CA2506686A1 - Cct6s as modifiers of the rb pathway and methods of use - Google Patents

Abstract

Human CCT6 genes are identified as modulators of the RB pathway, and thus are therapeutic targets for disorders associated with defective RB function.
Methods for identifying modulators of RB, comprising screening for agents that modulate the activity of CCT6 are provided.

Description

CCT6s AS MODIFIERS OF THE RB PATHWAY AND METHODS OF USE
REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. provisional patent application 60/428,872 filed 11/25/2002. The contents of the prior application are hereby incorporated in their entirety.
BACKGROUND OF THE INVENTION
Retinoblastoma, a pediatric eye tumor, has served as an important model for the heritable predisposition to cancer. The primary mechanism in the development of retinoblastoma is loss or inactivation of both alleles of this gene (Murphree, A. L. and Benedict, W. F. (1984) Science 223: 1028-1033). The high incidence of second primary tumors among patients who inherit one retinoblastoma gene suggests that this cancer gene plays a key role in the etiology of several other primary malignancies.
The retinoblastoma protein, RB, functions as a tumor suppressor by controlling progression through the cell cycle which is achieved by sequestering a variety of nuclear proteins involved in cellular growth. Thus, it acts as a signal transducer connecting the cell cycle clock with the transcriptional machinery (Weinberg, R. A. (1995) Cell 81: 323-330). RB regulates cell proliferation by restricting cell cycle progression at a specific point in G1, by interaction with the E2F family of transcription factors to arrest cells in G1 (Goodrich, D. W. et al. (1991) Cell 67: 293-302; Zhang, H. S. et al. (1999) Cell 97: 53-61).
RB function is regulated primarily by its phoaphorylatiori state, which is determined by the complex interaction of multiple kinases and their inhibitors that together form the'Rb pathway' (DeCaprio, J. A. et aI (1989) Cell 58: 1085-1095;
Buchkovich, K. et al (1989) Cell 58: 1097-1105; Chen, P.-L. et al. (1989) Cell 58: 1193-1198). This pathway has been found to be functionally inactivated in almost all types of cancer.
RB sequence is conserved in evolution, and exists in mouse (Bernards R et al (1989) Proc. Natl. Acad. Sci. U.S.A. 86:6474-6478), rat (Roy NK et al. (1993) Nucleic Acids Res. 21:170-170), Drosophila (Du W et aI (1996) Genes Dev 10:1206-18), and C.
elegarzs (The C. elegans Sequencing Consortium (1998) Science 282:2012-2018).
CCT6A (Chaperonin containing T-complex 1 subunit 6A (zeta)) is a subunit of the TCP1 cytosolic hexadecamer structure involved in ATP-dependent folding of actin, tubulin and other proteins (Li WZ et al (1994) J Biol Chem 269:18616-22). CCT
plays important roles in the recovery of cells from protein damage by assisting in the folding of proteins that are actively synthesized and/or renatured during this period (Yokota SI et al (2000) Eur J Biochem 267:1658-64). Decreased activity of CCT6A may result in misfolded tubulin aggregates in Alzheimers disease (Schuller E et al (2001) Life Sci 69:263-70). CCT6B is a testis-specific subunit of TCP1 and may function in the folding of testiscular proteins (Ozaki K et al (1996) Genomics 36:316-319).
The ability to manipulate the genomes of model organisms such as Drosophila provides a powerful means to analyze biochemical processes that, due to significant evolutionary conservation, have direct relevance to more complex vertebrate organisms.
Due to a high level of gene and pathway conservation, the strong similarity of cellular processes, and the functional conservation of genes between these model organisms and mammals, identification of the involvement of novel genes in particular pathways and their functions in such model organisms can directly contribute to the understanding of the correlative pathways and methods of modulating them in mammals (see, for example, Mechler BM et al., 1985 EMBO J 4:1551-1557; Gateff E. 1982 Adv. Cancer Res.
37: 33-74; Watson KL., et al., 1994 J Cell Sci. 18: 19-33; Miklos GL, and Rubin GM.
1996 Cell 86:521-529; Wassarman DA, et al., 1995 Curr Opin Gen Dev 5: 44-50; and Booth DR.
1999 Cancer Metastasis Rev. 18: 261-284). For example, a genetic screen can be carried out in an invertebrate model organism or cell having underexpression (e.g.
knockout) or overexpression of a gene (referred to as a "genetic entry point") that yields a visible phenotype, such as altered cell growth. Additional genes are mutated in a random or targeted manner. When a gene mutation changes the original phenotype caused-by the mutation in the genetic entry point, the gene is identified as a "modifier"
involved in the same or overlapping pathway as the genetic entry point. When inactivation of either gene is not lethal, but inactivation of both genes results in reduced viability or death of the cell, tissue, or organism, the interaction is defined as "synthetic lethal" (Bender, A and Pringle J, (1991) Mol Cell Biol, 11:1295-1305; Hartman J et al, (2001) Science 291:1001-1004;
US PAT No:6,489,127). In a synthetic lethal interaction, the modifier may also be identified as an "interactor". When the genetic entry point is an ortholog of a human gene implicated in a disease pathway, such as RB, modifier genes can be identified that may be attractive candidate targets for novel therapeutics.

All references cited herein, including patents, patent applications, publications, and sequence information in referenced Genbanlc identifier numbers, are incorporated herein in their entireties.
SUMMARY OF THE INVENTION
We have discovered genes that modify the RB pathway in Drosophila cells, and identified their human orthologs, hereinafter referred to as Chaperonin containing T-complex 1 subunit 6 (CCT6). The invention provides methods for utilizing these RB
modifier genes and polypeptides to identify CCT6-modulating agents that are candidate therapeutic agents that can be used in the treatment of disorders associated with defective or impaired RB function and/or CCT6 function. Preferred CCT6-modulating agents specifically bind to CCT6 polypeptides and restore RB function. Other preferred CCT6-modulating agents are nucleic acid modulators such as antisense oligomers and RNAi that repress CCT6 gene expression or product activity by, for example, binding to and inhibiting the respective nucleic acid (i.e. DNA or mRNA).
CCT6 modulating agents may be evaluated by any convenient in vitro or in vivo assay for molecular interaction with a CCT6 polypeptide or nucleic acid. In one embodiment, candidate CCT6 modulating agents are tested with an assay system comprising a CCT6 polypeptide or nucleic acid. Agents that produce a change in the activity of the assay system relative to controls are identified as candidate RB modulating agents. The assay system may be cell-based or cell-free. CCT6-modulating agents include CCT6 related proteins (e.g. dominant negative mutants, and biotherapeutics);
CCT6 -specific antibodies; CCT6 -specific antiserise oligoiners and other nucleic acid modulators; and chemical agents that specifically bind to or interact with CCT6 or compete with CCT6 binding partner (e.g. by binding to a CCT6 binding partner).
In one specific embodiment, a small molecule modulator is identified using a binding assay. In specific embodiments, the screening assay system is selected from an apoptosis assay, a cell proliferation assay, an angiogenesis assay, and a hypoxic induction assay.
In another embodiment, candidate RB pathway modulating agents are further tested using a second assay system that detects changes in the RB pathway, such as angiogenic, apoptotic, or cell proliferation changes produced by the originally identified candidate agent or an agent derived from the original agent. The second assay system may use cultured cells or non-human animals. In specific embodiments, the secondary assay system uses non-human animals, including animals predetermined to have a disease or disorder implicating the RB pathway, such as an angiogenic, apoptotic, or cell proliferation disorder (e.g. cancer).
The invention further provides methods for modulating the CCT6 function and/or the RB pathway in a mammalian cell by contacting the mammalian cell with an agent that specifically binds a CCT6 polypeptide or nucleic acid. The agent may be a small molecule modulator, a nucleic acid modulator, or an antibody and may be administered to a mammalian animal predetermined to have a pathology associated the RB
pathway.
DETAILED DESCRIPTION OF THE INVENTION
The Rb co-RNAi synthetic lethal screen was designed to identify modifier genes that are synthetic lethal with the Drosophila Rbf gene (Du W et al (1996) supra), a Drosophila homolog of the human retinoblastoma (RB) gene. In addition to identifying modifier genes with synthetic lethal interactions with Rbf, this screen identified modifier genes that, when inactivated, preferentially reduced the viability of Rbf-deficient cells relative to normal cells. The CG8231 gene was identified as a modifier of the Rbf pathway. Accordingly, vertebrate orthologs of these modifiers, and preferably the human orthologs, CCT6 genes (i.e., nucleic acids and polypeptides) are attractive drug targets for the treatment of pathologies associated with a defective RB signaling pathway, such as cancer.
In vitro and in vivo methods of assessing CCT6 function are provided herein.
Modulation of the CCT6 or their respective binding partners is useful for understanding the association of the RB pathway and its members in normal and disease conditions and for developing diagnostics and therapeutic modalities for RB related-pathologies. CCT6-modulating agents that act by inhibiting or enhancing CCT6 expression, directly or indirectly, for example, by affecting a CCT6 function such as binding activity, can be identified using methods provided herein. CCT6 modulating agents are useful in diagnosis, therapy and pharmaceutical development.
Nucleic acids and polvneptides of the invention Sequences related to CCT6 nucleic acids and polypeptides that can be used in the invention are disclosed in Genbank (referenced by Genbank identifier (GI) number) as GI#s 22095341 (SEQ ID NO:1), 14348899 (SEQ m N0:2), 14517631 (SEQ ll~ N0:3), 5729760 (SEQ ID N0:4), 14771917 (SEQ ll~ N0:5), 1655415 (SEQ ID N0:6), and 34783247 (SEQ ID N0:7) for nucleic acid, and GI#s 4502643 (SEQ ID N0:8) and 5729761 (SEQ ID N0:9) for polypeptides.
The term "CCT6 polypeptide" refers to a full-length CCT6 protein or a functionally active fragment or derivative thereof. A "functionally active"
CCT6 fragment or derivative exhibits one or more functional activities associated with a full-length, wild-type CCT6 protein, such as antigenic or immunogenic activity, ability to bind natural cellular substrates, etc. The functional activity of CCT6 proteins, derivatives and fragments can be assayed by various methods known to one skilled in the art (Current Protocols in Protein Science (1998) Coligan et al., eds., John Wiley & Sons, Inc., Somerset, New Jersey) and as further discussed below. In one embodiment, a functionally active CCT6 polypeptide is a CCT6 derivative capable of rescuing defective endogenous CCT6 activity, such as in cell based or animal assays; the rescuing derivative may be from the same or a different species. For purposes herein, functionally active fragments also include those fragments that comprise one or more structural domains of a CCT6, such as a binding domain. Protein domains can be identified using the PFAM program (Bateman A., et al., Nucleic Acids Res, 1999, 27:260-2). For example, the TCP-1/cpn60 chaperonin family domain (PFAM 00118) of CCT6 from GI#s 4502643 and 5729761 (SEQ ID NOs:8 and 9, respectively) are located at approximately amino acid residues 30 to 526 and 29-525, respectively. Methods for obtaining CCT6 polypeptides are also further described below. In some embodiments, preferred fragments are functionally active, domain-containing fragments comprising at least 25 contiguous amino acids, preferably at least 50, more preferably 75, and most preferably at least 100 contiguous amino acids of a CCT6.
In further preferred embodiments, the fragment comprises the entire functionally active domain.
The term "CCT6 nucleic acid" refers to a DNA or RNA molecule that encodes a CCT6 polypeptide. Preferably, the CCT6 polypeptide or nucleic acid or fragment thereof is from a human, but can also be an ortholog, or derivative thereof with at least 70%
sequence identity, preferably at least 80%, more preferably 85%, still more preferably 90%, and most preferably at least 95% sequence identity with human CCT6.
Methods of identifying orthlogs are known in the art. Normally, orthologs in different species retain the same function, due to presence of one or more protein motifs and/or 3-dimensional structures. Orthologs are generally identified by sequence homology analysis, such as BLAST analysis, usually using protein bait sequences. Sequences are assigned as a potential ortholog if the best hit sequence from the forward BLAST result retrieves the original query sequence in the reverse BLAST (Huynen MA and Bork P, Proc Natl Acad Sci (1990 95:549-556; Huynen MA et al., Genome Research (2000) 10:1204-1210).
Programs for multiple sequence alignment, such as CLUSTAL (Thompson JD et al, 1994, Nucleic Acids Res 22:4673-460) may be used to highlight conserved regions and/or residues of orthologous proteins and to generate phylogenetic trees. In a phylogenetic tree representing multiple homologous sequences from diverse species (e.g., retrieved through BLAST analysis), orthologous sequences from two species generally appear closest on the tree with respect to all other sequences from these two species. Structural threading or other analysis of protein folding (e.g., using software by ProCeryon, Biosciences, Salzburg, Austria) may also identify potential orthologs. In evolution, when a gene duplication event follows speciation, a single gene in one species, such as I~rosophila, may correspond to multiple genes (paralogs) in another, such as human. As used herein, the term "orthologs" encompasses paralogs. As used herein, "percent (%) sequence identity" with respect to a subject sequence, or a specified portion of a subject sequence, is defined as the percentage of nucleotides or amino acids in the candidate derivative sequence identical with the nucleotides or amino acids in the subject sequence (or specified portion thereof), after aligning the sequences and introducing gaps, if necessary to achieve the maximum percent sequence identity, as generated by the program WU-BLAST-2.Oa19 (Altschul et al., J. Mol. Biol. (1997) 215:403-410) with all the search parameters set to default values. The HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched. A % identity value is determined by the number of matching identical nucleotides or amino acids divided by the sequence length for which the percent identity is being reported. "Percent (%) amino acid sequence similarity" is determined by doing the same calculation as for determining % amino acid sequence identity, but including conservative amino acid substitutions in addition to identical amino acids in the computation.
A conservative amino acid substitution is one in which an amino acid is substituted for another amino acid having similar properties such that the folding or activity of the protein is not significantly affected. Aromatic amino acids that can be substituted for each other are phenylalanine, tryptophan, and tyrosine; interchangeable hydrophobic amino acids are leucine, isoleucine, methionine, and valine; interchangeable polar amino acids are glutamine and asparagine; interchangeable basic amino acids are arginine, lysine and histidine; interchangeable acidic amino acids are aspartic acid and glutamic acid; and interchangeable small amino acids are alanine, serine, threonine, cysteine and glycine.
Alternatively, an alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman (Smith and Waterman, 1981, Advances in Applied Mathematics 2:482-489; database: European Bioinformatics Institute;
Smith and Waterman, 1981, J. of Molec.Biol., 147:195-197; Nicholas et al., 1998, "A
Tutorial on Searching Sequence Databases and Sequence Scoring Methods" (www.psc.edu) and references cited therein.; W.R. Pearson, 1991, Genomics 11:635-650). This algorithm can be applied to amino acid sequences by using the scoring matrix developed by Dayhoff (Dayhoff: Atlas of Protein Sequences and Structure, M. O. Dayhoff ed., 5 suppl. 3:353-358, National Biomedical Research Foundation, Washington, D.C., USA), and normalized by Gribskov (Gribskov 1986 Nucl. Acids Res. 14(6):6745-6763). The Smith-Waterman algorithm may be employed where default parameters are used for scoring (for example, gap open penalty of 12, gap extension penalty of two). From the data generated, the "Match" value reflects "sequence identity."
Derivative nucleic acid molecules of the subject nucleic acid molecules include sequences that hybridize to the nucleic acid sequence of a CCT6. The stringency of hybridization can be controlled by temperature, ionic strength, pH, and the presence of denaturing agents such as formamide during hybridization and washing.
Conditions routinely used are set out in readily available procedure texts (e.g., Current Protocol in Molecular Biology, Vol. 1, Chap. 2.10, John Wiley & Sons, Publishers (1994);
Sambrook et al., Molecular Cloning, Cold Spring Harbor (1989)). In some embodiments, a nucleic acid molecule of the invention is capable of hybridizing to a nucleic acid molecule containing the nucleotide sequence of a CCT6 under high stringency hybridization conditions that are: prehybridization of filters containing nucleic acid for 8 hours to overnight at 65° C in a solution comprising 6X single strength citrate (SSC) (1X SSC is 0.15 M NaCI, 0.015 M Na citrate; pH 7.0), 5X Denhardt's solution, 0.05% sodium pyrophosphate and 100 ,ug/ml herring sperm DNA; hybridization for 18-20 hours at 65° C
in a solution containing 6X SSC, 1X Denhardt's solution, 100 ~Cglml yeast tRNA
and 0.05% sodium pyrophosphate; and washing of filters at 65° C for lh in a solution containing O.1X SSC and 0.1% SDS (sodium dodecyl sulfate).
In other embodiments, moderately stringent hybridization conditions are used that are: pretreatment of filters containing nucleic acid for 6 h at 40° C
in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl (pH7.5), 5mM EDTA, 0.1% PVP, 0.1%

