CA2488006A1 - A human cell assay to determine effect of sample compounds on col2 enhancer expression - Google Patents
A human cell assay to determine effect of sample compounds on col2 enhancer expression Download PDFInfo
- Publication number
- CA2488006A1 CA2488006A1 CA002488006A CA2488006A CA2488006A1 CA 2488006 A1 CA2488006 A1 CA 2488006A1 CA 002488006 A CA002488006 A CA 002488006A CA 2488006 A CA2488006 A CA 2488006A CA 2488006 A1 CA2488006 A1 CA 2488006A1
- Authority
- CA
- Canada
- Prior art keywords
- sox9
- expression
- test compound
- activity
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
This invention relates to human chondrocyte activity (growth)/differentiation/production of extracellular matrix) and to the effe ct of Sox9transcription factor and Colt enhancer as a measure for such activity . It also relates to a chimeric cell and assay utilizing such cell useful in predicting the effect of sample compounds on chondrocyte activity as measure d by Sox9 and Colt expression/activity.
Description
A HUMAN CELL ASSAY TO DETERMINE EFFECT OF SAMPLE COMPOUNDS
FIELD OF THE INVENTION
This invention relates to human chondrocyte activity (growth)/differentiation/production of extracellular matrix)and to the effect of Sox9 transcription factor and Col2 enhancer as a measure for such activity. It also relates to a chimeric cell and assay utilizing such cell useful in predicting the effect of sample compounds on chondrocyte activity as measured by Sox9 and Col2 expression/activity.
BACKGOUND OF THE INVENTION
The progressive destruction of articular cartilage is common to osteoarthritis and rheumatoid arthritis. This tissue provides the lubrication and compressibility needed for joint function. Therefore, the loss of articular cartilage results in increasing pain and morbidity.
Articular cartilage is composed of a collagen and proteoglycan rich extracellular matrix and the chondrocytes that produce it. Thus, the chondrocyte is central to understanding normal cartilage function as well as the arthritic and degenerative disease affecting it. Isolated chondrocytes have little proliferative capacity and tend to de-differentiate to fibroblast-like cells when placed in cell cultures. Sources of human cells for study, particularly from non-diseased tissue, are extremely scarce for obvious ethical and practical reasons. Thus, much of our knowledge of chondrocyte biology is derived from animal studies or their cultured tissues and cells.
Genetic studies from human subjects suffering from severe skeletal abnormalities have contributed to our understanding of chondrocyte biology. Mutations leading to the loss of function/expression of a single allele of the human Sox9 gene were identified as the cause of a rare and severe skeletal malformation syndrome known as camptomelic dysplasia (Wagner T, Wirth J, Meyer J, Zabel 8, Held M, Zimmer J, Pasantes J, Bricarelli FD, Keutel J, Hustert E, .: Autosomal sex reversal and camptomelic dysplasia are caused by mutations in and around the SRY related gene SOX9. Cell 79:1111-1120, 1994; Wright E, Hargrave MR, Christiansen J, Cooper L, Kun J, Evans T, Gangadharan U, Greenfield A, Koopman P: The Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat Genet 9:15-20, 1995) Male patients present with XY sex reversal ( Wagner T, Wirth J, Meyer J, Zabel 8, Held M, ZimmerJ, Pasantes J, Bricarelli FD, Keutel J, Hustert E.: Autosomal sex reversal and camptomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9.
Cell 79:1111-1120, 1994) confirming the other major role of Sox9 in development, male sex determination.
Mice engineered to express only one allele of the Sox9 gene (Sox9 +/-), represent a near phenocopy of the human skeletal syndrome (Bi W, Huang W, Whitworth DJ, Deng JM, _2_ Zhang Z, Behringer RR, de Crombrugghe 8: Haploinsufficiency of Sox9 results in defective cartilage primordia and premature skeletal mineralization. Proc Natl Acad Sci U S A 98:6698-6703, 2001), displaying hypoplasia of all cartilage primordia and bones derived therefrom.
Furthermore, mice derived by chimerism of wild-type and Sox9 -/- ES cells (expressing B-galactosidase) showed that Sox9 expression is a obligatory for cells to be incorporated into mesenchymal condensations that give rise to cartilage structures (Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe 8: Sox9 is required for cartilage formation. Nat Genet 22:85-89, 1999).
Genetically modified mice having impaired or enhanced Sox9 expression showed XY
or XX sex reversal, respectively (Bishop CE, Whitworth DJ, Qin Y, Agoulnik AI, Agoulnik IU, Harrison WR, Behringer RR, Overbeek PA: A transgenic insertion upstream of sox9 is associated with dominant XX sex reversal in the mouse. Nat Genet 26:490-494, 2000; Vidal VP, Chaboissier MC, de Rooij DG, Schedl A: Sox9 induces testis development in XX
transgenic mice. Nat Genet 28:216-217, 2001); confirming the role of Sox9 in sex determination in mice as well as humans.
Sox9 is a member of a family of HMG-box proteins. This family of proteins is unusual in that they bind to the minor groove of DNA and usually cooperate with a protein partners) to regulate gene expression (reviewed in Kamachi Y, Uchikawa M, Kondoh H: Pairing SOX off.' with partners in the regulation of embryonic development. Trends Genet 16:182-187, 2000).
hLSox5 and Sox6 appear to play a partly overlapping role in collaborating with Sox9 to regulate the expression of chondrocyte target genes including the Col2a1 and aggrecan (Smits P, Li P, Mandel J, Zhang Z, Deng JM, Behringer RR, de Croumbrugghe B, Lefebvre V:
The transcription factors L-SoxS and Sox6 are essential for cartilage formation. Dev Cell 1:277-290, 2001; Lefebvre V, Behringer RR, de Crombrugghe 8: L-SoxS, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway.
Osteoarthritis Cartilage 9 Suppl A: S69-S75, 2001.
Sox9 also regulates the "minor cartilage collagen", Co111a2, by interactions with HMG-like sites in both the promoter (Bridgewater LC, Lefebvre V, de Crombrugghe 8:
Chondrocyte-specific enhancer elements in the Co111a2 gene resemble the Col2a1 tissue-specific enhancer. J Biol Chem 273:14998-15006, 1998) and within an intronic enhancer ( Liu Y, Li H, Tanaka K, Tsumaki N, Yamada Y: Identification of an enhancer sequence within the first intron required for cartilage-specific transcription of the alpha2(XI) collagen gene. J Biol Chem 275:12712-12718, 2000).
Sox9 appears to integrate the many signaling pathways regulating the expression of cartilage matrix proteins. This includes signals that positively regulate the cartilage phenotype, such as a FGFs, and BMP-2, as well as parathyroid hormone in prehypertrophic chondrocytes (Murakami S, Kan M, McKeehan WL, de Crombrugghe 8: Up-regulation of the chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogen-activated protein kinase pathway. Proc Natl Acad Sci U S A 97:1113-1118, 2000; Uusitalo H, Hiltunen A, Ahonen M, Gao TJ, Lefebvre V, Harley V, Kahari VM, Vuorio E: Accelerated up-regulation of L-SoxS, Sox6, and Sox9 by BMP-2 gene transfer during murine fracture healing. J Bone Miner Res 16:1837-1845, 2001 ).
Inhibition of matrix expression by cytokines and retinoic acid also involves inhibition of Sox9 (Murakami S, Lefebvre V, de Crombrugghe 8: Potent inhibition of the master chondrogenic factor Sox9 gene by interleukin-1 and tumor necrosis factor-alpha. J Biol Chem 275:3687-3692, 2000); Sekiya I, Koopman P, Tsuji K, Mertin S, Harley V, Yamada Y, Shinomiya K, Niguji A, Noda M: Transcriptional suppression of Sox9 expression in chondrocytes by retinoic acid. J Cell Biochem 81: 71-78, 2001).
Studies have shown that Sox9 activity is regulated by both the level of expression and by post-translational modification ( Huang W, Zhou X, Lefebvre V, de Crombrugghe B:
Phosphorylation of SOX9 by Cyclic AMP-Dependent Protein Kinase A Enhances SOX9's Ability To Transactivate a Col2a1 Chondrocyte-Specific Enhancer. Mol Cell Biol 20:4149-4158, 2000).
Sox9 has been termed the " Master Chondrogenic Transcription Factor" (Murakami S, Lefebvre V, de Crombrugghe 8: Potent inhibition of the master chondrogenic factor Sox9 gene by interleukin-1 and tumor necrosis factor-alpha.( J Biol Chem 275:3687-3692, 2000).
Therefore, understanding Sox9 function in cartilage development, tissue maintenance, and disease processes is important in considering strategies to halt cartilage destruction and induce repair.
The Sox 9 transcription factor has emerged as an important determinant of chondrocyte development and the regulation of type II collagen and aggrecan gene expression. The Sox9 transcription factor is known to play a role in the expression/activity of Col2 by chondrocytes.
It would be useful to construct a model that could correlate the level of Sox9 presence to the expression/activity of Col2. It would also be useful to develop a model that would permit the testing of various compounds to determine whether they have an effect on Sox9 expression/activity.
