CA2443341A1 - Human gene critical to fertility - Google Patents
Human gene critical to fertility Download PDFInfo
- Publication number
- CA2443341A1 CA2443341A1 CA002443341A CA2443341A CA2443341A1 CA 2443341 A1 CA2443341 A1 CA 2443341A1 CA 002443341 A CA002443341 A CA 002443341A CA 2443341 A CA2443341 A CA 2443341A CA 2443341 A1 CA2443341 A1 CA 2443341A1
- Authority
- CA
- Canada
- Prior art keywords
- mater
- leu
- protein
- sequence
- human
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/36—Gynecology or obstetrics
- G01N2800/367—Infertility, e.g. sperm disorder, ovulatory dysfunction
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
Disclosed herein are novel nucleic acid and protein sequences that are essential to fertility. In particular, human Mater genomic, cDNA and protein sequences are provided, as are fragments and variants thereof. Functional MATER is required for female fertility; zygotes that arise from Mater null oocytes do not progress beyond the two-cell stage. Methods are described for using Mater molecules in diagnoses, prognosis, and treatment of infertility and reduced fertility, and kits related to such methods. Also provided are methods for using Mater as a contraceptive agent. The disclosure also describes compounds involved in such methods, and the identification of such compounds.
Description
HUMAN GENE CRITICAL TD FERTILITY
REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of PCT Application Number PCT/LTS01110981, filed April 4, 2001, which claims the benefit of U.S. Provisional Application 60/241,510, filed October 18, 2000, both of which are incorporated herein by reference in their entirety.
FIELD
The present disclosure is generally related to fertility, including the mechanisms controlling it, diseases that arise from defects in such mechanisms, and methods of influencing (either inhibiting or enhancing) fertility.
BACKGROUND
Premature ovarian failure (POF) is a term used to describe certain types of infertility in women. As many as 1 % of all women in the United States are thought to be afflicted with POF, which manifests as menopausal-type symptoms, including infertility, in women under the age of 40.
Many different diseases and conditions can cause POF, including underlying chromosomal defects (e.g., X-chromosome fragility), chemotherapy, or radiation treatment.
Autoimmunity is a well-established mechanism of premature ovarian failure (see Yan et al., J Womens Health Gend Based Med. 9:275-87, 2000; and Kalantaridou & Nelson, JAm Med Womens Assoc. 53:18-20, 1998). In autoimmune infertility, a woman's ovaries are attacked by cells of her own immune system, leading to a condition known as autoimmune oophoritis (inflammation of the ovary).
Autoimmune disease can develop in response to a single inciting antigen and then spread to involve other antigenic molecules of the same organ (Kaufinan, Natzzre 366:69-72, 1993). Therefore, identifying the autoantigen target in an organ-specific autoi~mune disease is essential to understanding its pathogenesis.
An experimental animal (mouse) model has been used to gain insight into the mechanisms of human autoimmune oophoritis. Removal of the thymus (thymectomy) in neonatal mice (about three days old) induces experimental autoimmune oophoritis in certain strains of mice (Taguchi et al., Clin Exp Immunol. 42:324-331, 1980). This experimentally induced condition leads to the production of high levels of anti-ooplasm antibodies and sterility, accompanied by follicular degeneration; the progression of the condition appears to closely parallel human autoimmune oophoritis (Kalantaridou & Nelson, JAm Med Wornens ASSOC. 53:18-20, 1998).
Maternal products control the developmental program until embryonic genome activation takes place. Maternal effect genes that are important in early embryonic development have been well documented in Drosophila and Xenopus (Morisato & Anderson, Annu. Rev. Genet.
29:371-399, 1995;
Newport & Kirschner, Cell 30:687-696,1982), but their presence has only been inferred in mammals (Gardner, Huzn. Reprod. Update 2:1-27, 1999). In mice, embryonic transcription is first detected in the late 1-cell zygote stage and is required for development beyond the 2-cell stage (Schultz, Bioassays 15:531-538, 1993; Flach et al., EMBO J. 1:681-686, 1982; Latham et al., Mol. Reprod.
Dev. 35:140-150, 1993). The factors governing this transition from the maternal to the embryonic genome are unknown.
A critical transition in development occurs with the switch from dependence on proteins stored in the egg to those that result from activation of the embryonic genome. This shift which occurs at the two-cell stage in mice is dependent on maternal factors. Gene transcription and protein translation are active during marine oogenesis and RNAs and proteins accumulate within oocytes.
However, germ cells becomes transcriptionally inactive late in oogenesis and much of the maternal RNA is degraded during meiotic maturation and ovulation of the egg into the oviduct. Thus, few maternal gene products persist past the two-cell embryo stage and none have been demonstrated directly to affect early development (Schultz, Bioassays 15, 531-538, 1993;
Gardner, Hum. Reprod.
Update 2, 3-27, 1996).
SUMMARY OF THE DISCLOSURE
Described herein is the human MATER protein, an approximately 135 kDa (predicted estimated molecular weight) cytoplasmic protein expressed in mammalian oocytes that is required for female fertility. Zygotes that arise from a MATER null oocyte do not progress beyond the two-cell stage.
Some embodiments include an isolated human MATER protein predicted to have an estimated molecular weight of about 125 kDa to about 135 kDa, in some embodiments more particularly about 134.2 kDa. For instance, this estimated molecular weight may be obtained by SDS-polyacrylamide gel electrophoresis and Western blotting, for instance using an antibody raised against a C-terminal peptide of marine MATER (e.g., residues 1093 to 1111 of SEQ ID
NO: 6). MATER
proteins include an amino acid sequence as set forth in SEQ ID NOs: 2 or 4 or 24, or a sequence having at least 65% sequence identity (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more) with SEQ ID NOs: 2 or 4 or 24. Certain specific examples of such proteins may contain one or more conservative variants within such sequences.
Certain of the provided human MATER proteins have MATER protein biological activity, for instance in that they can complement a MATER null phenotype.
One specific embodiment is thus an isolated human MATER protein predicted to have an estimated molecular weight of about 135 kDa, wherein the human MATER protein comprises amino acid sequences as set forth in SEQ ID NO: 2 and/or SEQ ID NO: 4 and/or SEQ ID
NO: 24, the protein is an oocyte cytoplasm-specific autoantigen associated with autoimmune infertility, and it can complement a Mater null phenotype by permitting progression of an embryo beyond the two-cell stage.
Other embodiments are variant MATER proteins, having at least one variant amino acid compared to wildtype. Examples of such variant proteins include proteins where at least one variant amino acid occurs within a recognized domain or region withhi the protein. In other examples, at least one variant amino acid occurs outside of a recognized domain or region of the MATER protein.
Still other examples are variants having at least one amino acid variant in and one outside of a recognized domain. Further embodiments are isolated nucleic acid molecules that encode a variant MATER protein, recombinant nucleic acid molecules that include a promoter sequence operably linleed to a MATER nucleic acid molecule and cells transformed with such a recombinant nucleic acid molecule.
Methods of detecting a biological condition associated with an abnormal Mater nucleic acid or an abnormal MATER expression or an autoimmuna response to MATER in a subject are also provided. Examples of such a biological condition include infertility (such as autoimmune infertility) or reduced fertility, or an increased susceptibility to infertility or reduced fertility. Also provided are kits for use with such methods.
A fiu-ther embodiment includes methods of screening for a compound useful in influencing MATER-mediated fertility in a mammal.
The foregoing and other features and advantages of the invention will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows two digitized gels, and a series of digitized micrographs, detailing the developmental expression of marine MATER.
FIG. 1A is a digitized image of a Northern blots showing RNAse protection of Mater and ZP3 transcripts. RNase protection assays were performed using total RNA from 50 oocytes, eggs or embryos. 3zP-labeled antisense probes and protected fragment lengths for Mater and ZP3 were 180/139 nt and 257/205 nt, respectively.
FIG. 1 B is a digitized image of a Western blot, showing MATER protein (approximately 125 kD) amounts in the indicated marine cell types. MATER protein was assayed in 25 oocytes, eggs or embryos by immunoblotting with monospecific antisera to MATER.
FIG. 1 C is a series of digitized micrographs, showing the cellular localization of MATER
protein. Protein localization was determined using fluorescent labeled antibody, by imaging oocytes, eggs and embryos with laser-scanning confocal microscopy alone (upper images) or after superimposition on a Nomarski image (lower images). Scale bar, 50 Vim.
FIG. 2 shows the characterization of targeted Mater locus disruptions.
FIG. 2A is a schematic representation of the normal marine Mater allele (upper), the targeting construct (middle) and the null allele (bottom). The 5' and 3' probes used to assess targeting were outside the region of DNA homology.
REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of PCT Application Number PCT/LTS01110981, filed April 4, 2001, which claims the benefit of U.S. Provisional Application 60/241,510, filed October 18, 2000, both of which are incorporated herein by reference in their entirety.
FIELD
The present disclosure is generally related to fertility, including the mechanisms controlling it, diseases that arise from defects in such mechanisms, and methods of influencing (either inhibiting or enhancing) fertility.
BACKGROUND
Premature ovarian failure (POF) is a term used to describe certain types of infertility in women. As many as 1 % of all women in the United States are thought to be afflicted with POF, which manifests as menopausal-type symptoms, including infertility, in women under the age of 40.
Many different diseases and conditions can cause POF, including underlying chromosomal defects (e.g., X-chromosome fragility), chemotherapy, or radiation treatment.
Autoimmunity is a well-established mechanism of premature ovarian failure (see Yan et al., J Womens Health Gend Based Med. 9:275-87, 2000; and Kalantaridou & Nelson, JAm Med Womens Assoc. 53:18-20, 1998). In autoimmune infertility, a woman's ovaries are attacked by cells of her own immune system, leading to a condition known as autoimmune oophoritis (inflammation of the ovary).
Autoimmune disease can develop in response to a single inciting antigen and then spread to involve other antigenic molecules of the same organ (Kaufinan, Natzzre 366:69-72, 1993). Therefore, identifying the autoantigen target in an organ-specific autoi~mune disease is essential to understanding its pathogenesis.
An experimental animal (mouse) model has been used to gain insight into the mechanisms of human autoimmune oophoritis. Removal of the thymus (thymectomy) in neonatal mice (about three days old) induces experimental autoimmune oophoritis in certain strains of mice (Taguchi et al., Clin Exp Immunol. 42:324-331, 1980). This experimentally induced condition leads to the production of high levels of anti-ooplasm antibodies and sterility, accompanied by follicular degeneration; the progression of the condition appears to closely parallel human autoimmune oophoritis (Kalantaridou & Nelson, JAm Med Wornens ASSOC. 53:18-20, 1998).
Maternal products control the developmental program until embryonic genome activation takes place. Maternal effect genes that are important in early embryonic development have been well documented in Drosophila and Xenopus (Morisato & Anderson, Annu. Rev. Genet.
29:371-399, 1995;
Newport & Kirschner, Cell 30:687-696,1982), but their presence has only been inferred in mammals (Gardner, Huzn. Reprod. Update 2:1-27, 1999). In mice, embryonic transcription is first detected in the late 1-cell zygote stage and is required for development beyond the 2-cell stage (Schultz, Bioassays 15:531-538, 1993; Flach et al., EMBO J. 1:681-686, 1982; Latham et al., Mol. Reprod.
Dev. 35:140-150, 1993). The factors governing this transition from the maternal to the embryonic genome are unknown.
A critical transition in development occurs with the switch from dependence on proteins stored in the egg to those that result from activation of the embryonic genome. This shift which occurs at the two-cell stage in mice is dependent on maternal factors. Gene transcription and protein translation are active during marine oogenesis and RNAs and proteins accumulate within oocytes.
However, germ cells becomes transcriptionally inactive late in oogenesis and much of the maternal RNA is degraded during meiotic maturation and ovulation of the egg into the oviduct. Thus, few maternal gene products persist past the two-cell embryo stage and none have been demonstrated directly to affect early development (Schultz, Bioassays 15, 531-538, 1993;
Gardner, Hum. Reprod.
Update 2, 3-27, 1996).
SUMMARY OF THE DISCLOSURE
Described herein is the human MATER protein, an approximately 135 kDa (predicted estimated molecular weight) cytoplasmic protein expressed in mammalian oocytes that is required for female fertility. Zygotes that arise from a MATER null oocyte do not progress beyond the two-cell stage.
Some embodiments include an isolated human MATER protein predicted to have an estimated molecular weight of about 125 kDa to about 135 kDa, in some embodiments more particularly about 134.2 kDa. For instance, this estimated molecular weight may be obtained by SDS-polyacrylamide gel electrophoresis and Western blotting, for instance using an antibody raised against a C-terminal peptide of marine MATER (e.g., residues 1093 to 1111 of SEQ ID
NO: 6). MATER
proteins include an amino acid sequence as set forth in SEQ ID NOs: 2 or 4 or 24, or a sequence having at least 65% sequence identity (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more) with SEQ ID NOs: 2 or 4 or 24. Certain specific examples of such proteins may contain one or more conservative variants within such sequences.
Certain of the provided human MATER proteins have MATER protein biological activity, for instance in that they can complement a MATER null phenotype.
One specific embodiment is thus an isolated human MATER protein predicted to have an estimated molecular weight of about 135 kDa, wherein the human MATER protein comprises amino acid sequences as set forth in SEQ ID NO: 2 and/or SEQ ID NO: 4 and/or SEQ ID
NO: 24, the protein is an oocyte cytoplasm-specific autoantigen associated with autoimmune infertility, and it can complement a Mater null phenotype by permitting progression of an embryo beyond the two-cell stage.
Other embodiments are variant MATER proteins, having at least one variant amino acid compared to wildtype. Examples of such variant proteins include proteins where at least one variant amino acid occurs within a recognized domain or region withhi the protein. In other examples, at least one variant amino acid occurs outside of a recognized domain or region of the MATER protein.
Still other examples are variants having at least one amino acid variant in and one outside of a recognized domain. Further embodiments are isolated nucleic acid molecules that encode a variant MATER protein, recombinant nucleic acid molecules that include a promoter sequence operably linleed to a MATER nucleic acid molecule and cells transformed with such a recombinant nucleic acid molecule.
Methods of detecting a biological condition associated with an abnormal Mater nucleic acid or an abnormal MATER expression or an autoimmuna response to MATER in a subject are also provided. Examples of such a biological condition include infertility (such as autoimmune infertility) or reduced fertility, or an increased susceptibility to infertility or reduced fertility. Also provided are kits for use with such methods.
A fiu-ther embodiment includes methods of screening for a compound useful in influencing MATER-mediated fertility in a mammal.
The foregoing and other features and advantages of the invention will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows two digitized gels, and a series of digitized micrographs, detailing the developmental expression of marine MATER.
FIG. 1A is a digitized image of a Northern blots showing RNAse protection of Mater and ZP3 transcripts. RNase protection assays were performed using total RNA from 50 oocytes, eggs or embryos. 3zP-labeled antisense probes and protected fragment lengths for Mater and ZP3 were 180/139 nt and 257/205 nt, respectively.
FIG. 1 B is a digitized image of a Western blot, showing MATER protein (approximately 125 kD) amounts in the indicated marine cell types. MATER protein was assayed in 25 oocytes, eggs or embryos by immunoblotting with monospecific antisera to MATER.
FIG. 1 C is a series of digitized micrographs, showing the cellular localization of MATER
protein. Protein localization was determined using fluorescent labeled antibody, by imaging oocytes, eggs and embryos with laser-scanning confocal microscopy alone (upper images) or after superimposition on a Nomarski image (lower images). Scale bar, 50 Vim.
FIG. 2 shows the characterization of targeted Mater locus disruptions.
FIG. 2A is a schematic representation of the normal marine Mater allele (upper), the targeting construct (middle) and the null allele (bottom). The 5' and 3' probes used to assess targeting were outside the region of DNA homology.
FIG. 2B is a series of digitized Northern blots, showing that the Mater null allele was detected in XbaI digested ES cell DNA as a 3.5 kb fragment with the 5' (left) or as a 4.0 kb fragment with the 3' (middle) and neo (right) probes.
FIG. 2C is a pair of digitized Northern blots, showing that Mater transcripts were detected in normal and heterozygous (half the abundance of normal), but not in homozygous null ovaries (left panel). ZP3 transcripts (control) were present in all three genotypes (right panel).
FIG. 3 is a series of digitized micrographs and corresponding bar graphs, showing the in vivo development defects of embryos derived from Mater null female mice.
After gonadotrophin induced ovulation, female mice were mated with normal males and oviducts from normal (FIG. 3A, 3D, 3G, and 3J) or Mater null (FIG. 3B, 3E, 3H, and 3K) females were flushed one (FIG. 3A and 3B), two (FIG. 3D and 3E), three (FIG. 3G and 3H) and four (FIG. 3J
and 3K) days later. The unfixed embryos were photographed using Nomarski optics. The arrows point to pronuclei in 1-cell zygotes (FIG. 3A and 3B). Scale bar, 50 Vim.
The bar graphs indicate developmental progress of the average number of embryos derived from Mater null (1) and normal (L7) females at one (FIG. 3C), two (FIG. 3F), three (FIG. 3I), and four (FIG. 3L) days after mating. Each bar represents the average of 4-5 experiments + s.e.m.
FIG. 4 shows that de novo transcription and translation occurs in murine embryos lacking Mater.
FIG. 4A-4F show digitized micrograph images of murine embryos. Newly synthesized RNA
was measured by BrUTP incorporation into the nucleus of one- (FIG. 4A and 4B) and 2-cell (FIG. 4C
and 4D) embryos derived from Mater null (FIG. 4A and 4C) and normal (FIG. 4B
and 4D) females using laser-scanning confocal microscopy and a monoclonal antibody to BrUTP.
FIG. 4G is a bar graph, showing the quantity of BrUTP incorporated in 2-cell embryos with (+) and without (-) Mater using arbitrary fluorescence units after subtraction of that obtained with uninfected controls (FIG. 4E and 4F). Scale bar, 50 pm.
FIG. 4H is a pair of digitized northern blots, showing RNase protection assays of 28S
ribosomal RNA using total RNA from 50 growing oocytes, eggs and 2-cell embryos isolated from females with (+) and without (-) Mater. 32P-labeled antisense probes and protected fragment lengths for 28S-rRNA were 153 nt and 115 nt, respectively.
FIG. 4I is a series of digitized fluorographs, showing de novo protein synthesis in 1-cell zygotes (left panel) and 2-cell embryos (middle and right panels) that do (+) or do not (-) contain Mater. Each lane contained proteins from 10 embryos that were dissolved in sample buffer directly (left and middle panels) or after partial purification extraction of TRC (65-75 kDa) and p35 (right panels).
FIG. 5 shows ovarian histology, eggs and the number of eggs produced from Mater null females. The number of ovulated eggs and their morphology indicating maturation or degeneration were not remarkably different between normal and Mater null mice.
FIG. 2C is a pair of digitized Northern blots, showing that Mater transcripts were detected in normal and heterozygous (half the abundance of normal), but not in homozygous null ovaries (left panel). ZP3 transcripts (control) were present in all three genotypes (right panel).
FIG. 3 is a series of digitized micrographs and corresponding bar graphs, showing the in vivo development defects of embryos derived from Mater null female mice.
After gonadotrophin induced ovulation, female mice were mated with normal males and oviducts from normal (FIG. 3A, 3D, 3G, and 3J) or Mater null (FIG. 3B, 3E, 3H, and 3K) females were flushed one (FIG. 3A and 3B), two (FIG. 3D and 3E), three (FIG. 3G and 3H) and four (FIG. 3J
and 3K) days later. The unfixed embryos were photographed using Nomarski optics. The arrows point to pronuclei in 1-cell zygotes (FIG. 3A and 3B). Scale bar, 50 Vim.
The bar graphs indicate developmental progress of the average number of embryos derived from Mater null (1) and normal (L7) females at one (FIG. 3C), two (FIG. 3F), three (FIG. 3I), and four (FIG. 3L) days after mating. Each bar represents the average of 4-5 experiments + s.e.m.
FIG. 4 shows that de novo transcription and translation occurs in murine embryos lacking Mater.
FIG. 4A-4F show digitized micrograph images of murine embryos. Newly synthesized RNA
was measured by BrUTP incorporation into the nucleus of one- (FIG. 4A and 4B) and 2-cell (FIG. 4C
and 4D) embryos derived from Mater null (FIG. 4A and 4C) and normal (FIG. 4B
and 4D) females using laser-scanning confocal microscopy and a monoclonal antibody to BrUTP.
FIG. 4G is a bar graph, showing the quantity of BrUTP incorporated in 2-cell embryos with (+) and without (-) Mater using arbitrary fluorescence units after subtraction of that obtained with uninfected controls (FIG. 4E and 4F). Scale bar, 50 pm.
FIG. 4H is a pair of digitized northern blots, showing RNase protection assays of 28S
ribosomal RNA using total RNA from 50 growing oocytes, eggs and 2-cell embryos isolated from females with (+) and without (-) Mater. 32P-labeled antisense probes and protected fragment lengths for 28S-rRNA were 153 nt and 115 nt, respectively.
FIG. 4I is a series of digitized fluorographs, showing de novo protein synthesis in 1-cell zygotes (left panel) and 2-cell embryos (middle and right panels) that do (+) or do not (-) contain Mater. Each lane contained proteins from 10 embryos that were dissolved in sample buffer directly (left and middle panels) or after partial purification extraction of TRC (65-75 kDa) and p35 (right panels).
FIG. 5 shows ovarian histology, eggs and the number of eggs produced from Mater null females. The number of ovulated eggs and their morphology indicating maturation or degeneration were not remarkably different between normal and Mater null mice.
FIG. 5A and SB are digitized images of ovarian slices from a 4 week old (FIG.
5A) and 8 week old (FIG. 5B) Mater null mouse. The 4 week old Mater null ovarian histology (FIG. 5A) displays different stages of normal ovarian follicles with oogenesis, which are indistinguishable from normal ovarian histology. In the 8 week old sample (FIG. 5B), there are a number of corpora lutea indicating normal spontaneous ovulation, similar to follicular luteinization in the wild-type mouse ovary.
FIG. SC is a digitized photograph of ovulated eggs from the Mater null mice, produced in response to exogenous PMSG and hCG. Morphology appears similar to that of ovulated eggs from wild-type mice.
FIG. 5D is a bar graphs showing the numbers (mean ~ s.e.m.) of the ovulated eggs from the Mater null and wild-type mice.
FIG. 6 is a digitized image comparing the gross morphological appearance of the uterus and ovaries of normal and Mater null mice. Ovaries and uteri if Mater null female mice (right) were indistinguishable from the ovaries and uteri from the wild-type female mice (left).
FIG. 7 is an alignment of the amino acid sequence of human MATER (SEQ ID NO:
24) and murine MATER (SEQ ID NO: 6) proteins. Identical amino acids are identified;
similar amino acids are indicated with a plus (+) symbol.
FIG. 8 is illustrates human MATER mRNA and its oocyte-specific expression.
FIG. 8A is a digitized image of a Northern hybridization of human M,4TER.
Total human ovarian RNAs were prepared from women at age 19 (lane 1) and 26 (lane 2) years, as described herein. Ten micrograms of each RNA were separated by gel-electrophoresis and transferred onto a nitrocellulose membrane. The blot was probed with 3zP-labeled human MATER
cDNA. RNA
molecular sizes (kb) are indicated on the left of panel.
FIG. 8B and 8C are digitized images of agarose gels, showing analysis of the indicated transcripts by RT-PCR. Using the Human Rapid-Scan Gene Expression Panel (Origene Inc) and specific primers, cDNAs at 100X concentration were used to amplify human (3-actin (FIG. 8B), while cDNA at 1000X concentration were used to amplify human MATER (FIG. 8C). The cDNAs were synthesized from the RNAs of the human brain (lane 1), heart (2), kidney (3), spleen (4), liver (5), colon (6), lung (7), small intestine (8), muscle (9), stomach (10), testis (11), placenta (12), salivary gland (13), thyroid (14), adrenal gland (15), pancreas (16), ovary (17), uterus (18), prostate (19), skin (20), blood leucocytes (21), bone marrow (22), fetal brain (23), fetal liver (24). Lane 25 and 26 serve as a positive control (human ovarian cDNA, Invitrogen) and a negative control (without cDNA), respectively. PCR products were separated by 2% agarose gel-electrophoresis and visualized by 0.1 % ethidium bromide. Amplification of the PCR products of human (i-actin (640 bp) and human MATER (280 bp) is indicated on the right, respectively.
FIG. 8D is an image of a Southern hybridization blot prepared from the agarose gel separating the human MATER PCR product in FIG. 8C, and probed with 3zP-labeled human MATER
cDNA. Hybridization signals were detected by autoradiography. The arrow indicates the position of PCR product hybridization of human MATER (280 bp) in the control (lane 25) and ovary samples (lane 17).
FIG. 8E and 8F illustrate in situ hybridization of MATER cDNA. 35S-labeled antisense and sense probes were synthesized in vitro transcription using the human MATER
cDNA as templates.
The frozen human ovarian sections were hybridized with the antisense probe (FIG. 8E) and sense probe (FIG. 8F). Dark-field images are displayed, and an arrow indicates the locations of the oocytes.
Scale bar, 100 pm.
FIG. 9 is a series of digitized micrographs, showing oocyte-specific expression of Mater transcripts in human by in situ hybridization. Both [35S]-labeled antisense and sense probes were synthesized by in vitro transcription using the cloned human Mater cDNA as a template. The frozen human ovarian sections were hybridized with the radiolabeled sense (FIG. 9A
and 9C) and antisense (FIG. 9B and 9D) probes. The slides were stained with hematoxylin and eosin.
For each probe, bright-field (FIG. 9A and 9B) and dark-field (FIG. 9C and 9D) images are shown.
FIG. 10 is a pair of digitized micrographs, showing oocyte-specific expression of human MATER protein. Frozen human ovarian sections were incubated with rabbit antisera (1:200) against a C-terminal peptide of mouse MATER protein, and FITC-conjugated goat anti-rabbit IgG antisera were used as the second antibody to detect human MATER protein in the oocyte (FIG. 10A). The corresponding phase contrast image is shown in FIG. l OB.
FIG. 11 illustrates human MATER protein expression in oocytes.
FIG. 11A and 11B are digitized micrographs showing immunohistofluorescence of human MATER in ovarian sections. Frozen human ovarian sections were incubated with rabbit antisera (1:200) against the mouse MATER peptide. FITC-conjugated goat anti-rabbit IgG
antibody was used as a second antibody to detect the primary antibody bound MATER protein.
Tissue sections were visualized by a fluorescence microscopy (FIG. 11A). Corresponding phase contrast is shown in the FIG. 11B. Arrows indicate the location of oocytes. Scale bar: 100 pm.
FIG. 11 C is a protein immunoblot of human MATER. Solubilized proteins of human eggs (lane l, 10 eggs and lane 2, 15 eggs) were separated by 3-8% Tris-Acetate SDS-PAGE
electrophoresis. A protein blot was incubated with rabbit anti-mouse MATER
peptide antisera (1:1000). The ECL detection kit with HRP-conjugated goat anti-rabbit IgG
antibody was used to detect the blot-bound primary antibodies. Approximate protein molecular masses (kDa) are indicated on the left. Human MATER protein is indicated by an arrow at 134 kDa.
FIG. 12 shows the nucleotide (cDNA; SEQ ID NO: 23) and amino acid (SEQ ID NO:
24) sequences of human MATER. The nucleotides (3885 nts) from 5' are displayed on the top line and their numbers are indicated on the right. The initiation code (ATG) and termination code (TGA) is underlined (solid), respectively. The polyadenylation signal (AATAAA) is underlined with a dashed line. The nucleotides at the 5' end of the non-coding region remain to be determined. The deduced amino acid sequence (1200 residues) is under the nucleotide sequence and numbered on the right.
Some structural motifs present in the protein sequence are shown in FIG. 14B.
These sequence data have been submitted to GenBank under an accession number AY054986.
FIG. 13 shows Dotplot analyses of human and mouse MATER amino acid sequences.
Human MATER amino acid sequence was compared with itself (FIG 13A) and the mouse MATER amino acid sequence (FIG. 13B). The center diagonal line from the left to the right represents the direct correspondence of the two sequences of the same protein from amino- to carboxyl-terminus. Identities are shown by the dots. The short diagonal lines parallel to the center diagonal line are present at the carboxyl-terminus and a region close to the amino-terminus, reflecting repeated amino acid sequences at these regions. Display of the dots and short parallel lines delineate similarities of amino acid sequences between human MATER (1200 residues) and mouse MATER
(1111 residues), reflecting homologies of the composition and structure of the MATER protein of the two species.
FIG. 14 illustrates the results of computational analysis of structural motifs in human MATER.
FIG. 14A is a Kyte & Doolittle hydropathy plot of human MATER amino acid sequence.
Hydrophilic repeats at amino-terminus (32-304 amino acids) contain a short hydrophobic region (104-136 amino acids). At the carboxyl-terminus, there is a short hydrophilic region (1184-1200 amino acids).
FIG. 14B is a schematic representation of structural motifs of human MATER.
The horizontal line from amino- to carboxyl-terminus represents the entire peptide chain of human MATER (1200 residues). The opened boxes represent structural motifs and their positions on the peptide chain. The protein contains a domain of PAAD DAPIN at the amino-terminus and six domains of leucine-rich repeats (LRR) at the carboxyl-terminus. Both molecular domains are for protein-protein interactions. In addition, there are motifs with potentials for ATPIGTP-binding (P-loop), nuclear translocation (NLS_BF) and aldo/keto reductase activity (aldo ket red). Locations of these motifs are indicated in the numbers following the particular motifs.
FIG. 15 is a pair of schematic representations of exon-intron maps of human MATER (FIG.
15A) and mouse Mater (FIG. 15B). The exon-intron map of human MATER (~63 kbp) was compared with the mouse Mater (~32 kbp) exon-intron map (Tong et al., Mammal Genonae 11:281, 2000).
Both gene loci have fifteen exons that are indicated by the Arabic numbers on top of each of the vertical bars representing the exons. The horizontal solid lines between exons represent introns, and the horizontal dashed lines at 5' ends represent the undetermined 5' ends of both gene loci. Scale bar (2 kbp) is shown under the map of human MATER.
_g_ SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NO: 1 shows the nucleic acid sequence of human Mater cDNA fragment 1.
SEQ ID NO: 2 shows the amino acid sequence of the human MATER peptide encoded by fragment 1 (SEQ ID NO: 1).
SEQ ID NO: 3 shows the nucleic acid sequence of human Mater cDNA fragment 2.
SEQ ID NO: 4 shows the amino acid sequence of the human MATER peptide encoded by fragment 2 (SEQ ID No: 3).
SEQ ID NO: 5 shows the nucleic acid sequence of murine Mater cDNA (GenBank Accession number NM 011860.1 and AF074018; individual exons are also listed in AF143573).
SEQ ID NO: 6 shows the amino acid sequence of the murine MATER protein (GenBank Accession number NP 035990).
SEQ ID NOs: 7-22 shows several synthetic oligonucleotides useful as probes and/or primers.
SEQ ID NO: 23 shows the nucleic acid sequence of the human Mater cDNA, and the amino acid sequence so encoded.
SEQ ID NO: 24 shows the amino acid sequence of the human MATER protein.
SEQ ID NOs: 25-38 are oligonucleotide sequences that overlap the intron-exon boundaries in the human Mater gene. In order, these oligonucleotides correspond to the splice junctions that define exons 1-15, as described more fully herein.
SEQ ID NOs: 39 and 40 are human (3-actin specific primers.
SEQ ID NOs: 41 and 42 are human MATER-specific primers.
DETAILED DESCRIPTION OF THE DISCLOSURE
1. Abbreviations ES: embryonic stem Mater: Maternal _Antigen _That _Embryos _Require OPl: Ooplasm-specific Protein 1 POF: Premature Ovarian Failure TRC: Transcription Related Complex ZP3: zor~a pellucida glycoprotein 3 1l. Terms Unless otherwise noted, technical terms are used according to conventional usage.
Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes Y, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Erzcyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the invention, the following explanations of specific terms are provided:
Abnormal: Deviation from normal characteristics. Normal characteristics can be found in a control, a standard for a population, etc. For instance, where the abnormal condition is an autoimmune disease condition, such as autoimmune infertility, sources of normal characteristics might include an individual who is not suffering from the autoimmune disorder, a population standard of individuals believed not to be suffering from the disease, etc.
In some examples, abnormal may refer to a condition that is associated with a disease. The term "associated with" includes an increased risk of developing the disease as well as the disease itself. For instance, a certain abnormality (such as an abnormality in an Mater nucleic acid or MATER protein expression) can be described as being associated with the biological conditions of altered (e.g., reduced) fertility and tendency to develop autoimmune infertility.
An abnormal nucleic acid, such as an abnormal Mater nucleic acid, is one that is different in some manner to a normal (wildtype) nucleic acid. Such abnormality includes but is not necessarily .
limited to: (1) a mutation in the nucleic acid (such as a point mutation (e.g., a single nucleotide polymorphism) or short deletion or duplication of a few to several nucleotides); (2) a mutation in the control sequences) associated with that nucleic acid such that replication or expression of the nucleic acid is altered (such as the functional inactivation of a promoter); (3) a decrease in the amount or copy number of the nucleic acid in a cell or other biological sample (such as a deletion of the nucleic acid, either through selective gene loss or by the loss of a larger section of a chromosome or under expression of the mRNA); and (4) an increase in the amount or copy number of the nucleic acid in a cell or sample (such as a genomic amplification of part or all of the nucleic acid or the overexpression of an mRNA), each compared to a control or standard. It will be understood that these types of abnormalities can co-exist in the same nucleic acid or in the same cell or sample; for instance, a genomic-amplified nucleic acid sequence may also contain one or more point mutations. In addition, it is understood that an abnormality in a nucleic acid may be associated with, and in fact may cause, an abnormality in expression of the corresponding protein.
Abnormal protein expression, such as abnormal MATER protein expression, refers to expression of a protein that is in some manner different to expression of the protein in a normal (wildtype) situation. This includes but is not necessarily limited to: (1) a mutation in the protein such that one or more of the amino acid residues is different; (2) a short deletion or addition of one or a few amino acid residues to the sequence of the protein; (3) a longer deletion or addition of amino acid residues, such that an entire protein domain or sub-domain is removed or added; (4) expression of an increased amount of the protein, compared to a control or standard amount; (5) expression of an decreased amount of the protein, compared to a control or standard amount; (6) alteration of the subcellular localization or targeting of the protein; (7) alteration of the temporally regulated expression of the protein (such that the protein is expressed when it normally would not be, or alternatively is not expressed when it normally would be); and (8) alteration of the localized (e.g., organ or tissue specific) expression of the protein (such that the protein is not expressed where it would normally be expressed or is expressed where it normally would not be expressed), each compared to a control or standard.
Controls or standards appropriate for comparison to a sample, for the determination of abnormality, include samples believed to be normal as well as laboratory values, even though possibly arbitrarily set, keeping in mind that such values may vary from laboratory to laboratory.
Laboratory standards and values may be set based on a known or determined population value and may be supplied in the format of a graph or table that permits easy comparison of measured, experimentally determined values.
Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two strands, a 5' ->
3' strand, referred to as the plus strand, and a 3' -> 5' strand (the reverse complement), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus strand of the DNA serves as the template for the RNA during transcription.
Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).
Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a dsDNA target.
Binding or stable binding: An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount of the oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding. Binding can be detected by either physical or functional properties of the target:oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including both functional and physical binding assays. Binding may be detected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription, translation, and the like.
Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absorption detection procedures.
For example, one method that is widely used, because it is so simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target disassociate from each other, or melt.
The binding between an oligomer and its target nucleic acid is frequently characterized by the temperature (Tm) at which 50% of the target sequence remains hybridized to a perfectly matechd probe or complementary strand. A higher (Tm) means a stronger or more stable complex relative to a complex with a lower (Tm).
cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and transcriptional regulatory sequences. cDNA may also contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA
molecule. cDNA is usually synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
DNA (deoxyribonucleic acid): DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)).
The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine (A), guanine (G), cytosine (C), and thymine (T) bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide, or for a stop signal. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.
Unless otherwise specified, any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single-strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double-stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes a specific protein, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence of the disclosed nucleic acid molecules.
Deletion: The removal of a sequence of DNA, the regions on either side of the removed sequence being joined together.
Gene amplification or genomic amplification: An increase in the copy number of a gene or a fragment or region of a gene or associated 5' or 3' region, as compared to the copy number in normal tissue. An example of a genomic amplification is an increase in the copy number of an oncogene. A "gene deletion" is a deletion of one or more nucleic acids normally present in a gene sequence and, in extreme examples, can include deletions of entire genes or even portions of chromosomes.
Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (LJ), and thymine (T)) or purines (adenine (A) and guanine (G)).
These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
"Specifically hybridizable" and "specifically complementary" are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.
Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na concentration) of the hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al.
(ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11, herein incorporated by reference.
For present purposes, "stringent conditions" encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence. "Stringent conditions" may be broken down into particular levels of stringency for more precise definition. Thus, as used herein, "moderate stringency" conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of "medium stringency" are those under which molecules with more than 15%
mismatch will not hybridize, and conditions of "high stringency" are those under which sequences with more than 10%
mismatch will not hybridize. Conditions of "very high stringency" are those under which sequences with more than 6% mismatch will not hybridize.
Isz vitro amplification: Techniques that increases the number of copies of a nucleic acid molecule in a sample or specimen. An example of amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to nucleic acid template in the sample.
The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. The product of in vitro amplification may be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing, using standard techniques. Other examples of in vitro amplification techniques include strand displacement amplification (see U.S. Patent No. 5,744,311); transcription-free isothermal amplification (see U.S.
Patent No. 6,033,881); repair chain reaction amplification (see WO 90/01069);
ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Patent No.
5,427,930); coupled ligase detection and PCR (see U.S. Patent No. 6,027,889);
and NASBATM RNA
transcription-free amplification (see U.S. Patent No. 6,025,134).
Injectable composition: A pharmaceutically acceptable fluid composition including at least one active ingredient. The active ingredient is usually dissolved or suspended in a physiologically acceptable carrier, and the composition can additionally include minor amounts of one or more non-toxic auxiliary substances, such as emulsifying agents, preservatives, and pH
buffering agents and the like. Such injectable compositions that are useful for use with the provided nucleotides and proteins are conventional; appropriate formulations are well known in the art.
Isolated: An "isolated" biological component (such as a nucleic acid molecule, protein or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, /.e., other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
MATER protein: A cytosol-localized protein (SEQ ID NO: 24) of approximately 125 to approximately 135 kDa (estimated molecular weight based on gel mobility) that is essential for female fertility. The acronym stands for Maternal Antigen That Embryos Require. Mater is a single-copy gene found on human Chromosome 19. Zygotes that arise from Mater null (Mater ~-) oocytes do not progress beyond the two-cell stage. Thus, Mater represents a novel maternal effect gene that is required for embryonic survival and early development in mammals.
Proteins can be identified as MATER proteins by comparing their activity and other physical characteristics to a prototypical MATER protein, such as the human or murine MATER protein.
MATER protein biological activity can be described in terms of the ability of a protein to complement (substantially replace the lost function in) a Mater null mutant. The ability of a protein to complement a Mater mutant may be readily determined by introducing the gene encoding the protein into a Mater mutant animal system (such as the Mater null mice described herein) using standard methods. If the encoded protein has MATER protein biological activity, this will be manifested as a proportion of the transgenic progeny animals having a relatively wild-type phenotype for those characteristics linked to the Mater mutant (e.g., infertility of Mater null females due to failure of Mater null oocytes to progress beyond the two-cell stage).
Other MATER protein physical characteristics that can be examined when evaluating a hypothetical MATER protein include the molecular weight of the protein (approximately 125-135 kDa, see Example 1, though this value may vary somewhat from species to species), the subcellular localization of the protein (human MATER is expressed in oocytes (Example 4)), and is predicted to be specifically expressed in the cytoplasm and excluded from the nucleus, as occurs in mice (see Example 1), and the temporal and spatial regulation of the mRNA (Mater transcript is produced in the maturing oocyte, see Examples 1 and 3). Antibodies that recognize one MATER
protein (e.g., a murine MATER) may recognize a MATER protein from another species (e.g., human MATER) (see Example 4); thus, hypothetical MATER proteins can be further examined and identified based on recognition by anti-MATER antibodies produced against MATER proteins from other species. The identity of the human MATER protein can therefore be confnmed for instance by immunological identification using an antibody raised against the murine MATER protein, or an epitope of that protein.
Nucleotide: "Nucleotide" includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is one monomer in a polynucleotide. A
nucleotide sequence refers to the sequence of bases in a polynucleotide.
Oligonucleotide: An oligonucleotide is a plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 300 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide.
Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 200 nucleotides in length, for example a sequence (such as DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15, 20, or 23 bases.
Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
Open reading frame: A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide.
Ortholog: Two nucleic acid or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.
Parenteral: Administered outside of the intestine, e.g., not via the alimentary tract.
Generally, parenteral formulations are those that will be administered through any possible mode except ingestion. This term especially refers to injections, whether administered intravenously, intrathecally, intramuscularly, intraperitoneally, or subcutaneously, and various surface applications including intranasal, intradermal, and topical application, for instance.
Peptide Nucleic Acid (PNA): An oligonucleotide analog with a backbone comprised of monomers coupled by amide (peptide) bonds, such as amino acid monomers joined by peptide bonds.
Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful with the compositions provided herein are conventional. Martin, Remington's Pharmaceutical Seienees, published by Mack Publishing Co., Easton, PA, 19th Edition, 1995, describes compositions and formulations suitable for pharmaceutical delivery of the nucleotides and proteins herein disclosed.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Polymorphism: Variant in a sequence of a gene. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, geographic locations. The term polymorphism also encompasses variations that produce gene products with altered function, i. e., variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also encompasses variations that produce no gene product, an inactive gene product, or increased gene product. The term polymorphism may be used interchangeably with allele or mutation, unless context clearly dictates otherwise.
Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule that is linked to the variation (e.g., an alteration of a secondary structure such as a stem-loop, or an alteration of the binding affinity of the nucleic acid for associated molecules, such as polymerases, lRNases, and so forth).
Probes and primers: Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided as indicators of disease or disease progression. It is also appropriate to generate probes and primers based on fragments or portions of these nucleic acid molecules. Also appropriate are probes and primers specific for the reverse complement of these sequences, as well as probes and primers to 5' or 3' regions.
A probe comprises an isolated nucleic acid attached to a detectable label or other reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols irz Molecular Biology, John Wiley & Sons, New York, 1998).
Primers are short nucleic acid molecules, for instance DNA oligonucleotides 10 nucleotides or more in length. Longer DNA oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerise enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerise chain reaction (PCR) or other in vitro nucleic-acid amplification methods known in the art.
Methods for preparing and using nucleic acid probes and primers are described, for example, in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989), Ausubel et al. (ed.) (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998), and Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990). Amplification primer pairs (for instance, for use with polymerise chain reaction amplification) can be derived from a known sequence such as the Mater sequences described herein, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, O
1991, Whitehead Institute for Biomedical Research, Cambridge, MA).
One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 30 consecutive nucleotides of a MATER protein encoding nucleotide will anneal to a target sequence, such as another homolog of the designated MATER protein, with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in order to obtain greater specificity, probes and primers can be selected that comprise at least 20, 23, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of a MATER protein-encoding nucleotide sequences.
Also provided are isolated nucleic acid molecules that comprise specified lengths of the disclosed Mater nucleotide sequences. Such molecules may comprise at least 10, 15, 20, 23, 25, 30, 35, 40, 45 or 50 or more consecutive nucleotides of these sequences or more, and may be obtained from any region of the disclosed sequences (e.g., a Mater nucleic acid may be apportioned into halves or quarters based on sequence length, and isolated nucleic acid molecules may be derived from the first or second halves of the molecules, or any of the four quarters, etc.). A
Mater cDNA or other encoding sequence also can be divided into smaller regions, e.g. about eighths, sixteenths, twentieths, fiftieths and so forth, with similar effect.
