T1275 regulatory element and construction of transformation vectors.
The constructs are presented relative to T1275-GUS-nos or 35S-GUS-nos. The arrow indicates the transcriptional start site. Plant DNA is indicated by the solid line labeled T1275, the 35S regulatory region by the solid line labelled CaMV35S, the NdeI -SmaI
region by a filled in box, the shaded box coding for the amino terminal peptide, and the promoterless GUS-nos gene is indicated by an open box. The deletion construct removing the NdeI - SmaI fragment of T1275-GUS-nos is identified as T1275-N-GUS-nos. The NdeI - SmaI fragment from T1275-GUS-nos was also introduced into 35S-GUS-nos to produce 35S+N-Gus-nos.

[0051 ] FIGURE 8 shows the region surrounding the insertion site in untransformed plants, positions of various probes used for RNase protection assays, and~results o~the RNase protection assay. Figure 8 (A) shows a restriction map of the insertion site ' and various probes used for the assay (IP: insertion point of GUS in transformed plants; * : that T 1275 probe ended at the BstYl site, not the IP; * * :
,probe 7 included 600bp of the T1275 plant sequence and 400 by of the GUS gene). Figure 8 (B) ' shows results of an RNase protection assay of RNA isolated from leaf (L), stem (St), , root (R), flower bud (F) and developing seed (Se) tissues of tobacco transformed with T1275-GUS-nos (10 pg RNA) and untransformed tobacco (30 gg RNA). Undigested probe (p)~ r_t~a negative control (-) ~a'nes and markers are indicated.
F~l~Tase proteCtiO?'I - -- rr -asSays S11oW11 used a probe t0 det~~t S°nC~
tr~_n_cCriptg hAfy.~ACn a~,nyt -446 and +596 of T1275-GUS-nos or between about -446 to +169 of untransformed tobacco. The protected fragment in transformed plants is about 596 by (upper arrowhead) and, if present, accumulated transcripts initiated at this site in untransformed plants are predicted to protect a fragment of about 169 by (lower arrowhead). Upper band in RNA-containing lanes was added to samples to indicate loss of sample during assay.
[0052] FIGURE 9 shows the levels of mRNA, as well as the ratio between GUS
specific activity and mRNA levels in leaves of individual, regenerated, greenhouse-grown transgenic plants containing T1275-GUS-nos (i.e. tCUP-GUS-nosy, or 35S-GUS-nos constructs, with or without the Ndel Smal fragment (see Figure 7).
Figure 9 (A) shows the level of accumulated GUS mRNA measured by RNase protection assay and densitometry of autoradiograms in leaves from the same randomly selected plants containing either T1275-GUS-nos, T1275-N-GUS-nos. Figure 9 (B) shows the level of accumulated GUS mRNA measured by RNase protection for 35S-GUS-nos or 35S+N-GUS-nos. Figure 9 (C) shows the ratio between GUS specific activity and mRNA levels in leaves of individual, regenerated, greenhouse-grown transgenic plants containing tCUP-GUS-nos, tCUP-N-GUS-nos, 35S-GUS-nos, or 35S+N-GUS-nos constructs.

[0053] FIGURE 10 shows the maps of T1275-GUS-nos and T1275(ON)-GUS-nos.
Figure 10 (A) shows T1275-GUS-nos (also referred to as,tCUP-GUS-nas). Figuxe (B) shows T1275(~N)-GUS-nos (also referred to as tCUPdelta-GUS-nosy. "0N", (also referred to as "dN" or "deltaN") was created by changing the NdeI site "a" in the leader sequence of T1275-GUS-nos (Figure 10(A)) to a BgIII site ;'b" (see Figure 10(B)) to eliminate the upstream ATG at nucleotides 2087-2089 of SEQ ID N0:2.
'A
Kozak consensus sequence "c" was constructed at the initiator MET codon and a NcoI , site was added. The transcriptional start site, determined for T1275, is indicated by the arrow. ' X0054] FIGURE 11 shows constructs used for the transient expression via particle bombard~-ner~t of cam callus. Maps for 35S-GUS-nos, 35S (+NT)-GUS-nos, 35S
(~N)-GUS-nos and 35S(+i)-GT".JS-nos are presented indicating the "N" region, ADT.-il intron, and the arrow indicates the transcriptional start site. Note that 35S(ON)-GUS-nos is referred to as 35S+deltaN-dK-GUS-nos. Also shown are the associated, .
activities of the constructs in the callus expressed as a ratio of GUS to luciferase (control) activity.
[0055] FIGURE 12 shows maps of the constructs used for transient expression in yeast. Shown are pYES-GUS-nos (also referred to as pYEGUS); pYES(+N)-GUS-nos (also referred to as pYENGUS); pYES(ON)-GUS-nos (also referred to as pYEdNGUS) and pYES(ONM)-GUS-nos (also referred to as pYEdNMGUS), which lacks the Kozak consensus sequence.
[0056] FIGURE 13 shows the sequence similarity between several members of the RENT family of highly repetitive sequences. Figure 13 (A) shows a homology tree of an approximately 600 by fragment of RENT 1 (SEQ ID N0:5), RENT 2 (SEQ ID
N0:6), RENT 3 (SEQ ID N0:7), RENT 5 (SEQ ID N0:8), RENT 7 (SEQ ID N0:9) and T1275 (tCUP; SEQ ID NO:1). Figure 13 (B) shows a graphic representation of the sequence alignments between the different RENT clones and T1275 (tCUP).
Figure 13 (C) shows the actual sequence alignments of Figure 13 (B), where the numbering above the sequences indicates the numbering relative to RENT 7 (SEQ
ID
N0:9), and the numbering below the sequences indicate the alignment of the RENT
consensus sequence (SEQ ID N0:21 ) relative to the tCUP ~ sequence (SEQ ID
NO:1 ).
The consensus sequence relative to tCUP islpresented. Inserts within the RENT
consensus nucleotide sequence that are not present in tCUP, are indicated above the consensus sequence. Deletions in the nucleotide sequence in at least one member of the RENT family of nucleotide sequences that are not present in tCUP, are indicated as "-" above the consensus sequence. R is G or A; Y is fi or C; M is A~or C; K
is G or T;S~sGorC;WisAorT;BisGorCorT;Dis.AlorGorT;HisAorCorT;and N is A or C or T or G. Figur a 13(I3) shoves the RENT consensus sequence (SEQ
ID
-~ ~ P,.A d f y g o , ( f p '._~O__! ), seP i.,a,,n r~~ , o m_r.~ . ~ (~'1 .nr GIPt~.g p'f ceqapnCC
rr,,~~gRn.~:l~n. ~:g'u: °
13(E) shows the nucleotide sequence for tCUP-RENT (SEQ ID N0:22) where nucleotides 1-1723 comprise the nucleotide sequence of tCUP (SEQ ID NO:1), and nucleotides from 1724 to 2224 comprise the RENT consensus sequence (SEQ ID
N0:21). ' [0057] FIGURE 14 shows the expression of a coding region of interest driven by regulatory elements obtained from several members of the RENT family of highly repetitive sequences. Figure 14 (A) shows the transient expression of constructs comprising a RENT regulatory element in operative association with GUS-nos, and the expression of these constructs in pea protoplasts. The constructs were introduced into pea protoplasts via electroporation (see methods for details). tCUP RENT
(PCR
fragment from 1772 of SEQ ID NO:1 fused to delta N); RENT 1 (SEQ ID NO:S), RENT 2 (SEQ ID N0:6), RENT 3 (SEQ ID N0:7), RENT 5 (SEQ ID N0:8), RENT
7 (SEQ ID N0:9), 355-46 (35S minimal promoter. Figure 14 (B) shows histochemical analysis of GUS expression in transgenic Arabidopsis plants containing -394tCUP-GUS construct. GUS gene was expressed in leaves, stems, flowers, siliques and roots of transgenic Arabidopsis plants.

DETAILED DESCRIPTION
~~ .
[0058] The present invention relates to regulatory elements obtained from a plant.
This invention further relates to the use of one or more than one regulatory element to control the expression of exogenous DNAs of interest in a desired host.
[0059] The following description'is of a preferred embodiment. ' ' , [0060] T-DNA tagging with a promoterless (3-glucuronidase (GUS) gene generated several transgenic Nicotiana tabacum plants that expressed GUS activity. An 'example, which is not to be considered limiting in ahy manner, of transgeriic plants displaying expression of the promoterless reporter gene, includes a plant trat expressed GUS in aii organs, T i 275 (see co-pending' patent applications U S
serial No.
08/593121, PCT/CA97/00064; and PCT/CA99/0057 which are incorporated by ~ , reference).
~ I T f"lnnina anrl rleletinn anal~rcig of the (":T TC f,,,5i~ng ;n tl~PSO.
nluntc rc»realerl that ... ._ Jv ~ v ivr a a m one or more than one regulatory region was located in the plant DNA proximal to the GUS gene. In T1275, a regulatory region was identified within an XbaI - SmaI
fragment that exhibits constitutive activity in all organs, tissues and plants tested. This constitutive regulatory element, is referred to as T1275, or tCUP herein (SEQ
ID
NO's:l or 22), and comprises several other regulatory elements throughout the sequence, and that exhibit regulatory region activity as defined herein, for example:
- a minimal promoter region between DraI and NdeI sites (1875-2084 of SEQ
ID NO's:l and 22), also referred to as a,cqre promoter element; see Figure SC "-197-GUS-nos", and Table 6;
- negative regulatory elements between 1040-1370 of SEQ ID NO's:l and 22 ("-1304 to -684"; see Figures SJ and K, where activity obtained for "tCUP" and "-684" are each above that of the activity obtained for "-13 04");