Much of our understanding is based on studies of genetically modified mice and on the functional analysis of mouse chondrocytes in vitro. The murine cell lines that have been developed in which some of the properties of chondrocyte development have been mimicked are useful but the advantages of a human cell line which can be used to determine the effect of different compounds on the expression of Col2 would be highly useful. Thus, to better characterize the potential role of Sox9 in human chondrocyte function and in disease processes, it would be desirable to identify a human cell line that conserves the Sox9 regulatory pathways identified in mouse.
It is desirable to increase the Col2 enhancer activity in chondrocytes to facilitate the regeneration of collagen. It would be useful to screen different compounds to determine their effect on Col2 expression. Unfortunately it is not possible to use chondrocytes to test the compounds because chondrocytes have little proliferative capacity in vitro and tend to differentiate into fibroblast like cells.
Thus, it is an object of this invention to provide a cell line and an assay procedure that is capable of screening compounds to determine their ability to modify Col2 enhancer activity in chondrocytes.
SUMMARY OF THE INVENTION
The present invention relates to a method of predicting the effect of a test compound on human chondrocyte activity. The method comprises the steps of transfecting human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA binding sites;
contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and determining the activity of the reporter.
The present invention also provides a chimeric cell line that is capable of mimicking the effect of various compounds on Col2 expression/activity. The cell line comprises a SW1353 cell transfected with a plasmid containing Sox9 DNA reporter binding sites.
It has been determined that the SW1353 cell line is capable of modeling chondrocyte behavior in response the regulation of Col2 expression by various compounds.
When SW1353 cells are transfected with a reporter plasmid containing Sox9 DNA
binding sites, the cells can be used as an assay to determine the effectiveness of the introduced compound in changing the level of Sox9 and indirectly the level of Col2a expression/activity, and thereby acting as a tool to a lesser or greater degree predictive of the effect of the introduced compound on chondrocyte differentiation.
Transient transfection studies demonstrate that the basal expression of a Sox9-dependent Colt enhancer reporter construct could be increased by co-expression of a Sox9 expression vector. A panel of known regulators of murine Sox9 expression/activity were tested in the enhancer assay and results were correlated with expression of the endogenous Sox9 gene using real-time PCR.
The SW1353 cell line recapitulates many of the effects of cytokines and growth factors on Col2 enhancer activity observed with primary mouse chondrocytes including stimulation by FGF-1 and FGF-2 and repression by IL-1a and TNFa. These effects have been correlated with changes in Sox9 mRNA levels. We have discovered that FGF-stimulates Sox9 expression and Col2 enhancer activity. In addition, a careful examination of the effect of IL-1/3 dose on Col2 enhancer activity shows that very low levels of cytokines actually stimulate enhancer activity while higher doses, sufficient to stimulate IL-8 expression, are inhibitory.
This discovery has relevance to the natural progression of osteoarthritic disease.
Since Chondrocytes respond to early osteoarthritic disease with attempted repair by increasing expression of Col2 and correlates with autocrine expression of IL-1, these results suggest a causal link between the two. We show that SW1353 cells can respond to a dynamic range of IL-1 levels, from Col2 stimulation at low levels to repression to induction of catabolic responses at higher levels.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1A shows the stimulation of basal expression of the 48bp Co12a1Luc enhancer reporter by co-expression of Sox9 in transiently transfected SW 1353 cells.
Figure 1 B shows western blot of SW 1353 cells transfected with the Sox9 expression plasmid.
Figure 2 shows the response of SW 1353 cells to growth factors and cytokines with activation or repression of the 48bp Col2a1 enhancer reporter.
Figure 3 shows the opposing effects of FGFs and cytokines on the expression of Sox9 in SW 1353 cells.
Figure 4 shows the dynamic range of SW1353 biological response as a function of IL-1 (3 concentration.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a method of predicting the effect of a test compound on human chondrocyte differentiation. The method comprises the steps of transfecting SW1353 human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA
binding sites; contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and determining the activity of the reporter. The present invention also provides a chimeric cell line that is capable of mimicking the effect of various compounds on Col2 expression/activity. The cell line comprises a SW1353 cell transfected with a plasmid containing Sox9 DNA reporter binding sites.
The present invention demonstrates that SW1353 cells model many of the signaling pathways identified in primary murine chondrocytes and are therefore useful in translating experimental results obtained in murine systems to human systems.
FGF-1 and FGF-2 were found to increase Sox9 mRNA levels and the corresponding activity of the Sox9-dependent 48bp Col2a1 enhancer construct. This has relevance to joint repair either by the normal response of chondrocytes in attempting the normal repair of damaged cartilage or when considering strategies for therapeutic intervention.
For example, Sox9 expression is elevated in the joints of mice attempting to repair damage induced by the expression of a mutant Type IIA collagen gene (Salminen H, Vuorio E, Saamanen AM:
Expression of Sox9 and type IIA procollagen during attempted repair of articular cartilage damage in a transgenic mouse model of osteoarthritis. Arthritis Rheum 44:947-955, 2001).
In situ analysis showed that Sox9 expression corresponds with the most proliferative and metabolically active chondrocytes present in the repair tissue of this model. The expression of endogenous FGF-2 is also correlated with the repair of joint damage, as a neutralizing antibody to FGF-2 blocks the repair of full-thickness cartilage defects in a rabbit model, while the infusion of FGF-2 leads to improved repair (Salminen H, Vuorio E, Saamanen AM: Expression of Sox9 and type IIA procollagen during attempted repair of articular cartilage damage in a transgenic mouse model of osteoarthritis.
Arthritis Rheum 44:947-955, 2001). Thus Sox9 provides a direct link between the input of prochondrogenic growth factors and the expression of chondrocytic genes needed for repair.
The present invention discloses that FGF-9 stimulates Sox9 expression and activity in a human chondrocyte-like cell line. In agreement with these findings, FGF-9 and FGF-2 were found to be the most potent of all the FGF family members in terms of stimulating the growth and matrix production of chicken chondrocyte cultures (Praul CA, Ford BC, Leach RM: Effect of fibroblast growth factors 1, 2, 4, 5, 6, 7, 8, 9, and 10 on avian chondrocyte proliferation. J
Cell Biochem 84:359-366, 2002). As mentioned previously, FGF-9 expression is associated with the growth of benign cartilage nodules in the joints of chondromatosis patients. These results demonstrate stimulation or the FGF-9/FGFR/Sox-9 signaling pathway has value in stimulating the repair of cartilage damage.
FGF-9 signals through both FGFR2c and FGFR3b (Santos-Ocampo S, Colvin JS, Chellaiah A, Ornitz DM: Expression and biological activity of mouse fibroblast growth factor-9.
J Biol Chem 271:1726-1731, 1996), and mice lacking FGFR3 have severe achondroplasia (Colvin JS, Bohne BA, Harding GIN, McEwen DG, Ornitz DM: Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat Genet 12:390-397, 1996)).
However, mice lacking FGF9 have normal cartilage-derived structures, but instead show XY sex reversal and lung hypoplasia ( Colvin JS, Green RP, Schmahl J, Capel 8, Ornitz DM: Male-to-female sex reversal in mice lacking fibroblast growth factor 9.
Cell 104:875-889, 200; Colvin JS, White AC, Pratt SJ, Ornitz DM: Lung hypoplasia and neonatal death in Fgf9-null mice identify this gene as an essential regulator of lung mesenchyme.
Development 128:2095-2106, 2001 ).
This suggests that other FGF's can compensate for the loss of FGF-9 and restore normal cartilage development, but the reciprocal is not true; other FGF
receptors are not able to functionally replace the loss of FGFR3 in the developing cartilage.
The similarities between SW1353 cells and primary murine chondrocytes includes catabolic responses induced by inflammatory cytokines that lead to the destruction of cartilage in the rheumatoid joint. Although this is itself not a novel observation in this cell line, _7_ the connection to the repression of Sox9 level/activity is. We discovered that very low levels of IL-1b stimulate expression of the 48bp Co12a1 enhancer and may offer an explanation for the paradoxical results found in osteoarthritic joints, where chondrocyte IL-1 expression correlates with increased type II collagen synthesis. Thus, the low level autocrine expression of IL-1 may actually drive a beneficial response by the chondrocytes to attempt repair in the degenerating joint. Although the repression of Col2 expression by IL-1a has been reported in an immortalized human chondrocyte cell line, the discovery of the ability of SW1353 to respond specifically to a dynamic range of IL-1 levels is novel and particularly useful for a human chondrocyte cell model.
The functional response of the SW 1353 cells suggest they may be more representative of chondrocytes making up hyaline cartilages than those chondrocytes comprising developing or repairing bone. Postnatal functions of Sox9 include the maintenance of prehypertrophic chondrocytes in the growing bone. Such studies have shown that Sox9 activity is controlled both at the level of expression and by posttranslational modifications. In the prehypertrophic chondrocyte, Sox9 activity is stimulated by protein kinase A (PKA) in response to treatment with PTHrP ( Huang IN, Chung UI, Kronenberg HM, de Crombrugghe 8: The chondrogenic transcription factor Sox9 is a target of signaling by the parathyroid hormone-related peptide in the growth plate of endochondral bones.