Another mode of division is to select the 5' (upstream) and/or 3' (downstream) region associated with a Mater gene.
Nucleic acid molecules may be selected that comprise at least 10, 15, 20, 25, 30, 35, 40, 50 or 100 or more consecutive nucleotides of any of these or other portions of a human Mater nucleic acid molecule, such as those disclosed herein, and associated flanking regions. Thus, representative nucleic acid molecules might comprise at least 10 consecutive nucleotides of the human cDNA
fragments show in SEQ ID NOs: 1 and 2, or the full human MATER cDNA shown in SEQ ID NO:
24.
Protein: A biological molecule expressed by a gene or recombinant or synthetic coding sequence and comprised of amino acids.
Purified: The term "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell or within a production reaction chamber (as appropriate).
Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
Homologs or orthologs of human MATER protein, and the corresponding cDNA or gene sequence, will possess a relatively high degree of sequence identity when aligned using standard methods. This homology will be more significant when the orthologous proteins or genes or cDNAs are derived from species that are more closely related (e.g., human and chimpanzee sequences), compared to species more distantly related (e.g., human and C. elegans sequences).
Methods of alignment of sequences for comparison are well known in the art.
Various programs and alignment algorithms are described in: Smith & Waterman Adv.
Appl. Math. 2: 482, 1981; Needleman ~ Wunsch J. Mol. Biol. 48: 443, 1970; Pearson & Lipman Proc.
Natl. Acad. Sci.
USA 85: 2444, 1988; Higgins & Sharp Getae, 73: 237-244, 1988; Higgins & Sharp GABIOS 5: 151-153, 1989; Corpet et al. Nuc. Acids Res. 16, 10881-90, 1988; Huang et al.
Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al. Meth. Mol. Bio. 24, 307-31, 1994. Altschul et al. (J.
Mol. Biol. 215:403-410, 1990), presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. J. Mol.
Biol.
215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. By way of example, for comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties).
An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and are different under different environmental parameters.
Generally, stringent conditions are selected to be about 5° C to 20° C lower than the thermal melting point (Tin) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50°~0 of the target sequence remains hybridized to a perfectly matched probe or complementary strand. Conditions for nucleic acid hybridization and calculation of stringencies can be found in Sambrook et al. (In Molecular Cloning: A
Laboratory Manual, CSHL, New York, 1989) and Tijssen (Laboratory Technigues in Biochemistry ahd Molecular Biology--Hybridization with Nucleic Acid Probes Part I, Chapter 2, Elsevier, New York, 1993). Nucleic acid molecules that hybridize under stringent conditions to a human MATER protein-encoding sequence will typically hybridize to a probe based on either an entire human MATER
protein-encoding sequence or selected portions of the encoding sequence under wash conditions of 2x SSC at 50° C.
Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein.
Specific binding agent: An agent that binds substantially only to a defined target. Thus a protein-specific binding agent binds substantially only the specified protein.
By way of example, as used herein, the term "MATER-protein specific binding agent" includes anti-MATER protein antibodies (and functional fragments thereof] and other agents (such as soluble receptors) that bind substantially only to the MATER protein.
Anti-MATER protein antibodies may be produced using standard procedures described in a number of texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). The determination that a particular agent binds substantially only to the specified protein may readily be made by using or adapting routine procedures. One suitable in vitro assay makes use of the Western blotting procedure (described in many standard texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988)). Western blotting may be used to determine that a given protein binding agent, such as an anti- MATER protein monoclonal antibody, binds substantially only to the MATER protein.
Shorter fragments of antibodies can also serve as specific binding agents. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to a specified protein would be specific binding agents. These antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain;
two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab')2, a dimer of two Fab' fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (6) single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine.
Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.
Target sequence: "Target sequence" is a portion of ssDNA, dsDNA or RNA that, upon hybridization to a therapeutically effective oligonucleotide or oligonucleotide analog, results in the inhibition of expression. For example, hybridization of therapeutically effectively oligonucleotide to a Mater target sequence results in inhibition of MATER expression. Either an antisense or a sense molecule can be used to target a portion of dsDNA, since both will interfere with the expression of that portion of the dsDNA. The antisense molecule can bind to the plus strand, and the sense molecule can bind to the minus strand. Thus, target sequences can be ssDNA, dsDNA, and RNA.
Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the teen transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA
by electroporation, lipofection, and particle gun acceleration.
Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are, incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
111. Brief Overview of Several Embodimev~ts Described herein is the human MATER protein, an approximately 135 kDa (predicted estimated molecular weight) cytoplasmic protein expressed in mammalian oocytes that is required for female fertility. Zygotes that arise from a MATER null oocyte do not progress beyond the two-cell stage.
One described embodiment is an isolated variant MATER protein comprising an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO:
4, or SEQ ID NO:
24, and comprising at least one variant amino acid in a recognized MATER
protein domain. Another embodiment is an isolated variant MATER protein comprising an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 24, and comprising at least one variant amino acid in a region outside of a recognized MATER protein domain. Yet another embodiment is an isolated variant MATER protein comprising an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 24, and comprising at least one variant amino acid in a recognized MATER protein domain and at least one variant amino acid outside of a recognized MATER protein domain.
Specific variant MATER proteins have a sequence that comprises at least one variant amino acid in a Leucine-rich repeat, or in the PAAD-DAPIN domain, or in the aldo ket red domain, or in the ATP-/GTP-binding domain, or in any two or more of these recognized domains. Also provided are isolated variant MATER proteins, wherein the sequence of the protein comprises at least one variant amino acid outside of a recognized MATER protein domain.
Other embodiments are isolated nucleic acid molecule encoding one of these proteins, recombinant nucleic acid molecule comprising a promoter sequence operably linked to such a nucleic acid molecule, and cell transformed with one of those recombinant nucleic acid molecules.
Another embodiment is a method of detecting in a subject a biological condition associated with an abnormal MATER nucleic acid, which method involves reacting at least one MATER nucleic acid in a clinical sample from the subject with a reagent comprising a MATER-specific nucleic acid binding agent to form a MATER:agent complex, and detecting the complex. In specific examples of this method, the MATER-specific nucleic acid binding agent is a MATER
oligonucleotide, for instance one that comprises at least 10 contiguous nucleotides of a human MATER intron sequence. By way of example, certain of the MATER oligonucleotides include a sequence as shown in any one of SEQ ID
NOs: 25 through 38.
Another embodiment provides a method of detecting in a subject a biological condition associated with an abnormal MATER nucleic acid, which further involves quantifying the MATER:agent complex and comparing the quantity of the MATER:agent complex with the quantity of an equivalent MATER:agent complex formed in a reference sample (e.g., one taken from a reference subject, such as a subject known to have or not to have the biological condition).
In certain specific examples of these methods, the clinical sample comprises a reproductive cell.
Representative examples of provided methods of detecting in a subject a biological condition associated with an abnormal MATER nucleic acid further comprising in vitro amplifying a MATER
nucleic acid prior to detecting the abnormal Mater nucleic acid. The in vitro amplification can be carried out in vitro using at least one oligonucleotide primer derived from a MATER protein encoding sequence. Specific examples of the oligonucleotide primer include a sequence of an intron-exon boundary of human MATER, for instance as shown in any on of SEQ ID NOs: 25 through 38. Other embodiments are oligonucleotide primers used in any of these methods.
In certain examples of the described methods, the MATER:agent complex is detected by nucleotide hybridization. The agent, used to form the MATER:agent complex in some of the described methods, is a labeled nucleotide probe. Representative examples of such probes include a sequence as shown in any one of SEQ ID NOs: 25 through 38. Other embodiments are labeled nucleotide probe used in any of these methods.
A further embodiment is a kit for detection of a genetic mutation in a sample of nucleic acid.
One such kit includes a first container containing an oligonucleotide capable of specifically hybridizing with a MATER nucleic acid, which oligonucleotide has a sequence comprising at least 10 contiguous nucleotides from an human MATER intron; and a second container containing a fluorescent labeled nucleic acid probe that is fully complementary to the oligonucleotide. In examples of these kits, the fluorescent labeled nucleic acid probe has a length of between 5 and 500 nucleotides. Specific examples of kits provided herein include an oligonucleotide that includes a sequence as shown in any one of SEQ ID NOs: 25 through 38.
IV. Human MATER Protein artd Nucleic Acid Seqz~ences Embodiments provide MATER proteins and Mater nucleic acid molecules, including cDNA
sequences. The prototypical Mater sequences are the murine and human sequences, and the use of these sequences to produce transgenic animals having increased or decreased levels of MATER
protein is provided, as are diagnostic methods to detect defects or alterations in Mater expression or MATER protein production.
The full-length cDNA for human Mater (SEQ ID NO: 23) is determined to be 3900 base pairs long (which is somewhat longer the mouse Mater cDNA, GenBank Accession #
NM 011860.1, SEQ ID NO: 5) and its ORF encodes a protein of 1200 amino acids, having a predicted molecular weight of approximately 135.2 kDa and a predicted pI of about 6.08. The human Mater cDNA
comprises the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 3, which are thought to be aligned approximately with the seventh and eleventh through fifteenth exons of the mouse Mater sequence, respectively. The human Mater mRNA is expressed in oocytes, as shown by iH
situ hybridization experiments (Example 3).
Human MATER protein (SEQ ID NO: 24) has been specifically localized by immunofluorescence to human oocytes (Example 4). The ATG initiation codon of the Mater cDNA
lies within the context of the ANNATG motif associated with vertebrate initiator codon (I~ozak, 1991, J. Biol. Chem. 266:19867). The human MATER protein comprises the deduced protein sequences (SEQ ID NOs: 2 and 4) corresponding to the herein described human Mater cDNA
sequences (SEQ ID NOs: 1 and 3, respectively). These protein fragments show low but significant sequence homology with the OP1/MATER protein from mouse (GenBank # NP 035990, SEQ ID
NO: 6). In particular, SEQ ID NO: 2 is 54% identical to residues 257-638 of marine MATER (SEQ
ID NO: 6), while SEQ ID NO: 4 is 64% identical to residues 854-1111 of marine MATER. The overall human MATER protein sequence (SEQ ID NO: 24) shares approximately 50%
similarity with the marine MATER protein sequence (SEQ ID NO: 6); the relevant sequence alignment is shown in FIG. 9. The depicted comparison between the human and marine MATER proteins was conducted using the BLAST 2 Sequences Program with parameter conditions of Expect 10 and Filter closed (NIH-NCBI).
Certain regions of the human Mater cDNA have been identified through the sequencing of human HTGSs, though no function or identity had been previously assigned to those sequences. See, for instance, GenBanc accession numbers: AC024580 (GI = 7705010, published May 4, 2000);
AC012107 (GI = 6088020, published October 20, 1999, and updated as GI =
7329252, published March 28, 2000); and AC023887 (GI = 7631054, published April 21, 2000). These fragmentary and overlapping human sequences are up to 207 nucleotides in length and are scattered throughout the marine Mater cDNA sequence. The human ESTs individually share up to 89%
identity with the marine Mater cDNA over short, discontinuous regions. Oligonucleotides according to the current disclosure may be chosen to avoid these ESTs. Overall, the first 75 nucleotides of human Mater (1-75) and the corresponding deduced amino acids (1-25) were determined by comparison to published human genomic DNA sequences, while the remainder of the Mater sequence was determined by direct cloning and sequencing of human ovarian cDNAs.
Using the sequence of the cloned human MATER cDNA to blast the human hgts database (which is accessible on-line), a single genomic clone (AC01740) with a full DNA sequence was determined to harbor an entire gene locus of human MATER.
Mater is a single-copy maternal effect gene, the protein product of which is required for early embryonic survival. Although eggs lacking MATER protein can be fertilized, morphologic signs of deterioration are observed as early as the 2-cell stage beyond which the mutant embryos do not progress. The human MATER protein with 1200 amino acids is predicted to have similar molecular domains to those seen in the marine MATER protein (1111 amino acids). As described by Tong et al. (Mamnr. Genonre 11:281-287, 2000), the mouse MATER protein contains a five-fold hydrophilic repeat (26-27 amino acid) near its N-terminus, a short leucine-zipper and a fourteen-fold leucine-rich repeat (28-29 amino acid) near its carboxyl terminus (based on a comparison to the marine MATER protein, as described in Tong et al., Marnm. Genorne 11, 281-287, 2000). The hydrophilic repeat has low homology with a cytoskeletonal protein (neurofilament), raising the possibility that this region mediates interactions that anchor MATER in the cytoplasm. The presence of the leucine-rich domain, as well as a short leucine zipper, both motifs known to mediate protein-protein interactions (Kajava, J. Mol. Biol. 277, 519-527, 1998; Buchanan &
Gay, Prog. Biophys. Mol.
Biol. 65, 1-44, 1996), suggests that MATER may affect embryonic progression through intermediate factor(s), one or more of which binds directly to MATER in the cytoplasm.
Using antisera against a mouse MATER peptide (residues 1093 through 1111 of marine MATER, SEQ ID NO: 6), the inventors have demonstrated that human MATER protein is present in oocytes in human ovary sections (Example 4). Likewise, using mouse-derived nucleotide sense and antisense probes for in situ hybridization experiments, it has been demonstrated that human oocytes express Mater mRNA (Example 3).
Marine MATER has been further characterized herein as to its function in mammalian embryogenesis. This protein is a "maternal" protein, generated in the oocyte prior to fertilization, and therefore encoded for by a maternal gene. MATER is unusual in that it persists (as measured by protein level) into the late blastocyst stage of embryonic development.
Functional MATER is required for female fertility; zygotes that arise from Mater null oocytes do not progress beyond the two-cell stage; this is true regardless of what Mater genotype male produced the sperm. The protein is cytoplasmic, with definite exclusion from the nucleus.
The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the invention to the particular features or embodiments described.
Characterization of the Marine MATER protein This example provides several methods for examining MATER proteins and nucleic acids in a mammalian system; the marine system is used.
Methods:
Isolation of oocytes, eggs and embryos. All experiments were conducted in compliance with the guidelines of the Animal Care and Use Committee under an approved animal study protocol.
Resting, growing and fully grown oocytes were dissected from 1, 10 and 21 day old (d/o) mouse ovaries, respectively, and eggs were isolated from gonadotrophin stimulated female mice (Tong et al., J. Biol. Chern. 270, 849-853, 1995; Rankin et al., Development 125, 2415-2424, 1998). Embryos were obtained by mating gonadotrophin stimulated females with males and 1-cell zygotes, 2-cell embryos, morulae and blastocysts were flushed from the oviducts at 1, 2, 3 and 4 days, respectively, counting the morning after hCG administration as day 1. Embryos were either incubated in M16 media (37 ~C, 5% COZ), fixed in 1% paraformaldehyde for subsequent confocal microscopy, or frozen at -80 ~C for RNA and protein analyses. Ovaries were fixed (10% formalin) and embedded in paraffin prior to sectioning and staining with hematoxylin and eosin (American Histolabs, Gaithersburg, Maryland).
Detection of transcripts and proteins. Mater, ZP3, (3-actin, cyclophilin and 28S-rRNA
transcripts were detected by RNase protection assays as previously described (Tong & Nelson, Endocrinology 140, 3720-3726, 1999;Tong et al., J. Biol. Chern. 270, 849-853, 1995) using an RPA
II kit (Ambion, Austin, TX).
Rabbits were immunized with a KLH conjugated MATER peptide (amino acids 1093-1111) to obtain a monospecific antisera. After incubating immunoblots with MATER
antisera (1:1000, two hours, 20 °C), antibody binding was detected by ECL using a HRP-conjugated goat anti-rabbit antibody (Amersham Pharmacia Biotech, Piscataway, NJ). Fixed oocytes, eggs or embryos were incubated with MATER antisera (1:8000, 4 °C, 16 hours) and imaged by laser-scanning confocal microscopy (LSM 5; Zeiss, Thornwood, NY) using Cy5-conjugated goat anti-rabbit IgG (1:200).
Protein synthesis and irnrnunoblotting. Embryos were incubated in 100 ~l of M16 medium containing L-35S-methionine (0.5 Cilml, Amersham) at 37 °C for 4 hours.
At the end of radiolabeling, 1-cell and 2-cell embryos were harvested at 26 hours and 48 hours post-hCG/mating, respectively.
After washing with 1% BSA in 10 mM Tris-HCl (pH 7.4), 1mM EDTA and 140 mM
NaCl, ten embryos were dissolved directly in 10 ~1 of sample buffer (1) directly or (2) after treatment with 2%
Triton X-100/0.3 M KCl to extract the TRC and p35 (Conover et al., Dev. Biol.
144, 392-404, 1991).
After SDS-PAGE and fluorography as previously reported (Tong et al., J. Biol.
Chern. 270, 849-853, 1995), radioactive incorporation was determined by a phosphoimager and ImageQuant software (Molecular Dynamics, Amersham Pharmacia Biotech, Piscataway, NJ).
Production of Mater null mice. Constructs use to produce Mater null mice are shown in FIG. 2. To construct a targeting vector in pPNT (Tybulewicz et al., Cell 65, 1153-1163, 1991), a 1.5 kbp SacI-EcoRI DNA fragment containing the first two exons of marine Mater (Tong et al., Marnm.
Genorne 11, 281-287, 2000) was inserted between the PGK-Neo and PGK-TK
cassettes and a 2 kbp EcoRI-BamHI fragment containing exons 3 and 4 was inserted upstream of the PCK-Neo. After linearization and electroporation into embryonic stem (ES) cells (Redmond et al., Nat. Genet. 20, 344-351, 1998), the presence of the mutant allele in chemically selected clones was detected as 3.5 kbp and 4.0 kbp XbaI fragments with 5' and 3' (or Neo) probes, respectively.
Both the 5' and 3' probes detected the normal allele as a 9.4 kbp XbaI fragment. C57BL/6 blastocysts were injected with 8-12 ES cells derived from five independently selected clones. Two cell lines that gave rise to coat-color chimeric animals were mated with C57BL/6 females and transmitted the Mater mutation through the germ line. The absence of Mater transcripts in homozygous null females was confirmed by northern blot analysis as described previously (Tong & Nelson, Endocrinology 140, 3720-3726, 1999).
Reproductive performance. Vaginal smears were obtained daily to examine four or more estrus cycles of 6-10 week-old female mice (Rugh, The Mouse: Its Reproductiozz and Developznent 210 Oxford University Press, Oxford, 1991). Mating behavior was evaluated by the presence of a vaginal plug on the morning after mating with fertile males.
Zygotic gene transcription assays. A 5-10 p1 aliquot of 100 mM BrUTP, 140 mM
KCl and 2mM Pipes, pH 7.4 was microinjected into the cytoplasm of embryos isolated 28 hours (1-cell embryos) and 48 hours (2-cell embryos) following hCG and mating, essentially as previously described (Bouniol et al., Exp. Cell Res. 218, 57-62, 1995). After incubation in M16 medium in 5%
COZ for one hour at 37 °C, the injected embryos were fixed in 1%
paraformaldehyde.
BrUTP incorporation into RNA was assayed with a mouse anti-BrdU monoclonal antibody (Sigma, 1:1000, 16 hours, 4 °C). After washing in PBS containing 3%
BSA, a FITC-conjugated goat anti-mouse IgG antibody was used to image the embryos by confocal microscopy;
fluorescence was recorded in arbitrary units. This assay primarily reflects de novo RNA
polymerise II activity, because poor penetration of the monoclonal antibody into nucleoli prevents measurement of BrUTP
incorporation into ribosomal RNA (Wansink, et al., J. Cell Biol. 122, 283-293, 1993).
Results Mater transcript and protein expression Mater mRNA was first detected as oocytes entered into their growth phase (30-50 pm) (FIG.
1A). Mater transcripts were most abundant in fully-grown oocytes (75-85 pm) and, like many oocyte transcripts (Bachvarova, in Developmental Biology: Oogenesis 1, 453-524, Plenum Press, New York, 1985; Epifano et al., Developrzzent 121, 1947-1956, 1995), were degraded during meiotic maturation and subsequent ovulation. Mater mRNA was not detected in the early embryo (FIG. 1A), although its presence in EST databases derived from early embryos suggest that some transcripts may have escaped destruction.
The initial accumulation of MATER protein during oogenesis was similar to that observed for Mater transcripts (compare FIG. 1A with FIG. 1B). However, unlike the virtual disappearance of the transcripts, the MATER protein persisted during preimplantation development until the late blastocyst stage (FIG. 1B). Using confocal microscopy, MATER protein was located in the cytoplasm of growing oocytes and noticeably excluded from the nucleus. MATER
was more concentrated in the cortical region of oocytes and early embryos (one- and two-cell stages), and this peripheral pattern persisted later in preimplantation development with a higher concentration of MATER in the outer trophectodermal cells compared to the inner cell mass of blastocysts (FIG. 1C).
Mater null animals To determine the function of MATER protein, Mater null mouse lines were generated, in which homozygous females did not express either Mater transcripts or protein.
Mater null mice were born in the expected Mendelian ratios with equal sex distribution. No phenotypic abnormalities were observed from birth through adulthood.
Ovaries and uteri from Mater null mice appeared morphologically normal (FIG.
6). Mater null ovaries had a normal complement of primordial follicles and all stages of follicular development were normally represented; corpora lutea, indicating past spontaneous ovulation, were also present (FIG. 5).
Ova lacking Mater were fertilized normally in vivo (FIG. 1 ). The number and morphology of zygotes and 2-cell embryos from the Mater null females were similar to those from normal females (FIG. 5). However, by 3 or 4 days after mating the embryos from Mater null females still remained at the 2-cell stage or had begun to degenerate (compare FIG. 3D and 3G with 3E
and 3H). Thus, fertilization is normal in Mater null females and the resulting zygotes can progress through the first cleavage, but subsequent development is arrested at the 2-cell stage. This indicates that an arrest of early embryogenesis accounts for the infertility in Mater null females.
Two mouse lines with a Mater null mutation (T54 and T85) were generated (FIG.
2A and 2B) and neither Mater transcript (FIG. 2C) nor protein (FIG. 2D) were detected in homozygous null females.
Reproductive phenotype of Mater null animals Matings of heterozygous Mater null parents produced average sized litters (8.5 + 1.9) with normal Mendelian and equal sex distribution of the null allele in progeny.
Homozygous null animals appeared normal and males were as fertile as normal littermates. However, homozygous null females produced no litters, even after five months of mating (Table 1) which implicated Mater as a maternal effect gene.
Table 1: Fertility and Mendelian allele ratio of mice with Mater mutation Mating pairs Litter sizesMendelian ratios a' x ~ n* mean + s.e.m.+/+ +/- -/-Mater+'+ x Mater11 7.5 ~ 1.8 1.00 0 0 +'+
Mater +'+ x Mater10 7.4 + 1.9 n.d. t n.d. n.d.
+'-Mater +'+ x Mater9 0 n.a. ~ n.a. n.a.
-'' Mater -'- x Mater8 7.6 + 2.4 0 1.00 0 +'+
Mater -'- x Mater18 8.4 t 1.9 0 0.47 0.53 ''-'-Mater ~' x Mater15 8.5 + 1.9 0.21 0.57 0.22 +'' n, the numoer of mating pairs, ' n.a., not Gone, * n.a., not appucame.
Sexually mature Mater null females exhibited regular 5.67 ~ 0.22 days estrus cycles, similar to those observed in normal females (5.40 ~ 0.23 days). Mating occurred normally, as demonstrated by the appearance of vaginal plugs in about 70% of either Mater null or normal females, after exposure to fertile males. The Mater null ovary had a normal complement of primordial follicles, with all stages of follicular development as well as corpora lutea indicating past spontaneous ovulations (FIG. 5A and 5B). In addition, the Mater null females ovulated normally after stimulation with exogenous gonadotropins. However, homozygous null females produced no litters even after five months of mating with normal males, while the homozygous null males and heterozygous females had normal fertility.
The mean number (~ s.e.m.) of ovulated eggs recovered from null (27.6 ~ 4.5, n=14) was not statistically different (p > 0.05) from that obtained from normal (27.7 ~ 4.3, n=12) females (FIG. 5D).
Morphologically, the two groups of eggs were indistinguishable from one another (FIG. 5C).
Fertilization and embryo development in Mater null animals To evaluate in vivo fertilization and early development, embryos were isolated from normal and Mater null females at 1, 2, 3 and 4 days after mating with normal males.
Fertilization occurred in eggs lacking MATER, as demonstrated by the presence of two pronuclei (arrows, FIG. 3A and 3B).
The number and morphology of 1-cell zygotes and 2-cell embryos obtained in vivo from the Mater null females were similar to those observed from normal females, although the 2-cell mutant embryos appeared less healthy, displaying cytoplasmic granulations (FIG. 3A-3F).
Embryos obtained from the Mater null female mice 3 or 4 days after mating still remained at the 2-cell stage (or had begun to degenerate), while embryos from normal mice had progressed to the morula or blastocyst stages, respectively An equal percentage (~70%) of fertilized 1-cell zygotes derived from Mater null and normal females progressed in vitro to the 2-cell stage. However, after four days in culture, embryos lacking MATER remained arrested at the 2-cell stage (most were degenerating) (FIG.
3K); embryos from the normal females developed to the blastocyst stage in the same time (FIG. 3J).
Thus, although fertilization appears normal and zygotes without MATER can progress through the first cleavage, subsequent embryonic development is arrested at the 2-cell stage.
Characterization of transcription in Mater null animals The early arrest phenotype seen in Mater null mice is reminiscent of the 2-cell block that occurs after exposure of mouse embryos to a-amanitin (Schultz, Bioessays 15:531-538, 1993; Flach et al., EMBO J. 1, 681-686, 1982), a mushroom toxin that binds to RNA polymerase II and prevents elongation of transcription beyond dinucleotides (Vaisius & Wieland, Biochemistry 21, 3097-3101, 1982). Normal embryonic transcription is first detected late in the 1-cell zygote at a level that is ~20% that of the 2-cell embryo (Aoki et al., Dev. Biol. 181, 296-307, 1997), but these nascent transcripts are poorly, if at all, translated into protein (Nothias et al., EMBO J. 15, 5715-5725, 1996).
_28_ To assess de novo RNA polymerase II activity of the early Mater null embryo, bromo-UTP
(BrUTP) incorporation was assayed with a monoclonal antibody specific to BrUTP
using laser-scanning confocal microscopy, essentially as described previously (Bouniol et al., Exp. Cell Res. 218, 57-62, 1995) (FIG. 4A-4G). Morphologically there was a dramatic difference in the amount of BrUTP detected in the nuclei of normal embryos 28 hours (FIG. 4B) and 48 hours (FIG. 4D) after mating compared to those lacking MATER (FIG. 4A and 4C). BrUTP incorporation in embryos without MATER was marginally greater than that of uninfected controls (FIG. 4E
and 4F) and de novo transcription was less than 5% that observed in normal 2-cell embryos (FIG. 4G).
Characterization of TRC in Mater null animals During meiotic maturation and ovulation, more than 50% of maternal RNA is lost in normal mice (Bachvarova, in Developrnental Biology: Oogenesis 1, 453-524, Plenum Press, New York, 1985). This degradative process also occurs in females lacking MATER with loss of ribosomal RNA
(FIG. 4H) and at least some mRNAs ((i-actin, ZP3, cyclophilin, and GAPDH).
Normally, the subsequent activation of the embryonic genome at the 2-cell stage is preceded by the transient transcription and translation of a subset of gene products, some of which form the distinctive Transcription Related Complex (TRC) (Bolton et al., J. Embryol. Exp. Morphol.
79:139-163, 1984;
Nothias et al., EMBO J. 15:5715-5725, 1996; Conover et al., Dev. Biol. 144:392-404, 1991). This complex, first observed in the early 2-cell embryo, is not formed in the presence of a-amanitin.
To assay for the TRC, 1- and 2-cell embryos derived from Mater null females mated with normal males were incubated with 35S-methionine. No global differences in the amount of 35S-methionine incorporation or in protein profiles were noted in comparing normal 1-cell zygotes and those lacking MATER (FIG. 4I, left panel). Although TRC complexes were detected in embryos without MATER at the 2-cell stage (FIG. 4I, middle and right panels), they appeared somewhat less abundant (~60% of normal), which could reflect abnormal protein synthesis in the embryos lacking MATER. This indicates that MATER is not absolutely critical for initiation of all transcription-translation machinery in early embryos.
Although this striking decrease in transcription could reflect generalized morbidity of the embryo, a similar decrease in 1-cell zygotes, which appear quite healthy, as well as absence of an equally dramatic decrease in de novo protein synthesis (FIG. 4I) suggest that the depressed levels of transcription are due either directly, or indirectly to the absence of MATER.
Functions) of mammalian MATER
The homology of the leucine-rich repeat domain of mammalian MATER protein with porcine ribonuclease inhibitor implies that MATER may act as an inhibitor of cytoplasmic RNase. If this is true, RNA in embryos lacking MATER might be subject to extensive degradation, perhaps an accentuation of the normal turnover of RNA that occurs during the maternal-to-zygotic transition in the early embryo. The degradation of IRNAs, including those that encode proteins required for transcription, could account for the phenotype observed in Mater null embryos.
This seems unlikely;
however, because in the absence of Mater mutant embryos incorporate 35S-methionine into proteins and no major difference in protein profiles are observed in comparison with normal embryos. These results indicate that sufficient mRNA, tRNA and ribosomal RNA are present in the mutant embryos to support protein biosynthesis, although it does not preclude the degradation of a targeted subset of RNA required for early embryonic survival.
Transcription-dependent protein synthesis occurs in two phases in the 2-cell embryo, an early minor activation (2-4 hours after the first mitotic division) that is characterized by appearance of the TRC proteins, and a later major activation that occurs in GZ (8-10 hours after the first mitotic division). The later activation initiates developmental programs required for progression beyond the 2-cell stage (Schultz, Bioessays 1S, S31-538, 1993). The observed decrease in embryonic transcription in embryos lacking MATER could result from deterioration of transcription machinery, decreased access to genomic DNA or abnormalities in the chromatin template within the nucleus.
However, the presence of the TRC proteins in Mater null animals indicates that MATER is not 1 S critical for the early phase of transcription-dependent protein synthesis in 2-cell embryos. It further suggests that the transcription machinery, and its ability to access nuclear DNA, is largely intact in Mater null embryos (as it appears to be in Mater null oocytes, which are also transcriptionally active).
The TRC proteins resulting from the early burst of transcription are associated with the nucleus (Schultz, Bibessays 1S, S31-538, 1993). These proteins could relieve the late transcriptional repression required for progression beyond the 2-cell stage via mechanisms involving MATER.
Additionally, it has been reported that mouse oocytes and 1-cell embryos lack coactivator(s) required for enhancer-dependent transcription in 2-cell embryos (Lawinger et al., J.
Biol. Chern. 274, 8002-8011, 1999). The nature of these coactivators is unknown; they may arise by modification of pre-existing maternal proteins or from early transcription-dependent protein synthesis in the 2-cell 2S embryo. Such process may involve cytoplasmic MATER. Alternatively, MATER
might be involved in one or more interactions that are required for cell cycle progression beyond the 2-cell stage.
Identification and characterization of proteins that interact with MATER will provide insights into the role of this maternal protein in promoting embryonic survival and early development.
Mater is the first maternal effect gene demonstrated to play a critical role in early mammalian development and the observed sterile phenotype raises the possibility that the absence of a similar molecule could be a cause of human infertility.
EXAMPLE 2:
Identification of the Human MATER cDNA
3S The human MATER cDNA was identified based on its homology to the mouse MATER
cDNA sequence by searching the collection of hwnan High Throughput Genomic (HTG) Sequences, maintained by NCBI and the National Library of Medicine. Using the isolated and discontinuous nucleotide fragments identified in this search, the inventors devised oligonucleotide primers pairs (for instance, SEQ ID NOs: 7 and 8, 19 and 20, and 21 and 22) that where used to amplify MATER
sequence from purified human ovarian DNA or mRNA/cDNA, and to isolate a partial cDNA clone from a human cDNA library, using standard techniques.
The sequence of two long fragments of the human MATER cDNA is shown in SEQ ID
NO:
1 and 3. Together, these two long cDNA fragments constitute 2213 nucleotides of the complete human MATER cDNA.
The deduced human MATER protein portions encoded cDNA fragment 1 (SEQ ID NO:
1) and fragment 2 (SEQ ID NO: 3) are shown in SEQ ID NOs: 2 and 4, respectively.
Using these sequences, the remainder of the human MATER cDNA has been identified; the sequence of the full length cDNA is shown in SEQ ID NO: 23. Overall, the first 75 nucleotides of human MATER (1-75) and the corresponding deduced amino acids (1-25) were determined by comparison to published human genomic DNA sequences, while the remainder of the Mater sequence was determined by direct cloning and sequencing of human ovarian cDNAs. The complete sequence of the human MATER protein is shown in SEQ ID NO: 24.
EXAMPLE 3:
Detection of Mater RNA in human ovarian total RNA
This example provides one method of detecting MATER RNA in human ovarian total RNA.
Human ovarian total RNA from a 19-year-old woman was obtained under an IRB-approved protocol (McGill University, Montreal, Canada) and the use of it was approved by the NIH office of Human Subjects Research. Ovarian RNA from a 26 year old woman was purchased from BioChain Inc. (Hayward, CA, USA). Separation of human ovarian total RNA (10 fig) was performed by 1%
agarose/formaIdehyde gel electrophoresis. The RNA was transferred onto a nitrocellulose membrane to prepare a Northern blot. Human Mater cDNA (~0.5 kb) was labeled with a-[32P]dCTP (3000 Ci/mmol; ICN, Costa Mesa, CA, USA) using Ready-To-Go DNA dCTP Beads (Pharmacia, Inc., Piscataway, NJ, USA). Blots were hybridized (68°C, 2 hours) with 3zP-labeled cDNA probe (~0.5 kb) in QuikHyb solution (Stratagene, La Jolla, CA, USA). After washing the blots with a solution of O.lxstandard saline citrate/0.1% sodium dodecyl sulfate (SDS) at 65°C, the hybridization signals were detected by autoradiography.
This Northern blot hybridization revealed the presence of a single ~4.2 kb MATER
transcript in the human ovarian total RNA (Figure 8A). The human MATER
transcripts appeared to be larger than the mouse MATER transcript (3.75 kb). The relatively greater abundance of MATER
mRNA detected in the ovarian RNA from a 19 year old woman (lane 1), compared with the RNA
from a 26 year old woman (lane 2), may reflect the relatively greater number of oocytes present in ovaries from younger women.
EXAMPLE 4:
1z vitro amplification via PCR for human MATER transcripts This example provides one method of detecting MATER transcripts in RNA samples from different tissues.
To determine whether expression of human MATER transcripts is ovarian-specific, in vitro amplification (in this case, PCR amplification) reactions were carried out using cDNA that were derived from human RNA of 24 different tissues (Human Rapid-Scan Gene Expression Panel).
Human ovarian cDNA (Invitrogene; Origene), human ovarian cDNA library (Clonetech), and the Human Rapid-Scan Gene Expression Panel (Origene), were used as templates for PCR
reactions, essentially following the manufacturer's instructions. Taq DNA
polymerase (Life Technologies, Rockville, MD, USA) was used to amplify DNA products expected within 1.5 kbp at a condition of the PCR reaction (95°C, 1 minute; 60°C, 1 minute;
72V, 2 minutes; and 72V, 10 minutes for further extension). Platinum PCR SuperMix (Life Technologies) was used for amplification of DNA products (2-5 kb) with prolonging extension time at 72°C in every cycle, according to the product's manual. The PCR products were electrophoresed on agarose gels containing 0.1% ethidium bromide and subcloned into a TA cloning vector (Invitrogen) for DNA
sequencing.
As a control, as shown in figure 8B, the PCR products (640 base pairs) of human (3-actin were amplified in all cDNA derived from 25 tissues and human ovary (lanes 1-25) using the human (3-actin-specific primers (5'-GCATGGGTCAGAAGGAT-3'/3'-GTCCAGTAGTGGTAACC'S';
SEQ
ID NOs: 39 and 40). In contrast, using human MATER -specific primers, (5'-TGACTTCTGATTGCTGTGAGG-3'/3'--CTACTGGCCATGACCACCTT-5 ; SEQ ID NOs: 41 and 42), the PCR products (280 base pairs) were only generated in the cDNA
synthesized from the ovarian RNA (Figure 8C, lanes 17 and 25).
EXAMPLE 5:
Southern Blot Hybridization OF Human MATER cDNA to PCR-amplified MATER
Transcripts This example provides one method of confirming the identity of the DNA
amplified using MATER-specific PCR primers.
Ovarian-specific expression of the human MATER transcripts was further evidenced by a Southern blot hybridization of the human MATER primer-amplified PCR reactions probed with radiolabeled MATER cDNA (Figure 8D).
PCR products obtained in Example 5 were separated by 2% agarose gel electrophoresis and transferred onto a nitrocellulose membrane to prepare a Southern blot. Human MATER cDNA (~0.5 kbp) was labeled with a-[32P]dCTP (3000 Ci/mmol; ICN, Costa Mesa, CA, USA) using Ready-To-Go DNA dCTP Beads (Pharmacia, Inc., Piscataway, NJ, USA). Blots were hybridized (68°C, 2 hours) with 3ZP-labeled cDNA probe (rv0.5 kbp) in QuikHyb solution (Stratagene, La Jolla, CA, USA). After washing the blots with a solution of O.lx standard saline citratel0.1% sodium dodecyl sulfate (SDS) at 65°C, the hybridization signals were detected by autoradiography.
EXAMPLE 6:
Localization of Human MATER transcript This example provides one method for detecting expression of the human MATER
transcript.
To produce in situ hybridization probes, human genomic DNA was amplified using the following primers:
5'-primer: 5'- TTTCACATGAACATCCTTCTCC-3' (SEQ ID NO: 7);
3'-primer: 5'-AGTGCTGGAGGCAGAAGGAAG-3' (SEQ ID NO: 8).
The resultant amplified nucleic acid molecule product size was 496 bp, and is predicted to fall within exon 7 of the human MATER gene, based on comparison to the murine MATER exon-intron map.
This fragment was subcloned into pBluscript vector as a DNA template. Both 35S-UTP-labeled sense and antisense sequences were synthesized by in vitro transcription using T3 and T7 RNA
polymerases.
In situ hybridization was carried out essentially as described previously (Tong & Nelson, Endocrinology 140:3720-3726, 1999). Briefly, the probes were prepared by alkaline hydrolysis and hybridized with frozen human ovarian sections at 60 °C for 24 hours.
After dipping in Kodak NTB-2 emulsion, the slides were exposed to film for 2-3 days and the autoradiographs developed.
The frozen human ovarian sections were hybridized with the radio-labeled sense (FIG. 9A
and 9C) and antisense (B and D) probes. The slides were stained with hematoxylin and eosin. For each probe, bright-field (A and B) and dark-field (C and D) images are displayed. MATER transcript was localized to oocytes.
EXAMPLE 7:
In situ hybridization with MATER probes This example provides another method for detecting expression of the human MATER
transcript.
Both [35S]UTP-labeled sense and antisense probes were synthesized by in vitro transcription using human MATER cDNA as templates and T3/T~ RNA polymerase (Ambion, Inc., Austin, TX, USA). Short probes 0300 nt) of alkaline hydrolysis were hybridized at 60°C for 24 hours with frozen sections (8~) of human ovary obtained from the National Disease Research Institute (NDRI;
Philadelphia, PA, USA). After dipping in Kodak NTB-2 emulsion, the slides were exposed for 1 week on an X-ray film for developing in Kodak D-19 and Kodak Fixer. The slides were finally stained with hematoxylin and eosin, and examined by microscopy under both light and dark fields.
In situ hybridization revealed the oocyte-specific expression of human MATER
transcripts.
As shown in Figure 8E, the hybridization signals using synthetic human MATER
antisense probe were present within the oocytes but not in the follicular cells. The control MATER
sense probes did not hybridize with oocytes or the ovarian cells (Figure 8F). Thus, the oocyte-restricted expression of the human MATER gene appears similar to the expression pattern of the mouse MATER
gene.
EXAMPLE 8:
Localization of Human MATER Protein This example provides one method for examining the localization of human MATER
protein.
In situ localization was carried out essentially as described for marine samples (see, Tong and Nelson, Endoerinolo~ 140:3720-3726, 1999). Briefly, rabbit polyclonal antibody to a marine MATER C-terminal peptide (residues 1093 through 1111 of SEQ ID NO: 6) was prepared as described in Example 18C. Frozen human ovarian sections were incubated with this antiserum (1:200), and FITC-conjugated goat anti-rabbit IgG antiserum was used as the secondary antibody to detect human MATER protein in the oocyte (FIG. 10A). FIG. 10B shows the phase contrast images corresponding to the samples in FIG. 10A.
EXAMPLE 9:
Expression of Human MATER Protein in Oocytes This example provides one method for examining the localization of human MATER
protein.
After blocking with 10% normal goat sera in phosphate-buffered saline (PBS), frozen sections (8~) of human ovary (NDRI) were incubated at 25°C for 2 hours with rabbit antisera (1:200) specific to mouse Mater peptide. The slides were washed with 0.05% Tween-20 in PBS, and incubated with a goat anti-rabbit IgG antibody conjugated with fluorescein isothiocyanate (1:300;
Sigma Chemical Co., St. Louis, MO, USA). After washing and applying with glycerol-glass cover, the slides were examined under fluorescent microscopy.
No fluorescence was observed in somatic cells in the ovarian section other than the oocytes (Figure 11A and 11B). Normal rabbit sera did not stain the oocytes.
EXAMPLE 10:
Immunoblotting to Determine the Size of Native MATER Protein This example provides one method for determining the size of the native Mater protein.
Human immature oocytes were supplied for this study by a clinical IVF program (Rockvill Reproductive Science Center, Rockville, MD, USA) after obtaining consent and approval of the NIH
office of Human Subjects Research. For immunoblotting, human oocyte proteins were separated on a 3-8% Tris-acetate SDS-polyacrylamide gel electrophoresis. After transferring onto a nitrocellulose membrane, 5% dry milk in PBS was used to block non-specific binding in the blot. Subsequently, the blot was incubated with rabbit anti-Mater peptide antibody (1:1000) for 2 hours at 25°C. After the blot was washed, the primary antibody-bound proteins were detected by a goat anti-rabbit IgG
antibody (1:1000) labeled with horseradish peroxidase using an enhanced chemiluminescence system according to the manufacturer's instructions (Amersham/Pharmacia, Inc., Piscatoway, NJ, TJSA).
As shown in Figure 11 C, human MATER protein 0134 kDa) was detected in the preparation of the human oocyte proteins using anti-mouse MATER antibody. It was noted that there were two close signals of MATER proteins present in the immunoblotting. This might reflect a post-translational modification of human MATER protein or the possibility of an alternative initiation site in the synthesis of the polypeptide chain.
EXAMPLE 11:
Methods of Making Human MATER cDNA
The original means by which the Mater cDNA was identified and obtained is described above. With the provision of the sequence of the large portions of the MATER
protein (SEQ ID
NOs: 2 and 4) and encoding nucleic acid molecules (SEQ ID NOs: 1 and 3), nucleotide amplification (such as polymerase chain reaction (PCR)) now may be utilized in a simple method for producing the MATER cDNA.
Total RNA is extracted from human cells by any one of a variety of methods well known to those of ordinary skill in the art. Sambrook et al. (In Molecular Cloning: A
Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992) provide descriptions of methods for RNA isolation.
Because MATER is expressed in oocytes, human cell lines derived from oocytes or ovaries can be used as a source of such RNA. The extracted RNA is then used as a template for performing reverse transcription-polymerase chain reaction (RT-PCR) amplification of cDNA.