,, I , s - a transcriptional enhancer between BstYI and DraI sites (1660-1875 of SEQ
,ID NO's:l and 22), also referred to as a BstYI-DraI fragment; see Figure I , SC e.g. "-394 GUS-nos", and Table, 6);~
a translational enhancer regulatory element between NdeI and SmaI site's , ' 1 I~
(2084-2224 of SEQ ID NO's:l and 22) see Figures SB (+30-GUS-nosy, , ~ , ' Figure 7 (T1275-GUS-nos; 35S-GUS'-nos) and Tables 7-13.' This ' fragment is also referred to as "N" heiein. Also see Figure.l 1 (comp'are ' ';
. , 'the activity of 35S+N-GUS=nos, comprising the INdeI-SmaI fragment, with I
t . , that of 35S-GUS-nos, lacking the~NdeI-SmaI~fragment). A shorten~'d I
fragment of N comprising nucleotides 2091-2170 of SEQ ID NO's:l and ' 22 (presented in SEQ ID X0:2; also referred to as dN, deltaN, tCUP ' delta), ~NM (a fragment that lacks a Kozak sequence; SEQ ID N0:4),, or a fragment that comprises a Kozak sequence (Figure 10, SEQ ID N0:3) also exhibit enhancer regulatory. element activity.
- an enhancer element between 1660-1992 of SEQ ID NO's:l and'22 (fragment between BstYI ("-394") and "-62"), see Figure SD (see Bstl-GUS; Bstl-35S, and tandem fragments: Bst2-GUS, Bst2-35S);
- a transcriptional enhancer between 1875-1992 of SEQ ID NO's: l and 22 (fragment between Dral ("-197") and "-62"), see Figure SD (Dral-GUS;
Drat-GUS; Dral-355; Dra2-35S), and Figures SE-G (Dral-355; Dra2-35S); and - members of the RENT family exhibit greater than 75% sequence identity with nucleotides 1724-2224 of SEQ ID NO:1, or more preferably, from about 77% to 92 % sequence identity with nucleotides 1724-2224 of SEQ
ID NO:I (see Figures 13C, 13D and 14A. This region includes several of the regulatory elements identified above including the minimal promoter between DraI and NdeI sites (1875-2086 of SEQ ID NO:1) and the translational enhancer between NdeI and, SmaI sites (2084-2224 of SEQ ID
NO:l). The consensus sequence for meinbers,of the RENT family (SF;Q
,, .
1D NO's: 21 and 22) is presented in Figures ~13(C) = 13(E). , [0062] Therefore, the present invention provides one or more thap one regulatory region obtained from T1275 (tCUP; SEQ ID NO's:l or 22), wherein the regulatory region may comprise: .
- the'full length sequence of SEQ ID NO:1,'SEQ ID N0:21, or SEQ ID
NO:22; , , - a ptclP:otodA gPrniA~r;C tat ~ ~~~_rir?i~Cg t~ ~E(~1 ID i~_T!~~ 1 ~Fll 1TZ
1~T(1-21 Z --J-- .- , .a, vm~ aiv i v. a, yr SEQ ID NO:22;
- a nucleotide sequence that hybridizes to the compliment of SEQ ID NO:1, SEQ ID N0:21, or SEQ ID N0:22; , .
- a fragment of SEQ ID NO:1, SEQ ID N0:21 or SEQ ID N0:22, or - a nucleotide sequence that hybridizes to a fragment of SEQ ID NO:1 SEQ
ID N0:21, or SEQ ID N0:22, wherein the nucleotide sequence exhibits regulatory element activity, or is capable of mediating transcriptional efficiency of a transcript encoding a gene of interest that is operatively linked thereto.
[0063] By a nucleotide sequence exhibiting regulatory element activity it is meant that the nucleotide sequence, when operatively linked with a coding sequence of interest, regulates, modifies or mediates the expression of the coding sequence. For example, a nucleotide sequence exhibiting regulatory element activity may function as a promoter, a core promoter, a constitutive regulatory element, a negative element or silencer (i.e. elements that decrease promoter activity), or a transcriptional or translational enhancer, thereby regulating, modifying or mediating expression of a I , s i coding region of interest that may be operatively linked thereto.
Hybridization condition ray be selected from the group consisting o~f: ' , - hybridizing overnight in a. solution' coinprisirig 7% SDS, O.SM NaP04 buffer at pH 7.2, and 10 mM EDTA ax 65°C and washing for one hour at 60°C in a solution comprising 0.1 X SSC and 0.1% SDS; ~ , ' ,, - hybridizing overnight in a solution comprising 7% SDS, O.S~M NaP04 buffer ' at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 65°C.in a solution ' ' '~
comprising 2 X SSC and 0.1 % SDS; and , ' ~ ' . , - hybridizing overnight in a solution comprising, 4 X SSC'at 65°C and washing one hour i_r10.1_ X SSC at 65°C. '' [0064] Furthermore, the present invention exemplifies the use of one or~more probes, for example but not limited to nucleotides 1660-2224 of SEQ ID NO:1 (BstYI-SmaI
fragment), that may be used identify members of the RENT family of sequences (see , Examples "RENT Repetitive Element from N. tabacum family of repetitive elements'' in the Examples).
[0065] However, it is to be understood that other portions of the isolated disclosed regulatory elements within T1275 (tCUP) may also exhibit activities in directing organ specificity, tissue specificity, or a combination thereof, or temporal activity, or developmental activity, or a combination thereof, or other regulatory attributes including, negative regulatory elements, enhancer sequences, or post transcriptional regulatory elements, including sequences that affect stability of the transcription or initiation complexes or stability of the transcript. The full-length nucleotide sequence of the T1275 (tCUP) regulatory region is provided in SEQ ID NO:1. Nucleotide sequences that exhibit from about 75% sequence identity with nucleotides from about 1724 to 2224 of the T1274 regulatory region (SEQ ID NO:1), and that exhibit regulatory element activity, are also disclosed. These nucleotide sequences include members of the RENT family of nucleotide sequences (see Figure 13C), and when , ~, , operatively linked with a coding region of interest; drive the expression of the coding region of interest (see Figure 14(A)).
[0066] Thus, the present invention includes, but is not limited to one'or more than one ; , regulatory element obtained fr4m plants that is capable, of conferring, rr~ediating, modifying, reducing, or enhancing expression upon a coding region of interest ~ , ' operatively linked therewith. Furthermore; the,present invention includes one or more ' '.
than one regulatory element obtained from a plant that i,s capable of mediating the ~ ~; , ,, translational efficiency of a transcript produced frorri a coding region of interest linked' in operative association therewith.' It is to b~ understood that the regulatory elements of the present invention may also be used iri combination with other regulatory ' elements, either cryptic or otherwise, 'such as promoters,'enhancers, or fragments' thereof, and the Like. . , [0067] Furthermore, the present invention provides an isolated plant constitutive regulatory element. This regulatory element may be characterized in that: , - it directs expression in a variety of plant tissues and organs, for example, the ovary, tl_ower, a_m__mature embryo, matprP emb_ryp~ cePd~ cterri~ 1_eaf _r~nt and CpltprPd tissues;
- it lacks a TATA box;
- it is not detected in untransformed soybean, potato, sunflower, Arabidopsis, B. napus, or B. oleracea, corn, wheat, black spruce, by Southern analysis under the following conditions: 4XSSC at 65°C overnight (from 12-18 hours), followed by washing in 0.1 XS S C at 65 °C for an hour; and - it is a member of a large family of repetitive elements (RENT).
[0068] The regulatory element described herein is a member of a large family of repetitive elements identified within the Nicotiana tabacum SR1 genome that exhibits greater than about 75%, and preferably from about 77% to about 90% sequence 2j similarity to fragment of approximately 532 by of SEQ ID NO:1 (including nucleotides 1724 to 2224; see Figures 13 (A) and (C); the,sequence.of tCUP in Figure 13 (C) includes the tDNA portion of the T1275 sequence which comprise nucleotides 635-667 of Figure 13(C)). This family of repetitive elements has been termed RENT
(Repetitive Element Nicotiana~ tabacum). The approximately 532, by fragment of SEQ
ID NO:1, and related nucleotide sequences as determined within the RENT family (SEQ~ID NO's: 5 to 9), exhibit regulatory element activity and are capable of directing GUS expression in a range of plants. The RENT consensus sequence is provided in Figures 13(C)-(E) and in SEQ ID NO's:21 and 22.
[0069] This invention is also directed to a regulatory element that comprises a nucleotide sequence of at least 18 contiguous base pairs of SEQ ID NO'~s:l, 5, 6, 7, 8, 9, 21 or 22. Oligonucleotides of 18 by or more are useful in constructing heterologous~
regulatory elements that comprise fragments of the regulatory element as defined in SEQ ID NO's:l, 5, 6, 7, 8, 9, 21, or 22. The use of such heterologous regulatory Wu..WeS iS 'v'v11 cStabiiS h':d ii1 ti3c iiiCtaIaALC. For example, fragments of specific elements within the 35S CaMV promoter have been duplicated or combined with other promoter fragments to produce chimeric promoters with desired properties (e.g.
U.S. 5,491,288; US 5,424,200; US 5,322,938; US 5,196,525; US 5,164,316).
Oligonucleotides of 18 bps or longer are useful as probes or PCR primers in identifying or amplifying related DNA or RNA sequences in other tissues or organisms. Furthermore, oligonucleotides of 18 bps or more are useful in identifying sequences homologous to those identified within SEQ ID NO's:l, 5 to 9, 21 or 22 for example, but not limited to, the RENT family of elements, as described herein.
[0070] By "regulatory element" or "regulatory region", it is meant a portion of nucleic acid typically, but not always, upstream of a gene, and may be comprised of either DNA or RNA, or both DNA and RNA. The regulatory elements of the present invention include those which are capable of mediating organ specificity, or controlling developmental or temporal gene activation. Furthermore, "regulatory element" includes promoter elements, core promoter elements, elements that are CA 02507563 2005-05-13 ' ,, s inducible in response to an external stimulus, elements that are activated ~ ' , constitutively, or elements that decrease or increase promoter activity such as negative regulatory elements or transcriptional enhancers, respectively. By a nucleotide ,~ , sequence exhibiting regulatory element activity it is meant that the nucleotide ' sequence when operatively linked with a coding sequence of interest functions as a ' promoter, a core promoter, a constitutive regulatory element, a negative element or ,, , , silencer (i.e. elements that decrease promoter activity), or a transcriptional or ,,.
translational enhances. ' ' .
, ~ ' , [0071 J ~By "operatively linked" it is meant that the particular sequences;
for .~Xample a regulatory element and a coding region of interest, interact either directly or indi_reCtly to Carry apt an i__r~tP_n_rlPra yrtinn gyCh aS mediation or I:~odulatior~ 0'f gene expression. The interaction of operatively linked sequences may, for exar.~ple, be mediated by proteins that interact with the operatively linked sequences. I
~ , [0072) Regulatory elements as used herein,~also includes elements that are active _ , , , following transcription initiation or transcription, for example, regulatory dements ' ' that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, and mRNA stability or instability determinants. In the context of this disclosure, the term "regulatory element"
also refers to a sequence of DNA, usually, but not always, upstream (5') to the coding sequence of a structural gene, which includes sequences which control the expression of the coding region by providing the recognition for RNA polymerise and/or other factors required for transcription to start at a particular site. An example of a regulatory element that provides for the recognition for RNA polymerise or other transcriptional factors to ensure initiation at a particular site is a promoter element. A
promoter element comprises a core promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as listed above) that modify gene expression. It is to be understood that nucleotide sequences, located within introns, or 3' of the coding region sequence may also contribute to the regulation of expression of a coding region of interest. A regulatory element may also include those elements located downstream (3') to the site of transcription initiation, or within transcribed regions, or both. In the context of the present invention a,post-transcriptional , regulatory element may include elements that are active~follovving transcription initiation, for example translational and transcriptional enhancers, translational and transcriptional repressors, and mRNA stability determinants. , [0073,] The regulatory elements, or fragments thereof, of the present invention may be operatively associated (operatively linked) with heterologous regulatory elements or promoters in order to modulate the activity of the, heterologous regulatory~element.
such modulation includes enhancing or repressing transcriptional activity of the .
heterologous regulatory element, modulating post-transcriptional events, or both enhancing or repressing transcriptional activity of the heterologous regulatory element and modulating post-transcriptional events. For example, one or more regulatory elements, or fragments thereof, of the present invention may be operatively associated with constitutive, inducible, tissue specific promoters or fragment thereof, or , , iagW2utS of rc~uiatGly GiG111Gilts, for exdir~pie, bui not limited to TATA or il4 sequences may be operatively associated with the regulatory elements of the present invention, to modulate the activity of such promoters within plant, insect, fungi, bacterial, yeast, or animal cells.
[0074] T here are generally two types of promoters, inducible and constitutive promoters. An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically the protein factor that binds specifically to an inducible promoter to activate transcription is present in an inactive form which is then directly or indirectly converted to the active form by the inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible promoter may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods.
[4075] A constitutive promoter directs the expression of a gene throughout,the various parts of a plant and continuously throughout plant development, Examples of known constitutive promoters include those associated with the CaMV 35S
transcript.
(Odell et al., 1985, Nature, 313: 810-812); the rice actin 1 (Zhang et ~1, 1991, Plant Cell, 3: 1155-1165) and triosephosphate isomeras'e 1 (Xu et al, 1994, Plant Physiol.
106: 459-467) genes, the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol.
29: 637=646), the Arabidopsis ubiquitin 1 anc~ 6 genes (Holtorf et al, 1995, Plarit Mol.
Biol. 29: 637-646), and the tobacco translationa~ iritiation factor 4A gene (Mandel et al, 1995 Pla:Zt I~ToI. Biol. 29: 995-1 CC-~+). The present invention is directed to a DNA
sequence which contains a regulatory element capable, of directing the expression, of a gene. Preferably the regulatory elemerit is a constitutive regulatory element isolated from N. tabacum. ' [0076] The term "constitutive" as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types, although some variation in abundance is often observed.
[0077] An example, which is not to be considered limiting in any manner, of a regulatory element of the present invention includes a constitutive regulatory element obtained from the plant T1275, as described herein and analogues or fragments thereof, or a nucleic acid fragment localized between Xbal - Smal, as identified by the restriction map of Figure 4 (B) or a fragment thereof. Furthermore, the regulatory element may be defined as a nucleic acid fragment localized between XbaI -SmaI as identified by the restriction map of Figure 5 (C) or a fragment thereof. The regulatory element may also be defined by a nucleotide sequence comprising at least an 18 by fragment of the regulatory region defined in SEQ ID NO's:l, 5, 6, 7, 8, 9, 21 or 22 The regulatory element may also be defined by a nucleic acid comprising from about 70%, preferably greater than about 75%, nucleotide sequence similarity to the nucleotide sequence of SEQ ID NO's: l , 5, 6, 7, 8, 9; 21 or 22 or a fragment thereof, or by a nucleic acid substantially homologous to the nucleotide sequence of SEQ
ID , NO's:l, 5, 6, 7, 8, 9, 21 or 22 or a fragment thereof, wherein the nucleic acid exhibits regulatory element activity.
[0078] Another regulatory element of the present invention includes, but is not limited to, a post-transcriptional or translational enhancer regulatory element localized between NdeI - SmaI (see Figures S (A), (B) or (C), Figure 7, and Figure 11), or the post-transcriptional or translational enhancer regulatory element may comprise the nucleotide sequence as defined by nucleotides 2084 -2224 of SEQ ID NO' 1 or an .
analog thereof, or the element may comprise 70% similarity to the nucleotide sequence of nucleotides 2084-2224 of SEQ ID i~TO:1 (i.e. a portion of the NdeI-Smal fragment from Nd~I to the integration point of T1275 at nucleotide 2224).
[0079] Furthermore, other regulatory elements of the present invention include negative regulatory elements (for example located w',thi_n_ an XhnT-RctYT
fragment as defined by Figure 5 (C), and described in more detail below), a transcriptional enhancer localized within the BstYI-DraI fragment of Figure 5 (C), a core regulatory element located within the DraI-NdeI fragment of Figure 5 (C), or a regulatory element or post-transcriptional element downstream of the transcriptional start site.
[0080] A further regulatory element of the present invention includes an enhancer element within the -394 to -62 fragment of T1275 (nucleotides 1660 to 1992 of SEQ
ID NO:1). This fragment may also be duplicated and fused to a regulatory region, for example a core promoter, producing an increase in the activity of the regulatory region (see Figure 5 (D)). A portion of the -394 to -62 fragment of T1275 (tCUP), from nucleotides 1724-1992 of SEQ ID NO:1 or 22 exhibits substantial homology with other members of the RENT family of repetitive sequences (Figures 13 (A) -(C)).
The homologous fragment present within the RENT family of sequences also exhibit regulatory element activity (Figure 14 (A)) and are active in a range of plants, and direct the constitutive expression of a coding region of interest throughout a plant (Figure 14,(B)).
[0081 ] Therefore, the present invention alsb provides ~~for a chimeric nucleic acid construct comprising a regulatory element in operative association with, a coding ' region of interest, the regulatory element comprising nucleotides 1660-1992 of SEQ
ID NO:1 (or SEQ ID N0:22), or a duplicate thereof. , ~ ' ' ,, , , [0082] Another regulatory element of the present invention includes, but is not limited to, a post-transcriptional or translational enh~rlcer regulatory element localized ~lPt\ PP O - C,,;h T f ~~ F ",-P 7 "" 1A r;aoQ~ '7'7n ~ ~ n i.rn. ~~. , ~....n .. ~.., a 's Iguw. i, mu~m.(imuW 20UZ-2GG-T of Slug IL lVll.l or GG, or I
p,,~,wlapti,~iac 1_1 ~jø~ ~f ~F,Q TD N(]:21 a1~:3 r~ierr~d tn a3 "~T"_ The .t-,,~5tvru~':wripiiv nui or translational enhances regulatory element may also camprise the nucleotide sequence as defined by nucleotides 1-141 of SEQ ID N0:2 (nucleotides 2084-2224 of , SEQ ID NO:1 or 22) or an analog thereof, or the element may comprise 70%
similarity (sequence identity) to the nucleotide sequence of nucleotides 1-141 of SEQ
ID N0:2 (nucleotides 2084-2224 of SEQ ID NO:1 or 22). This regulatory' element ' also exhibits substantial homology with members of the RENT family of repetitive elements (see Figure 13 (C); nucleotides 495-635 or nucleotides 2084-2224 of tCUP). , [0083] A shortened fragment of the NdeI - SmaI fragment, referred to as 0N, dN, deltaN, or tCUP delta, is also characterized within the present invention. ON
was prepared by mutagenesis replacing the out of frame ATG (located at nucleotides 2087-2089, SEQ ID NO:1) within the NdeI-SmaI fragment (see Figure 10). ON
constructs with (SEQ ID N0:3) or without (SEQ ID N0:4) a Kozak consensus sequence was also characterized (Tables 10, and 12) and found to exhibit enhances activity. Therefore, other cryptic regulatory elements of the present invention include, but are not limited to, post- transcriptional or translational enhances regulatory elements localized at nucleotides 1-97 of SEQ ID NO's:3 and nucleotides 1-86 of SEQ ID NO's: 3 or 4. These post-transcriptional or translational enhances regulatory elements may comprise the nucleotide sequence as defined by nucleotides 1-86 of SEQ ID NO's:3 or 4 (nucleotides 2091-2170 of SEQ ID NO:1) or an analog thereof, or the element may comprise 70% similarity to the nucleotide sequence of nucleotides 1-86 of SEQ ID NO's:3 or 4 (nucleotides 2091-2170 of ~SEQ ID NO:1).
Furthermore, these regulatory elements may comprise the nucleotide sequence as defined by nucleotides 1-97 of SEQ ID N0:3 and comprising a Kozack sequence or an analog thereof, or the element may comprise 70% similarity to the nucleotide sequence of nucleotides 1-97 of SEQ ID N0:3.
[0084] Furthermore, other regulatory elements of the present invention include negative regulatory elements (for example located within an XbaI-BstYI
fragment as' defined by Figure 5 (C); nucleotides 1-1660 of SEQ'ID NO:1), a transcriptional enhancer_ localized within the BstYI-DraI fragment of Figure 5 (C) (nucleotides 1660-1875 of SEQ ID NO: i), a core promoter element located within the Dral-NdeI
fragment of Figure 5 (C) (nucleotides 1875-2084 of SEQ ID NO:1 or 22), a transcriptional enhancer within the Dral to -62 fragment (nucleotides 1875-19,92 of , aLQ ii iw~: l UI 22; i figures 5 (v) to (u)), or a regulatory element or post-transcriptional element downstream of the transcriptional start site, for example but not limited to the NdeI-SmaI fragment (nucleotides 1-188 of SEQ ID N02) and derivatives and fragments thereof (for example nucleotides 1-141 of SEQ ID
N0:2);
including ON (nucleotides 1-129 or 1-97 of SEQ ID N0:3, ONM (nucleotides 1-119 or 1-86 SEQ ID N0:4), and nucleotides 1-86 of SEQ ID N0:3 or 4 (nucleotides 2084 to 2170 of SEQ ID NO: l ). ' [0085] The following non-limiting list of fragments of SEQ ID NO:1 or 22 have been characterized and their utility demonstrated herein, nucleotides:
1660-1992 ("-394" to "-62" fragment) enhances expression of the -46 minimal promoter of 35S, and a fragment of T1275 (see Bstl-GUS; Bstl-355, Bst2-GUS, Bst2-35S, of Figure 5D);
1660-1875 (BstYI-DraI fragment; see Figure SC; and Table 6; -394 GUS-nos) exhibits enhancer activity;

' ' 1660-2224 (BstYI-SmaI fragment; see Figure SC; and Tables 5 and 6; -394-GUS-nos) .also exhibits enhancer activity;
1724-2224 (Figures 13C, and Figure 14A, "tCUP RENT") exhibits regulatory element activity and comprises .several regulatory elements (core promoter element and an translational enhancer element). Nucleic acid sequences that hybridize to ~ ~ ' nucleotides 1724-2224 under stringent hybridization conditions and that exhibit one or ' ' more than one regulatory element activity, or nucleic acid sequences that exhibit , ' ~ , , ,, .
greater than 75% sequence identity with nucle,otides,'1724-2224 and that exhibit one , Ui inorc than one regulatory element activities, arelmembers of the RENT
family (SEQ ID NO's:21 and 22); , ' ' ~ ' 1875-2084 (DraI-NdpI fragment; core promoter element), see Figure SC and Table 6 (-197-GUS-nosy; ~ ~ , 1875-1992 (DraI - "-62" fragment) This fragment is shown to enhance expression of the -46 minimal promoter of ~ 5 S, arid a fragment of T1275, as shown in ~~
Figures SD (see Dral-GUS; Dra2-GUS; Dral-35S; Dra2-35S), and Figures SE-G
(Dral-355; Drat-35S), and functions as a transcriptional enhancer;
2084-2224 (NdeI-SmaI fragment, or "N"; Tables 10-12, Figure SB (+~0-GUS-nos), Figure 7 (T127~-GUS-nos; 355-GUS-nosy, and Figure 11 (35S+N-GUS-nos) exhibits translational regulatory element activity; and 2091-2170 (ON; see Tables 10-12) exhibits translational enhancer activity.
[0086] Therefore, the present invention is directed to an isolated nucleic acid sequence comprising a regulatory element selected from the group consisting of a nucleotide sequence:
defined by nucleotides I-1660 of SEQ ID NO:1 or 22 (XbaI-BstYI), defined by nucleotides 1660-1992 of SEQ ID NO:1 or 22 (BstYI to -62), JJ

defined by nucleotides 1660-1875 of SEQ ID NO:1 or 22 (BstYI-DraI), defined by nucleotides 1660-2224 of SEQ ID NQ:1 or 22 (BstYI-SrnaI), defined by nucleotides 1724-2224 of SEQ ID NO:1 or 22 (RENT), defined by nucleotides 1875-2084 of SEQ ID NO:1 or 22 (DraI-NdeI), I defined by nucleotides 1875-1992 of SEQ ID NO:1 or 22(Dral to -62), . defined by nucleotides 2084-2224 of SEQ ID NO:1 or 22 (NdeI-Smal), defined by nucleotides 2091- 2170 of SEQ ID NO:1 or 22 (N), defined by nucleotides 1992-2042 of SEQ ID NO:1 or 22 (-62 to -12), defined by nucleotides 415-2224 of SEQ ID NO:l or 22 (SphI- Smal), defined by nucleotides 1040-2224 of SEn ID NOv 1 or 72 ~PctT- .(',s,.yl h gird ' defined by nucleotides 1370-2224 of SEQ ID NO:1 or 22 (SspI-Smal).
[0087] The present invention also provides an isolated nucleic acid sequence comprising a regulatory element selected from the group consisting of a nucleotide sequence:
that hybridizes to nucleotides 1-1660 of SEQ ID NO:1 or 22 or a compliment thereof, that hybridizes to nucleotides 1660-1992 of S$Q ID NO:1 or 22_ or a compliment thereof, that hybridizes to nucleotides 1660-1875 of SEQ ID NO:I or 22 or a compliment thereof, CA 02507563 2005-05-13 .
that hybridizes to nucleotides 1724-2224 of SEQ ID NO:1 or 22 or a compliment thereof, ' . . ~ , , thathybridizes to nucleotides 1875-2084 of SEQ ID NO:1 or 22 or a compliment thereof, that hybridizes to nucleotides 1875-2224 of SEQ ID NO:1 or 22 or a compliment thereof, that hybridizes to nucleotides 1875-1992 of SEQ ID NO:I or 22 or a I compliment thereof, ~ ' , that hybridizes to nucleotides 2084-2224 of SEQ ID NO:1 or 22 nr a compliment thereof, and , that hybridizes to nucleotides 2091-2170 of SEQ ID N0:1 or 22 or a compliment thereof, ' wherein hybridization is under a co_n_di_tion set_ectPd from the grrnop rnngigting of:
hybridizing overnight (16-20 hours) in a solution comprising 7% SDS, O.SM
NaP04 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 60°C
in a solution comprising 0.1 X SSC and 0.1% SDS;
hybridizing overnight (16-20 hours) in a solution comprising ?% SDS, O.SM
NaP04 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 65°C
in a solution comprising 2 X SSC and 0.1% SDS; and hybridizing overnight (16-20 hours) in a solution comprising 4 X SSC at 65°C
and washing one hour in 0.1 X SSC at 65°C, and wherein the regulatory element exhibits regulatory element activity and is capable of mediating the transcriptional or translational efficiency of a transcript encoding a coding region of interest that is operatively linked thereto.
3~

[0088] Furthermore, the present invention provides an isolated nucleotide sequence comprising nucleotides defined by the nucleotide sequence of SEQ ID
N0:22, or a compliment thereof comprising the the positions following nucleotides at indicated in ' , Table 1 a. .

Table la: Identification of nucleotides ly and of the RENT fami their positions , ~ ' within within SEQ ID N0:22 . . , ~ ' '.

Position* Nucleotide . ' ~

~. . _ , ' tCUP RENT1 RENT2 ~ RENT3 RENTS RENT?

1744 . C C ~ C ' ~' C , C A

1749 A A A ' T' A A

1?50 T T T . T T C

1751 C T T~ T T ~ T

1763 G A A ~ A A A

1799 T T C ~T T T

2000 G T G ~ ~, G, G , ~ A
~

' 1807 G G A G G G

' 1811 T T T T T C

1812 T C 'T T C C

1823 , T T T ~ ~~T G ~ T

1 O'1 ~ T T
1 O.C.,'t 1 1 j ~ j 1827 T - T ~T T T

1834 T A T T T ~ T

1843 G A G G G , G

~, s 1883 T A T ~ T T ~ T

1886 G G G ~ . , A G G , , a , 1897 G G ~ G G G A ' ' .

1897-8 - C C -C C A ~ ' ' ' 1901 C ,, , ~ ,-- C , , . - - ,, 1903 A A A A A . ' ~ ~G

, i 907 G A ~A G . . A A
~ ~

~. , 1912 A ~ T -A A -1913 A A 'A - A ~ - ' 1914 T T T , ' - T

.