Proc Natl Acad Sci U S A 98:160-165, 2001; Huang LN, Zhou X, Lefebvre V, de Crombrugghe 8:
Phosphorylation of SOX9 by Cyclic AMP-Dependent Protein Kinase A Enhances SOX9's Ability To Transactivate a Col2a 1 Chondrocyte-Specific Enhancer. Mol Cell Biol 20:4149-4158, 200014).
Although we have not seen an effect of PTHrP on Sox9 activity in SW 1353 cells transfected with the 48bp Co12a1 enhancer, they do respond to cAMP analogs with about a 2 fold increase in enhancer expression (LB and JS, unpublished observations).
SW1353 cells also appear unresponsive to TGFa, BMPs-2, -4, and -6 (data not shown), and is consistent with their phenotype being more cartilage-like and less bone-like. Therefore, SW1353 cells are considered to be a useful model for studying the Sox9 signaling pathways, especially those most relevant to cartilage.
FGFIFGF receptor signaling has a profound effect on the growth and differentiation of chondrocytes in vitro. However, determining the physiologically relevant interactions is made enormously complex since there are four FGF receptors and 22 ligands in this family. In murine chondrocytes and immortal chondrocyte model cell-lines (ATDCS and C3H10T1/2), the 48bp Luc reporter is induced by pro-chondrogenic factors including FGF-1 and FGF-2, but not by FGF-7 which signals exclusively through the epithelial-cell restricted FGFRIIIb receptor (Murakami S, Kan M, McKeehan INL, de Crombrugghe 8: Up-regulation of the chondrogenic _g_ Sox9 gene by fibroblast growth factors is mediated by the mitogen-activated protein kinase pathway. Proc Natl Acad Sci U S A 97:1113-1118, 2000).
This reporter plasmid includes five tandem repeats of the 48bp Co12a1 enhancer and encompasses the minimal sequence, including Sox 9 binding sites, sufficient to direct chondrocyte specific expression in vivo (Zhou G, Lefebvre V, Zhang Z, Eberspaecher H, de Crombrugghe B: Three high mobility group-like sequences within a 48-base pair enhancer of the Co12a1 gene are required for cartilage-specific expression in vivo. J Biol Chem 273:14989-14997, 1998).
While additional proteins bind to this enhancer fragment, including LSox5 and Sox6 and assist to drive chondrocyte specific expression (Lefebvre V, Behringer RR, de Crombrugghe B: L-SoxS, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway. Osteoarthritis Cartilage 9 Suppl A:S69-S75, 2001), Sox9 binding is necessary for full activity (Zhou G, et al. J Biol Chem 273:14989-14997, 1998).
FGF-9 is potent chondrogenic factor and signals through FGFR3b and FGFR2c.
Mutations that result in a constitutively active FGFR3 cause skeletal malformations including achondroplasia, hypochondroplasia and thanatorphoric dysplasia and disturb the balance between chondrocyte growth and differentiation (Weksler NB, Lunstrum GP, Reid ES, Horton WA: Differential effects of hbroblast growth factor (FGF) 9 and FGF2 on proliferation, differentiation and terminal differentiation of chondrocytic cells in vitro.
Biochem J 342 Pt 3:677-682, 1999).
Furthermore, FGF-9 over-expression was implicated in a rare disease, chondromatosis, characterized by cartilaginous nodule formation of the synovium. These studies suggest a central role for FGF-9 in controlling the differentiation of stem cells into chondrocytes.
Previous studies showed that Col2 enhancer activity correlates with Sox9 expression.
For instance, FGF-2 stimulates and cytokines repress the expression of Sox9 mRNA and protein in primary mouse chondrocytes results that point to Sox9 as being a key intermediate for in regulating expression of Col2 and aggrecan expression.
EXPERMENTAL
1. Sox9 expression construct To generate the human Sox-9 mammalian expression construct, mRNA from cultures of immortalized human chondrocyte-like cells T/C-28a4 was purified by RNeasy kit (Qiagen).
The entire 1.5 Kb coding region (GenBank database, accession No. 246629) was obtained by reverse transcription (Clontech Advantage RT Kit) followed by PCR reaction (Roche Expand High Fidelity PCR Kit) using primers: sense 5'-CGGGATCCGCCACCATGAATCTCCTGGACCCCTTCATG-3' and antisense 5'-_g_ CGGAATTCCTCAAGGTCGAGTGAGCTGT-3'. The PCR product was subcloned into pcDNA3.1(+) (Invitrogen) and sequence verified.
FIELD OF THE INVENTION
This invention relates to human chondrocyte activity (growth)/differentiation/production of extracellular matrix)and to the effect of Sox9 transcription factor and Col2 enhancer as a measure for such activity. It also relates to a chimeric cell and assay utilizing such cell useful in predicting the effect of sample compounds on chondrocyte activity as measured by Sox9 and Col2 expression/activity.
BACKGOUND OF THE INVENTION
The progressive destruction of articular cartilage is common to osteoarthritis and rheumatoid arthritis. This tissue provides the lubrication and compressibility needed for joint function. Therefore, the loss of articular cartilage results in increasing pain and morbidity.
Articular cartilage is composed of a collagen and proteoglycan rich extracellular matrix and the chondrocytes that produce it. Thus, the chondrocyte is central to understanding normal cartilage function as well as the arthritic and degenerative disease affecting it. Isolated chondrocytes have little proliferative capacity and tend to de-differentiate to fibroblast-like cells when placed in cell cultures. Sources of human cells for study, particularly from non-diseased tissue, are extremely scarce for obvious ethical and practical reasons. Thus, much of our knowledge of chondrocyte biology is derived from animal studies or their cultured tissues and cells.
Genetic studies from human subjects suffering from severe skeletal abnormalities have contributed to our understanding of chondrocyte biology. Mutations leading to the loss of function/expression of a single allele of the human Sox9 gene were identified as the cause of a rare and severe skeletal malformation syndrome known as camptomelic dysplasia (Wagner T, Wirth J, Meyer J, Zabel 8, Held M, Zimmer J, Pasantes J, Bricarelli FD, Keutel J, Hustert E, .: Autosomal sex reversal and camptomelic dysplasia are caused by mutations in and around the SRY related gene SOX9. Cell 79:1111-1120, 1994; Wright E, Hargrave MR, Christiansen J, Cooper L, Kun J, Evans T, Gangadharan U, Greenfield A, Koopman P: The Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat Genet 9:15-20, 1995) Male patients present with XY sex reversal ( Wagner T, Wirth J, Meyer J, Zabel 8, Held M, ZimmerJ, Pasantes J, Bricarelli FD, Keutel J, Hustert E.: Autosomal sex reversal and camptomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9.
Cell 79:1111-1120, 1994) confirming the other major role of Sox9 in development, male sex determination.
Mice engineered to express only one allele of the Sox9 gene (Sox9 +/-), represent a near phenocopy of the human skeletal syndrome (Bi W, Huang W, Whitworth DJ, Deng JM, _2_ Zhang Z, Behringer RR, de Crombrugghe 8: Haploinsufficiency of Sox9 results in defective cartilage primordia and premature skeletal mineralization. Proc Natl Acad Sci U S A 98:6698-6703, 2001), displaying hypoplasia of all cartilage primordia and bones derived therefrom.
Furthermore, mice derived by chimerism of wild-type and Sox9 -/- ES cells (expressing B-galactosidase) showed that Sox9 expression is a obligatory for cells to be incorporated into mesenchymal condensations that give rise to cartilage structures (Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe 8: Sox9 is required for cartilage formation. Nat Genet 22:85-89, 1999).
Genetically modified mice having impaired or enhanced Sox9 expression showed XY
or XX sex reversal, respectively (Bishop CE, Whitworth DJ, Qin Y, Agoulnik AI, Agoulnik IU, Harrison WR, Behringer RR, Overbeek PA: A transgenic insertion upstream of sox9 is associated with dominant XX sex reversal in the mouse. Nat Genet 26:490-494, 2000; Vidal VP, Chaboissier MC, de Rooij DG, Schedl A: Sox9 induces testis development in XX
transgenic mice. Nat Genet 28:216-217, 2001); confirming the role of Sox9 in sex determination in mice as well as humans.
Sox9 is a member of a family of HMG-box proteins. This family of proteins is unusual in that they bind to the minor groove of DNA and usually cooperate with a protein partners) to regulate gene expression (reviewed in Kamachi Y, Uchikawa M, Kondoh H: Pairing SOX off.' with partners in the regulation of embryonic development. Trends Genet 16:182-187, 2000).
hLSox5 and Sox6 appear to play a partly overlapping role in collaborating with Sox9 to regulate the expression of chondrocyte target genes including the Col2a1 and aggrecan (Smits P, Li P, Mandel J, Zhang Z, Deng JM, Behringer RR, de Croumbrugghe B, Lefebvre V:
The transcription factors L-SoxS and Sox6 are essential for cartilage formation. Dev Cell 1:277-290, 2001; Lefebvre V, Behringer RR, de Crombrugghe 8: L-SoxS, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway.