Methods and conditions for RT-PCR are described in Kawasaki et al., (In PCR Protocols, A Guide to Methods and Applications, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California, 1990).
The selection of amplification primers will be made according to the portions) of the cDNA
that is to be amplified. Primers may be chosen to amplify a segment of a cDNA
or the entire cDNA
molecule. Variations in amplification conditions may be required to accommodate primers and amplicons of differing lengths and composition; such considerations are well known in the art and are discussed for instance in Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990). By way of example, the majority of the coding portion of the human MATER cDNA molecule (approximately 2.8 kb) may be amplified using the following combination of primers:
5'-primer (part of exon 7):
5'-CAGGAATTGGGAAATCGGCTCTCTAG-3' (SEQ ID NO.: 9);
3'-primer (end of exon 15):
5'-CCAAATGCTTTGTGTTTATTTAATTCC-3' (SEQ ID NO.: 10).
One of ordinary skill can use the full length human MATER cDNA sequence provided herein (SEQ
ID NO: 23) to devise primers that could be used to amplify the entire cDNA
using known techniques.
The following set of four primers can be used to amplify 950 by at the 5'-end of human MATER cDNA:
The 5'-primers are the universal adapter primers (ADP) for 5'-RACE-PCR as follows (OriGene Technologies, Inc, Rockville, MD):
ADPl: 5'-CGGAATTCGTCACTCAGCG-3' (SEQ ID NO.: 11) ADP2: 5'-AGCGCGTGAATCAGATCG-3' (SEQ ID NO.: 12) The 3'-primers are gene-specific primers (GSP) for human MATER cDNA within exon 7, as follows:
GSP1: 5'-ATTCCCTGGTAGAGTCCACCTTGC-3' (SEQ ID NO.: 13) GSP2: 5'-ACAGCACGATCCTTCTGGCTAGAG-3' (SEQ ID NO.: I4).
GSP 1 is used as a primer for reverse transcription of human ovarian RNA to synthesize cDNA. The reverse transcribed cDNAs are then adapted at the 5'-end by ADP1 primer, then amplified for the first round of PCR using ADP1 and GSP1 primers. The second round of PCR
amplification is followed using PCR products from the first round as template, and ADP2 and GSP2 as primers.
Fragment 1 of the human MATER cDNA (SEQ ID NO: 1 ) may be amplified using the following combination of primers:
5'-primer: 5'-CAAGCTCCGGTGACGGAGATCAT-3' (SEQ ID NO.: 15);
3'-primer: 5'-AGCTGGAGGCAGAAGGAAGATG-3' (SEQ ID NO.: 16).
The 3'-terminal region of the human MATER cDNA molecule (also referred to herein as human MATER cDNA fragment 2, SEQ ID NO: 3) may be amplified using the following combination of primers:
5'-primer: 5'-TCTGGCCTCAGCCCTCGTCAGCTTGAC-3' (SEQ ID NO.: 17);
3'-primer: 5'-CCAAATGCTTTGTGTTTATTTAATTCC-3' (SEQ ID NO.: 18).
These primers are illustrative only; one skilled in the art will appreciate that many different primers may be derived from the provided cDNA sequence in order to amplify particular the indicated regions MATER cDNA, as well as to complete the sequence of the human MATER cDNA.
Re-sequencing of PCR products obtained by these amplification procedures is recommended; this will facilitate confirmation of the amplified sequence and will also provide information on natural variation on this sequence in different populations or species.
Oligonucleotides derived from the provided MATER sequences provided may be used in such sequencing methods.
Orthologs of human MATER can be cloned in a similar manner, where the starting material consists of cells taken from a non-human species. Orthologs will generally share at least 80%
sequence homology with the disclosed human MATER cDNA. Where the non-human species is more closely related to humans, the sequence homology will in general be greater.
Closely related orthologous MATER molecules may share at least 82%, at least 85%, at least 90%, at least 91%, at least 93%, at least 95%, or at least 98% sequence homology with the disclosed human sequences.
Oligonucleotides derived from the human MATER cDNA sequence (SEQ ID NO: 23), or fragments thereof (such as SEQ ID NOs: 1 and 3), are encompassed within the scope of the present disclosure. Preferably, such oligonucleotide primers will comprise a sequence of at least 23 consecutive nucleotides of the Mater nucleic acid sequence. To enhance amplification specificity, oligonucleotide primers comprising at least 25, 30, 35, 40, 45 or 50 consecutive nucleotides of these sequences may also be used. These primers for instance may be obtained from any region of the disclosed sequences. By way of example, the human Mater cDNA, ORF and gene sequences may be apportioned into about halves or quarters based on sequence length, and the isolated nucleic acid molecules (e.g., oligonucleotides) may be derived from the first or second halves of the molecules, or any of the four quarters. The murine MATER cDNA, shown in SEQ ID NO: 5, can be used to illustrate this. The human MATER cDNA is 3447 nucleotides in length and so may be hypothetically divided into about halves (nucleotides 1-1723 and 1724-3447) or about quarters (nucleotides 1-862, 863-1723, 1724-2586 and 2587-3447). The human cDNA can be likewise apportioned, or can be described in terms of the fragments presented herein (e.g., fragment 1, corresponding to around about nucleotide 1700 through around about 1950 of murine Mater; and fragment 2 of the human Mater cDNA, corresponding to the 3'-terminal region of murine Mater cDNA, around about nucleotide 2500 through the polyA tail of the murine Mater cDNA).
Also encompassed herein are oligonucleotides from within the human MATER gene, for use in the methods described herein. These include, but are not limited to, oligonucleotides that span or include the sequence spanning an intron-exon boundary of the human MATER gene (see Table 2).
Nucleic acid molecules may be selected that comprise at least 15, 20, 23, 25, 30, 35, 40, 50 or 100 consecutive nucleotides of any of these or other portions of the human MATER cDNA. Thus, representative nucleic acid molecules might comprise at least 15 consecutive nucleotides of the human MATER cDNA (SEQ ID NO: 23), or fragment 1 or fragment 2 of the disclosed human Mater coding sequence (SEQ ID NOs: 1 and 3, respectively).
EXAMPLE 12:
Isolation of Human MATER cDNA
This example provides another method of making human MATER cDNA.
Human MATER oligonucleotide primers were designed to amplify, using PCR, nucleic acids from human ovarian cDNA and a library produced therefrom (see Example 4).
Using the PCR-cloned cDNA as the probes for in situ hybridization, human oocytes were confnmed to express the corresponding transcripts (see Example 5). DNA sequencing revealed that these PCR products are human MATER cDNA homologous to the mouse Mater cDNA.
The PCR products were generated to span ~98% of the coding region from nt 76 to nt 3596.
The 3' non-coding regions were determined by sequencing cDNA clones isolated from the human ovarian cDNA library using the PCR-cloned cDNA as probe. The first 75 nt at the 5' end were derived from a predicted cDNA of the genomic clone AC011470 (http://www.ensemble.org). The non-coding region present at the 5' end of the Mater cDNA remains undetermined. Assuming the presence of a poly(A) tail 0150-200 nt), assembly of the determined human MATER cDNA
sequence, its poly(A) tail and 5' undetermined non-coding region correspond in size with the MATER
transcripts detected in the Northern hybridization (4.2 kb; Example 3). This suggests that the cloned cDNA sequence represents a full-length coding region.
As shown in Figure 12, the open reading frame (nt 1 to nt 3600) of the cloned cDNA (3885 nt) encodes a protein composed of 1200 amino acids. The entire polypeptide chain is predicted to have a I 6.08 and a molecular mass of 134,235.76 DA, which corresponded to the size of the human oocyte protein recognized by the antisera specific to murine Mater peptide.
Expression of a recombinant protein further confirmed the cloned cDNA to encode the human MATER protein.
The initiator code (ATG) encoding the first methionine in the open reading frame (ORF) was in a context (ATCATGAAG), the consensus sequence recognized for initiation in vertebrates. The stop codon (TGA) was followed by 282 nt of the 3' non-coding sequence. A
signal sequence (AATAAA) for polyadenylation was located just 18 nt upstream of the poly(A) tail. None of the known genes and proteins deposited in GenBank was found to have significant homologies to the human MATER gene or MATER protein. However, the carboxyl-terminal sequence of the human MATER peptide had a ~32% homology with human and porcine ribonuclease inhibitors (457 residues). Thus, human MATER contains a structural domain of the ribonuclease inhibitor-like Leucine-rich repeats at the carboxy terminus, as found in mouse. The human and mouse MATER
cDNAs share 67% homology, while their deduced polypeptide chains share 53%
amino acid identity.
EXAMPLE 13:
Analysis of Human MATER Polypeptide Chain This example provides one method of analyzing the structural domains of the human MATER protein.
Computational analyses of DNA sequences and deduced peptide sequences were conducted using software available at the National Center for Biotechnology Information at NIH
(http://www.nbci.nlm.nih.gov), the EMBL-EBI (http://www.ensemble.org), the Sanger Center (http://www.sanger.ac.uk) and the ExPASy Molecular Biology Server of the Swiss Institute for Bioinformatics (hrip://www.expasy.ch).
A computational analysis was carried out to search for the structural features of the human MATER protein. When the entire polypeptide chain of human MATER was compared with itself, the DotPlot analysis revealed the presence of repeat structural motifs at amino-and carboxyl-termini.
These repeats were evidenced by a series of parallel but offset lines in these regions (Figure 13A), as also seen in the mouse MATER protein. A comparison between the polypeptide chains of human and mouse MATER indicated the similarities and homologies of their structural motifs and compositions (Figure 13B).
A hydrophobicity plot (Figure 14A) indicated that there were hydrophilic regions present at amino- (32-304 residues) and carboxyl-termini (1184-1200 residues). No structural motifs were found for either peptide signals of protein secretion, or for transmembrane domains. The peptide chain had some notable motifs, as indicated in Figure 14B. A signal for nuclear localization was present at the residue 517-534 (NLS BP), which was not detected in the mouse MATER. There appears to be no recognizable peptide domains for DNA binding. Further experimental evidence is required to determine if the human MATER is translocated into nuclei.
Human MATER protein had six Leucine-rich repeats at the carboxyl-terminus, and a PAAD DAPIN domain (52-148 residues), both of which are recognized as the structural basis for protein-protein interactions. Their presence implies that human MATER
interacts with other oocyte proteins to perform its function. In addition, human MATER protein had an aldo ket red domain (71-87) at the amino-terminus, and an ATP-/GTP-binding domain (P-loop) at residue 286-293. The aldo ket red is a domain present in protein with oxireductase activity, and the P-loop is the typical domain for binding to ATP/GTP in participating in an intracellular signal transduction.
EXAMPLE 14:
Genomic Organization of the Human MATER Locus This example provides a method of determining the size and numbers of exons and introns in the MATER genomic sequence.
Using the sequence of cloned human MATER cDNA, one human genomic clone (GenBank Accession Number AC011470) was determined to carry an entire gene locus of human MATER.
Using the sequence of the cloned human MATER cDNA to blast the human hgts database (which is accessible on-line, for instance via the NCBI web site), a single genomic clone (ACOl 1470) that had been fully sequenced was determined to harbor an entire gene locus of human MATER.
To determine the number and size of the exons and introns, the sequence of the cloned cDNA was compared with the sequence of the AC011470c1one isolated from human chromosome 19 (Fig. 15 A and B). The AG-exon-GT rule was applied to determine a splicing site between exon and introns (Table 2).
The 15 exons and 14 introns were identified to span a ~63 kb region of DNA.
The exons ranging in size from 56 to 1597 by were intervened by 14 introns ranging from 760 to 9327 by (Table 2). In addition, there were 282 nucleotides of the 3' non-coding region within exon 15, and undetermined nucleotides of the S' non-coding region within exon 1. The sequences switching between each exon and introns were confirmed to meet with the bordering consensus sequences (AG--GT) for splice sites of the exon-intron. Thus, the human MATER locus spanned a ~63 kb DNA and was composed of the 15 exons and 14 introns.
Table 2. Exon and intron and splice-junction sequences of human MATER
Exon Splice-junction sequences Intron No. Position Length Exon No. Length 101 1-62 >62 .......... 1 GTCGACAGCC 1 3928 Human MATER and mouse Mater loci had identical numbers of exons and introns, while the human locus was longer than the mouse locus (32 kbp). This mainly reflects the larger size of the human introns. The counterpart exons were comparable. Both had a large exon 7 spanning ~50% of the coding sequences, and the counterparts of exons 8-14 had an identical number of nucleotides.
However, the first six exons (1-6) in the human locus ranged in size from 56-380 nt, while their counterparts in the mouse locus had 48-78 nt. A larger exon 2 (380 nt) in the human MATER locus made the human MATER cDNA coding region (3600 nt) slightly longer than the mouse cDNA coding region (3333 nt). All of these structural similarities and variations reflect conservation and evolution between mouse Mater and human MATER loci.
EXAMPLE 15:
Cloning of the Mater Genomic Sequence (or Gene) The Mater cDNA sequence and fragments thereof described above does not contain introns, upstream transcriptional promoter or regulatory regions or downstream transcriptional regulatory regions of the MATER gene. It is possible that some mutations in the MATER
gene that may lead to defects in embryo development, infertility, or reduced fertility are not included in the cDNA but rather are located in other regions of the MATER gene. Mutations located outside of the open reading frame that encodes the MATER protein are not likely to affect the functional activity of the protein, but rather are likely to result in altered levels of the protein in the cell.
For example, mutations in the promoter region of the MATER gene may prevent transcription of the gene and therefore lead to the complete absence of the MATER protein in the cell.
Additionally, mutations within intron sequences in the genomic gene may also prevent expression of the MATER protein. Following transcription of a gene containing introns, the intron sequences are removed from the RNA molecule in a process termed splicing prior to translation of the RNA molecule which results in production of the encoded protein. When the RNA
molecule is spliced to remove the introns, the cellular enzymes that perform the splicing function recognize sequences around the intron/exon border and in this manner recognize the appropriate splice sites. If there is a mutation within the sequence of the intron close to the junction of the intron with an exon, the enzymes may not recognize the junction and may fail to remove the intron.
If this occurs, the encoded protein will likely be defective. Thus, mutations inside the intron sequences within the MATER gene (termed "splice site mutations") may also lead to defects in embryo development.
However, knowledge of the exon structure and intronic splice site sequences of the MATER gene is required to define the molecular basis of these abnormalities.
The provision herein of the MATER cDNA sequence and the sequence of the MATER
gene (as now identified within AC011470) enables the cloning of the entire MATER
gene (including the promoter and other regulatory regions and the intron sequences). With this information in hand, diagnosis of a genetic predisposition to fertility defects based on DNA
analysis will comprehend all possible mutagenic events at the MATER locus.
The MATER gene may be isolated by one or more routine procedures, including direct sequencing of one or more BAC or PAC clones that contain the MATER sequence.
Alternatively, using the information provided herein, in particular the identification of the entire gene sequence from within GenBank Accession No. AC011470, portions of the MATER gene (or the entire gene) can be amplified from genomic DNA using in vitro amplification techniques. For long portions of the gene, or the entire gene, it may be advantageous to use techniques especially tailored to amplification of long sequences. Such techniques are known to those of ordinary skill in the art.
With the sequences of human MATER cDNA and gene in hand, primers derived from these sequences may be used in diagnostic tests (described below) to determine the presence of mutations in any part of the genomic MATER gene of a patient. Such primers will be oligonucleotides comprising a fragment of sequence from the MATER gene (intron sequence, exon sequence, or a sequence spanning an intron-exon boundary) and may include at least 10 consecutive nucleotides of the MATER cDNA or gene. Specific examples of such oligonucleotides include those comprising the sequences shown in SEQ ID NOs: 25-38. It will be appreciated that greater specificity may be achieved by using primers of greater lengths. Thus, in order to obtain enhanced specificity, the primers used may comprise 15, 17, 20, 23, 25, 30, 40 or even 50 consecutive nucleotides of the MATER cDNA or gene, particularly overlapping an intron-exon boundary.
Furthermore, with the provision of the MATER intron sequence information, the analysis of a large and as yet untapped source of patient material for mutations is now possible using methods such as chemical cleavage of mismatches (Cotton et al., Proc. Natl. Acad. Sci. USA 85:4397-4401, 1985;
Montandon et al., Nucleic Acids Res. 9:3347-3358, 1989) and single-strand conformational polymorphism analysis (Orita et al., Genomics 5:874-879, 1989).
Additional experiments may be performed to identify and characterize regulatory elements flanking the MATER gene. These regulatory elements may be characterized by standard techniques including deletion analyses wherein successive nucleotides of a putative regulatory region are removed and the effect of the deletions are studied by either transient or long-term expression analyses experiments. The identification and characterization of regulatory elements flanking the genomic MATER gene may be made by functional experimentation (deletion analyses, etc.) in mammalian cells by either transient or long-term expression analyses.
It will be apparent to one skilled in the art that either the genomic clone or the cDNA or sequences derived from these clones may be utilized in applications, including but not limited to, studies of the expression of the MATER gene, studies of the function of the MATER protein, the generation of antibodies to the MATER protein diagnosis and therapy of MATER
deleted or mutated patients to prevent or treat the defects in embryo development. Descriptions of applications describing the use of MATER cDNA, or fragments thereof, are therefore intended to comprehend the use of the genomic MATER gene.
It will also be apparent to one skilled in the art that homologs of this gene may now be cloned from other species, such as the rat or a monkey, by standard cloning methods. Such homologs will be useful in the production of animal models of onset and development of autoimmune infertility, and early embryogenesis. In general, such orthologous MATER molecules will share at least 70%
sequence identity with the human MATER nucleic acid disclosed herein; more closely related orthologous sequences will share at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% sequence identity with this sequence.
EXAMPLE 16:
Mater Nucleic Acid and Amino Acid Sequence Variants With the provision of human MATER protein fragments and corresponding nucleic acid sequences herein, the creation of variants of these sequences is now enabled.
Variant MATER proteins include proteins that differ in amino acid sequence from the human MATER sequences disclosed but that share at least 65% amino acid sequence homology with the provided human MATER protein. Other variants will share at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% amino acid sequence homology.
Manipulation of the nucleotide sequence of Mater using standard procedures, including for instance site-directed mutagenesis or PCR, can be used to produce such variants. The simplest modifications involve the substitution of one or more amino acids for amino acids having similar biochemical properties. These so-called conservative substitutions are likely to have minimal impact on the activity of the resultant protein. Table 3 shows amino acids that may be substituted for an original amino acid in a protein, and which are regarded as conservative substitutions.
Table 3 Original Residue Conservative Substitutions Ala ser Arg lys Asn gln; his Asp glu Cys ser Gln asn Glu asp Gly pro His asn; gln Ile leu; val Leu ile; val Lys arg; gln; glu Met leu; ile Phe met; leu; tyr Ser thr Thr ser Trp tyr Tyr trp; phe Val ile; leu More substantial changes in enzymatic function or other protein features may be obtained by selecting amino acid substitutions that are less conservative than those listed in Table 3. Such changes include changing residues that differ more significantly in their effect on maintaining polypeptide backbone structure (e.g., sheet or helical conformation) near the substitution, charge or hydrophobicity of the molecule at the target site, or bulk of a specific side chain. The following substitutions are generally expected to produce the greatest changes in protein properties: (a) a hydrophilic residue (e.g., seryl or threonyl) is substituted for (or by) a hydrophobic residue (e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl); (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain (e.g., lysyl, arginyl, or histadyl) is substituted for (or by) an electronegative residue (e.g., glutamyl or aspartyl); or (d) a residue having a bulky side chain (e.g., phenylalanine) is substituted for (or by) one lacking a side chain (e.g., glycine).
Variant MATER encoding sequences may be produced by standard DNA mutagenesis techniques, for example, M13 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (In Molecular Cloning: A Laboratory Marraral, CSHL, New York, 1989), Ch. 15. By the use of such techniques, variants may be created that differ in minor ways from the human MATER
sequences disclosed. DNA molecules and nucleotide sequences that are derivatives of those specifically disclosed herein, and which differ from those disclosed by the deletion, addition, or substitution of nucleotides while still encoding a protein that has at least 82% sequence identity with the human MATER encoding sequence disclosed (SEQ ID NOs: 1 and 3), are comprehended by this disclosure. Also comprehended are more closely related nucleic acid molecules that share at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% nucleotide sequence homology with the disclosed Mater sequences. In their most simple form, such variants may differ from the disclosed sequences by alteration of the coding region to fit the codon usage bias of the particular organism into which the molecule is to be introduced. The full length human MATER cDNA (SEQ
ID NO: 23) is also encompassed in the disclosure, and as a molecule that comprises both fragment 1 (SEQ ID NO:
1) and fragment 2 (SEQ ID NO: 3), and encoding the human MATER protein with described physical characteristics and biological properties.
Alternatively, the coding region may be altered by taking advantage of the degeneracy of the genetic code to alter the coding sequence such that, while the nucleotide sequence is substantially altered, it nevertheless encodes a protein having an amino acid sequence substantially similar to the disclosed human MATER protein sequences. For example, because of the degeneracy of the genetic code, four nucleotide codon triplets - (GCT, GCG, GCC and GCA) - code for alanine. The coding sequence of any specific alanine residue within the human MATER protein, therefore, could be changed to any of these alternative codons without affecting the amino acid composition or characteristics of the encoded protein. Based upon the degeneracy of the genetic code, variant DNA
molecules may be derived from the cDNA and gene sequences disclosed herein using standard DNA
mutagenesis techniques as described above, or by synthesis of DNA sequences.
Thus, this disclosure also encompasses nucleic acid sequences that encode a MATER protein, but which vary from the disclosed nucleic acid sequences by virtue of the degeneracy of the genetic code.
Variants of the MATER protein may also be defined in terms of their sequence identity with the prototype human MATER protein. As described above, human MATER proteins share at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% amino acid sequence identity with the human MATER protein (SEQ ID NO: 24) or fragments disclosed herein (such as SEQ ID NOs: 2 and 4). Nucleic acid sequences that encode such proteins/fragments readily may be determined simply by applying the genetic code to the amino acid sequence of an MATER
protein or fragment, and such nucleic acid molecules may readily be produced by assembling oligonucleotides corresponding to portions of the sequence.
Variant MATER proteins may contain one or more variant amino acids (amino acids different from the prototypical sequence provided herein). For instance, specific variant MATER
proteins have at least two, at least three, at least 4, at least 5, at least 6, at least 8, at least 10, at least 15, at least 20, or even 25, 30, 50, 100 or more variant amino acids compared to the prototypical MATER sequence (SEQ ID NO: 24).
Particular embodiments include MATER variant proteins wherein at least one amino acid sequence variation is within a recognized protein domain or recognized functional sequence. Specific examples include variations in one of the Leucine-rich repeats at the carboxyl-terminus, the PAAD-DAPIN domain (52-148 residues), the aldo ket red domain (71-87) at the amino-terminus, or the ATP-/GTP-binding domain (P-loop) at residue 286-293. Thus, in particular examples a variant MATER protein (or nucleic acid encoding such) will include one or more residue changes in a leucine-rich repeat, or in the PAAD DAPIN domain; such example proteins may have differential interactions with other proteins in the cell. Specific variant MATER proteins of this type are interaction-disruptive, and affect (e.g., inhibit or enhance) MATER function in the cell, and may be defective in one or more other activities of the MATER protein.
In other embodiments, a variant MATER protein (or nucleic acid encoding such) has one or more sequence variations in the aldo ket red domain. Specific examples of such variants disrupt an oxireductase activity of the protein, and may be defective in one or more other activities of the MATER protein.
In still other embodiments, a variant MATER protein (or nucleic acid encoding such) has one or more sequence variations in the ATP-IGTP-binding domain (P-loop).
Examples of such variant proteins are defective in ATP and/or GTP binding and may be defective in one or more other activities of the MATER protein.
In some embodiments, a variation in the amino acid sequence occurs in each of two or more such defined domains.
In still other embodiments, a protein sequence variation occurs outside of these defined domains. Examples of such variants include variants occurring, for instance, in any one of residues 149 through 285. Specific examples of such variant proteins will include more than one sequence variation.
Nucleic acid molecules that are derived from the human MATER cDNA nucleic acid sequences disclosed include molecules that hybridize under stringent conditions to the disclosed prototypical MATER nucleic acid molecules, or fragments thereof. Stringent conditions are hybridization at 65° C in 6 x SSC, 5 x Denhardt's solutions 0.5% SDS
and 100 ~g/ml sheared salmon testes DNA, followed by 15-30 minute sequential washes in 2 x SSC, 0.5% SDS, followed by 1 x SSC, 0.5% SDS and finally 0.2 x SSC, 0.5% SDS, at 65° C.
Low stringency hybridization conditions (to detect less closely related homologs) are performed as described above but at 50°C (both hybridization and wash conditions); however, depending on the strength of the detected signal, the wash steps may be terminated after the first 2 x SSC wash.
Human MATER nucleic acid encoding molecules (including the cDNA shown in SEQ
ID
NO: 23 and fragments shown in SEQ ID NOs: 1 and 3, and nucleic acids comprising these sequences), and orthologs and homologs of these sequences, may be incorporated into transformation or expression vectors.
EXAMPLE 17:
Expression of MATER Protein and Variants thereof With the provision of human MATER cDNA sequence fragments, and methods for determining and cloning the full length human MATER cDNA, the expression and purification of the MATER protein by standard laboratory techniques is now enabled. Purified human MATER protein may be used for functional analyses, antibody production, diagnostics, and patient therapy.
Furthermore, the DNA sequence of the MATER cDNA can be manipulated in studies to understand the expression of the gene and the function of its product. Mutant forms of the human MATER may be isolated based upon information contained herein, and may be studied in order to detect alteration in expression patterns in terms of relative quantities, cellular localization, tissue specificity and functional properties of the encoded mutant MATER protein. Partial or full-length cDNA sequences, which encode for the subject protein, may be ligated into bacterial expression vectors. Methods for expressing large amounts of protein from a cloned gene introduced into Escherichia coli (E. coli) may be utilized for the purification, localization and functional analysis of proteins. For example, fusion proteins consisting of amino terminal peptides encoded by a portion of the E.
coli lacZ or trpE gene linked to MATER proteins may be used to prepare polyclonal and monoclonal antibodies against these proteins. Thereafter, these antibodies may be used to purify proteins by immunoaffmity chromatography, in diagnostic assays to quantitate the levels of protein and to localize proteins in tissues and individual cells by immunofluorescence. Such antibodies may be specific for epitope tags, which can be added to the expression construct for identification an/or purification purposes.
Intact native protein may also be produced in E. eoli in large amounts for functional studies.
Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al. (Sambrook et al., In Molecular Cloning: A
Laboratory Manxfal, Ch. 17, CSHL, New York, 1989). Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response. Native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ribosome-binding site upstream of the cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy. Suitable methods are presented in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and are well known in the art. Often, proteins expressed at high levels are found in insoluble inclusion ~ bodies. Methods for extracting proteins from these aggregates are described by Sambrook et al. (In Molecular Cloning: A Laboratory Mafaual, Ch. 17, CSHL, New York, 1989). Vector systems suitable for the expression of laoZ fusion genes include the pUR series of vectors (Ruther and Muller-Hill, EMBO J. 2:1791, 1983), pEXl-3 (Stanley and Luzio, EMBO.1. 3:1429, 1984) and pMR100 (Gray et al., Proc. Natl. Acad. Sci. USA 79:6598, 1982). Vectors suitable for the production of intact native proteins include pKC30 (Shimatake and Rosenberg, Nature 292:128, 1981), pKK177-3 (Amann and Brosius, Gene 40:183, 1985) and pET-3 (Studiar and Moffatt, J. Mol.
Biol. 189:113, 1986). MATER fusion proteins may be isolated from protein gels, lyophilized, ground into a powder and used as an antigen. The DNA sequence can also be transferred from its existing context to other cloning vehicles, such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al., Science 236:806-812, 1987). These vectors may then be introduced into a variety of hosts including somatic cells, and simple or complex organisms, such as bacteria, fungi (Timberlake and Marshall, Science 244:1313-1317, 1989), invertebrates, plants, and animals (Pursel et al., Science 244:1281-1288, 1989), which cells or organisms are rendered transgenic by the introduction of the heterologous Mater cDNA.
For expression in mammalian cells, the cDNA sequence may be ligated to heterologous promoters, such as the simian virus (SV) 40 promoter in the pSV2 vector (Mulligan and Berg, Proc.
Natl. Aced. Sci. USA 78:2072-2076, 1981), and introduced into cells, such as monleey COS-1 cells (Gluzman, Cel123:175-182, 1981), to achieve transient or long-term expression.
The stable integration of the chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J. Mol. Appl. Genet. 1:327-341, 1982) and mycophenolic acid (Mulligan and Berg, Proc. Natl. Aced Sci. USA 78:2072-2076, 1981).
DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence-alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with nucleic acid amplification.
The cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques.
These vectors are designed to permit the transcription of the cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA
and ensure its proper splicing and polyadenylation. Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan et al., Proc. Natl. Aced. Sci. USA
78:1078-2076, 1981; Gorman et al., Proc. Natl. Aced. Sci USA 78:6777-6781, 1982). The level of expression of the cDNA can be manipulated with this type of vector, either by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S
frugiperda cells (Summers and Smith, In Genetically Altered VirZases and the Environment, Fields et al.
(Eds.) 22:319-328, CSHL Press, Cold Spring Harbor, New York, 1985) or by using vectors that contain promoters amenable to modulation, for example, the glucocorticoid-responsive promoter from the mouse mammary tumor virus (Lee et al., Nature 294:228, 1982). The expression of the cDNA can be monitored in the recipient cells 24 to 72 hours after introduction (transient expression).
In addition, some vectors contain selectable markers such as the gpt (Mulligan and Berg, Proc. Natl. Aced. Sci. USA 78:2072-2076, 1981) or neo (Southern and Berg, J.
Mol. Appl. Genet.
1:327-341, 1982) bacterial genes. These selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vectors (and therefore the cDNA).
The vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses, such as papilloma (Server et al., Mol. Cell Biol. 1:486-496, 1981) or Epstein-Barr (Sugden et al., Mol.
Cell Biol. 5:410-413, 1985). Alternatively, one can also produce cell lines that have integrated the vector into genomic DNA. Both of these types of cell lines produce the gene product on a continuous basis. One can also produce cell lines can also produced that have amplified the number of copies of the vector (and therefore of the cDNA as well) to create cell lines that can produce high levels of the gene product (Alt et al., J. Biol. Chern. 253:1357-1370, 1978).
The transfer of DNA into eukaryotic, in particular human or other mammalian cells, is now a conventional technique. Recombinant expression vectors can be introduced into the recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vender Eb, Virology 52:466, 1973) or strontium phosphate (Brash et al., Mol. Cell Biol. 7:2013, 1987), electroporation (Neumann et al., EMBO J 1:841, 1982), lipofection (Felgner et al., Proc. Natl. Aced.
Sci USA 84:7413, 1987), DEAE dextran (McCuthan et al., J. Natl. Cancer Inst.
41:351, 1968), microinjection (Mueller et al., Cell 15:579, 1978), protoplast fusion (Schafner, Proc. Natl. Aced. Sci.
USA 77:2163-2167, 1980), or pellet guns (Klein et al., Nature 327:70, 1987).
Alternatively, the cDNA, or fragments thereof, can be introduced by infection with virus vectors.
Systems are developed that use, for example, retroviruses (Bernstein et al., Gen. Engr'g 7:235, 1985), adenoviruses (Ahmad et al., J. Virol. 57:267, 1986), or Herpes virus (Spaete et al., Cell 30:295, 1982). Techniques of use in packaging long transcripts can be found in Kochanek et al. (Proc. Natl.
Acad. Sci. USA 93:5731-5739, 1996) Parks et al. (Pros. Natl. Aced. Sci. USA
93:13565-13570, 1996) and Parks and Graham (J Virol. 71:3293-3298, 1997). MATER encoding sequences can also be delivered to target cells in vitro via non-infectious systems, for instance liposomes.
These eukaryotic expression systems can be used for studies of MATER encoding nucleic acids and mutant forms of these molecules, the MATER protein and mutant forms of this protein.
Such uses include, for example, the identification of regulatory elements located in the 5' region of the Mater gene on genomic clones that can be isolated from human genomic DNA
libraries using the information contained herein. The eukaryotic expression systems also may be used to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring or artificially produced mutant proteins.
Using the above techniques, expression vectors containing the MATER gene sequence or cDNA, or fragments or variants or mutants thereof, can be introduced into human cells, mammalian cells from other species or non-mammalian cells, as desired. The choice of cell is determined by the purpose of the treatment. For example, monkey COS cells (Gluzman, Cell 23:175-182, 1981) that produce high levels of the SV40 T antigen and permit the replication of vectors containing the SV40 origin of replication may be used. Similarly, Chinese hamster ovary (CHO), mouse NIH 3T3 fibroblasts or human fibroblasts or lymphoblasts (as described herein) may be used.
Embodiments described herein thus encompass recombinant vectors that comprise all or part of a MATER encoding sequence, such as the MATER gene or cDNA or variants thereof, for expression in a suitable host. The MATER DNA is operatively linleed in the vector to an expression control sequence in the recombinant DNA molecule so that the MATER polypeptide can be expressed. The expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof. The expression control sequence may be specifically selected from the group consisting of the lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of fd coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter of the yeast alpha-mating factors and combinations thereof. , The host cell, which may be transfected with a vector, may be selected from the group consisting of E. coli, Pseudomonas, Bacillus subtilis, Bacillus stearothermophilus or other bacilli;
other bacteria; yeast; fungi; insect; mouse or other animal; or plant hosts;
or human tissue cells.
It is appreciated that for mutant or variant MATER DNA sequences, similar systems are employed to express and produce the mutant product.
EXAMPLE 18:
Production of an Antibody to MATER Protein Monoclonal or polyclonal antibodies may be produced to either the normal MATER
protein or mutant forms of this protein. Optimally, antibodies raised against the MATER protein would specifically detect the MATER protein. That is, such antibodies would recognize and bind the MATER protein and would not substantially recognize or bind to other proteins found in human cells.
Antibodies the human MATER protein may recognize MATER from other species, such as marine MATER, and vice versa.
The determination that an antibody specifically detects the MATER protein is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique (Sambrook et al., In Molecular Clonifag.~ A Laboratory Manual, CSHL, New York, 1989). To determine that a given antibody preparation (such as one produced in a mouse) specifically detects the MATER protein by Western blotting, total cellular protein is extracted from human cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel. The proteins are then transferred to a membrane (for example, nitrocellulose or PVDF) by Western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of (by way of example) an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase. Application of an alkaline phosphatase substrate S-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immunolocalized allcaline phosphatase. Antibodies that specifically detect the MATER protein will, by this technique, be shown to bind to the MATER protein band (which will be localized at a given position on the gel determined by its molecular weight, which is approximately 125 kDa based on gel-mobility estimation for marine MATER. Non-specific binding of the antibody to other proteins may occur and may be detectable as a weak signal on the Western blot. The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody-MATER protein binding.
In certain embodiments, antibodies are generated which are specific to a domain or portion of the MATER protein.
Substantially pure MATER protein suitable for use as an immunogen is isolated from the transfected or transformed cells as described above. The concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon (Millipore, Bedford, Massachusetts) or similar filter device, to the level of a few micrograms per milliliter. Monoclonal or polyclonal antibody to the protein can then be prepared as follows:
A. Monoclonal Antibody Production by Hybridoma Fusion Monoclonal antibody to epitopes of the MATER protein identified and isolated as described can be prepared from marine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495-497, 1975) or derivative methods thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein over a period of a few weeks.
The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused with mouse myeloma cells using polyethylene glycol, and the excess un-fused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). Successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate, where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol. 70(A):419-439, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane (Antibodies, A
Laboratory Mahual, CSHL, New York, 1988).
B. Polyclonal Antibody Production by Immunization Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein (Example 8), which optionally can be modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than others and may require the use of carriers and adjuvant, examples of which are known. Also, host animals vary in response to site of inoculations and dose, with either inadequate or excessive doses of antigen resulting in low titer antisera. A series of small doses (ng level) of antigen administered at multiple intradermal sites appear to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis et al.
(J. Clin. Erzdocrinol.
Metab. 33:988-991, 1971).
Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof begins to fall, as determined semi-quantitatively (for example, by double immunodiffusion in agar against known concentrations of the antigen). See, for example, Ouchterlony et al. (In Handbook of ExperimetZtal Immunology, Wier, D. (ed.) chapter 19. Blackwell, 1973). Plateau concentration of antibody is usually in the range of about 0.1 to 0.2 mg/ml of serum (about 12 ~M). Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Irraruufzology, Ch. 42, 1980).
C. Antibodies Raised against Synthetic Peptides A third approach to raising antibodies against the MATER protein is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence of the MATER protein.
By way of example only, mouse MATER C-terminal peptide (residues 1093 through 1111 of SEQ ID NO: 6) was conjugated with KLH to immunize the female rabbits (two) every two-weeks.
Starting from the third immunization, a small amount (~3 ml) of blood was collected from the immunized rabbits to examine the titer of the anti-peptide antibodies using the peptide as antigen and ELISA method. Immunizations continued until the antibodies reached maximal titers, which occurred in about ten immunizations, and then the rabbits were sacrificed to bleed in preparation for the sera. The resultant preparation was used both to characterize murine MATER
(Example 1) and human MATER (Example 4).
D. Antibodies Raised by Injection of MATER Encoding Sequence Antibodies may be raised against the MATER protein by subcutaneous injection of a recombinant DNA vector that expresses the MATER protein into laboratory animals, such as mice.
Delivery of the recombinant vector into the animals may be achieved using a hand-held form of the Biolistic system (Sanford et al., Particulate Sci. Technol. 5:27-37, 1987), as described by Tang et al.
(Nature 356:152-154, 1992). Expression vectors suitable for this purpose may include those that express the MATER encoding sequence under the transcriptional control of either the human J3-actin promoter or the cytomegalovirus (CMV) promoter.
Antibody preparations, both monoclonal and polyclonal, are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples;
they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample.
EXAMPLE 19:
DNA-Based Diagnosis The Mater sequence information presented herein can be used in the area of genetic testing for predisposition to reduced fertility or infertility, such as autoimmune infertility, owing to defects in Mater, such as deletion, duplication or mutation. The gene sequence of the Mater gene, including intron-exon boundaries (listed in Table 2), is also useful in such diagnostic methods. Individuals carrying mutations in the Mater gene (or a portion thereof), or having duplications or heterozygous or homozygous deletions of the Mater gene, may be detected at the DNA level with the use of a variety of techniques. For such a diagnostic procedure, a biological sample of the subject, which biological sample contains either DNA or RNA derived from the subject, is assayed for a mutated, duplicated or deleted Mater gene. Suitable biological samples include samples containing genomic DNA or RNA
obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material. The detection in the biological sample of either a mutant Mater gene, a mutant Mater RNA, or a duplicated or homozygously or heterozygously deleted Mater gene, may be performed by a number of methodologies, examples of which are discussed below.
One embodiment of such detection techniques for the identification of unknown mutations is the amplification (e.g., polymerase chain reaction amplification) of reverse transcribed RNA (RT-PCR) isolated from a subject, followed by direct DNA sequence determination of the products. The presence of one or more nucleotide differences between the obtained sequence and the prototypical Mater cDNA sequence, and especially, differences in the ORF portion of the nucleotide sequence, are taken as indicative of a potential Mater gene mutation.
Alternatively, DNA extracted from a biological sample may be used directly for amplification. Direct amplification from genomic DNA would be appropriate for analysis of the entire Mater gene including regulatory sequences located upstream and downstream from the open reading frame, or intronlexon borders (see Table 2). By way of example, the intro-exon boundaries themselves can serve as sequences for oligonucleotide primers (or portions thereof) for us in in vitro amplification of such samples; representative examples of such oligonucleotides are shown in SEQ
ID NOs: 25-38. Reviews of direct DNA diagnosis have been presented by Caskey (Science 236:1223-1228, 1989) and by Landegren et al. (Science 242:229-237, 1989).
Other mutation scanning techniques appropriate for detecting unknown within amplicons derived from DNA or cDNA could also be performed. These techniques include direct sequencing (without sequencing), single-strand conformational polymorphism analysis (SSCP) (for instance, see Hongyo et al., Nucleic Acids Res. 21:3637-3642, 1993), chemical cleavage (including HOT cleavage) (Bateman et al., Am. J. Med Genet. 45:233-240, 1993; reviewed in Ellis et al., Haam. Mutat. 11:345-353, 1998), denaturing gradient gel electrophoresis (DGGE), ligation amplification mismatch protection (LAMP), and enzymatic mutation scanning (Taylor and Deeble, Genet.
Anal. 14:181-186, 1999), followed by direct sequencing of amplicons with putative sequence variations.
Further studies of MATER genes isolated from female subjects displaying infertility, particularly autoimmune infertility subjects, or their relatives, may reveal particular mutations, genomic amplifications, or deletions, which occur at a high frequency within this population of individuals. In such case, rather than sequencing the entire Mater gene, DNA
diagnostic methods can be designed to specifically detect the most common, or most closely disease-linked, MATER defects.
The detection of specific DNA mutations may be achieved by methods such as hybridization using allele specific oligonucleotides (ASOs) (Wallace et al., CSHL Symp.
Quart. Biol. 51:257-261, 1986), oligonucleotides specific for intron-exon boundaries (e.g., any one of SEQ ID NOs: 25-38), direct DNA sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995, 1988), the use of restriction enzymes (Flavell et al., Cell 15:25-41, 1978; Geever et al., 1981), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, Cold Spring Harbor Symp. Quant. Biol. 51:275-284, 1986), RNase protection (Myers et al., Science 230:1242-1246, 1985), chemical cleavage (Cotton et al., Proc. Natl. Acad Sci.
USA 85:4397-4401, 1985), and the ligase-mediated detection procedure (Landegren et al., Science 241:1077-1080, 1988).
In particular embodiments, the amount of complex formed between a MATER
sequence and a MATER-specific oligonucleotide in a test sample (e.g, a clinical sample from a subject) is compared to the amount of complex formed in a control or reference sample.
Depending on the oligonucleotide selected, an increase in the formation of complex will be indicative of the presence of a biological condition associated with an abnormal MATER nucleic acid. In other circumstances, a decrease in the formation of complex will be indicative of the presence of a biological condition associated with an abnormal MATER nucleic acid. By way of example, in some embodiments, a wildtype oligonucleotide is used, and loss of complex formation is indicative of a mutation in the sample at the target regions. In other embodiments, a mutant or variant oligonucleotide (e.g., one comprising a known SNP), and an increase in complex formation is indicative of the presence of the mutation. Other combinations follow logically, including the reverse of these situations.
Oligonucleotides specific to normal or mutant sequences are chemically synthesized using commercially available machines. These oligonucleotides are then labeled radioactively with isotopes (such as 3'P) or non-radioactively, with tags such as biotin (Ward and Langer, Proc. Natl.
Acad. Sci. USA 78:6633-6657, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis. These specific sequences are visualized by methods such as autoradiography or fluorometric (Landegren et al., Science 242:229-237, 1989) or colorimetric reactions (Gebeyehu et al., Nucleic Acids Res.
15:4513-4534, 1987). Using an ASO specific for a normal allele, the absence of hybridization would indicate a mutation in the particular region of the gene, or deleted Mater gene. In contrast, if an ASO
specific for a mutant allele hybridizes to a clinical sample, this would indicate the presence of a mutation in the region defined by the ASO.
Sequence differences between normal and mutant forms of the MATER gene may also be revealed by the direct DNA sequencing method of Church and Gilbert (Proc.