1918 A A A ~ - A -CA 02507563 2005-05-13 ' 1927 ' C ~ T ~C C C ' T

. , , 1930 T G G v C ~ G ~ G , 1931 C C A ~ C C C

1932 C C C ' C I T C , 1934 G G ~ G T G G
' , ' ~ w1939 , ~ A A ' ~A G ' A
A , 1947-8 - A ~ A ~A A , A

1949 T T T ~T T C

.. , , ' 1952 C C C T C C

1954 A ~= G v T

GCTTTTC TCTTATC GCTTATC GCTTATC GCTTATC

CAACCC CAACCC CAACCC CAACCC .CAACCC

1990 C C T C C ,C

1991 ~ C T T ~ , C , C C ' 2012 C G , A A , A ~ G

2026 T T C ~ T II T T

,, ~ .
2029 T C ', C , , . _ C ' C y ~, ,, 2031 ~ C _ T , ~ ' C . , , 2032 T _ , G T T T ' 2051-2 - C C G C ~ C ' 2054 T C C _ _ _ .
.

?n5~ ~ r~ ~ A C A

2058 T C C C C C , 2066 A G A ~ A A A

2091 A A A _ A _ 2092 T T T - T _ ' ~ ~ , S
2171 A C C C C ~C ' 2172 ~ A C C ~. , C , C C . ' , a " , 2173 T A ~ A A ' A A ' ,, , , 2174 A C C CI~ C C ~ ~ ' ,, , ~ , 2181 T C ', C , , .C C C

2185 ~ C A A , ~A ~ A ' A
~

,, ,.

2186 A G G G G , ' G

2189 C - ~' ' G - G
-2191 G - ~- T - T

2193 G G - - G - , 2196 A C - - C _ 2201 T G ~ - ~G G G

2202 A G - G , G ' G

2205 C G - G ~G G , 2210 C T - ~, T T T
' , 2214 C T C ~T T T

2216 T A G A A ~ A

2220 T - - N - . T

* position within SEQ ID N0:22 wherein the nucleotide sequence exhibits regulatory element activity and is capable of conferring ,or enhancing expression on a coding region of interest linked in operative , association therewith. ' [0089] An "analogue" of the above identified regulatory elements includes any ~ ' substitution, deletion, or additions to the sequence of a regulatory element provided ' ' , that said analogue maintains at least one regulat'or'y property associated with the ~ ' ~. , ,, activity of the regulatory element. Such properties include directing organ specificity, ' tissue specificity, or a combination thereof, pr.temporal activity, or developmental .
activity, or a combination thereof, or other regulatory attributes including, negative regulatory elements, enhancer sequences, or sequences that affect stability of the ' transcription or translation complexes or stability of tl~e transcript.
[0090] ~he present invention is further directed to a chimeric gene construct containing a DNA of interest operatively linked to,the regulatory element of the present invention. Any exogenous gene can be used and manipulated accdrding to th'e present invention to result in the expression of said exogenous gene. A DNA or coding region of interest may include, but is not limited to, a gene encoding a protein, , a DNA that is transcribed to produce antisense RNA, or a transcript product that functions in some manner that mediates the expression of other DNAs, for example that results in the co-suppression of other DNAs ,or the like. A coding region of interest may also include, but is not limited to, a gene that encodes a pharmaceutically active protein, for example growth factors, growth regulators, antibodies, antigens, their derivatives useful for immunization or vaccination and the like. Such proteins include, but are not limited to, interleukins, insulin, G-CSF, GM-CSF, hPG-CSF, M-CSF or combinations thereof, interferons, for example, interferon-a, interferon-l3, interferon-i, blood clotting factors, for example, Factor VIII, Factor IX, or tPA or combinations thereof. A coding region of interest may also encode an industrial enzyme, protein supplement, nutraceutical, or a value-added product for feed, food, or both feed and food use. Examples of such proteins include, but are not limited to proteases, oxidases, phytases, chitinases, invertases;,lipases, cellulases, xylanases, enzymes involved in oil biosynthesis etc.
[0091 ] The ~chimeric gene construct of the present invention can further comprise a 3' untranslated region. A 3' unfranslated region refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression.
The ,.
polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3' end of the mRNA'precursor. Polyadenylation . ' ' signals are commonly recognized by the presence of homology to the canonical form' .
5' AATAAA-3' although variations are not uncommon.
[0092] Exaanples of suitable 3' regions are the 3' transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as tr~e nopaline synthase (Nos gene) and plant genes such as the soybean y , , storage protein genes arid the small subunit of the ribulose-1, 5-bisphosphate carboxylase (ssRUBISCO) gene. The 3' untranslated region from the structural gene of the present construct can therefore be used to construct chimeric genes for ' expression in plants.
[0093] The chimeric gene construct of the present invention can also include further enhancers, either~translation or transcription enhancers, as may be required.
These enhancer regions are well known to persons skilled in the art, and can include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence to ensure translation of the entire sequence. The translation control signals and initiation codons can be from a variety of origins, both natural and synthetic. Translational initiation regions may be provided from the source of the transcriptional initiation region, or from the structural gene. The sequence can also be derived from the regulatory element selected to express the gene, and can be specifically modified so as to increase translation of the mRNA.

~, , , s [0094] To 'aid in identification of transformed plant cells, the constructs of this , invention may be further manipulated. to include plant selectable markers.
Useful .
selectable markers include enzymes which provide for resistance to an antibiotic such " , . , as gentamycin, hygromycin, kanamycin, and tlie, like. Similarly, enzymes providing ' for production of a compound identifiable.by colour c~iange such as GUS ~ 1 , . ' (13-glucuronidase), or luminescence, such as luciferase are useful.
' ' '' ~ ' .
[0095] Also considered part of this invention are'transgenic plants, trees, yeast, ~ ' ~:
bacteria, fungi, insect and animal cells. containing tl~t chim~ric gene construct comprising a regulatory element of the presyt invention. 'However, it is to be ' understoad that the regulatory elements of the present invention may also be combined with coding region of interest for expression within a rar_ge of host ' organisms that are amenable to transformation. Such,organisms include, but are not limited to: ' , ~ plants, both monocots and dicots, for example, corn, cereal plants, wheat, barley, oat, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabfdopsis;
~ trees, gymnosperms and angiosperms, including both hardwood and softwood trees, for example peach, plum, spruce;
~ yeast, fungi, insects, animal and bacteria cells.
[0096] Methods for the transformation and regeneration of these organisms are established in the art and known to one of skill in the art and the method of obtaining transformed and regenerated plants is not critical to this invention.
[0097] In general, transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for s regeneration of plants. The plants may then be used to establish repetitive generation, either from seeds or using vegetative propagation techniques.
[0098] The constructs of the present invention can be introduced into'plant~cells using Ti plasmids, Ri plasmids, plant virus,vectors, direct DNA transformation, micro=
injection, electroporation, etc. For reviews of such techniques see for example Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, , ~ ~; , ,, 2d Ed. (1988); and Miki and Iyer, Fundamentals of Qene Transfer in Plants. In Plant Metabolism, 2d Ed. DT. Dennis, DH Turpin,'DD Lefebrve; DB Layzell (eds), Addison Wesly, Langmans Ltd. London, pp. 561-579 (197). The present invention further includes'a suitable vector comprising t'he chimeric gene canstruct. ' [0099) When specific sequences are referred to in the present invention, it is understood that these sequences include within their scope sequences that are '°substantially homologous" to the specific sequences, or sequences or a compliment , of the sequences hybridise to one or more than one nucleotide sequence as 'defined ~ ' herein under stringent hybridisation conditions. Sequences are "substantially homologous" when at least about 70%, or more preferably 75% of the nucleotides match over a defined length of the nucleotide sequence providing that such homologous sequences exhibit one or more than one regulatory element activity as disclosed herein. For example which is not to be, considered limiting, the RENT
family of nucleotide sequences as defined herein exhibits greater than about 75%
sequence similarity with a fragment (nucleotides 1724 to 2224) of the nucleotide sequence of SEQ ID NO:1 or 22. Furthermore, members of the RENT family also hybridise with the nucleotide sequence defined by SEQ ID NO: l or 22 under stringent hybridisation conditions and exhibits one or more than one regulatory element activity.
[00100] Such a sequence similarity may be determined using a nucleotide sequence comparison program, such as that provided within DNASIS (using, for example but not limited to, the following parameters: GAP penalty 5, #of top diagonals 5, fixed GAP penalty 10, k-tuple 2, floating gap 10, and window size 5),.
However, Qther methods of alignment of sequences'for comparison are weld-known in ' the art for example the algorithms of Smith & Waterman (Adv. Appl. Math.
2:482, 1981), Needleman & Wunsch (J. Mol. Biol. 48:443, 1970), Pearspn & Lipman (Proc.
Nat'l. Acad. Sci. USA 85:2444, 1988), and by computerized implementations of these ' , algorithms (GAP, BESTFIT, FASTA; and BLAST, available through the NIH.), or by , , manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology, Ausubel et al., eds. 1995 supplement), or using Southern or Northern ,, ~y~r~d'zatio:~ uirder Strlngcnt C,onditlyrlj (see i~ianiatis ei ai., in i~oiecuiar Cloning (A ' ~. ".~
Laboratory Manual), Cold Spring Harbor Laboratory, 1982) to the nucleotide sequence of SEQ ID NO's:l, 5, 6, 7, 8, 9, 21 or 22 provided that the sequences maintain at least one regulatory property or regulatory element activity, as defined herein. Preferably, sequences that are substantially homologous exhibit at least about 80% and most preferably at least about 90% sequence similarity over a defined length of the molecule. , [001 O 1 ] The DNA sequences of the present invention thus include the DNA
sequences of SEQ ID NO's:l, 5, 6, 7, 8, 9 21 or 22, their regulatory regions and fragments thereof, as well as analogues of, or nucleic acid sequences comprising about 70% similarity with the nucleic acids, or fragments thereof, as defined in SEQ
ID NO:1, 5 to 9, 21 and 22. Sequences that are "substantially homologous"
include any substitution, deletion, or addition within the sequence.
[00102] An example of one such stringent hybridization conditions may be overnight (from about 16-20 hours) hybridization in 4 X SSC at 65°C, followed by washing in 0.1 X SSC at 65°C for an hour, or 2 washes in 0.1 X SSC at 65°C each for 20 or 30 minutes. Alternatively an exemplary stringent hybridization condition could be overnight (16-20 hours) in 50% formamide, 4 X SSC at 42°C, followed by washing in 0.1 X SSC at 65°C for an hour, or 2 washes in 0.1 X SSC at 65°C each for 20 or 30 minutes, or overnight (16-20 hours), or hybridization in Church aqueous phosphate buffer (7% SDS; O.SM NaP04 buffer pH 7.2; 10 mM EDTA) at 65°C, with 2 washes either at 50°C in 0.1 X SSC, 0.1% SDS for 20 or 30 minutes each, or 2 washes at 65°C in 2 X SSC, 0.1% SDS for 20 or 30 minutes each for unique seduence regions.
[00103] Analogues also include those DNA sequences which hybridize, to the sequence of SEQ ID NO:1, 5, 6, 7, 8, 9, 21 or 22 or a fragment thereof, under relaxed ~ , ' hybridization conditions, provided that said sequences maintain at least one regulatory property of the activity of the regulatory element. ' Examples of such relaxed ' ' ' , , hybridization conditions includes overnight (16-20 fours) hybridization in 4 X
SSC at . .
50°C, with 30-40% formamide at 42°C, or 65°C in 2 X SSC, 0.1% SDS for example for analysis of repetitive regions as described hererin [00104] The specific sequences, referred to in the present invention, also include sequences which are "functionally equivalent" to said specific sequences. ~ In the present invention functionally equivalent sequences refer to sequences which although not identical to the specific sequences provide the same or substantially the same function. DNA sequences that are functionally equivalent include ariy substitution, deletion or addition within the sequence. With reference to the present invention functionally equivalent sequences will preferably direct the expression of an exogenous gene constitutively.
[00105] The results presented in the examples indicate that the constitutive expression of GUS activity in the plant T1275 is regulated by a cryptic regulatory element. Similarly, other experiments indicate that homologs of the cryptic regulatory element (for example members of the RENT family) are also effective in obtaining constitutive expression of a coding region of interest under their control.
RNase protection assays performed on the region spanning the regulatory element and downstream region did not reveal a transcript for the sense strand (see Figure 8, Table 2). RNase protection assays were performed using RNA from organs of untransformed tobacco and probes that spanned the T1275 sequence from about -by to +1200 by relative to the transcriptional start site. In all tissues tested (leaf, stem, root, flower bud, petal, ovary and developing seed) protected fragments were not detected, in the sense orientation relative to the GUS coding region, ,with~all probe (Figure 8), and indicates that the site was the same in each organ.
Furthermore, GenBank searches revealed no significant sequence similarity with the T127S
sequence. An amino acid identity of about 66% with two open reading frames on the antisense strand of the genomic sequence of T127S (between about -1418 and -1308;
nucleotides 636-746 of SEQ ID N0:1; and between about -541 and -395;
nucleotides 1513-1659 of SEQ ID NO:1 relative to the transcriptional start) and an open reading frame of a partial Arabidopsis expressed sequence (GenBank Accession No.
W43439) ;~°as ldWtiiied. T he sequence which lies downstream of sequences at tile T-DNA ~ I
insertion point in untrar~sforined tobacco shows no significant similarity,in GenBank searches. These data suggest that this region is silent in untransformed plants and that the insertion of the T-DNA activated a cryptic regulatory element.
[00106] Similar RNase protection assays using probes from tCUP (T127,S) against members of the RENT family of sequences (SEQ ID NO's: S to ~9) indicates that thcsc SequenGe$ are dl5u SllCni lri untransIOrmeCl plants [00107] Southern analysis indicates that the 2.2 kb regulatory region of T1275 does not hybridize with DNA isolated from soybean, potato, sunflower;
Arabidopsis, B. napus, B. oleracea, corn, wheat or black spruce. However, transient assays indicate that this regulatory region can direct expression of the GUS coding region in all plant species tested including canola, tobacco, soybean, alfalfa, potato, Ginseng, peach, pea, Arabidopsis, B. napus, white spruce, corn, wheat, oat and barley (Table 3), indicating that this regulatory element is useful for directing gene expression in both dicot and monocot plants. A fragment of the T1275 (tCUP) regulatory region that exhibits substantial homology with a segment of the RENT family of repetitive elements, and the corresponding fragments from the RENT nucleotide sequences, for example, but not limited to SEQ ID NO's: S to 9, and 21 are also active in other species, for example but not limited to pea and Arabidopsis (see Figure 14).

[00108] The following fragments of the members of the RENT family (see SEQ
ID N0:21), and there corresponding fragments of SEQ ID NO:l, have been , characterized, and their utility demonstrated in thepresent ,invention. For example, the fragment comprising nucleotides from SEQ' ID NO:l or 22 of:
.
1724-2224 and nucleotide sequences that are characterized as having greater ~
~ .
than 75% sequence identify with nucleotides 1724-2224 of SEQ ID NO~1 or 22 (see ' '.
Figure 13C) exhibit regulatory element activity (e:g. Figure 14(A)); , ~ ' ';
, ,, 1875-2086 (DraI-NdeI fragment; core promoter element), see Figure 5C and . , Table 6 (-197-GUS-nosy;
1875-1992 (DraI -62 fragment) - this fragment enhances expression of the -46 minimal promoter of 355, and a fragment of T1275, as shown in Figures 5D (see, Dral-GUS; Dra2-GUS; Dral-355; Dra2-35S), and Figures 5E-G (Drat-355; Dra2-35S), and functions as a transcriptional enhancer;
2084-2224 (NdeI-SmaI fragment; or "N"; Tables 10-12, Figure 5R r+30_GTT~~
nosy, Figure 7 (T1275-GUS-nos; 35S-GUS-nosy, and Figure 11 (35S+N-GUS-nos) a translational enhancer; and 2091-2170 (~N) see Tables 10-12; a translational enhancer.
[00109] The transcriptional start site of T1'275 (tCUP) was delimited by RNase protection assay to a single position about 220 by upstream of the translational initiation codon of the GUS coding region in the T-DNA. The sequence around the transcriptional start site exhibits similarity with sequences favored at the transcriptional start site compiled from available dicot plant genes (T/A T/C
A+1 A
C/A C/A A/ClT A A A/T). Sequence similarity is not detected about 30 by upstream of the transcriptional start site with the TATA-box consensus compiled from available dicot plant genes (C T A T A A/T A T/A A).

[00110] ~ Deletions in the upstream region indicate that negative regulatory elements and enhancer sequences exist within the frill length regulatory region. FQr example deletion of the 5' region to BstYI (-394 relative to the transcriptional start site; position 1660 of SEQ ID NO:1 or 22) resulted in a 3 to 8 fold increase in expression of the gene associated therewith (see Table 6 in Examples, and Figure 5 (C)), indicating the occurrence of at least one negative regulatory element within the XbaI-BstYI portion of the full length regulatory element. Other negative regulatory elements also exist within the XbaI- BstYI fragment of T1275 as removal of an~XbaI-~Sii iagWV:ut aiw reSUitcd in iuCreascd actiYity (-i304-GUS-nos; Table 6, Examples, and Figure 5, comprising a deletion of nucleotides 1-1040 of SEQ ID NO:1 or 22).~ , [00111 ] An enhancer is also localized within the BstYI-DraI fragment of tCUP
as removal of this region results in a 4 fold loss in activity of the remaining regulatory region (-197-GUS-nos; Table 6, Examples, and Figure 5, comprising a deletion of nucleotides 1-1875 of SEQ ID NO:1 or 22). In addition to the -197 to -62 region , (corresponding to nucleotides 1875 to 1992 of SEQ ID NO:1 ) exhibiting enhancer-like properties, the region spanning -394 to -62 (corresponding to nucleotides 1660 to 1992 of SEQ ID NO:1) also exhibit similar prope ~ies. When the -19 7 to -62 (nucleotides 1875-1992 of SEQ ID NO:1 or 22) and -394 to -62 (nucleotides 1660-1992 of SEQ ID NO:1 or 22) fragments of T1275 canstruct are fused with the -46 minimal promoter of 35S, the promoter activities were enhanced to about 150 fold (Dral-355 Figure 5 (D)). Duplication of the -197 to -62 (Dra2-GUS; Figure 5 (D)), or the -394 to -197 (labelled as Bstl in Figure 5 (D)) fragments, or a combination of these two fragments, resulted increased regulatory element activity when placed in association with a regulatory element fragment, for example, T1275 (Bst2-GUS;
Figure 5 (D)) or 355 (Bst2-35S).
[00112] 5' deletions of the regulatory element (see Figures 5(A) and (B) and analysis by transient expression using biolistics showed that the regulatory element was active within a fragment 62 by from the transcriptional start site indicating that the core promoter has a basal level of expression (see Table 5, Examples; and Figures ' "
s (H) and (I)). Deletion of a fragment containing the transcriptional start site (see -, 62(-tsr)-GLJS-nos in Figures 5 (B), (H) and (I); Table 5, Examples) reduced , expression dramatically in transgenic tomato, however deletions to +30 did eliminate " , expression indicating that the region defined fr6m about -12 to about +30 by ' contained the core promoter. Deletion of sequences surrounding the trasncriptional , start site, reduced activity to about 2% of the activity associated with the -62-GUS ~ ' construct, indicating that the trasncriptional start site sequence is required for tCUP
,,.
regulatory element activity. DNA sequence searches did not reveal conventional core ' ~ '' . . ~ , , prp_rn__YtPr mntifc fpynd in plant ~r.ene5 ~u~h a~ i~~W T, ETA bur. ' , ~ , .
" , " ~ . .
[00113] Substitutian of nucleotides at'-30 to -24, of -62-GUS-nos, with the TATA-box sequence TATATAA (~igures 5 (D)~and (H),"increased care promoter acti wiry abo~zt 3 fold (r figure 5 (1). Addition of,a GCC-box sequence (Hart et ai.,1,993;
Ohme-Takagi and Shinshi, 1995) to -62-GUS-nos resulted in about a four fold increase in activity (see Figure 5 (I)). The results presented in Figures 5 (D) and (I) demonstrate that the regulatory elements of the present invention may be modulated ' through a variety of modifications including duplication of fragments that exhibit enhar~cer or silencer activity, or by substituting, inserting, or adding regulatory elements to enhance or silence tCUP regulatory element activity.
[00114] A number of the 5' regulatory element deletion clones (Figure 5 (C)) were transferred into tobacco by Agrobacterium-mediated transformation using the vector pRD400. Analysis of GUS specific activity in leaves of transgenic plants (see Table 6, Examples) confirmed the transient expression data down to the -197 fragment (nucleotides 1857-2224 of SEQ ID NO:1). Histochemical analysis of tobacco organs sampled from the transgenic plants indicated GUS expression in leaf, seeds and flowers. Histochemical analysis of Arabidopsis organs revealed GUS
activity in leaf, stem flowers and silques when the promoter was deleted to the -394 and -197 fragments (see Figures 5 (E) to (G)).