Osteoarthritis Cartilage 9 Suppl A: S69-S75, 2001.
Sox9 also regulates the "minor cartilage collagen", Co111a2, by interactions with HMG-like sites in both the promoter (Bridgewater LC, Lefebvre V, de Crombrugghe 8:
Chondrocyte-specific enhancer elements in the Co111a2 gene resemble the Col2a1 tissue-specific enhancer. J Biol Chem 273:14998-15006, 1998) and within an intronic enhancer ( Liu Y, Li H, Tanaka K, Tsumaki N, Yamada Y: Identification of an enhancer sequence within the first intron required for cartilage-specific transcription of the alpha2(XI) collagen gene. J Biol Chem 275:12712-12718, 2000).
Sox9 appears to integrate the many signaling pathways regulating the expression of cartilage matrix proteins. This includes signals that positively regulate the cartilage phenotype, such as a FGFs, and BMP-2, as well as parathyroid hormone in prehypertrophic chondrocytes (Murakami S, Kan M, McKeehan WL, de Crombrugghe 8: Up-regulation of the chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogen-activated protein kinase pathway. Proc Natl Acad Sci U S A 97:1113-1118, 2000; Uusitalo H, Hiltunen A, Ahonen M, Gao TJ, Lefebvre V, Harley V, Kahari VM, Vuorio E: Accelerated up-regulation of L-SoxS, Sox6, and Sox9 by BMP-2 gene transfer during murine fracture healing. J Bone Miner Res 16:1837-1845, 2001 ).
Inhibition of matrix expression by cytokines and retinoic acid also involves inhibition of Sox9 (Murakami S, Lefebvre V, de Crombrugghe 8: Potent inhibition of the master chondrogenic factor Sox9 gene by interleukin-1 and tumor necrosis factor-alpha. J Biol Chem 275:3687-3692, 2000); Sekiya I, Koopman P, Tsuji K, Mertin S, Harley V, Yamada Y, Shinomiya K, Niguji A, Noda M: Transcriptional suppression of Sox9 expression in chondrocytes by retinoic acid. J Cell Biochem 81: 71-78, 2001).
Studies have shown that Sox9 activity is regulated by both the level of expression and by post-translational modification ( Huang W, Zhou X, Lefebvre V, de Crombrugghe B:
Phosphorylation of SOX9 by Cyclic AMP-Dependent Protein Kinase A Enhances SOX9's Ability To Transactivate a Col2a1 Chondrocyte-Specific Enhancer. Mol Cell Biol 20:4149-4158, 2000).
Sox9 has been termed the " Master Chondrogenic Transcription Factor" (Murakami S, Lefebvre V, de Crombrugghe 8: Potent inhibition of the master chondrogenic factor Sox9 gene by interleukin-1 and tumor necrosis factor-alpha.( J Biol Chem 275:3687-3692, 2000).
Therefore, understanding Sox9 function in cartilage development, tissue maintenance, and disease processes is important in considering strategies to halt cartilage destruction and induce repair.
The Sox 9 transcription factor has emerged as an important determinant of chondrocyte development and the regulation of type II collagen and aggrecan gene expression. The Sox9 transcription factor is known to play a role in the expression/activity of Col2 by chondrocytes.
It would be useful to construct a model that could correlate the level of Sox9 presence to the expression/activity of Col2. It would also be useful to develop a model that would permit the testing of various compounds to determine whether they have an effect on Sox9 expression/activity.
Much of our understanding is based on studies of genetically modified mice and on the functional analysis of mouse chondrocytes in vitro. The murine cell lines that have been developed in which some of the properties of chondrocyte development have been mimicked are useful but the advantages of a human cell line which can be used to determine the effect of different compounds on the expression of Col2 would be highly useful. Thus, to better characterize the potential role of Sox9 in human chondrocyte function and in disease processes, it would be desirable to identify a human cell line that conserves the Sox9 regulatory pathways identified in mouse.
It is desirable to increase the Col2 enhancer activity in chondrocytes to facilitate the regeneration of collagen. It would be useful to screen different compounds to determine their effect on Col2 expression. Unfortunately it is not possible to use chondrocytes to test the compounds because chondrocytes have little proliferative capacity in vitro and tend to differentiate into fibroblast like cells.
Thus, it is an object of this invention to provide a cell line and an assay procedure that is capable of screening compounds to determine their ability to modify Col2 enhancer activity in chondrocytes.
SUMMARY OF THE INVENTION
The present invention relates to a method of predicting the effect of a test compound on human chondrocyte activity. The method comprises the steps of transfecting human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA binding sites;
contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and determining the activity of the reporter.
The present invention also provides a chimeric cell line that is capable of mimicking the effect of various compounds on Col2 expression/activity. The cell line comprises a SW1353 cell transfected with a plasmid containing Sox9 DNA reporter binding sites.
It has been determined that the SW1353 cell line is capable of modeling chondrocyte behavior in response the regulation of Col2 expression by various compounds.
When SW1353 cells are transfected with a reporter plasmid containing Sox9 DNA
binding sites, the cells can be used as an assay to determine the effectiveness of the introduced compound in changing the level of Sox9 and indirectly the level of Col2a expression/activity, and thereby acting as a tool to a lesser or greater degree predictive of the effect of the introduced compound on chondrocyte differentiation.
Transient transfection studies demonstrate that the basal expression of a Sox9-dependent Colt enhancer reporter construct could be increased by co-expression of a Sox9 expression vector. A panel of known regulators of murine Sox9 expression/activity were tested in the enhancer assay and results were correlated with expression of the endogenous Sox9 gene using real-time PCR.
The SW1353 cell line recapitulates many of the effects of cytokines and growth factors on Col2 enhancer activity observed with primary mouse chondrocytes including stimulation by FGF-1 and FGF-2 and repression by IL-1a and TNFa. These effects have been correlated with changes in Sox9 mRNA levels. We have discovered that FGF-stimulates Sox9 expression and Col2 enhancer activity. In addition, a careful examination of the effect of IL-1/3 dose on Col2 enhancer activity shows that very low levels of cytokines actually stimulate enhancer activity while higher doses, sufficient to stimulate IL-8 expression, are inhibitory.
This discovery has relevance to the natural progression of osteoarthritic disease.
Since Chondrocytes respond to early osteoarthritic disease with attempted repair by increasing expression of Col2 and correlates with autocrine expression of IL-1, these results suggest a causal link between the two. We show that SW1353 cells can respond to a dynamic range of IL-1 levels, from Col2 stimulation at low levels to repression to induction of catabolic responses at higher levels.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1A shows the stimulation of basal expression of the 48bp Co12a1Luc enhancer reporter by co-expression of Sox9 in transiently transfected SW 1353 cells.
Figure 1 B shows western blot of SW 1353 cells transfected with the Sox9 expression plasmid.
Figure 2 shows the response of SW 1353 cells to growth factors and cytokines with activation or repression of the 48bp Col2a1 enhancer reporter.
Figure 3 shows the opposing effects of FGFs and cytokines on the expression of Sox9 in SW 1353 cells.
Figure 4 shows the dynamic range of SW1353 biological response as a function of IL-1 (3 concentration.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a method of predicting the effect of a test compound on human chondrocyte differentiation. The method comprises the steps of transfecting SW1353 human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA
binding sites; contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and determining the activity of the reporter. The present invention also provides a chimeric cell line that is capable of mimicking the effect of various compounds on Col2 expression/activity. The cell line comprises a SW1353 cell transfected with a plasmid containing Sox9 DNA reporter binding sites.
The present invention demonstrates that SW1353 cells model many of the signaling pathways identified in primary murine chondrocytes and are therefore useful in translating experimental results obtained in murine systems to human systems.
FGF-1 and FGF-2 were found to increase Sox9 mRNA levels and the corresponding activity of the Sox9-dependent 48bp Col2a1 enhancer construct. This has relevance to joint repair either by the normal response of chondrocytes in attempting the normal repair of damaged cartilage or when considering strategies for therapeutic intervention.
For example, Sox9 expression is elevated in the joints of mice attempting to repair damage induced by the expression of a mutant Type IIA collagen gene (Salminen H, Vuorio E, Saamanen AM:
Expression of Sox9 and type IIA procollagen during attempted repair of articular cartilage damage in a transgenic mouse model of osteoarthritis. Arthritis Rheum 44:947-955, 2001).
In situ analysis showed that Sox9 expression corresponds with the most proliferative and metabolically active chondrocytes present in the repair tissue of this model. The expression of endogenous FGF-2 is also correlated with the repair of joint damage, as a neutralizing antibody to FGF-2 blocks the repair of full-thickness cartilage defects in a rabbit model, while the infusion of FGF-2 leads to improved repair (Salminen H, Vuorio E, Saamanen AM: Expression of Sox9 and type IIA procollagen during attempted repair of articular cartilage damage in a transgenic mouse model of osteoarthritis.