Ficoll, 1% BSA, and 500 ~ug/ml denatured salmon sperm DNA; hybridization for 18-20h at 40° C in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl (pH7.5), 5mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 ~,g/ml salmon sperm DNA, and 10% (wt/vol) dextran sulfate; followed by washing twice for 1 hour at 55° C in a solution containing 2X SSC and 0.1% SDS.
Alternatively, low stringency conditions can be used that are: incubation for hours to overnight at 37° C in a solution comprising 20% formamide, 5 x SSC, 50 mM
sodium phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20 ~,glml denatured sheared salmon sperm DNA; hybridization in the same buffer for 18 to hours; and washing of filters in 1 x SSC at about 37° C for 1 hour.
Isolation, Production, Expression, and Mis-expression of CCT6 Nucleic Acids and Polyneutides CCT6 nucleic acids and polypeptides are useful for identifying and testing agents that modulate CCT6 function and for other applications related to the involvement of CCT6 in the RB pathway. CCT6 nucleic acids and derivatives and orthologs thereof may be obtained using any available method. For instance, techniques for isolating cDNA or genomic DNA sequences of interest by screening DNA libraries or by using polymerase chain reaction (PCR) are well known in the art. In general, the particular use for the protein will dictate the particulars of expression, production, and purification methods.
For instance, production of proteins for use in screening for modulating agents may require methods that preserve specific biological activities of these proteins, whereas production of proteins for antibody generation may require-structural integrity of particular epitopes. Expression of proteins to be purified for screening or antibody production may require the addition of specific tags (e.g., generation of fusion proteins).
Overexpression of a CCT6 protein for assays used to assess CCT6 function, such as involvement in cell cycle regulation or hypoxic response, may require expression in eukaryotic cell lines capable of these cellular activities. Techniques for the expression, production, and purification of proteins are well known in the art; any suitable means therefore may be used (e.g., Higgins SJ and Hames BD (eds.) Protein Expression: A Practical Approach, Oxford University Press Inc., New York 1999; Stanbury PF et al., Principles of Fermentation Technology, 2nd edition, Elsevier Science, New York, 1995; Doonan S (ed.) Protein Purification Protocols, Humana Press, New Jersey, 1996; Coligan JE et al, Current Protocols in Protein Science (eds.), 1999, John Wiley & Sons, New York). In particular embodiments, recombinant CCT6 is expressed in a cell line known to have defective RB
function (e.g. SAOS-2 osteoblasts, BT549 breast cancer cells, and C33A
cervical cancer cells, among others, available from American Type Culture Collection (ATCC), Manassas, VA). The recombinant cells are used in cell-based screening assay systems of the invention, as described further below.
The nucleotide sequence encoding a CCT6 polypeptide can be inserted into any appropriate expression vector. The necessary transcriptional and translational signals, including promoter/enhancer element, can derive from the native CCT6 gene and/or its flanking regions or can be heterologous. A variety of host-vector expression systems may be utilized, such as mammalian cell systems infected with virus (e.g. vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g. baculovirus);
microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, plasmid, or cosmid DNA. An isolated host cell strain that modulates the expression of, modifies, and/or specifically processes the gene product may be used.
To detect expression of the CCT6 gene product, the expression vector can comprise a promoter operably linked to a CCT6 gene nucleic acid, one or more origins of replication, and, one or more selectable markers (e.g. thymidine kinase activity, resistance to antibiotics, etc.). Alternatively, recombinant expression vectors can be identified by assaying for the expression of the CCT6 gene product based on the physical or functional properties of the CCT6 protein in in vitro assay systems (e.g. immunoassays).
The CCT6 protein, fragment, or derivative may be optionally expressed as a fusion, or chimeric protein product (i.e. it is joined via a peptide bond to a heterologous protein sequence of a different protein), for eXample to facilitate purification or detection.
A chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other using standard methods and expressing the chimeric product. A chimeric product may also be made by protein synthetic techniques, e.g. by use of a peptide synthesizer (Hunkapiller et al., Nature (1984) 310:105-111).
Once a recombinant cell that expresses the CCT6 gene sequence is identified, the gene product can be isolated and purified using standard methods (e.g. ion exchange, affinity, and gel exclusion chromatography; centrifugation; differential solubility;
electrophoresis). Alternatively, native CCT6 proteins can be purified from natural sources, by standard methods (e.g. immunoaffinity purification). Once a protein is obtained, it may be quantified and its activity measured by appropriate methods, such as immunoassay, bioassay, or other measurements of physical properties, such as crystallography.
The methods of this invention may also use cells that have been engineered for altered expression (mis-expression) of CCT6 or other genes associated with the RB
pathway. As used herein, mis-expression encompasses ectopic expression, over-expression, under-expression, and non-expression (e.g. by gene knock-out or blocking expression that would otherwise normally occur).
Genetically modified animals Animal models that have been genetically modified to alter CCT6 expression may be used in in vivo assays to test for activity of a candidate RB modulating agent, or to further assess the role of CCT6 in a RB pathway process such as apoptosis or cell proliferation. Preferably, the altered CCT6 expression results in a detectable phenotype, such as decreased or increased levels of cell proliferation, angiogenesis, or apoptosis compared to control animals having normal CCT6 expression. The genetically modified animal may additionally have altered RB expression (e.g. RB knockout).
Preferred genetically modified animals are mammals such as primates, rodents (preferably mice or rats), among others. Preferred non-mammalian species include zebrafish, C.
elegans, and Drosoplzila. Preferred genetically modified animals are transgenic animals having a heterologous nucleic acid sequence present as an extrachromosomal element in a portion of its cells, i.e. mosaic animals (see, for example, techniques described by Jakobovits, 1994, Curr. Biol. 4:761-763.) or stably integrated into its germ line DNA
(i.e., in the genomic sequence of most or all of its cells). Heter~logous nucleic acid is introduced into the germ line of such transgenic animals by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal.
Methods of making transgenic animals are well-known in the art (for transgenic mice see Brinster et al., Proc. Nat. Acad. Sci. USA 82: 4438-4442 (1985), U.S.
Pat. Nos.
4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al., and Hogan, B., Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); for particle bombardment see U.S. Pat. No., 4,945,050, by Sandford et al.; for transgenic Drosophila see Rubin and Spradling, Science (1982) 218:348-53 and U.S. Pat. No. 4,670,388; for transgenic insects see Berghammer A.J. et al., A Universal Marker for Transgenic Insects (1999) Nature 402:370-371; for transgenic Zebrafish see Lin S., Transgenic Zebrafish, Methods Mol Biol. (2000);136:375-3830); for microinjection procedures for fish, amphibian eggs and birds see Houdebine and Chourrout, Experientia (1991) 47:897-905; for transgenic rats see Hammer et al., Cell (1990) 63:1099-1112; and for culturing of embryonic stem (ES) cells and the subsequent production of transgenic animals by the introduction of DNA into ES cells using methods such as electroporation, calcium phosphate/DNA precipitation and direct injection see, e.g., Teratocarcinomas and Embryonic Stem Cells, A Practical Approach, E. J.
Robertson, ed., IRL Press (1987)). Clones of the nonhuman transgenic animals can be produced according to available methods (see Wilmut, I. et al. (1997) Nature 385:810-813; and PCT
International Publication Nos. WO 97/07668 and WO 97/07669).
In one embodiment, the transgenic animal is a "knock-out" animal having a heterozygous or homozygous alteration in the sequence of an endogenous CCT6 gene that results in a decrease of CCT6 function, preferably such that CCT6 expression is undetectable or insignificant. Knock-out animals are typically generated by homologous recombination with a vector comprising a transgene having at least a portion of the gene to be knocked out. Typically a deletion, addition or substitution has been introduced into the transgene to functionally disrupt it. The transgene can be a human gene (e.g., from a human genomic clone) but more preferably is an ortholog of the human gene derived from the transgenic host species. For example, a mouse CCT6 gene is used to construct a homologous recombination vector suitable for altering an endogenous CCT6 gene in the mouse genome. Detailed methodologies for homologous recombination in mice are available (see Capecchi, Science (1989) 244:1288-1292; Joyner et al., Nature (1989) 338:153-156). Procedures for the production of non-rodent transgenic mammals and other animals are also available (Houdebine and Chourrbut, supra; Purseret al., Science (1989) 244:1281-1288; Simms et al., Bio/Technology (1988) 6:179-183). In a preferred embodiment, knock-out animals, such as mice harboring a knockout of a specific gene, may be used to produce antibodies against the human counterpart of the gene that has been knocked out (Claesson MH et al., (1994) Scan J Immunol 40:257-264; Declerck PJ
et al., (1995) J Biol Chem. 270:8397-400).
In another embodiment, the transgenic animal is a "knock-in" animal having an alteration in its genome that results in altered expression (e.g., increased (including ectopic) or decreased expression) of the CCT6 gene, e.g., by introduction of additional copies of CCT6, or by operatively inserting a regulatory sequence that provides for altered expression of an endogenous copy of the CCT6 gene. Such regulatory sequences include inducible, tissue-specific, and constitutive promoters and enhancer elements.
The knock-in can be homozygous or heterozygous.
Transgenic nonhuman animals can also be produced that contain selected systems allowing for regulated expression of the transgene. One example of such a system that may be produced is the cre/loxP recombinase system of bacteriophage P1 (Lakso et al., PNAS (1992) 89:6232-6236; U.S. Pat. No. 4,959,317). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al.
(1991) Science 251:1351-1355; U.S. Pat. No. 5,654,182). In a preferred embodiment, both Cre-LoxP and Flp-Frt are used in the same system to regulate expression of the transgene, and for sequential deletion of vector sequences in the same cell (Sun X et al (2000) Nat Genet 25:83-6).
The genetically modified animals can be used in genetic studies to further elucidate the RB pathway, as animal models of disease and disorders implicating defective RB
function, and for in vivo testing of candidate therapeutic agents, such as those identified in screens described below. The candidate therapeutic agents are administered to a genetically modified animal having altered CCT6 function and phenotypic changes are compared with appropriate control animals such as genetically modified animals that receive placebo treatment, and/or animals with unaltered CCT6 expression that receive candidate therapeutic agent.
In addition to the above-described genetically modified animals having altered CCT6 function, animal models having defective RB function (and otherwise normal CCT6 function), can be used in the methods of the present invention. For example, a mouse with defective RB function can be used to assess, in vivo, the activity of a candidate RB
modulating agent identified in one of the in vitro assays described below.
Transgenic mice with defective RB function have been described in literature (Robanus-Maandag E et al. (1998) Genes Dev 12:1599-609; Windle, J. J. et al (1990) Nature 343: 665-669).
Preferably, the candidate RB modulating agent when administered to a model system with cells defective in RB function, produces a detectable phenotypic change in the model system indicating that the RB function is restored, i.e., the cells exhibit normal cell cycle progression.
Modulating Agents The invention provides methods to identify agents that interact with and/or modulate the function of CCT6 andlor the RB pathway. Modulating agents identified by the methods are also part of the invention. Such agents are useful in a variety of diagnostic and therapeutic applications associated with the RB pathway, as well as in further analysis of the CCT6 protein and its contribution to the RB pathway.
Accordingly, the invention also provides methods for modulating the RB pathway comprising the step of specifically modulating CCT6, activity by administering a CCT6-interacting or modulating agent.
As used herein, a "CCT6-modulating agent" is any agent that modulates CCT6 function, for example, an agent that interacts with CCT6 to inhibit or enhance activity or otherwise affect normal CCT6 function. CCT6 function can be affected at any level, including transcription, protein expression, protein localization, and cellular or extra-cellular activity. In a preferred embodiment, the CCT6 - modulating agent specifically modulates the function of the CCT6. The phrases "specific modulating agent", "specifically modulates", etc., are used herein to refer to modulating agents that directly bind to the CCT6 polypeptide or nucleic acid, and preferably inhibit, enhance, or otherwise alter, the function of the CCT6. These phrases also encompass modulating agents that alter the interaction of the CCT6 with a binding partner, substrate, or cofactor (e.g. by binding to a binding partner of a CCT6; or to a proteiri/binding partner complex, and altering CCT6 function). In a further preferred embodiment, the CCT6-modulating agent is a modulator of the RB pathway (e.g. it restores and/or upregulates RB
function) and thus is also a RB-modulating agent.
Preferred CCT6-modulating agents include small molecule compounds; CCT6-interacting proteins, including antibodies and other biotherapeutics; and nucleic acid modulators such as antisense and RNA inhibitors. The modulating agents may be formulated in pharmaceutical compositions, for example, as compositions that may comprise other active ingredients, as in combination therapy, and/or suitable carriers or excipients. Techniques for formulation and administration of the compounds may be found in "Remington's Pharmaceutical Sciences" Mack Publishing Co., Easton, PA, 19th edition.

Small molecule modulators Small molecules are often preferred to modulate function of proteins with enzymatic function, and/or containing protein interaction domains. Chemical agents, referred to in the art as "small molecule" compounds are typically organic, non-peptide molecules, having a molecular weight up to 10,000, preferably up to 5,000, more preferably up to 1,000, and most preferably up to 500 daltons. This class of modulators includes chemically synthesized molecules, for instance, compounds from combinatorial chemical libraries. Synthetic compounds may be rationally designed or identified based on known or inferred properties of the CCT6 protein or may be identified by screening compound libraries. Alternative appropriate modulators of this class are natural products, particularly secondary metabolites from organisms such as plants or fungi, which can also be identified by screening compound libraries for CCT6-modulating activity.
Methods for generating and obtaining compounds are well known in the art (Schreiber SL, Science (2000) 151: 1964-1969; Radmann J and Gunther J, Science (2000) 151:1947-1948).
Small molecule modulators identified from screening assays, as described below, can be used as lead compounds from which candidate clinical compounds may be designed, optimized, and synthesized. Such clinical compounds may have utility in treating pathologies associated with the RB pathway. The activity of candidate small molecule modulating agents may be improved several-fold through iterative secondary functional validation, as further described below, structure determination, and candidate modulator modification and testing. Additionally, candidate clinical compounds are generated with specific regard to clinical and pharmacological properties. For example, the reagents may be derivatized and re-screened using ifi vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development.
Protein Modulators Specific CCT6-interacting proteins are useful in a variety of diagnostic and therapeutic applications related to the RB pathway and related disorders, as well as in validation assays for other CCT6-modulating agents. In a preferred embodiment, interacting proteins affect normal CCT6 function, including transcription, protein expression, protein localization, and cellular or extra-cellular activity. In another embodiment, CCT6-interacting proteins are useful in detecting and providing information about the function of CCT6 proteins, as is relevant to RB related disorders, such as cancer (e.g., for diagnostic means).