[0011 S] As indicated above, a fragment of the regulatory element tCUP
(T1275) exhibits substantial homology with a large family of repetitive elements , within N. ta.bacum. These homologous sequences (SEQ~ ID NO's: 5 to 9; RENT 1, 2, 3, 5 and 7) also exhibit regulatory activity as determined by an increase in the expression of GUS in pea protoplast assays (Figure ~14 (A)). This,region (-394 tCUP-GUS) was also found to drive the constitutive expression of a coding region of interest in transgenic Arabidopsis (Figure 14 (B)). Therefore, the present invention also describes the regulatory elements associated with members of the RENT family of repetitive elements including tCUP (T1275). The consensus sequence for _m__e_m__bP_rs ~f ,, ~P pFNT f~rrily i5 prOVlded in Fig'akes i3(C) aad i~3(D).
[00116] Expression of GUS, under the contral of T1275 or a fragment thereof, or the modulation of GUS expression arising from x'1275 or a fragment thereof, has been observed in a range of species including corn, wheat, barley, oat;
tobacco, , Brassica, soybean, alfalfa, pea, potato, Ginseng, Arabidopsis, peach, spruce, yeast, , fungi, insects and bacterial cells ('Table 3, Examples, and Figures 14 (A), and (~)).
Occurrence of a post-transcriptional regulatory element in the T1275 nucleotide sequence [00117] A comparison of GUS specific activities in the leaves ef transgenic tobacco SR1 transformed with the T1275-GUS-nos gene and the 35S-GUS-nos genes revealed a similar range of values (Figure. 6(A)). Furthermore, the GUS
protein levels detected by Western blotting were similar between plants transformed with either gene when the GUS specific activities were similar (Figure. 6(C)).
Analysis of GUS mRNA levels by RNase protection however revealed that the levels of mRNA
were about 60 fold (mean of 13 measurements) lower in plants transformed with the T1275-GUS-nos gene (Figure 6(B) suggesting the existence of a post-transcriptional regulatory element in the mRNA leader sequence.
[00118] Further analysis confirmed the presence of a regulatory sequence within the NdeI-SmaI fragment of the mRNA leader sequence that had a significant impact on the level of GUS specific activity expressed in all organs tested.
Deletion of the NdeI-SmaI fragment (nucleotides 2084-2224 bf SEQ ID N0:1 or 22) from t$e T1275-GUS-nos gene (Figure 7) resulted in about a'46-fold reduction in the amount of GUS specific activity that could be detected in leaves of transgenic tobacco cv Delgold (see Table 7). Similar~results were also observed in the t;ansgenic tobacco cultivar SRl and transgenic alfalfa (Table 7). Addition of the same fragment to a 35S-GUS-nos gene construct (Figure 7) increased the amount of GUS specific activity by, about 5-fold in transgenic tobacco and a higher amount in transgenic alfalfa '(see Table 7, ). TnCreage4l GTJC u~t, ~',ty' :'Jas vbSCr ved iil urgalis of tobaccU
dIld alIalIa plants tranformed with constructs containing NdeI-SmaI fragment (Table 8 and 9): This data is cuiisisterit wit'n the presence of a post-transcriptional regulatory element in this fragment.
[00119) A modulation of GUS activity was noted in a variety of species that were transformed with a regulatory element of the present invention. For example but not necessarily limited to; the NdeI-SmaI fragment of T1275 (also referred to a~ "N") and derivatives or analogues thereof, produced an increase in activity within a variety of organisms tested including a range of plants ( T ables 3 and 10, and Figure 11), white spruce (a conifer; Table 11 ) and yeast (Table 12).
[00120] A shortened fragment of the NdeI-SmaI fragment, (referred to as "0N", "dN", or "deltaN") was produced that lacks the out-of frame upstream ATG
at nucleotides 2087-2089 of SEQ ID NO:l (see Figure 10(A) and (B)). Constructs comprising T1275(~N)-GUS-nos yielded 5 fold greater levels of GUS activity in leaves of transgenic tobacco compared to plants expressing T1275-GUS-nos.
Furthermore, in corn callus and yeast, ON significantly increased GUS
expression driven by the 35 S promoter (Figure 119 and Table 10).
[00121 ] The Ndel Smal regulatory elements situated downstream of the transcriptional start site functions both at a transcriptional, and post-transcriptional level. The levels of mRNA examined from transgenic tobacco plants transformed with either T1275-GUS-nos, T1275-N-GUS-nos, 35S-GUS-nos, or 35S+N-GUS-nos, are higher in transgenic plants comprising the Ndel Smal fragment under the control of the T1275 regulatory element but lower in those under control of the 35S
promoter, than in plants comprising constructs that lack this region (Figures 9 (A) and (B)). ' This indicates that this region functions by ether modulating transcriptional rates, or the stability of the transcript, or both. , [00122] The Ndel Smal region also functions posh-transcriptionally. The ratio ~ ' ,, of GUS specific activity to relative RNA level,in indiwidual'transgenic tobacco plants that lack the Ndel Smal fragment is lower, arid when averaged indicates an eight fold .
reduction in GUS activity per RNA, Char. in plants comorisir_g this rPgion_ lFigurP ~?
(C)). Sirizilarly, an increase, by an average of six fold, in 'GUS specific activity is' observed when the Ndel Smal region is added within xhe 35S untranslated region, (Figure 9 (C)). The GUS specific activ'ity:relative RNA levels are similar in constructs 'containing the Ndel Smal fragment (tCUP-GUS-nos and 35S-~N-GT~TS-nos). These results indicate that the Ndel Smal fragment (nucleotides 2084-2224 of SEQ ID NO:I or 22) modulates gene expression post-transcriptionally. Further experiments suggest that this region is a novel translational enhancer.
Translation of transcripts in vitro demonstrate an increase in translational efficiency of RNA
containing the Ndel to Smal fragment (see Table 13). Furthermore, the levels of protein produced using mRNAs comprising the Ndel Smal fragment are greater than those produced using the known translational enhancer of Alfalfa Mosaic Virus RNA4. These results indicate that this region functions post-transcriptionally, as a translational enhancer.
(00123] One or more of the constitutive regulatory elements described herein may be used to drive the expression within all organs or tissues, or both of a plant of a coding region of interest, and such uses are well established in the literature. For example, fragments of specific elements within the 35S CaMV promoter have been duplicated or combined with other regulatory element fragments to produce chimeric regulatory elements with desired properties (e.g. U.S. 5,491,288; US
5,424.200; US

' 5,322,938; US 5,196,525; US 5,164,316). As indicated above; the constitutive ' regulatory element or a fragment thereof, as defined'herein, may also be used along with other regulatory element, enhancer elements, or fragments thereof, translational ' enhancer elements or fragments thereof in order to control gene expression.
Furthermore, oligonucleotides of 18 bps or longer are useful as prpbes, for example to identify other members of the RENT family of repetitive sequences, or as PCR ' ' , primers in identifying or amplifying related DNA or RNA sequences in other tissues , .
or prgamsms.
[00124] I Thus this invention is directed to a ccanstitutive regulatory e1_ement~ .
associated regulatory elements identified within the tCUP nucleotide sequence fSEO
ID NO:1 or 22), and combinations comprising one or more than one of these regulatory elements. further this invention is directed to such regulatory elements and combinations thereof, in a cloning vector, wherein the coding region of interest _is under the control of the regulatory element and is capable of being expressed its a , plant cell transformed with the vector. This invention further relates to transformed plant cells, transgenic plants regenerated from such plant cells, and seeds produced tom uiiese plarsts. The regulatory element, and regulatory element-gene combination of the present invention can be used to transform any plant cell for the production of , any transgenic plant. The present invention is not limited to any plant species.
[00125] Therefore, the regulatory elements of the present invention may be used to control the expression of a coding region of interest within desired host expression system, for example, but not limited to:
~ plants, both monocots and dicots, for example, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, wheat, oat, barley, Arabidopsis;
~ trees, for example peach, spruce;
~ yeast, fungi, insects, and bacteria.

.
,~ , , [00126] ~ Furthermore, the regulatory elements as described herein may be~
used .
in conjunction with other regulatory elements, such as 'tissue specific, inducible or .
constitutive promoters, enhancers, or fragments thereof, and the like. For example, ,~ , the regulatory region or a fragment thereof as defined herein maybe used to regulate ' gene expression of a coding region of interest spatially"and developmentally.within a , plant of interest or within a heterologous expression system, for example yeast, , insects, or fungi expression systems. Regulatory~regions or fragments thereof, ~,~ , including enhancer fragments of the present invention, may be operatively associated With a heterologous nucleotide s~~"pn~.e lrlr_'111d1~1g,hPternl~,g~u~
rvguiatvi~% ri,gi~i2S.iv i . ~ . , increase, decrease, or otherwise modulate, rite expression of a coding region of :ntarnet ~zrit~a:~ 1 f ;...,tr....:,...... ,7: ' t azmvav.m vtmzuz a iiVJl Vl~'GLL11J111. A l.Vlllng ieg1~11W1 Irl~l'.rest may include, but is not .
limited to, a gene that encodes a pharmaceutically active protein, for example growth factors, growth regulators, antibodies, antigens, their derivatives useful for immunization or vaccination and the like. Such proteins include, but are not limited to, interleukins, insulin, G-CSF, GM-C'SF, hPG-CSF, M-CSF Or ccim__hi_natinnc thereof, interferons, for example, interferon-a, interferon-13, interferon-T,, blood clotting factors, for example, Factor VIII, Factor IX, or tPA or combinations thereof.
A coding region of interest may also encode an industrial enzyme, protein supplement, , nutraceutical, or a value-added product for feed, food, or both feed and food use.
Examples of such proteins include, but are not limited to proteases, oxidases, phytases chitinases, invertases, lipases, cellulases, xylanases, enzymes involved in oil metabolic and biosynthetic pathways etc. A coding region of interest may also encode a protein imparting or enhancing herbicide resistance or insect resistance of a plant transformed with a construct comprising a constitutive regulatory element as described herein.
[00127] A list of the nucleotide sequences provided in the present invention is provided in Table lb.

Table lb: Nucleotide Sequence Summary .
, , . , , . , , SEQ ID NO: Name of sequence , , 1 T 1275 (tCUP) ' ' 2 Nde-Sma , 3 ON ' 4 f ~Nm ,. , , ~ ~ V T J

pr-1 S (primer) 11 pr-3A (primer) 12 pr-2S (primer) .

13 pr-4S (primer) 14 pr-5 A (primer) pr-6S (primer) 16 pr-7S (primer) 17 pr-8A (primer) ~8 . ~ , ~ ~ . c 18 GCC-62-GUS fragment , 19 HindIII primer ' . , 20 BglII primer ' ' ~ ' ~ ' ' ' , , ~~
21 ' RENT consensus sequence - ~ , ' ' , , ~~ , , 22 tCUP consensus sequence , ,, . ~ ,. , ~ . , ,~
, .. , , [00128] The present invention will be further illustrated in the following examples.
Examples ' , ' ' , Characterization of a Constitutive regulatory element - GUS Fusion [00129] Transfer of binary constructs to Agrobacterium and leaf disc v ~ .
transformation of N. tabacum SR1 were performed as described by Fobert et al.
(1991, Plant Mol. Biol. 17, 837-851). Plant tissue was maintained on 100 g.glml , kanamycin sulfate (Sigma) throughout in vitro culture.
[00130] From the transgenic plants produced, one of these, T1275, was chosen for detailed study because of its high level and constitutive expression of GUS.
[00131] Fluorogenic and histological GUS assays were performed according to Jefferson (Plant Mol. Biol. Rep., 1987, 5, 387-405), as modified by Fobert et al.
(Plant Mol. Biol., 1991, 17, 837-851). For initial screening, leaves were harvested from in vitro grown plantlets. Later nine different tissues: leaf (L), stem (S), root (R), anther (A), petal (P), ovary (O), sepal (Se), seeds 10 days post anthesis (S1) and seeds 20 days post-anthesis (S2), were collected from plants grown in the greenhouse and analyzed. For detailed, quantitative analysis of GUS activity, leaf, stem and root tissues were collected from kanamycin resistant F 1 progeny grown in vitro.
Floral v tissues were harvested at developmental stages 8-10 (Koltunow et al., 1990, Plant Cell 2, 120,1-1224) from the original transgenic plants: Flowers were also tagged and ' , ,~
developing seeds were collected from capsules at.10 and 20 dpa. In all cases, tissue a ~~ , . , was weighed, immediately frozen in liquid nitrogen, and stored' at -80°C. ' ~, , ~, [00132] ~ Tissues analyzed by histological assay were at the same developmental ~ ~ , ' stages as those listed above. Different hand-cut. sections were analyzed for each ' ', organ. For each plant,, histological assays, were performed on at least two different , ' ': , ,, occasions to ensure reproducibility. Except for florar organs, all tissues were assayed ' , , in phoslihate buffer according to Jefferson (1987, Plant ~Llol. Biol. Rep. 5, 387405), with 1 mM X-Gluc (Sigma) as substrate. Flowexs were assayed in the same buffer containipg 20% (v!v) methanol (Kosugi et al., 1990, Plarit Sci. 70, 133-140).
[00133], GUS activity in plant T1275 was found in all tissues. Figure 1 shbws , the constitutive expression of GUS by histochemical staining with X-Gluc of T1275, including leaf (a), stem (b), root (cl, flower (d). ovary (e); e_m_b_rync if a"rd g)9 and s~PP.d v (h). , [00134] Constitutive GL'S expression was confirmed with the more sensitive fluorogenic assay of plant tissue from transformed plant T1275. These results are shown in Figure 2. GUS expression was evident in all tissue types including leaf (L), stem (S), root (R), anther (A); pistil (P), ovary (O), sepal (Se), seeds at 10 dpa (S 1 ) and 20 dpa (S2). Furthermore, the level of GUS expression is comparable to the level of expression in transformed plants containing the constitutive promoter CaMV

in a GUS - nos fusion. As reported by Fobert et al. (1991; Plant Molecular Biology, 17: 837-851) GUS activity in transformed plants containing pBI121 (Clontech), which contains a CaMV 35S - GUS - nos chimeric gene, was as high as 18,770 ~ 2450 (pmole MU per minute per mg protein) Genetic Analysis of Transgenic Plant T1275 [00135) The T-DNA contains a kanamycin resistance gene. Seeds i'rom self pollinated transgenic plants were surface-sterilized in 70% ethanol for 1 min and in undiluted Javex bleach (6% sodium hypochloride) for 25 min. Seeds were then washed several times with sterile distilled water, dried under laminar flow, and placed in Petri dishes containing MSO medium supplemented with 100 ~g/ml kanamycin as described in Miki et al. (1993, Methods in Plant Molecular Biology and Biotechnology, Eds., B.R. Glick and J.E. Tompson,'CRC Press, Boca. Raton, 67-88).
At least 90 plantlets _were counted for each transformant. The number of green {kanamycin-resistant) and bleached (kanamycin-sensitive) plantiets were counted a-ft_er 4-6 weeks, and analyzed using the Chit test at a significance level of P<0.05.
[00136) The genetic analysis results are shown below in Table 1 c, which demonstrates that the T-DNA loci segregated as a single locus of insertion. ' TABLE le: Genetic Analysis of Transgenic Plant T1275 No. of I No. of Observed Expected Chi' I
~