Arthritis Rheum 44:947-955, 2001). Thus Sox9 provides a direct link between the input of prochondrogenic growth factors and the expression of chondrocytic genes needed for repair.
The present invention discloses that FGF-9 stimulates Sox9 expression and activity in a human chondrocyte-like cell line. In agreement with these findings, FGF-9 and FGF-2 were found to be the most potent of all the FGF family members in terms of stimulating the growth and matrix production of chicken chondrocyte cultures (Praul CA, Ford BC, Leach RM: Effect of fibroblast growth factors 1, 2, 4, 5, 6, 7, 8, 9, and 10 on avian chondrocyte proliferation. J
Cell Biochem 84:359-366, 2002). As mentioned previously, FGF-9 expression is associated with the growth of benign cartilage nodules in the joints of chondromatosis patients. These results demonstrate stimulation or the FGF-9/FGFR/Sox-9 signaling pathway has value in stimulating the repair of cartilage damage.
FGF-9 signals through both FGFR2c and FGFR3b (Santos-Ocampo S, Colvin JS, Chellaiah A, Ornitz DM: Expression and biological activity of mouse fibroblast growth factor-9.
J Biol Chem 271:1726-1731, 1996), and mice lacking FGFR3 have severe achondroplasia (Colvin JS, Bohne BA, Harding GIN, McEwen DG, Ornitz DM: Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat Genet 12:390-397, 1996)).
However, mice lacking FGF9 have normal cartilage-derived structures, but instead show XY sex reversal and lung hypoplasia ( Colvin JS, Green RP, Schmahl J, Capel 8, Ornitz DM: Male-to-female sex reversal in mice lacking fibroblast growth factor 9.
Cell 104:875-889, 200; Colvin JS, White AC, Pratt SJ, Ornitz DM: Lung hypoplasia and neonatal death in Fgf9-null mice identify this gene as an essential regulator of lung mesenchyme.
Development 128:2095-2106, 2001 ).
This suggests that other FGF's can compensate for the loss of FGF-9 and restore normal cartilage development, but the reciprocal is not true; other FGF
receptors are not able to functionally replace the loss of FGFR3 in the developing cartilage.
The similarities between SW1353 cells and primary murine chondrocytes includes catabolic responses induced by inflammatory cytokines that lead to the destruction of cartilage in the rheumatoid joint. Although this is itself not a novel observation in this cell line, _7_ the connection to the repression of Sox9 level/activity is. We discovered that very low levels of IL-1b stimulate expression of the 48bp Co12a1 enhancer and may offer an explanation for the paradoxical results found in osteoarthritic joints, where chondrocyte IL-1 expression correlates with increased type II collagen synthesis. Thus, the low level autocrine expression of IL-1 may actually drive a beneficial response by the chondrocytes to attempt repair in the degenerating joint. Although the repression of Col2 expression by IL-1a has been reported in an immortalized human chondrocyte cell line, the discovery of the ability of SW1353 to respond specifically to a dynamic range of IL-1 levels is novel and particularly useful for a human chondrocyte cell model.
The functional response of the SW 1353 cells suggest they may be more representative of chondrocytes making up hyaline cartilages than those chondrocytes comprising developing or repairing bone. Postnatal functions of Sox9 include the maintenance of prehypertrophic chondrocytes in the growing bone. Such studies have shown that Sox9 activity is controlled both at the level of expression and by posttranslational modifications. In the prehypertrophic chondrocyte, Sox9 activity is stimulated by protein kinase A (PKA) in response to treatment with PTHrP ( Huang IN, Chung UI, Kronenberg HM, de Crombrugghe 8: The chondrogenic transcription factor Sox9 is a target of signaling by the parathyroid hormone-related peptide in the growth plate of endochondral bones.
Proc Natl Acad Sci U S A 98:160-165, 2001; Huang LN, Zhou X, Lefebvre V, de Crombrugghe 8:
Phosphorylation of SOX9 by Cyclic AMP-Dependent Protein Kinase A Enhances SOX9's Ability To Transactivate a Col2a 1 Chondrocyte-Specific Enhancer. Mol Cell Biol 20:4149-4158, 200014).
Although we have not seen an effect of PTHrP on Sox9 activity in SW 1353 cells transfected with the 48bp Co12a1 enhancer, they do respond to cAMP analogs with about a 2 fold increase in enhancer expression (LB and JS, unpublished observations).
SW1353 cells also appear unresponsive to TGFa, BMPs-2, -4, and -6 (data not shown), and is consistent with their phenotype being more cartilage-like and less bone-like. Therefore, SW1353 cells are considered to be a useful model for studying the Sox9 signaling pathways, especially those most relevant to cartilage.
FGFIFGF receptor signaling has a profound effect on the growth and differentiation of chondrocytes in vitro. However, determining the physiologically relevant interactions is made enormously complex since there are four FGF receptors and 22 ligands in this family. In murine chondrocytes and immortal chondrocyte model cell-lines (ATDCS and C3H10T1/2), the 48bp Luc reporter is induced by pro-chondrogenic factors including FGF-1 and FGF-2, but not by FGF-7 which signals exclusively through the epithelial-cell restricted FGFRIIIb receptor (Murakami S, Kan M, McKeehan INL, de Crombrugghe 8: Up-regulation of the chondrogenic _g_ Sox9 gene by fibroblast growth factors is mediated by the mitogen-activated protein kinase pathway. Proc Natl Acad Sci U S A 97:1113-1118, 2000).
This reporter plasmid includes five tandem repeats of the 48bp Co12a1 enhancer and encompasses the minimal sequence, including Sox 9 binding sites, sufficient to direct chondrocyte specific expression in vivo (Zhou G, Lefebvre V, Zhang Z, Eberspaecher H, de Crombrugghe B: Three high mobility group-like sequences within a 48-base pair enhancer of the Co12a1 gene are required for cartilage-specific expression in vivo. J Biol Chem 273:14989-14997, 1998).
While additional proteins bind to this enhancer fragment, including LSox5 and Sox6 and assist to drive chondrocyte specific expression (Lefebvre V, Behringer RR, de Crombrugghe B: L-SoxS, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway. Osteoarthritis Cartilage 9 Suppl A:S69-S75, 2001), Sox9 binding is necessary for full activity (Zhou G, et al. J Biol Chem 273:14989-14997, 1998).
FGF-9 is potent chondrogenic factor and signals through FGFR3b and FGFR2c.
Mutations that result in a constitutively active FGFR3 cause skeletal malformations including achondroplasia, hypochondroplasia and thanatorphoric dysplasia and disturb the balance between chondrocyte growth and differentiation (Weksler NB, Lunstrum GP, Reid ES, Horton WA: Differential effects of hbroblast growth factor (FGF) 9 and FGF2 on proliferation, differentiation and terminal differentiation of chondrocytic cells in vitro.
Biochem J 342 Pt 3:677-682, 1999).
Furthermore, FGF-9 over-expression was implicated in a rare disease, chondromatosis, characterized by cartilaginous nodule formation of the synovium. These studies suggest a central role for FGF-9 in controlling the differentiation of stem cells into chondrocytes.
Previous studies showed that Col2 enhancer activity correlates with Sox9 expression.
For instance, FGF-2 stimulates and cytokines repress the expression of Sox9 mRNA and protein in primary mouse chondrocytes results that point to Sox9 as being a key intermediate for in regulating expression of Col2 and aggrecan expression.
EXPERMENTAL
1. Sox9 expression construct To generate the human Sox-9 mammalian expression construct, mRNA from cultures of immortalized human chondrocyte-like cells T/C-28a4 was purified by RNeasy kit (Qiagen).
The entire 1.5 Kb coding region (GenBank database, accession No. 246629) was obtained by reverse transcription (Clontech Advantage RT Kit) followed by PCR reaction (Roche Expand High Fidelity PCR Kit) using primers: sense 5'-CGGGATCCGCCACCATGAATCTCCTGGACCCCTTCATG-3' and antisense 5'-_g_ CGGAATTCCTCAAGGTCGAGTGAGCTGT-3'. The PCR product was subcloned into pcDNA3.1(+) (Invitrogen) and sequence verified.
2. Cell culture Reagents were obtained from Invitrogen unless otherwise noted. SW1353 human chondrosarcoma cells (ATCC #HTB-94) were grown in DMEM 10% FBS 10 ug/ml Gentamicin and passaged (2 times a week) using with 0.25% Trypsin-EDTA.
3. Transfection experiments Cells were plated at -106 cells per flask into a T-75 in 10 ml growth media or an equivalent based on culture vessel surface area, 24 hours prior to transfection. For each transfection, 24 ul of Transit (PanVera) was diluted into 250 ul OptiMEM and 12 ug of reporter plasmid Col2a1 enhancer construct (48bp Col2a1, was added. After 15-30 minute incubation, growth media was removed from the cells, and the DNA-transfection reagent complexes diluted to a final volume of 10 ml with OptiMEM and added to the cells.