A CCT6-interacting protein may be endogenous, i.e. one that naturally interacts genetically or biochemically with a CCT6, such as a member of the CCT6 pathway that modulates CCT6 expression, localization, and/or activity. CCT6-modulators include dominant negative forms of CCT6-interacting proteins and of CCT6 proteins themselves.
Yeast two-hybrid and variant screens offer preferred methods for identifying endogenous CCT6-interacting proteins (Finley, R. L. et al. (1996) in DNA Cloning-Expression Systems: A Practical Approach, eds. Glover D. & Hames B. D (Oxford University Press, Oxford, England), pp. 169-203; Fashema SF et al., Gene (2000) 250:1-14; Drees BL Curr Opin Chem Biol (1999) 3:64-70; Vidal M and Legrain P Nucleic Acids Res (1999) 27:919-29; and U.S. Pat. No. 5,928,868). Mass spectrometry is an alternative preferred method for the elucidation of protein complexes (reviewed in, e.g., Pandley A
and Mann M, Nature (2000) 405:837-846; Yates JR 3rd, Trends Genet (2000) 16:5-8).
An CCT6-interacting protein may be an exogenous protein, such as a CCT6-specific antibody or a T-cell antigen receptor (see, e.g., Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory; Harlow and Lane (1999) Using antibodies: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press). CCT6 antibodies are further discussed below.
In preferred embodiments, a CCT6-interacting protein specifically binds a CCT6 protein. In alternative preferred embodiments, a CCT6-modulating agent binds a substrate, binding partner, or cofactor.
Antibodies In another embodiment, the protein modulator is a CCT6 specific antibody agonist or antagonist. The antibodies have therapeutic and diagnostic utilities, and can be used in screening assays to identify CCT6 modulators. The antibodies can also be used in dissecting the portions of the CCT6 pathway responsible for various cellular responses and in the general processing and maturation of the CCT6.
Antibodies that specifically bind CCT6 polypeptides can be generated using known methods. Preferably the antibody is specific to a mammalian ortholog of polypeptide, and more preferably, to human CCT6. Antibodies may be polyclonal, monoclonal (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')₂ fragments, fragments produced by a FAb expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.
Epitopes of CCT6 which are particularly antigenic can be selected, for example, by routine screening of CCT6 polypeptides for antigenicity or by applying a theoretical method for selecting antigenic regions of a protein (Hopp and Wood (1981), Proc. Nati.
Acad. Sci.
U.S.A. 78:3824-28; Hopp and Wood, (1983) Mol. Immunol. 20:483-89; Sutcliffe et al., (1983) Science 219:660-66) to the amino acid sequence of a CCT6. Monoclonal antibodies with affinities of 108 M-1 preferably 109 M-1 to 101° M-1, or stronger can be made by standard procedures as described (Harlow and Lane, supra; Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed) Academic Press, New York; and U.S. Pat. Nos. 4,381,292; 4,451,570; and 4,618,577). Antibodies may be generated against crude cell extracts of CCT6 or substantially purified fragments thereof. If CCT6 fragments are used, they preferably comprise at least 10, and more preferably, at least 20 contiguous amino acids of a CCT6 protein. In a particular embodiment, CCT6-specific antigens and/or immunogens are coupled to carrier proteins that stimulate the immune response. For example, the subject polypeptides are covalently coupled to the keyhole limpet hemocyanin KT.Hl( 1 carrier, and the conjugate is emulsified in Freund's complete adjuvant, which enhances the immune response. An appropriate immune system such as a laboratory rabbit or mouse is immunized according to conventional protocols.
The presence of CCT6-specific antibodies is assayed by an appropriate assay such as a solid phase enzyme-linked immunosorbant assay (ELISA) using immobilized corresponding CCT6 polypeptides. Other assays, such as radioimmunoassays or fluorescent assays might also be used.
Chimeric antibodies specific to CCT6 polypeptides can be made that contain different portions from different animal species. For instance, a human immunoglobulin constant region may be linked to a variable region of a murine mAb, such that the antibody derives its biological activity from the human antibody, and its binding specificity from the murine fragment. Chimeric antibodies are produced by splicing together genes that encode the appropriate regions from each species (Morrison et al., Proc. Natl. Acad. Sci. (1984) 81:6851-6855; Neuberger et al., Nature (1984) 312:604-608;
Takeda et al., Nature (1985) 31:452-454). Humanized antibodies, which are a form of chimeric antibodies, can be generated by grafting complementary-determining regions (CDRs) (Carlos, T. M., J. M. Harlan. 1994. Blood 84:2068-2101) of mouse antibodies into a background of human framework regions and constant regions by recombinant DNA technology (Riechmann LM, et al., 1988 Nature 323: 323-327). Humanized antibodies contain ~10% murine sequences and ~90% human sequences, and thus further reduce or eliminate immunogenicity, while retaining the antibody specificities (Co MS, and Queen C. 1991 Nature 351: 501-501; Morrison SL. 1992 Ann. Rev. Immun.

10:239-265). Humanized antibodies and methods of their production are well-known in the art (U.S. Pat. Nos. 5,530,101, 5,585,089, 5,693,762, and 6,180,370).
CCT6-specific single chain antibodies which are recombinant, single chain polypeptides formed by linking the heavy and light chain fragments of the Fv regions via an amino acid bridge, can be produced by methods known in the art (U.S. Pat.
No.
4,946,778; Bird, Science (1988) 242:423-426; Huston et al., Proc. Natl. Acad.
Sci. USA
(1988) 85:5879-5883; and Ward et al., Nature (1989) 334:544-546).
Other suitable techniques for antibody production involve in vitro exposure of lymphocytes to the antigenic polypeptides or alternatively to selection of libraries of antibodies in phage or similar vectors (Ruse et al., Science (1989) 246:1275-1281). As used herein, T-cell antigen receptors are included within the scope of antibody modulators (Harlow and Lane, 1988, supra).
The polypeptides and antibodies of the present invention may be used with or without modification. Frequently, antibodies will be labeled by joining, either covalently or non-covalently, a substance that provides for a detectable signal, or that is toxic to cells that express the targeted protein (Menard S, et al., Int J. Biol Markers (1989) 4:131-134).
A wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, fluorescent emitting lanthanide metals, chemiluminescent moieties, bioluminescent moieties, magnetic particles, and the like (U.S. Pat. Nos. 3,817,837; 3,850,752;
3,939,350;
3,996,345; 4,277,437; 4,275,149; and 4,366,241): Also, recombinant immunoglobulins may be produced (U.S. Pat. No. 4,816,567). Antibodies to cytoplasmic polypeptides may be delivered and reach their targets by conjugation with membrane-penetrating toxin proteins (U.S. Pat. No. 6,086,900).
When used therapeutically in a patient, the antibodies of the subject invention are typically administered parenterally, when possible at the target site, or intravenously. The therapeutically effective dose and dosage regimen is determined by clinical studies.
Typically, the amount of antibody administered is in the range of about 0.1 mg/lcg -to about 10 mg/kg of patient weight. For parenteral administration, the antibodies are formulated in a unit dosage injectable form (e.g., solution, suspension, emulsion) in association with a pharmaceutically acceptable vehicle. Such vehicles are inherently nontoxic and non-therapeutic. Examples are water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Nonaqueous vehicles such as fixed oils, ethyl oleate, or liposome carriers may also be used. The vehicle may contain minor amounts of additives, such as buffers and preservatives, which enhance isotonicity and chemical stability or otherwise enhance therapeutic potential. The antibodies' concentrations in such vehicles are typically in the range of about 1 mg/ml to aboutl0 mg/ml.
Immunotherapeutic methods are further described in the literature (US Pat. No.
5,859,206;
W00073469).
Nucleic Acid Modulators Other preferred CCT6-modulating agents comprise nucleic acid molecules, such as antisense oligomers or double stranded RNA (dsRNA), which generally inhibit activity. Preferred nucleic acid modulators interfere with the function of the CCT6 nucleic acid such as DNA replication, transcription, translocation of the CCT6 RNA to the site of protein translation, translation of protein from the CCT6 RNA, splicing of the to yield one or more mRNA species, or catalytic activity which may be engaged in or facilitated by the CCT6 RNA.
In one embodiment, the antisense oligomer is an oligonucleotide that is sufficiently complementary to a CCT6 mRNA to bind to and prevent translation, preferably by binding to the 5' untranslated region. CCT6-specific antisense oligonucleotides, preferably range from at least 6 to about 200 nucleotides. In some embodiments the oligonucleotide is preferably at least 10, 15, or 20 nucleotides in length. In other embodiments, the oligonucleotide is preferably less than 50, 40, or 30 nucleotides in length. The oligonucleotide can be DNA or RNA or a chimeric mixture or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone. The oligonucleotide may include other appending groups such as peptides, agents that facilitate transport across the cell membrane, hybridization-triggered cleavage agents, and intercalating agents.
In another embodiment, the antisense oligomer is a phosphothioate morpholino oligomer (PMO). PMOs are assembled from four different morpholino subunits, each of which contain one of four genetic bases (A, C, G, or T) linked to a six-membered morpholine ring. Polymers of these subunits are joined by non-ionic phosphodiamidate intersubunit linkages. Details of how to make and use PMOs and other antisense oligomers are well known in the art (e.g. see W099/18193; Probst JC, Antisense Oligodeoxynucleotide and Ribozyme Design, Methods. (2000) 22(3):271-281;
Summerton J, and Welter D. 1997 Antisense Nucleic Acid Drug Dev. :7:187-95; US Pat. No.
5,235,033; and US Pat No. 5,378,841).
Alternative preferred CCT6 nucleic acid modulators are double-stranded RNA
species mediating RNA interference (RNAi). RNAi is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by double-stranded RNA (dsRNA) that is homologous in sequence to the silenced gene. Methods relating to the use of RNAi to silence genes in C. elegans, Drosoplzila, plants, and humans are known in the art (Fire A, et al., 1998 Nature 391:806-811; Fire, A. Trends Genet.
15, 358-363 (1999); Sharp, P. A. RNA interference 2001. Genes Dev. 15, 485-490 (2001);
Hammond, S. M., et al., Nature Rev. Genet. 2, 110-1119 (2001); Tuschl, T. Chem.
Biochem. 2, 239-245 (2001); Hamilton, A. et al., Science 286, 950-95'2 (1999); Hammond, S. M., et al., Nature 404, 293-296 (2000); Zamore, P. D., et al., Cell 101, 25-33 (2000);
Bernstein, E., et al., Nature 409, 363-366 (2001); Elbashir, S. M., et al., Genes Dev. 15, , (2001); WO0129058; W09932619; Elbashir SM, et al., 2001 Nature 411:494-498).
Nucleic acid modulators are commonly used as research reagents, diagnostics, and therapeutics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used to elucidate the function of particular genes (see, for example, U.S. Pat. No. 6,165,790). Nucleic acid modulators are also used, for example, to distinguish between functions of various members of a biological pathway.
For example, antisense oligomers have been employed as therapeutic moieties in the treatment of disease states in animals and man and have been demonstrated in numerous clinical trials to be safe and effective (Milligan JF, et al; -Current Concepts in Antisense Drug Design, J Med Chem. (1993) 36:1923-1937; Tonkinson JL et al., Antisense Oligodeoxynucleotides as Clinical Therapeutic Agents, Cancer Invest. (1996) 14:54-65).
Accordingly, in one aspect of the invention, a CCT6-specific nucleic acid modulator is used in an assay to further elucidate the role of the CCT6 in the RB pathway, and/or its relationship to other members of the pathway. In another aspect of the invention, a CCT6-specific antisense oligomer is used as a therapeutic agent for treatment of RB-related disease states.
Assay Systems The invention provides assay systems and screening methods for identifying specific modulators of CCT6 activity. As used herein, an "assay system"
encompasses all the components required for performing and analyzing results of an assay that detects and/or measures a particular event. In general, primary assays are used to identify or confirm a modulator's specific biochemical or molecular effect with respect to the CCT6 nucleic acid or protein. In general, secondary assays further assess the activity of a CCT6 modulating agent identified by a primary assay and may confirm that the modulating agent affects CCT6 in a manner relevant to the RB pathway. In some cases, CCT6 modulators will be directly tested in a secondary assay.
In a preferred embodiment, the screening method comprises contacting a suitable assay system comprising a CCT6 polypeptide or nucleic acid with a candidate agent under conditions whereby, but for the presence of the agent, the system provides a reference activity (e.g. binding activity), which is based on the particular molecular event the screening method detects. A statistically significant difference between the agent-biased activity and the reference activity indicates that the candidate agent modulates CCT6 activity, and hence the RB pathway. The CCT6 polypeptide or nucleic acid used in the assay may comprise any of the nucleic acids or polypeptides described above.
Primary Assays The type of modulator tested generally determines the type of primary assay.
Primary assays for small molecule »zodulators For small molecule modulators, screening assays are used to identify candidate modulators. Screening assays may be cell-based or may use a cell-free system that recreates or retains the relevant biochemical reaction of the target protein (reviewed in Sittampalam GS et al., Curr Opin Chem Biol (1997) 1:34-91 and accompanying references). As used herein the term "cell-based" refers to assays using live cells, dead cells, or a particular cellular fraction, such as a membrane, endoplasmic reticulum, or mitochondria) fraction. The term "cell free" encompasses assays using substantially purified protein (either endogenous or recombinantly produced), partially purified or crude cellular extracts. Screening assays may detect a variety of molecular events, including protein-DNA interactions, protein-protein interactions (e.g., receptor-ligand binding), transcriptional activity (e.g., using a reporter gene), enzymatic activity (e.g., via a property of the substrate), activity of second messengers, immunogenicty and changes in cellular morphology or other cellular characteristics. Appropriate screening assays may use a wide range of detection methods including fluorescent, radioactive, colorimetric, spectrophotometric, and amperometric methods, to provide a read-out for the particular molecular event detected.
Cell-based screening assays usually require systems for recombinant expression of CCT6 and any auxiliary proteins demanded by the particular assay. Appropriate methods for generating recombinant proteins produce sufficient quantities of proteins that retain their relevant biological activities and are of sufficient purity to optimize activity and assure assay reproducibility. Yeast two-hybrid and variant screens, and mass spectrometry provide preferred methods for determining protein-protein interactions and elucidation of protein complexes. In certain applications, when CCT6-interacting proteins are used in screens to identify small molecule modulators, the binding specificity of the interacting protein to the CCT6 protein may be assayed by various known methods such as substrate processing (e.g. ability of the candidate CCT6-specific binding agents to function as negative effectors in CCT6-expressing cells), binding equilibrium constants (usually at least about 10' M-1, preferably at least about 10$ M-1, more preferably at least about 109 M-1), and immunogenicity (e.g. ability to elicit CCT6 specific antibody in a heterologous host such as a mouse, rat, goat or rabbit). For enzymes and receptors, binding may be assayed by, respectively, substrate and ligand processing.
The screening assay may measure a candidate agent's ability to specifically bind to or modulate activity of a CCT6 polypeptide, a fusion protein thereof, or to cells or membranes bearing the polypeptide or fusion protein. The CCT6 polypeptide can be full length or a fragment thereof that retains functional CCT6 activity. The CCT6 polypeptide may be fused to another polypeptide, such as a peptide tag for detection or anchoring, or to another tag. The CCT6 polypeptide is preferably humanCCT6, or is an ortholog or derivative thereof as described above. In a preferred embodiment, the screening assay detects candidate agent-based modulation of CCT6 interaction with a binding target, such as an endogenous or exogenous protein or other substrate that has CCT6 -specific binding activity, and can be used to assess normal CCT6 gene function.
Suitable assay formats that may be adapted to screen for CCT6 modulators are known in the art. Preferred screening assays are high throughput or ultra high throughput and thus provide automated, cost-effective means of screening compound libraries for lead compounds (Fernandes PB, Curr Opin Chem Biol (1998) 2:597-603; Sundberg SA, Curr Opin Biotechnol 2000, 11:47-53). In one preferred embodiment, screening assays uses fluorescence technologies, including fluorescence polarization, time-resolved fluorescence, and fluorescence resonance energy transfer. These systems offer means to monitor protein-protein or DNA-protein interactions in which the intensity of the signal emitted from dye-labeled molecules depends upon their interactions with partner molecules (e.g., Selvin PR, Nat Struct Biol (2000) 7:730-4; Fernandes PB, supra;
Hertzberg RP and Pope AJ, Curr Opin Chem Biol (2000) 4:445-451).
A variety of suitable assay systems may be used to identify candidate CCT6 and RB pathway modulators (e.g. U.S. Pat. Nos. 5,550,019 and 6,133,437 (apoptosis assays);
and U.S. Pat. Nos. 5,976,782, 6,225,118 and 6,444,434 (angiogenesis assays), among others). Specific preferred assays are described in more detail below.
Apoptosis assays. Assays for apoptosis may be performed by terminal deoxynucleotidyl transferase-mediated digoxigenin-11-dUTP nick end labeling (TUNEL) assay. The TUNEL assay is used to measure nuclear DNA fragmentation characteristic of apoptosis ( Lazebnik et al., 1994, Nature 371, 346), by following the incorporation of fluorescein-dUTP (Yonehara et al., 1989, J. Exp. Med. 169, 1747). Apoptosis may further be assayed by acridine orange staining of tissue culture cells (Lucas, R., et al., 1998, Blood 15:4730-41). Other cell-based apoptosis assays include the caspase-3/7 assay and the cell death nucleosome ELISA assay. The caspase 3/7 assay is based on the activation of the caspase cleavage activity as part of a cascade of events that occur during programmed cell death in many apoptotic pathways. In the caspase 3/7 assay (commercially available Apo-ONES Homogeneous Caspase-317 assay from Promega, cat# 67790), lysis buffer and caspase substrate are mixed and added to cells. The caspase substrate becomes fluorescent when cleaved by active caspase 3/7. The nucleosome ELISA assay is a general cell death assay known to those skilled in the art, and available commercially -(Roche;
Cat#
1774425). This assay is a quantitative sandwich-enzyme-immunoassay which uses monoclonal antibodies directed against DNA and histones respectively, thus specifically determining amount of mono- and oligonucleosomes in the cytoplasmic fraction of cell lysates. Mono and oligonucleosomes are enriched in the cytoplasm during apoptosis due to the fact that DNA fragmentation occurs several hours before the plasma membrane breaks down, allowing for accumalation in the cytoplasm. Nucleosomes are not present in the cytoplasmic fraction of cells that are not undergoing apoptosis. An apoptosis assay system may comprise a cell that expresses a CCT6, and that optionally has defective RB
function (e.g. RB is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the apoptosis assay system and changes in induction of apoptosis relative to controls where no test agent is added, identify candidate RB
modulating agents.