Progeny Progeny Ratio Ratio ~r ~s 262 88 3:1 3:1 0 Consistent with a single dominant gene Southern Blot Analysis [00137] The T-DNA in the transgenic plant T1275 was analyzed using either a GUS gene coding region probe or a nptll gene coding region probe.
[00138) Genomic DNA was isolated from freeze-dried leaves using the protocol of Sanders et al. (1987, Nucleic Acid Res. 15, 1543-1558). Ten micrograms of T1275 DNA was digested for several hours with EcoRI using the appropriate CA 02507563 2005-05-13 ~ ~ , ' . ' ~ ~ ~ ~ , manufacturer-supplied buffer supplemented with 2.5 mM spermidine. After electrophoresis through a 0.8% TAE agarose gel, Southern blot analysis was ,, .
conducted using standard protocols. As the T-DNA from the construct containing the .; , constitutive regulatory element - GUS = nos construct contains only a single Eco RI
recognition site the hybridizing fragments are composed of both T-DNA and flanking , ~ ' .
tobacco DNA sequences. The length of the fragment will vary depending on the ~
' ~, location of the nearest Eco RI site. Using the GUS gene as a probe (Figure 3 -lane 1), the fragment to the nearest Eco RI site in the plant DNA will be detected.
With ~ ' ' T 127x, vnc sui:il iagiiient was iUCdieCi. Using ihe~nptli coding region as a probe, .: , . , . ., . , , (Figure 3 - lane 2), which hybridizes to~ sequences on the opposite side of the Ecb RI
site, again only one hybridization band, was evident. As'can also be seen in Figure 3, no major rearrangements occurred within the T-DNA.
Cloning and Analysis of the Constitutive Regulatory element - GUS Fusion rnni~m n_._____,_ raT~ ~ , ~ , -~V~fYJ7 j ~ct~tmtlm ijl~ti vVd~ I~Utai.ed IrOm leaves aCCOrdlng t0 Hattoy et a~. ' i (1987, Anal. Biochem. 165, 70-74). Ten ~,g of T1275 total DNA was digested with EcoRI and XbaI according to the manufacturer's instructions. The digested DNA
was size-fractionated on a 0.7% agarose gel. The DNA fragments of about 4 to 6 kb were isolated from the gel using the Elu-Quick kit (Schleicher and Schuell) and ligated to lambdaGEM-2 arms previously digested with EcoRI and XbaI and phosphatase-treated. About 40,000 plaques were transferred to a nylon membrane (Hybond, Amersham) and screened with the 32P-labelled 2kb GUS insert isolated form pBI121, essentially as described in Rutledge et al. (1991, Mol. Gen Genet. 229, ~ 1-40). The positive clones were isolated. The XbaI-EcoRI fragment (see restriction map Figure 4) was isolated from the lambda phage and cloned into pTZl9R previously digested with XbaI and EcoRI and treated with intestinal calf phosphatase.
[00140] The plant DNA sequence within the clone SEQID NO:1 has not been previously reported in sequence data bases. It is not observed among diverse species as Southern blots did not reveal bands hybridizing with the fragment in soybean, potato, sunflower, Arabidopsis, B. napus, B. oleracea, corn, wheat or black spruce (data not shown). In tobacco, Southern blots did not reveal evidence for gross , rearrangements at or upstream of the T-DNA insertion site (data not shown).
The T1275 Regulatory Element is Cryptic [00141 ] The 4.2kb fragment containing about 2.2kb of the T 1275 regulatory ' element fused to the GUS gene and the nos 3' was isolated by digesting.pTZ-T1275 , .
with HindIII.and EcoRI. The isolated fragment was ligated into the pRD400 vector ;(T~atla vt nl,~~ 1 992 Go;~o~ 211 :3f23=3Q4) pre'vi~rusiy uigeSted with Hindiii and GcoRi ,, and treated with calf intestinal phosphatase. Transfer of the binary vector to Agi~vvaCieriu~ri iuiiiejucien8 and leaf disc transformation of N: tabacum SR1 were performed as described above. GUS activity was examined in several organs of many independent transgenic lines. GUS mRNA was also examined in the same organ by RNase protection assay (Melton et al, 1984, Nucleic Acids Res. 121: 7035 -7056) .
using a probe that mapped the mRNA 5' en_c_1_,'_n tenth ,mtransfn~e.d ~r.~ tr~-.~~~-.:~
uaAU ~a CLilJ~4i11v tissues. RNA was isolated from frozen-ground tissues using the TRIZOL Reagent (Life Technologies) as described by the manufacturer. For each assay 10 - 30 ug of total RNA was hybridized to an antisense RNA probe as described in Figure 8 (A).
Assays were performed using the RPAII kit (Ambion CA) as described by the manufacturer. The protected fragments were separated on a 5% Long Ranger acrylamide (J.J. Baker, N.J.) denaturing gel which was dried and exposed to Kodak X-RP film.
[00142] RNase protection assays performed with RNA from leaves, stem, root, developing seeds and flowers of transgenic tobacco revealed a single protected fragment in all organs indicating a single transcription start site that was the same in each organ, whereas RNA from untransformed tobacco tissues did not reveal a protected fragment (Figure 8 (B)). The insertion site, including 1200 by downstream, was cloned from untransformed tobacco as a PCR fragment and sequenced. A
composite restriction map of the insertion site was assembled as shown in Figure 8 CA 02507563 2005-05-13 ~ ' , ,~ , ;
(A). RNA probes were prepared that spanned the entire region as shown in Figure 8 (A). RNase protection assays did not reveal transcripts from the sense strand as ~ ' summarized. in Table 2. These data suggest that the insertion site is transcriptionally ,a ~ ~ , silent in untransformed tobacco and is activated by T-DNA insertion. The ~egion ' upstream of the insertion site is therefore anpther exarraple of a plant cryptic regulatory , ' . ~ ' element. , ' ~, , Table 2. Summary of the RNase Protection Assays of the insertion site in ~ , ' 1; , ,, .
untransfot~med tobacco. See Figure 8'(A) for probe positions. ~ , , ., , Probe Rnase Protection Assay result ' ' Looicing,for "sense" RNAs (relative,.to the T1~75 regulatory element) C8-EcoRI many bands, all in tRNA (negative control) A10-HindIII no bands 1 ~ ~ , 2-21-HindIII no bands ' 1-4 ~m_~I manor hande alb i,~ tT?AT n ' ~ .
.:~ . tauvr i I ~.
7-EcoRI faint bands, all in ~tRNA , Constitutive Activity of the T1275 Regulatory Element [00143] For analysis of transient expression of GUS activity mediated by biolistics (Sandford et al, 1983, Methods Enzymol, 217: 483-509), the Xbal -EcoRl fragment was subcloned in pUC 19 and GUS activity was detected by staining with X-Gluc as described above. Leaf tissue of greenhouse-grown plants or cell suspension cultures were examined for the number of blue spots that stained. As shown in Table 3, the T1275 - GUS nos gene was active in each of the diverse species examined and can direct expression of a coding region of interest in all plant species tested. Leaf tissue of canola, tobacco, soybean, alfalfa, pea, Arabidopsis, potato, Ginseng, peach, and cell suspensions of oat, corn, wheat, barley and white spruce exhibited GUS-positive blue spots after transient bombardment-mediated assays and histochemical CA 02507563 2005-05-13 .
GUS activity staining. This suggests that the T1275~ regulatory element may be useful . for directing gene expression in both dicot and monbcot pants. , ~ , , TABLE 3: ~ Transient Expression of GUS Activity in Tissues of Diverse Plant Species , , Tissue Source Species . GUS Activity Leaf Soybean +++

. , Alfalfa ~ , ++
, , , Arabidopsis ~ , ~ . +

. ' I Potato ++
f Ginseng. ~ ~ ++
~

Peach ' + !

Leaf disc Tobacco , ++ ' B. napes +

Pea ~ ~ +

Cell Cultures Oat +

Corn +

W_h_Pat +

Barley , ++

White spruce ++

* Numbers of blue spots: 1 - 10 (+), 10 - 100 (++), 100 - 400 (+++) [00144] For analysis of GUS expression in different organs, lines derived from .
progeny ef tfe above lines were examined in detail. Table 4 shows the GUS
specific activities in one of these plants. It is expressed in leaf, stem, root, developing seeds and the floral organs, sepals, petals, anthers, pistils and ovaries at varying levels, confirming constitutive expression. Introduction of the same vector into B.
napes also revealed expression of GUS activity in these organs (data not shown) indicating that constitutive expression was not specific to tobacco. Examination of GUS mRNA
in the tobacco organs showed that the transcription start sites were similar (Figure 8 (B)), and the level of mRNA was similar except in flower buds where it was lower (Table 4).

~. , TABLE 4: GUS Specific Activity and Relative RNA Levels in the Organs of Progeny of Transgenic Line T64 ' , , ~ , , Organ Relative GUS GUS Specific RNA Activity Levels in T64 (picomollMU/min/mg protein) Progeny (grey ~ , scale ' units) .

TransformedUntransformed Tobacco Tobacco .

Leaf , 1774 988.32 ,, 3.02 , ' Steiu ' i82v 826.48 ~ 7.58 , , .. ~

Root 1636 ~ 4078.45 22.18 T ' 14 day post l 790 253.21 y 10.03 ' anthesis Seeds Flower - buds715 2.59 ~ ND*

Petals ND* 28.24 1.29 ~

n - 4 rti,nro TvTTI* ~ r n .
~.o~ i~.33 Pistils ND* 9.76 ' 1.72 Sepals ND* 110.02 I 2,48 Ovary ND* 4.42 2.71 * Not Done T1275 sequence comparison [00145] The present invention provides an isolated nucleotide sequence selected from the group consisting of SEQ ID NO: 1, and a nucleotide sequence that hybridizes to SEQ ID NO:l under a condition selected from the group consisting of:
- hybridizing overnight (16-20hrs) in a solution comprising 7% SDS, O.SM
NaP04 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 60°C
in a solution comprising 0.1 X SSC and 0.1% SDS;

~. ' , - hybridizing overnight (16-20hrs) in a solution comprising 7% SDS, 0.5M
NaP04 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 65°C ' , in a solution comprising 2 X SSC and 0.1% SDS; and"
., - hybridizing overnight (16-20hrs) in a solution comprising 4 X SSC at 65°C , and washing for one hour in 0.1 X SSC at 65°C;
~, ~ , . , wherein the nucleotide sequence confers constitutive expression of a coding region of ' interest linked in operative association therewith. , ' ' . . , , ,, , [OOi46~' The Tm of T1275 is compared to the clos2st homoi_og~ae idPr!tifPd In a ' sequence similarity search. an At-abid~nsi.c n_h_~~rn~helas_,'_,_.mthase be a (~=a~ha~W
i v aav r ~ , Acc~ssian No.AF085230) that exhibits 52% similarity with T1275. The following analysis indicates that the T 1275 sequence and' nucleic acid sequences that hybridize to T1275 under stringent conditions defined herein are unique.
[00147 T he T m°C, under the hybriaization conditions stated above ~for T1275 ;
and AF085230, are provided in table 4A below, where, - % similarity was calculated using NCBI Blast 2 program (available through , the NIH at: ncbi.nlm.nih.gov/cgi-bin/BLAST/; parameters for alignments were set at:
match 5; mismatch -4; gap open 5; gap extension 2; x dropoff 50; expect 10;
worksize 11 and filter ON).
- Conditions for A, B and C listed in Table 4A are:
A= 7% SDS, O.SM NaP04, lOmM EDTA, at 65°C (hybridization) B= 2xSSC, 0.1%SDS, at 65°C (washing) C= O.IxSSC, o.l%SDS, at 60° or 65°C (washing) CA 02507563 2005-05-13 , - Tm~(perfect match) is calculated using the formula described in Baldino et al (Baldino, Chesselet and Lewis 1989. High-resolution in situ hybridization.
histochemistry. Methods in Enzymology 168: 761-777) using the following~formula:
Tm = 81.5 + 16.6(log[Na+]) + 0.41(%G+C) - 675/(PL) - 0.65(%formamide).
-PL is the probe length in bases;
-Tin (heterologous match) was calculated by the method as described in Baldino et ~l (Baldino, Chesselet and Lewis 1989'. High-resolution imsitu ' , ' hybridization histochemistry. Methods in Enzyrnohg~ 16R: 761-777) and~Borner et al (Bonner, Brenner, Neufeld and Britten 1973. Reduction in the rate of DNA
reassociation by sequence divergence. J. Mol. Biol. 81: 123-13S), using the following formula:
Tm (heterologous match) = Tm(perfect match)-1.0(%mismatches, including gaps)., TabIQ 4A
nucleotide sequence of % similarity with Tm °C Tm °C
SEQ ID NO:1 AF085230 (perfect match) (heterologous match) A B C A B C
1-2224 52 79 73 53 31 . 25 5 [00148] These results of the above calculations show that there is about 1 degree C of decrease in Tm for each % mismatch between two DNA sequences.
Assuming a perfect match (100% similarity, which is not the case) between the sequence disclosed in AF085230 and that of SEQ ID NO:1, the results shown in Table 4A demonstrate that a Tm of less than 79°, 73°, and 53°C
is required to detect , hybridization between nucleotides 1-2224 of SEQ ID NO:1 and the sequence of AF085230 under the hybridization and washing conditions stated above.

CA 02507563 2005-05-13 ' ~ . ~. , s Furthermore, taking into account the % similarity between nucleotides 1-2224 of SEQ.
ID NO:1 and the sequence of AF085230, the results in Table 4A demonstrate that a.
hybridization temperature of greater than 31 °C,(Tm heterologous match) will not . , result in hybridization between nucleotides 1-2224 of SEQ ID NO:1 and AF085230. ' ' ' . , , ~, , .
~, ' , [00149] ~ As the temperatures stated for hybridization above are from 60° to ~ , ' ' ~ , 65°C, and are well above the calculated Tm's indicated in Table 4A, abbve,~the , ;
hybridization conditions stated for T1275 do not detect the nucleotide sequence ' , comprising AF085230. Therefore, the T1275 sequence and riucleiclacid,sequences ' .. .
that hybridize to T1275 under stringent conditions fdefin~d'herein are uni fue. ~ , ' ' I~lenti~catio'n of Regulatory Elements within the Full ~,ength T1Z75 Regulatory Element [00150] An array of deletions of the full length regulatory region of T1275 were ' prepared, as identified in Figures 5 (A) and (B), far further analysis of the cryptic .
regulatory element. ' ~ , , Plasmid Construction [00151 ] Deletion and replacement constructs were created in the vector pBI221 (Clontech), which contains the GUS (uidA) coding region driven by the CaMV 35S
promoter and the NOS terminator. Independent constructs representing 5' deletions of the tCUP were generated at convenient restriction sites within the tCUP
sequence.
The CaMV 35S promoter of pBI221 was replaced with the deletion fragments of tCUP to generate -1304-GUS, -684-GUS, -394-GUS, -197-GUS and -62-GUS. The numbers represent the nucleotide numbers relative to the transcription initiation site.
[00152] Fragments to test the enhancer elements between the fragments -394 to -62 (1660-1992 of SEQ ID N0:1 or 22) and -197 to -62 (1875-1992 of SEQ ID NO:l or 22) relative to the transcription start site of the tCUP were amplified by PCR with . Taq DNA polymerase. The fragment from -394 to -62 was amplified with pr-1 and pr- ' . 3 primers: ~ , , ~ , pr-1 S: TTGCCTGCAGGGGATCTTCTGCAAGCATC (SEQ ID NO:10); and ' . pr-31A: TCAAATGCATGGATCAAAAGGGGAAAC (SEQ ID NO:11 ), and the fragment from -197 to -62 was amplified with pr-2 . , , pr-2 S: GGAGCTGCAGGCTATTTAAATACTAGCC (SEQ ID N0:12) and ~~
Ipr-3 primers. All primers had additional nucleotides at the 5' ends to gi~,re ahe Pstl ' restriction sites for subcloning PCR products. The PAR products were ligated into the Pstl sites located upstream of the -394-GUS and -197-GUS to generate -394(2X)-GUS and -197(2X)-GUS constructs. ~ , [00153] A ~6 minimal 35S promoter (-46-35S) was generated by PCR using ' 1 the pr-4 and pr-5 primers: .
pr-4 S: CACTCTGCAGGCAAGACCCTTCCTCTATA (SEQ ID N0:13);
pr-5 A: ATATAAGCTTTGGGGTTTCTACAGGACG (SEQ ID N0:14)) and pBI221 DNA as a template. The PCR product was digested with Pstl and BamHI, and the resulting fragment was used to replace the PstlI and BamHI fragment in pBI221. The fragment from -197 to -62 of tCUP (nucleotides 1875-1992 of SEQ ID
NO:1 or 22) was subcloned into the the PstI sites located upstream of the -~6-GUS to generate -197-35S-GUS, -1978-35S-GUS ,and -197(2X)-35S-GUS
constructs.
?0 i, s [00154] ~ The -12-GUS construct was generated by PCR using the pr-6 and pr-5 .
primers: , ,~ , pr-5 A: ATATAAGCTTTGGGGTTTCTACAGGACG,(SEQ iDN0:14); , pr-6 S: GAGAAGATCTCCAAACACCCCT .AACTCTATC (SEQ ID'NO:15). , [00155] The PCR product was digested with XbaI and KpnI, and the resulting fragment was used to replace the XbaI.and KpnI fragment in tCUP-GUS. To generate , ' ' ;
the -62-tsr=GUS construct, the DNA sequence bet~~en~=62' and -12 of tCUP was amplified with the pr-7 and pr-8 primers: ~ ~ ~ ' ' ' , ' ~ , pr-7 S: TTGATCATT TTGATCAACGCCCAG (SEQ ID N0:16);
pr-8 A: AGGGGGTGCATATGAATTAAAAAAGGAAAAG (SEQ ID , N0:17). , [00156] The PCR product was digested with XbaI and NdeI, and the resulting fragment was used to replace the XbaI and IVdeT fi-a'gme_n_t in r_C'.LTp-Cv'TI
rS~, 'f he T A 3~_ ~
GUS construct was generated using pr-9 and pr-5 primers. To generate GCC-62-GUS
construct, a 51-by fragment: ' GCC-62-GUS fragment:
GCATAAGAGCCGCCACTAAAATAAGACCGATCAAATAAGAGCCGCCATG
CA (SEQ ID N0:18) containing two GCC boxes (GCCGCC; Ohme-Takagi and Shinshi, 1995, Ethylene-inducible DNA binding proteins that interact with an ethylene- responsive element.
Plant Cell 7: 173-182) was ligated into the PstI site located upstream of the -construct.

. i' , . , ~, , , s Plant Transformation and Selection [00157] ~ ' , Ardbidopsis thaliana (ecotype Columbia) was grown in a growth chamber (16 hr of light and 8 hr of darkness at ~23°C) after, a 2-4 day ~ernalization , period. For growth under sterile conditions,. seeds were ,surface 'sterilized (15 min', , ' ~~ ' incubation in 5% [v/v] sodium hypochlorite, and a three-time rinse in sterile distilled , ~ ' water) and sown on half strength Murashige and,Skoog salts (Sigma), supplemented with 1 % sucrose, pH 5.7, and 0:8% (w/v)' agar in Petri dishes. ~ ~ , ~ ~ ; , ,, . , [00158] All the consticuts and GUS fusion vi~ere subcloned into the pRD400 , , (Latla RS, Harnrneriindi 3K, Panchuk is, Pelcher LE, l~eller W: Modified binary plant transformaticn vectors with the wild-type gene encoding ~1PTII. Gene 211: 383-384, 1992) or pCANIBIA2300 (Cambia, Canberra, Australia) binary vectors for plant.
transformation. Plant transformation plasmids were electroporated into Agrobac~terium tumefaciens GV3101 (Van Lar~beke, N, Engler, G, Holsters, M, Van den Elscker, S, Zainen, I, Schilperoort, RA, and Schell, J:. Large plasmid in Agrobacterium tumefaciens essential for crown gall-inducing ability. Nature 252,169-170,' 1974) as'' described by Sha:v (Sha~t~ CH: Introductory of cloning plasmids into Agrobacterium tumefaciens. Meth Mol Biol 49, 33-37, 1995). The Agrobacterium-mediated , transformation of Arabidopsis thaliana was performed as described (Clough SJ, Bent AF: Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16: 735-743, 1998,), with the following modifications.
Plants with immature floral buds and few siliques were dipped into a solution containing Agrobacterium tumefaciens, 2.3 g/L MS salts (Sigma), 5% (wlv) sucrose and 0.03% Silwet L-77 (Lehle Seeds, Round Rock, TX) for 0.5 min. Tl seeds were collected, dried at 25°C, and sown on sterile media containing 40~gJmL
kanamycin to select the transformants. Surviving T1 plantlets were transferred to soil. 15 to 30 independent transgenic lines for each construct were selected and used for the analysis.
of GUS activity.