Transfection media was replaced with fresh media after 7 hours. 24 hours post transfection the cells were treated with media alone or indicated factors. Cells were harvested 48 hours post-transfection and luciferase activity measured using the LucLite and the TopCount LSC plate reader (Packard).
Transfection media was replaced with fresh media after 7 hours. 24 hours post transfection the cells were treated with media alone or indicated factors. Cells were harvested 48 hours post-transfection and luciferase activity measured using the LucLite and the TopCount LSC plate reader (Packard).
4. lNestern blotting Cell lysates were prepared from monolayer cultures in 24 well dishes by the addition of Tris Glycine sample buffer (Invitrogen). Equivalent volumes of lysate were loaded on a 4 20% polyacrylamide gradient gel(Invitrogen) and electrophoresed. Gels were transferred to nitrocellulose (Invitrogen) using a semi-dry apparatus (BioRad). Western blocking reagent (Roche) was used to block the membrane. Sox9 antibody was used at 1:1000 in 50%
Western blocking reagent 50% TBS-T ~ The secondary antibody was rabbit anti-mouse IgG
conjugated to HRP (Pierce). ECL reagents from Pierce were used to develop the blots.
Chemiluminescence was imaged with a Lumi-Imager (Roche).
Western blocking reagent 50% TBS-T ~ The secondary antibody was rabbit anti-mouse IgG
conjugated to HRP (Pierce). ECL reagents from Pierce were used to develop the blots.
Chemiluminescence was imaged with a Lumi-Imager (Roche).
5. Taxman RNA Analysis RNA was prepared from 75 cm dishes using RNeasy Kits with DNAse treatment (Qiagen) according to the manufacturer's protocol except a second application of DNase was used. cDNA was prepared from 10-20u1 of RNA (1-4 ug) using random hexamer primers and PE Biosystems Reverse Transcription reagents. Taqman reactions used 8 ul cDNA
and 2x PE Universal PCR Master Mix (PE Biosystems), 900 nM PCR primers and 200nM FAM-TAMRA probe. Reactions (50 ul) were cycled and quantified using the PE 5700 with standard conditions for 45 cycles. The data was analyzed using GeneAmp5700 software Mix (PE
Biosystems), adjusting the threshold to linear range for all samples. The OCt is calculated by subtracting normalizer (GAPDH) from corresponding gene-specific values. The 04Ct is calculated by subtracting treated 4Ct from control ~Ct. Fold induction is determined by calculating 2°°~' Data is reported as % increase over control sample.
and 2x PE Universal PCR Master Mix (PE Biosystems), 900 nM PCR primers and 200nM FAM-TAMRA probe. Reactions (50 ul) were cycled and quantified using the PE 5700 with standard conditions for 45 cycles. The data was analyzed using GeneAmp5700 software Mix (PE
Biosystems), adjusting the threshold to linear range for all samples. The OCt is calculated by subtracting normalizer (GAPDH) from corresponding gene-specific values. The 04Ct is calculated by subtracting treated 4Ct from control ~Ct. Fold induction is determined by calculating 2°°~' Data is reported as % increase over control sample.
6. Tagman Primers and Probes CACACAGCTCACTCGACCTTG
Sox 9 (+1868) forward primer TTCGGTTATTTTTAGGATCATCTCG
Sox 9 (-1943) reverse primer , FRET probe: FAM-CCCACGAAGGGCGACGATGG-TAMRA
Results 1. Col2 enhancer activity is responsive to increasing levels of Sox9 We analyzed the activity of the 48bp Col2a1 enhancer construct (48bp Col2a1) in transfected SW1353 cells. SW1353 cells were transfected with a constant amount of reporter (0.25 ug), with or without increasing amounts of the Sox9 expression construct or empty vector.
Basal luciferase activity was detected with the 48bp Col2a1 reporter alone (Fig. 1A ), as an enhancerless control construct, containing the same Col2 derived minimal promoter (p89). It was essentially inactive (<5% activity), demonstrating that SW 1353 cells likely normally express transcription factors that stimulate enhancer activity.
To determine the effect of the Sox9 expression plasmid, co-transfection with increasing amounts of the Sox9 expression plasmid (20:1, 10:1, 2:1 and 1:1 ) was undertaken.
The results demonstrate that enhancer activity was increased in a dose dependent manner and that Sox9 levels were limiting. Including large amounts of the Sox9 expression plasmid (1:1 ) resulted in a slight reduction of reporter activity.
Sox9 expression was confirmed by preparing Western blots from cell extracts prepared from duplicate transfections (Fig 1 B). At the highest DNA
concentration (0.25ug), an immunoreactive band appeared, migrating with the 66 kD marker, in good agreement with 68 kD size predicted for Sox9 (lane 5). Protein of the same size was observed in transfections having 2 and 10 fold less expression plasmid (lanes 4 and 3). On longer exposures, anti-Sox9 immunoreactive proteins were detected faintly with the 20:1 transfection and for those cells receiving no Sox9 expression plasmid.
2. SW1353 cells are responsive to pro-chondroqenic Fibroblast Growth Factors.
We analyzed the responsiveness of SW 1353 cells to these fibroblast growth factors using the 48bp Col2a1 enhancer transfection assay. Addition of FGF-1 (200 ng/ml), FGF-2 (5.9 ng/ml) to the cultures increased expression of the 48bp enhancer between 3 and 4 fold, whereas FGF-7 (200ng/ml) expression had no effect (Fig 2). These results demonstrate the conservation of FGF-1 and FGF-2 signaling pathways in SW1353 cells.
To examine the effect of FGF-9 on enhancer activity, FGF-9 was added to cultures of SW1353 cells that had been transfected with the Col2 reporter. FGF-9 (200 ng/ml) stimulated enhancer expression up to 4 fold (Fig 2). This result suggests that the SW
1353 cells express functional FGFR3b and/or FGFR2c receptors and further validates their utility in studying chondrocyte biology.
3. Pro-inflammatory cytokines repress Col2 enhancer activity in SW1353 The ability of IL-1,8 and TNFa to repress Col2 enhancer activity in primary murine chondrocytes is NFkB dependent and coincides with reduced Sox9 expression.
SW1353 cells were transfected with the 48bp Col2a1 reporter and then treated with vehicle, TNFa (10 ng/ml) or IL-1/3 (10 ng/ml) (Fig. 2A). The results demonstrate that SW1353 cells express functional TNF and IL-1 receptors by showing these agents can stimulate the expression of IL-8 (shown) and matrix metalloproteases (not shown).
Enhancer driven luciferase expression was reduced approximately 60% by TNFa and 50% by IL-1,8 treatment. The cytokine mediated inhibition of enhancer expression could be partially relieved by co-treating the cells with either FGF-1, FGF-2 or FGF-9 (Fig 2B). These results are consistent with the potential for pro-chondrogenic growth factors to diminish or reverse the cartilage damage in animal or human joint inflammation.
4. Col2 enhancer activity correlates with relative Sox9 mRNA expression in The effect of chondrocyte growth factors as well as inhibitory cytokines on the expression of Sox9 RNA in SW1353 cells using real time quantitative PCR
(TaqMan, PE
Applied Biosystems) was determined. Cells were cultured and treated with growth factors or cytokines as described above. After 48 hours cells were harvested and RNA
prepared. A
custom Sox9 primer probe set was validated by an efficiency plot over several logs and relative Sox 9 expression was quantified relative to GAPDH.
The expression of Sox9 mRNA increased approximately 1.5 fold by FGF-2 and 2-fold by FGF1 and FGF-9, while TNFa and IL-1~ decreased Sox9 expression by 45% and 60%, respectively (Fig. 3). These data are consistent with Col2 enhancer expression in SW1353 being regulated, at least in part, at the level of Sox9 expression.
5. Expression of the Col2 Enhancer Reporter is stimulated by the presence of low levels of IL-1,8 An increase in type II collagen (Col2) expression has been observed in both man and dogs during the course of osteoarthritic disease (8urfon-Wurster N, Hui-Chou CS, Greisen HA, Lust G: Reduced deposition of collagen in the degenerated articular cartilage of dogs with degenerative joint disease. Biochim Biophys Acta 718:74-84, 1982; Uusitalo H, Hiltunen A, Ahonen M, Gao TJ, Lefebvre V, Harley V, Kahari VM, Vuorio E: Accelerated up-regulation of L-SoxS, Sox6, and Sox9 by BMP-2 gene transfer during murine fracture healing.
J Bone Miner Res 16:1837-1845, 2001 ).
Col2 expression appears to be greatest in early to moderate disease and this appears to reflect a response by the chondrocytes to attempt repair of the degenerating cartilage. Coincidentally, chondrocytes from OA patients with early to moderate disease also express increased levels of IL- ~3 and IL-1/3 and these also decline with disease progression (Towle CA, Hung HH, Bonassar LJ, Treadwell BV, Mangham DC: Detection of interleukin-1 in the cartilage of patients with osteoarthritis: a possible autocrinelparacrine role in pathogenesis. Osteoarthritis Cartilage 5:293-300, 199.