In some embodiments of the invention, an apoptosis assay may be used as a secondary assay to test a candidate RB modulating agents that is initially identified using a cell-free assay system. An apoptosis assay may also be used to test whether CCT6 function plays a direct role in apoptosis. For example, an apoptosis assay may be performed on cells that over- or under-express CCT6 relative to wild type cells. Differences in apoptotic response compared to wild type cells suggests that the CCT6 plays a direct role in the apoptotic response. Apoptosis assays are described further in US Pat. No. 6,133,437.
Cell proliferation and cell cycle assays. Cell proliferation may be assayed via bromodeoxyuridine (BRDU) incorporation. This assay identifies a cell population undergoing DNA synthesis by incorporation of BRDU into newly-synthesized DNA.
Newly-synthesized DNA may then be detected using an anti-BRDU antibody (Hoshino et al., 1986, Int. J. Cancer 38, 369; Campana et al., 1988, J. Immunol. Meth.
107, 79), or by other means.
Cell proliferation is also assayed via phospho-histone H3 staining, which identifies a cell population undergoing mitosis by phosphorylation of histone H3.
Phosphorylation of histone H3 at serine 10 is detected using an antibody specfic to the phosphorylated form of the serine 10 residue of histone H3. (Chadlee,D.N. 1995, J. Biol. Chem 270:20098-105). Cell Proliferation may also be examined using [3H]-thymidine incorporation (Chen, J., 1996, Oncogene 13:1395-403; Jeoung, J., 1995, J. Biol. Chem. 270:18367-73). This assay allows for quantitative characterization of S-phase DNA syntheses. In this assay, cells synthesizing DNA will incorporate [3H]-thymidine into newly synthesized DNA.
Incorporation can then be measured by standard techniques such as-bycountirig of radioisotope in a scintillation counter (e.g., Beckman LS 3800 Liquid Scintillation Counter). Another proliferation assay uses the dye Alamar Blue (available from Biosource International), which fluoresces when reduced in living cells and provides an indirect measurement of cell number (Voytik-Harbin SL et al., 1998, In Vitro Cell Dev Biol Anim 34:239-46). Yet another proliferation assay, the MTS assay, is based on in vitro cytotoxicity assessment of industrial chemicals, and uses the soluble tetrazolium salt, MTS. MTS assays are commercially available, for example, the Promega CellTiter 96~
AQueous Non-Radioactive Cell Proliferation Assay (Cat.# G5421).
Cell proliferation may also be assayed by colony formation in soft agar (Sambrook et al., Molecular Cloning, Cold Spring Harbor (1989)). For example, cells transformed with CCT6 are seeded in soft agar plates, and colonies are measured and counted after two weeks incubation.
Cell proliferation may also be assayed by measuring ATP levels as indicator of metabolically active cells. Such assays are commercially available, for example Cell Titer-GIoTM, which is a luminescent homogeneous assay available from Promega.
Involvement of a gene in the cell cycle may be assayed by flow cytometry (Gray JW et al. (1986) Int J Radiat Biol Relat Stud Phys Chem Med 49:237-55). Cells transfected with a CCT6 may be stained with propidium iodide and evaluated in a flow cytometer (available from Becton Dickinson), which indicates accumulation of cells in different stages of the cell cycle.
Accordingly, a cell proliferation or cell cycle assay system may comprise a cell that expresses a CCT6, and that optionally has defective RB function (e.g. RB
is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the assay system and changes in cell proliferation or cell cycle relative to controls where no test agent is added, identify candidate RB modulating agents. In some embodiments of the invention, the cell proliferation or cell cycle assay may be used as a secondary assay to test a candidate RB modulating agents that is initially identified using another assay system such as a cell-free assay system. A cell proliferation assay may also be used to test whether CCT6 function plays a direct role in cell proliferation or cell cycle.
For example, a cell proliferation or cell cycle assay may be performed on cells that over-or under-express CCT6 relative to wild type cells. Differences in proliferation or cell cycle compared to wild type cells suggests that the CCT6 plays a direct role in cell proliferation or cell cycle.
Angiogenesis. Angiogenesis may be assayed using various human endothelial cell systems, such as umbilical vein, coronary artery, or dermal cells. Suitable assays include Alamar Blue based assays (available from Biosource International) to measure proliferation; migration assays using fluorescent molecules, such as the use of Becton Dickinson Falcon HTS FluoroBlock cell culture inserts to measure migration of cells through membranes in presence or absence of angiogenesis enhancer or suppressors; and tubule formation assays based on the formation of tubular structures by endothelial cells on Matrigel~ (Becton Dickinson). Accordingly, an angiogenesis assay system may comprise a cell that expresses a CCT6, and that optionally has defective RB
function (e.g.
RB is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the angiogenesis assay system and changes in angiogenesis relative to controls where no test agent is added, identify candidate RB modulating agents. In some embodiments of the invention, the angiogenesis assay may be used as a secondary assay to test a candidate RB modulating agents that is initially identified using another assay system. An angiogenesis assay may also be used to test whether CCT6 function plays a direct role in cell proliferation. For example, an angiogenesis assay may be performed on cells that over- or under-express CCT6 relative to wild type cells.
Differences in angiogenesis compared to wild type cells suggests that the CCT6 plays a direct role in angiogenesis. U.S. Pat. Nos. 5,976,782, 6,225,118 and 6,444,434, among others, describe various angiogenesis assays.
Hypoxic induction. The alpha subunit of the transcription factor, hypoxia inducible factor-1 (IiIF-1), is upregulated in tumor cells following exposure to hypoxia in vitro. Under hypoxic conditions, IilF-1 stimulates the expression of genes known to be important in tumour cell survival, such as those encoding glyolytic enzymes and VEGF.
Induction of such genes by hypoxic conditions may be assayed by growing cells transfected with CCT6 in hypoxic conditions (such as with 0.1% 02, 5% C02, and balance N2, generated in a Napco 7001 incubator (Precision Scientific)) and normoxic conditions, followed by assessment of gene activity or expression by Taqman~.
For example, a hypoxic induction assay system may comprise a cell that expresses a CCT6, and that optionally has defective RB function (e.g. RB is over-expressed or under-expressed relative to wild-type cells). A test agent can be added to the hypoxic induction assay system and changes in hypoxic response relative to controls where no test agent is added, identify candidate RB modulating agents. In some embodiments of the invention, the hypoxic induction assay may be used as a secondary assay to test a candidate RB
modulating agents that is initially identified using another assay system. A
hypoxic induction assay may also be used to test whether CCT6 function plays a direct role in the hypoxic response. For example, a hypoxic induction assay may be performed on cells that over- or under-express CCT6 relative to wild type cells. Differences in hypoxic response compared to wild type cells suggests that the CCT6 plays a direct role in hypoxic induction.
Cell adhesion. Cell adhesion assays measure adhesion of cells to purified adhesion proteins, or adhesion of cells to each other, in presence or absence of candidate modulating agents. Cell-protein adhesion assays measure the ability of agents to modulate the adhesion of cells to purified proteins. For example, recombinant proteins are produced, diluted to 2.5g/mL in PBS, and used to coat the wells of a microtiter plate. The wells used for negative control are not coated. Coated wells are then washed, blocked with 1% BSA, and washed again. Compounds are diluted to 2x final test concentration and added to the blocked, coated wells. Cells are then added to the wells, and the unbound cells are washed off. Retained cells are labeled directly on the plate by adding a membrane-permeable fluorescent dye, such as calcein-AM, and the signal is quantified in a fluorescent microplate reader.
Cell-cell adhesion assays measure the ability of agents to modulate binding of cell adhesion proteins with their native ligands. These assays use cells that naturally or recombinantly express the adhesion protein of choice. In an exemplary assay, cells expressing the cell adhesion protein are plated in wells of a multiwell plate.
Cells expressing the ligand are labeled with a membrane-permeable fluorescent dye, such as BCECF , and allowed to adhere to the monolayers in the presence of candidate agents.
Unbound cells are washed off, and bound cells are detected using a fluorescence plate reader.
High-throughput cell adhesion assays have also been described. In one such assay, small molecule ligands and peptides are bound to the surface of microscope slides using a microarray spotter, intact cells are then contacted with the slides, and unbound cells are washed off. In this assay, not only the binding specificity of the peptides and modulators against cell lines are determined, but also the functional cell signaling of attached cells using immunofluorescerice techniques in situ on the microchip is measured (Falsey JR et al., Bioconjug Chem. 2001 May-Jun;l2(3):346-53).
Tubulogenesis. Tubulogenesis assays monitor the ability of cultured cells, generally endothelial cells, to form tubular structures on a matrix substrate, which generally simulates the environment of the extracellular matrix. Exemplary substrates include Matrigel~ (Becton Dickinson), an extract of basement membrane proteins containing laminin, collagen IV, and heparin sulfate proteoglycan, which is liquid at 4° C
and forms a solid gel at 37° C. Other suitable matrices comprise extracellular components such as collagen, fibronectin, and/or fibrin. Cells are stimulated with a pro-angiogenic stimulant, and their ability to form tubules is detected by imaging. Tubules can generally be detected after an overnight incubation with stimuli, but longer or shorter time frames may also be used. Tube formation assays are well known in the art (e.g., Jones MK et al., 1999, Nature Medicine 5:1418-1423). These assays have traditionally involved stimulation with serum or with the growth factors FGF or VEGF. Serum represents an undefined source of growth factors. In a preferred embodiment, the assay is performed with cells cultured in serum free medium, in order to control which process or pathway a candidate agent modulates. Moreover, we have found that different target genes respond differently to stimulation with different pro-angiogenic agents, including inflammatory angiogenic factors such as TNF-alpa. Thus, in a further preferred embodiment, a tubulogenesis assay system comprises testing a CCT6's response to a variety of factors, such as FGF, VEGF, phorbol myristate acetate (PMA), TNF-alpha, ephrin, etc.
Cell Migration. An invasion/migration assay (also called a migration assay) tests the ability of cells to overcome a physical barrier and to migrate towards pro-angiogenic signals. Migration assays are known in the art (e.g., Paik JH et al., 2001, J
Biol Chem 276:11830-11837). In a typical experimental set-up, cultured endothelial cells are seeded onto a matrix-coated porous lamina, with pore sizes generally smaller than typical cell size. The matrix generally simulates the environment of the extracellular matrix, as described above. The lamina is typically a membrane, such as the transwell polycarbonate membrane (Corning Costar Corporation, Cambridge, MA), and is generally part of an upper chamber that is in fluid contact with a lower chamber containing pro-angiogenic stimuli. Migration is generally assayed after an overnight incubation with stimuli, but longer or shorter time frames may also be used. Migration is assessed as the number of cells that crossed the lamina, and may be detected by staining cells with hemotoXylin solution (VWR Scientific, South San Francisco, CA), or by any other method for determining cell number. In another exemplary set up, cells are fluorescently labeled and migration is detected using fluorescent readings, for instance using the Falcon HTS
FluoroBlok (Becton Dickinson). While some migration is observed in the absence of stimulus, migration is greatly increased in response to pro-angiogenic factors. As described above, a preferred assay system for migrationlinvasion assays comprises testing a CCT6's response to a variety of pro-angiogenic factors, including tumor angiogenic and inflammatory angiogenic agents, and culturing the cells in serum free medium.
Sprouting assay. A sprouting assay is a three-dimensional ira vitro angiogenesis assay that uses a cell-number defined spheroid aggregation of endothelial cells ("spheroid"), embedded in a collagen gel-based matrix. The spheroid can serve as a starting point for the sprouting of capillary-like structures by invasion into the extracellular matrix (termed "cell sprouting") and the subsequent formation of complex anastomosing networks (Korff and Augustin, 1999, J Cell Sci 112:3249-58). In an exemplary experimental set-up, spheroids are prepared by pipetting 400 human umbilical vein endothelial cells into individual wells of a nonadhesive 96-well plates to allow overnight spheroidal aggregation (Korff and Augustin: J Cell Biol 143: 1341-52, 1998).
Spheroids are harvested and seeded in 9001 of methocel-collagen solution and pipetted into individual wells of a 24 well plate to allow collagen gel polymerization.
Test agents are added after 30 min by pipetting 100 ~,1 of 10-fold concentrated working dilution of the test substances on top of the gel. Plates are incubated at 37°C for 24h. Dishes are fixed at the end of the experimental incubation period by addition of paraformaldehyde.
Sprouting intensity of endothelial cells can be quantitated by an automated image analysis system to determine the cumulative sprout length per spheroid.
Primary assays for antibody modulators For antibody modulators, appropriate primary assays test is a binding assay that tests the antibody's affinity to and specificity for the CCT6 protein. Methods for testing antibody affinity and specificity are well known in the art (Harlow and Lane, 1988, 1999, supra). The enzyme-linked immunosorbant assay (ELISA) is a preferred method for detecting CCT6-specific antibodies; others include FACS assays, radioimmunoassays, and fluorescent assays.
In some cases, screening assays described for small molecule modulators may also be used to test antibody modulators.
Primary assays for nucleic acid modulators For nucleic acid modulators, primary assays may test the ability of the nucleic acid modulator to inhibit or enhance CCT6 gene expression, preferably mRNA
expression. In general, expression analysis comprises comparing CCT6 expression in like populations of cells (e.g., two pools of cells that endogenously or recombinantly express CCT6) in the presence and absence of the nucleic acid modulator. Methods for analyzing mRNA
and protein expression are well known in the art. For instance, Northern blotting, slot blotting, ribonuclease protection, quantitative RT-PCR (e.g., using the TaqMan~, PE
Applied Biosystems), or microarray analysis may be used to confirm that CCT6 mRNA
expression is reduced in cells treated with the nucleic acid modulator (e.g., Current Protocols in Molecular Biology (1994) Ausubel FM et al., eds., John Wiley & Sons, Inc., chapter 4;
Freeman WM et al., Biotechniques (1999) 26:112-125; Kallioniemi OP, Ann Med 2001, 33:142-147; Blohm DH and Guiseppi-Elie, A Curr Opin Biotechnol 2001, 12:41-47).
Protein expression may also be monitored. Proteins are most commonly detected with specific antibodies or antisera directed against either the CCT6 protein or specific peptides. A variety of means including Western blotting, ELISA, or in situ detection, are available (Harlow E and Lane D, 1988 and 1999, supra).
In some cases, screening assays described for small molecule modulators, particularly in assay systems that involve CCT6 mRNA expression, may also be used to test nucleic acid modulators.
Secondary Assays Secondary assays may be used to further assess the activity of CCT6-modulating agent identified by any of the above methods to confirm that the modulating agent affects CCT6 in a manner relevant to the RB pathway. As used herein, CCT6-modulating agents encompass candidate clinical compounds or other agents derived from previously identified modulating agent. Secondary assays can also be used to test the activity of a modulating agent on a particular genetic or biochemical pathway or to test the specificity of the modulating agent's interaction with CCT6.
Secondary assays generally compare like populations of cells or animals (e.g., two pools of cells or animals that endogenously or recombinantly express CCT6) in the presence and absence of the candidate modulator. In general, such assays test whether treatment of cells or animals with a candidate CCT6-modulating agent results in changes in the RB pathway in comparison to untreated (or mock- or placebo-treated) cells or animals. Certain assays use "sensitised genetic backgrounds", which, as used herein, describe cells or animals engineered for altered expression of genes in the RB
or interacting pathways.
Cell-based assays Cell based assays may use a variety of mammalian cell lines known to have defective RB function (e.g. SAOS-2 osteoblasts, BT549 breast cancer cells, and cervical cancer cells, among others, available from American Type Culture Collection (ATCC), Manassas, VA). Cell based assays may detect endogenous RB pathway activity or may rely on recombinant expression of RB pathway components. Any of the aforementioned assays may be used in this cell-based format. Candidate modulators are typically added to the cell media but may also be injected into cells or delivered by any other efficacious means.
Azzimal Assays A variety of non-human animal models of normal or defective RB pathway may be used to test candidate CCT6 modulators. Models for defective RB pathway typically use genetically modified animals that have been engineered to mis-express (e.g., over-express or lack expression in) genes involved in the RB pathway. Assays generally require systemic delivery of the candidate modulators, such as by oral administration, injection, etc.
In a preferred embodiment, RB pathway activity is assessed by monitoring neovascularization and angiogenesis. Animal models with defective and normal RB are used to test the candidate modulator's affect on CCT6 in Matrigel~ assays.
Matrigel~ is an extract of basement membrane proteins, and is composed primarily of laminin, collagen IV, and heparin sulfate proteoglycan. It is provided as a sterile liquid at 4° C, but rapidly forms a solid gel at 37° C. Liquid Matrigel~ is mixed with various angiogenic agents, such as bFGF and VEGF, or with human tumor cells which over-express the CCT6.
The mixture is then injected subcutaneously(SC) into female athymic nude mice (Taconic, Germantown, NY) to support an intense vascular response. Mice with Matrigel~
pellets may be dosed via oral (PO), intraperitoneal (IP), or intravenous (IV) routes with the candidate modulator. Mice are euthanized 5 -12 days post-injection, and the Matrigel~
pellet is harvested for hemoglobin analysis (Sigma plasma hemoglobin kit).
Hemoglobin content of the gel is found to correlate the degree of neovascularization in the gel.
In another preferred embodiment, the effect of the candidate modulator on CCT6 is assessed via tumorigenicity assays. Tumor xenograft assays are known in the art (see, e.g., Ogawa K et al., 2000, Oncogene 19:6043-6052). Xenografts are typically implanted SC into female athymic mice, 6-7 week old, as single cell suspensions either from a pre-existing tumor or from in vitro culture. The tumors which express the CCT6 endogenously are injected in the flank, 1 x 105 to 1 x 10~ cells per mouse in a volume of 100 ~,L using a 27gauge needle. Mice are then ear tagged and tumors are measured twice weekly. Candidate modulator treatment is initiated on the day the mean tumor weight reaches 100 mg. Candidate modulator is delivered IV, SC, IP, or PO by bolus administration. Depending upon the pharmacokinetics of each unique candidate modulator, dosing can be performed multiple times per day. The tumor weight is assessed by measuring perpendicular diameters with a caliper and calculated by multiplying the measurements of diameters in two dimensions. At the end of the experiment, the excised tumors maybe utilized for biomarker identification or further analyses. For immunohistochemistry staining, xenograft tumors are fixed in 4%
paraformaldehyde, O.1M phosphate, pH 7.2, for 6 hours at 4°C, immersed in 30% sucrose in PBS, and rapidly frozen in isopentane cooled with liquid nitrogen.
In another preferred embodiment, tumorogenicity is monitored using a hollow fiber assay, which is described in U.S. Pat No. US 5,698,413. Briefly, the method comprises implanting into a laboratory animal a biocompatible, semi-permeable encapsulation device containing target cells, treating the laboratory animal with a candidate modulating agent, and evaluating the target cells for reaction to the candidate modulator.
Implanted cells are generally human cells from a pre-existing tumor or a tumor cell line. After an appropriate period of time, generally around six days, the implanted samples are harvested for evaluation of the candidate modulator. Tumorogenicity and modulator efficacy may be evaluated by assaying the quantity of viable cells present in the macrocapsule, which can be determined by tests known in the art, for example, MTT dye conversion assay, neutral red dye uptake, trypan blue staining, viable cell counts, the number of colonies formed in soft'agar, the capacity of the cells to recover and replicate in vitro, etc.
In another preferred embodiment, a tumorogenicity assay use a transgenic animal, usually a mouse, carrying a dominant oncogene or tumor suppressor gene knockout under the control of tissue specific regulatory sequences; these assays are generally referred to as transgenic tumor assays. In a preferred application, tumor development in the transgenic model is well characterized or is controlled. In an exemplary model, the "R1P1-Tag2"
transgene, comprising the SV40 large T-antigen oncogene under control of the insulin gene regulatory regions is expressed in pancreatic beta cells and results in islet cell carcinomas (Hanahan D, 1985, Nature 315:115-122; Parangi S et al, 1996, Proc Natl Acad Sci USA 93: 2002-2007; Bergers G et al, 1999, Science 284:808-812). An "angiogenic switch," occurs at approximately five weeks, as normally quiescent capillaries in a subset of hyperproliferative islets become angiogenic. The RIPl-TAG2 mice die by age weeks. Candidate modulators may be administered at a variety of stages, including just prior to the angiogenic switch (e.g., for a model of tumor prevention), during the growth of small tumors (e.g., for a model of intervention), or during the growth of large and/or invasive tumors (e.g., for a model of regression). Tumorogenicity and modulator efficacy can be evaluating life-span extension and/or tumor characteristics, including number of tumors, tumor size, tumor morphology, vessel density, apoptotic index, etc.
Diagnostic and therapeutic uses Specific CCT6-modulating agents are useful in a variety of diagnostic and therapeutic applications where disease or disease prognosis is related to defects in the RB
pathway, such as angiogenic, apoptotic, or cell proliferation disorders.
Accordingly, the invention also provides methods for modulating the RB pathway in a cell, preferably a cell pre-determined to have defective or impaired RB function (e.g. due to overexpression, underexpression, or misexpression of RB, or due to gene mutations), comprising the step of administering an agent to the cell that specifically modulates CCT6 activity.
Preferably, the modulating agent produces a detectable phenotypic change in the cell indicating that the RB function is restored. The phrase "function is restored", and equivalents, as used herein, means that the desired phenotype is achieved, or is brought closer to normal compared to untreated cells. For example, with restored RB
function, cell proliferation and/or progression through cell cycle may normalize, or be brought closer to normal relative to untreated cells. The invention also provides methods for treating disorders or disease associated with impaired RB function by administering a therapeutically effective amount of a CCT6 -modulating agent that modulates the RB
pathway. The invention further provides methods for modulating CCT6 function in a cell, preferably a cell pre-determined to have defective or impaired CCT6 function, by administering a CCT6 -modulating agent. Additionally, the invention provides a method for treating disorders or disease associated with impaired CCT6 function by administering a therapeutically effective amount of a CCT6 -modulating agent.
The discovery that CCT6 is implicated in RB pathway provides for a variety of methods that can be employed for the diagnostic and prognostic evaluation of diseases and disorders involving defects in the RB pathway and for the identification of subjects having a predisposition to such diseases and disorders.
Various expression analysis methods can be used to diagnose whether CCT6 expression occurs in a particular sample, including Northern blotting, slot blotting, ribonuclease protection, quantitative RT-PCR, and microarray analysis. (e.g., Current Protocols in Molecular Biology (1994) Ausubel FM et al., eds., John Wiley &
Sons, Inc., chapter 4; Freeman WM et al., Biotechniques (1999) 26:112-125; Kallioniemi OP, Ann Med 2001, 33:142-147; Blohm and Guiseppi-Elie, Curr Opin Biotechnol 2001, 12:41-47).
Tissues having a disease or disorder implicating defective RB signaling that express a CCT6, are identified as amenable to treatment with a CCT6 modulating agent. In a preferred application, the RB defective tissue overexpresses a CCT6 relative to normal tissue. For example, a Northern blot analysis of mRNA from tumor and normal cell lines, or from tumor and matching normal tissue samples from the same patient, using full or partial CCT6 cDNA sequences as probes, can determine whether particular tumors express or overexpress CCT6. Alternatively, the TaqMan~ is used for quantitative RT-PCR
analysis of CCT6 expression in cell lines, normal tissues and tumor samples (PE Applied Biosystems).
Various other diagnostic methods may be performed, for example, utilizing reagents such as the CCT6 oligonucleotides, and antibodies directed against a CCT6, as described above for: (1) the detection of the presence of CCT6 gene mutations, or the detection of either over- or under-expression of CCT6 mRNA relative to the non-disorder state; (2) the detection of either an over- or an under-abundance of CCT6 gene product relative to the non-disorder state; and (3) the detection of perturbations or abnormalities in the signal transduction pathway mediated by CCT6.
Thus, in a specific embodiment, the invention is drawn to a method for diagnosing a disease or disorder in a patient that is associated with alterations in CCT6 expression, the method comprising: a) obtaining a biological sample from the patient; b) contacting the sample with a probe for CCT6 expression; c) comparing results from step (b) with a control; and d) determining whether step (c) indicates a likelihood of the disease or disorder. Preferably, the disease is cancer, most preferably a cancer as shown in TABLE
1. The probe may be either DNA or protein, including an antibody.
EXAMPLES
The following experimental section and examples are offered by way of illustration and not by way of limitation.
I. Drosophila RB RNAi screen RNA interference (RNAi) was used to create Rbf-deficient cultured Drosophila cells (Schneider S2 cells (Schneider, I. (1972) J. Embryol. Exp. Morph. 27, 363), adapted to serum-free media, from Invitrogen Corp., Carlsbad, CA). Cells were treated for 3 days with Rbf double stranded RNA (dsRNA) or a control dsRNA representing sequences from an EGFP luciferase cDNA. Following pretreatment with Rbf or control dsRNA, cells were plated in 96-well format and dsRNA representing approximately 6000 different Drosophila genes were added to individual wells. A cell proliferation assay (ProCheckTM
assay - Serological Corporation, Norcross, GA) was used to quantify cell viability after a 96-hour incubation. For each of the greater than 6000 dsRNA sequences tested in this manner, cell viability data was obtained on Rbf deficient cells (Rbf dsRNA-treated) and control cells (EGFP luciferase dsRNA-treated). Comparison of this data for each dsRNA
identified dsRNA sequences that preferentially reduced the viability of Rbf-deficient cells.
Modifiers that reduced the viability of Rbf deficient cells were identified.
Human orthologs of the modifiers are referred to herein as CCT6.
BLAST analysis (Altschul et al., supra) was employed to identify orthologs of Drosophila modifiers. For example, representative sequences from CCT6, GI#