Re~ulatory element activity in tomato: protoplast isolation and electroporation [00159] Young and fully expanded leaves were excised from ,about 4 weeks old .
tomato plants and surface sterilized in 5% commercial bleach (Javex) (1%
NaOCI).
The abaxial surface of leaves were gently rubbed with earborandum powder and rinsed three times with sterile water. After removing midribs, the~remaining leaf blades were cut by sharp razor into small pieces and 'floated on enzyme mixture containing 0.3% Cellulase Onozuka R-10 (Yakult Honsha), 0.15% macerozyme R-10 (Yakult Horisha) and 0.4 M sucrose.
[00160] After overnight incubation in dark at 30°C, protoplasts were collected by filtration through a 100~m nylon mesh filter followed by centrifugation at 500 rpm for 5 min. The floated protoplasts were gently collected by a wide bore pipette and washed twice with electroporation buffer (150 mM ~KCI and 0.4 M mannitol) for min at 400 rpm and finally suspended at approximately 1x106Jm1 in O.S M
mannitol containing 150 ~M MgCl2.
[OU 161 ] 'fhe viability of protoplasts was confirmed by fluorescin diacetate and alanine blue staining and protoplasts were kept on ice for 30 minutes prior to electroporation. A 25-30 ~g plasmid DNA (see Figure 5 (H) for added constructs) was added to 5008.1 protoplast syspension, mixed gntly and electroporated at 100~.F
and 200 Volts using Gene Pulser II (BioRad). To normalize for transfection efficiency, the CaMV 35S promoter-luciferase plasmid was cotransfected in each experiment. The electroporated protoplasts were kept on ice for 15-30 min, centrifuged for 5 min at 500 rpm and mixed with 0.5 ml Murashige and Skoog medium (containing 3% sucrose, 9% mannitol, 0.1 mM MgS04, 2 mg/L
naphthylacetic acid and 0.5 mg.~I, benzyladenine). The cultures were kept in dark at 25°C for 24 hr, and cells were collected in microcentrifuge tubes. To each 500p.1 of protoplast suspension 200 ~1 of buffer solution (100 mM sodium phosphate, pH
7.8, 1 mM EDTA, 0.5% Triton X-100, 70 mM 2-mercaptoethanol and 10% glycerol) was added and protoplasts were lysed for lucerifase and GUS assay.

CA 02507563 2005-05-13 ' ,~ , Deletion analysis of tCUP , , [00162] ~ ' , In order to delineate functi~b~nal regions, of the tCUP' regulatory, a series of 5' deletion constructs were made (Figure's (J)), anc~~ activities were'examined in , ,:
leaves of transgenic Arabidopsis plants. As shown in Figure 5 (K) and ,Table 5 below, , ' ' . ~ ' , all sequences from about -2054 to ~ -684 (nucleotides about 290 to 1370 of SEQ
ID ~ , ' NO:1 or 22) relative to the transcription initiation site of the tCUP promoter could be ' ' .
deleted with no significant effect on promoter activity. Deletion of sequences to'-394 ~ ~;
. , and -197 (nucleotides 1660-1875 of SEQ ID NO:1 at 22) dbcreased expression about 40% and 60%, respectively. The -62 deletion construct reduced GUS~activity td a~ ~ .
, level slightly over background. These results indicated that the -62 fragment contained the minimal promoter and positive~cis'~regulatary elements were potentially located in the regions from:
-684 to -394 (nucleotides 1370-1660 of SEQ ID NO: l or 22);
-394 to -197 (nucleotides1660-1875 of SEQ ID NO:1 or 22); and ~ ;
-197 to -62 {nucleotides 1875-1992 of SEQ ID.NO: i or 22).
Identification of enhancer elements [00163] To locate enhancer activities within the fragments -394 to -62 (nucleotides 1660-1992 of SEQ ID NO:1 or 22),~and -197 to --62 (nucleotides 1992 of SEQ ID NO:1 or 22), these fragments were duplicated in the promoter constructs, -394(2X)-GUS and -197(2X)-GUS (Figure (J)), and GUS activity was analyzed in transgenic Arabidopsis plants. As shown in Figure S (K), insertion of two copies, of -197 to -62 and -394 to -62 fragments (nucleotides 1660-1992 and 1992, respectively, of SEQ ID NO:1 or 22) increased promoter activity about 1.5 to 2-fold compared with the constructs with only one copy of these fragments.
[00164] To evaluate whether the enhancers within fragment -197 to -62 (nucleotides 1875-1992 of SEQ ID NO: l or 22) could function with other core promoters, the fragment was also fused to the -46 minimal promoter of CaMV 35S
(Figure 5 (L)). As shown in Figure 5 (M), insertion of one copy the, fragment in bpth the forward. and reverse orientation increased GUSI activity by about 15-fold in leaves ' of transgenic Arabisopsis. Insertion of two copies further enhanced GUS
activity by .
40-fold. This suggests that the fragment -197 to -62 (nucleotides ~ 875-1992 of.SEQ
ID NO:1 or 22) may function as a transcriptional enhancer element.
Analysis of core promoter region [00165] ~ To analyze the tCUP core promoter, a series of deletions or ~r~odificatiorm surrounding tire transcriptionai start site were made (Figure 5 (H)). ' I
Promoter activities were examined using a transient assay in tomato protoplasts (Figure 5 (I)):
- deletion of the core promoter to -12 (position 2042 of SEQ IDNO:1 or 24) decreased GUS activity by 40%;
- deletion of the sequence surroundings the transcription start site reduced it tb 2°,% of the -62-GT~JS construct activity, suggesting that the transcription start site sequence was essential for tCUP promoter activity;
- substitution of the sequence -30 to -24 with a TATA-box (TATATAA) in the -62-GUS construct increased the promoter activity about 3-fold;
- addition of GCC-box sequences (Hart CM, Nagy F and Meins Jr F: A 61 by enhancer element of the tobacco beta-1,3-glucanase B gene interacts with one or more regulated nuclear proteins. Plant Mol Biol 21, 121=131,1993; Ohme-Takagi M, Shinshi H: Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7: 173-182,1995) further increased the core promoter activity to about 4-fold.
[00166] 5' deletions of the regulatory element (see Figures S(A) and (B) and analysis by transient expression using biolistics showed that the regulatory element 7~

was active within a fragment 62bp from the transcriptional start site (position 1992 of .
SEQ ID NO:1 or 22) indicating that the core promoter'has a basal level of expression ., , (see Table 5: Figures 5 (D) and (I)). ~ . " .
:~ , ', ~ ~ , Table 5: Transient GUS activity detected. in soybean, leaves by staining with X-, ."
gluc after particle bombardment. Vectors illustrated in Figures. 5 (A) and (B). , ~ , ' Genes (nucleotides) , ,GUS staining ' SEQ ID NO:1 or 22 ' ' 1. T1275-GUS-nos (1-2224). . ~ , ,~- ' . , 2. ' -1639-GUS-nos (705-2224) ~ , ~ + , , . , , , ' , .
3. -1304-GUS-nos (1040-222x) ' ~ + ' , ' ' ,.
4. -684-GUS-nos (1370-2224) ' , +
5,. -394-GUS=nos (1660-2224) ' ' + ~ , , 6. -197-GUS-nos (1875-2224) , +
7. -62-GUS-nos (1992-2224) ~ ~
8. -62(-tsr)-GUS-nos + ' ' 9. -12-GUS-nos (2042-2224) + , ' 10. +30-GUS-nos - ' -~~ , [00167] Deletion of a fragment containing the ~transcriptional start site (see -62(-tsr)/GUS/nos in Figure 6(B), Table 5) did not eliminate expression, however deletions to +30 (+30-GUS nos) reduced expression dramatically. Similar results were obsereved in transgenic tomato (see below; Figures 5 (H) and (I)) indicating that the region defined from about -12 to about +30 contained the core promoter.
DNA
sequence searches did not reveal conventional core promoter motifs within this region as are typically found in plant genes, such as the TATA box.
[00168] Deletion of a fragment containing the transcriptional start site (see -62(-tsr)-GUS-nos in Figures 5 (B), (H) and (I); Table 5, Examples) reduced expression dramatically in transgenic tomato, however deletions to +30 did eliminate expression indicating that the region defined from about -12 to about +30 by contained the core promoter. Deletion of sequences surrounding the trasncriptional start site, reduced activity to about 2% of the activity associated with the -' construct, indicating that the trasncriptional start site sequence' is required for tCUP ' ' regulatory element activity. ' , ~ , , [00169] ~ A number of the 5' regulatory element deletion clones (Figure 5(A)) were transferred into tobacco by Agrobacterium-mediated transformation using the ' vector pRD400. Analysis of GUS specific activity in leaves of transgenic plants (see Table ~6) confirmed the transient expression data dovim to the -19.7 fragment ' (nucleotide 1857 of SEQ ID NO:1). ' , Table 6: GUS specific activities in leaves of greenhouse-grown transgenic iuiOacCO, Sici, transformed with the T iz75-GUS-rios gene fusion ar_d 5' deletion clanes (see Figure 5 C). MeantSE(n) Genes nucleotides GUS specific activities SEQ ID NO:1 or 22 pmoles MU/min/mg protein 1.T1275-GUS-nos(1-2224) 283.1171 (27) 2.-1639-GUS-nos(705-2224) 587188 (26) , , 3.-1304-GUS-nos(1040-2224) 632217 (10) 4.-b84-GUS-nos (i3r0-2224) not determined S.-394-GUS-nos (1660-2224) 1627340 (13) 6.-197-GUS-nos (1875-2224) 47574 (27) [00170] Histochemical analysis of organs sampled from the transgenic plants indicated GUS expression in leaf, seeds and flowers. .
[00171 ] Deletions in the upstream region indicate that negative regulatory elements and enhancer sequences exist within the full length regulatory region.
Deletion of the 5' region to BstYI (-394 relative to the transcriptional start site) resulted in a 3 to 8 fold increase in expression of the gene associated therewith (Table 6), indicating the occurrence of at least one negative regulatory element within the XbaI-BstYI portion of the full length regulatory element. Other negative regulatory elements also exist within the XbaI- BstYI fragment as removal of an XbaI-PstI
fragment also resulted in increased activity (-1304-GUS-nos; Table 6).

[40172] ~ To determine if enhancer elements exist, fragments -394 to -62 (nucleotides 1660 to 1992 of SEQ ID NO:I) and -197~to -62 (nucleotides 1875 to , ,. ' 1992 of SEQ ID NO:1) were fused to the -46 35S core promoter. Both fragments ' ' ' raised the expression of the core promoter about 150 fold (Figure 5 (D), constructs DRAT-35S and BSTl-35S). Doubling of the -394 to -62 region (nucleotides 1660 to 1992 of SEQ ID NO:1 ) resulted in a 1.8 fold increase in GUS activity when fused to T1275 core promoter (BST1-GUS (-394-GUS) v. BST2-GUS; Figure 5~(D)), a similar , effect is observed when the -394 to -62~region is double and fused to the 35S
core ' ~ , promoter (BSTl-35S v. BST2-35S). Doubling of the -197 to -62 fragment (:~acleotides 1875 to i 992 of SEQ iD i3O: i ) aiso produced increased GUS
activity when fused to the T1275 core promoter (DRA2-GUS). , [00173] The -197 to -62 fragment (nucleotidcs 1875 to 1992 of SEQ ID NO:I; ' DRA1-35S), the -197 to -62 fragment in reverse orientation, o_r inverted (DRA

35S), and a repeat of the -197 to -62 fragment (DRA2-35S) were also fused with the .
35S minimal promoter (Figure 5 (E) and used to transform Arabidopsis:
[00174] A,°abidcpsis plants wi'~h immatwe floral buds and few silques were transformed with the above constructs by dipping the plant into a solution containing Agrobacterium tumefaciens, 2.3 g/L MS, 5% (w/v) sucrose and 0.03% Silwet L-77 (Lehle Seeds, Round Rock, TX) for 1-2 min, and allowing the plants to grow and set seed. Seeds from mature plants were collected, dried at 25°C, and sown on sterile media containing 40p,g/mL kanamycin to select transformants. Surviving plantlets were transferred to soil, grown and seed collected.
[00175] Constructs comprising the -197 to -62 fragment (nucleotides 1875 to 1992 of SEQ ID NO:1) in regular or inverted orientation exhibited increased transcriptional enhancer activity, over that of the minimal promoter (Figure ~
(F). A
further increase in activity was observed when plants were transformed with constructs comprising repeated regions of this regulatory element (Figure 5 (F).
Tissue staining of transformed plants expressing DRAT-35S indicated that this construct was expressed constitutively as it was detected in all tested organs, including . , flower, silque and seedling (Figure 5 (G)). ' RENT (Repetitive Element from N tabacum) family of repetitive'elements , [00176] An amplified N. tabacum line SRl custom library (Stratagene), which .
;
contained MboI partially digested genomic DNA in' the 8-DashII vector, was screened ' by hybridization with 32P-labelled probe fragin~nt S (probe 5 is a BstYI- SmaI
, ~ , ,, fragment of T1275, nucleotides 1660-2224 of SEQ Ip NO:,I, see frgure-5 (C)) at 65°C
~. , over ''night (16-20 hours in Churches buffer: 7% fDS; O.,SM NaP04; IOmM EDTA) , and washing at 50°C in 0.1 X SSC, O.j% SDS for 60 minutes, or two washes of 20-30 minutes.each. Approximately 70 clones were identified in this manner. The , restriction fragment of each 8 insert which hybridized with probe fragment 5 on a Southern blot, hybridized at 65°C (overnight; 16-20 hours) and washed at 60°C,10.1 X
SSC, 0.1% SDS (for 60 minutes, or two washes of 20-30 minutes each; stringent hybridization conditions), was gel purified with EluQuick (Schleicher and Schuell) , and subcloned _into pGEM4Z (Promegal. Rot_h_'strands of Pach s,~bclone ~=.~ere sequenced with universal or custom designed primers, as appropriate. From this screen, 5 clones were obtained for further analysis. Approximately 2 to 3 kb of each ' genomic clone was subcloned and overlapping sequences obtained. These clones are called RENT 1, 2, 3, 5 and 7.
[00177] Two primers, approximately 30 basepairs in length were synthesized (Synthaid Biotechnologies Inc.), one in the forward direction at position 1707 of the T1275 nucleotide sequence and the other in the reverse direction at position 2092.
Each incorporated a convenient restriction site, the first a HindIII site:
HindIII primer: TTA AGA TTT AAT Taa get tAT AAT TAC AAA (SEQ ID N0:19) and the second a BgIII site:
BgIII primer: ATT Cag atc tGG CGG TTGGTG AGA AA (SEQ ID N0:20).

' [00178] ~ The primers were then used for PCR~ amplification of each of the five RENT fragments with attached restriction sites using ~Taq, DNA polymerase (frorrx MBI Fermentas Inc). The protocol accompanying the modifying enzyme was ~ , ' ' ' followed, with a reduction to. 0.2u1 in the amount of Taq DNA polymerase used, in a , total reaction mix of 50w1. The fragment from the original T127~ sequence was also amplified.
[00179] All PCR products were,electrophoresed on a 1% TAE agaxose gel and visualized fy staining with ethidium bromide. The ;400 basepair band representing the PCR product was excised and purified. Each DNA,sample was then digested with ' Hind IIL~Bgl II and concentrated in an overnight precipitation with one half volume of 7.5M ammonium acetate and 2 volumes of 95% ethanol.
[00180] A plasmid containing the vector, pTZl9R, containing the tCUP delta ,, regulatory element, with a Kozak sequence was also digested with Hind III/Bgl II, ' electrophoresed on a 1 % agarose gel and gel purified. Briefly, tCUP delta (see below, description relating to Table 10 and Figure 10) was 'created by replacing the NdeI site (Figure 10(A)) within the leader sequence to a Bglii site thereby eliminating the upstream ATG at position 2087 of SEQ ID NO:1. A Kozak consensus sequence was also constructed at the initiator MET codon and a NcoI site was added to facilitate construction with other coding regions (see Figure 10 (B)). Nucleotides 1-86 of SEQ
ID N0:3 (i.e. tCUP delta with Kozack sequence) are derived from T1275 (nucleotides 2086-2170 of SEQ ID NO:1), and a Kozack sequence from nucleotides 87 to 97 of SEQ ID N0:3. Nucleotides 98 to 126 of SEQ ID N0:3 comprise the vector sequence between the enhancer fragment and the GUS ATG. The GUS ATG is located at nucleotides 127-129 of SEQ ID N0:3.
[00181] Each of the five RENT PCR fragments, as well as the T1275 control PCR fragment was ligated into the digested plasmid, in a 4 to 1, insert to vector ratio.
These were transformed into ToplO competent cells (Invitrogen Corp.) via electroporation using an Invitrogen electroporator and their supplied protocol. The CA 02507563 2005-05-13 ' w , i transformed cells were plated on ampicillin containing LB plates and allowedlto grow. ' overnight. The colonies were then grown overnight irr liquid LB plus ampicillin to be ' , used for plasmid isolation using the Wizard Plasmid Miniprep Kit,(Promega Corp.) or .
the Qiaprep Spin Miniprep Kit (Qiagen Inc.). Isolated plasmid5 were restricted with ' Hind III, Bgl II and Hind III/Xba I to verify restriction ,patterns. Once these were . . , ' ascertained to be correct, the insert containing plasrxiids were sequenced.
Therefore, the regulatory elements used fox the analysis in Figure 14 (A), including~tCUP-RENT, ~ ' ~~~ , ~ n _ consist of the amplified PCR fragment fused to tCUP delta comprising a, Kozak ~ '' '. ~ , sequence. The 35S-46 construct used for the analysis presented in Figure 14 (A) was prepared by generating a -46 minimal 3~SS proineter (-46-3JS) was g2rlGralGd by ~PCR
using the primer pair: ~ . ', 46-35S-1 primer: CACTCTGCAGGCAAGACCCTT~CTCTATA (SEQ ID N~:13), ' , and ' ATATAAGCTTTGGGGTTTCTt~CAGGACG (SEQ ID NO:14), and pRI221 (lv'1C itech) Dl'VA as a te~iyiate. T iie PCR product was digested with Pstl and BamHI, and the resulting fragment was used to replace the PstII and BamHI
fragment in pBI221.
[00182] Approximately 2 to 3 kb region of each genomic clone, which on Southern blots hybridized with probe 5 (a BstYI-~'maI fragment) was subcloned and overlapping sequence reads were obtained on both DNA strands of each subclone.
Sequence analysis indicated the presence of sequence similarity, but not identity, along the 3' ends of these subclones, with divergence at the 5' ends. The 5' ends of the clones all diverged at the same position. These data suggest that each independent clone represented a different member of the RENT repetitive element family interrupting different regions of the genome. Moreover, all five subclones studied were similar to the tCUP sequence in the region which delimits maximal regulatory element activity and is situated towards one end of RENT. The five subclones exhibited 77 to 92 % (Figures 13 (A) - (C)) with sequence similarity with the tCUP