Natl. Acad Sci. USA
81:1991-1995, 1988). Cloned DNA segments may be used as probes to detect specific DNA
segments. The sensitivity of this method is greatly enhanced when combined with nucleic acid amplification, e.g., PCR (Wrichnik et al., Nucleic Acids Res. 15:529-542, 1987; Wong et al., Nature 330:384-386, 1987; Stoflet et al, Science 239:491-494, 1988). In this approach, a sequencing primer that lies within the amplified sequence is used with double-stranded PCR
product or single-stranded template generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotides or by automatic sequencing procedures with fluorescent tags.
Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or may eliminate existing restriction sites. Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization (Southern, J. Mol. Biol.
98:503-517, 1975). DNA fragments carrying the restriction site (either normal or mutant) are detected by their reduction in size or increase in corresponding restriction fragment numbers.
Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme; fragments of different sizes are then visualized under UV
light in the presence of ethidium bromide after gel electrophoresis.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing reagent.
Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis. For example, a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8% non-denaturing polyacrylamide gel (WO 91/10734; Nagamine et al., Am. J.
Hum. Genet. 45:337-339, 1989). DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al., Science 230:1242-1246, 1985). Alternatively, a method of detecting a mutation comprising a single base substitution or other small change could be based on differential primer length in a PCR. For example, an invariant primer could be used in addition to a primer specific for a mutation. The PCR
products of the normal and mutant genes can then be differentially detected in acrylamide gels.
In addition to conventional gel-electrophoresis and blot-hybridization methods, DNA
fragments may also be visualized by methods where flee individual DNA samples are not immobilized on membranes. The probe and target sequences may be both in solution, or the probe sequence may be immobilized (Saiki et al., Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989). A
variety of detection methods, such as autoradiography involving radioisotopes, direct detection of radioactive decay (in the presence or absence of scintillant), spectrophotometry involving calorigenic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes.
See also the following patent documents, for instance: WO 89/10977; WO
97/27317; WO 97/29212;
WO 98/28438; WO 99/05320; WO 99/47706; WO 00/47767; WO 00/56926; WO 00/79006;
WO
01183813; US 2002/0012930; US 5,70p,637; US 6,228,575; US 6,300,063; and US
6,307,039.
If multiple mutations are encountered frequently in the MATER gene, a system capable of detecting such multiple mutations likely will be desirable. For example, a nucleic acid amplification reaction with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al., Nucl.
Acids Res. 16:1141-1155, 1988). The procedure may involve immobilized sequence-specific oligonucleotide probes (Saiki et al., Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989).
EXAMPLE 20:
Quantitation of MATER Protein An alternative method of diagnosing Mater gene deletion, amplification, or mutation is to quantitate the level of MATER protein in the cells of a subject. This diagnostic tool would be useful for detecting reduced levels of the MATER protein that result from, for example, mutations in the promoter regions of the Mater gene or mutations within the coding region of the gene that produce truncated, non-functional or unstable polypeptides, as well as from deletions of the entire Mater gene.
Alternatively, duplications of the Mater gene may be detected as an increase in the expression level of this protein. The determination of reduced or increased MATER protein levels would be an alternative or supplemental approach to the direct determination of Mater gene deletion, duplication or mutation status by the methods outlined above.
The availability of antibodies specific to the MATER protein will facilitate the quantitation of cellular MATER protein by one of a number of immunoassay methods, which are well known in the art and are presented in Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988).
For the purposes of quantitating the MATER protein, a biological sample of the subject, which sample includes cellular proteins, is required. Such a biological sample may be obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, amniocentesis samples, surgical specimens and autopsy material. In particular, female reproductive cells (e.g., ova) or embryos are appropriate samples. Quantitation of MATER protein is achieved by immunoassay and compared to levels of the protein found in healthy cells (e.g., cells from a female known not to suffer from decreased fertility). A significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) reduction in the amount of MATER protein in the cells of a subject compared to the amount of MATER protein found in normal human cells would be taken as an indication that the subject may have deletions or mutations in the Mater gene locus, whereas a significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) increase would indicate that a duplication or enhancing mutation had occurred.
EXAMPLE 21:
Detection of Serum Antibody against MATER Protein The MATER family of proteins was first identified as autoantibodies involved in the pathogenesis of certain cases of autoimmune infertility. With the provision herein of human MATER
protein sequences and encoding nucleic acids, methods for the detection and diagnosis of such fertility failure are now enabled.
Autoantibodies that recognize an epitope of the human MATER protein can be detected in samples from a subject, for instance serum or other fluid, using known immunological techniques.
The presence of such autoantibodies (e.g., circulating autoantibodies specific for a MATER epitope) indicates that the subject suffers from MATER-mediated infertility or reduced fertility, or has an increased susceptibility to suffer from one of these conditions.
Many techniques are commonly known in the art for the detection and quantification of antigen. Most commonly, the purified antigen will be bound to a substrate, the antibody of the sample will bind via its Fab portion to this antigen, the substrate will then be washed and a second, labeled antibody will then be added which will bind to the Fc portion of the antibody that is the subject of the assay. The second, labeled antibody will be species specific, i.e., if the serum is from a human, the second, labeled antibody will be anti-human-IgG antibody. The specimen will then be washed and the amount of the second, labeled antibody that has been bound will be detected and quantified by standard methods.
Examples of methods for the detection of antibodies in biological samples, including methods employing dip strips or other immobilized assay devices, are disclosed for instance in the following patents: U.S. Patents No. 5,965,356 (Herpes simplex virus type specific seroassay);
6,114,179 (Method and test kit for detection of antigens and/or antibodies);
6,077,681 (Diagnosis of motor neuropathy by detection of antibodies); 6,057,097 (Marker for pathologies comprising an auto-immune reaction and/or for inflammatory diseases); and 5,552,285 (Immunoassay methods, compositions and kits for antibodies to oxidized DNA bases).
EXAMPLE 22:
Suppression of MATER Expression A reduction of MATER protein expression in a transgenic cell may be obtained by introducing into cells an antisense construct based on the Mater' encoding sequence, including the human Mater cDNA or fragments thereof (for instance, the cDNA fragments shown in SEQ ID
NO: 1 and 3) or gene sequence or flanking regions thereof. For antisense suppression, a nucleotide sequence from an MATER encoding sequence, e.g. all or a portion of the Mater cDNA or gene, is arranged in reverse orientation relative to the promoter sequence in the transformation vector.
Other aspects of the vector may be chosen as discussed above (Example 8).
The introduced sequence need not be the full length human Mater cDNA (SEQ ID
NO: 23) or gene, and need not be exactly homologous to the equivalent sequence found in the cell type to be transformed. Thus, portions or fragments of the murine cDNA (SEQ ID NO: 5) could also be used to knock out expression of the human Mater gene. Generally, however, where the introduced sequence is of shorter length, a higher degree of homology to the native Mater sequence will be needed for effective antisense suppression. The introduced antisense sequence in the vector may be at least 30 nucleotides in length, and improved antisense suppression typically will be observed as the length of the antisense sequence increases. The length of the antisense sequence in the vector advantageously may be greater than 100 nucleotides, and can be up to about the full length of the human Mater cDNA
or gene. For suppression of the Mater gene itself, transcription of an antisense construct results in the production of RNA molecules that are the reverse complement of mRNA molecules transcribed from the endogenous Mater gene in the cell.
Although the exact mechanism by which antisense RNA molecules interfere with gene expression has not been elucidated, it is believed that antisense RNA
molecules bind to the endogenous mRNA molecules and thereby inhibit translation of the endogenous mRNA.
Small inhibitory RNAs (siRNAs) can also be used.
Suppression of endogenous MATER expression can also be achieved using ribozymes.
Ribozymes are synthetic RNA molecules that possess highly specific endoribonuclease activity. The production and use of ribozymes are disclosed in U.S. Patent No. 4,987,071 to Cech and U.S. Patent No. 5,543,508 to Haselhoff. The inclusion of ribozyme sequences within antisense RNAs may be used to confer RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that bind to the antisense RNA are cleaved, which in turn leads to an enhanced antisense inhibition of endogenous gene expression.
Finally, dominant negative mutant forms of MATER may be used to block endogenous MATER activity.
EXAMPLE 23:
MATER Knockout and Overexpression Transgenic Animals Mutant organisms that under-express or over-express MATER protein are useful for research. Such mutants allow insight into the physiological and/or pathological role of MATER in a healthy and/or pathological organism. These mutants are "genetically engineered," meaning that information in the form of nucleotides has been transferred into the mutant's genome at a location, or in a combination, in which it would not normally exist. Nucleotides transferred in this way are said to be "non-native." For example, a non-Mater promoter inserted upstream of a native Mater gene would be non-native. An extra copy of a Mater gene or other encoding sequence on a plasmid, transformed into a cell, would be non-native, whether that extra copy was Mater derived from the same or a different species.
Mutants may be, for example, produced from mammals, such as mice, that either over-express or under-express MATER protein, or that do not express MATER at all.
Over-expression mutants are made by increasing the number of MATER-encoding sequences (such as genes) in the organism, or by introducing an MATER-encoding sequence into the organism under the control of a constitutive or inducible or viral promoter such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter or the metallothionein promoter. Mutants that under-express MATER may be made by using an inducible or repressible promoter, or by deleting the Mater gene, or by destroying or limiting the function of the Mater gene, for instance by disrupting the gene by transposon insertion.
Antisense genes may be engineered into the organism, under a constitutive or inducible promoter, to decrease or prevent MATER expression, as discussed above in Example 13.
A gene is "functionally deleted" when genetic engineering has been used to negate or reduce gene expression to negligible levels. When a mutant is referred to in this application as having the Mater gene altered or functionally deleted, this refers to the Mater gene and to any ortholog of this gene. When a mutant is referred to as having "more than the normal copy number" of a gene, this means that it has more than the usual number of genes found in the wild-Type organism, e.g., in the diploid mouse or human.
A mutant mouse over-expressing MATER may be made by constructing a plasmid having the Mater gene driven by a promoter, such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter. This plasmid may be introduced into mouse oocytes by microinjection. The oocytes are implanted into pseudopregnant females, and the litters are assayed for insertion of the transgene. Multiple strains containing the transgene are then available for study.
WAP is quite specific for mammary gland expression during lactation, and MMTV
is expressed in a variety of tissues including mammary gland, salivary gland and lymphoid tissues.
Many other promoters might be used to achieve various patterns of expression, e.g., the metallothionein promoter.
An inducible system may be created in which the subject expression construct is driven by a promoter regulated by an agent that can be fed to the mouse, such as tetracycline. Such techniques are well known in the art.
A mutant knockout animal (e.g., mouse) from which the Mater gene is deleted or otherwise disabled can be made by removing coding regions of the Mater gene from embryonic stem cells. The 1 S methods of creating deletion mutations by using a targeting vector have been described (see, for instance, Thomas and Capecch, Cell S1:S03-512, 1987). One specific example ofthe production of a Mater null mouse is described above, in Example 1.
EXAMPLE 24:
Gene Therapy Gene therapy approaches for combating MATER-mediated fertility defects in subjects, or for causing MATER-mediated infertility in subjects, are now made possible.
Retroviruses have been considered the preferred vector for experiments in gene therapy, with a high efficiency of infection and stable integration and expression (Orkin et al., Prog. Med. Genet.
2S 7:130-142, 1988). The full-length MATER gene or cDNA can be cloned into a retroviral vector and driven from either its endogenous promoter or, for instance, from the retroviral LTR (long terminal repeat). Other viral transfection systems may also be utilized for this type of approach, including adenovirus, adeno-associated virus (AAV) (McLaughlin et al., J. Virol. 62:1963-1973, 1988), Vaccinia virus (Moss et al., Anrru. Rev. Irnmunol. 5:305-324, 1987), Bovine Papilloma virus (Rasmussen et al, Methods En~mol. 139:642-654, 1987) or members of the herpesvirus group such as Epstein-Barr virus (Margolskee et al., Mol. Cell. Biol. 8:2837-2847, 1988).
Recent developments in gene therapy techniques include the use of RNA-DNA
hybrid oligonucleotides, as described by Cole-Strauss, et al. (Science 273:1386-1389, 1996). This technique may allow for site-specific integration of cloned sequences, thereby permitting accurately targeted gene replacement.
In addition to delivery of MATER to cells using viral vectors, it is possible to use non-infectious methods of delivery. For instance, lipidic and liposome-mediated gene delivery has recently been used successfully for transfection with various genes (for reviews, see Templeton and Lasic, Mol. Biotechnol. 11:175-180, 1999; Lee and Huang, Crit. Rev. Ther. Drug Carrier Syst.
14:173-206; and Cooper, Sernin. Oncol. 23:172-187, 1996). For instance, cationic liposomes have been analyzed for their ability to transfect monocytic leukemia cells, and shown to be a viable alternative to using viral vectors (de Lima et al., Mol. Mentbr. Biol. 16:103-109, 1999). Such cationic liposomes can also be targeted to specific cells through the inclusion of, for instance, monoclonal antibodies or other appropriate targeting ligands (Kao et al., Cancer Gene Ther. 3:250-256, 1996).
EXAMPLE 25:
Identification of Therapeutic Compounds The human MATER molecules disclosed herein can be used to identify (screen for) compounds that are useful in influencing MATER-mediated fertility in a mammal, either by blocking (inhibiting) the activity of MATER (and thereby reducing fertility) or enhancing MATER activity (and thereby increasing fertility).
Such screening methods can include determining if a test compound binds directly to or otherwise interacts with a MATER protein, or a variant or fragment of a MATER
protein. Proteins that do bind to such a molecule are select for further characterization.
In specific embodiments, the compound being tested for activity is applied to a cell for instance a test cell (e.g., a developing oocyte or embryo of a mammal). The activity of the MATER
protein in that test cell is then measured, for instance by determining whether the oocyte or embryo progresses beyond the two-cell stage. If application of the test compound alters proportion of embryos that progress beyond two cells, then that compound is selected as a likely candidate for further characterization. In particular examples, a test agent that opposes or inhibits a MATER
activity is selected for further study, for example by exposing the agent to a mammalian female reproductive system in vivo, to determine if in vivo fertility is inhibited.
Such identified compounds may be useful as contraceptive agents.
Specific examples of compounds likely to be effective at inhibiting MATER
activity, and therefore effective as contraceptives, include antibodies specifically directed to epitopes of the MATER protein. The general concept of immunocontraceptives has been described (see, e.g., U.S.
Patents No. 5,637,300 and 6,027,727, describing contraceptive antibodies directed to proteins of the aona pellucida, and incorporated herein by reference).
Alternatively, compounds that increase the proportion of embryos that progress beyond two cells (for instance, in an animal system known to be defective for fertility) are selected for further study as possible fertility enhancing agents. Similar screens can be used to identify compounds that mimic the activity of MATER protein, for instance in a MATER null animal.
In addition, it is suggested that MATER protein perform its function within the cytoplasm through interacting with other unknown protein. Physical blockage of such interaction is expected to arrest the MATER function. Candidates for such interactions are being identified based on interactions in a yeast two-hybrid system (Fields and Songs, Nature 340:245, 1989). Once molecular domains for the protein interaction are known, molecules can be designed directly based to specifically inhibit or otherwise interfere with MATER protein interactions with these other proteins.
Compounds selected using these methods are comprehended by this disclosure.
EXAMPLE 26:
Kits Kits are provided which contain the necessary reagents for determining MATER
gene copy number, such as probes or primers specific for the MATER gene, as well as written instructions. Kits are also provided to determine abnormal expression of MATER mRNA (i.e., containing probes) or MATER protein (i.e., containing a MATER-specific binding agent). Instructions provided in the diagnostic kits can include calibration curves or charts to compare with the determined (e.g., experimentally measured) values.
A. Kits for Detection of MATER Genomic Sequences The nucleotide sequences disclosed herein, and fragments thereof, can be supplied in the form of a kit for use in detection of MATER genomic sequences and/or diagnosis of infertility or reduced fertility. In such a kit, an appropriate amount of one or more of the MATER-specific oligonucleotide primers is provided in one or more containers. The oligonucleotide primers) (for instance, particular oligonucleotides disclosed herein) may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance. The containers) in which the oligonucleotide(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles. In some applications, pairs of primers may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers. With such an arrangement, the sample to be tested for the presence of MATER genomic amplification, or deletion, can be added to the individual tubes and in vitro amplification carried out directly.
The amount of each oligonucleotide primer supplied in the kit can be any appropriate amount, depending for instance on the market to which the product is directed.
For instance, if the kit is adapted for research or clinical use, the amount of each oligonucleotide primer provided would likely be an amount sufficient to prime several in vitro amplification reactions. Those of ordinary skill in the art know the amount of oligonucleotide primer that is appropriate for use in a single amplification reaction. General guidelines may for instance be found in Innis et al. (PCR Protocols, A Guide to Methods afZd Applications, Academic Press, Inc., San Diego, CA, 1990), Sambrook et al.
(In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989), and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).
A kit may include more than two primers, in order to facilitate the PCR in vitro amplification of MATER sequences, for instance the MATER gene, specific exon(s) or other portions of the gene (e.g., a portion bridging an intron-exon boundary), or the 5' or 3' flanking region thereof.
In some embodiments, kits may also include the reagents necessary to carry out in vitro amplification reactions, such as PCR amplification, including, for instance, DNA sample preparation reagents, appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Written instructions may also be included.
Kits may in addition include either labeled or unlabeled oligonucleotide probes for use in detection of the in vitro amplified MATER sequences. The appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the in vitro amplification reaction.
It may also be advantageous to provided in the kit one or more control sequences for use in the amplification reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
B. Kits for Detection of Mater mRNA Expression Kits similar to those disclosed above for the detection of MATER genomic sequences can be used to detect MATER mRNA expression levels. Such kits may include an appropriate amount of one or more of the oligonucleotide primers for use in reverse transcription amplification reactions, similarly to those provided above, with art-obvious modifications for use with RNA.
In some embodiments, kits for detection of MATER mRNA expression levels may also include the reagents necessary to carry out RT-PCR in vitro amplification reactions, including, for instance, RNA sample preparation reagents (including e.g., an RNAse inhibitor), appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs).
Written instructions may also be included.
Kits in addition may include either labeled or unlabeled oligonucleotide probes for use in detection of the in vitro amplified target sequences. The appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the PCR reaction, or another in vitro amplification reaction.
It also may be advantageous to provided in the kit one or more control sequences for use in the RT-PCR reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
Alternatively, kits may be provided with the necessary reagents to carry out quantitative or semi-quantitative Northern analysis of MATER mRNA. Such kits include, for instance, at least one MATER-specific oligonucleotide for use as a probe. This oligonucleotide may be labeled in any conventional way, including with a selected radioactive isotope, enzyme substrate, co-factor, ligand, chemiluminescent or fluorescent agent, hapten, or enzyme.
C. Kits For Detection of MATER Protein or Peptide Expression Kits for the detection of MATER protein expression, for instance MATER at least one target (e.g., MATER) protein specific binding agent (e.g., a polyclonal or monoclonal antibody or antibody fragment) and may include at least one control. The MATER protein specific binding agent and control may be contained in separate containers. The kits may also include means for detecting MATER:agent complexes, for instance the agent may be detestably labeled. If the detectable agent is not labeled, it may be detected by second antibodies or protein A for example which may also be provided in some kits in one or more separate containers. Such techniques are well known.
Additional components in some kits include instructions for carrying out the assay.
Instructions will allow the tester to determine whether MATER expression levels are altered, for instance in comparison to a control sample. Reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits.
By way of example only, an effective and convenient immunoassay kit such as an enzyme-linked immunosorbent assay can be constructed to test anti-MATER antibody in human serum, as reported for detection of non-specific anti-ovarian antibodies (VJheatcroft et al, Clin. Exp. Immurrol.
96:122-128, 1994; Wheatcroft et al, Hum. Reprod. 12:2617-2622, 1997).
Expression vectors can be constructed using the human MATER cDNA to produce the recombinant human MATER
protein in either bacteria or baculovirus (as described in Example 8). By affinity purification, unlimited amounts of pure recombinant MATER protein can be produced.
An assay kit could provide the recombinant protein as an antigen and enzyme-conjugated goat anti-human IgG as a second antibody as well as the enzymatic substrates.
Such kits can be used to test if the patient sera contain antibodies against human MATER.
This disclosure provides MATER nucleic acids and proteins, including the human Mater molecules described above. The disclosure further provides methods employing these molecules, including methods to predict and/or diagnose infertility, reduced fertility, or reproductive failure in females, as well as treatments for such infertility and reduced fertility, and contraceptives. It will be apparent that the precise details of the molecules and methods described may be varied or under- or overexpression, are also contemplated. Such kits will include modified without departing from the spirit of the described invention. The inventors claim all such modifications and variations that fall within the scope and spirit of the claims below.
SEQUENCE LISTING
<110> The Government of the United States of America as represented by the Secretary of the Department of Health and Human Services Nelson, Lawrence Tong, Zhi-Bin <120> Human Gene Critical to Fertility <130> 4239-62463 <150> 60/241,510 <151> 2000-10-18 <150> PCT/USOl/10981 <15l> 2001-04-04 <160> 42 <170> PatentIn version 3.1 <210> 1 <211> 1157 <212> DNA
<213> Homo Sapiens <400>
caagctccggtgacggagatcatgtcccgaccagaaaggctgttgttcatc~attgacggt60 ttcgatgacctgggctctgtcctcaacaatgacacaaagctctgcaaagactgggctgag 120 aagcagcctccgttcaccctcatacgcagtctgctgaggaaggtcctgctccctgagtcc 180 ttcctgatcgtcaccgtcagagacgtgggcacagagaagctcaagtcagaggtcgtgtct 240 ccccgttacctgttagttagaggaatctccggggaacaaagaatccacttgctccttgag 300 cgcgggattggtgagcatcagaagacacaagggttgcgtgcgatcatgaacaaccgtgag 360 ctgctcgaccagtgccaggtgcccgccgtgggctctctcatctgcgtggccctgcagctg 420 caggacgtggtgggggagagcgtcgcccccttcaaccaaacgctcacaggcctgcacgcc 480 gcttttgtgtttcatcagctcacccctcgaggcgtggtccggcgctgtctcaatctggag 540 gaaagagttgtcctgaagcgcttctgccgtatggctgtggagggagtgtggaataggaag 600 tcagtgtttgacggtgacgacctcatggttcaaggactcggggagtctgagctccgtgct 660 ctgtttcacatgaacatccttctcccagacagccactgtgaggagtactacaccttcttc 720 cacctcagtctccaggacttctgtgccgccttgtactacgtgttagagggcctggaaatc 780 gagccagctc tctgccctct gtacgttgag aagacaaaga ggtccatgga gcttaaacag 840 gcaggcttcc atatccactc gctttggatg aagcgtttct tgtttggcct cgtgagcgaa 900 gacgtaagga ggccactgga ggtcctgctg ggctgtcccg ttcccctggg ggtgaagcag 960 aagcttctgc actgggtctc tctgttgggt cagcagccta atgccaccac cccaggagac 1020 accctggacg ccttccactg tcttttcgag actcaagaca aagagtttgt tcgcttggca 1080 ttaaacagct tccaagaagt gtggcttccg attaaccaga acctggactt gatagcatct 1140 tccttctgcc tccagct 1157 <210> 2 <21l> 385 <212> PRT
<213> Homo Sapiens <400> 2 Gln Ala Pro Val Thr Glu Ile Met Ser Arg Pro Glu Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Asp Leu Gly Ser Val Leu Asn Asn Asp Thr Lys Leu Cys Lys Asp Thr Ala Glu Lys Gln Pro Pro Phe Thr Leu Ile Arg Ser Leu Leu Arg Lys Val Leu Leu Pro Glu Ser Phe Leu Ile Val Thr Val Arg Asp Val Gly Thr Glu Lys Leu Lys Ser G1u Val Val Ser Pro Arg Tyr Leu Leu Val Arg Gly Ile Ser Gly Glu Gln Arg Ile His Leu Leu Leu Glu Arg Gly Ile Gly Glu His Gln Lys Thr Gln Gly Leu Arg Ala Ile Met Asn Asn Arg Glu Leu Leu Asp Gln Cys Gln Va1 Pro 115 120 l25 Ala Val Gly Ser Leu Ile Cys Va1 Ala Leu Gln Leu Gln Asp Val Va1 Gly Glu Ser Va1 Ala Pro Phe Asn Gln Thr Leu Thr Gly Leu His A1a Ala Phe Val Phe His Gln Leu Thr Pro Arg Gly Val Val Arg Arg Cys Leu Asn Leu Glu Glu Arg Val Val Leu Lys Arg Phe Cys Arg Met Ala Va1 Glu Gly Val Thr Asn Arg Lys Ser Val Phe Asp Gly Asp Asp Leu l95 200 205 Met Val Gln Gly Leu Gly Glu Ser Glu Leu Arg Ala Leu Phe His Met Asn Ile Leu Leu Pro Asp Ser His Cys Glu Glu Tyr Tyr Thr Phe Phe His Leu Ser Leu Gln Asp Phe Cys Ala Ala Leu Tyr Tyr Val Leu Glu Gly Leu Glu Ile Glu Pro Ala Leu Cys Pro Leu Tyr Val Glu Lys Thr Lys Arg Ser Met Glu Leu Lys Gln Ala G1y Phe His Ile His Ser Leu Thr Met Lys Arg Phe Leu Phe Gly Leu Val Ser Glu Asp Val Arg Arg Pro Leu Glu Val Leu Leu Gly Cys Pro Val Pro Leu Gly Val Lys Gln Lys Leu Leu His Thr Val Ser Leu Leu Gly Gln Gln Pro Asn Ala Thr Thr Pro Gly Asp Thr Leu Asp Ala Phe His Cys Leu Phe Glu Thr Gln Asp Lys Glu Phe Val Arg Leu Ala Leu Asn Ser Phe Gln Glu Val Thr Leu Pro Ile Asn Gln Asn Leu Asp Leu Ile Ala Ser Ser Phe Cys Leu Gln <210> 3 <211> 1075 <212> DNA
<213> Homo sapiens <400> 3 tctggcctca gccctcgtca gcaaccggag cttgacacac ctgtgcctat ccaacaacag 60 cctggggaacgaaggtgtaaatctactgtgtcgatccatgaggcttccccactgtagtct120 gcagaggctgatgctgaatcagtgccacctggacacggctggctgtggttctcttgcact180 tgcgcttatgggtaactcatggctgacgcacctgagccttagcatgaaccctgtggaaga240 caatggcgtgaagcttctgtgcgaggtcatgagagaaccatcttgtcatctccaggacct300 ggagttggtaaaatgtcatctcaccgccgcgtgctgtgagagtctgtcctgtgtgatctc360 gaggagcagacacctgaagagcctggatctcacggacaatgccctgggtgacggtggggt420 tgctgcgctgtgcgagggactgaagcaaaagaacagtgttctgacgagactcgggttgaa480 ggcatgtggactgacttctgattgctgtgaggcactctccttggccctttcctgcaaccg540 gcatctgaccagtctaaacctggtgcagaataacttcagtcccaaaggaatgatgaagct600 gtgttcggcctttgcctgtcccacgtctaacttacagataattgggctgtggaaatggca660 gtaccctgtgcaaataaggaagctgctggaggaagtgcagctactcaagccccgagtcgt720 aattgacggtagttggcattcttttgatgaagatgaccggtactggtggaaaaactgaag780 atacggaaacctgccccactcacacccatctgatggaggaactttaaacgctgttttctc840 agagcaagctatgcacctgggagttccttctcaaagatggagaatgatttctgattctca900 caaagccctcaatggtagtgattcttctgtgttcactctacgttggttactggatttgaa960 ggctagagaccttcaagtcataggactcagtatctgtgaaatgtccgtcatatctcagag1020 catatagagg gaattaaata aacacaaagc atttggaaaa aaaaaaaaaa aaaaa 1075 <210> 4 <211> 258 <212> PRT
<213> Homo Sapiens <400> 4 Leu Ala Ser Ala Leu Val Ser Asn Arg Ser Leu Thr His Leu Cys Leu Ser Asn Asn Ser Leu Gly Asn Glu G1y Val Asn Leu Leu Cys Arg Ser Met Arg Leu Pro His Cys Ser Leu Gln Arg Leu Met Leu Asn Gln Cys His Leu Asp Thr Ala Gly Cys Gly Ser Leu Ala Leu A1a Leu Met Gly Asn Ser Thr Leu Thr His Leu Ser Leu Ser Met Asn Pro Val Glu Asp Asn Gly Val Lys Leu Leu Cys Glu Val Met Arg Glu Pro Ser Cys His Leu Gln Asp Leu Glu Leu Val Lys Cys His Leu Thr Ala Ala Cys Cys l00 105 110 Glu Ser Leu Ser Cys Val Ile Ser Arg Ser Arg His Leu Lys Ser Leu Asp Leu Thr Asp Asn Ala Leu Gly Asp Gly Gly Val Ala Ala Leu Cys Glu G1y Leu Lys Gln Lys Asn Ser Val Leu Thr Arg Leu Gly Leu Lys Ala Cys Gly Leu Thr Ser Asp Cys Cys Glu Ala Leu Ser Leu Ala Leu Ser Cys Asn Arg His Leu Thr Ser Leu Asn Leu Val Gln Asn Asn Phe Ser Pro Lys Gly Met Met Lys Leu Cys Ser Ala Phe Ala Cys Pro Thr Ser Asn Leu Gln Ile Ile Gly Leu Thr Lys Thr Gln Tyr Pro Val Gln Ile Arg Lys Leu Leu Glu Glu Val Gln Leu Leu Lys Pro Arg Val Val Ile Asp Gly Ser Thr His Ser Phe Asp Glu Asp Asp Arg Tyr Thr Thr Lys Asn <210> 5 <211> 3447 <212> DNA
<213> Mus musculus <400> 5 aaagcacaat gggtcctcca gaaaaagaaa gtaaagcaat cttgaaagca cgtggattgg 60 aagaggaaca gaagtcagaa agaaaaatga cttctccaga aaacgacagt aaatcaatcc 120 agaaagacca aggaccagag caggagcaga catcagaaag cacaatgggt cctccagaaa l80 aagacagtaaagcaatcttgaaagcacgtggattggaagaggaacagaagtcagaaagca 240 caatgtctccttcagaaaatgtcagtagagcaatcctgaaagacagtggatcagaagaag 300 tggaacaggcgtcagaaagaaaaatgacttctccagaaaacgacagtaaatcaatccaga 360 aagaccaaggaccagagcaggagcagacatcagaaaccttacaatctaaggaagaagatg 420 aagtgacagaggcagataaagataatggaggtgacttacaagactacaaggcccatgtga 480 ttgctaagttcgacacaagtgtggatctacactatgacagcccagagatgaaattattgt 540 ctgatgcttttaaaccataccagaaaaccttccagcctcacaccattatcctacatggaa 600 gaccaggagttgggaagtcagctttggccagaagtattgttcttggctgggcacagggta 660 aactcttccaaaaaatgtcctttgtcatcttcttctctgttagagaaataaagtggacag 720 agaagagcagtttggcacagctgattgctaaggagtgtccagactcctgggatctagtga 780 caaagatcatgtcccaaccagaaagactcttgtttgtcatagatggcttggatgatatgg 840 actctgtcctccaacatgatgatatgacactatccagagactggaaggatgaacagccca 900 tatacatcctgatgtacagcctcctgaggaaggctctcttacctcagtcctttctcatca 960 ttaccaccagaaacacaggcttagaaaaactcaagtcaatggttgtgtcccccctctata1020 tactggttgaaggactgtctgcatcaaggagatctcagctggtcctcgagaacatctcca1080 atgagtctgatagaatacaagtcttccattctctgatagaaaatcaccagctgtttgacc1140 aatgccaggccccctctgtgtgctccctggtctgtgaggctctacagctacagaagaaac1200 tgggaaagagatgcaccctaccctgccagactctcaccggtttgtatgccacgttggtgt1260 ttcaccagctcaccttgaaaaggccttcccagagcgctctcagtcaggaagaacagatta1320 ctctagtgggtttgtgcatgatggcagctgaaggagtgtggaccatgaggtcggtgttct1380 atgatgatgacctgaagaactatagcctaaaggagtctgagatcttggccctctttcaca1440 tgaacatccttctccaggttggccacaacagtgagcagtgttatgttttctcccacctca1500 gcctgcaggatttctttgctgccttatattatgttttagaagggctggaggaatggaatc1560 agcatttttgcttcattgaaaaccaaaggagcatcatggaggtgaagagaactgacgaca1620 ctcgcctcctcgggatgaagcgtttcttatttggcctcatgaacaaggatatcttgaaga1680 ctctggaggttctgtttgaatatcccgtgattccaactgttgagcagaagctccaacact1740 gggtctctctgatagctcagcaggtcaatggcaccagcccaatggacaccctggatgcct1800 tctattgtctatttgagtctcaggatgaagagtttgttggcggggctctcaaacgcttcc1860 aagaagtgtggctgctgattaaccagaagatggacttgaaggtctcttcctactgtctca1920 agcactgtcagaacttgaaggcaatccgggtggatatcagagacctcctctcggtagata1980 atactctcgagctgtgccctgttgttactgtccaggagacacaatgtaagcccctcctca2040 tggagtggtggggaaacttctgctctgtgcttggcagcctccggaacttgaaggagctgg2100 acttgggcgacagcatcctgagtcaacgggccatgaagatactgtgcctcgagctgcgga2160 atcagtcctgcagaatacagaagctgacgtttaagagtgcagaggtagtgtctggcctga2220 aacatctctggaagctcctttttagcaatcaaaacttaaagtacctcaatctagggaaca2280 ctcccatgaaggatgatgacatgaagttagcctgcgaagcgctgaaacatccaaagtgct2340 ccgtggagactctgaggttggattcctgtgagttaaccatcattggttatgagatgatct2400 ccacgcttcttatttcaaccaccaggctaaagtgtctcagcctggccaaaaatagagtgg2460 gagtaaaaagcatgatatcccttgggaatgccttgagtagctcaatgtgtctactgcaaa2520 agttgatactggacaactgtggcctcacacctgccagctgccaccttctggtctcagccc2580 ttttcagcaaccagaacttgacacacctgtgcctgtcaaacaacagcctggggactgaag2640 gagtgcaacagctgtgtcagttcctgaggaatccagaatgtgctctccagcggctgatac2700 tgaatcactgcaacattgtagatgatgcttatggcttcctggcaatgagacttgcaaaca2760 acacaaagctgacccacctgagcctgaccatgaaccccgtaggggatggtgcaatgaagc2820 tactgtgtgaagctttaaaggaacctacttgttaccttcaagaactggaactagtggact2880 gccaactcacacagaactgctgcgaggacctggcctgtatgatcacaacaaccaagcact29.40 taaaaagtttggatcttggtaacaacgccctgggtgacaaaggagtcataaccctgtgtg3000 agggactgaagcaaagtagcagctccctgaggagacttgggttgggggcatgtaagttga3060 cttccaattgctgtgaggcattgtcattggccatctcttgcaaccctcacctgaacagcc3120 taaacctggtgaagaatgacttcagtacatcggggatgttgaagctgtgctctgcgttcc3180 aatgccctgtctctaacctggggataattggcctgtggaagcaggagtactatgcccgag3240 tgagaagacagctggaggaagttgagtttgtcaagccccacgtggtgattgatggtgatt3300 ggtatgctagtgatgaagatgaccgaaactggtggaaaaactgaagacatgagccccctc3360 tccttcacgtcctagcactgcagtatctgtgaaatgtttgtctcaccttggaggatgtag3420 caagaatgaaataaacacagcatttag 3447 <210> 6 <211> 1111 <212> PRT
<213> Mus musculus <400> 6 Met Gly Pro Pro Glu Lys Glu Ser Lys Ala Ile Leu Lys Ala Arg G1y Leu Glu Glu Glu Gln Lys Ser Glu Arg Lys Met Thr Ser Pro Glu Asn Asp Ser Lys Ser Ile Gln Lys Asp Gln Gly Pro Glu Gln Glu Gln Thr Ser Glu Ser Thr Met Gly Pro Pro Glu Lys Asp Ser Lys Ala Ile Leu Lys Ala Arg Gly Leu Glu Glu Glu Gln Lys Ser Glu Ser Thr Met Ser Pro Ser Glu Asn Val Ser Arg Ala Ile Leu Lys Asp Ser Gly Ser Glu Glu Val Glu Gln Ala Ser Glu Arg Lys Met Thr Ser Pro Glu Asn Asp Ser Lys Ser Ile Gln Lys Asp Gln Gly Pro Glu Gln Glu Gln Thr Sex 115 120 l25 Glu Thr Leu Gln Ser Lys Glu Glu Asp Glu Val Thr Glu A1a Asp Lys Asp Asn Gly Gly Asp Leu Gln Asp Tyr Lys Ala His Val Ile Ala Lys Phe Asp Thr Ser Val Asp Leu His Tyr Asp Ser Pro Glu Met Lys Leu l65 170 175 Leu Ser Asp Ala Phe Lys Pro Tyr Gln Lys Thr Phe Gln Pro His Thr Ile Ile Leu His Gly Arg Pro Gly Val Gly Lys Ser A1a Leu A1a Arg Ser Ile Val Leu Gly Thr Ala Gln Gly Lys Leu Phe Gln Lys Met Ser Phe Val Ile Phe Phe Ser Val Arg Glu Ile Lys Thr Thr Glu Lys Ser Ser Leu Ala G1n Leu Ile Ala Lys Glu Cys Pro Asp Ser Thr Asp Leu Val Thr Lys Ile Met Ser Gln Pro Glu Arg Leu Leu Phe Val Ile Asp Gly Leu Asp Asp Met Asp Ser Val Leu Gln His Asp Asp Met Thr Leu Ser Arg Asp Thr Lys Asp Glu Gln Pro Ile Tyr Ile Leu Met Tyr Ser Leu Leu Arg Lys Ala Leu Leu Pro Gln Ser Phe Leu Ile Ile Thr Thr Arg Asn Thr Gly Leu Glu Lys Leu Lys Ser Met Val Val Ser Pro Leu Tyr Ile Leu Val Glu Gly Leu Ser Ala Ser Arg Arg Ser Gln Leu Val Leu Glu Asn Ile Ser Asn G1u Ser Asp Arg Ile G1n Val Phe His Ser Leu Ile G1u Asn His Gln Leu Phe Asp Gln Cys Gln Ala Pro Ser Val Cys Ser Leu Val Cys Glu Ala Leu Gln Leu Gln Lys Lys Leu Gly Lys Arg Cys Thr Leu Pro Cys Gln Thr Leu Thr Gly Leu Tyr Ala Thr Leu Val Phe His G1n Leu Thr Leu Lys Arg Pro Ser Gln Ser Ala Leu Ser Gln Glu Glu Gln Ile Thr Leu Val Gly Leu Cys Met Met Ala A1a Glu Gly Val Thr Thr Met Arg Ser Val Phe Tyr Asp Asp Asp Leu Lys Asn Tyr Ser Leu Lys G1u Ser Glu Tle Leu Ala Leu Phe His Met Asn Ile Leu Leu Gln Val Gly His Asn Ser Glu Gln Cys Tyr Val Phe Ser His Leu Ser Leu Gln Asp Phe Phe Ala Ala Leu Tyr Tyr Val Leu Glu Gly Leu Glu Glu Thr Asn Gln His Phe Cys Phe Ile Glu Asn Gln Arg Ser Ile Met Glu Val Lys Arg Thr Asp Asp Thr Arg Leu Leu Gly Met Lys Arg Phe Leu Phe Gly Leu Met Asn Lys Asp Ile Leu Lys Thr Leu Glu Val Leu Phe Glu Tyr Pro Val Ile Pro Thr Val Glu Gln Lys Leu Gln His Thr Val Ser Leu Ile Ala Gln Gln Va1 Asn Gly Thr Ser Pro Met Asp Thr Leu Asp Ala Phe Tyr Cys Leu Phe Glu Ser Gln Asp Glu Glu Phe Val Gly Gly Ala Leu Lys Arg Phe Gln Glu Val Thr Leu Leu Ile Asn Gln Lys Met Asp Leu Lys Val Ser Ser Tyr Cys Leu Lys His Cys Gln Asn Leu Lys Ala Ile Arg Val Asp Ile Arg Asp Leu Leu Ser Val Asp Asn Thr Leu Glu Leu Cys Pro Val Val Thr Val Gln Glu Thr G1n Cys Lys Pro Leu Leu Met Glu Thr Thr Gly Asn Phe Cys Ser Val Leu Gly Ser Leu Arg Asn Leu Lys Glu Leu Asp Leu Gly Asp Ser Ile Leu Ser Gln Arg Ala Met Lys Ile Leu Cys Leu Glu Leu Arg Asn Gln Ser Cys Arg Tle Gln Lys Leu Thr Phe Lys Ser Ala Glu Val Val Ser Gly Leu Lys His Leu Thr Lys Leu Leu Phe Ser Asn Gln Asn Leu Lys Tyr Leu Asn Leu Gly Asn Thr Pro Met Lys Asp Asp Asp Met Lys Leu Ala Cys Glu Ala Leu Lys His Pro Lys Cys Ser Val Glu Thr Leu Arg Leu Asp Ser Cys Glu Leu Thr Ile Ile Gly Tyr Glu Met Ile Ser Thr Leu Leu Ile Ser Thr Thr Arg Leu Lys Cys Leu Ser Leu Ala Lys Asn Arg Val Gly Val Lys Ser Met Ile Ser Leu Gly Asn Ala Leu Ser Ser Ser Met Cys Leu Leu Gln Lys Leu Ile Leu Asp Asn Cys Gly Leu Thr Pro Ala Ser Cys His Leu Leu Val Ser Ala Leu Phe Ser Asn Gln Asn Leu Thr His Leu Cys Leu 5er Asn Asn Ser Leu Gly Thr Glu Gly Val Gln Gln Leu Cys Gln Phe Leu Arg Asn Pro Glu Cys Ala Leu Gln Arg Leu Ile Leu Asn His Cys Asn Ile Val Asp Asp Ala Tyr Gly Phe Leu Ala Met Arg Leu A1a Asn Asn Thr Lys Leu Thr His Leu Ser Leu Thr Met Asn Pro Val Gly Asp Gly Ala Met Lys Leu Leu Cys Glu Ala Leu Lys Glu Pro Thr Cys Tyr Leu Gln Glu Leu Glu Leu Val Asp Cys Gln Leu Thr Gln Asn Cys Cys Glu Asp Leu Ala Cys Met Ile Thr Thr Thr Lys His Leu Lys Ser Leu Asp Leu Gly Asn Asn Ala Leu Gly Asp Lys Gly Val Ile Thr Leu Cys Glu Gly Leu Lys Gln Ser Ser Ser Ser Leu Arg Arg Leu Gly Leu Gly Ala Cys Lys Leu Thr Ser Asn Cys Cys Glu Ala Leu Ser Leu A1a Ile Ser Cys Asn Pro His Leu Asn Ser Leu Asn Leu Val Lys Asn Asp Phe Ser Thr Ser Gly Met Leu Lys Leu Cys Ser Ala Phe Gln Cys Pro Val Ser Asn Leu Gly Ile Tle Gly Leu Thr Lys Gln Glu Tyr Tyr Ala Arg Val Arg Arg Gln Leu Glu Glu Val Glu Phe Val Lys Pro His Val Val Ile Asp Gly Asp Thr Tyr Ala Ser Asp Glu Asp Asp Arg Asn Thr Thr Lys Asn <210> 7 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 7 tttcacatga acatccttct cc 22 <210> 8 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic 0ligonucleotide <400> 8 agtgctggag gcagaaggaa g 21 <210> 9 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 9 caggaattgg gaaatcggct ctctag 26 <210> 10 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 10 ccaaatgctt tgtgtttatt taattcc 27 <210> 11 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 11 cggaattcgt cactcagcg 19 <210> 12 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 12 agcgcgtgaa tcagatcg 18 <210> 13 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 13 attccctggt agagtccacc ttgc _ 24 <210> 14 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 14 acagcacgat ccttctggct agag 24 <210> 15 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> l5 caagctccgg tgacggagat cat 23 <210> 16 <211> 22 <212> DNA