(SEQ ID NO:B), and GI# 5729761 (SEQ ID NO:9) share 69% and 66% amino acid identity, respectively, with the Drosoplaila CG8231.
Various domains, signals, and functional subunits in proteins were analyzed using the PSORT (Nakai K., and Horton P., Trends Biochem Sci, 1999, 24:34-6; Kenta Nakai, Protein sorting signals and prediction of subcellular localization, Adv.
Protein Chem. 54, 277-344 (2000)), PFAM (Bateman A., et al., Nucleic Acids Res, 1999, 27:260-2), SMART (Ponting CP, et al., SMART: identification and annotation of domains from signaling and extracellular protein sequences. Nucleic Acids Res. 1999 Jan 1;27(1):229-32), TM-HMM (Erik L.L. Sonnhammer, Gunnar von Heijne, and Anders Krogh: A
hidden Markov model for predicting transmembrane helices in protein sequences. In Proc. of Sixth Int. Conf. on Intelligent Systems for Molecular Biology; p 175-182 Ed J.
Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C. Sensen Menlo Park, CA:
AAAI
Press, 1998), and clust (Remm M, and Sonnhammer E. Classification of transmembrane protein families in the Caenorhabditis elegans genome and identification of human orthologs. Genome Res. 2000 Nov;lO(11):1679-89) programs. For example, the TCP-1/cpn60 chaperonin family domain (PFAM 00118) of CCT6 from GI#s 4502643 and 5729761 (SEQ ll~ NOs:B and 9, respectively) are located at approximately amino acid residues 30 to 526 and 29-525, respectively.
II. High-Throughput In Vitro Fluorescence Polarization Assay Fluorescently-labeled CCT6 peptide/substrate are added to each well of a 96-well microtiter plate, along with a test agent in a test buffer (10 mM HEPES, 10 mM
NaCI, 6 mM magnesium chloride, pH 7.6). Changes in fluorescence polarization, determined by using a Fluorolite FPM-2 Fluorescence Polarization Microtiter System (Dynatech Laboratories, Inc), relative to control values indicates the test compound is a candidate modifier of CCT6 activity.
III. High-Throughput In Vitro Binding Assay ssP-labeled CCT6 peptide is added in an assay buffer (100 mM KCI, 20 mM
HEPES pH 7.6, 1 mM MgCh, 1% glycerol, 0.5% NP-40, 50 mM beta-mercaptoethanol, mg/ml BSA, cocktail of protease inhibitors) along with a test agent to the wells of a Neutralite-avidin coated assay plate and incubated at 25°C for 1 hour.
Biotinylated substrate is then added to each well and incubated for 1 hour. Reactions are stopped by washing with PBS, and counted in a scintillation counter. Test agents that cause a difference in activity relative to control without test agent are identified as candidate RB
modulating agents.
IV. Immunoprecipitations and Immunoblottin~
For coprecipitation of transfected proteins, 3 x 106 appropriate recombinant cells containing the CCT6 proteins are plated on 10-cm dishes and transfected on the following day with expression constructs. The total amount of DNA is kept constant in each transfection by adding empty vector. After 24 h, cells are collected, washed once with phosphate-buffered saline and lysed for 20 min on ice in 1 ml of lysis buffer containing 50 mM Hepes, pH 7.9, 250 mM NaCI, 20 mM -glycerophosphate, 1 mM sodium orthovanadate, 5 mM p-riitrophenyl phosphate, 2 mM dithiothreitol, protease inhibitors (complete, Roche Molecular Biochemicals), and 1% Nonidet P-40. Cellular debris is removed by centrifugation twice at 15,000 x g for 15 min. The cell lysate is incubated with 25 ,ul of M2 beads (Sigma) for 2 h at 4 °C with gentle rocking.
After extensive washing with lysis buffer, proteins bound to the beads are solubilized by boiling in SDS sample buffer, fractionated by SDS-polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membrane and blotted with the indicated antibodies. The reactive bands are visualized with horseradish peroxidase coupled to the appropriate secondary antibodies and the enhanced chemiluminescence (ECL) Western blotting detection system (Amersham Pharmacia Biotech).