sequence in the probe 5 region (1724-2224 of SEQ ID NO:1) which confers regulatory element activity. The repetitive elements also do nat appear to be pxesent in close, tandem locations as probe five hybridized only once v~itf~ each genomic close.
[00183] Therefore, t-CLJ~ is a member of a large family of repetitive elements in Nicotiana tabacum (RENT) in which the regions essential for regulatory element activity have been conserved. All RENT sequences,~including t~UP share a common ,.
sequence of ca. 525 by from transcriptional start site of t-CUP (1724-2224 of SEQ ID
' , NO:1). RENT sequences 1, 2, 3, 5 and 7 had high homology among themselves, 'outside ofthis 525 by region (Figures 13 (A) and (B)).. ~ . ' (00184] The following fragments of the members of the RENT family, including the SEQ ID NO:l, have been characterized, and their utility demonstrated herein. For example, the fragment comprising nucleotides: ' 1660-1992 (-394 to -62 fragment) enhances expression of the -46 minimal.
promoter of 355, and a fragment of T1275 (see Bstl-GUS; Bstl-355, Bst2-GUS, Bst2-3JS, of Ir'lgulG JD);
1660-1875 (BstYI-DraI fragment; see Figure SC; -394 GUS-nos; and Table 6) The data in Table 6 indicates that this fragment acts as an enhancer;
1660-2224 (BstYI-SmaI fragment; see Figure SC; -394-GUS-nos) The activity of this fragment is described in Tables 5 and 6;
1724-2224 (Figures 13C, and Figure 14A, tCUP RENT);
1875-2086 (DraI-NdeI fragment; core promoter element), see Figure SC
and Table 6 (-197-GUS-nosy;
1875-1992 (DraI -62 fragment) This fragment is shown to enhance expression of the -46 minimal promoter of 355, and a fragment of T1275, as shown in Figures 5D'(see Dral-GUS; Dra2-GUS; Dral.-355; Drat-35S), and Figures SE-.G
(Drat-355; Drat-35S), and functions as a transcriptioral enhancer; . ' , 2084-2224 (NdeI-SmaI fragment; or "N"; fiables 10-12, Figure S1B (+30-. ,, GUS-nosy, Figure 7 (T1275-GUS-nos; 355-GUS-nosy, and Figure 11 (3,55+N-GUS-.
nosy; ~ , ' ~ , , , ,, , 2091-2170 (L1N) see'Tables 10-12.' ~ , ~ ' ,.
'. ~ , ~' [00185] Based on sequence similarity using ~1CBI Blast 2 analysis (default ~ ' i ~. , .
parameters: blastn matrix, Lambda =1.37, Kf0.71 l, H=1.31), the fragmerits identified in above, exhibit from about 90~ to 98% identity to similar length fragments of the RENT sequences (SLQ ID ND's: 5-9)~~ ~ ' [00186] To verify the number of, repetitive elements in the region' giving rise to regulatory,element activity, more precise measurements were performed using slot blot hybridization. Slot blots were probed under conditions of high stringency level a,s used for the Southern blot (data not presented). 'These results indicate that'a range bf °
approximately 10 to 43 copies of similar repetitive elements were esti~~~ated per haploid genome of N. tabacum. When the same slot blots were washed at lower stringency, the same stringency as used during library screening, a range of approximately 62 to 199 copies of similar repetitive elements were estimated per haploid genome. .
[00187] RNase protection assays and probes spanning both strands of the combined tCUP and downstream sequence region, in the areas encompassing probes to 8 (probe 5 was a 578 by BstYI-SmaI fragment; probe 6 was a 574 by RsaI-RsaI
fragment; probe 7 was a 244 by RsaI-RsaI fragment; and probe 8 was a 321 by Rsal-XbaI fragment) did not result in any protection in the repetitive region.
RNase protection assays performed under these conditions has previously been shown to tolerate single mismatches by protection of non-identical sequences. This suggests that protected fragments may be detectable if members of the RENT family were , ~ . ~ ~ , r transcribef, at least for those elements that exhibit high sequence similarity.
Examples of those elements which may be~detectable xre those hybridizing at high ~ ' stringency on blots or those from which the downstream PCR clones originated.
A
~~ , lack of open reading frames was obseived within the RENT sequences. Together, this suggests a lack of coding capacity within the sequenced region.
[00188] Thus the tCUP cryptic, constitutive regulatory element is contained ' '.
within a moderately repeated repetitive element, which is the first known member of a ~ ~, , ,, new repetitive element family. ' ~ ' ~ ' , ,' , . , ,;.
Prntp~l~ct ieplatinnt elP~trppCrat~nn ar"1 C,ul~,u~e ~,. , [00189] ~ 1 Plasmids, prepared as described above were amplified and isoiateil to produce a sufficient amount of DNA necessary for transient expression ix~ pea protoplasts, using the Qiagen Plasmid ~VIidiKit (Qiagen Inc.). , [00190] Pea (Pisum sativum L. var. Laxton, Progress) seedlings were grown in, soil at 18°C (16 hr light, 8hr dark; 15-20 p.mol rh 2 s') provided by Philips~(USA) F2b ' T12'cool white' flourescent tubes and young (ally expanded leaves were harvested from 2-3 weeks old plants. Leaves surface sterilized 5 minutes in 5%
commercial bleach (Javex) (1% NaOCI). The abaxial surface of leaves were gently rubbed with carborundum powder, rinsed three times with sterile water, midribs removed and remaining leaf blade was cut by sharp razor into ~ca 1 cubic cni pieces and floated rubbed surface facing first enzyme solution containing 0.1 % (w/v) pectolyase (Seishin Pharmaceutical, Japan), 0.5% potassium dextran sulphate (Calbiochem, USA) and 0.5 M mannitol (pH 5.5) and vacuum infiltrated for 15 minutes. The leaf tissues were then incubated at 26 °C for another 15 minutes on a shaker at 60 excursions/min. The solution was then decanted by filtration through a 100 mesh nylon filter and the remaining tissue was incubated for 1-1.5 hr in a second enzyme solution containing 1.0% (w/v) Cellulase Onozuka R-10 (Yakult Honshu, Japan), Pectolyase Y-23 0.05% (w/v) (Seishin Pharmaceutical, Japan and 0.5 M mannitol, pH
6.0 at 26 C with 60 excursions/min.

[00191 ] The protoplasts were collected by filtration through a 100 ~.m nylon mesh filter followed by centrifugation at 500 rpm for 5 min. The protoplasts were, gently collected by a wide bore pippet and washed twice with WS
electroporation ' buffer ( 4.Sg NaCI, O.Sg glucose, 9.2g CaCl2 , 2.Og KC in 500 ml) for 5 min at 500 rpm and finally suspended at approximately 1x106/ml in 0.5 M m~nnitol containing 150 ~,M MgCl2.
[00192] The viability of protoplasts was confirmed by FDA (Fluorescein diactate) and alanine blue staining and protoplasts were kept on ice for 30 'minutes prior to electroporation. A 25-30 u.g luciferin and desired DNA was added to 500;!! ' protoplast suspension, mixed gently and elecr_roporated at 100 uF and 200 v Lsi_r._g Gene Pulser II (BioRad). The electroporated protoplasts were kept on ice for 1 s-30 min, centrifuged for 5 min at 500 rpm and mixed with 0.5 ml growth medium. The cultures were kept in dark at 25°C for 24 hr.
[uv i 93] Te each 500~i of protopiast suspension 200 ~.i of buffer solution containing 100 mM KP04, 1mM EDTA, 10% glycerol, 0.5% triton x-100, 7 mM [3-merceptoethanol was added and protoplasts were lysed and 1»ciferase and GT TS
activities were measured as described in Jefferson 1987 and Mathews et al., (Jefferson, R.A. 1987. Assaying chimeric genes in plants: the GUS fusion system.
Plant Mol. Biol. Reporter 5:387-405; Mathews, F.B., Saunders J.A., Gebhardt J.S., Lin J-J., and Koehler M. 1995. Reporter genes and transient assays for plants.
In "
Methods in Molecular Biology, Vol 55: Plant Cell Electroporation and Electrofusion Protocols" ed. J.A. Nickoloff Humana Press Inc., Totowa, N.J. pp.147-162). All GUS
activities were normalized with respect to luciferase activities to account for variation caused by electroporation.
[00194] When RENT sequences were cloned and tested for GUS transient gene expression, all RENT sequences demonstrated high regulatory element activity (Figure 14 (A)).
8~

CA 02507563 2005-05-13 ' .
s [00195] ~ Figure 14 (A) shows that each.of the~regulatory elements isolated from .

the 5 RENT sequences (RENT 1, 2, 3,.5, 7 'and tCUP-RENT) is capable of driving the expression of a coding region of interest (ix~ this case GUS) with which they are in ~ , i~ n , I ' ' 1 operative association. The RENT regulatory elements resulted in more GUS
activity' than that observed with .the 35S~minimal promoter-GUS construct (35S-46;
Figure 14 (A)). Furthermore, these results demonstrate that the RENT regulatory sequences are ~ ' active in a heterologous species (pea).
'~' ~. ~ . , , r Constitutive e~ ne expressibn by -394t-CUP seguenc~ in fraris~enic Arabidopsis 1 ,, thaliana L. , ~ , ' [vvi 9v] , ~iiu''uiu'tip~is i~iaiiana (e,cotype Co~iumbiaj was grown in a growth , chamber (16 hr of light and 8 hr of darkness at 23°C). Plants with immature floral buds and few siliques were dipped into, a solution containing Agrobacterium ~
~ , tumefaciens, 2.3 g/L MS salts (Sigma), 5% (w/v) sucrose and 0.03% Silwe~ L-77 (Lehle Seeds. Round Rock; TXl for 0-S _m__,'_n_ T1 CPPdc ~7VPrP rottPct~,d~
d,.ie~ zt 2c°C;
..
and sown on sterile media containing 40qg/mL kanamycin to select the trahsformants.
Surviving Tl plantlets were transferred to soil and used for the analysis of GUS
activity. For histochemical GUS assay, tissue was incubated in a 0.5 mg/ml solution , of 5-bromo-4-chloro-indolyl 13-D-glucuronide in 100 mM sodium phosphate buffer, pH 7.0, infiltrated in a vacuum for half a hour and incubated at 37° C
overnight.
Following the incubation, tissue was washed in 7.0% ethanol to clear off chlorophyll.
[00197] Arabidopsis plants were transformed with -394t-CUP-GUS fusion gene. This fragment of tCUP exhibits substantial homology with the other identified RENT sequences (Figure 13 (B). The result, presented in Figure 14 (B), demonstrates that the -394t-CUP sequence drive constitutively GUS reporter gene expression in all organs such as leaves, stem, roots, and floral organs in transgenic Arabidopsis. Since this region is common to the characterized RENT sequences these results indicate that all RENT sequences contain regulatory elements capable of regulating constitutive gene expression.

Activity of the T1275 Regulatory Element , [00198) Analysis of leaves of randomly-selected, greenhouse-grown plants ~ , regenerated~from culture revealed a wide range of GUS specific activities (Figure 6 ' (A); T plants). Plants transformed with pBI 121 (CLONETECH) which contains the 3~S-GUS-nos gene yielded comparable specific activity levels (Figure 6 (A); S
plants. Furthermore, the GUS protein levels detected by Western blotting were similar between plants transformed with either gene When the GUS specific activities . were similar~(Figure. 6 (C)).
,, ' [00199) Generally, the IGVeI Vf V~S mRi~A in the leaves as determined by ' R~Tase protection (Fig~,re 6 (B)) c";-,.~~~t~.a ...:,,-.~ r~.~~
v m.auwu w1 1 llle Vvu SpeCIIIC aCtiVlIleS, however, the level of GUS mR~~IA was about 60 fold (mean of 13 measurements) lower in plants transformed with the T1275-GUS-nos gene (figure 6(B)) when compared with plants transformed with 35S-GUS-nos.
[uU2ii0) Since the levels of protein and the activity of extractable protein were similar in plants transformed with T1275-GUS-nos or 35S-GUS-nos, yet the mRNA
levels were dramat,'_cal_ly different, these results suggested the existence of a regulatory element downstream of the transcriptional start site in the sequence of T1275-derived , transcript.
Post-Transcriptional Regulatory Elements within T1275 [00201 ) An experiment was performed to determine the presence of a post-transcriptional regulatory element within the T1275 leader sequence. A portion of the sequence downstream from the transcriptional initiation site was deleted in order to examine whether this region may have an effect on translational efficiency (determined by GUS extractable activity), mRNA stability or transcription.
[00202) Deletion of the Ndel-Smalfragment ("N"; SEQ ID N0:2) from the T1275-GUS-nos gene (Figure 15; T1275-N-GUS-nos; includes nucleotides 2084-2224 of SEQ ID NO:1) resulted in at least about 46-fold reduction in the amount of ~~ , i GUS specific activity that could be detected in leaves of transgenic tobacco ev , , Delgold (see Table 7). Similar results, of about at least a 40 fold reduction in GUS .
. ., , activity due to the deletion of the Ndel-Smal fragment, were observed in transgenic ~, , tobacco cv SRl and transgenic alfalfa (Table 7)'. , Addition of the same fragment (Ndel-Smal) to a 35S-GUS-nos gene (Figure 7; 35S+~I'-GUS-nos) construct increased , the amount of GUS specific activity by about 5-fold. in tobacco, and by a much higher ' amount in alfalfa (see Table 7). ~ ' ' ' Table 7: GUS specific activity in leaves of greenhouse=grown transgenic tobacco ' .
cv Delgold, SRl and transgenic alfalfa tra~isformed with vectors c~esigned~to~
assess the presence of cryptic regulatory sequQnces within the transcribed sequence derived from the T12'S~ G>.1S gene fusion (see Figure 7): MeantSE(n).

Construct , GUS specific activity ~ ~ , pmoles MU/min/mg protein ;

Delgold (1)'Delgold (2) ~ SR1 Alfalfa T i275-GUS-nos557ti83 (2i)493ti57 (25)~ 805+253 (22) 18~7t64 (24) T1275-N-GUS- 1213 (22) 1213 (27) ' , 612 (25) '40.5 (25) ~ ~

nos 35S-GUS-nos 1848=692 i347~ 41 S (26) 1383+263 (25) 1711 (15) (24) 35S+N-GUS- 69903148 6624.12791 (26) 619211923 1428601 (23) (24) nos (24) [00203] A similar effect was noted in organs tested from transformed tobacco (Table 8) and alfalfa plants (Table 9) CA 02507563 2005-05-13 ' Table 8: Expression of T1275-GUS-nos (+N) compared with T1275-(-N)-GUS-nos (-N) in organs of transgenic tobacco cv. Delgol~and SRl. Mean~SE(n=5)., Organ GUS specific Activity (pmol MU/min/mg/protein) Delgold ~ , SR1 +N -N +N -N
Leaf, '1513+222 35+4~ 904138 4~1 , Flower 360+47 38+8 ~ 175+44 28+3 ' Seed 402+65 697 ' 370+87~. 335 ' , , Table 9: Expression of T1275-GUS-nos, T1275-I-N)-GUS-nos; 35S-~I tS-n_r~z;
35S-GUS(+N)-GUS-nos in organs of transgenic alfalfa. Mean~SE(n=S).
Construct GUS Specific Activity (pmol Mu/min/mg protein) .
Leaf Petiole Stem Flower ~~.u- v.~ i.~;~~~.~.~ trL,tW-iG.l 1.J00./~GbU 4jb.1~16U.y T1275(-N)GUS 5.411.4 7.6+1.2 8.12.0 7.2511.7 35S-GUS 67.550.3 48.9+23.2 56.8128.7 23.217.3 35S(+N)GUS 5545+2015 107916194 9931+5496 1039+476.7 Control 3.7 13.2 11.8 18.7 [00204] In transient expression assays using particle bombardment of tobacco leaves, the Nde 1-Sma 1 fragment fused to the minimal -46 3 5 S promoter enhanced basal level of 35S promoter activity by about 80 fold (28.67 X2.91 v. 0.33 +0.33 relative units; No.blue units/leaf).
[00205] SEQ ID N0:2 comprises nucleotides 2084 to 2224 of SEQ ID NO:1.
Nucleotides 1-141 of SEQ ID N0:2 comprise nucleotides obtained from the plant portion of T1275 (nucleotides 2084 to 2224 of SEQ ID NO:l). Nucleotides 142-of SEQ ID N0:2 comprise vector sequence between the enhancer fragment and the GUS ATG. The GUS ATG is located at nucleotides 186-188 of SEQ ID N0:2.

[00206] ~ A shortened fragment of the Ndel-SrreaI fragment (see SEQ ID N0:3), referred to as "ON", "dN", "deltaN" or "tCUP delta" and lacking the out~of frame , ,, , upstream A'TG at nucleotide 2087-2089 of SEQ ID NO:l, was also constructed and tested in a variety of species. ON was~created by replacing the NdeI site (Figure 10(A)) , within the leader sequence to a BgllI site thereby eliminating the upstream ATG at position 2087 of SEQ ID NO:1. A Kozak consensus sequence was also constructed at the initiator MET codon and a NcoI site was added to facilitate construction with other , , coding regions (see Figure 10 (B)). Nucleotides 1-86 of SEQ ID N0:3 (i.e. ~N
with Ko'zack sequence) are derived from T1275 (nucle'otides 2086-2170 of SEQ ID
NO:1).
L1N also includes a Kozack sequence ,from nucl_eotid'es 87 to 97 of SEQ ID
?10:3, ar~d nucleotides 98 to 126 of SEQ _ID N0:3 comprise thewector Seq»e_n_ce her~.uee.n the enhancer fragment and the GUS ATG. The GUS ATG is located at nucleotides 127-129 of SEQ ID NO:3. ' ' [00207] Constructs comprising AN, for example T1275(~N)-GUS-nos, ,when , ii~urv~i.'W~eV iritV tVVClvIiV ylCldGd J foil greater ieveis of GUS activity in leaves of transgenic tobacco (5291986 pmolMU/minlmg protein; (n=29) compared to plants expressing T1275-GUS-nos (1115299 pmol MU/min/mg protein, n=291.
Activity of NdeI-Smal, N, and ON in other species ' [00208] In monocots, transient expression in corn callus indicated that the NdeI-SmaI fragment (SEQ ID N0:2), or a shortened NdeI-SmaI fragment, ON (SEQ
ID N0:3), significantly increases GUS expression driven by the 35 S promoter, but not to the higher level of expression generated in the presence of the ADH1 intron ("i"; Figure 11 and Table 10).

Table 10: Transient expression analysis of GUS activity in bombarded corn calli. Luciferase activity was used to normalize the'data. Mean tse (n=5).
Construct Ratio GUS:Luciferase activity ~ , 35S GUS-nos 7.4+4 , 35S(+N)-GUS-nos 19+5 ~ , ' 35S(ON)-GUS-nos 18+10 ~ ~ , ~ ' '.

35S-i-GUS-nos 66+27 ,, .. , , [00209] The ~nctionality of the t1%dei-SmaI fragment (SEQ ID N0:2) was also deteriiiiiivu iii nvir-piallt JpV.V.iGJ. 111 l.Vill Grs, for~exdrrrpie white spruce, transient . ~. ~ , bombardment of cell culture exhibited an increase in expression (Table 11).
Table 11: Expression of T1275-GUS'-nos, T1275(-N)-GUS-nos, 35S-GUS-nos, 35S (+N)-GUS-nos in white spruce embryonal masses following bombardment (n'3). , . ~ .
Construct Average GUS expression per leaf (Number of blue s ots) T1275-GUS-nos 72.6719.33 T1275(-N)-GUS-nos 21.33+4.49 35S-GUS-nos 113.67+17.32 35S(+N)-GUS-nos 126.33+19.41 * average spot much greater in size and strength.
[00210] In yeast, the presence of the NdeI-SmaI fragment (SEQ ID N0:2) or ~N (SEQ DI N0:3) exhibited strong increase in expression of the marker gene. A
series of constructs comprising a galactose inducible promoter Pg~~, various forms of the Ndel-Smal fragment, and GUS (UidA) were made within the yeast plasmid pYES2. A full length Ndel-Smal fragment N (pYENGUS), dN (containing a Kozak consensus sequence; pYEdNGUS), and ~N without a Kozak consensus sequence (pYEdNMGUS; or ONM) were prepared (see Figure 12, and SEQ ID N0:4).