<2l3> Artificial Sequence <220>
<223> Sythetic Oligonucleotide <400> 16 agctggaggc agaaggaaga tg 22 <210> 17 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 17 tctggcctca gccctcgtca gcttgac 27 <210> 18 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 18 ccaaatgctt tgtgtttatt taattcc 27 <210> 19 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 19 tctggcctca gccctcgtca g 21 <210> 20 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 20 actgaagtta ttctgcacca g 21 <210> 21 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 21 tgacttctga ttgctgtgag 2f <210> 22 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 22 ttccaccagt accggtcatc 2p <210> 23 <211> 3900 <212> DNA
<213> Homo sapiens <220>
<221> CDS
<222> (1)..(3600) <223> , <400> 23 atg aag gtt gca gga gga ctt gaa ctt gga get get get ctg ctc tca 48 Met Lys Val Ala Gly Gly Leu Glu Leu Gly Ala Ala Ala Leu Leu Ser gca tca cca cgt get ctt gtc act ctt tcc aca ggt cct act tgc tct 96 Ala Ser Pro Arg Ala Leu Val Thr Leu Ser Thr Gly Pro Thr Cys Ser atatta ccaaagaat cca ttcccccaa ctgagc tctcagcct 144 ctt aac IleLeu ProLysAsn Pro PheProGln LeuSer SerGlnPro Leu Asn tgtatc aagatggaa gga aaatcgctc ttttcc agctacggg 192 gac acc CysIle LysMetGlu Gly LysSerLeu PheSer SerTyrGly Asp Thr ctgcaatggtgt ctctatgag ctagacaag gaagaattt cagaca ttc 240 LeuGlnTrpCys LeuTyrGlu LeuAspLys GluGluPhe GlnThr Phe aaggaattacta aagaagaaa tcttcagaa tcgaccaca tgctct att 288 LysG1uLeuLeu LysLysLys SerSerGlu SerThrThr CysSer Ile ccacagtttgaa atcgagaat gccaacgtg gaatgtctg gcactc ctc 336 ProGlnPheGlu IleGluAsn AlaAsnVal GluCysLeu AlaLeu Leu ttgcatgagtat tatggagca tcgctggcc tgggetacg tccatt agc 384 LeuHisGluTyr TyrGlyAla SerLeuAla TrpAlaThr SerIle Ser atctttgaaaac atgaacctg cgaaccctc tcggagaag gcacgg gat 432 IlePheGluAsn MetAsnLeu ArgThrLeu SerGluLys AlaArg Asp gacatgaaaaga cattcacca gaagatcct gaagcaacg atgact gac 480 AspMetLysArg HisSerPro GluAspPro GluAlaThr MetThr Asp caaggaccaagc aaggaaaaa gtgccagga atttcacaa getgtg caa 528 GlnGlyProSer LysGluLys ValProGly IleSerGln AlaVal Gln caagatagtgcc acagetgca gagacaaaa gaacaggaa atttca caa 576 GlnAspSerAla ThrAlaA1a GluThrLys GluGlnGlu IleSer Gln getatggaacaa gaaggtgcc acagcagca gagacagaa gaacaa gaa 624 AlaMetGluGln GluGlyAla ThrA1aAla GluThrGlu GluGln Glu atttcacaaget atggaacaa gaaggtgcc acagcagca gagaca gaa 672 IleSerGlnAla MetGluGln GluGlyAla ThrAlaAla GluThr Glu gaacaaggacat ggaggtgac acatgggac tacaagagt cacgtg atg 720 GluGlnGlyHis GlyGlyAsp ThrTrpAsp TyrLysSer HisVal Met accaaattcget gaggaggag gatgtacgt cgtagtttt gaaaac act 768 ThrLysPheAla GluGluGlu AspValArg ArgSerPhe GluAsn Thr getgetgactgg ccggaaatg caaacgttg getggtget tttgat tca 816 AlaAlaAspTrp ProGluMet GlnThrLeu AlaGlyAla PheAsp Ser gaccggtggggc ttccggcct cgcacggtg gttctgcac ggaaag tca 864 Asp Trp Gly Phe Pro Thr Val Val His Gly Lys Ser Arg Arg Arg Leu gga ggg aaa tcg cta aga agg atc ctg tgc tgg gcg 912 att get gcc gtg Gly Gly Lys Ser Leu Arg Arg Ile Leu Cys Trp Ala Ile Ala Ala Val caaggtggactc taccaggga atgttctcc tacgtcttc ttccte ccc 960 GlnGlyGlyLeu TyrGlnGly MetPheSer TyrValPhe PheLeu Pro 305 310 ~ 315 320 gttagagagatg cagcggaag aaggagagc agtgtcaca gagttc atc 1008 ValArgGluMet GlnArgLys LysGluSer SerValThr GluPhe Ile tecagggagtgg ccagactec caggetecg gtgacggag ateatg tce 1056 SerArgGluTrp ProAspSer GlnAlaPro ValThrGlu IleMet Ser cgaccagaaagg ctgttgttc atcattgac ggtttcgat gacctg ggc 1104 ArgProGluArg LeuLeuPhe IleI1eAsp GlyPheAsp AspLeu Gly tctgtcctcaac aatgacaca aagctctgc aaagactgg getgag aag 1152 SerValLeuAsn AsnAspThr LysLeuCys LysAspTrp AlaGlu Lys cagcctccgttc accctcata cgcagtctg ctgaggaag gtcctg ctc 120.0 GlnProProPhe ThrLeuIle ArgSerLeu LeuArgLys ValLeu Leu cctgagtccttc ctgatcgtc accgtcaga gacgtgggc acagag aag 1248 ProGlu5erPhe LeuIleVal ThrValArg AspValGly ThrGlu Lys ctcaagtcagag gtcgtgtct ccccgttac ctgttagtt agagga atc 1296 LeuLys5erGlu Va1ValSer ProArgTyr LeuLeuVal ArgGly Ile tccggggaacaa agaatccac ttgctcctt gagcgcggg attggt gag 1344 SerGlyGluGln ArgIleHis LeuLeuLeu GluArgGly IleG1y Glu catcagaagaca caagggttg cgtgcgatc atcaacaac cgtgag ctg 1392 HisGlnLysThr GlnGlyLeu ArgA1aIle IleAsnAsn ArgGlu Leu ctcgaccagtgc caggtgccc gccgtgggc tctctcatc tgcgtg gcc 1440 LeuAspGlnCys GlnValPro AlaValGly SerLeuTle CysVal A1a ctgcagctgcag gacgtggtg ggggagagc gtcgccccc ttcaac caa 1488 LeuGlnLeuGln AspValVal GlyGluSer ValAlaPro PheAsn Gln acgctcaca~ggcctgcacgcc gettttgcg tttcatcag cteacc cet 1536 ThrLeuThrGly LeuHisAla AlaPheAla PheHisGln LeuThr Pro cgaggcgtggtc cggcgctgt ctcaatctg gaggaaaga gttgtc ctg 1584 ArgGlyValVal ArgArgCys LeuAsnLeu GluGluArg ValVal Leu aagcgc ttctgccgt atggetgtg gagggagtg tggaat aggaagtca 1632 LysArg PheCysArg MetAlaVal G1uGlyVal TrpAsn ArgLysSer gtgttt gatggtgac gacctcatg gttcaagga ctcggg gagtctgag 1680 ValPhe AspGlyAsp AspLeuMet ValGlnGly LeuGly GluSerGlu ctccgt getctgttt cacatgaac atccttctc ccagac agccactgt 1728 LeuArg AlaLeuPhe HisMetAsn IleLeuLeu ProAsp SerHisCys gaggag tactacacc ttcttccac ctcagtctc caggac ttctgtgcc 1776 GluGlu TyrTyrThr PhePheHis LeuSerLeu GlnAsp PheCysAla gccttg tactacgtg ttagagggc ctggaaatc gagcca getctctgc 1824 AlaLeu TyrTyrVa1 LeuGluGly LeuGluIle GluPro AlaLeuCys cctctg tacgttgag aagacaaag aggtccatg gagctt aaacaggca 1872 ProLeu TyrVa1Glu LysThrLys ArgSerMet GluLeu LysGlnAla ggcttc catatccac tcgctttgg atgaagcgt ttcttg tttggcctc 1920 GlyPhe HisIleHis SerLeuTrp MetLysArg PheLeu PheGlyLeu gtgagc gaagacgta aggaggcca ctggaggtc ctgctg ggctgtccc 1968 ValSer GluAspVal ArgArgPro LeuG1uVal LeuLeu GlyCysPro gttccc ctgggggtg aagcagaag cttctgcac tgggtc tctctgttg 2016 ValPro LeuGlyVal LysGlnLys LeuLeuHis TrpVal SerLeuLeu ggtcag cagcctaat gccaccacc ccaggagac accctg gacgccttc 2064 GlyGln GlnProAsn AlaThrThr ProGlyAsp ThrLeu AspAlaPhe cactgt cttttcgag actcaagac aaagagttt gttcgc ttggcatta 2112 HisCys LeuPheGlu ThrGlnAsp LysGluPhe ValArg LeuA1aLeu aacagc ttccaagaa gtgtggctt ccgatt aaccagaacctg gacttg 2160 AsnSer PheGlnGlu ValTrpLeu ProIle AsnGlnAsnLeu AspLeu atagca tcttccttc tgcctccag cactgt ccgtatttgcgg aaaatt 2208 IleAla SerSerPhe CysLeuGln HisCys ProTyrLeuArg LysIle cgggtg gatgtcaaa gggatcttc ccaaga gatgagtccget gaggca 2256 ArgVal AspValLys GlyI1ePhe ProArg AspGluSerAla GluAla tgtcct gtggtccct ctatggatg cgggat aagaccctcatt gaggag 2304 CysPro ValValPro LeuTrpMet ArgAsp LysThrLeuIle GluGlu cagtgg gaagatttc tgctccatg cttggcacc cacccacac ctgcgg 2352 GlnTrp GluAspPhe CysSerMet LeuGlyThr HisProHis LeuArg cagctg gacctgggc agcagcatc ctgacagag cgggccatg aagacc 2400 GlnLeu AspLeuGly SerSerIle LeuThrGlu ArgAlaMet LysThr ctgtgt gccaagctg aggcatccc acctgcaag atacagacc ctgatg 2448 LeuCys AlaLysLeu ArgHisPro ThrCysLys IleGlnThr LeuMet tttaga aatgcacag attacccct ggtgtgcaa cacctctgg agaatc 2496 PheArg AsnAlaGln IleThrPro G1yValGln HisLeuTrp ArgIle gtcatg gccaaccgt aacctaaga tccctcaac ttgggaggc acccac 2544 ValMet AlaAsnArg AsnLeuArg SerLeuAsn LeuGlyGly ThrHis ctgaaggaagag gatgtaagg atggcgtgt gaagcctta aaacaccca 2592 LeuLysGluGlu AspValArg MetAlaCys GluAlaLeu LysHisPro aaatgtttgttg gagtctttg aggctggat tgctgtgga ttgacccat 2640 LysCysLeuLeu GluSerLeu ArgLeuAsp CysCysG1y LeuThrHis gcctgttacctg aagatctcc caaatcctt acgacctcc cccagcctg 2888 AlaCysTyrLeu LysIleSer GlnIleLeu ThrThrSer ProSerLeu aaatctctgagc ctggcagga aacaaggtg acagaccag ggagtaacg 2736 LysSerLeuSer LeuAlaGly AsnLysVa1 ThrAspGln G1yValThr cctctcagtgat gccttgagg gtctcccag tgcgccctg cagaagctg 2784 ProLeuSerAsp A1aLeuArg ValSerGln CysAlaLeu GlnLysLeu atactggaggac tgtggcatc acagccacg ggttgccag agtctggcc 2832 IleLeuGluAsp CysGlyIle ThrAlaThr GlyCysG1n SerLeuAla tcagccctcgtc agcaaccgg agcttgaca cacctgtgc ctatccaac 2880 SerAlaLeuVal SerAsnArg SerLeuThr HisLeuCys LeuSerAsn aacagcctgggg aacgaaggt gtaaatcta ctgtgtcga tccatgagg 2928 AsnSerLeuGly AsnGluGly ValAsnLeu LeuCysArg SerMetArg cttccccactgt agtctgcag aggctgatg ctgaatcag tgccacctg 2976 LeuProHisCys SerLeuGln ArgLeuMet LeuAsnGln CysHisLeu gacacggetggc tgtggttct cttgcactt gcgcttatg ggt 3024 aac tca AspThrAlaG1y CysGlySer LeuAlaLeu A1aLeuMet Gly Asn Ser tggctg acg cacctgagc ctt agcatg aaccctgtg gaa gacaat 3069 TrpLeu Thr HisLeuSer Leu SerMet AsnProVal Glu AspAsn ggcgtg aag cttcogtgc gag gtcatg agagaacca tct tgtcat 3114 GlyVal Lys LeuLeuCys Glu ValMet ArgGluPro Ser CysHis ctccag gac ctggagttg gta aagtgt catctcacc gcc gcgtgc 3159 LeuGln Asp LeuGluLeu Val LysCys HisLeuThr Ala AlaCys tgtgag agt ctgtcctgt gtg atctcg aggagcaga cac ctgaag 3204 CysGlu Ser LeuSerCys Val IleSer ArgSerArg His LeuLys agcctg gat ctcacggac aat gccctg ggtgacggt ggg gttget 3249 SerLeu Asp LeuThrAsp Asn AlaLeu GlyAspGly Gly ValAla gcgctg tgc gagggactg aag caaaag aacagtgtt ctg acgaga 3294 AlaLeu Cys GluGlyLeu Lys GlnLys AsnSerVal Leu ThrArg ctcggg ttg aaggcatgt gga ctgact tctgattgc tgt gaggca 3339 LeuGly Leu LysAlaCys Gly LeuThr SerAspCys Cys GluAla ctctcc ttg gccctttcc tgc aaccgg catctgacc agt ctaaac 3384 LeuSer Leu AlaLeuSer Cys AsnArg HisLeuThr Ser 2euAsn ctggtg cag aataacttc agt cccaaa ggaatgatg aag ctgtgt 3429 LeuVal Gln AsnAsnPhe Ser ProLys GlyMetMet Lys LeuCys tcggcc ttt gcctgtccc acg tctaac ttacagata att gggctg 3474 SerAla Phe AlaCysPro Thr SerAsn LeuGlnIle Ile GlyLeu tggaaa tgg cagtaccct gtg caaata aggaagctg ctg gaggaa 3519 TrpLys Trp GlnTyrPro Val GlnIle ArgLysLeu Leu GluGlu gtgcag cta ctcaagccc cga gtcgta attgacggt agt tggcat 3564 ValG1n Leu LeuLysPro Arg ValVa1 IleAspGly Ser TrpHis tctttt gat gaagatgac cgg tactgg tggaaaaac tgaagatacg 9610 SerPhe Asp GluAspAsp Arg TyrTrp TrpLysAsn gaaacctgcc ccactcacac ccatctgatg gaggaacttt aaacgctgtt ttctcagagc 3670 aagctatgca cctgggagtt ccttctcaaa gatggagaat gatttctgat tctcacaaag 3730 ccctcaatgg tagtgattct tctgtgttca ctctacgttg gttactggat ttgaaggcta 3790 gagaccttca agtcatagga ctcagtatct gtgaaatgtc cgtcatatct cagagcatat 3850 agagggaatt aaataaacac aaagcatttg gaaaaaaaaa aaaaaaaaaa 3900 <210> 24 <211> 1200 <212> PRT
<213> Homo sapiens <400> 24 Met Lys Val Ala Gly Gly Leu Glu Leu Gly Ala Ala Ala Leu Leu Ser Ala Sex Pro Arg Ala Leu Val Thr Leu Ser Thr Gly Pro Thr Cys Ser Ile Leu Pro Lys Asn Pro Leu Phe Pro Gln Asn Leu Ser Ser Gln Pro Cys Ile Lys Met G1u Gly Asp Lys Ser Leu Thr Phe Ser Ser Tyr Gly Leu Gln Trp Cys Leu Tyr Glu Leu Asp Lys Glu Glu Phe Gln Thr Phe Lys Glu Leu Leu Lys Lys Lys Ser Ser Glu Ser Thr Thr Cys Ser Ile Pro Gln Phe Glu Ile Glu Asn Ala Asn Val Glu Cys Leu Ala Leu Leu Leu His Glu Tyr Tyr Gly Ala Ser Leu Ala Trp Ala Thr Ser Ile Ser 115 120 l25 Ile Phe Glu Asn Met Asn Leu Arg Thr Leu Ser Glu Lys Ala Arg Asp Asp Met Lys Arg His Ser Pro Glu Asp Pro Glu Ala Thr Met Thr Asp Gln Gly Pro Ser Lys Glu Lys Val Pro Gly I1e Ser Gln A1a Val Gln Gln Asp Ser Ala Thr Ala Ala Glu Thr Lys G1u Gln G1u Ile Ser Gln Ala Met Glu Gln Glu Gly Ala Thr Ala Ala Glu Thr Glu Glu Gln Glu Ile Ser Gln Ala Met Glu Gln Glu Gly A1a Thr Ala Ala Glu Thr Glu Glu Gln Gly His Gly Gly Asp Thr Trp Asp Tyr Lys Ser His Val Met Thr Lys Phe Ala Glu Glu Glu Asp Val Arg Arg Ser Phe Glu Asn Thr Ala Ala Asp Trp Pro Glu Met Gln Thr Leu Ala Gly A1a Phe Asp Ser Asp Arg Trp Gly Phe Arg Pro Arg Thr Val Val Leu His G1y Lys Ser Gly Ile Gly Lys Ser Ala Leu Ala Arg Arg Ile Val Leu Cys Trp Ala Gln Gly Gly Leu Tyr Gln Gly Met Phe Ser Tyr Val Phe Phe Leu Pro 305 3l0 315 320 Val Arg G1u Met Gln Arg Lys Lys Glu Ser Ser Val Thr Glu Phe Ile Ser Arg Glu Trp Pro Asp Ser G1n Ala Pro Val Thr Glu 21e Met Ser Arg Pro Glu Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Asp Leu Gly Ser Val Leu Asn Asn Asp Thr Lys Leu Cys Lys Asp Trp Ala Glu Lys G1n Pro Pro Phe Thr Leu Ile Arg Ser Leu Leu Arg Lys Val Leu Leu Pro Glu Ser Phe Leu Ile Val Thr Val Arg Asp Val Gly Thr Glu Lys Leu Lys Ser Glu Val Val Ser Pro Arg Tyr Leu Leu Val Arg Gly Ile Ser Gly Glu Gln Arg Ile His Leu Leu Leu G1u Arg Gly Ile Gly Glu His Gln Lys Thr Gln Gly Leu Arg A1a Ile Tle Asn Asn Arg Glu Leu Leu Asp Gln Cys Gln Val Pro Ala Val Gly Ser Leu Ile Cys Val Ala Leu Gln Leu Gln Asp Val Val Gly Glu Ser Val Ala Pro Phe Asn Gln Thr Leu Thr Gly Leu His Ala Ala Phe Ala Phe His Gln Leu Thr Pro Arg Gly Val Val Arg Arg Cys Leu Asn Leu Glu Glu Arg Val Val Leu Lys Arg Phe Cys Arg Met Ala Val Glu Gly Va1 Trp Asn Arg Lys Ser Val Phe Asp Gly Asp Asp Leu Met Val Gln Gly Leu Gly Glu Ser Glu Leu Arg Ala Leu Phe His Met Asn I1e Leu Leu Pro Asp Ser His Cys Glu Glu Tyr Tyr Thr Phe Phe His Leu Ser Leu Gln Asp Phe Cys Ala Ala Leu Tyr Tyr Val Leu Glu Gly Leu Glu Ile Glu Pro Ala Leu Cys Pro Leu Tyr Val Glu Lys Thr Lys Arg Ser Met Glu Leu Lys G1n Ala Gly Phe His Ile His Ser Leu Trp Met Lys Arg Phe Leu Phe Gly Leu Val Ser Glu Asp Val Arg Arg Pro Leu Glu Val Leu Leu Gly Cys Pro Val Pro Leu Gly Val Lys Gln Lys Leu Leu His Trp Val Ser Leu Leu Gly Gln Gln Pro Asn Ala Thr Thr Pro Gly Asp Thr Leu Asp Ala Phe His Cys Leu Phe Glu Thr Gln Asp Lys Glu Phe Val Arg Leu Ala Leu Asn Ser Phe Gln Glu Val Trp Leu Pro Ile Asn Gln Asn Leu Asp Leu Ile Ala Ser Ser Phe Cys Leu Gln His Cys Pro Tyr Leu Arg Lys Ile Arg Val Asp Val Lys Gly Ile Phe Pro Arg Asp Glu Ser Ala Glu Ala Cys Pro Val Val Pro Leu Trp Met Arg Asp Lys Thr Leu Ile Glu Glu Gln Trp Glu Asp Phe Cys Ser Met Leu Gly Thr His Pro His Leu Arg Gln Leu Asp Leu Gly Ser Ser Ile Leu Thr Glu Arg Ala Met Lys Thr Leu Cys Ala Lys Leu Arg His Pro Thr Cys Lys Ile Gln Thr Leu Met Phe Arg Asn Ala Gln Ile Thr Pro Gly Va1 Gln His Leu Trp Arg Ile Val Met Ala Asn Arg Asn Leu Arg Ser Leu Asn Leu Gly Gly Thr His Leu Lys Glu Glu Asp Val Arg Met Ala Cys Glu Ala Leu Lys His Pro Lys Cys Leu Leu Glu Ser Leu Arg Leu Asp Cys Cys Gly Leu Thr His Ala Cys Tyr Leu Lys Ile Ser Gln Ile Leu Thr Thr Ser Pro Ser Leu Lys Ser Leu Ser Leu Ala Gly Asn Lys Val Thr Asp Gln G1y Val Thr Pro Leu Ser Asp Ala Leu Arg Val Ser G1n Cys Ala Leu Gln Lys Leu Ile Leu Glu Asp Cys Gly Ile Thr Ala Thr Gly Cys Gln Ser Leu Ala Ser Ala Leu Val Ser Asn Arg Ser Leu Thr His Leu Cys Leu Ser Asn Asn Ser Leu Gly Asn Glu Gly Val Asn Leu Leu Cys Arg Ser Met Arg Leu Pro His Cys Ser Leu Gln Arg Leu Met Leu Asn Gln Cys His Leu Asp Thr Ala Gly Cys Gly Ser Leu Ala Leu Ala Leu Met Gly Asn Ser Trp Leu Thr His Leu Ser Leu Ser Met Asn Pro Val Glu Asp Asn Gly Val Lys Leu Leu Cys Glu Val Met Arg Glu Pro Ser Cys His Leu Gln Asp Leu Glu Leu Val Lys Cys His Leu Thr Ala Ala Cys Cys Glu Ser Leu Ser Cys Val Ile Ser Arg Ser Arg His Leu Lys Ser Leu Asp Leu Thr Asp Asn Ala Leu Gly Asp Gly Gly Val Ala Ala Leu Cys Glu Gly Leu Lys Gln Lys Asn Ser Val Leu Thr Arg Leu Gly Leu Lys Ala Cys Gly Leu Thr Ser Asp Cys Cys G1u Ala Leu Ser Leu Ala Leu Ser Cys Asn Arg His Leu Thr Ser Leu Asn Leu Val Gln Asn Asn Phe Ser Pro Lys Gly Met Met Lys Leu Cys Ser Ala Phe Ala Cys Pro Thr Ser Asn Leu Gln Ile Ile Gly Leu Trp Lys Trp GIn Tyr Pro Val Gln Ile Arg Lys Leu Leu Glu Glu Val Gln Leu Leu Lys Pro Arg Val Val Ile Asp Gly Ser Trp His Ser Phe Asp Glu Asp Asp Arg Tyr Trp Trp Lys Asn <210> 25 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 25 tcttttaaag gta agc gag a 20 Val Ser Glu <210> 26 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 26 tgtcttccag gtt aga ggg g 20 Val Arg Gly , <210> 27 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223> ' <400> 27 tcttttgcag gtg aat gaa a 20 Val Asn Glu <210> 28 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10j <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 28 tcttttgcag gtg tgg aaa a 20 Val Trp Zys <210> 29 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<22l> exon <222> (11) . . (20) <223>
<400> 29 tcttttgcag gtg agg aaa a 20 Val Arg Lys <210> 30 <211> 20 <212> DNA
<213> Homo sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 30 ctgactccag gtg agt acc c 20 Val Ser Thr <210> 31 <211> 20 <212> DNA
<213> Homo sapiens <220>
<221> Intron <222> (1) . . (10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 31 cctgacatag gta agg ctg c 20 Val Arg Leu <210> 32 <211> 20 <212> DNA
<213> Homo sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11) . . (20) <223>
<400> 32 cccattgcag gta cgt ctc t 20 Val Arg Leu <210> 33 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
r <400> 33 gtctctgcag gtg agt gcc a 20 Val Ser Ala <210> 34 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 34 cttcttgcag gtg agt ctg g 20 Val Ser Leu <210> 35 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<22l> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11) . . (20) <223>
<400> 35 tgccccacag gtg agt ttc c 20 Val Sex Phe <210> 36 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 36 cctcttgcag gta act tcc t 20 Val Thr Ser <210> 37 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1) . . (10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 37 gaccctgcag gta agt cgc c 20 Val Ser Arg <210> 38 <211> 20 <212> DNA
<213> Homo sapiens <220>
<22l> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 38 gcctccccag gtt gtc aag t ' 20 Val Val Zys <210> 39 <211> 17 <212> DNA
<213> Homo sapiens <400> 39 gcatgggtca gaaggat 17 <210> 40 <211> 17 <212> DNA
<213> Homo sapiens <400> 40 gtccagtagt ggtaacc 17 <210> 41 <211> 21 <212> DNA
<213> Homo sapiens <400> 41 tgacttctga ttgctgtgag g 21 <210> 42 <211> 20 <212> DNA
<213> Homo Sapiens <400> 42 ctactggcca tgaccacctt 20
5A) and 8 week old (FIG. 5B) Mater null mouse. The 4 week old Mater null ovarian histology (FIG. 5A) displays different stages of normal ovarian follicles with oogenesis, which are indistinguishable from normal ovarian histology. In the 8 week old sample (FIG. 5B), there are a number of corpora lutea indicating normal spontaneous ovulation, similar to follicular luteinization in the wild-type mouse ovary.
FIG. SC is a digitized photograph of ovulated eggs from the Mater null mice, produced in response to exogenous PMSG and hCG. Morphology appears similar to that of ovulated eggs from wild-type mice.
FIG. 5D is a bar graphs showing the numbers (mean ~ s.e.m.) of the ovulated eggs from the Mater null and wild-type mice.
FIG. 6 is a digitized image comparing the gross morphological appearance of the uterus and ovaries of normal and Mater null mice. Ovaries and uteri if Mater null female mice (right) were indistinguishable from the ovaries and uteri from the wild-type female mice (left).
FIG. 7 is an alignment of the amino acid sequence of human MATER (SEQ ID NO:
24) and murine MATER (SEQ ID NO: 6) proteins. Identical amino acids are identified;
similar amino acids are indicated with a plus (+) symbol.
FIG. 8 is illustrates human MATER mRNA and its oocyte-specific expression.
FIG. 8A is a digitized image of a Northern hybridization of human M,4TER.
Total human ovarian RNAs were prepared from women at age 19 (lane 1) and 26 (lane 2) years, as described herein. Ten micrograms of each RNA were separated by gel-electrophoresis and transferred onto a nitrocellulose membrane. The blot was probed with 3zP-labeled human MATER
cDNA. RNA
molecular sizes (kb) are indicated on the left of panel.
FIG. 8B and 8C are digitized images of agarose gels, showing analysis of the indicated transcripts by RT-PCR. Using the Human Rapid-Scan Gene Expression Panel (Origene Inc) and specific primers, cDNAs at 100X concentration were used to amplify human (3-actin (FIG. 8B), while cDNA at 1000X concentration were used to amplify human MATER (FIG. 8C). The cDNAs were synthesized from the RNAs of the human brain (lane 1), heart (2), kidney (3), spleen (4), liver (5), colon (6), lung (7), small intestine (8), muscle (9), stomach (10), testis (11), placenta (12), salivary gland (13), thyroid (14), adrenal gland (15), pancreas (16), ovary (17), uterus (18), prostate (19), skin (20), blood leucocytes (21), bone marrow (22), fetal brain (23), fetal liver (24). Lane 25 and 26 serve as a positive control (human ovarian cDNA, Invitrogen) and a negative control (without cDNA), respectively. PCR products were separated by 2% agarose gel-electrophoresis and visualized by 0.1 % ethidium bromide. Amplification of the PCR products of human (i-actin (640 bp) and human MATER (280 bp) is indicated on the right, respectively.
FIG. 8D is an image of a Southern hybridization blot prepared from the agarose gel separating the human MATER PCR product in FIG. 8C, and probed with 3zP-labeled human MATER
cDNA. Hybridization signals were detected by autoradiography. The arrow indicates the position of PCR product hybridization of human MATER (280 bp) in the control (lane 25) and ovary samples (lane 17).
FIG. 8E and 8F illustrate in situ hybridization of MATER cDNA. 35S-labeled antisense and sense probes were synthesized in vitro transcription using the human MATER
cDNA as templates.
The frozen human ovarian sections were hybridized with the antisense probe (FIG. 8E) and sense probe (FIG. 8F). Dark-field images are displayed, and an arrow indicates the locations of the oocytes.
Scale bar, 100 pm.
FIG. 9 is a series of digitized micrographs, showing oocyte-specific expression of Mater transcripts in human by in situ hybridization. Both [35S]-labeled antisense and sense probes were synthesized by in vitro transcription using the cloned human Mater cDNA as a template. The frozen human ovarian sections were hybridized with the radiolabeled sense (FIG. 9A
and 9C) and antisense (FIG. 9B and 9D) probes. The slides were stained with hematoxylin and eosin.
For each probe, bright-field (FIG. 9A and 9B) and dark-field (FIG. 9C and 9D) images are shown.
FIG. 10 is a pair of digitized micrographs, showing oocyte-specific expression of human MATER protein. Frozen human ovarian sections were incubated with rabbit antisera (1:200) against a C-terminal peptide of mouse MATER protein, and FITC-conjugated goat anti-rabbit IgG antisera were used as the second antibody to detect human MATER protein in the oocyte (FIG. 10A). The corresponding phase contrast image is shown in FIG. l OB.
FIG. 11 illustrates human MATER protein expression in oocytes.
FIG. 11A and 11B are digitized micrographs showing immunohistofluorescence of human MATER in ovarian sections. Frozen human ovarian sections were incubated with rabbit antisera (1:200) against the mouse MATER peptide. FITC-conjugated goat anti-rabbit IgG
antibody was used as a second antibody to detect the primary antibody bound MATER protein.
Tissue sections were visualized by a fluorescence microscopy (FIG. 11A). Corresponding phase contrast is shown in the FIG. 11B. Arrows indicate the location of oocytes. Scale bar: 100 pm.
FIG. 11 C is a protein immunoblot of human MATER. Solubilized proteins of human eggs (lane l, 10 eggs and lane 2, 15 eggs) were separated by 3-8% Tris-Acetate SDS-PAGE
electrophoresis. A protein blot was incubated with rabbit anti-mouse MATER
peptide antisera (1:1000). The ECL detection kit with HRP-conjugated goat anti-rabbit IgG
antibody was used to detect the blot-bound primary antibodies. Approximate protein molecular masses (kDa) are indicated on the left. Human MATER protein is indicated by an arrow at 134 kDa.
FIG. 12 shows the nucleotide (cDNA; SEQ ID NO: 23) and amino acid (SEQ ID NO:
24) sequences of human MATER. The nucleotides (3885 nts) from 5' are displayed on the top line and their numbers are indicated on the right. The initiation code (ATG) and termination code (TGA) is underlined (solid), respectively. The polyadenylation signal (AATAAA) is underlined with a dashed line. The nucleotides at the 5' end of the non-coding region remain to be determined. The deduced amino acid sequence (1200 residues) is under the nucleotide sequence and numbered on the right.
Some structural motifs present in the protein sequence are shown in FIG. 14B.
These sequence data have been submitted to GenBank under an accession number AY054986.
FIG. 13 shows Dotplot analyses of human and mouse MATER amino acid sequences.
Human MATER amino acid sequence was compared with itself (FIG 13A) and the mouse MATER amino acid sequence (FIG. 13B). The center diagonal line from the left to the right represents the direct correspondence of the two sequences of the same protein from amino- to carboxyl-terminus. Identities are shown by the dots. The short diagonal lines parallel to the center diagonal line are present at the carboxyl-terminus and a region close to the amino-terminus, reflecting repeated amino acid sequences at these regions. Display of the dots and short parallel lines delineate similarities of amino acid sequences between human MATER (1200 residues) and mouse MATER
(1111 residues), reflecting homologies of the composition and structure of the MATER protein of the two species.
FIG. 14 illustrates the results of computational analysis of structural motifs in human MATER.
FIG. 14A is a Kyte & Doolittle hydropathy plot of human MATER amino acid sequence.
Hydrophilic repeats at amino-terminus (32-304 amino acids) contain a short hydrophobic region (104-136 amino acids). At the carboxyl-terminus, there is a short hydrophilic region (1184-1200 amino acids).
FIG. 14B is a schematic representation of structural motifs of human MATER.
The horizontal line from amino- to carboxyl-terminus represents the entire peptide chain of human MATER (1200 residues). The opened boxes represent structural motifs and their positions on the peptide chain. The protein contains a domain of PAAD DAPIN at the amino-terminus and six domains of leucine-rich repeats (LRR) at the carboxyl-terminus. Both molecular domains are for protein-protein interactions. In addition, there are motifs with potentials for ATPIGTP-binding (P-loop), nuclear translocation (NLS_BF) and aldo/keto reductase activity (aldo ket red). Locations of these motifs are indicated in the numbers following the particular motifs.
FIG. 15 is a pair of schematic representations of exon-intron maps of human MATER (FIG.
15A) and mouse Mater (FIG. 15B). The exon-intron map of human MATER (~63 kbp) was compared with the mouse Mater (~32 kbp) exon-intron map (Tong et al., Mammal Genonae 11:281, 2000).
Both gene loci have fifteen exons that are indicated by the Arabic numbers on top of each of the vertical bars representing the exons. The horizontal solid lines between exons represent introns, and the horizontal dashed lines at 5' ends represent the undetermined 5' ends of both gene loci. Scale bar (2 kbp) is shown under the map of human MATER.
_g_ SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NO: 1 shows the nucleic acid sequence of human Mater cDNA fragment 1.
SEQ ID NO: 2 shows the amino acid sequence of the human MATER peptide encoded by fragment 1 (SEQ ID NO: 1).
SEQ ID NO: 3 shows the nucleic acid sequence of human Mater cDNA fragment 2.
SEQ ID NO: 4 shows the amino acid sequence of the human MATER peptide encoded by fragment 2 (SEQ ID No: 3).
SEQ ID NO: 5 shows the nucleic acid sequence of murine Mater cDNA (GenBank Accession number NM 011860.1 and AF074018; individual exons are also listed in AF143573).
SEQ ID NO: 6 shows the amino acid sequence of the murine MATER protein (GenBank Accession number NP 035990).
SEQ ID NOs: 7-22 shows several synthetic oligonucleotides useful as probes and/or primers.
SEQ ID NO: 23 shows the nucleic acid sequence of the human Mater cDNA, and the amino acid sequence so encoded.
SEQ ID NO: 24 shows the amino acid sequence of the human MATER protein.
SEQ ID NOs: 25-38 are oligonucleotide sequences that overlap the intron-exon boundaries in the human Mater gene. In order, these oligonucleotides correspond to the splice junctions that define exons 1-15, as described more fully herein.
SEQ ID NOs: 39 and 40 are human (3-actin specific primers.
SEQ ID NOs: 41 and 42 are human MATER-specific primers.
DETAILED DESCRIPTION OF THE DISCLOSURE
1. Abbreviations ES: embryonic stem Mater: Maternal _Antigen _That _Embryos _Require OPl: Ooplasm-specific Protein 1 POF: Premature Ovarian Failure TRC: Transcription Related Complex ZP3: zor~a pellucida glycoprotein 3 1l. Terms Unless otherwise noted, technical terms are used according to conventional usage.
Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes Y, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Erzcyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the invention, the following explanations of specific terms are provided:
Abnormal: Deviation from normal characteristics. Normal characteristics can be found in a control, a standard for a population, etc. For instance, where the abnormal condition is an autoimmune disease condition, such as autoimmune infertility, sources of normal characteristics might include an individual who is not suffering from the autoimmune disorder, a population standard of individuals believed not to be suffering from the disease, etc.
In some examples, abnormal may refer to a condition that is associated with a disease. The term "associated with" includes an increased risk of developing the disease as well as the disease itself. For instance, a certain abnormality (such as an abnormality in an Mater nucleic acid or MATER protein expression) can be described as being associated with the biological conditions of altered (e.g., reduced) fertility and tendency to develop autoimmune infertility.
An abnormal nucleic acid, such as an abnormal Mater nucleic acid, is one that is different in some manner to a normal (wildtype) nucleic acid. Such abnormality includes but is not necessarily .
limited to: (1) a mutation in the nucleic acid (such as a point mutation (e.g., a single nucleotide polymorphism) or short deletion or duplication of a few to several nucleotides); (2) a mutation in the control sequences) associated with that nucleic acid such that replication or expression of the nucleic acid is altered (such as the functional inactivation of a promoter); (3) a decrease in the amount or copy number of the nucleic acid in a cell or other biological sample (such as a deletion of the nucleic acid, either through selective gene loss or by the loss of a larger section of a chromosome or under expression of the mRNA); and (4) an increase in the amount or copy number of the nucleic acid in a cell or sample (such as a genomic amplification of part or all of the nucleic acid or the overexpression of an mRNA), each compared to a control or standard. It will be understood that these types of abnormalities can co-exist in the same nucleic acid or in the same cell or sample; for instance, a genomic-amplified nucleic acid sequence may also contain one or more point mutations. In addition, it is understood that an abnormality in a nucleic acid may be associated with, and in fact may cause, an abnormality in expression of the corresponding protein.
Abnormal protein expression, such as abnormal MATER protein expression, refers to expression of a protein that is in some manner different to expression of the protein in a normal (wildtype) situation. This includes but is not necessarily limited to: (1) a mutation in the protein such that one or more of the amino acid residues is different; (2) a short deletion or addition of one or a few amino acid residues to the sequence of the protein; (3) a longer deletion or addition of amino acid residues, such that an entire protein domain or sub-domain is removed or added; (4) expression of an increased amount of the protein, compared to a control or standard amount; (5) expression of an decreased amount of the protein, compared to a control or standard amount; (6) alteration of the subcellular localization or targeting of the protein; (7) alteration of the temporally regulated expression of the protein (such that the protein is expressed when it normally would not be, or alternatively is not expressed when it normally would be); and (8) alteration of the localized (e.g., organ or tissue specific) expression of the protein (such that the protein is not expressed where it would normally be expressed or is expressed where it normally would not be expressed), each compared to a control or standard.
Controls or standards appropriate for comparison to a sample, for the determination of abnormality, include samples believed to be normal as well as laboratory values, even though possibly arbitrarily set, keeping in mind that such values may vary from laboratory to laboratory.
Laboratory standards and values may be set based on a known or determined population value and may be supplied in the format of a graph or table that permits easy comparison of measured, experimentally determined values.
Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two strands, a 5' ->
3' strand, referred to as the plus strand, and a 3' -> 5' strand (the reverse complement), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus strand of the DNA serves as the template for the RNA during transcription.
Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).
Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a dsDNA target.
Binding or stable binding: An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount of the oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding. Binding can be detected by either physical or functional properties of the target:oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including both functional and physical binding assays. Binding may be detected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription, translation, and the like.
Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absorption detection procedures.
For example, one method that is widely used, because it is so simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target disassociate from each other, or melt.
The binding between an oligomer and its target nucleic acid is frequently characterized by the temperature (Tm) at which 50% of the target sequence remains hybridized to a perfectly matechd probe or complementary strand. A higher (Tm) means a stronger or more stable complex relative to a complex with a lower (Tm).
cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and transcriptional regulatory sequences. cDNA may also contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA
molecule. cDNA is usually synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
DNA (deoxyribonucleic acid): DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)).
The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine (A), guanine (G), cytosine (C), and thymine (T) bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide, or for a stop signal. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.
Unless otherwise specified, any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single-strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double-stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes a specific protein, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence of the disclosed nucleic acid molecules.
Deletion: The removal of a sequence of DNA, the regions on either side of the removed sequence being joined together.
Gene amplification or genomic amplification: An increase in the copy number of a gene or a fragment or region of a gene or associated 5' or 3' region, as compared to the copy number in normal tissue. An example of a genomic amplification is an increase in the copy number of an oncogene. A "gene deletion" is a deletion of one or more nucleic acids normally present in a gene sequence and, in extreme examples, can include deletions of entire genes or even portions of chromosomes.
Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (LJ), and thymine (T)) or purines (adenine (A) and guanine (G)).
These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
"Specifically hybridizable" and "specifically complementary" are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.
Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na concentration) of the hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al.
(ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11, herein incorporated by reference.
For present purposes, "stringent conditions" encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence. "Stringent conditions" may be broken down into particular levels of stringency for more precise definition. Thus, as used herein, "moderate stringency" conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of "medium stringency" are those under which molecules with more than 15%
mismatch will not hybridize, and conditions of "high stringency" are those under which sequences with more than 10%
mismatch will not hybridize. Conditions of "very high stringency" are those under which sequences with more than 6% mismatch will not hybridize.
Isz vitro amplification: Techniques that increases the number of copies of a nucleic acid molecule in a sample or specimen. An example of amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to nucleic acid template in the sample.
The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. The product of in vitro amplification may be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing, using standard techniques. Other examples of in vitro amplification techniques include strand displacement amplification (see U.S. Patent No. 5,744,311); transcription-free isothermal amplification (see U.S.
Patent No. 6,033,881); repair chain reaction amplification (see WO 90/01069);
ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Patent No.
5,427,930); coupled ligase detection and PCR (see U.S. Patent No. 6,027,889);
and NASBATM RNA
transcription-free amplification (see U.S. Patent No. 6,025,134).
Injectable composition: A pharmaceutically acceptable fluid composition including at least one active ingredient. The active ingredient is usually dissolved or suspended in a physiologically acceptable carrier, and the composition can additionally include minor amounts of one or more non-toxic auxiliary substances, such as emulsifying agents, preservatives, and pH
buffering agents and the like. Such injectable compositions that are useful for use with the provided nucleotides and proteins are conventional; appropriate formulations are well known in the art.
Isolated: An "isolated" biological component (such as a nucleic acid molecule, protein or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, /.e., other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
MATER protein: A cytosol-localized protein (SEQ ID NO: 24) of approximately 125 to approximately 135 kDa (estimated molecular weight based on gel mobility) that is essential for female fertility. The acronym stands for Maternal Antigen That Embryos Require. Mater is a single-copy gene found on human Chromosome 19. Zygotes that arise from Mater null (Mater ~-) oocytes do not progress beyond the two-cell stage. Thus, Mater represents a novel maternal effect gene that is required for embryonic survival and early development in mammals.
Proteins can be identified as MATER proteins by comparing their activity and other physical characteristics to a prototypical MATER protein, such as the human or murine MATER protein.
MATER protein biological activity can be described in terms of the ability of a protein to complement (substantially replace the lost function in) a Mater null mutant. The ability of a protein to complement a Mater mutant may be readily determined by introducing the gene encoding the protein into a Mater mutant animal system (such as the Mater null mice described herein) using standard methods. If the encoded protein has MATER protein biological activity, this will be manifested as a proportion of the transgenic progeny animals having a relatively wild-type phenotype for those characteristics linked to the Mater mutant (e.g., infertility of Mater null females due to failure of Mater null oocytes to progress beyond the two-cell stage).