V. Expression analysis All cell lines used in the following experiments are NCI (National Cancer Institute) lines, and are available from ATCC (American Type Culture Collection, Manassas, VA
20110-2209). Normal and tumor tissues were obtained from Impath, UC Davis, Clontech, Stratagene, Ardais, Genome Collaborative, and Ambion.
TaqMan° analysis was used to assess expression levels of the disclosed genes in various samples.
RNA was extracted from each tissue sample using Qiagen (Valencia, CA) RNeasy kits, following manufacturer's protocols, to a final concentration of 50ng/~,1. Single stranded cDNA was then synthesized by reverse transcribing the RNA samples using random hexamers and 500ng of total RNA per reaction, following protocol 4304965 of Applied Biosystems (Foster City, CA).
Primers for expression analysis using TaqMan~ assay (Applied Biosystems, Foster City, CA) were prepared according to the TaqMan~ protocols, and the following criteria: a) primer pairs were designed to span introns to eliminate genomic contamination, and b) each primer pair produced only one product. Expression analysis was performed using a 7900HT instrument.
TaqMan~ reactions were carried out following manufacturer's protocols, in 25 ~.l total volume for 96-well plates and 10 ~,1 total volume for 384-well plates, using 300nM
primer and 250 nM probe, and approximately 25ng of cDNA. The standard curve for result analysis was prepared using a universal pool of human cDNA samples, which is a mixture of cDNAs from a wide variety of tissues so that the chance that a target will be present in appreciable amounts is good. The raw data were normalized using 18S
rRNA
(universally expressed in all tissues and cells).
For each expression analysis, tumor tissue samples were compared with matched normal tissues from the same patient. A gene was considered overexpressed in a tumor when the level of expression of the gene was 2 fold or higher in the tumor compared with its matched normal sample. In cases where normal tissue was not available, a universal pool of cDNA samples was used instead. In these cases, a gene was considered overexpressed in a tumor sample when the difference of expression levels between a tumor sample and the average of all normal samples from the same tissue type was greater than 2 times the standard deviation of all normal samples (i.e., Tumor -average(all normal samples) > 2 x STDEV(all normal samples) ).

Results are shown in Table 1. Number of pairs of tumor samples and matched normal tissue from the same patient are shown for each tumor type. Percentage of the samples with at least two-fold overexpression for each tumor type is provided.
A
modulator identified by an assay described herein can be further validated for therapeutic effect by administration to a tumor in which the gene is overexpressed. A
decrease in tumor growth confirms therapeutic utility of the modulator. Prior to treating a patient with the modulator, the likelihood that the patient will respond to treatment can be diagnosed by obtaining a tumor sample from the patient, and assaying for expression of the gene targeted by the modulator. The expression data for the genes) can also be used as a diagnostic marker for disease progression. The assay can be performed by expression analysis as described above, by antibody directed to the gene target, or by any other available detection method.

GCT~ ~T# 220953415729760 ,' Seq IDNO. 1 4 "; =

Breast 36% 14%
>' '.~

of Pairs 36 36 h . a Colon'; 37% 29%

# of Pairs41 41 Head And 23% 0%
Neck # of Pairs13 13 t. ~~
.

~dney ' 5% 9%
~ ' ~

# of Pairs22 22 ~WecN"~ 75% 12%
~.>

# of Pairs8 8 . _ ~~~' -Lung :- 44% 7%
ti , of ;Pairs 41 41 ILyinplioma67% 0%
= a I

# of Pairs3 3 . '.

Ova~'y~ 42% 16%
, ~ ~

#,ofvPairs19 19 Pancreas 54% 31 ~ ' ' %
' -~:

# of Pairs13 13 ' ~

Prostate 12% 8%

#'of Pairs25 25 Skm- ' S7% 14%

# of Pairs7 7 Stomach 73% 0%
_ ' # of Pairs11 11 Testis= 38% 0%
x ofrPairs, 8 8 _a _ Thyroid 14% 7%
Gland # of Pairs14 14 Uterus 17% 17%
-#.of Pairs.24 24 ':

VI. CCT6 functional assays RNAi experiments were carried out to knock down expression of CCT6 (SEQ ID
NOs 1 and 4) in various cell lines using small interfering RNAs (siRNA, Elbashir et al, supra).
Effect of CCT6 RNAi on cell proliferation and growth. BrdU and Cell Titer-GIoTM
assays, as described above, were employed to study the effects of decreased expression on cell proliferation. The results of these experiments indicated that RNAi of CCT6 of both SEQ ID N0:1 and SEQ D7 N0:4 decreased proliferation in LX1 lung cancer and HCT116 colon cancer cells. MTS cell proliferation assay, as described above, was also employed to study the effects of decreased CCT6 expression on cell proliferation.
The results of this experiment indicated that RNAi of CCT6 of SEQ ID N0:1 decreased proliferation in LX1 lung cancer and SW480 colon cancer cells. RNAi of CCT6 of SEQ
ID NO:4 decreased proliferation in LX1 lung cancer, 231T breast cancer, A549 lung cancer, HCT116 colon cancer, and SW480 colon cancer cells. Standard colony growth assays, as described above, were employed to study the effects of decreased expression on cell growth. Effect of CCT6 RNAi on apoptosis. Nucleosome ELISA
apoptosis assay, as described above, was employed to study the effects of decreased CCT6 expression on apoptosis. Results indicated that RNAi_of.CCT6 of SEQ m NO:1 increased apoptosis in A549 lung cancer and LX1 lung cancer cells. RNAi of CCT6 of SEQ ~
N0:4 increased apoptosis in LXl lung cancer cells.
Effect of CCT6 RNAi on cell cycle. Propidium iodide (PI) cell cycle assay, as described above, was employed to study the effects of decreased CCT6 expression on cell cycle. RNAi of CCT6 of both SEQ ID N0:1 and SEQ ID N0:4 increased the sub-G1 peak in A549 lung cancer, 231 breast cancer, and LXl lung cancer cells. The region of subGl represents cells undergoing apoptosis-associated DNA degradation CCT6 overexpression analysis. CCT6 (SEQ ID N0:4) was overexpressed and tested in colony growth assays as described above. Overexpressed CCT6 of SEQ
ID N0:4 had some morphological effects on cells, and strong effects on colony growth.
Effects of overexpressed CCT6 on expression of various transcription factors was also studied.

Overexpressed CCT6 caused an increased expression of the following transcription factors: SRE (Serum response element), ETS 1 (ETS oncogene; v-ets avian erythroblastosis virus e26 oncogene homolog 1), and EGR (Early growth response).

SEQUENCE LISTING
<110> EXELIXIS, INC.
<120> CCT6s AS MODIFIERS OF THE RB PATHWAY AND METHODS OF USE
<130> EX03-086C-PC
<150> US 60/428,872 <151> 2002-11-25 <160> 9 <170> PatentIn version 3.2 <210> 1 <211> 2562 <212> DNA

<213> Homo Sapiens <400> 1 gccgcgccgg ctctgggcactcagcatcgtttccttttcctccgctggagcagctatggc 60 ggcggtgaag accctgaaccccaaggccgaggtggcccgagcgcaggcggcgctggcggt 120 caacatcagc gcagcgcggggtctgcaggacgtgctaaggaccaacctggggcccaaggg 180 caccatgaag atgctcgtttctggcgctggagacatcaaacttactaaagacggcaatgt 240 ~

gctgcttcac gaaatgcaaattcaacacccaacagcttccttaatagcaaaggtagcaac 300 agcccaggat gatataactggtgatggtacgacttctaatgtcctaatcattggagagct 360 gctgaaacag gcggatctctacatttctgaaggccttcatcctagaataatcactgaagg 420 atttgaagct gcaaaggaaaaggcccttcagtttttggaagaagtcaaagtaagcagaga 480 gatggacagg gaaacacttatagatgtggccagaacatctcttcgtactaaagttcatgc 540 tgaacttgca gatgtcttaacagaggctgtagtggactccattttggccattaaaaagca 600 agatgaacct attgatctcttcatgattgagatcatggagatgaaacataaatctgaaac 660 tgatacaagcttaatcagagggcttgttttggaccacggagcacggcatcctgatatgaa720 gaaaagggtggaggatgcatacatcctcacttgtaacgtgtcattagagtatgagaaaac780 agaagtgaattctggctttttttacaagagtgcagaagagagagaaaaactcgtgaaagc840 tgaaagaaaattcattgaagatagggttaaaaaaataatagaactgaaaaggaaagtctg900 tggcgattcagataaaggatttgttgttattaatcaaaagggaattgaccccttttcctt960 agatgctctttcaaaagaaggcatagtcgctctgcgcagagctaaaaggagaaatatgga1020 gaggctgactcttgcttgtggtggggtagccctgaattcttttgacgacctaagtcctga1080 ctgcttgggacatgcaggacttgtatatgagtatacattgggagaagagaagtttacctt1140 tattgagaaatgtaacaaccctcgttctgtcacattattgatcaaaggaccaaataagca1200 cacactcactcagatcaaagatgcagtgagggacggcttgagggctgtcaaaaatgctat1260 tgatgatggc tgtgtggttccaggtgctggtgccgtggaagtggcaatggcagaagccct1320 gattaaacat aagcccagtgtaaagggcagggcacagcttggagtccaagcatttgctga1380 tgcattgctc attattcccaaggttcttgctcagaactctggttttgaccttcaggaaac1440 attagttaaa attcaagcagaacattcagaatcaggtcagcttgtgggtgtggacctgaa1500 cacaggtgag ccaatggtggcagcagaagtaggcgtatgggataactattgtgtaaagaa1560 acagcttctt cactcctgcactgtgattgccaccaacattctcttggttgatgagatcat1620 gcgagctgga atgtcttctctgaaaggttgaattgaagcttcctctgtatctgaatcttg1680 aagactgcaa agtgatcctgaggattacagctgtggaatttttgtccaagcttcaaataa1740 ttttgaaaga aattttcccatatgaaaaaaggagagaacactggcatctgttgaaatttg1800 gaagttctga aattatagtatttttaaaaattgcactgaagtgtatacacataaagcagg1860 tcttttatcc agtgaacaggatgttttgctttagcagcagtgacataaaattccatgtta1920 gataagcata tgttacttaccttgttattaaatatttcttgaaaagcaaattttaatggt1980 taattttatg tggacgtatgttaaattatccaaactaccctattgttaagcatttggttt2040 taaaattttt atgctaatataaatgctcaagtaatttaaaatattgaaagcatccctgtt2100 ggtataaatt tctgagtaaatgcattggatcagttggactttgaacgccctttgaaatgg2160 ctttgctaaa atgctcccgccacaaagttgtaggaaatgggaagaggagtcaactagagg2220 caagggagtt gagagagctgcaactgtaaagggcaagaacaggcagaggtaaaaagatga2280 tggaaggtgt ggtgactaagggccacggttattgggtgaaatttgagatgtaggccaact2340 gtattttcaa gcttctgaacttaaggcaaaatattcatcgcaaagtctctagcgtcatat2400 ttttctcacc caaattacgtttccacgagttattatatatagttggtctatctctgcagt2460 ccttgaaggt gaagttgtgtgttactaggctgtgttttgggatgtcagcagtggcctgaa2520 gtgagttgtg caataaatgttaagttgaaacctcaaaaaaas 2562 <210> 2 <211> 2562 <212> DNA
<213> Homo Sapiens <400> 2 gccgcgccgg ctctgggcac tcagcatcgt ttccttttcc tccgctggag cagctatggc 60 ggcggtgaag accctgaacc ccaaggccga ggtggcccga gcgcaggcgg cgctggcggt 120 caacatcagc gcagcgcggg gtctgcagga cgtgctaagg accaacctgg ggcccaaggg 180 caccatgaag atgctcgttt ctggcgctgg agacatcaaa cttactaaag acggcaatgt 240 gctgcttcac gaaatgcaaa ttcaacaccc aacagcttcc ttaatagcaa aggtagcaac 300 agcccaggatgatataactggtgatggtacgacttctaatgtcctaatcattggagagct360 gctgaaacaggcggatctctacatttctgaaggccttcatcctagaataatcactgaagg420 atttgaagctgcaaaggaaaaggcccttcagtttttggaagaagtcaaagtaagcagaga480 gatggacagggaaacacttatagatgtggccagaacatctcttcgtactaaagttcatgc540 tgaacttgcagatgtcttaacagaggctgtagtggactccattttggccattaaaaagca600 agatgaacctattgatctcttcatgattgagatcatggagatgaaacataaatctgaaac660 tgatacaagcttaatcagagggcttgttttggaccacggagcacggcatcctgatatgaa720 gaaaagggtggaggatgcatacatcctcacttgtaacgtgtcattagagtatgagaaaac780 agaagtgaattctggctttttttacaagagtgcagaagagagagaaaaactcgtgaaagc840 tgaaagaaaattcattgaagatagggttaaaaaaataatagaactgaaaaggaaagtctg900 tggcgattcagataaaggatttgttgttattaatcaaaagggaattgaccccttttcctt960 agatgctctttcaaaagaaggcatagtcgctctgcgcagagctaaaaggagaaatatgga1020 gaggctgactcttgcttgtggtggggtagccctgaattcttttgacgacctaagtcctga1080 ctgcttgggacatgcaggacttgtatatgagtatacattgggagaagagaagtttacctt1140 tattgagaaatgtaacaaccctcgttctgtcacattattgatcaaaggaccaaataagca1200 cacactcactcagatcaaagatgcagtgagggacggcttgagggctgtcaaaaatgctat1260 tgatgatggctgtgtggttccaggtgctggtgccgtggaagtggcaatggcagaagccct1320 gattaaacataagcccagtgtaaagggcagggcacagcttggagtccaagcatttgctga1380 tgcattgctcattattcccaaggttcttgctcagaactctggttttgaccttcaggaaac1440 attagttaaaattcaagcagaacattcagaatcaggtcagcttgtgggtgtggacctgaa1500 eacaggtgagccaatggtggeagcagaagt-aggegtatgg-gataactattgtgtaaagaa1560 acagcttcttcactcctgcactgtgattgccaccaacattctcttggttgatgagatcat1620 gcgagctggaatgtcttctctgaaaggttgaattgaagcttcctctgtatctgaatcttg1680 aagactgcaaagtgatcctgaggattacagctgtggaatttttgtccaagcttcaaataa1740 ttttgaaagaaattttcccatatgaaaaaaggagagaacactggcatctgttgaaatttg1800 gaagttctgaaattatagtatttttaaaaattgcactgaagtgtatacacataaagcagg1860 tcttttatccagtgaacaggatgttttgctttagcagcagtgacataaaattccatgtta1920 gataagcatatgttacttaccttgttattaaatatttcttgaaaagcaaattttaatggt1980 taattttatgtggacgtatgttaaattatccaaactaccctattgttaagcatttggttt2040 taaaatttttatgctaatataaatgctcaagtaatttaaaatattgaaagcatccctgtt2100 ggtataaatttctgagtaaatgcattggatcagttggactttgaacgccctttgaaatgg2160 ctttgctaaaatgctcccgccacaaagttgtaggaaatgggaagaggagtcaactagagg2220 caagggagttgagagagctgcaactgtaaagggcaagaacaggcagaggtaaaaagatga2280 tggaaggtgtggtgactaagggccacggttattgggtgaaatttgagatgtaggccaact2340 gtattttcaagcttctgaacttaaggcaaaatattcatcgcaaagtctctagcgtcatat2400 ttttctcacccaaattacgtttccacgagttattatatatagttggtctatctctgcagt2460 ccttgaaggtgaagttgtgtgttactaggctgtgttttgggatgtcagcagtggcctgaa2520 gtgagttgtgcaataaatgttaagttgaaacctcaaaaaaas 2562 <210> 3 <211> 2647 <212> DNA