Thus, IL-1 expression appears to overlap with Col2 expression. Although this appears to be paradoxical, it should be noted that the IL-1 levels found in osteoarthritic joints is derived from chondrocytes and these levels are distinguished from the very high levels of cytokines found in the rheumatoid joint and principally derived macrophages.
Unlike rheumatoid joints, IL-1 levels are lowest in OA when cartilage degradation is highest, suggesting that IL-1 does not play the same role in cartilage destruction in the two diseases.
The effect of low IL-1~ doses on expression of the 48bp Co12a1 enhancer in transfected SW1353 cells was determined. Surprisingly, very low levels of IL-1/3 (0.1-1 pg/ml) stimulated enhancer activity about 150% (Fig. 4); although the magnitude of induction was modest, this response was consistently observed. Col2 enhancer activity was decreased as the concentration of IL-1~ was increased above 1pg/ml, with maximal inhibition occurring between 20 and 100 pg/ml.
The effect of increasing IL-1/3 doses on the two response was determined. As shown in Fig. 4, induction of IL-8 was not detected with IL-1 concentrations below 20 pg/ml, a concentration that caused maximal repression of the 48bp Col2a1 enhancer.
Therefore, SW1353 cells appear to respond to a dynamic range of IL-1~ levels with selective functional responses, making them potentially useful in models of both osteoarthritis and rheumatoid diseases.
SEQUENCE LISTING
<110> PFIZER PRODUCT INC.
<120> A HUMAN CELL ASSAY TO DETERMINE EFFECT OF SAMPLE
<130> PC25156A
<140>
<141>
<160> 4 <170> PatentIn Ver. 2.1 <210> 1 <211> 38 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Sense Probe <400> 1 cgggatccgc caccatgaat ctcctggacc ccttcatg 38 <210> 2 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Anti-sense Probe <400> 2 cggaattcct caaggtcgag tgagctgt 28 <210> 3 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Forward Primer <400> 3 cacacagctc actcgacctt g 21 <210> 4 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Reverse Primer <400> 4 ttcggttatt tttaggatca tctcg 25
Sox 9 (+1868) forward primer TTCGGTTATTTTTAGGATCATCTCG
Sox 9 (-1943) reverse primer , FRET probe: FAM-CCCACGAAGGGCGACGATGG-TAMRA
Results 1. Col2 enhancer activity is responsive to increasing levels of Sox9 We analyzed the activity of the 48bp Col2a1 enhancer construct (48bp Col2a1) in transfected SW1353 cells. SW1353 cells were transfected with a constant amount of reporter (0.25 ug), with or without increasing amounts of the Sox9 expression construct or empty vector.
Basal luciferase activity was detected with the 48bp Col2a1 reporter alone (Fig. 1A ), as an enhancerless control construct, containing the same Col2 derived minimal promoter (p89). It was essentially inactive (<5% activity), demonstrating that SW 1353 cells likely normally express transcription factors that stimulate enhancer activity.
To determine the effect of the Sox9 expression plasmid, co-transfection with increasing amounts of the Sox9 expression plasmid (20:1, 10:1, 2:1 and 1:1 ) was undertaken.
The results demonstrate that enhancer activity was increased in a dose dependent manner and that Sox9 levels were limiting. Including large amounts of the Sox9 expression plasmid (1:1 ) resulted in a slight reduction of reporter activity.
Sox9 expression was confirmed by preparing Western blots from cell extracts prepared from duplicate transfections (Fig 1 B). At the highest DNA
concentration (0.25ug), an immunoreactive band appeared, migrating with the 66 kD marker, in good agreement with 68 kD size predicted for Sox9 (lane 5). Protein of the same size was observed in transfections having 2 and 10 fold less expression plasmid (lanes 4 and 3). On longer exposures, anti-Sox9 immunoreactive proteins were detected faintly with the 20:1 transfection and for those cells receiving no Sox9 expression plasmid.
2. SW1353 cells are responsive to pro-chondroqenic Fibroblast Growth Factors.
We analyzed the responsiveness of SW 1353 cells to these fibroblast growth factors using the 48bp Col2a1 enhancer transfection assay. Addition of FGF-1 (200 ng/ml), FGF-2 (5.9 ng/ml) to the cultures increased expression of the 48bp enhancer between 3 and 4 fold, whereas FGF-7 (200ng/ml) expression had no effect (Fig 2). These results demonstrate the conservation of FGF-1 and FGF-2 signaling pathways in SW1353 cells.
To examine the effect of FGF-9 on enhancer activity, FGF-9 was added to cultures of SW1353 cells that had been transfected with the Col2 reporter. FGF-9 (200 ng/ml) stimulated enhancer expression up to 4 fold (Fig 2). This result suggests that the SW
1353 cells express functional FGFR3b and/or FGFR2c receptors and further validates their utility in studying chondrocyte biology.
3. Pro-inflammatory cytokines repress Col2 enhancer activity in SW1353 The ability of IL-1,8 and TNFa to repress Col2 enhancer activity in primary murine chondrocytes is NFkB dependent and coincides with reduced Sox9 expression.
SW1353 cells were transfected with the 48bp Col2a1 reporter and then treated with vehicle, TNFa (10 ng/ml) or IL-1/3 (10 ng/ml) (Fig. 2A). The results demonstrate that SW1353 cells express functional TNF and IL-1 receptors by showing these agents can stimulate the expression of IL-8 (shown) and matrix metalloproteases (not shown).
Enhancer driven luciferase expression was reduced approximately 60% by TNFa and 50% by IL-1,8 treatment. The cytokine mediated inhibition of enhancer expression could be partially relieved by co-treating the cells with either FGF-1, FGF-2 or FGF-9 (Fig 2B). These results are consistent with the potential for pro-chondrogenic growth factors to diminish or reverse the cartilage damage in animal or human joint inflammation.
4. Col2 enhancer activity correlates with relative Sox9 mRNA expression in The effect of chondrocyte growth factors as well as inhibitory cytokines on the expression of Sox9 RNA in SW1353 cells using real time quantitative PCR
(TaqMan, PE
Applied Biosystems) was determined. Cells were cultured and treated with growth factors or cytokines as described above. After 48 hours cells were harvested and RNA
prepared. A
custom Sox9 primer probe set was validated by an efficiency plot over several logs and relative Sox 9 expression was quantified relative to GAPDH.
The expression of Sox9 mRNA increased approximately 1.5 fold by FGF-2 and 2-fold by FGF1 and FGF-9, while TNFa and IL-1~ decreased Sox9 expression by 45% and 60%, respectively (Fig. 3). These data are consistent with Col2 enhancer expression in SW1353 being regulated, at least in part, at the level of Sox9 expression.
5. Expression of the Col2 Enhancer Reporter is stimulated by the presence of low levels of IL-1,8 An increase in type II collagen (Col2) expression has been observed in both man and dogs during the course of osteoarthritic disease (8urfon-Wurster N, Hui-Chou CS, Greisen HA, Lust G: Reduced deposition of collagen in the degenerated articular cartilage of dogs with degenerative joint disease. Biochim Biophys Acta 718:74-84, 1982; Uusitalo H, Hiltunen A, Ahonen M, Gao TJ, Lefebvre V, Harley V, Kahari VM, Vuorio E: Accelerated up-regulation of L-SoxS, Sox6, and Sox9 by BMP-2 gene transfer during murine fracture healing.
J Bone Miner Res 16:1837-1845, 2001 ).
Col2 expression appears to be greatest in early to moderate disease and this appears to reflect a response by the chondrocytes to attempt repair of the degenerating cartilage. Coincidentally, chondrocytes from OA patients with early to moderate disease also express increased levels of IL- ~3 and IL-1/3 and these also decline with disease progression (Towle CA, Hung HH, Bonassar LJ, Treadwell BV, Mangham DC: Detection of interleukin-1 in the cartilage of patients with osteoarthritis: a possible autocrinelparacrine role in pathogenesis. Osteoarthritis Cartilage 5:293-300, 199.
Thus, IL-1 expression appears to overlap with Col2 expression. Although this appears to be paradoxical, it should be noted that the IL-1 levels found in osteoarthritic joints is derived from chondrocytes and these levels are distinguished from the very high levels of cytokines found in the rheumatoid joint and principally derived macrophages.
Unlike rheumatoid joints, IL-1 levels are lowest in OA when cartilage degradation is highest, suggesting that IL-1 does not play the same role in cartilage destruction in the two diseases.
The effect of low IL-1~ doses on expression of the 48bp Co12a1 enhancer in transfected SW1353 cells was determined. Surprisingly, very low levels of IL-1/3 (0.1-1 pg/ml) stimulated enhancer activity about 150% (Fig. 4); although the magnitude of induction was modest, this response was consistently observed. Col2 enhancer activity was decreased as the concentration of IL-1~ was increased above 1pg/ml, with maximal inhibition occurring between 20 and 100 pg/ml.