CA 02507563 2005-05-13 .
[00211] ~ Nucleotides 1-86 of SEQ ID N0:4 (~NM ) comprise a portion of the enhancer regulatory region obtained from T1275 (n~icleotide 2086 -2170'of SEQ
ID
,, NO:1 ), while nucleotides 87-116 comprise a vector sequence between the enhancer ' ' ' fragment and the GUS ATG which is.located at nucleotides 117-119 of SEQ
ID N0:4. , ~
,, ~ ' ~ [00212] These constructs were tested in yeast.strain INVSCI using known transformation protocols (Agatep R. et al. 1998; bioriiednet.com/db/tto): The yeast were grown in non-inducible medium comprising raffinose as a carbon source for 48hr at 30°C' and then transferred onto inducible medium (galactose as a carbon , source). Yeast cells were harvested after 4 hr post induction and GUS activity determined quantitatively. Up to about a 12 fold inc~'ease in activity was observed with constructs comprising ON. Constructs comprising ONM exhibited even higher levels of reporter activity. The results indicate that the Ndel-Smal fragment (SEQ 11'7 ' N0:.2), ON (SEQ ID N0:3) and ONM (SEQ ID N0:4) are functional in yeast (Table ~
12). ~ , , Table 12: Expression of pYEGUS, pYENGUS, pYEdNGUS, and pYEdNMGUS
(0N, without a Kozak consensus sequence) in transformed yeast (n=5).
Construct Expt. 1 Expt. 2 , Activity Activity pYES-GUS-nos 9315 407+8 pYES(+N)-GUS-nos 753186 1771191 pYES(ON)-GUS-nos 1119+85 2129+166 pYES(ONM)-GUS-nos 173145 6897536 [00213] Constructs containing ONM (i.e. ON lacking the Kozack sequence; SEQ
ID N0:4) were also tested in insect cells. These constructs comprised the insect virus promoter ie2 (Theilmann D.A and Stewart S., 1992, Virology 187: pp. 84-96) in the present or absence of ONM and CAT (chloramphenicol acetyl-transferase) as the reporter gene. The insect line, Ld652Y, derived from gypsy moth (Lymantria dispar) CA 02507563 2005-05-13 ' ,~ , , ;
was transiently transformed with the above' constructs using liPosomes (Campbell M.J. 1995,.Biotechniques 18: pp. 1027-1032; Forsythe LJ. et al 1998, Virology 252:
. , , pp. 65-81 ). .Cells were harvested 48 hours after transformation and CAT
activity ,a quanitatively measured using tritiated acetyl-CoA (Leaky P. et al: 1995 Biotechnique~
19: pp. 894-898). The presence of the transl,ational enlz'ancer was found to ~
~ I~ ~ , ' significantly modulate the activity of the insect promoter-reporter gene construct in ' . , , , insect cells. ~ ' ~ ' ' ~ I
y [00214] ' Bacteria we're transformed with either'pBI22'1, comprising 35S , promoter and GUS, or 35S-N-GUS , comprising the full~length Ndel-Smal fragment (SEQ ID N0:3). Since uidA (GUS) is native to ~.coli, two uidA mutants, uidAl and , , ' uidA?, that do not express uidA, w~re'used for these experiments (mutants obtained from E.coli Genetic Center 335 Osborn Memorial Laboratories, Department of Biology, Box 208104, Yale University; New Haven CT 06520-8104). These bacteria ' , were transformed using standard protocols, and' tr~nsformants were assessed by assaying GUS activity from a 50 ~.l aliquot of an overnight culture. The "N"
fragment ,~ .
(35s-N-GUS) was observed to modulate the activity of the reporter gene in bacterial cells.
[00215] These data are consistent with the presence of a post-transcriptional regulatory sequence in the NdeI-SmaI fragment.
The Ndel Smal fragment functions as a transcriptional enhancer or mRNA
stability determinant [00216] The levels of mRNA were determined in leaves obtained from plants transformed with either T1275-GUS-nos, T1275-N-GUS-nos, 35S-GUS-nos, or 35S+N-GUS-nos (Figure 9 (A)). Relative RNA levels were determined by ribonuclease protection assay (Ambion RPAII Kit) in the presence of a-32P-CTP
labeled in vitro transcribed probe and autoradiographic quantification using Kodak Digital Science 1D Image Analysis Software. Hybridization conditions used during RNase protection assay were overnight at 42-45 degrees in 80% formamide, 100 mM
sodium citrate pH 6.4, 300 mM sodium acetate pH 8.~, 1 mM EDTQ. ~ , , ,, X00217] The levels of mRNA examined frorr~ transgenic tobacco plants ' transformed. with either T127~-GUS-nos, T1275-N-GUS-nos, 35S-GUS-nos, or 35S+N-GUS-nos, were higher in transgenic plants comprising the~Ndel Smal fragmgnt under the control of the T1275 regulatory element but lpwer in those under the control of the 35S promoter, than in plants comprising constructs that lack this region (Figure 7 (A)). This indicates that this region functions by either modulating 'transcriptionai rates, or the stability of the transcripts, or both. ~ , ' ~~le ~~lQ~ .~'mnT ~ra~_m__oj,t fn~n~f« ~ 2;; a ti au~i~a~~Tiai cyiiai3C~r' [00218] Analysis were perforrzed in order to determine whether the Ndel Smal ' region functions post-transcriptionally. The GUS specific activity:relative RNA level was determined from the GUS specific activity measurements, and relative RNA .
ieveis in greenhouse grown transgenic plants (figure 9 (B)). The ratio of GUS
specific activity to relative RNA level in individual transgenic tobacco plants comprising the Ndel-Smal fragment is higher than in plants that do not comprise this region (Figure 9 (B)). Similar results are obtained when the data are averaged, indicating an eight fold reduction in GUS activity per RNA. Similarly, an increase, by an average of six fold, in GUS specific activity is observed when the Ndel Smal region is added within the 35S untranslated region (Figure 9 (B)). The GUS specific activity:relative RNA
levels are similar in constructs containing the Ndel Smal fragment (T1275-GUS-nos and 35S+N-GUS-nosy. These results indicate that the Ndel-Smal fragment (SEQ ID
N0:2) modulates gene expression post-transcriptionally.
[00219] Further experiments, involving in vitro translation, suggest that this region is a novel translational enhancer. For these experiments, fragments, from approximately 3' of the transcriptional start site to the end of the terminator, were excised from the constructs depicted in Figure 7 using appropriate restriction endonucleases and ligated to pGEM4Z at an approximately similar distance from the I
' ~~ ' , ' transcriptional start site used by the prokaryotic T7 RNA polymerase. Another ' I
construct containing the AMV enhancer in the 5' UTR' of a GUS-nos fusion was , similarly prepared. This AMV-GUS-nos construct was created by restriction , endonuclease digestion of an AMV-GUS-nos fusion, with Bglll and EcoRl, from ' pBI525 (Dada et al., 1993, Plant Science 94; 139-149)~~and ligation with pGEM4Z , ' (Promega) digested with BamHl and EcoRl. Transcripts were prepared in vitro in the ~ ' resence of m~G 5' S' G Ca Analo Ambion . Transcri is were translated in P ( )PPP( ) P g ( , , ~ p ' vitro in Wheat Germ Extract (Promega) in the presence,of 35S-Mexhion~ne and fold ~ ~ '~
I ~ , enharace_m__ent calcol_atPd from TC_'_A_~prPE,i_Yi_tahl'P rp~n~c , , [00220] Translation of transcripts in vitro, demanstrate an increase in transiational efficiency of RhlA containing the Ndel to Srizal fragment (see Table'13).
Table 13: In vitro translation of mRNA obtained from transgenic tobacco plants , transformed with vectors with or without a Ndel-Smal fragment obtained from the T127S f 1TC gPnP fn_cinn (CPP FigyrP 7), ycins ;xy~~t grr ~.. ~..~.-/] ~
1t 1111 ~\.H I
.
' I iI
in vitro translation in vitro transcriptfold Qnhuncement T1275-GUS-nos 3.7 TI275-N GUS-nos1 AMV GUS-nos 1.9 [00221 ] The levels of protein produced using mRNAs comprising the NdeI-SmaI fragment are also greater than those produced using the known translational enhancer of Alfalfa Mosaic Virus RNA4 (Jobling S.A. and Gehrke L. 1987, Nature, vol 325 pp. 622-625; Datla R.S.S. et al 1993 Plant Sci. vol 94, pp. 139-149).
These results indicate that this region functions post-transcriptionally, as a translational enhancer.

, , [00222] All citations are hereby incorporated by reference. The nucleic acid , , sequences fisted in the Sequence Listing filed herewith are incorporated by reference into this application in their entireties. ~ ~ , , ,, , , ,, [00223] The present invention has been described with regard to ,one or mole.
~~
embodiments.. However, it will be apparent to persons skilled in the art that a number , of variations and modifications can be made without departing from ~he~ scope of the ' ', invention as defined in the claims.
I ,, , , , WH_A_T TC f_'T,_A_T__.M_F.TI TC~ ~ ' - ~ , , , , ,

Claims (35)

1. An isolated nucleotide sequence comprising the nucleic acid sequence defined by SEQ ID NO:22, a nucleotide sequence that hybridizes to the nucleic acid sequence of SEQ ID NO:22, or a nucleotide sequence that hybridizes to a compliment of the nucleotide sequence of SEQ ID NO:22, wherein hybridization condition is selected from the group consisting of hybridizing overnight in a solution comprising 7% SDS, 0.5M NaPO4 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 60°C in a solution comprising 0.1 × SSC and 0.1% SDS;

hybridizing overnight in a solution comprising 7% SDS, 0.5M NaPO4 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 65°C in a solution comprising 2 × SSC and 0.1% SDS; and hybridizing overnight in a solution comprising 4 × SSC at 65°C
and washing one hour in 0.1 × SSC at 65°C, and wherein the nucleotide sequence exhibits regulatory element activity.

2. The isolated nucleotide sequence of claim 1, wherein the nucleotide sequence is defined by SEQ ID NO:1, a nucleic acid sequence that hybridizes to the nucleotide sequence of SEQ ID NO:1, or a nucleic acid sequence that hybridizes to a compliment of the nucleotide sequence of SEQ ID NO:1.

3. The isolated nucleotide sequence of claim 1, wherein the nucleotide sequence is defined by SEQ ID NO:21, a nucleic acid sequence that hybridizes to the nucleotide sequence of SEQ ID NO:21, or a nucleic acid sequence that hybridizes to a compliment of the nucleotide sequence of SEQ ID NO:21.

4. The isolated nucleotide sequence of claim 1, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:5, SEQ ID
NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:21.

5. An isolated nucleotide sequence comprising the nucleic acid sequence defined by nucleotides 1660-1875 of SEQ ID NO:1, a nucleotide sequence that hybridizes to nucleotides 1660-1875 of SEQ ID NO:1, or a nucleotide sequence that hybridizes to a compliment of nucleotides 1660-1875 of SEQ ID NO:1, wherein hybridization condition is 65°C over night in 7% SDS; 0.5,M NaPO4; 10mM EDTA, followed by two washes at 50°C in 0.1 × SSC, 0.1% SDS for 30 minutes each, wherein the nucleotide sequence exhibits regulatory element activity.

6. The isolated nucleotide sequence of claim 5, wherein the nucleotide sequence is defined by nucleotides 1660-1992 of SEQ, ID NO:1.

7. An isolated nucleotide sequence comprising the nucleic acid sequence defined by nucleotides 2091-2170 of SEQ ID NO: 1, a nucleotide sequence that hybridizes to nucleotides 2091-2170 of SEQ ID NO:1, or a nucleotide sequence that hybridizes to a compliment of nucleotides 2091-2170 of SEQ ID NO:1, wherein hybridization condition is 65°C over night in 7% SDS; 0.5M NaPO4; 10mM EDTA, followed by two washes at 50°C in 0.1 X SSC, 0.1% SDS for 30 minutes each, wherein the nucleotide sequence exhibits regulatory element activity.

8. The isolated nucleotide sequence of claim 7, wherein the nucleotide sequence is defined by nucleotides 1660-2224 of SEQ ID NO:1.

9. The isolated nucleotide sequence of claim 7, wherein the nucleotide sequence is defined by nucleotides 1723-2224 of SEQ ID NO:1.

10. The isolated nucleotide sequence of claim 7, wherein the nucleotide sequence is defined by nucleotides 415-2224 of SEQ ID NO:1.

11. The isolated nucleotide sequence of claim 7, wherein the nucleotide sequence is defined by nucleotides 1040-2224 of SEQ ID NO:1.

12. The isolated nucleotide sequence of claim 7, wherein the nucleotide sequence is defined by nucleotides 1370-2224 of SEQ ID NO:1.

13. The isolated nucleotide sequence of claim 7, wherein the nucleotide sequence is defined by nucleotides 2084-2224 of SEQ ID NO 1.

14. The isolated nucleotide sequence of claim 7, wherein the nucleotide sequence is defined by nucleotides 2042-2224 of SEQ ID NO:1.

15. An isolated nucleotide sequence comprising the nucleic acid sequence defined by nucleotides 1875-1992 of SEQ ID NO:1, a nucleotide sequence that hybridizes to compliment of nucleotides 1875-1992 of SEQ ID NO: 1, wherein hybridization nucleotides 1875-1992 of SEQ ID NO:1, or a nucleotide sequence that hybridizes to a compliment of nucleotides 1875-1992 of SEQ ID NO:1, wherein hybridization condition is 65°C over night in 7% SDS; 0.5M NaPO4; 10mM EDTA, followed by two washes at 50°C in 0.1 × SSC, 0.1% SDS for 30 minutes each.
wherein the nucleotide sequence exhibits regulatory element activity.

16. The isolated nucleotide sequence of claim 15, wherein the nucleotide sequence is defined by nucleotides 1875-2084 of SEQ ID NO:1.

17. The isolated nucleotide sequence of claim 15, wherein the nucleotide sequence is present in tandem.

18. An isolated nucleotide sequence comprising the nucleic acid sequence defined by nucleotides 1-1660 of SEQ ID NO:1, a nucleotide sequence that hybridizes to nucleotides 1875-1660 of SEQ ID NO:1, or a nucleotide sequence that hybridizes to a compliment of nucleotides 1-1660 of SEQ ID NO:1, wherein hybridization condition is 65°C over night in 7% SDS; 0.5M NaPO4; 10mM EDTA, followed by two washes at 50°C in 0.1 × SSC, 0.1% SDS for 30 minutes each, wherein the nucleotide sequence is exhibits regulatory element activity.

19. A chimeric construct comprising the isolated nucleotide sequence of claim operatively, linked with a coding region of interest.

20. A method of expressing a coding region of interest within a plant comprising introducing the chimeric construct of claim 19 into a plant and expressing the coding region of interest.

21. A plant comprising the chimeric construct of claim 19.

22. A seed comprising the chimeric construct of claim 19.

23. A plant cell comprising the chimeric construct of claim 19.

24. The plant of claim 21, wherein the plant is selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.

25. The seed of claim 22, wherein the plant is selected from the group consisting of: a monocot giant, a dicot plant; a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.

26. The plant cell of claim 23, wherein the plant is selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.

27. An isolated nucleotide sequence comprising the following nucleic acid sequence TTATAATTAC AAAATTGATT MTAGTWYYTT TAATTTAATR YTTWTACATT
ATTAATTAAY TTAGHWSTTT YAATTYDTTT TCARAAAYYA TTTTACTATK
KTT(T/-)RT AAAAWMAAAR GGRRAAARTG GYTATTTAAA TACYAAC(M/-) CTATTTYATT TCAATTWTAR,CCTAAAATCA R(M/-)CCC(C/-) ARTTARCCCC
(W/-) (A/-) (T/-) (T/-) (Y/-) (C/-) (A/-) (A/-) (A/-) (T/-) (T/-)(C/-) AAAYGGBMYA KCCCARTTCC TAAA(A/-)Y RACYCDCYCC
TAAGCC (K/-) (C/-) (T/-) (T/-) (W/-) (T/-) (C/-) (C/-) (A/-) (A/-)(C/-) (C/-)(C/-) RCCCKRTTYC CYCTTTTGAT CCAGGYYGTT
GATCATTTTG ATCAACGVCC ARAATTTCCC CYTTYC(Y/-) (K/-)TTTT
TMATTCCCAA ACACC(S/-) CCYAAMYYTA TCCCRTTTCT CACCAACCGC
CAGATMT(R/-)(W/-)(A/-)(T/-)CCTCT TATCTCTCAA ACTCTCTCGA
ACCTTCCCCT AACCCTAGCA GCCTCTCATC ATCCTCACCT CAAAACCCAC
CGGMMWMCAT GGCYTCTMRA G(S/-)(M/-)(K/-)(Y/-) (G/-)(R/-) (W/-) (M/-) (M/-) (C/-) (C/-) (K/-) (K/-) (R/-) (T/-) (R/-) (S/-)(T/-) (C/-)(A/-)( S/-)(Y/-) YCCYYD(T/-)(G/-)(Y/-) (N/-) (M/-) (T/-) (T/-) (A/-), a nucleotide sequence that hybridizes to the nucleic acid sequence, or a nucleotide sequence that hybridizes to a compliment of the nucleotide sequence, where R
is G or A; Y is T or C; M is A or C; K is G or T; S is G or C ;W is A or T; B is G or C or T;

D is A or G or T; H is A or C or T; and N is A or C or T or G, and wherein hybridization is selected from the group consisting of:

hybridizing overnight in a solution comprising 7% SDS, 0.5M NaPO4 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one hour at 60°C in a solution comprising 0.1 × SSC and 0.1% SDS;

hybridizing overnight in a solution comprising 7% SD,S, 0.5M NaPO4 buffer at pH 7.2, and 10 mM EDTA at 65°C and washing for one, hour at 65°C in,a solution comprising 2 × SSC and 0.1% SDS; and hybridizing overnight in a solution comprising 4 × SSC at 65°C
and washing one hour in 0.1 × SSC at 65°C, and wherein the nucleotide sequence exhibits regulatory element activity.

28. A chimeric construct comprising the isolated nucleotide sequence of claim operatively linked with a coding region of interest.

29. A method of expressing a coding region of interest within a plant comprising introducing the chimeric construct of claim 28 into a plant and expressing the coding region of interest.

30. A plant comprising the chimeric construct of claim 28.

31. A seed comprising the chimeric construct of claim 28.

32. A plant cell comprising the chimeric construct of claim 28.

33. The plant of claim 30, wherein the plant is selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.

34. The seed of claim 31, wherein the plant is selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant, wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.

35. The plant cell of claim 32, wherein the plant is selected from the group consisting of: a monocot plant, a dicot plant, a gymnosperm, an angiosperm, a hardwood tree, a softwood tree, a cereal plant; wheat, barley, oat, corn, tobacco, Brassica, soybean, pea, alfalfa, potato, ginseng, Arabidopsis, a peach, a plum and a spruce.