<213> Homo sapiens <400> 3 gggcggcggc gcgcgggcacgctgggggccggccagacgggccgacttttccagaagacc 60 cggatagttc ctcccggccacgccgcgccggctctgggcactcagcatcgtttccttttc 120 ctccgctgga gcagctatggcggcggtgaagaccctgaaccccaaggccgaggtggcccg 180 agcgcaggcg gcgctggcggtcaacatcagcgcagcgcggggtctgcaggacgtgctaag 240 gaccaacctg gggcccaagggcaccatgaagatgctcgtttctggcgctggagacatcaa 300 acttactaaa gacggcaatgtgctgcttcacgaaatgcaaattcaacacccaacagcttc 360 cttaatagca aaggtagcaacagcccaggatgatataactggtgatggtacgacttctaa 420 tgtcctaatc attggagagctgctgaaacaggcggatctctacatttctgaaggccttca 480 tcctagaata atcactgaaggatttgaagctgcaaaggaaaaggcccttcagtttttgga 540 agaagtcaaa gtaagcagagagatggacagggaaacacttatagatgtggccagaacatc 600 tcttcgtact aaagttcatgctgaacttgcagatgtcttaacagaggctgtagtggactc 660 cattttggccattaaaaagcaagatgaacctattgatctcttcatgattgagatcatgga720 gatgaaacataaatctgaaactgatacaagcttaatcagagggcttgttttggaccacgg780 agcacggcatcctgatatgaagaaaagggtggaggatgcatacatcctcacttgtaacgt840 gtcattagagtatgagaaaacagaagtgaattctggctttttttacaagagtgcagaaga900 gagagaaaaactcgtgaaagctgaaagaaaattcattgaagatagggttaaaaaaataat960 agaactgaaaaggaaagtctgtggcgattcagataaaggatttgttgttattaatcaaaa1020 gggaattgacccctttcccttaagtgctctttcaaaagaaggcatagtcgctctgcgcag1080 agctaaaaggagaaatatggagaggctgactcttgcttgtggtggggtagccctgaattc1140 ttttgacgacctaagtcctgactgcttgggacatgcaggacttgtatatgagtatacatt1200 gggagaagagaagtttacctttattgagaaatgtaacaaccctcgttctgtcacattatt1260 gatcaaaggaccaaataagcacacactcactcagatcaaagatgcagtgagggacggctt1320 gagggctgtcaaaaatgctattgatgatggctgtgtggttccaggtgctggtgccgtgga1380 agtggcaatggcagaagccctgattaaacataagcccagtgtaaagggcagggcacagct1440 tggagtccaagcatttgctgatgcattgctcattattcccaaggttcttgctcagaactc1500 tggttttgaccttcaggaaacattagttaaaattcaagcagaacattcagaatcaggtca1560 gcttgtgggtgtggacctgaacacaggtgagccaatggtggcagcagaagtaggcgtatg1620 ggataactattgtgtaaagaaacagcttcttcactcctgcactgtgattgccaccaacat1680 tctcttggttgatgagatcatgcgagctggaatgtcttctctgaaaggttgaattgaagc1740 ttcctctgtatctgaatcttgaagactgcaaagtgatcctgaggattacagctgtggaat1800 ttttgtccaagcttcaaataattttgaaagaaattttcccatataaaaaaaggagagaac1860 actggcatctgttgaaatttggaagttctgaaattatagtatttttaaaaattgcactga1920 agtgtatacacataaagcaggtcttttatccagtgaacaggatgttttgctttagcagca1980 gtgacataaaattccatgttagataagcatatgttacttaccttgttattaaatatttct2040 tgaaaagcaaattttaatggtttaattttatgtggacgtatgttaaattatccaactacc2100 ctattgttaagcatttggttttaaaatttttatgctaatataaatgctcaagtaatttaa2160 aatattgaaagcatccctgttggtataaatttctgagtaaatgcattggatcagttggac2220 tttgaacgcctttgaaatggctttgctaaaatgctcccgccacaaagttgtaggaaatgg2280 gaagaggagtcaactagaggcaagggagttgagagagctgcaactgtaaagggcaagaac2340 aggcagaggtaaaaagatgatggaaggtgtggtgactaagggccacggttattgggtgaa2400 atttgagattgtaggccaactgtattttcaagcttctgaacttaggcaaaatattcatcg2460 caaagtctctagcgtcatatttttctcacccaaattacgtttccacgagattatttatat2520 atagttggtctatctctgcagtccttgaaggtgaagttgtgtgttactaggctgtgtttt2580 gggatgtcagcagtggcctgaagtgagttgtgcaataaatgttaagttgaaacctcaaaa2640 aaaaaaa 2647 <210> 4 <211> 1759 <212> DNA
<213> Homo Sapiens <400> 4 cgcgactaag gctttttttt tttctccctc tgaacggtta ggctatggct gcgataaagg 60 ccgtcaactc caaggctgag gtggcgcggg ccaggcagct ttggctgtca atatatgcgc 120 cgccgagggt gcaggatgtg ctgcggacca acttgggtcc taaaggcacc atgaaaatgc 180 ttgtttctggtgcaggtgacatcaaactcaccaaagatggcaatgtgctgctcgatgaga240 tgcaaattcaacatccaacagcttccttgatagcaaaagtagcaacagctcaggatggcg300 tcacaggagatggtactacaacaaatgttctaattattggagagttattaaaacaagctg360 acctgtacatttctgagggcctgcaccctagaataatagctgaaggatttgaagctgcaa420 agataaaagcacttgaagttttggaggaagttaaagtgacaaaggagatgaaaagaaaaa480 tcctcttagatgtagctagaacatcattacaaactaaagttcatgctgaactggctgatg540 tcttaacagaggttgtggtggattctcttttccctgttagaagaccaccttaccctattg600 atctcttcatggtagaaataatggagatgaagcataaattaggaacagatacaaagttga660 tccaaggattagttttggatcatggtgcccgtcatccagatatgaagaagcgagtagaag720 atgcatttatccttatttgcaacgtttcactggaatatgaaaaaacagaggtgaactctg780 ctttcttttataagactgcagaagagaaagagaaattggtaaaagctgaaagaaaattta840 ttgaagatagagtacaaaaaataatagacctgaaggacaaagtctgtgctcagtcaaata900 aaggatttgtcgtcattaatcaaaagggaattgatccattttccttagattctcttgcaa960 aacatggaatagtagctcttcgcagagcaaaaagaagaaatatggaaagactctctcttg1020 cttgtggtggaatggccgtgaattcttttgaagatctcactgtagattgcttgggacatg1080 ctggtcttgtgtatgagtatacattaggtgaagaaaagttcacttttattgaggagtgtg1140 ttaacccttgctctgttaccttgttggttaaaggaccaaataagcatactctcacacaag1200 tcaaggatgccataagagatggacttcgtgctatcaaaaatgccattgaagatggttgta1260 tggttcctggagctggtgcaattgaagtggcaatggctgaagctcttgttacatataaga1320 acagtataaaaggaagagctcgtcttggagtccaagcttttgctgatgccttactcatta1380 ttcccaaggttcttgctcagaatgctggtt-atgacccaca-ggaaacattagtaaaagttc1440 aggctgagcatgtcgagtcaaaacaacttgtgggcgtagatttgaatacaggtgagccaa1500 tggtagcagcagatgcaggagtttgggataattattgtgtaaaaaaacaacttcttcact1560 cttgcacagtgattgccaccaacattctcctggttgatgaaattatgcgagctgggatgt1620 cttctcaaatgatgattgaattcaaaatcaacccttctagaagatgaaatttagtacact1680 ttacatctgactactattgtgtagcctgagccattctgaatttctacacaataaatgcag1740 tttatgtcttttgggtcgt 1759 <210>

<211>

<212>
DNA

<213>
Homo sapiens <400> 5 cgcgactaag gctttttttt tttctccctc tgaacggtta ggctatggct gcgataaagg 60 ccgtcaactccaaggctgaggtggcgcgggcccgggcagctttggctgtcaatatatgcg120 ccgcccgagggctgcaggatgtgctgcggaccaacttgggtcctaaaggcaccatgaaaa180 tgcttgtttctggtgcaggtgacatcaaactcaccaaagatggcaatgtgctgctcgatg240 agatgcaaattcaacatccaacagcttccttgatagcaaaagtagcaacagctcaggatg300 acgtcacaggagatggtactacttcaaatgttctaattattggagagttattaaaacaag360 ctgacctgtacatttctgagggcctgcaccctagaataatagctgaaggatttgaagctg420 caaagataaaagcacttgaagttttggaggaagttaaagtgacaaaggagatgaaaagaa480 aaatcctcttagatgtagctagaacatcattacaaactaaagttcatgctgaactggctg540 atgtcttaacagaggttgtggtggattctgttttggctgttagaagaccaggttacccta600 ttgatctcttcatggtagaaataatggagatgaagcataaattaggaacagatacaaagt660 tgatccaaggattagttttggatcatggtgcccgtcatccagatatgaagaagcgagtag720 aagatgcatttatccttatttgcaacgtttcactggaatatgaaaaaacagaggtgaact780 ctggtttcttttataagactgcagaagagaaagagaaattggtaaaagctgaaagaaaat840 ttattgaagatagagtacaaaaaataatagacctgaaggacaaagtctgtgctcagtcaa900 ataaaggatttgtcgtcattaatcaaaagggaattgatccattttccttagattctcttg960 caaaacatggaatagtagctcttcgcagagcaaaaagaagaaatatggaaagactctctc1020 ttgcttgtggtggaatggccgtgaattcttttgaagatctcactgtagattgcttgggac1080 atgctggtcttgtgtatgagtatacattaggtgaagaaaagttcacttttattgaggagt1140 gtgttaacccttgctctgttaccttgttggttaaaggaccaaataagcatactctcacac1200 aagtcaagga tgccataagagatggacttcgtgctatcaaaaatgccattgaagatggtt1260 gtatggttcc tggagctggtgcaattgaagtggcaatggctgaagctcttgttacatata1320 agaacagtat aaaaggaagagctcgtcttggagtccaagcttttgctgatgccttactca1380 ttattcccaa ggttcttgctcagaatgctggttatgacccacaggaaacattagtaaaag1440 ttcaggctga gcatgtcgagtcaaaacaacttgtgggcgtagatttgaatacaggtgagc1500 caatggtagc agcagatgcaggagtttgggataattattgtgtaaaaaaacaacttcttc1560 actcttgcac agtgattgccaccaacattctcctggttgatgaaattatgcgagctggga1620 tgtcttctct caaatgatgattgaattcaaaatcaacccttctagaagatgaaatttagt1680 acactttaca tctgactactattgtgtagcctgagccattctgaatttctacacaataaa1740 tgcagtttat gtcttttgggtc 1762 <210> 6 <211> 1759 <212>
DNA