Other MATER protein physical characteristics that can be examined when evaluating a hypothetical MATER protein include the molecular weight of the protein (approximately 125-135 kDa, see Example 1, though this value may vary somewhat from species to species), the subcellular localization of the protein (human MATER is expressed in oocytes (Example 4)), and is predicted to be specifically expressed in the cytoplasm and excluded from the nucleus, as occurs in mice (see Example 1), and the temporal and spatial regulation of the mRNA (Mater transcript is produced in the maturing oocyte, see Examples 1 and 3). Antibodies that recognize one MATER
protein (e.g., a murine MATER) may recognize a MATER protein from another species (e.g., human MATER) (see Example 4); thus, hypothetical MATER proteins can be further examined and identified based on recognition by anti-MATER antibodies produced against MATER proteins from other species. The identity of the human MATER protein can therefore be confnmed for instance by immunological identification using an antibody raised against the murine MATER protein, or an epitope of that protein.
Nucleotide: "Nucleotide" includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is one monomer in a polynucleotide. A
nucleotide sequence refers to the sequence of bases in a polynucleotide.
Oligonucleotide: An oligonucleotide is a plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 300 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide.
Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 200 nucleotides in length, for example a sequence (such as DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15, 20, or 23 bases.
Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
Open reading frame: A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide.
Ortholog: Two nucleic acid or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.
Parenteral: Administered outside of the intestine, e.g., not via the alimentary tract.
Generally, parenteral formulations are those that will be administered through any possible mode except ingestion. This term especially refers to injections, whether administered intravenously, intrathecally, intramuscularly, intraperitoneally, or subcutaneously, and various surface applications including intranasal, intradermal, and topical application, for instance.
Peptide Nucleic Acid (PNA): An oligonucleotide analog with a backbone comprised of monomers coupled by amide (peptide) bonds, such as amino acid monomers joined by peptide bonds.
Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful with the compositions provided herein are conventional. Martin, Remington's Pharmaceutical Seienees, published by Mack Publishing Co., Easton, PA, 19th Edition, 1995, describes compositions and formulations suitable for pharmaceutical delivery of the nucleotides and proteins herein disclosed.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Polymorphism: Variant in a sequence of a gene. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, geographic locations. The term polymorphism also encompasses variations that produce gene products with altered function, i. e., variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also encompasses variations that produce no gene product, an inactive gene product, or increased gene product. The term polymorphism may be used interchangeably with allele or mutation, unless context clearly dictates otherwise.
Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule that is linked to the variation (e.g., an alteration of a secondary structure such as a stem-loop, or an alteration of the binding affinity of the nucleic acid for associated molecules, such as polymerases, lRNases, and so forth).
Probes and primers: Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided as indicators of disease or disease progression. It is also appropriate to generate probes and primers based on fragments or portions of these nucleic acid molecules. Also appropriate are probes and primers specific for the reverse complement of these sequences, as well as probes and primers to 5' or 3' regions.
A probe comprises an isolated nucleic acid attached to a detectable label or other reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols irz Molecular Biology, John Wiley & Sons, New York, 1998).
Primers are short nucleic acid molecules, for instance DNA oligonucleotides 10 nucleotides or more in length. Longer DNA oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerise enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerise chain reaction (PCR) or other in vitro nucleic-acid amplification methods known in the art.
Methods for preparing and using nucleic acid probes and primers are described, for example, in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989), Ausubel et al. (ed.) (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998), and Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990). Amplification primer pairs (for instance, for use with polymerise chain reaction amplification) can be derived from a known sequence such as the Mater sequences described herein, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, O
1991, Whitehead Institute for Biomedical Research, Cambridge, MA).
One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 30 consecutive nucleotides of a MATER protein encoding nucleotide will anneal to a target sequence, such as another homolog of the designated MATER protein, with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in order to obtain greater specificity, probes and primers can be selected that comprise at least 20, 23, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of a MATER protein-encoding nucleotide sequences.
Also provided are isolated nucleic acid molecules that comprise specified lengths of the disclosed Mater nucleotide sequences. Such molecules may comprise at least 10, 15, 20, 23, 25, 30, 35, 40, 45 or 50 or more consecutive nucleotides of these sequences or more, and may be obtained from any region of the disclosed sequences (e.g., a Mater nucleic acid may be apportioned into halves or quarters based on sequence length, and isolated nucleic acid molecules may be derived from the first or second halves of the molecules, or any of the four quarters, etc.). A
Mater cDNA or other encoding sequence also can be divided into smaller regions, e.g. about eighths, sixteenths, twentieths, fiftieths and so forth, with similar effect.
Another mode of division is to select the 5' (upstream) and/or 3' (downstream) region associated with a Mater gene.
Nucleic acid molecules may be selected that comprise at least 10, 15, 20, 25, 30, 35, 40, 50 or 100 or more consecutive nucleotides of any of these or other portions of a human Mater nucleic acid molecule, such as those disclosed herein, and associated flanking regions. Thus, representative nucleic acid molecules might comprise at least 10 consecutive nucleotides of the human cDNA
fragments show in SEQ ID NOs: 1 and 2, or the full human MATER cDNA shown in SEQ ID NO:
24.
Protein: A biological molecule expressed by a gene or recombinant or synthetic coding sequence and comprised of amino acids.
Purified: The term "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell or within a production reaction chamber (as appropriate).
Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
Homologs or orthologs of human MATER protein, and the corresponding cDNA or gene sequence, will possess a relatively high degree of sequence identity when aligned using standard methods. This homology will be more significant when the orthologous proteins or genes or cDNAs are derived from species that are more closely related (e.g., human and chimpanzee sequences), compared to species more distantly related (e.g., human and C. elegans sequences).
Methods of alignment of sequences for comparison are well known in the art.
Various programs and alignment algorithms are described in: Smith & Waterman Adv.
Appl. Math. 2: 482, 1981; Needleman ~ Wunsch J. Mol. Biol. 48: 443, 1970; Pearson & Lipman Proc.
Natl. Acad. Sci.
USA 85: 2444, 1988; Higgins & Sharp Getae, 73: 237-244, 1988; Higgins & Sharp GABIOS 5: 151-153, 1989; Corpet et al. Nuc. Acids Res. 16, 10881-90, 1988; Huang et al.
Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al. Meth. Mol. Bio. 24, 307-31, 1994. Altschul et al. (J.
Mol. Biol. 215:403-410, 1990), presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. J. Mol.
Biol.
215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. By way of example, for comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties).
An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and are different under different environmental parameters.
Generally, stringent conditions are selected to be about 5° C to 20° C lower than the thermal melting point (Tin) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50°~0 of the target sequence remains hybridized to a perfectly matched probe or complementary strand. Conditions for nucleic acid hybridization and calculation of stringencies can be found in Sambrook et al. (In Molecular Cloning: A
Laboratory Manual, CSHL, New York, 1989) and Tijssen (Laboratory Technigues in Biochemistry ahd Molecular Biology--Hybridization with Nucleic Acid Probes Part I, Chapter 2, Elsevier, New York, 1993). Nucleic acid molecules that hybridize under stringent conditions to a human MATER protein-encoding sequence will typically hybridize to a probe based on either an entire human MATER
protein-encoding sequence or selected portions of the encoding sequence under wash conditions of 2x SSC at 50° C.
Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein.
Specific binding agent: An agent that binds substantially only to a defined target. Thus a protein-specific binding agent binds substantially only the specified protein.
By way of example, as used herein, the term "MATER-protein specific binding agent" includes anti-MATER protein antibodies (and functional fragments thereof] and other agents (such as soluble receptors) that bind substantially only to the MATER protein.
Anti-MATER protein antibodies may be produced using standard procedures described in a number of texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). The determination that a particular agent binds substantially only to the specified protein may readily be made by using or adapting routine procedures. One suitable in vitro assay makes use of the Western blotting procedure (described in many standard texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988)). Western blotting may be used to determine that a given protein binding agent, such as an anti- MATER protein monoclonal antibody, binds substantially only to the MATER protein.
Shorter fragments of antibodies can also serve as specific binding agents. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to a specified protein would be specific binding agents. These antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain;
two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab')2, a dimer of two Fab' fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (6) single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine.
Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.
Target sequence: "Target sequence" is a portion of ssDNA, dsDNA or RNA that, upon hybridization to a therapeutically effective oligonucleotide or oligonucleotide analog, results in the inhibition of expression. For example, hybridization of therapeutically effectively oligonucleotide to a Mater target sequence results in inhibition of MATER expression. Either an antisense or a sense molecule can be used to target a portion of dsDNA, since both will interfere with the expression of that portion of the dsDNA. The antisense molecule can bind to the plus strand, and the sense molecule can bind to the minus strand. Thus, target sequences can be ssDNA, dsDNA, and RNA.
Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the teen transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA
by electroporation, lipofection, and particle gun acceleration.
Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are, incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
111. Brief Overview of Several Embodimev~ts Described herein is the human MATER protein, an approximately 135 kDa (predicted estimated molecular weight) cytoplasmic protein expressed in mammalian oocytes that is required for female fertility. Zygotes that arise from a MATER null oocyte do not progress beyond the two-cell stage.
One described embodiment is an isolated variant MATER protein comprising an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO:
4, or SEQ ID NO:
24, and comprising at least one variant amino acid in a recognized MATER
protein domain. Another embodiment is an isolated variant MATER protein comprising an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 24, and comprising at least one variant amino acid in a region outside of a recognized MATER protein domain. Yet another embodiment is an isolated variant MATER protein comprising an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 24, and comprising at least one variant amino acid in a recognized MATER protein domain and at least one variant amino acid outside of a recognized MATER protein domain.
Specific variant MATER proteins have a sequence that comprises at least one variant amino acid in a Leucine-rich repeat, or in the PAAD-DAPIN domain, or in the aldo ket red domain, or in the ATP-/GTP-binding domain, or in any two or more of these recognized domains. Also provided are isolated variant MATER proteins, wherein the sequence of the protein comprises at least one variant amino acid outside of a recognized MATER protein domain.
Other embodiments are isolated nucleic acid molecule encoding one of these proteins, recombinant nucleic acid molecule comprising a promoter sequence operably linked to such a nucleic acid molecule, and cell transformed with one of those recombinant nucleic acid molecules.
Another embodiment is a method of detecting in a subject a biological condition associated with an abnormal MATER nucleic acid, which method involves reacting at least one MATER nucleic acid in a clinical sample from the subject with a reagent comprising a MATER-specific nucleic acid binding agent to form a MATER:agent complex, and detecting the complex. In specific examples of this method, the MATER-specific nucleic acid binding agent is a MATER
oligonucleotide, for instance one that comprises at least 10 contiguous nucleotides of a human MATER intron sequence. By way of example, certain of the MATER oligonucleotides include a sequence as shown in any one of SEQ ID
NOs: 25 through 38.
Another embodiment provides a method of detecting in a subject a biological condition associated with an abnormal MATER nucleic acid, which further involves quantifying the MATER:agent complex and comparing the quantity of the MATER:agent complex with the quantity of an equivalent MATER:agent complex formed in a reference sample (e.g., one taken from a reference subject, such as a subject known to have or not to have the biological condition).
In certain specific examples of these methods, the clinical sample comprises a reproductive cell.
Representative examples of provided methods of detecting in a subject a biological condition associated with an abnormal MATER nucleic acid further comprising in vitro amplifying a MATER
nucleic acid prior to detecting the abnormal Mater nucleic acid. The in vitro amplification can be carried out in vitro using at least one oligonucleotide primer derived from a MATER protein encoding sequence. Specific examples of the oligonucleotide primer include a sequence of an intron-exon boundary of human MATER, for instance as shown in any on of SEQ ID NOs: 25 through 38. Other embodiments are oligonucleotide primers used in any of these methods.
In certain examples of the described methods, the MATER:agent complex is detected by nucleotide hybridization. The agent, used to form the MATER:agent complex in some of the described methods, is a labeled nucleotide probe. Representative examples of such probes include a sequence as shown in any one of SEQ ID NOs: 25 through 38. Other embodiments are labeled nucleotide probe used in any of these methods.
A further embodiment is a kit for detection of a genetic mutation in a sample of nucleic acid.
One such kit includes a first container containing an oligonucleotide capable of specifically hybridizing with a MATER nucleic acid, which oligonucleotide has a sequence comprising at least 10 contiguous nucleotides from an human MATER intron; and a second container containing a fluorescent labeled nucleic acid probe that is fully complementary to the oligonucleotide. In examples of these kits, the fluorescent labeled nucleic acid probe has a length of between 5 and 500 nucleotides. Specific examples of kits provided herein include an oligonucleotide that includes a sequence as shown in any one of SEQ ID NOs: 25 through 38.
IV. Human MATER Protein artd Nucleic Acid Seqz~ences Embodiments provide MATER proteins and Mater nucleic acid molecules, including cDNA
sequences. The prototypical Mater sequences are the murine and human sequences, and the use of these sequences to produce transgenic animals having increased or decreased levels of MATER
protein is provided, as are diagnostic methods to detect defects or alterations in Mater expression or MATER protein production.
The full-length cDNA for human Mater (SEQ ID NO: 23) is determined to be 3900 base pairs long (which is somewhat longer the mouse Mater cDNA, GenBank Accession #
NM 011860.1, SEQ ID NO: 5) and its ORF encodes a protein of 1200 amino acids, having a predicted molecular weight of approximately 135.2 kDa and a predicted pI of about 6.08. The human Mater cDNA
comprises the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 3, which are thought to be aligned approximately with the seventh and eleventh through fifteenth exons of the mouse Mater sequence, respectively. The human Mater mRNA is expressed in oocytes, as shown by iH
situ hybridization experiments (Example 3).
Human MATER protein (SEQ ID NO: 24) has been specifically localized by immunofluorescence to human oocytes (Example 4). The ATG initiation codon of the Mater cDNA
lies within the context of the ANNATG motif associated with vertebrate initiator codon (I~ozak, 1991, J. Biol. Chem. 266:19867). The human MATER protein comprises the deduced protein sequences (SEQ ID NOs: 2 and 4) corresponding to the herein described human Mater cDNA
sequences (SEQ ID NOs: 1 and 3, respectively). These protein fragments show low but significant sequence homology with the OP1/MATER protein from mouse (GenBank # NP 035990, SEQ ID
NO: 6). In particular, SEQ ID NO: 2 is 54% identical to residues 257-638 of marine MATER (SEQ
ID NO: 6), while SEQ ID NO: 4 is 64% identical to residues 854-1111 of marine MATER. The overall human MATER protein sequence (SEQ ID NO: 24) shares approximately 50%
similarity with the marine MATER protein sequence (SEQ ID NO: 6); the relevant sequence alignment is shown in FIG. 9. The depicted comparison between the human and marine MATER proteins was conducted using the BLAST 2 Sequences Program with parameter conditions of Expect 10 and Filter closed (NIH-NCBI).
Certain regions of the human Mater cDNA have been identified through the sequencing of human HTGSs, though no function or identity had been previously assigned to those sequences. See, for instance, GenBanc accession numbers: AC024580 (GI = 7705010, published May 4, 2000);
AC012107 (GI = 6088020, published October 20, 1999, and updated as GI =
7329252, published March 28, 2000); and AC023887 (GI = 7631054, published April 21, 2000). These fragmentary and overlapping human sequences are up to 207 nucleotides in length and are scattered throughout the marine Mater cDNA sequence. The human ESTs individually share up to 89%
identity with the marine Mater cDNA over short, discontinuous regions. Oligonucleotides according to the current disclosure may be chosen to avoid these ESTs. Overall, the first 75 nucleotides of human Mater (1-75) and the corresponding deduced amino acids (1-25) were determined by comparison to published human genomic DNA sequences, while the remainder of the Mater sequence was determined by direct cloning and sequencing of human ovarian cDNAs.
Using the sequence of the cloned human MATER cDNA to blast the human hgts database (which is accessible on-line), a single genomic clone (AC01740) with a full DNA sequence was determined to harbor an entire gene locus of human MATER.
Mater is a single-copy maternal effect gene, the protein product of which is required for early embryonic survival. Although eggs lacking MATER protein can be fertilized, morphologic signs of deterioration are observed as early as the 2-cell stage beyond which the mutant embryos do not progress. The human MATER protein with 1200 amino acids is predicted to have similar molecular domains to those seen in the marine MATER protein (1111 amino acids). As described by Tong et al. (Mamnr. Genonre 11:281-287, 2000), the mouse MATER protein contains a five-fold hydrophilic repeat (26-27 amino acid) near its N-terminus, a short leucine-zipper and a fourteen-fold leucine-rich repeat (28-29 amino acid) near its carboxyl terminus (based on a comparison to the marine MATER protein, as described in Tong et al., Marnm. Genorne 11, 281-287, 2000). The hydrophilic repeat has low homology with a cytoskeletonal protein (neurofilament), raising the possibility that this region mediates interactions that anchor MATER in the cytoplasm. The presence of the leucine-rich domain, as well as a short leucine zipper, both motifs known to mediate protein-protein interactions (Kajava, J. Mol. Biol. 277, 519-527, 1998; Buchanan &
Gay, Prog. Biophys. Mol.
Biol. 65, 1-44, 1996), suggests that MATER may affect embryonic progression through intermediate factor(s), one or more of which binds directly to MATER in the cytoplasm.
Using antisera against a mouse MATER peptide (residues 1093 through 1111 of marine MATER, SEQ ID NO: 6), the inventors have demonstrated that human MATER protein is present in oocytes in human ovary sections (Example 4). Likewise, using mouse-derived nucleotide sense and antisense probes for in situ hybridization experiments, it has been demonstrated that human oocytes express Mater mRNA (Example 3).
Marine MATER has been further characterized herein as to its function in mammalian embryogenesis. This protein is a "maternal" protein, generated in the oocyte prior to fertilization, and therefore encoded for by a maternal gene. MATER is unusual in that it persists (as measured by protein level) into the late blastocyst stage of embryonic development.
Functional MATER is required for female fertility; zygotes that arise from Mater null oocytes do not progress beyond the two-cell stage; this is true regardless of what Mater genotype male produced the sperm. The protein is cytoplasmic, with definite exclusion from the nucleus.
The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the invention to the particular features or embodiments described.
Characterization of the Marine MATER protein This example provides several methods for examining MATER proteins and nucleic acids in a mammalian system; the marine system is used.
Methods:
Isolation of oocytes, eggs and embryos. All experiments were conducted in compliance with the guidelines of the Animal Care and Use Committee under an approved animal study protocol.
Resting, growing and fully grown oocytes were dissected from 1, 10 and 21 day old (d/o) mouse ovaries, respectively, and eggs were isolated from gonadotrophin stimulated female mice (Tong et al., J. Biol. Chern. 270, 849-853, 1995; Rankin et al., Development 125, 2415-2424, 1998). Embryos were obtained by mating gonadotrophin stimulated females with males and 1-cell zygotes, 2-cell embryos, morulae and blastocysts were flushed from the oviducts at 1, 2, 3 and 4 days, respectively, counting the morning after hCG administration as day 1. Embryos were either incubated in M16 media (37 ~C, 5% COZ), fixed in 1% paraformaldehyde for subsequent confocal microscopy, or frozen at -80 ~C for RNA and protein analyses. Ovaries were fixed (10% formalin) and embedded in paraffin prior to sectioning and staining with hematoxylin and eosin (American Histolabs, Gaithersburg, Maryland).
Detection of transcripts and proteins. Mater, ZP3, (3-actin, cyclophilin and 28S-rRNA
transcripts were detected by RNase protection assays as previously described (Tong & Nelson, Endocrinology 140, 3720-3726, 1999;Tong et al., J. Biol. Chern. 270, 849-853, 1995) using an RPA
II kit (Ambion, Austin, TX).
Rabbits were immunized with a KLH conjugated MATER peptide (amino acids 1093-1111) to obtain a monospecific antisera. After incubating immunoblots with MATER
antisera (1:1000, two hours, 20 °C), antibody binding was detected by ECL using a HRP-conjugated goat anti-rabbit antibody (Amersham Pharmacia Biotech, Piscataway, NJ). Fixed oocytes, eggs or embryos were incubated with MATER antisera (1:8000, 4 °C, 16 hours) and imaged by laser-scanning confocal microscopy (LSM 5; Zeiss, Thornwood, NY) using Cy5-conjugated goat anti-rabbit IgG (1:200).
Protein synthesis and irnrnunoblotting. Embryos were incubated in 100 ~l of M16 medium containing L-35S-methionine (0.5 Cilml, Amersham) at 37 °C for 4 hours.
At the end of radiolabeling, 1-cell and 2-cell embryos were harvested at 26 hours and 48 hours post-hCG/mating, respectively.
After washing with 1% BSA in 10 mM Tris-HCl (pH 7.4), 1mM EDTA and 140 mM
NaCl, ten embryos were dissolved directly in 10 ~1 of sample buffer (1) directly or (2) after treatment with 2%
Triton X-100/0.3 M KCl to extract the TRC and p35 (Conover et al., Dev. Biol.
144, 392-404, 1991).
After SDS-PAGE and fluorography as previously reported (Tong et al., J. Biol.
Chern. 270, 849-853, 1995), radioactive incorporation was determined by a phosphoimager and ImageQuant software (Molecular Dynamics, Amersham Pharmacia Biotech, Piscataway, NJ).
Production of Mater null mice. Constructs use to produce Mater null mice are shown in FIG. 2. To construct a targeting vector in pPNT (Tybulewicz et al., Cell 65, 1153-1163, 1991), a 1.5 kbp SacI-EcoRI DNA fragment containing the first two exons of marine Mater (Tong et al., Marnm.
Genorne 11, 281-287, 2000) was inserted between the PGK-Neo and PGK-TK
cassettes and a 2 kbp EcoRI-BamHI fragment containing exons 3 and 4 was inserted upstream of the PCK-Neo. After linearization and electroporation into embryonic stem (ES) cells (Redmond et al., Nat. Genet. 20, 344-351, 1998), the presence of the mutant allele in chemically selected clones was detected as 3.5 kbp and 4.0 kbp XbaI fragments with 5' and 3' (or Neo) probes, respectively.
Both the 5' and 3' probes detected the normal allele as a 9.4 kbp XbaI fragment. C57BL/6 blastocysts were injected with 8-12 ES cells derived from five independently selected clones. Two cell lines that gave rise to coat-color chimeric animals were mated with C57BL/6 females and transmitted the Mater mutation through the germ line. The absence of Mater transcripts in homozygous null females was confirmed by northern blot analysis as described previously (Tong & Nelson, Endocrinology 140, 3720-3726, 1999).
Reproductive performance. Vaginal smears were obtained daily to examine four or more estrus cycles of 6-10 week-old female mice (Rugh, The Mouse: Its Reproductiozz and Developznent 210 Oxford University Press, Oxford, 1991). Mating behavior was evaluated by the presence of a vaginal plug on the morning after mating with fertile males.
Zygotic gene transcription assays. A 5-10 p1 aliquot of 100 mM BrUTP, 140 mM
KCl and 2mM Pipes, pH 7.4 was microinjected into the cytoplasm of embryos isolated 28 hours (1-cell embryos) and 48 hours (2-cell embryos) following hCG and mating, essentially as previously described (Bouniol et al., Exp. Cell Res. 218, 57-62, 1995). After incubation in M16 medium in 5%
COZ for one hour at 37 °C, the injected embryos were fixed in 1%
paraformaldehyde.
BrUTP incorporation into RNA was assayed with a mouse anti-BrdU monoclonal antibody (Sigma, 1:1000, 16 hours, 4 °C). After washing in PBS containing 3%
BSA, a FITC-conjugated goat anti-mouse IgG antibody was used to image the embryos by confocal microscopy;
fluorescence was recorded in arbitrary units. This assay primarily reflects de novo RNA
polymerise II activity, because poor penetration of the monoclonal antibody into nucleoli prevents measurement of BrUTP
incorporation into ribosomal RNA (Wansink, et al., J. Cell Biol. 122, 283-293, 1993).
Results Mater transcript and protein expression Mater mRNA was first detected as oocytes entered into their growth phase (30-50 pm) (FIG.
1A). Mater transcripts were most abundant in fully-grown oocytes (75-85 pm) and, like many oocyte transcripts (Bachvarova, in Developmental Biology: Oogenesis 1, 453-524, Plenum Press, New York, 1985; Epifano et al., Developrzzent 121, 1947-1956, 1995), were degraded during meiotic maturation and subsequent ovulation. Mater mRNA was not detected in the early embryo (FIG. 1A), although its presence in EST databases derived from early embryos suggest that some transcripts may have escaped destruction.
The initial accumulation of MATER protein during oogenesis was similar to that observed for Mater transcripts (compare FIG. 1A with FIG. 1B). However, unlike the virtual disappearance of the transcripts, the MATER protein persisted during preimplantation development until the late blastocyst stage (FIG. 1B). Using confocal microscopy, MATER protein was located in the cytoplasm of growing oocytes and noticeably excluded from the nucleus. MATER
was more concentrated in the cortical region of oocytes and early embryos (one- and two-cell stages), and this peripheral pattern persisted later in preimplantation development with a higher concentration of MATER in the outer trophectodermal cells compared to the inner cell mass of blastocysts (FIG. 1C).
Mater null animals To determine the function of MATER protein, Mater null mouse lines were generated, in which homozygous females did not express either Mater transcripts or protein.
Mater null mice were born in the expected Mendelian ratios with equal sex distribution. No phenotypic abnormalities were observed from birth through adulthood.
Ovaries and uteri from Mater null mice appeared morphologically normal (FIG.
6). Mater null ovaries had a normal complement of primordial follicles and all stages of follicular development were normally represented; corpora lutea, indicating past spontaneous ovulation, were also present (FIG. 5).
Ova lacking Mater were fertilized normally in vivo (FIG. 1 ). The number and morphology of zygotes and 2-cell embryos from the Mater null females were similar to those from normal females (FIG. 5). However, by 3 or 4 days after mating the embryos from Mater null females still remained at the 2-cell stage or had begun to degenerate (compare FIG. 3D and 3G with 3E
and 3H). Thus, fertilization is normal in Mater null females and the resulting zygotes can progress through the first cleavage, but subsequent development is arrested at the 2-cell stage. This indicates that an arrest of early embryogenesis accounts for the infertility in Mater null females.
Two mouse lines with a Mater null mutation (T54 and T85) were generated (FIG.
2A and 2B) and neither Mater transcript (FIG. 2C) nor protein (FIG. 2D) were detected in homozygous null females.
Reproductive phenotype of Mater null animals Matings of heterozygous Mater null parents produced average sized litters (8.5 + 1.9) with normal Mendelian and equal sex distribution of the null allele in progeny.
Homozygous null animals appeared normal and males were as fertile as normal littermates. However, homozygous null females produced no litters, even after five months of mating (Table 1) which implicated Mater as a maternal effect gene.
Table 1: Fertility and Mendelian allele ratio of mice with Mater mutation Mating pairs Litter sizesMendelian ratios a' x ~ n* mean + s.e.m.+/+ +/- -/-Mater+'+ x Mater11 7.5 ~ 1.8 1.00 0 0 +'+
Mater +'+ x Mater10 7.4 + 1.9 n.d. t n.d. n.d.
+'-Mater +'+ x Mater9 0 n.a. ~ n.a. n.a.
-'' Mater -'- x Mater8 7.6 + 2.4 0 1.00 0 +'+
Mater -'- x Mater18 8.4 t 1.9 0 0.47 0.53 ''-'-Mater ~' x Mater15 8.5 + 1.9 0.21 0.57 0.22 +'' n, the numoer of mating pairs, ' n.a., not Gone, * n.a., not appucame.
Sexually mature Mater null females exhibited regular 5.67 ~ 0.22 days estrus cycles, similar to those observed in normal females (5.40 ~ 0.23 days). Mating occurred normally, as demonstrated by the appearance of vaginal plugs in about 70% of either Mater null or normal females, after exposure to fertile males. The Mater null ovary had a normal complement of primordial follicles, with all stages of follicular development as well as corpora lutea indicating past spontaneous ovulations (FIG. 5A and 5B). In addition, the Mater null females ovulated normally after stimulation with exogenous gonadotropins. However, homozygous null females produced no litters even after five months of mating with normal males, while the homozygous null males and heterozygous females had normal fertility.
The mean number (~ s.e.m.) of ovulated eggs recovered from null (27.6 ~ 4.5, n=14) was not statistically different (p > 0.05) from that obtained from normal (27.7 ~ 4.3, n=12) females (FIG. 5D).
Morphologically, the two groups of eggs were indistinguishable from one another (FIG. 5C).
Fertilization and embryo development in Mater null animals To evaluate in vivo fertilization and early development, embryos were isolated from normal and Mater null females at 1, 2, 3 and 4 days after mating with normal males.
Fertilization occurred in eggs lacking MATER, as demonstrated by the presence of two pronuclei (arrows, FIG. 3A and 3B).
The number and morphology of 1-cell zygotes and 2-cell embryos obtained in vivo from the Mater null females were similar to those observed from normal females, although the 2-cell mutant embryos appeared less healthy, displaying cytoplasmic granulations (FIG. 3A-3F).
Embryos obtained from the Mater null female mice 3 or 4 days after mating still remained at the 2-cell stage (or had begun to degenerate), while embryos from normal mice had progressed to the morula or blastocyst stages, respectively An equal percentage (~70%) of fertilized 1-cell zygotes derived from Mater null and normal females progressed in vitro to the 2-cell stage. However, after four days in culture, embryos lacking MATER remained arrested at the 2-cell stage (most were degenerating) (FIG.
3K); embryos from the normal females developed to the blastocyst stage in the same time (FIG. 3J).
Thus, although fertilization appears normal and zygotes without MATER can progress through the first cleavage, subsequent embryonic development is arrested at the 2-cell stage.
Characterization of transcription in Mater null animals The early arrest phenotype seen in Mater null mice is reminiscent of the 2-cell block that occurs after exposure of mouse embryos to a-amanitin (Schultz, Bioessays 15:531-538, 1993; Flach et al., EMBO J. 1, 681-686, 1982), a mushroom toxin that binds to RNA polymerase II and prevents elongation of transcription beyond dinucleotides (Vaisius & Wieland, Biochemistry 21, 3097-3101, 1982). Normal embryonic transcription is first detected late in the 1-cell zygote at a level that is ~20% that of the 2-cell embryo (Aoki et al., Dev. Biol. 181, 296-307, 1997), but these nascent transcripts are poorly, if at all, translated into protein (Nothias et al., EMBO J. 15, 5715-5725, 1996).
_28_ To assess de novo RNA polymerase II activity of the early Mater null embryo, bromo-UTP
(BrUTP) incorporation was assayed with a monoclonal antibody specific to BrUTP
using laser-scanning confocal microscopy, essentially as described previously (Bouniol et al., Exp. Cell Res. 218, 57-62, 1995) (FIG. 4A-4G). Morphologically there was a dramatic difference in the amount of BrUTP detected in the nuclei of normal embryos 28 hours (FIG. 4B) and 48 hours (FIG. 4D) after mating compared to those lacking MATER (FIG. 4A and 4C). BrUTP incorporation in embryos without MATER was marginally greater than that of uninfected controls (FIG. 4E
and 4F) and de novo transcription was less than 5% that observed in normal 2-cell embryos (FIG. 4G).
Characterization of TRC in Mater null animals During meiotic maturation and ovulation, more than 50% of maternal RNA is lost in normal mice (Bachvarova, in Developrnental Biology: Oogenesis 1, 453-524, Plenum Press, New York, 1985). This degradative process also occurs in females lacking MATER with loss of ribosomal RNA
(FIG. 4H) and at least some mRNAs ((i-actin, ZP3, cyclophilin, and GAPDH).
Normally, the subsequent activation of the embryonic genome at the 2-cell stage is preceded by the transient transcription and translation of a subset of gene products, some of which form the distinctive Transcription Related Complex (TRC) (Bolton et al., J. Embryol. Exp. Morphol.
79:139-163, 1984;
Nothias et al., EMBO J. 15:5715-5725, 1996; Conover et al., Dev. Biol. 144:392-404, 1991). This complex, first observed in the early 2-cell embryo, is not formed in the presence of a-amanitin.
To assay for the TRC, 1- and 2-cell embryos derived from Mater null females mated with normal males were incubated with 35S-methionine. No global differences in the amount of 35S-methionine incorporation or in protein profiles were noted in comparing normal 1-cell zygotes and those lacking MATER (FIG. 4I, left panel). Although TRC complexes were detected in embryos without MATER at the 2-cell stage (FIG. 4I, middle and right panels), they appeared somewhat less abundant (~60% of normal), which could reflect abnormal protein synthesis in the embryos lacking MATER. This indicates that MATER is not absolutely critical for initiation of all transcription-translation machinery in early embryos.
Although this striking decrease in transcription could reflect generalized morbidity of the embryo, a similar decrease in 1-cell zygotes, which appear quite healthy, as well as absence of an equally dramatic decrease in de novo protein synthesis (FIG. 4I) suggest that the depressed levels of transcription are due either directly, or indirectly to the absence of MATER.
Functions) of mammalian MATER
The homology of the leucine-rich repeat domain of mammalian MATER protein with porcine ribonuclease inhibitor implies that MATER may act as an inhibitor of cytoplasmic RNase. If this is true, RNA in embryos lacking MATER might be subject to extensive degradation, perhaps an accentuation of the normal turnover of RNA that occurs during the maternal-to-zygotic transition in the early embryo. The degradation of IRNAs, including those that encode proteins required for transcription, could account for the phenotype observed in Mater null embryos.
This seems unlikely;
however, because in the absence of Mater mutant embryos incorporate 35S-methionine into proteins and no major difference in protein profiles are observed in comparison with normal embryos. These results indicate that sufficient mRNA, tRNA and ribosomal RNA are present in the mutant embryos to support protein biosynthesis, although it does not preclude the degradation of a targeted subset of RNA required for early embryonic survival.
Transcription-dependent protein synthesis occurs in two phases in the 2-cell embryo, an early minor activation (2-4 hours after the first mitotic division) that is characterized by appearance of the TRC proteins, and a later major activation that occurs in GZ (8-10 hours after the first mitotic division). The later activation initiates developmental programs required for progression beyond the 2-cell stage (Schultz, Bioessays 1S, S31-538, 1993). The observed decrease in embryonic transcription in embryos lacking MATER could result from deterioration of transcription machinery, decreased access to genomic DNA or abnormalities in the chromatin template within the nucleus.
However, the presence of the TRC proteins in Mater null animals indicates that MATER is not 1 S critical for the early phase of transcription-dependent protein synthesis in 2-cell embryos. It further suggests that the transcription machinery, and its ability to access nuclear DNA, is largely intact in Mater null embryos (as it appears to be in Mater null oocytes, which are also transcriptionally active).
The TRC proteins resulting from the early burst of transcription are associated with the nucleus (Schultz, Bibessays 1S, S31-538, 1993). These proteins could relieve the late transcriptional repression required for progression beyond the 2-cell stage via mechanisms involving MATER.
Additionally, it has been reported that mouse oocytes and 1-cell embryos lack coactivator(s) required for enhancer-dependent transcription in 2-cell embryos (Lawinger et al., J.
Biol. Chern. 274, 8002-8011, 1999). The nature of these coactivators is unknown; they may arise by modification of pre-existing maternal proteins or from early transcription-dependent protein synthesis in the 2-cell 2S embryo. Such process may involve cytoplasmic MATER. Alternatively, MATER
might be involved in one or more interactions that are required for cell cycle progression beyond the 2-cell stage.
Identification and characterization of proteins that interact with MATER will provide insights into the role of this maternal protein in promoting embryonic survival and early development.
Mater is the first maternal effect gene demonstrated to play a critical role in early mammalian development and the observed sterile phenotype raises the possibility that the absence of a similar molecule could be a cause of human infertility.
EXAMPLE 2:
Identification of the Human MATER cDNA
3S The human MATER cDNA was identified based on its homology to the mouse MATER
cDNA sequence by searching the collection of hwnan High Throughput Genomic (HTG) Sequences, maintained by NCBI and the National Library of Medicine. Using the isolated and discontinuous nucleotide fragments identified in this search, the inventors devised oligonucleotide primers pairs (for instance, SEQ ID NOs: 7 and 8, 19 and 20, and 21 and 22) that where used to amplify MATER
sequence from purified human ovarian DNA or mRNA/cDNA, and to isolate a partial cDNA clone from a human cDNA library, using standard techniques.
The sequence of two long fragments of the human MATER cDNA is shown in SEQ ID
NO:
1 and 3. Together, these two long cDNA fragments constitute 2213 nucleotides of the complete human MATER cDNA.
The deduced human MATER protein portions encoded cDNA fragment 1 (SEQ ID NO:
1) and fragment 2 (SEQ ID NO: 3) are shown in SEQ ID NOs: 2 and 4, respectively.
Using these sequences, the remainder of the human MATER cDNA has been identified; the sequence of the full length cDNA is shown in SEQ ID NO: 23. Overall, the first 75 nucleotides of human MATER (1-75) and the corresponding deduced amino acids (1-25) were determined by comparison to published human genomic DNA sequences, while the remainder of the Mater sequence was determined by direct cloning and sequencing of human ovarian cDNAs. The complete sequence of the human MATER protein is shown in SEQ ID NO: 24.
EXAMPLE 3:
Detection of Mater RNA in human ovarian total RNA
This example provides one method of detecting MATER RNA in human ovarian total RNA.
Human ovarian total RNA from a 19-year-old woman was obtained under an IRB-approved protocol (McGill University, Montreal, Canada) and the use of it was approved by the NIH office of Human Subjects Research. Ovarian RNA from a 26 year old woman was purchased from BioChain Inc. (Hayward, CA, USA). Separation of human ovarian total RNA (10 fig) was performed by 1%
agarose/formaIdehyde gel electrophoresis. The RNA was transferred onto a nitrocellulose membrane to prepare a Northern blot. Human Mater cDNA (~0.5 kb) was labeled with a-[32P]dCTP (3000 Ci/mmol; ICN, Costa Mesa, CA, USA) using Ready-To-Go DNA dCTP Beads (Pharmacia, Inc., Piscataway, NJ, USA). Blots were hybridized (68°C, 2 hours) with 3zP-labeled cDNA probe (~0.5 kb) in QuikHyb solution (Stratagene, La Jolla, CA, USA). After washing the blots with a solution of O.lxstandard saline citrate/0.1% sodium dodecyl sulfate (SDS) at 65°C, the hybridization signals were detected by autoradiography.
This Northern blot hybridization revealed the presence of a single ~4.2 kb MATER
transcript in the human ovarian total RNA (Figure 8A). The human MATER
transcripts appeared to be larger than the mouse MATER transcript (3.75 kb). The relatively greater abundance of MATER
mRNA detected in the ovarian RNA from a 19 year old woman (lane 1), compared with the RNA
from a 26 year old woman (lane 2), may reflect the relatively greater number of oocytes present in ovaries from younger women.
EXAMPLE 4:
1z vitro amplification via PCR for human MATER transcripts This example provides one method of detecting MATER transcripts in RNA samples from different tissues.
To determine whether expression of human MATER transcripts is ovarian-specific, in vitro amplification (in this case, PCR amplification) reactions were carried out using cDNA that were derived from human RNA of 24 different tissues (Human Rapid-Scan Gene Expression Panel).
Human ovarian cDNA (Invitrogene; Origene), human ovarian cDNA library (Clonetech), and the Human Rapid-Scan Gene Expression Panel (Origene), were used as templates for PCR
reactions, essentially following the manufacturer's instructions. Taq DNA
polymerase (Life Technologies, Rockville, MD, USA) was used to amplify DNA products expected within 1.5 kbp at a condition of the PCR reaction (95°C, 1 minute; 60°C, 1 minute;
72V, 2 minutes; and 72V, 10 minutes for further extension). Platinum PCR SuperMix (Life Technologies) was used for amplification of DNA products (2-5 kb) with prolonging extension time at 72°C in every cycle, according to the product's manual. The PCR products were electrophoresed on agarose gels containing 0.1% ethidium bromide and subcloned into a TA cloning vector (Invitrogen) for DNA
sequencing.
As a control, as shown in figure 8B, the PCR products (640 base pairs) of human (3-actin were amplified in all cDNA derived from 25 tissues and human ovary (lanes 1-25) using the human (3-actin-specific primers (5'-GCATGGGTCAGAAGGAT-3'/3'-GTCCAGTAGTGGTAACC'S';
SEQ
ID NOs: 39 and 40). In contrast, using human MATER -specific primers, (5'-TGACTTCTGATTGCTGTGAGG-3'/3'--CTACTGGCCATGACCACCTT-5 ; SEQ ID NOs: 41 and 42), the PCR products (280 base pairs) were only generated in the cDNA
synthesized from the ovarian RNA (Figure 8C, lanes 17 and 25).
EXAMPLE 5:
Southern Blot Hybridization OF Human MATER cDNA to PCR-amplified MATER
Transcripts This example provides one method of confirming the identity of the DNA
amplified using MATER-specific PCR primers.
Ovarian-specific expression of the human MATER transcripts was further evidenced by a Southern blot hybridization of the human MATER primer-amplified PCR reactions probed with radiolabeled MATER cDNA (Figure 8D).
PCR products obtained in Example 5 were separated by 2% agarose gel electrophoresis and transferred onto a nitrocellulose membrane to prepare a Southern blot. Human MATER cDNA (~0.5 kbp) was labeled with a-[32P]dCTP (3000 Ci/mmol; ICN, Costa Mesa, CA, USA) using Ready-To-Go DNA dCTP Beads (Pharmacia, Inc., Piscataway, NJ, USA). Blots were hybridized (68°C, 2 hours) with 3ZP-labeled cDNA probe (rv0.5 kbp) in QuikHyb solution (Stratagene, La Jolla, CA, USA). After washing the blots with a solution of O.lx standard saline citratel0.1% sodium dodecyl sulfate (SDS) at 65°C, the hybridization signals were detected by autoradiography.
EXAMPLE 6:
Localization of Human MATER transcript This example provides one method for detecting expression of the human MATER
transcript.
To produce in situ hybridization probes, human genomic DNA was amplified using the following primers:
5'-primer: 5'- TTTCACATGAACATCCTTCTCC-3' (SEQ ID NO: 7);
3'-primer: 5'-AGTGCTGGAGGCAGAAGGAAG-3' (SEQ ID NO: 8).
The resultant amplified nucleic acid molecule product size was 496 bp, and is predicted to fall within exon 7 of the human MATER gene, based on comparison to the murine MATER exon-intron map.
This fragment was subcloned into pBluscript vector as a DNA template. Both 35S-UTP-labeled sense and antisense sequences were synthesized by in vitro transcription using T3 and T7 RNA
polymerases.
In situ hybridization was carried out essentially as described previously (Tong & Nelson, Endocrinology 140:3720-3726, 1999). Briefly, the probes were prepared by alkaline hydrolysis and hybridized with frozen human ovarian sections at 60 °C for 24 hours.
After dipping in Kodak NTB-2 emulsion, the slides were exposed to film for 2-3 days and the autoradiographs developed.
The frozen human ovarian sections were hybridized with the radio-labeled sense (FIG. 9A
and 9C) and antisense (B and D) probes. The slides were stained with hematoxylin and eosin. For each probe, bright-field (A and B) and dark-field (C and D) images are displayed. MATER transcript was localized to oocytes.
EXAMPLE 7:
In situ hybridization with MATER probes This example provides another method for detecting expression of the human MATER
transcript.