The effect of increasing IL-1/3 doses on the two response was determined. As shown in Fig. 4, induction of IL-8 was not detected with IL-1 concentrations below 20 pg/ml, a concentration that caused maximal repression of the 48bp Col2a1 enhancer.
Therefore, SW1353 cells appear to respond to a dynamic range of IL-1~ levels with selective functional responses, making them potentially useful in models of both osteoarthritis and rheumatoid diseases.
SEQUENCE LISTING
<110> PFIZER PRODUCT INC.
<120> A HUMAN CELL ASSAY TO DETERMINE EFFECT OF SAMPLE
<130> PC25156A
<140>
<141>
<160> 4 <170> PatentIn Ver. 2.1 <210> 1 <211> 38 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Sense Probe <400> 1 cgggatccgc caccatgaat ctcctggacc ccttcatg 38 <210> 2 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Anti-sense Probe <400> 2 cggaattcct caaggtcgag tgagctgt 28 <210> 3 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Forward Primer <400> 3 cacacagctc actcgacctt g 21 <210> 4 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Reverse Primer <400> 4 ttcggttatt tttaggatca tctcg 25
Claims (16)
1. A method of predicting the effect of a test compound on human chondrocyte activity comprising:
(a) transfecting SW1353 human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA binding sites;
(b) contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and (c) determining the activity of the reporter.
(a) transfecting SW1353 human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA binding sites;
(b) contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and (c) determining the activity of the reporter.
2. A method for detecting the effect of a test compound on the expression of Col2 enhancer reporter construct comprising:
(a) transfecting SW1353 human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA binding sites;
(b) contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and (c) determining the activity of the reporter.
(a) transfecting SW1353 human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA binding sites;
(b) contacting the transfected cells with a test compound for a period of from about 2 to about 24 hours; and (c) determining the activity of the reporter.
3. The method of claim 1 or claim 2, in which the reporter plasmid comprises naturally occurring promoter or regulatory control regions that have Sox9 response elements.
4. The method of claim 1 or claim 2, in which the SW1353 cells are transfected with the 48bp Col2a1 reporter.
5. The method of claim 3, wherein the Sox9 response element is selected from Col2, aggrecan, and Col11 reporter constructs.
6. The method of claim 5, wherein the reporter constructs contain synthetic Sox9 response elements.
7. The method of claim 1 or claim 2, wherein the test compound is selected from: small molecules, antibodies, antibody fragments, and biological or recombinant agents.
8. The method of claim 1 or claim 2, wherein the test compound is an antagonist of the activity of a Sox9 repressor.
9. The method of claim 1 or claim 2, wherein the test compound is an antagonist of the cytokine receptor.
10. The method of claim 1 or claim 2, wherein the test compound inhibits a negative transcription factor.
11. The method of claim 10, wherein the negative transcription factor is NFkB.
12. The method of claim 1 or claim 2, wherein the test compound inhibits a signaling pathway.
13. The method of claim 11, wherein the test compound inhibits the IKK signaling pathway.
14. The method of claim 1 or claim 2, wherein the test compound is an agonist of a beneficial signaling pathway.
15. The method of claim 1 or claim 2, wherein the beneficial signaling pathway is the MAPK pathway.
16. A chimeric cell comprising SW1353 transfected with a Col2a1 enhancer construct.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US38615602P | 2002-06-04 | 2002-06-04 | |
US60/386,156 | 2002-06-04 | ||
PCT/IB2003/002256 WO2003102130A2 (en) | 2002-06-04 | 2003-05-26 | A human cell assay to determine effect of sample compounds on col2 enhancer expression |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2488006A1 true CA2488006A1 (en) | 2003-12-11 |
Family
ID=29712234
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002488006A Abandoned CA2488006A1 (en) | 2002-06-04 | 2003-05-26 | A human cell assay to determine effect of sample compounds on col2 enhancer expression |
Country Status (7)
Country | Link |
---|---|
EP (1) | EP1576098A2 (en) |
JP (1) | JP2006500915A (en) |
AU (1) | AU2003233009A1 (en) |
BR (1) | BR0311594A (en) |
CA (1) | CA2488006A1 (en) |
MX (1) | MXPA04012042A (en) |
WO (1) | WO2003102130A2 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2010507595A (en) * | 2006-10-27 | 2010-03-11 | ザ・ユニヴァーシティ・オヴ・ウェスタン・オンタリオ | Inhibition of SOX9 function in the treatment of pathophysiological conditions associated with proteoglycans |
KR102084227B1 (en) * | 2018-09-05 | 2020-03-03 | (주)루젠에스씨아이 | Human transformed chondrocyte cell line mediated drug screening system for cartilage disease remedy |
-
2003
- 2003-05-26 WO PCT/IB2003/002256 patent/WO2003102130A2/en not_active Application Discontinuation
- 2003-05-26 AU AU2003233009A patent/AU2003233009A1/en not_active Abandoned
- 2003-05-26 MX MXPA04012042A patent/MXPA04012042A/en unknown
- 2003-05-26 CA CA002488006A patent/CA2488006A1/en not_active Abandoned
- 2003-05-26 BR BRPI0311594-1A patent/BR0311594A/en unknown
- 2003-05-26 EP EP03727809A patent/EP1576098A2/en not_active Withdrawn
- 2003-05-26 JP JP2004510372A patent/JP2006500915A/en active Pending
Also Published As
Publication number | Publication date |
---|---|
JP2006500915A (en) | 2006-01-12 |
WO2003102130A2 (en) | 2003-12-11 |
MXPA04012042A (en) | 2005-03-07 |
EP1576098A2 (en) | 2005-09-21 |
AU2003233009A8 (en) | 2003-12-19 |
BR0311594A (en) | 2007-04-27 |
AU2003233009A1 (en) | 2003-12-19 |
WO2003102130A3 (en) | 2006-06-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Blom et al. | Involvement of the Wnt signaling pathway in experimental and human osteoarthritis: prominent role of Wnt‐induced signaling protein 1 | |
Schaefer et al. | FGF signaling antagonizes cytokine-mediated repression of Sox9 in SW1353 chondrosarcoma cells | |
Bliziotes et al. | Neurotransmitter action in osteoblasts: expression of a functional system for serotonin receptor activation and reuptake | |
Aubin | Regulation of osteoblast formation and function | |
Blaney Davidson et al. | Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling | |
Hering | Regulation of chondrocyte gene expression | |
Li et al. | Smad3‐deficient chondrocytes have enhanced BMP signaling and accelerated differentiation | |
Li et al. | Modulation of connexin43 alters expression of osteoblastic differentiation markers | |
Gualeni et al. | Defective proteoglycan sulfation of the growth plate zones causes reduced chondrocyte proliferation via an altered Indian hedgehog signalling | |
Ushita et al. | Transcriptional induction of SOX9 by NF-κB family member RelA in chondrogenic cells | |
Varghese et al. | Basic fibroblast growth factor stimulates expression of interstitial collagenase and inhibitors of metalloproteinases in rat bone cells | |
Attur et al. | F-spondin, a neuroregulatory protein, is up-regulated in osteoarthritis and regulates cartilage metabolism via TGF-β activation | |
de Hooge et al. | Adenoviral transfer of murine oncostatin M elicits periosteal bone apposition in knee joints of mice, despite synovial inflammation and up-regulated expression of interleukin-6 and receptor activator of nuclear factor-κB ligand | |
KR100722176B1 (en) | Screening methods for altering circadian rhythm proteins | |
JP2006500925A (en) | BMP-2 estrogen response element and method of use thereof | |
Nishida et al. | CCN family 2/connective tissue growth factor (CCN2/CTGF) regulates the expression of Vegf through Hif-1α expression in a chondrocytic cell line, HCS-2/8, under hypoxic condition | |
Dabovic et al. | Osteopetrosis-like phenotype in latent TGF-β binding protein 3 deficient mice | |
McDermott et al. | RNA binding proteins regulate anabolic and catabolic gene expression in chondrocytes | |
Teixeira et al. | Nitric oxide–nitric oxide synthase regulates key maturational events during chondrocyte terminal differentiation | |
Leong et al. | Stimulation of cartilage resorption by extracellular ATP acting at P2-purinoceptors | |
Araya et al. | Expression of the ectodomain‐releasing protease ADAM17 is directly regulated by the osteosarcoma and bone‐related transcription factor RUNX2 | |
Govindaraj et al. | Changes in Fluorescence Recovery After Photobleaching (FRAP) as an indicator of SOX9 transcription factor activity | |
EP1690932A1 (en) | Bone and/or joint disease-associated gene | |
Stheneur et al. | Basic fibroblast growth factor as a selective inducer of matrix Gla protein gene expression in proliferative chondrocytes | |
OLSEN et al. | Converging signals synergistically activate the LAMC2 promoter and lead to accumulation of the laminin gamma2 chain in human colon carcinoma cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
FZDE | Discontinued |