<213>
Homo sapiens <400>

cgcgactaaggctttttttttttctccctctgaacggttaggctatggctgcgataaagg 60 ccgtcaactccaaggctgaggtggcgcgggccaggcagctttggctgtcaatatatgcgc 120 cgccgagggtgcaggatgtgctgcggaccaacttgggtcctaaaggcaccatgaaaatgc 180 ttgtttctggtgcaggtgacatcaaactcaccaaagatggcaatgtgctgctcgatgaga 240 tgcaaattcaacatccaacagcttccttgatagcaaaagtagcaacagctcaggatggcg 300 tcacaggagatggtactacaacaaatgttctaattattggagagttattaaaacaagctg 360 acctgtacatttctgagggcctgcaccctagaataatagctgaaggatttgaagctgcaa 420 agataaaagcacttgaagttttggaggaagttaaagtgacaaaggagatgaaaagaaaaa 480 tcctcttagatgtagctagaacatcattacaaactaaagttcatgctgaactggctgatg 540 tcttaacagaggttgtggtggattctcttttccctgttagaagaccaccttaccctattg 600 atctcttcatggtagaaataatggagatgaagcataaattaggaacagatacaaagttga 660 tccaaggattagttttggatcatggtgcccgtcatccagatatgaagaagcgagtagaag 720 atgcatttatccttatttgcaacgtttcactggaatatgaaaaaacagaggtgaactctg 780 ctttcttttataagactgcagaagagaaagagaaattggtaaaagctgaaagaaaattta 840 ttgaagatagagtacaaaaaataatagacctgaaggacaaagtctgtgctcagtcaaata 900 aaggatttgtcgtcattaatcaaaagggaattgatccattttccttagattctcttgcaa 960 aacatggaat agtagctcttcgcagagcaaaaagaagaaatatggaaagactctctcttg1020 cttgtggtgg aatggccgtgaattcttttgaagatctcactgtagattgcttgggacatg1080 ctggtettgt gtatgagtat-acattaggtgaagaaaagtt-cacttttattgaggagtgtg1140 ttaacccttg ctctgttaccttgttggttaaaggaccaaataagcatactctcacacaag1200 tcaaggatgc cataagagatggacttcgtgctatcaaaaatgccattgaagatggttgta1260 tggttcctgg agctggtgcaattgaagtggcaatggctgaagctcttgttacatataaga1320 acagtataaa aggaagagctcgtcttggagtccaagcttttgctgatgccttactcatta1380 ttcccaaggt tcttgctcagaatgctggttatgacccacaggaaacattagtaaaagttc1440 aggctgagca tgtcgagtcaaaacaacttgtgggcgtagatttgaatacaggtgagccaa1500 tggtagcagc agatgcaggagtttgggataattattgtgtaaaaaaacaacttcttcact1560 cttgcacagt gattgccaccaacattctcctggttgatgaaattatgcgagctgggatgt1620 cttctcaaat gatgattgaattcaaaatcaacccttctagaagatgaaatttagtacact1680 ttacatctga ctactattgtgtagcctgagccattctgaatttctacacaataaatgcag1740 tttatgtctt ttgggtcgt 1759 <210> 7 <211> 1735 <212> DNA ' <213> Homo Sapiens <400> 7 ggttaggcta tggctgcgataaaggccgtcaactccaaggctgaggtggcgcgggcccag60 gcagctttgg ctgtcaatatatgcgccgcccgagggctgcaggatgtgctgcggaccaac120 ttgggtccta aaggcaccatgaaaatgcttgcttctggtgcaggtgacatcaaactcacc180 aaagatggca atgtactgctcgatgagatgcaaattcaacatccaacagcttccttgata240 gcaaaagtag caacagctcaggatgacgtcacaggagatggtactacttcaaatgttcta300 attattggag agttattaaaacaagctgacctgtacatttctgagggcctgcaccctaga360 ataatagctg aaggatttgaagctgcaaagataaaagcacttgaagttttggaggaagtt420 aaagtgacaa aggagatgaaaagaaaaatcctcttagatgtagctagaacatcattacaa480 actaaagttc atgctgaactggctgatgtcttaacagaggttgtggtggattctgttttg540 gctgttagaa gaccaggttaccctattgatctcttcatggtagaaataatggagatgaag600 cataaattag gaacagatacaaagttgatccaaggattagttttggatcatggtgcccgt660 catccagata tgaagaagcgagtagaagatgcatttatccttatttgcaacgtttcactg720 gaatatgaaa aaacagaggtgaactctggtttcttttataagactgcagaagagaaagag780 aaattggtaa aagctgaaagaaaatttattgaagatagagtacaaaaaataatagacctg840 aaggacaaag tctgtgctcagtcaaataaaggatttgtcgtcattaatcaaaagggaatt900 gatccatttt ccttagattctcttgcaaaacatggaatagtagctcttcgcagagcaaaa960 agaagaaata tggaaagactctctcttgcttgtggtggaatggccgtgaattcttttgaa1020 gatctcactgtagattgcttgggacatgctggtcttgtgtatgagtatacattaggtgaa1080 gaaaagttcacttttattgaggagtgtgttaacccttgctctgttaccttgttggttaaa1140 ggaccaaataagcatactctcacacaagtcaaggatgccataagagatggacttcgtgct1200 atcaaaaatgccattgaagatggttgtatggttcctggagctggtgcaattgaagtggca1260 atggctgaagctcttgttacatataagaacagtataaaaggaagagctcgtcttggagtc1320 caagcttttgctgatgccttactcattattcccaaggttcttgctcagaatgctggttat1380 gacccacaggaaacattagtaaaagttcaggctgagcatgtcgagtcaaaacaacttgtg1440 ggcgtagatttgaatacaggtgagccaatggtagcagcagatgcaggagtttgggataat1500 tattgtgtaaaaaaacaacttcttcactcttgcacagtgattgccaccaacattctcctg1560 gttgatgaaattatgcgagctgggatgtcttctctcaaatgatgattgaattcaaaatca1620 acccttctag aagatgaaat ttagtacact ttacatctga ctactattgt gtagcctgag 1680 ccattctgaa tttctacaca ataaatgcag tttatgtcga aaaaaaaaaa aaaaa 1735 <210> 8 <211> 531 <212> PRT
<213> Homo sapiens <400> 8 Met Ala Ala Val Lys Thr Leu Asn Pro Lys Ala Glu Val Ala Arg Ala Gln Ala Ala Leu Ala Val Asn Ile Ser Ala Ala Arg Gly Leu Gln Asp Val Leu Arg Thr Asn Leu Gly Pro Lys Gly Thr Met Lys Met Leu Val Ser Gly Ala Gly Asp Ile Lys Leu Thr Lys Asp Gly Asn Val Leu Leu His Glu Met Gln Ile Gln His Pro Thr Ala Ser Leu Ile Ala Lys Val Ala Thr Ala Gln Asp Asp Ile Thr Gly Asp Gly Thr Thr Ser Asn Val Leu Ile Ile Gly Glu Leu Leu Lys Gln Ala Asp Leu Tyr Ile Ser Glu Gly Leu His Pro Arg Ile Ile Thr Glu Gly Phe Glu Ala Ala Lys Glu Lys Ala Leu Gln Phe Leu Glu Glu Val Lys Val Ser Arg Glu Met Asp Arg Glu Thr Leu Ile Asp Val Ala Arg Thr Ser Leu Arg Thr Lys Val His Ala Glu Leu Ala Asp Val Leu Thr Glu Ala Val Val Asp Ser Ile Leu Ala I1e Lys Lys Gln Asp Glu Pro Ile Asp Leu Phe Met Ile Glu Ile Met Glu Met Lys His Lys Ser Glu Thr Asp Thr Ser Leu Ile Arg 1~

Gly Leu Val Leu Asp His Gly Ala Arg His Pro Asp Met Lys Lys Arg Val Glu Asp Ala Tyr Ile Leu Thr Cys Asn Val Ser Leu Glu Tyr Glu Lys Thr Glu Val Asn Ser Gly Phe Phe Tyr Lys Ser Ala Glu Glu Arg Glu Lys Leu Val Lys Ala Glu Arg Lys Phe Ile Glu Asp Arg Val Lys Lys Ile Ile Glu Leu Lys Arg Lys Val Cys Gly Asp Ser Asp Lys Gly Phe Val Val Ile Asn Gln Lys Gly Ile Asp Pro Phe Ser Leu Asp Ala Leu Ser Lys Glu Gly Ile Val Ala Leu Arg Arg Ala Lys Arg Arg Asn Met Glu Arg Leu Thr Leu Ala Cys Gly Gly Val Ala Leu Asn Ser Phe Asp Asp Leu Ser Pro Asp Cys Leu Gly His Ala Gly Leu Val Tyr Glu Tyr Thr Leu Gly Glu Glu Lys Phe Thr Phe Ile Glu Lys Cys Asn Asn Pro Arg Ser Val Thr Leu Leu Ile Lys Gly Pro Asn Lys His Thr Leu Thr Gln Ile Lys Asp Ala Val Arg Asp Gly Leu Arg Ala Val Lys Asn Ala Ile Asp Asp Gly Cys Val Val Pro Gly Ala Gly Ala Val Glu Va1 Ala Met Ala Glu Ala Leu Ile Lys His Lys Pro Ser Val Lys Gly Arg Ala Gln Leu Gly Val Gln Ala Phe Ala Asp Ala Leu Leu Ile Ile Pro Lys Val Leu Ala Gln Asn Ser Gly Phe Asp Leu Gln Glu Thr Leu Val Lys Ile Gln Ala Glu His Ser Glu Ser Gly Gln Leu Val Gly Val Asp Leu Asn Thr Gly Glu Pro Met Val Ala Ala Glu Val Gly Val Trp Asp Asn Tyr Cys Val Lys Lys Gln Leu Leu His Ser Cys Thr Val Ile Ala Thr Asn Ile Leu Leu Val Asp Glu Ile Met Arg Ala Gly Met Ser Ser Leu Lys Gly <210> 9 <211> 540 <212> PRT
<213> Homo Sapiens <400> 9 Met Ala Ala Ile Lys Ala Val Asn Ser Lys Ala Glu Val Ala Arg Ala Arg Gln Leu Trp Leu Ser Ile Tyr Ala Pro Pro Arg Val Gln Asp Val Leu Arg Thr Asn Leu Gly Pro-Lys Gly-Thr Met Lys Met Leu-Val Ser Gly Ala Gly Asp Ile Lys Leu Thr Lys Asp Gly Asn Val Leu Leu Asp Glu Met Gln Ile Gln His Pro Thr Ala Ser Leu Ile Ala Lys Val Ala 65 70 . 75 80 Thr Ala Gln Asp Gly Val Thr Gly Asp Gly Thr Thr Thr Asn Val Leu Ile Ile Gly Glu Leu Leu Lys Gln Ala Asp Leu Tyr Ile Ser Glu Gly Leu His Pro Arg Ile Ile Ala Glu Gly Phe Glu Ala Ala Lys Ile Lys Ala Leu Glu Val Leu Glu Glu Val Lys Val Thr Lys Glu Met Lys Arg Lys Ile Leu Leu Asp Val Ala Arg Thr Ser Leu Gln Thr Lys Val His Ala Glu Leu Ala Asp Val Leu Thr Glu Val Val Val Asp Ser Leu Phe Pro Val Arg Arg Pro Pro Tyr Pro Ile Asp Leu Phe Met Val Glu Ile Met Glu Met Lys His Lys Leu Gly Thr Asp Thr Lys Leu Ile Gln Gly Leu Val Leu Asp His Gly Ala Arg His Pro Asp Met Lys Lys Arg Val Glu Asp Ala Phe Ile Leu Ile Cys Asn Val Ser Leu Glu Tyr Glu Lys Thr Glu Val Asn Ser Ala Phe Phe Tyr Lys Thr Ala Glu Glu Lys Glu Lys Leu Val Lys Ala Glu Arg Lys Phe Ile Glu Asp Arg Val Gln Lys Ile Ile Asp Leu Lys Asp Lys Val Cys Ala Gln Ser Asn Lys Gly Phe Val Val Ile Asn Gln Lys Gly Ile Asp Pro Phe Ser Leu Asp Ser Leu Ala Lys His Gly Ile Val Ala Leu Arg Arg Ala Lys Arg Arg Asn Met Glu Arg Leu Ser Leu Ala Cys Gly Gly Met Ala Val Asn Ser Phe Glu Asp Leu Thr Val Asp Cys Leu Gly His Ala Gly Leu Val Tyr Glu Tyr Thr Leu Gly Glu Glu Lys Phe Thr Phe Ile Glu Glu Cys Val Asn Pro Cys Ser Val Thr Leu Leu Val Lys Gly Pro Asn Lys His Thr Leu Thr Gln Val Lys Asp Ala Ile Arg Asp Gly Leu Arg Ala Ile Lys Asn Ala Ile Glu Asp Gly Cys Met Val Pro Gly Ala Gly Ala Ile Glu Val Ala Met Ala Glu Ala Leu Val Thr Tyr Lys Asn Ser Ile Lys Gly Arg Ala Arg Leu Gly Val Gln Ala Phe Ala Asp Ala Leu Leu Ile Ile Pro Lys Val Leu Ala Gln Asn Ala Gly Tyr Asp Pro Gln Glu Thr Leu Val Lys Val Gln Ala Glu His Val Glu Ser Lys Gln Leu Val Gly Val Asp Leu Asn Thr Gly Glu Pro Met Val Ala Ala Asp Ala Gly Val Trp Asp Asn Tyr Cys Val Lys Lys Gln Leu Leu His Ser Cys Thr Val Ile Ala Thr Asn Ile Leu Leu Val Asp Glu Ile Met Arg Ala Gly Met Ser Ser Gln Met'-Met file Glu Phe Lys 2le Asn Pro Ser Arg Arg --

Claims (25)

WHAT IS CLAIMED IS:

1. A method of identifying a candidate RB pathway modulating agent, said method comprising the steps of:
(a) providing an assay system comprising a CCT6 polypeptide or nucleic acid;
(b) contacting the assay system with a test agent under conditions whereby, but for the presence of the test agent, the system provides a reference activity; and (c) detecting a test agent-biased activity of the assay system, wherein a difference between the test agent-biased activity and the reference activity identifies the test agent as a candidate RB pathway modulating agent.

2. The method of claim 1 wherein the assay system comprises cultured cells that express the CCT6 polypeptide.

3. The method of claim 2 wherein the cultured cells additionally have defective RB
function.

4. The method of claim 1 wherein the assay system includes a screening assay comprising a CCT6 polypeptide, and the candidate test agent is a small molecule modulator.

5. The method of claim 4 wherein the assay is a binding assay.

6. The method of claim 1 wherein the assay system is selected from the group consisting of an apoptosis assay system, a cell proliferation assay system, an angiogenesis assay system, and a hypoxic induction assay system.

7. The method of claim 1 wherein the assay system includes a binding assay comprising a CCT6 polypeptide and the candidate test agent is an antibody.

8. The method of claim 1 wherein the assay system includes an expression assay comprising a CCT6 nucleic acid and the candidate test agent is a nucleic acid modulator.

9. The method of claim 8 wherein the nucleic acid modulator is an antisense oligomer.

10. The method of claim 8 wherein the nucleic acid modulator is a PMO.

11. The method of claim 1 additionally comprising:
(d) administering the candidate RB pathway modulating agent identified in (c) to a model system comprising cells defective in RB function and, detecting a phenotypic change in the model system that indicates that the RB function is restored.

12. The method of claim 11 wherein the model system is a mouse model with defective RB function.

13. A method for modulating a RB pathway of a cell comprising contacting a cell defective in RB function with a candidate modulator that specifically binds to a CCT6 polypeptide, whereby RB function is restored.

14. The method of claim 13 wherein the candidate modulator is administered to a vertebrate animal predetermined to have a disease or disorder resulting from a defect in RB function.

15. The method of claim 13 wherein the candidate modulator is selected from the group consisting of an antibody and a small molecule.

16. The method of claim 1, comprising the additional steps of:
(e) providing a secondary assay system comprising cultured cells or a non-human animal expressing CCT6 , (f) contacting the secondary assay system with the test agent of (b) or an agent derived therefrom under conditions whereby, but for the presence of the test agent or agent derived therefrom, the system provides a reference activity; and (g) detecting an agent-biased activity of the second assay system, wherein a difference between the agent-biased activity and the reference activity of the second assay system confirms the test agent or agent derived therefrom as a candidate RB pathway modulating agent, and wherein the second assay detects an agent-biased change in the RB pathway.

17. The method of claim 16 wherein the secondary assay system comprises cultured cells.

18. The method of claim 16 wherein the secondary assay system comprises a non-human animal.

19. The method of claim 18 wherein the non-human animal mis-expresses a RB
pathway gene.

20. A method of modulating RB pathway in a mammalian cell comprising contacting the cell with an agent that specifically binds a CCT6 polypeptide or nucleic acid.

21. The method of claim 20 wherein the agent is administered to a mammalian animal predetermined to have a pathology associated with the RB pathway.

22. The method of claim 20 wherein the agent is a small molecule modulator, a nucleic acid modulator, or an antibody.

23. A method for diagnosing a disease in a patient comprising:
(a) obtaining a biological sample from the patient;
(b) contacting the sample with a probe for CCT6 expression;
(c) comparing results from step (b) with a control;
(d) determining whether step (c) indicates a likelihood of disease.

24. The method of claim 23 wherein said disease is cancer.

25. The method according to claim 24, wherein said cancer is a cancer as shown in Table 1 as having >25% expression level.