Both [35S]UTP-labeled sense and antisense probes were synthesized by in vitro transcription using human MATER cDNA as templates and T3/T~ RNA polymerase (Ambion, Inc., Austin, TX, USA). Short probes 0300 nt) of alkaline hydrolysis were hybridized at 60°C for 24 hours with frozen sections (8~) of human ovary obtained from the National Disease Research Institute (NDRI;
Philadelphia, PA, USA). After dipping in Kodak NTB-2 emulsion, the slides were exposed for 1 week on an X-ray film for developing in Kodak D-19 and Kodak Fixer. The slides were finally stained with hematoxylin and eosin, and examined by microscopy under both light and dark fields.
In situ hybridization revealed the oocyte-specific expression of human MATER
transcripts.
As shown in Figure 8E, the hybridization signals using synthetic human MATER
antisense probe were present within the oocytes but not in the follicular cells. The control MATER
sense probes did not hybridize with oocytes or the ovarian cells (Figure 8F). Thus, the oocyte-restricted expression of the human MATER gene appears similar to the expression pattern of the mouse MATER
gene.
EXAMPLE 8:
Localization of Human MATER Protein This example provides one method for examining the localization of human MATER
protein.
In situ localization was carried out essentially as described for marine samples (see, Tong and Nelson, Endoerinolo~ 140:3720-3726, 1999). Briefly, rabbit polyclonal antibody to a marine MATER C-terminal peptide (residues 1093 through 1111 of SEQ ID NO: 6) was prepared as described in Example 18C. Frozen human ovarian sections were incubated with this antiserum (1:200), and FITC-conjugated goat anti-rabbit IgG antiserum was used as the secondary antibody to detect human MATER protein in the oocyte (FIG. 10A). FIG. 10B shows the phase contrast images corresponding to the samples in FIG. 10A.
EXAMPLE 9:
Expression of Human MATER Protein in Oocytes This example provides one method for examining the localization of human MATER
protein.
After blocking with 10% normal goat sera in phosphate-buffered saline (PBS), frozen sections (8~) of human ovary (NDRI) were incubated at 25°C for 2 hours with rabbit antisera (1:200) specific to mouse Mater peptide. The slides were washed with 0.05% Tween-20 in PBS, and incubated with a goat anti-rabbit IgG antibody conjugated with fluorescein isothiocyanate (1:300;
Sigma Chemical Co., St. Louis, MO, USA). After washing and applying with glycerol-glass cover, the slides were examined under fluorescent microscopy.
No fluorescence was observed in somatic cells in the ovarian section other than the oocytes (Figure 11A and 11B). Normal rabbit sera did not stain the oocytes.
EXAMPLE 10:
Immunoblotting to Determine the Size of Native MATER Protein This example provides one method for determining the size of the native Mater protein.
Human immature oocytes were supplied for this study by a clinical IVF program (Rockvill Reproductive Science Center, Rockville, MD, USA) after obtaining consent and approval of the NIH
office of Human Subjects Research. For immunoblotting, human oocyte proteins were separated on a 3-8% Tris-acetate SDS-polyacrylamide gel electrophoresis. After transferring onto a nitrocellulose membrane, 5% dry milk in PBS was used to block non-specific binding in the blot. Subsequently, the blot was incubated with rabbit anti-Mater peptide antibody (1:1000) for 2 hours at 25°C. After the blot was washed, the primary antibody-bound proteins were detected by a goat anti-rabbit IgG
antibody (1:1000) labeled with horseradish peroxidase using an enhanced chemiluminescence system according to the manufacturer's instructions (Amersham/Pharmacia, Inc., Piscatoway, NJ, TJSA).
As shown in Figure 11 C, human MATER protein 0134 kDa) was detected in the preparation of the human oocyte proteins using anti-mouse MATER antibody. It was noted that there were two close signals of MATER proteins present in the immunoblotting. This might reflect a post-translational modification of human MATER protein or the possibility of an alternative initiation site in the synthesis of the polypeptide chain.
EXAMPLE 11:
Methods of Making Human MATER cDNA
The original means by which the Mater cDNA was identified and obtained is described above. With the provision of the sequence of the large portions of the MATER
protein (SEQ ID
NOs: 2 and 4) and encoding nucleic acid molecules (SEQ ID NOs: 1 and 3), nucleotide amplification (such as polymerase chain reaction (PCR)) now may be utilized in a simple method for producing the MATER cDNA.
Total RNA is extracted from human cells by any one of a variety of methods well known to those of ordinary skill in the art. Sambrook et al. (In Molecular Cloning: A
Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992) provide descriptions of methods for RNA isolation.
Because MATER is expressed in oocytes, human cell lines derived from oocytes or ovaries can be used as a source of such RNA. The extracted RNA is then used as a template for performing reverse transcription-polymerase chain reaction (RT-PCR) amplification of cDNA.
Methods and conditions for RT-PCR are described in Kawasaki et al., (In PCR Protocols, A Guide to Methods and Applications, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California, 1990).
The selection of amplification primers will be made according to the portions) of the cDNA
that is to be amplified. Primers may be chosen to amplify a segment of a cDNA
or the entire cDNA
molecule. Variations in amplification conditions may be required to accommodate primers and amplicons of differing lengths and composition; such considerations are well known in the art and are discussed for instance in Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990). By way of example, the majority of the coding portion of the human MATER cDNA molecule (approximately 2.8 kb) may be amplified using the following combination of primers:
5'-primer (part of exon 7):
5'-CAGGAATTGGGAAATCGGCTCTCTAG-3' (SEQ ID NO.: 9);
3'-primer (end of exon 15):
5'-CCAAATGCTTTGTGTTTATTTAATTCC-3' (SEQ ID NO.: 10).
One of ordinary skill can use the full length human MATER cDNA sequence provided herein (SEQ
ID NO: 23) to devise primers that could be used to amplify the entire cDNA
using known techniques.
The following set of four primers can be used to amplify 950 by at the 5'-end of human MATER cDNA:
The 5'-primers are the universal adapter primers (ADP) for 5'-RACE-PCR as follows (OriGene Technologies, Inc, Rockville, MD):
ADPl: 5'-CGGAATTCGTCACTCAGCG-3' (SEQ ID NO.: 11) ADP2: 5'-AGCGCGTGAATCAGATCG-3' (SEQ ID NO.: 12) The 3'-primers are gene-specific primers (GSP) for human MATER cDNA within exon 7, as follows:
GSP1: 5'-ATTCCCTGGTAGAGTCCACCTTGC-3' (SEQ ID NO.: 13) GSP2: 5'-ACAGCACGATCCTTCTGGCTAGAG-3' (SEQ ID NO.: I4).
GSP 1 is used as a primer for reverse transcription of human ovarian RNA to synthesize cDNA. The reverse transcribed cDNAs are then adapted at the 5'-end by ADP1 primer, then amplified for the first round of PCR using ADP1 and GSP1 primers. The second round of PCR
amplification is followed using PCR products from the first round as template, and ADP2 and GSP2 as primers.
Fragment 1 of the human MATER cDNA (SEQ ID NO: 1 ) may be amplified using the following combination of primers:
5'-primer: 5'-CAAGCTCCGGTGACGGAGATCAT-3' (SEQ ID NO.: 15);
3'-primer: 5'-AGCTGGAGGCAGAAGGAAGATG-3' (SEQ ID NO.: 16).
The 3'-terminal region of the human MATER cDNA molecule (also referred to herein as human MATER cDNA fragment 2, SEQ ID NO: 3) may be amplified using the following combination of primers:
5'-primer: 5'-TCTGGCCTCAGCCCTCGTCAGCTTGAC-3' (SEQ ID NO.: 17);
3'-primer: 5'-CCAAATGCTTTGTGTTTATTTAATTCC-3' (SEQ ID NO.: 18).
These primers are illustrative only; one skilled in the art will appreciate that many different primers may be derived from the provided cDNA sequence in order to amplify particular the indicated regions MATER cDNA, as well as to complete the sequence of the human MATER cDNA.
Re-sequencing of PCR products obtained by these amplification procedures is recommended; this will facilitate confirmation of the amplified sequence and will also provide information on natural variation on this sequence in different populations or species.
Oligonucleotides derived from the provided MATER sequences provided may be used in such sequencing methods.
Orthologs of human MATER can be cloned in a similar manner, where the starting material consists of cells taken from a non-human species. Orthologs will generally share at least 80%
sequence homology with the disclosed human MATER cDNA. Where the non-human species is more closely related to humans, the sequence homology will in general be greater.
Closely related orthologous MATER molecules may share at least 82%, at least 85%, at least 90%, at least 91%, at least 93%, at least 95%, or at least 98% sequence homology with the disclosed human sequences.
Oligonucleotides derived from the human MATER cDNA sequence (SEQ ID NO: 23), or fragments thereof (such as SEQ ID NOs: 1 and 3), are encompassed within the scope of the present disclosure. Preferably, such oligonucleotide primers will comprise a sequence of at least 23 consecutive nucleotides of the Mater nucleic acid sequence. To enhance amplification specificity, oligonucleotide primers comprising at least 25, 30, 35, 40, 45 or 50 consecutive nucleotides of these sequences may also be used. These primers for instance may be obtained from any region of the disclosed sequences. By way of example, the human Mater cDNA, ORF and gene sequences may be apportioned into about halves or quarters based on sequence length, and the isolated nucleic acid molecules (e.g., oligonucleotides) may be derived from the first or second halves of the molecules, or any of the four quarters. The murine MATER cDNA, shown in SEQ ID NO: 5, can be used to illustrate this. The human MATER cDNA is 3447 nucleotides in length and so may be hypothetically divided into about halves (nucleotides 1-1723 and 1724-3447) or about quarters (nucleotides 1-862, 863-1723, 1724-2586 and 2587-3447). The human cDNA can be likewise apportioned, or can be described in terms of the fragments presented herein (e.g., fragment 1, corresponding to around about nucleotide 1700 through around about 1950 of murine Mater; and fragment 2 of the human Mater cDNA, corresponding to the 3'-terminal region of murine Mater cDNA, around about nucleotide 2500 through the polyA tail of the murine Mater cDNA).
Also encompassed herein are oligonucleotides from within the human MATER gene, for use in the methods described herein. These include, but are not limited to, oligonucleotides that span or include the sequence spanning an intron-exon boundary of the human MATER gene (see Table 2).
Nucleic acid molecules may be selected that comprise at least 15, 20, 23, 25, 30, 35, 40, 50 or 100 consecutive nucleotides of any of these or other portions of the human MATER cDNA. Thus, representative nucleic acid molecules might comprise at least 15 consecutive nucleotides of the human MATER cDNA (SEQ ID NO: 23), or fragment 1 or fragment 2 of the disclosed human Mater coding sequence (SEQ ID NOs: 1 and 3, respectively).
EXAMPLE 12:
Isolation of Human MATER cDNA
This example provides another method of making human MATER cDNA.
Human MATER oligonucleotide primers were designed to amplify, using PCR, nucleic acids from human ovarian cDNA and a library produced therefrom (see Example 4).
Using the PCR-cloned cDNA as the probes for in situ hybridization, human oocytes were confnmed to express the corresponding transcripts (see Example 5). DNA sequencing revealed that these PCR products are human MATER cDNA homologous to the mouse Mater cDNA.
The PCR products were generated to span ~98% of the coding region from nt 76 to nt 3596.
The 3' non-coding regions were determined by sequencing cDNA clones isolated from the human ovarian cDNA library using the PCR-cloned cDNA as probe. The first 75 nt at the 5' end were derived from a predicted cDNA of the genomic clone AC011470 (http://www.ensemble.org). The non-coding region present at the 5' end of the Mater cDNA remains undetermined. Assuming the presence of a poly(A) tail 0150-200 nt), assembly of the determined human MATER cDNA
sequence, its poly(A) tail and 5' undetermined non-coding region correspond in size with the MATER
transcripts detected in the Northern hybridization (4.2 kb; Example 3). This suggests that the cloned cDNA sequence represents a full-length coding region.
As shown in Figure 12, the open reading frame (nt 1 to nt 3600) of the cloned cDNA (3885 nt) encodes a protein composed of 1200 amino acids. The entire polypeptide chain is predicted to have a I 6.08 and a molecular mass of 134,235.76 DA, which corresponded to the size of the human oocyte protein recognized by the antisera specific to murine Mater peptide.
Expression of a recombinant protein further confirmed the cloned cDNA to encode the human MATER protein.
The initiator code (ATG) encoding the first methionine in the open reading frame (ORF) was in a context (ATCATGAAG), the consensus sequence recognized for initiation in vertebrates. The stop codon (TGA) was followed by 282 nt of the 3' non-coding sequence. A
signal sequence (AATAAA) for polyadenylation was located just 18 nt upstream of the poly(A) tail. None of the known genes and proteins deposited in GenBank was found to have significant homologies to the human MATER gene or MATER protein. However, the carboxyl-terminal sequence of the human MATER peptide had a ~32% homology with human and porcine ribonuclease inhibitors (457 residues). Thus, human MATER contains a structural domain of the ribonuclease inhibitor-like Leucine-rich repeats at the carboxy terminus, as found in mouse. The human and mouse MATER
cDNAs share 67% homology, while their deduced polypeptide chains share 53%
amino acid identity.
EXAMPLE 13:
Analysis of Human MATER Polypeptide Chain This example provides one method of analyzing the structural domains of the human MATER protein.
Computational analyses of DNA sequences and deduced peptide sequences were conducted using software available at the National Center for Biotechnology Information at NIH
(http://www.nbci.nlm.nih.gov), the EMBL-EBI (http://www.ensemble.org), the Sanger Center (http://www.sanger.ac.uk) and the ExPASy Molecular Biology Server of the Swiss Institute for Bioinformatics (hrip://www.expasy.ch).
A computational analysis was carried out to search for the structural features of the human MATER protein. When the entire polypeptide chain of human MATER was compared with itself, the DotPlot analysis revealed the presence of repeat structural motifs at amino-and carboxyl-termini.
These repeats were evidenced by a series of parallel but offset lines in these regions (Figure 13A), as also seen in the mouse MATER protein. A comparison between the polypeptide chains of human and mouse MATER indicated the similarities and homologies of their structural motifs and compositions (Figure 13B).
A hydrophobicity plot (Figure 14A) indicated that there were hydrophilic regions present at amino- (32-304 residues) and carboxyl-termini (1184-1200 residues). No structural motifs were found for either peptide signals of protein secretion, or for transmembrane domains. The peptide chain had some notable motifs, as indicated in Figure 14B. A signal for nuclear localization was present at the residue 517-534 (NLS BP), which was not detected in the mouse MATER. There appears to be no recognizable peptide domains for DNA binding. Further experimental evidence is required to determine if the human MATER is translocated into nuclei.
Human MATER protein had six Leucine-rich repeats at the carboxyl-terminus, and a PAAD DAPIN domain (52-148 residues), both of which are recognized as the structural basis for protein-protein interactions. Their presence implies that human MATER
interacts with other oocyte proteins to perform its function. In addition, human MATER protein had an aldo ket red domain (71-87) at the amino-terminus, and an ATP-/GTP-binding domain (P-loop) at residue 286-293. The aldo ket red is a domain present in protein with oxireductase activity, and the P-loop is the typical domain for binding to ATP/GTP in participating in an intracellular signal transduction.
EXAMPLE 14:
Genomic Organization of the Human MATER Locus This example provides a method of determining the size and numbers of exons and introns in the MATER genomic sequence.
Using the sequence of cloned human MATER cDNA, one human genomic clone (GenBank Accession Number AC011470) was determined to carry an entire gene locus of human MATER.
Using the sequence of the cloned human MATER cDNA to blast the human hgts database (which is accessible on-line, for instance via the NCBI web site), a single genomic clone (ACOl 1470) that had been fully sequenced was determined to harbor an entire gene locus of human MATER.
To determine the number and size of the exons and introns, the sequence of the cloned cDNA was compared with the sequence of the AC011470c1one isolated from human chromosome 19 (Fig. 15 A and B). The AG-exon-GT rule was applied to determine a splicing site between exon and introns (Table 2).
The 15 exons and 14 introns were identified to span a ~63 kb region of DNA.
The exons ranging in size from 56 to 1597 by were intervened by 14 introns ranging from 760 to 9327 by (Table 2). In addition, there were 282 nucleotides of the 3' non-coding region within exon 15, and undetermined nucleotides of the S' non-coding region within exon 1. The sequences switching between each exon and introns were confirmed to meet with the bordering consensus sequences (AG--GT) for splice sites of the exon-intron. Thus, the human MATER locus spanned a ~63 kb DNA and was composed of the 15 exons and 14 introns.
Table 2. Exon and intron and splice-junction sequences of human MATER
Exon Splice-junction sequences Intron No. Position Length Exon No. Length 101 1-62 >62 .......... 1 GTCGACAGCC 1 3928 Human MATER and mouse Mater loci had identical numbers of exons and introns, while the human locus was longer than the mouse locus (32 kbp). This mainly reflects the larger size of the human introns. The counterpart exons were comparable. Both had a large exon 7 spanning ~50% of the coding sequences, and the counterparts of exons 8-14 had an identical number of nucleotides.
However, the first six exons (1-6) in the human locus ranged in size from 56-380 nt, while their counterparts in the mouse locus had 48-78 nt. A larger exon 2 (380 nt) in the human MATER locus made the human MATER cDNA coding region (3600 nt) slightly longer than the mouse cDNA coding region (3333 nt). All of these structural similarities and variations reflect conservation and evolution between mouse Mater and human MATER loci.
EXAMPLE 15:
Cloning of the Mater Genomic Sequence (or Gene) The Mater cDNA sequence and fragments thereof described above does not contain introns, upstream transcriptional promoter or regulatory regions or downstream transcriptional regulatory regions of the MATER gene. It is possible that some mutations in the MATER
gene that may lead to defects in embryo development, infertility, or reduced fertility are not included in the cDNA but rather are located in other regions of the MATER gene. Mutations located outside of the open reading frame that encodes the MATER protein are not likely to affect the functional activity of the protein, but rather are likely to result in altered levels of the protein in the cell.
For example, mutations in the promoter region of the MATER gene may prevent transcription of the gene and therefore lead to the complete absence of the MATER protein in the cell.
Additionally, mutations within intron sequences in the genomic gene may also prevent expression of the MATER protein. Following transcription of a gene containing introns, the intron sequences are removed from the RNA molecule in a process termed splicing prior to translation of the RNA molecule which results in production of the encoded protein. When the RNA
molecule is spliced to remove the introns, the cellular enzymes that perform the splicing function recognize sequences around the intron/exon border and in this manner recognize the appropriate splice sites. If there is a mutation within the sequence of the intron close to the junction of the intron with an exon, the enzymes may not recognize the junction and may fail to remove the intron.
If this occurs, the encoded protein will likely be defective. Thus, mutations inside the intron sequences within the MATER gene (termed "splice site mutations") may also lead to defects in embryo development.
However, knowledge of the exon structure and intronic splice site sequences of the MATER gene is required to define the molecular basis of these abnormalities.
The provision herein of the MATER cDNA sequence and the sequence of the MATER
gene (as now identified within AC011470) enables the cloning of the entire MATER
gene (including the promoter and other regulatory regions and the intron sequences). With this information in hand, diagnosis of a genetic predisposition to fertility defects based on DNA
analysis will comprehend all possible mutagenic events at the MATER locus.
The MATER gene may be isolated by one or more routine procedures, including direct sequencing of one or more BAC or PAC clones that contain the MATER sequence.
Alternatively, using the information provided herein, in particular the identification of the entire gene sequence from within GenBank Accession No. AC011470, portions of the MATER gene (or the entire gene) can be amplified from genomic DNA using in vitro amplification techniques. For long portions of the gene, or the entire gene, it may be advantageous to use techniques especially tailored to amplification of long sequences. Such techniques are known to those of ordinary skill in the art.
With the sequences of human MATER cDNA and gene in hand, primers derived from these sequences may be used in diagnostic tests (described below) to determine the presence of mutations in any part of the genomic MATER gene of a patient. Such primers will be oligonucleotides comprising a fragment of sequence from the MATER gene (intron sequence, exon sequence, or a sequence spanning an intron-exon boundary) and may include at least 10 consecutive nucleotides of the MATER cDNA or gene. Specific examples of such oligonucleotides include those comprising the sequences shown in SEQ ID NOs: 25-38. It will be appreciated that greater specificity may be achieved by using primers of greater lengths. Thus, in order to obtain enhanced specificity, the primers used may comprise 15, 17, 20, 23, 25, 30, 40 or even 50 consecutive nucleotides of the MATER cDNA or gene, particularly overlapping an intron-exon boundary.
Furthermore, with the provision of the MATER intron sequence information, the analysis of a large and as yet untapped source of patient material for mutations is now possible using methods such as chemical cleavage of mismatches (Cotton et al., Proc. Natl. Acad. Sci. USA 85:4397-4401, 1985;
Montandon et al., Nucleic Acids Res. 9:3347-3358, 1989) and single-strand conformational polymorphism analysis (Orita et al., Genomics 5:874-879, 1989).
Additional experiments may be performed to identify and characterize regulatory elements flanking the MATER gene. These regulatory elements may be characterized by standard techniques including deletion analyses wherein successive nucleotides of a putative regulatory region are removed and the effect of the deletions are studied by either transient or long-term expression analyses experiments. The identification and characterization of regulatory elements flanking the genomic MATER gene may be made by functional experimentation (deletion analyses, etc.) in mammalian cells by either transient or long-term expression analyses.
It will be apparent to one skilled in the art that either the genomic clone or the cDNA or sequences derived from these clones may be utilized in applications, including but not limited to, studies of the expression of the MATER gene, studies of the function of the MATER protein, the generation of antibodies to the MATER protein diagnosis and therapy of MATER
deleted or mutated patients to prevent or treat the defects in embryo development. Descriptions of applications describing the use of MATER cDNA, or fragments thereof, are therefore intended to comprehend the use of the genomic MATER gene.
It will also be apparent to one skilled in the art that homologs of this gene may now be cloned from other species, such as the rat or a monkey, by standard cloning methods. Such homologs will be useful in the production of animal models of onset and development of autoimmune infertility, and early embryogenesis. In general, such orthologous MATER molecules will share at least 70%
sequence identity with the human MATER nucleic acid disclosed herein; more closely related orthologous sequences will share at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% sequence identity with this sequence.
EXAMPLE 16:
Mater Nucleic Acid and Amino Acid Sequence Variants With the provision of human MATER protein fragments and corresponding nucleic acid sequences herein, the creation of variants of these sequences is now enabled.
Variant MATER proteins include proteins that differ in amino acid sequence from the human MATER sequences disclosed but that share at least 65% amino acid sequence homology with the provided human MATER protein. Other variants will share at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% amino acid sequence homology.
Manipulation of the nucleotide sequence of Mater using standard procedures, including for instance site-directed mutagenesis or PCR, can be used to produce such variants. The simplest modifications involve the substitution of one or more amino acids for amino acids having similar biochemical properties. These so-called conservative substitutions are likely to have minimal impact on the activity of the resultant protein. Table 3 shows amino acids that may be substituted for an original amino acid in a protein, and which are regarded as conservative substitutions.
Table 3 Original Residue Conservative Substitutions Ala ser Arg lys Asn gln; his Asp glu Cys ser Gln asn Glu asp Gly pro His asn; gln Ile leu; val Leu ile; val Lys arg; gln; glu Met leu; ile Phe met; leu; tyr Ser thr Thr ser Trp tyr Tyr trp; phe Val ile; leu More substantial changes in enzymatic function or other protein features may be obtained by selecting amino acid substitutions that are less conservative than those listed in Table 3. Such changes include changing residues that differ more significantly in their effect on maintaining polypeptide backbone structure (e.g., sheet or helical conformation) near the substitution, charge or hydrophobicity of the molecule at the target site, or bulk of a specific side chain. The following substitutions are generally expected to produce the greatest changes in protein properties: (a) a hydrophilic residue (e.g., seryl or threonyl) is substituted for (or by) a hydrophobic residue (e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl); (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain (e.g., lysyl, arginyl, or histadyl) is substituted for (or by) an electronegative residue (e.g., glutamyl or aspartyl); or (d) a residue having a bulky side chain (e.g., phenylalanine) is substituted for (or by) one lacking a side chain (e.g., glycine).
Variant MATER encoding sequences may be produced by standard DNA mutagenesis techniques, for example, M13 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (In Molecular Cloning: A Laboratory Marraral, CSHL, New York, 1989), Ch. 15. By the use of such techniques, variants may be created that differ in minor ways from the human MATER
sequences disclosed. DNA molecules and nucleotide sequences that are derivatives of those specifically disclosed herein, and which differ from those disclosed by the deletion, addition, or substitution of nucleotides while still encoding a protein that has at least 82% sequence identity with the human MATER encoding sequence disclosed (SEQ ID NOs: 1 and 3), are comprehended by this disclosure. Also comprehended are more closely related nucleic acid molecules that share at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% nucleotide sequence homology with the disclosed Mater sequences. In their most simple form, such variants may differ from the disclosed sequences by alteration of the coding region to fit the codon usage bias of the particular organism into which the molecule is to be introduced. The full length human MATER cDNA (SEQ
ID NO: 23) is also encompassed in the disclosure, and as a molecule that comprises both fragment 1 (SEQ ID NO:
1) and fragment 2 (SEQ ID NO: 3), and encoding the human MATER protein with described physical characteristics and biological properties.
Alternatively, the coding region may be altered by taking advantage of the degeneracy of the genetic code to alter the coding sequence such that, while the nucleotide sequence is substantially altered, it nevertheless encodes a protein having an amino acid sequence substantially similar to the disclosed human MATER protein sequences. For example, because of the degeneracy of the genetic code, four nucleotide codon triplets - (GCT, GCG, GCC and GCA) - code for alanine. The coding sequence of any specific alanine residue within the human MATER protein, therefore, could be changed to any of these alternative codons without affecting the amino acid composition or characteristics of the encoded protein. Based upon the degeneracy of the genetic code, variant DNA
molecules may be derived from the cDNA and gene sequences disclosed herein using standard DNA
mutagenesis techniques as described above, or by synthesis of DNA sequences.
Thus, this disclosure also encompasses nucleic acid sequences that encode a MATER protein, but which vary from the disclosed nucleic acid sequences by virtue of the degeneracy of the genetic code.
Variants of the MATER protein may also be defined in terms of their sequence identity with the prototype human MATER protein. As described above, human MATER proteins share at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% amino acid sequence identity with the human MATER protein (SEQ ID NO: 24) or fragments disclosed herein (such as SEQ ID NOs: 2 and 4). Nucleic acid sequences that encode such proteins/fragments readily may be determined simply by applying the genetic code to the amino acid sequence of an MATER
protein or fragment, and such nucleic acid molecules may readily be produced by assembling oligonucleotides corresponding to portions of the sequence.
Variant MATER proteins may contain one or more variant amino acids (amino acids different from the prototypical sequence provided herein). For instance, specific variant MATER
proteins have at least two, at least three, at least 4, at least 5, at least 6, at least 8, at least 10, at least 15, at least 20, or even 25, 30, 50, 100 or more variant amino acids compared to the prototypical MATER sequence (SEQ ID NO: 24).
Particular embodiments include MATER variant proteins wherein at least one amino acid sequence variation is within a recognized protein domain or recognized functional sequence. Specific examples include variations in one of the Leucine-rich repeats at the carboxyl-terminus, the PAAD-DAPIN domain (52-148 residues), the aldo ket red domain (71-87) at the amino-terminus, or the ATP-/GTP-binding domain (P-loop) at residue 286-293. Thus, in particular examples a variant MATER protein (or nucleic acid encoding such) will include one or more residue changes in a leucine-rich repeat, or in the PAAD DAPIN domain; such example proteins may have differential interactions with other proteins in the cell. Specific variant MATER proteins of this type are interaction-disruptive, and affect (e.g., inhibit or enhance) MATER function in the cell, and may be defective in one or more other activities of the MATER protein.
In other embodiments, a variant MATER protein (or nucleic acid encoding such) has one or more sequence variations in the aldo ket red domain. Specific examples of such variants disrupt an oxireductase activity of the protein, and may be defective in one or more other activities of the MATER protein.
In still other embodiments, a variant MATER protein (or nucleic acid encoding such) has one or more sequence variations in the ATP-IGTP-binding domain (P-loop).
Examples of such variant proteins are defective in ATP and/or GTP binding and may be defective in one or more other activities of the MATER protein.
In some embodiments, a variation in the amino acid sequence occurs in each of two or more such defined domains.
In still other embodiments, a protein sequence variation occurs outside of these defined domains. Examples of such variants include variants occurring, for instance, in any one of residues 149 through 285. Specific examples of such variant proteins will include more than one sequence variation.
Nucleic acid molecules that are derived from the human MATER cDNA nucleic acid sequences disclosed include molecules that hybridize under stringent conditions to the disclosed prototypical MATER nucleic acid molecules, or fragments thereof. Stringent conditions are hybridization at 65° C in 6 x SSC, 5 x Denhardt's solutions 0.5% SDS
and 100 ~g/ml sheared salmon testes DNA, followed by 15-30 minute sequential washes in 2 x SSC, 0.5% SDS, followed by 1 x SSC, 0.5% SDS and finally 0.2 x SSC, 0.5% SDS, at 65° C.
Low stringency hybridization conditions (to detect less closely related homologs) are performed as described above but at 50°C (both hybridization and wash conditions); however, depending on the strength of the detected signal, the wash steps may be terminated after the first 2 x SSC wash.
Human MATER nucleic acid encoding molecules (including the cDNA shown in SEQ
ID
NO: 23 and fragments shown in SEQ ID NOs: 1 and 3, and nucleic acids comprising these sequences), and orthologs and homologs of these sequences, may be incorporated into transformation or expression vectors.
EXAMPLE 17:
Expression of MATER Protein and Variants thereof With the provision of human MATER cDNA sequence fragments, and methods for determining and cloning the full length human MATER cDNA, the expression and purification of the MATER protein by standard laboratory techniques is now enabled. Purified human MATER protein may be used for functional analyses, antibody production, diagnostics, and patient therapy.
Furthermore, the DNA sequence of the MATER cDNA can be manipulated in studies to understand the expression of the gene and the function of its product. Mutant forms of the human MATER may be isolated based upon information contained herein, and may be studied in order to detect alteration in expression patterns in terms of relative quantities, cellular localization, tissue specificity and functional properties of the encoded mutant MATER protein. Partial or full-length cDNA sequences, which encode for the subject protein, may be ligated into bacterial expression vectors. Methods for expressing large amounts of protein from a cloned gene introduced into Escherichia coli (E. coli) may be utilized for the purification, localization and functional analysis of proteins. For example, fusion proteins consisting of amino terminal peptides encoded by a portion of the E.
coli lacZ or trpE gene linked to MATER proteins may be used to prepare polyclonal and monoclonal antibodies against these proteins. Thereafter, these antibodies may be used to purify proteins by immunoaffmity chromatography, in diagnostic assays to quantitate the levels of protein and to localize proteins in tissues and individual cells by immunofluorescence. Such antibodies may be specific for epitope tags, which can be added to the expression construct for identification an/or purification purposes.
Intact native protein may also be produced in E. eoli in large amounts for functional studies.
Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al. (Sambrook et al., In Molecular Cloning: A
Laboratory Manxfal, Ch. 17, CSHL, New York, 1989). Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response. Native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ribosome-binding site upstream of the cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy. Suitable methods are presented in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and are well known in the art. Often, proteins expressed at high levels are found in insoluble inclusion ~ bodies. Methods for extracting proteins from these aggregates are described by Sambrook et al. (In Molecular Cloning: A Laboratory Mafaual, Ch. 17, CSHL, New York, 1989). Vector systems suitable for the expression of laoZ fusion genes include the pUR series of vectors (Ruther and Muller-Hill, EMBO J. 2:1791, 1983), pEXl-3 (Stanley and Luzio, EMBO.1. 3:1429, 1984) and pMR100 (Gray et al., Proc. Natl. Acad. Sci. USA 79:6598, 1982). Vectors suitable for the production of intact native proteins include pKC30 (Shimatake and Rosenberg, Nature 292:128, 1981), pKK177-3 (Amann and Brosius, Gene 40:183, 1985) and pET-3 (Studiar and Moffatt, J. Mol.
Biol. 189:113, 1986). MATER fusion proteins may be isolated from protein gels, lyophilized, ground into a powder and used as an antigen. The DNA sequence can also be transferred from its existing context to other cloning vehicles, such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al., Science 236:806-812, 1987). These vectors may then be introduced into a variety of hosts including somatic cells, and simple or complex organisms, such as bacteria, fungi (Timberlake and Marshall, Science 244:1313-1317, 1989), invertebrates, plants, and animals (Pursel et al., Science 244:1281-1288, 1989), which cells or organisms are rendered transgenic by the introduction of the heterologous Mater cDNA.
For expression in mammalian cells, the cDNA sequence may be ligated to heterologous promoters, such as the simian virus (SV) 40 promoter in the pSV2 vector (Mulligan and Berg, Proc.
Natl. Aced. Sci. USA 78:2072-2076, 1981), and introduced into cells, such as monleey COS-1 cells (Gluzman, Cel123:175-182, 1981), to achieve transient or long-term expression.
The stable integration of the chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J. Mol. Appl. Genet. 1:327-341, 1982) and mycophenolic acid (Mulligan and Berg, Proc. Natl. Aced Sci. USA 78:2072-2076, 1981).
DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence-alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with nucleic acid amplification.
The cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques.
These vectors are designed to permit the transcription of the cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA
and ensure its proper splicing and polyadenylation. Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan et al., Proc. Natl. Aced. Sci. USA
78:1078-2076, 1981; Gorman et al., Proc. Natl. Aced. Sci USA 78:6777-6781, 1982). The level of expression of the cDNA can be manipulated with this type of vector, either by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S
frugiperda cells (Summers and Smith, In Genetically Altered VirZases and the Environment, Fields et al.
(Eds.) 22:319-328, CSHL Press, Cold Spring Harbor, New York, 1985) or by using vectors that contain promoters amenable to modulation, for example, the glucocorticoid-responsive promoter from the mouse mammary tumor virus (Lee et al., Nature 294:228, 1982). The expression of the cDNA can be monitored in the recipient cells 24 to 72 hours after introduction (transient expression).
In addition, some vectors contain selectable markers such as the gpt (Mulligan and Berg, Proc. Natl. Aced. Sci. USA 78:2072-2076, 1981) or neo (Southern and Berg, J.
Mol. Appl. Genet.
1:327-341, 1982) bacterial genes. These selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vectors (and therefore the cDNA).
The vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses, such as papilloma (Server et al., Mol. Cell Biol. 1:486-496, 1981) or Epstein-Barr (Sugden et al., Mol.
Cell Biol. 5:410-413, 1985). Alternatively, one can also produce cell lines that have integrated the vector into genomic DNA. Both of these types of cell lines produce the gene product on a continuous basis. One can also produce cell lines can also produced that have amplified the number of copies of the vector (and therefore of the cDNA as well) to create cell lines that can produce high levels of the gene product (Alt et al., J. Biol. Chern. 253:1357-1370, 1978).
The transfer of DNA into eukaryotic, in particular human or other mammalian cells, is now a conventional technique. Recombinant expression vectors can be introduced into the recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vender Eb, Virology 52:466, 1973) or strontium phosphate (Brash et al., Mol. Cell Biol. 7:2013, 1987), electroporation (Neumann et al., EMBO J 1:841, 1982), lipofection (Felgner et al., Proc. Natl. Aced.
Sci USA 84:7413, 1987), DEAE dextran (McCuthan et al., J. Natl. Cancer Inst.
41:351, 1968), microinjection (Mueller et al., Cell 15:579, 1978), protoplast fusion (Schafner, Proc. Natl. Aced. Sci.
USA 77:2163-2167, 1980), or pellet guns (Klein et al., Nature 327:70, 1987).
Alternatively, the cDNA, or fragments thereof, can be introduced by infection with virus vectors.
Systems are developed that use, for example, retroviruses (Bernstein et al., Gen. Engr'g 7:235, 1985), adenoviruses (Ahmad et al., J. Virol. 57:267, 1986), or Herpes virus (Spaete et al., Cell 30:295, 1982). Techniques of use in packaging long transcripts can be found in Kochanek et al. (Proc. Natl.
Acad. Sci. USA 93:5731-5739, 1996) Parks et al. (Pros. Natl. Aced. Sci. USA
93:13565-13570, 1996) and Parks and Graham (J Virol. 71:3293-3298, 1997). MATER encoding sequences can also be delivered to target cells in vitro via non-infectious systems, for instance liposomes.
These eukaryotic expression systems can be used for studies of MATER encoding nucleic acids and mutant forms of these molecules, the MATER protein and mutant forms of this protein.
Such uses include, for example, the identification of regulatory elements located in the 5' region of the Mater gene on genomic clones that can be isolated from human genomic DNA
libraries using the information contained herein. The eukaryotic expression systems also may be used to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring or artificially produced mutant proteins.
Using the above techniques, expression vectors containing the MATER gene sequence or cDNA, or fragments or variants or mutants thereof, can be introduced into human cells, mammalian cells from other species or non-mammalian cells, as desired. The choice of cell is determined by the purpose of the treatment. For example, monkey COS cells (Gluzman, Cell 23:175-182, 1981) that produce high levels of the SV40 T antigen and permit the replication of vectors containing the SV40 origin of replication may be used. Similarly, Chinese hamster ovary (CHO), mouse NIH 3T3 fibroblasts or human fibroblasts or lymphoblasts (as described herein) may be used.
Embodiments described herein thus encompass recombinant vectors that comprise all or part of a MATER encoding sequence, such as the MATER gene or cDNA or variants thereof, for expression in a suitable host. The MATER DNA is operatively linleed in the vector to an expression control sequence in the recombinant DNA molecule so that the MATER polypeptide can be expressed. The expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof. The expression control sequence may be specifically selected from the group consisting of the lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of fd coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter of the yeast alpha-mating factors and combinations thereof. , The host cell, which may be transfected with a vector, may be selected from the group consisting of E. coli, Pseudomonas, Bacillus subtilis, Bacillus stearothermophilus or other bacilli;
other bacteria; yeast; fungi; insect; mouse or other animal; or plant hosts;
or human tissue cells.
It is appreciated that for mutant or variant MATER DNA sequences, similar systems are employed to express and produce the mutant product.
EXAMPLE 18:
Production of an Antibody to MATER Protein Monoclonal or polyclonal antibodies may be produced to either the normal MATER
protein or mutant forms of this protein. Optimally, antibodies raised against the MATER protein would specifically detect the MATER protein. That is, such antibodies would recognize and bind the MATER protein and would not substantially recognize or bind to other proteins found in human cells.
Antibodies the human MATER protein may recognize MATER from other species, such as marine MATER, and vice versa.
The determination that an antibody specifically detects the MATER protein is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique (Sambrook et al., In Molecular Clonifag.~ A Laboratory Manual, CSHL, New York, 1989). To determine that a given antibody preparation (such as one produced in a mouse) specifically detects the MATER protein by Western blotting, total cellular protein is extracted from human cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel. The proteins are then transferred to a membrane (for example, nitrocellulose or PVDF) by Western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of (by way of example) an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase. Application of an alkaline phosphatase substrate S-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immunolocalized allcaline phosphatase. Antibodies that specifically detect the MATER protein will, by this technique, be shown to bind to the MATER protein band (which will be localized at a given position on the gel determined by its molecular weight, which is approximately 125 kDa based on gel-mobility estimation for marine MATER. Non-specific binding of the antibody to other proteins may occur and may be detectable as a weak signal on the Western blot. The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody-MATER protein binding.
In certain embodiments, antibodies are generated which are specific to a domain or portion of the MATER protein.
Substantially pure MATER protein suitable for use as an immunogen is isolated from the transfected or transformed cells as described above. The concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon (Millipore, Bedford, Massachusetts) or similar filter device, to the level of a few micrograms per milliliter. Monoclonal or polyclonal antibody to the protein can then be prepared as follows:
A. Monoclonal Antibody Production by Hybridoma Fusion Monoclonal antibody to epitopes of the MATER protein identified and isolated as described can be prepared from marine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495-497, 1975) or derivative methods thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein over a period of a few weeks.
The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused with mouse myeloma cells using polyethylene glycol, and the excess un-fused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). Successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate, where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol. 70(A):419-439, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane (Antibodies, A
Laboratory Mahual, CSHL, New York, 1988).
B. Polyclonal Antibody Production by Immunization Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein (Example 8), which optionally can be modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than others and may require the use of carriers and adjuvant, examples of which are known. Also, host animals vary in response to site of inoculations and dose, with either inadequate or excessive doses of antigen resulting in low titer antisera. A series of small doses (ng level) of antigen administered at multiple intradermal sites appear to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis et al.
(J. Clin. Erzdocrinol.
Metab. 33:988-991, 1971).
Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof begins to fall, as determined semi-quantitatively (for example, by double immunodiffusion in agar against known concentrations of the antigen). See, for example, Ouchterlony et al. (In Handbook of ExperimetZtal Immunology, Wier, D. (ed.) chapter 19. Blackwell, 1973). Plateau concentration of antibody is usually in the range of about 0.1 to 0.2 mg/ml of serum (about 12 ~M). Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Irraruufzology, Ch. 42, 1980).
C. Antibodies Raised against Synthetic Peptides A third approach to raising antibodies against the MATER protein is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence of the MATER protein.
By way of example only, mouse MATER C-terminal peptide (residues 1093 through 1111 of SEQ ID NO: 6) was conjugated with KLH to immunize the female rabbits (two) every two-weeks.
Starting from the third immunization, a small amount (~3 ml) of blood was collected from the immunized rabbits to examine the titer of the anti-peptide antibodies using the peptide as antigen and ELISA method. Immunizations continued until the antibodies reached maximal titers, which occurred in about ten immunizations, and then the rabbits were sacrificed to bleed in preparation for the sera. The resultant preparation was used both to characterize murine MATER
(Example 1) and human MATER (Example 4).
D. Antibodies Raised by Injection of MATER Encoding Sequence Antibodies may be raised against the MATER protein by subcutaneous injection of a recombinant DNA vector that expresses the MATER protein into laboratory animals, such as mice.
Delivery of the recombinant vector into the animals may be achieved using a hand-held form of the Biolistic system (Sanford et al., Particulate Sci. Technol. 5:27-37, 1987), as described by Tang et al.
(Nature 356:152-154, 1992). Expression vectors suitable for this purpose may include those that express the MATER encoding sequence under the transcriptional control of either the human J3-actin promoter or the cytomegalovirus (CMV) promoter.
Antibody preparations, both monoclonal and polyclonal, are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples;
they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample.
EXAMPLE 19:
DNA-Based Diagnosis The Mater sequence information presented herein can be used in the area of genetic testing for predisposition to reduced fertility or infertility, such as autoimmune infertility, owing to defects in Mater, such as deletion, duplication or mutation. The gene sequence of the Mater gene, including intron-exon boundaries (listed in Table 2), is also useful in such diagnostic methods. Individuals carrying mutations in the Mater gene (or a portion thereof), or having duplications or heterozygous or homozygous deletions of the Mater gene, may be detected at the DNA level with the use of a variety of techniques. For such a diagnostic procedure, a biological sample of the subject, which biological sample contains either DNA or RNA derived from the subject, is assayed for a mutated, duplicated or deleted Mater gene. Suitable biological samples include samples containing genomic DNA or RNA
obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material. The detection in the biological sample of either a mutant Mater gene, a mutant Mater RNA, or a duplicated or homozygously or heterozygously deleted Mater gene, may be performed by a number of methodologies, examples of which are discussed below.
One embodiment of such detection techniques for the identification of unknown mutations is the amplification (e.g., polymerase chain reaction amplification) of reverse transcribed RNA (RT-PCR) isolated from a subject, followed by direct DNA sequence determination of the products. The presence of one or more nucleotide differences between the obtained sequence and the prototypical Mater cDNA sequence, and especially, differences in the ORF portion of the nucleotide sequence, are taken as indicative of a potential Mater gene mutation.
Alternatively, DNA extracted from a biological sample may be used directly for amplification. Direct amplification from genomic DNA would be appropriate for analysis of the entire Mater gene including regulatory sequences located upstream and downstream from the open reading frame, or intronlexon borders (see Table 2). By way of example, the intro-exon boundaries themselves can serve as sequences for oligonucleotide primers (or portions thereof) for us in in vitro amplification of such samples; representative examples of such oligonucleotides are shown in SEQ
ID NOs: 25-38. Reviews of direct DNA diagnosis have been presented by Caskey (Science 236:1223-1228, 1989) and by Landegren et al. (Science 242:229-237, 1989).
Other mutation scanning techniques appropriate for detecting unknown within amplicons derived from DNA or cDNA could also be performed. These techniques include direct sequencing (without sequencing), single-strand conformational polymorphism analysis (SSCP) (for instance, see Hongyo et al., Nucleic Acids Res. 21:3637-3642, 1993), chemical cleavage (including HOT cleavage) (Bateman et al., Am. J. Med Genet. 45:233-240, 1993; reviewed in Ellis et al., Haam. Mutat. 11:345-353, 1998), denaturing gradient gel electrophoresis (DGGE), ligation amplification mismatch protection (LAMP), and enzymatic mutation scanning (Taylor and Deeble, Genet.
Anal. 14:181-186, 1999), followed by direct sequencing of amplicons with putative sequence variations.
Further studies of MATER genes isolated from female subjects displaying infertility, particularly autoimmune infertility subjects, or their relatives, may reveal particular mutations, genomic amplifications, or deletions, which occur at a high frequency within this population of individuals. In such case, rather than sequencing the entire Mater gene, DNA
diagnostic methods can be designed to specifically detect the most common, or most closely disease-linked, MATER defects.
The detection of specific DNA mutations may be achieved by methods such as hybridization using allele specific oligonucleotides (ASOs) (Wallace et al., CSHL Symp.
Quart. Biol. 51:257-261, 1986), oligonucleotides specific for intron-exon boundaries (e.g., any one of SEQ ID NOs: 25-38), direct DNA sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995, 1988), the use of restriction enzymes (Flavell et al., Cell 15:25-41, 1978; Geever et al., 1981), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, Cold Spring Harbor Symp. Quant. Biol. 51:275-284, 1986), RNase protection (Myers et al., Science 230:1242-1246, 1985), chemical cleavage (Cotton et al., Proc. Natl. Acad Sci.
USA 85:4397-4401, 1985), and the ligase-mediated detection procedure (Landegren et al., Science 241:1077-1080, 1988).
In particular embodiments, the amount of complex formed between a MATER
sequence and a MATER-specific oligonucleotide in a test sample (e.g, a clinical sample from a subject) is compared to the amount of complex formed in a control or reference sample.
Depending on the oligonucleotide selected, an increase in the formation of complex will be indicative of the presence of a biological condition associated with an abnormal MATER nucleic acid. In other circumstances, a decrease in the formation of complex will be indicative of the presence of a biological condition associated with an abnormal MATER nucleic acid. By way of example, in some embodiments, a wildtype oligonucleotide is used, and loss of complex formation is indicative of a mutation in the sample at the target regions. In other embodiments, a mutant or variant oligonucleotide (e.g., one comprising a known SNP), and an increase in complex formation is indicative of the presence of the mutation. Other combinations follow logically, including the reverse of these situations.
Oligonucleotides specific to normal or mutant sequences are chemically synthesized using commercially available machines. These oligonucleotides are then labeled radioactively with isotopes (such as 3'P) or non-radioactively, with tags such as biotin (Ward and Langer, Proc. Natl.
Acad. Sci. USA 78:6633-6657, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis. These specific sequences are visualized by methods such as autoradiography or fluorometric (Landegren et al., Science 242:229-237, 1989) or colorimetric reactions (Gebeyehu et al., Nucleic Acids Res.
15:4513-4534, 1987). Using an ASO specific for a normal allele, the absence of hybridization would indicate a mutation in the particular region of the gene, or deleted Mater gene. In contrast, if an ASO
specific for a mutant allele hybridizes to a clinical sample, this would indicate the presence of a mutation in the region defined by the ASO.
Sequence differences between normal and mutant forms of the MATER gene may also be revealed by the direct DNA sequencing method of Church and Gilbert (Proc.
Natl. Acad Sci. USA
81:1991-1995, 1988). Cloned DNA segments may be used as probes to detect specific DNA
segments. The sensitivity of this method is greatly enhanced when combined with nucleic acid amplification, e.g., PCR (Wrichnik et al., Nucleic Acids Res. 15:529-542, 1987; Wong et al., Nature 330:384-386, 1987; Stoflet et al, Science 239:491-494, 1988). In this approach, a sequencing primer that lies within the amplified sequence is used with double-stranded PCR
product or single-stranded template generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotides or by automatic sequencing procedures with fluorescent tags.
Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or may eliminate existing restriction sites. Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization (Southern, J. Mol. Biol.
98:503-517, 1975). DNA fragments carrying the restriction site (either normal or mutant) are detected by their reduction in size or increase in corresponding restriction fragment numbers.
Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme; fragments of different sizes are then visualized under UV
light in the presence of ethidium bromide after gel electrophoresis.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing reagent.
Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis. For example, a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8% non-denaturing polyacrylamide gel (WO 91/10734; Nagamine et al., Am. J.
Hum. Genet. 45:337-339, 1989). DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al., Science 230:1242-1246, 1985). Alternatively, a method of detecting a mutation comprising a single base substitution or other small change could be based on differential primer length in a PCR. For example, an invariant primer could be used in addition to a primer specific for a mutation. The PCR
products of the normal and mutant genes can then be differentially detected in acrylamide gels.
In addition to conventional gel-electrophoresis and blot-hybridization methods, DNA
fragments may also be visualized by methods where flee individual DNA samples are not immobilized on membranes. The probe and target sequences may be both in solution, or the probe sequence may be immobilized (Saiki et al., Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989). A
variety of detection methods, such as autoradiography involving radioisotopes, direct detection of radioactive decay (in the presence or absence of scintillant), spectrophotometry involving calorigenic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes.
See also the following patent documents, for instance: WO 89/10977; WO
97/27317; WO 97/29212;
WO 98/28438; WO 99/05320; WO 99/47706; WO 00/47767; WO 00/56926; WO 00/79006;
WO
01183813; US 2002/0012930; US 5,70p,637; US 6,228,575; US 6,300,063; and US
6,307,039.
If multiple mutations are encountered frequently in the MATER gene, a system capable of detecting such multiple mutations likely will be desirable. For example, a nucleic acid amplification reaction with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al., Nucl.
Acids Res. 16:1141-1155, 1988). The procedure may involve immobilized sequence-specific oligonucleotide probes (Saiki et al., Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989).
EXAMPLE 20:
Quantitation of MATER Protein An alternative method of diagnosing Mater gene deletion, amplification, or mutation is to quantitate the level of MATER protein in the cells of a subject. This diagnostic tool would be useful for detecting reduced levels of the MATER protein that result from, for example, mutations in the promoter regions of the Mater gene or mutations within the coding region of the gene that produce truncated, non-functional or unstable polypeptides, as well as from deletions of the entire Mater gene.
Alternatively, duplications of the Mater gene may be detected as an increase in the expression level of this protein. The determination of reduced or increased MATER protein levels would be an alternative or supplemental approach to the direct determination of Mater gene deletion, duplication or mutation status by the methods outlined above.
The availability of antibodies specific to the MATER protein will facilitate the quantitation of cellular MATER protein by one of a number of immunoassay methods, which are well known in the art and are presented in Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988).
For the purposes of quantitating the MATER protein, a biological sample of the subject, which sample includes cellular proteins, is required. Such a biological sample may be obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, amniocentesis samples, surgical specimens and autopsy material. In particular, female reproductive cells (e.g., ova) or embryos are appropriate samples. Quantitation of MATER protein is achieved by immunoassay and compared to levels of the protein found in healthy cells (e.g., cells from a female known not to suffer from decreased fertility). A significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) reduction in the amount of MATER protein in the cells of a subject compared to the amount of MATER protein found in normal human cells would be taken as an indication that the subject may have deletions or mutations in the Mater gene locus, whereas a significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) increase would indicate that a duplication or enhancing mutation had occurred.
EXAMPLE 21:
Detection of Serum Antibody against MATER Protein The MATER family of proteins was first identified as autoantibodies involved in the pathogenesis of certain cases of autoimmune infertility. With the provision herein of human MATER
protein sequences and encoding nucleic acids, methods for the detection and diagnosis of such fertility failure are now enabled.
Autoantibodies that recognize an epitope of the human MATER protein can be detected in samples from a subject, for instance serum or other fluid, using known immunological techniques.
The presence of such autoantibodies (e.g., circulating autoantibodies specific for a MATER epitope) indicates that the subject suffers from MATER-mediated infertility or reduced fertility, or has an increased susceptibility to suffer from one of these conditions.
Many techniques are commonly known in the art for the detection and quantification of antigen. Most commonly, the purified antigen will be bound to a substrate, the antibody of the sample will bind via its Fab portion to this antigen, the substrate will then be washed and a second, labeled antibody will then be added which will bind to the Fc portion of the antibody that is the subject of the assay. The second, labeled antibody will be species specific, i.e., if the serum is from a human, the second, labeled antibody will be anti-human-IgG antibody. The specimen will then be washed and the amount of the second, labeled antibody that has been bound will be detected and quantified by standard methods.
Examples of methods for the detection of antibodies in biological samples, including methods employing dip strips or other immobilized assay devices, are disclosed for instance in the following patents: U.S. Patents No. 5,965,356 (Herpes simplex virus type specific seroassay);
6,114,179 (Method and test kit for detection of antigens and/or antibodies);
6,077,681 (Diagnosis of motor neuropathy by detection of antibodies); 6,057,097 (Marker for pathologies comprising an auto-immune reaction and/or for inflammatory diseases); and 5,552,285 (Immunoassay methods, compositions and kits for antibodies to oxidized DNA bases).
EXAMPLE 22:
Suppression of MATER Expression A reduction of MATER protein expression in a transgenic cell may be obtained by introducing into cells an antisense construct based on the Mater' encoding sequence, including the human Mater cDNA or fragments thereof (for instance, the cDNA fragments shown in SEQ ID
NO: 1 and 3) or gene sequence or flanking regions thereof. For antisense suppression, a nucleotide sequence from an MATER encoding sequence, e.g. all or a portion of the Mater cDNA or gene, is arranged in reverse orientation relative to the promoter sequence in the transformation vector.
Other aspects of the vector may be chosen as discussed above (Example 8).
The introduced sequence need not be the full length human Mater cDNA (SEQ ID
NO: 23) or gene, and need not be exactly homologous to the equivalent sequence found in the cell type to be transformed. Thus, portions or fragments of the murine cDNA (SEQ ID NO: 5) could also be used to knock out expression of the human Mater gene. Generally, however, where the introduced sequence is of shorter length, a higher degree of homology to the native Mater sequence will be needed for effective antisense suppression. The introduced antisense sequence in the vector may be at least 30 nucleotides in length, and improved antisense suppression typically will be observed as the length of the antisense sequence increases. The length of the antisense sequence in the vector advantageously may be greater than 100 nucleotides, and can be up to about the full length of the human Mater cDNA
or gene. For suppression of the Mater gene itself, transcription of an antisense construct results in the production of RNA molecules that are the reverse complement of mRNA molecules transcribed from the endogenous Mater gene in the cell.
Although the exact mechanism by which antisense RNA molecules interfere with gene expression has not been elucidated, it is believed that antisense RNA
molecules bind to the endogenous mRNA molecules and thereby inhibit translation of the endogenous mRNA.
Small inhibitory RNAs (siRNAs) can also be used.
Suppression of endogenous MATER expression can also be achieved using ribozymes.
Ribozymes are synthetic RNA molecules that possess highly specific endoribonuclease activity. The production and use of ribozymes are disclosed in U.S. Patent No. 4,987,071 to Cech and U.S. Patent No. 5,543,508 to Haselhoff. The inclusion of ribozyme sequences within antisense RNAs may be used to confer RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that bind to the antisense RNA are cleaved, which in turn leads to an enhanced antisense inhibition of endogenous gene expression.
Finally, dominant negative mutant forms of MATER may be used to block endogenous MATER activity.
EXAMPLE 23:
MATER Knockout and Overexpression Transgenic Animals Mutant organisms that under-express or over-express MATER protein are useful for research. Such mutants allow insight into the physiological and/or pathological role of MATER in a healthy and/or pathological organism. These mutants are "genetically engineered," meaning that information in the form of nucleotides has been transferred into the mutant's genome at a location, or in a combination, in which it would not normally exist. Nucleotides transferred in this way are said to be "non-native." For example, a non-Mater promoter inserted upstream of a native Mater gene would be non-native. An extra copy of a Mater gene or other encoding sequence on a plasmid, transformed into a cell, would be non-native, whether that extra copy was Mater derived from the same or a different species.
Mutants may be, for example, produced from mammals, such as mice, that either over-express or under-express MATER protein, or that do not express MATER at all.
Over-expression mutants are made by increasing the number of MATER-encoding sequences (such as genes) in the organism, or by introducing an MATER-encoding sequence into the organism under the control of a constitutive or inducible or viral promoter such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter or the metallothionein promoter. Mutants that under-express MATER may be made by using an inducible or repressible promoter, or by deleting the Mater gene, or by destroying or limiting the function of the Mater gene, for instance by disrupting the gene by transposon insertion.
Antisense genes may be engineered into the organism, under a constitutive or inducible promoter, to decrease or prevent MATER expression, as discussed above in Example 13.
A gene is "functionally deleted" when genetic engineering has been used to negate or reduce gene expression to negligible levels. When a mutant is referred to in this application as having the Mater gene altered or functionally deleted, this refers to the Mater gene and to any ortholog of this gene. When a mutant is referred to as having "more than the normal copy number" of a gene, this means that it has more than the usual number of genes found in the wild-Type organism, e.g., in the diploid mouse or human.
A mutant mouse over-expressing MATER may be made by constructing a plasmid having the Mater gene driven by a promoter, such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter. This plasmid may be introduced into mouse oocytes by microinjection. The oocytes are implanted into pseudopregnant females, and the litters are assayed for insertion of the transgene. Multiple strains containing the transgene are then available for study.
WAP is quite specific for mammary gland expression during lactation, and MMTV
is expressed in a variety of tissues including mammary gland, salivary gland and lymphoid tissues.
Many other promoters might be used to achieve various patterns of expression, e.g., the metallothionein promoter.
An inducible system may be created in which the subject expression construct is driven by a promoter regulated by an agent that can be fed to the mouse, such as tetracycline. Such techniques are well known in the art.
A mutant knockout animal (e.g., mouse) from which the Mater gene is deleted or otherwise disabled can be made by removing coding regions of the Mater gene from embryonic stem cells. The 1 S methods of creating deletion mutations by using a targeting vector have been described (see, for instance, Thomas and Capecch, Cell S1:S03-512, 1987). One specific example ofthe production of a Mater null mouse is described above, in Example 1.
EXAMPLE 24:
Gene Therapy Gene therapy approaches for combating MATER-mediated fertility defects in subjects, or for causing MATER-mediated infertility in subjects, are now made possible.
Retroviruses have been considered the preferred vector for experiments in gene therapy, with a high efficiency of infection and stable integration and expression (Orkin et al., Prog. Med. Genet.
2S 7:130-142, 1988). The full-length MATER gene or cDNA can be cloned into a retroviral vector and driven from either its endogenous promoter or, for instance, from the retroviral LTR (long terminal repeat). Other viral transfection systems may also be utilized for this type of approach, including adenovirus, adeno-associated virus (AAV) (McLaughlin et al., J. Virol. 62:1963-1973, 1988), Vaccinia virus (Moss et al., Anrru. Rev. Irnmunol. 5:305-324, 1987), Bovine Papilloma virus (Rasmussen et al, Methods En~mol. 139:642-654, 1987) or members of the herpesvirus group such as Epstein-Barr virus (Margolskee et al., Mol. Cell. Biol. 8:2837-2847, 1988).
Recent developments in gene therapy techniques include the use of RNA-DNA
hybrid oligonucleotides, as described by Cole-Strauss, et al. (Science 273:1386-1389, 1996). This technique may allow for site-specific integration of cloned sequences, thereby permitting accurately targeted gene replacement.
In addition to delivery of MATER to cells using viral vectors, it is possible to use non-infectious methods of delivery. For instance, lipidic and liposome-mediated gene delivery has recently been used successfully for transfection with various genes (for reviews, see Templeton and Lasic, Mol. Biotechnol. 11:175-180, 1999; Lee and Huang, Crit. Rev. Ther. Drug Carrier Syst.
14:173-206; and Cooper, Sernin. Oncol. 23:172-187, 1996). For instance, cationic liposomes have been analyzed for their ability to transfect monocytic leukemia cells, and shown to be a viable alternative to using viral vectors (de Lima et al., Mol. Mentbr. Biol. 16:103-109, 1999). Such cationic liposomes can also be targeted to specific cells through the inclusion of, for instance, monoclonal antibodies or other appropriate targeting ligands (Kao et al., Cancer Gene Ther. 3:250-256, 1996).
EXAMPLE 25:
Identification of Therapeutic Compounds The human MATER molecules disclosed herein can be used to identify (screen for) compounds that are useful in influencing MATER-mediated fertility in a mammal, either by blocking (inhibiting) the activity of MATER (and thereby reducing fertility) or enhancing MATER activity (and thereby increasing fertility).
Such screening methods can include determining if a test compound binds directly to or otherwise interacts with a MATER protein, or a variant or fragment of a MATER
protein. Proteins that do bind to such a molecule are select for further characterization.
In specific embodiments, the compound being tested for activity is applied to a cell for instance a test cell (e.g., a developing oocyte or embryo of a mammal). The activity of the MATER
protein in that test cell is then measured, for instance by determining whether the oocyte or embryo progresses beyond the two-cell stage. If application of the test compound alters proportion of embryos that progress beyond two cells, then that compound is selected as a likely candidate for further characterization. In particular examples, a test agent that opposes or inhibits a MATER
activity is selected for further study, for example by exposing the agent to a mammalian female reproductive system in vivo, to determine if in vivo fertility is inhibited.
Such identified compounds may be useful as contraceptive agents.
Specific examples of compounds likely to be effective at inhibiting MATER
activity, and therefore effective as contraceptives, include antibodies specifically directed to epitopes of the MATER protein. The general concept of immunocontraceptives has been described (see, e.g., U.S.
Patents No. 5,637,300 and 6,027,727, describing contraceptive antibodies directed to proteins of the aona pellucida, and incorporated herein by reference).
Alternatively, compounds that increase the proportion of embryos that progress beyond two cells (for instance, in an animal system known to be defective for fertility) are selected for further study as possible fertility enhancing agents. Similar screens can be used to identify compounds that mimic the activity of MATER protein, for instance in a MATER null animal.
In addition, it is suggested that MATER protein perform its function within the cytoplasm through interacting with other unknown protein. Physical blockage of such interaction is expected to arrest the MATER function. Candidates for such interactions are being identified based on interactions in a yeast two-hybrid system (Fields and Songs, Nature 340:245, 1989). Once molecular domains for the protein interaction are known, molecules can be designed directly based to specifically inhibit or otherwise interfere with MATER protein interactions with these other proteins.
Compounds selected using these methods are comprehended by this disclosure.
EXAMPLE 26:
Kits Kits are provided which contain the necessary reagents for determining MATER
gene copy number, such as probes or primers specific for the MATER gene, as well as written instructions. Kits are also provided to determine abnormal expression of MATER mRNA (i.e., containing probes) or MATER protein (i.e., containing a MATER-specific binding agent). Instructions provided in the diagnostic kits can include calibration curves or charts to compare with the determined (e.g., experimentally measured) values.
A. Kits for Detection of MATER Genomic Sequences The nucleotide sequences disclosed herein, and fragments thereof, can be supplied in the form of a kit for use in detection of MATER genomic sequences and/or diagnosis of infertility or reduced fertility. In such a kit, an appropriate amount of one or more of the MATER-specific oligonucleotide primers is provided in one or more containers. The oligonucleotide primers) (for instance, particular oligonucleotides disclosed herein) may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance. The containers) in which the oligonucleotide(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles. In some applications, pairs of primers may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers. With such an arrangement, the sample to be tested for the presence of MATER genomic amplification, or deletion, can be added to the individual tubes and in vitro amplification carried out directly.
The amount of each oligonucleotide primer supplied in the kit can be any appropriate amount, depending for instance on the market to which the product is directed.
For instance, if the kit is adapted for research or clinical use, the amount of each oligonucleotide primer provided would likely be an amount sufficient to prime several in vitro amplification reactions. Those of ordinary skill in the art know the amount of oligonucleotide primer that is appropriate for use in a single amplification reaction. General guidelines may for instance be found in Innis et al. (PCR Protocols, A Guide to Methods afZd Applications, Academic Press, Inc., San Diego, CA, 1990), Sambrook et al.
(In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989), and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).
A kit may include more than two primers, in order to facilitate the PCR in vitro amplification of MATER sequences, for instance the MATER gene, specific exon(s) or other portions of the gene (e.g., a portion bridging an intron-exon boundary), or the 5' or 3' flanking region thereof.
In some embodiments, kits may also include the reagents necessary to carry out in vitro amplification reactions, such as PCR amplification, including, for instance, DNA sample preparation reagents, appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Written instructions may also be included.
Kits may in addition include either labeled or unlabeled oligonucleotide probes for use in detection of the in vitro amplified MATER sequences. The appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the in vitro amplification reaction.
It may also be advantageous to provided in the kit one or more control sequences for use in the amplification reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
B. Kits for Detection of Mater mRNA Expression Kits similar to those disclosed above for the detection of MATER genomic sequences can be used to detect MATER mRNA expression levels. Such kits may include an appropriate amount of one or more of the oligonucleotide primers for use in reverse transcription amplification reactions, similarly to those provided above, with art-obvious modifications for use with RNA.
In some embodiments, kits for detection of MATER mRNA expression levels may also include the reagents necessary to carry out RT-PCR in vitro amplification reactions, including, for instance, RNA sample preparation reagents (including e.g., an RNAse inhibitor), appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs).
Written instructions may also be included.
Kits in addition may include either labeled or unlabeled oligonucleotide probes for use in detection of the in vitro amplified target sequences. The appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the PCR reaction, or another in vitro amplification reaction.
It also may be advantageous to provided in the kit one or more control sequences for use in the RT-PCR reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
Alternatively, kits may be provided with the necessary reagents to carry out quantitative or semi-quantitative Northern analysis of MATER mRNA. Such kits include, for instance, at least one MATER-specific oligonucleotide for use as a probe. This oligonucleotide may be labeled in any conventional way, including with a selected radioactive isotope, enzyme substrate, co-factor, ligand, chemiluminescent or fluorescent agent, hapten, or enzyme.
C. Kits For Detection of MATER Protein or Peptide Expression Kits for the detection of MATER protein expression, for instance MATER at least one target (e.g., MATER) protein specific binding agent (e.g., a polyclonal or monoclonal antibody or antibody fragment) and may include at least one control. The MATER protein specific binding agent and control may be contained in separate containers. The kits may also include means for detecting MATER:agent complexes, for instance the agent may be detestably labeled. If the detectable agent is not labeled, it may be detected by second antibodies or protein A for example which may also be provided in some kits in one or more separate containers. Such techniques are well known.
Additional components in some kits include instructions for carrying out the assay.
Instructions will allow the tester to determine whether MATER expression levels are altered, for instance in comparison to a control sample. Reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits.
By way of example only, an effective and convenient immunoassay kit such as an enzyme-linked immunosorbent assay can be constructed to test anti-MATER antibody in human serum, as reported for detection of non-specific anti-ovarian antibodies (VJheatcroft et al, Clin. Exp. Immurrol.
96:122-128, 1994; Wheatcroft et al, Hum. Reprod. 12:2617-2622, 1997).
Expression vectors can be constructed using the human MATER cDNA to produce the recombinant human MATER
protein in either bacteria or baculovirus (as described in Example 8). By affinity purification, unlimited amounts of pure recombinant MATER protein can be produced.
An assay kit could provide the recombinant protein as an antigen and enzyme-conjugated goat anti-human IgG as a second antibody as well as the enzymatic substrates.
Such kits can be used to test if the patient sera contain antibodies against human MATER.
This disclosure provides MATER nucleic acids and proteins, including the human Mater molecules described above. The disclosure further provides methods employing these molecules, including methods to predict and/or diagnose infertility, reduced fertility, or reproductive failure in females, as well as treatments for such infertility and reduced fertility, and contraceptives. It will be apparent that the precise details of the molecules and methods described may be varied or under- or overexpression, are also contemplated. Such kits will include modified without departing from the spirit of the described invention. The inventors claim all such modifications and variations that fall within the scope and spirit of the claims below.
SEQUENCE LISTING
<110> The Government of the United States of America as represented by the Secretary of the Department of Health and Human Services Nelson, Lawrence Tong, Zhi-Bin <120> Human Gene Critical to Fertility <130> 4239-62463 <150> 60/241,510 <151> 2000-10-18 <150> PCT/USOl/10981 <15l> 2001-04-04 <160> 42 <170> PatentIn version 3.1 <210> 1 <211> 1157 <212> DNA
<213> Homo Sapiens <400>
caagctccggtgacggagatcatgtcccgaccagaaaggctgttgttcatc~attgacggt60 ttcgatgacctgggctctgtcctcaacaatgacacaaagctctgcaaagactgggctgag 120 aagcagcctccgttcaccctcatacgcagtctgctgaggaaggtcctgctccctgagtcc 180 ttcctgatcgtcaccgtcagagacgtgggcacagagaagctcaagtcagaggtcgtgtct 240 ccccgttacctgttagttagaggaatctccggggaacaaagaatccacttgctccttgag 300 cgcgggattggtgagcatcagaagacacaagggttgcgtgcgatcatgaacaaccgtgag 360 ctgctcgaccagtgccaggtgcccgccgtgggctctctcatctgcgtggccctgcagctg 420 caggacgtggtgggggagagcgtcgcccccttcaaccaaacgctcacaggcctgcacgcc 480 gcttttgtgtttcatcagctcacccctcgaggcgtggtccggcgctgtctcaatctggag 540 gaaagagttgtcctgaagcgcttctgccgtatggctgtggagggagtgtggaataggaag 600 tcagtgtttgacggtgacgacctcatggttcaaggactcggggagtctgagctccgtgct 660 ctgtttcacatgaacatccttctcccagacagccactgtgaggagtactacaccttcttc 720 cacctcagtctccaggacttctgtgccgccttgtactacgtgttagagggcctggaaatc 780 gagccagctc tctgccctct gtacgttgag aagacaaaga ggtccatgga gcttaaacag 840 gcaggcttcc atatccactc gctttggatg aagcgtttct tgtttggcct cgtgagcgaa 900 gacgtaagga ggccactgga ggtcctgctg ggctgtcccg ttcccctggg ggtgaagcag 960 aagcttctgc actgggtctc tctgttgggt cagcagccta atgccaccac cccaggagac 1020 accctggacg ccttccactg tcttttcgag actcaagaca aagagtttgt tcgcttggca 1080 ttaaacagct tccaagaagt gtggcttccg attaaccaga acctggactt gatagcatct 1140 tccttctgcc tccagct 1157 <210> 2 <21l> 385 <212> PRT
<213> Homo Sapiens <400> 2 Gln Ala Pro Val Thr Glu Ile Met Ser Arg Pro Glu Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Asp Leu Gly Ser Val Leu Asn Asn Asp Thr Lys Leu Cys Lys Asp Thr Ala Glu Lys Gln Pro Pro Phe Thr Leu Ile Arg Ser Leu Leu Arg Lys Val Leu Leu Pro Glu Ser Phe Leu Ile Val Thr Val Arg Asp Val Gly Thr Glu Lys Leu Lys Ser G1u Val Val Ser Pro Arg Tyr Leu Leu Val Arg Gly Ile Ser Gly Glu Gln Arg Ile His Leu Leu Leu Glu Arg Gly Ile Gly Glu His Gln Lys Thr Gln Gly Leu Arg Ala Ile Met Asn Asn Arg Glu Leu Leu Asp Gln Cys Gln Va1 Pro 115 120 l25 Ala Val Gly Ser Leu Ile Cys Va1 Ala Leu Gln Leu Gln Asp Val Va1 Gly Glu Ser Va1 Ala Pro Phe Asn Gln Thr Leu Thr Gly Leu His A1a Ala Phe Val Phe His Gln Leu Thr Pro Arg Gly Val Val Arg Arg Cys Leu Asn Leu Glu Glu Arg Val Val Leu Lys Arg Phe Cys Arg Met Ala Va1 Glu Gly Val Thr Asn Arg Lys Ser Val Phe Asp Gly Asp Asp Leu l95 200 205 Met Val Gln Gly Leu Gly Glu Ser Glu Leu Arg Ala Leu Phe His Met Asn Ile Leu Leu Pro Asp Ser His Cys Glu Glu Tyr Tyr Thr Phe Phe His Leu Ser Leu Gln Asp Phe Cys Ala Ala Leu Tyr Tyr Val Leu Glu Gly Leu Glu Ile Glu Pro Ala Leu Cys Pro Leu Tyr Val Glu Lys Thr Lys Arg Ser Met Glu Leu Lys Gln Ala G1y Phe His Ile His Ser Leu Thr Met Lys Arg Phe Leu Phe Gly Leu Val Ser Glu Asp Val Arg Arg Pro Leu Glu Val Leu Leu Gly Cys Pro Val Pro Leu Gly Val Lys Gln Lys Leu Leu His Thr Val Ser Leu Leu Gly Gln Gln Pro Asn Ala Thr Thr Pro Gly Asp Thr Leu Asp Ala Phe His Cys Leu Phe Glu Thr Gln Asp Lys Glu Phe Val Arg Leu Ala Leu Asn Ser Phe Gln Glu Val Thr Leu Pro Ile Asn Gln Asn Leu Asp Leu Ile Ala Ser Ser Phe Cys Leu Gln <210> 3 <211> 1075 <212> DNA
<213> Homo sapiens <400> 3 tctggcctca gccctcgtca gcaaccggag cttgacacac ctgtgcctat ccaacaacag 60 cctggggaacgaaggtgtaaatctactgtgtcgatccatgaggcttccccactgtagtct120 gcagaggctgatgctgaatcagtgccacctggacacggctggctgtggttctcttgcact180 tgcgcttatgggtaactcatggctgacgcacctgagccttagcatgaaccctgtggaaga240 caatggcgtgaagcttctgtgcgaggtcatgagagaaccatcttgtcatctccaggacct300 ggagttggtaaaatgtcatctcaccgccgcgtgctgtgagagtctgtcctgtgtgatctc360 gaggagcagacacctgaagagcctggatctcacggacaatgccctgggtgacggtggggt420 tgctgcgctgtgcgagggactgaagcaaaagaacagtgttctgacgagactcgggttgaa480 ggcatgtggactgacttctgattgctgtgaggcactctccttggccctttcctgcaaccg540 gcatctgaccagtctaaacctggtgcagaataacttcagtcccaaaggaatgatgaagct600 gtgttcggcctttgcctgtcccacgtctaacttacagataattgggctgtggaaatggca660 gtaccctgtgcaaataaggaagctgctggaggaagtgcagctactcaagccccgagtcgt720 aattgacggtagttggcattcttttgatgaagatgaccggtactggtggaaaaactgaag780 atacggaaacctgccccactcacacccatctgatggaggaactttaaacgctgttttctc840 agagcaagctatgcacctgggagttccttctcaaagatggagaatgatttctgattctca900 caaagccctcaatggtagtgattcttctgtgttcactctacgttggttactggatttgaa960 ggctagagaccttcaagtcataggactcagtatctgtgaaatgtccgtcatatctcagag1020 catatagagg gaattaaata aacacaaagc atttggaaaa aaaaaaaaaa aaaaa 1075 <210> 4 <211> 258 <212> PRT
<213> Homo Sapiens <400> 4 Leu Ala Ser Ala Leu Val Ser Asn Arg Ser Leu Thr His Leu Cys Leu Ser Asn Asn Ser Leu Gly Asn Glu G1y Val Asn Leu Leu Cys Arg Ser Met Arg Leu Pro His Cys Ser Leu Gln Arg Leu Met Leu Asn Gln Cys His Leu Asp Thr Ala Gly Cys Gly Ser Leu Ala Leu A1a Leu Met Gly Asn Ser Thr Leu Thr His Leu Ser Leu Ser Met Asn Pro Val Glu Asp Asn Gly Val Lys Leu Leu Cys Glu Val Met Arg Glu Pro Ser Cys His Leu Gln Asp Leu Glu Leu Val Lys Cys His Leu Thr Ala Ala Cys Cys l00 105 110 Glu Ser Leu Ser Cys Val Ile Ser Arg Ser Arg His Leu Lys Ser Leu Asp Leu Thr Asp Asn Ala Leu Gly Asp Gly Gly Val Ala Ala Leu Cys Glu G1y Leu Lys Gln Lys Asn Ser Val Leu Thr Arg Leu Gly Leu Lys Ala Cys Gly Leu Thr Ser Asp Cys Cys Glu Ala Leu Ser Leu Ala Leu Ser Cys Asn Arg His Leu Thr Ser Leu Asn Leu Val Gln Asn Asn Phe Ser Pro Lys Gly Met Met Lys Leu Cys Ser Ala Phe Ala Cys Pro Thr Ser Asn Leu Gln Ile Ile Gly Leu Thr Lys Thr Gln Tyr Pro Val Gln Ile Arg Lys Leu Leu Glu Glu Val Gln Leu Leu Lys Pro Arg Val Val Ile Asp Gly Ser Thr His Ser Phe Asp Glu Asp Asp Arg Tyr Thr Thr Lys Asn <210> 5 <211> 3447 <212> DNA
<213> Mus musculus <400> 5 aaagcacaat gggtcctcca gaaaaagaaa gtaaagcaat cttgaaagca cgtggattgg 60 aagaggaaca gaagtcagaa agaaaaatga cttctccaga aaacgacagt aaatcaatcc 120 agaaagacca aggaccagag caggagcaga catcagaaag cacaatgggt cctccagaaa l80 aagacagtaaagcaatcttgaaagcacgtggattggaagaggaacagaagtcagaaagca 240 caatgtctccttcagaaaatgtcagtagagcaatcctgaaagacagtggatcagaagaag 300 tggaacaggcgtcagaaagaaaaatgacttctccagaaaacgacagtaaatcaatccaga 360 aagaccaaggaccagagcaggagcagacatcagaaaccttacaatctaaggaagaagatg 420 aagtgacagaggcagataaagataatggaggtgacttacaagactacaaggcccatgtga 480 ttgctaagttcgacacaagtgtggatctacactatgacagcccagagatgaaattattgt 540 ctgatgcttttaaaccataccagaaaaccttccagcctcacaccattatcctacatggaa 600 gaccaggagttgggaagtcagctttggccagaagtattgttcttggctgggcacagggta 660 aactcttccaaaaaatgtcctttgtcatcttcttctctgttagagaaataaagtggacag 720 agaagagcagtttggcacagctgattgctaaggagtgtccagactcctgggatctagtga 780 caaagatcatgtcccaaccagaaagactcttgtttgtcatagatggcttggatgatatgg 840 actctgtcctccaacatgatgatatgacactatccagagactggaaggatgaacagccca 900 tatacatcctgatgtacagcctcctgaggaaggctctcttacctcagtcctttctcatca 960 ttaccaccagaaacacaggcttagaaaaactcaagtcaatggttgtgtcccccctctata1020 tactggttgaaggactgtctgcatcaaggagatctcagctggtcctcgagaacatctcca1080 atgagtctgatagaatacaagtcttccattctctgatagaaaatcaccagctgtttgacc1140 aatgccaggccccctctgtgtgctccctggtctgtgaggctctacagctacagaagaaac1200 tgggaaagagatgcaccctaccctgccagactctcaccggtttgtatgccacgttggtgt1260 ttcaccagctcaccttgaaaaggccttcccagagcgctctcagtcaggaagaacagatta1320 ctctagtgggtttgtgcatgatggcagctgaaggagtgtggaccatgaggtcggtgttct1380 atgatgatgacctgaagaactatagcctaaaggagtctgagatcttggccctctttcaca1440 tgaacatccttctccaggttggccacaacagtgagcagtgttatgttttctcccacctca1500 gcctgcaggatttctttgctgccttatattatgttttagaagggctggaggaatggaatc1560 agcatttttgcttcattgaaaaccaaaggagcatcatggaggtgaagagaactgacgaca1620 ctcgcctcctcgggatgaagcgtttcttatttggcctcatgaacaaggatatcttgaaga1680 ctctggaggttctgtttgaatatcccgtgattccaactgttgagcagaagctccaacact1740 gggtctctctgatagctcagcaggtcaatggcaccagcccaatggacaccctggatgcct1800 tctattgtctatttgagtctcaggatgaagagtttgttggcggggctctcaaacgcttcc1860 aagaagtgtggctgctgattaaccagaagatggacttgaaggtctcttcctactgtctca1920 agcactgtcagaacttgaaggcaatccgggtggatatcagagacctcctctcggtagata1980 atactctcgagctgtgccctgttgttactgtccaggagacacaatgtaagcccctcctca2040 tggagtggtggggaaacttctgctctgtgcttggcagcctccggaacttgaaggagctgg2100 acttgggcgacagcatcctgagtcaacgggccatgaagatactgtgcctcgagctgcgga2160 atcagtcctgcagaatacagaagctgacgtttaagagtgcagaggtagtgtctggcctga2220 aacatctctggaagctcctttttagcaatcaaaacttaaagtacctcaatctagggaaca2280 ctcccatgaaggatgatgacatgaagttagcctgcgaagcgctgaaacatccaaagtgct2340 ccgtggagactctgaggttggattcctgtgagttaaccatcattggttatgagatgatct2400 ccacgcttcttatttcaaccaccaggctaaagtgtctcagcctggccaaaaatagagtgg2460 gagtaaaaagcatgatatcccttgggaatgccttgagtagctcaatgtgtctactgcaaa2520 agttgatactggacaactgtggcctcacacctgccagctgccaccttctggtctcagccc2580 ttttcagcaaccagaacttgacacacctgtgcctgtcaaacaacagcctggggactgaag2640 gagtgcaacagctgtgtcagttcctgaggaatccagaatgtgctctccagcggctgatac2700 tgaatcactgcaacattgtagatgatgcttatggcttcctggcaatgagacttgcaaaca2760 acacaaagctgacccacctgagcctgaccatgaaccccgtaggggatggtgcaatgaagc2820 tactgtgtgaagctttaaaggaacctacttgttaccttcaagaactggaactagtggact2880 gccaactcacacagaactgctgcgaggacctggcctgtatgatcacaacaaccaagcact29.40 taaaaagtttggatcttggtaacaacgccctgggtgacaaaggagtcataaccctgtgtg3000 agggactgaagcaaagtagcagctccctgaggagacttgggttgggggcatgtaagttga3060 cttccaattgctgtgaggcattgtcattggccatctcttgcaaccctcacctgaacagcc3120 taaacctggtgaagaatgacttcagtacatcggggatgttgaagctgtgctctgcgttcc3180 aatgccctgtctctaacctggggataattggcctgtggaagcaggagtactatgcccgag3240 tgagaagacagctggaggaagttgagtttgtcaagccccacgtggtgattgatggtgatt3300 ggtatgctagtgatgaagatgaccgaaactggtggaaaaactgaagacatgagccccctc3360 tccttcacgtcctagcactgcagtatctgtgaaatgtttgtctcaccttggaggatgtag3420 caagaatgaaataaacacagcatttag 3447 <210> 6 <211> 1111 <212> PRT
<213> Mus musculus <400> 6 Met Gly Pro Pro Glu Lys Glu Ser Lys Ala Ile Leu Lys Ala Arg G1y Leu Glu Glu Glu Gln Lys Ser Glu Arg Lys Met Thr Ser Pro Glu Asn Asp Ser Lys Ser Ile Gln Lys Asp Gln Gly Pro Glu Gln Glu Gln Thr Ser Glu Ser Thr Met Gly Pro Pro Glu Lys Asp Ser Lys Ala Ile Leu Lys Ala Arg Gly Leu Glu Glu Glu Gln Lys Ser Glu Ser Thr Met Ser Pro Ser Glu Asn Val Ser Arg Ala Ile Leu Lys Asp Ser Gly Ser Glu Glu Val Glu Gln Ala Ser Glu Arg Lys Met Thr Ser Pro Glu Asn Asp Ser Lys Ser Ile Gln Lys Asp Gln Gly Pro Glu Gln Glu Gln Thr Sex 115 120 l25 Glu Thr Leu Gln Ser Lys Glu Glu Asp Glu Val Thr Glu A1a Asp Lys Asp Asn Gly Gly Asp Leu Gln Asp Tyr Lys Ala His Val Ile Ala Lys Phe Asp Thr Ser Val Asp Leu His Tyr Asp Ser Pro Glu Met Lys Leu l65 170 175 Leu Ser Asp Ala Phe Lys Pro Tyr Gln Lys Thr Phe Gln Pro His Thr Ile Ile Leu His Gly Arg Pro Gly Val Gly Lys Ser A1a Leu A1a Arg Ser Ile Val Leu Gly Thr Ala Gln Gly Lys Leu Phe Gln Lys Met Ser Phe Val Ile Phe Phe Ser Val Arg Glu Ile Lys Thr Thr Glu Lys Ser Ser Leu Ala G1n Leu Ile Ala Lys Glu Cys Pro Asp Ser Thr Asp Leu Val Thr Lys Ile Met Ser Gln Pro Glu Arg Leu Leu Phe Val Ile Asp Gly Leu Asp Asp Met Asp Ser Val Leu Gln His Asp Asp Met Thr Leu Ser Arg Asp Thr Lys Asp Glu Gln Pro Ile Tyr Ile Leu Met Tyr Ser Leu Leu Arg Lys Ala Leu Leu Pro Gln Ser Phe Leu Ile Ile Thr Thr Arg Asn Thr Gly Leu Glu Lys Leu Lys Ser Met Val Val Ser Pro Leu Tyr Ile Leu Val Glu Gly Leu Ser Ala Ser Arg Arg Ser Gln Leu Val Leu Glu Asn Ile Ser Asn G1u Ser Asp Arg Ile G1n Val Phe His Ser Leu Ile G1u Asn His Gln Leu Phe Asp Gln Cys Gln Ala Pro Ser Val Cys Ser Leu Val Cys Glu Ala Leu Gln Leu Gln Lys Lys Leu Gly Lys Arg Cys Thr Leu Pro Cys Gln Thr Leu Thr Gly Leu Tyr Ala Thr Leu Val Phe His G1n Leu Thr Leu Lys Arg Pro Ser Gln Ser Ala Leu Ser Gln Glu Glu Gln Ile Thr Leu Val Gly Leu Cys Met Met Ala A1a Glu Gly Val Thr Thr Met Arg Ser Val Phe Tyr Asp Asp Asp Leu Lys Asn Tyr Ser Leu Lys G1u Ser Glu Tle Leu Ala Leu Phe His Met Asn Ile Leu Leu Gln Val Gly His Asn Ser Glu Gln Cys Tyr Val Phe Ser His Leu Ser Leu Gln Asp Phe Phe Ala Ala Leu Tyr Tyr Val Leu Glu Gly Leu Glu Glu Thr Asn Gln His Phe Cys Phe Ile Glu Asn Gln Arg Ser Ile Met Glu Val Lys Arg Thr Asp Asp Thr Arg Leu Leu Gly Met Lys Arg Phe Leu Phe Gly Leu Met Asn Lys Asp Ile Leu Lys Thr Leu Glu Val Leu Phe Glu Tyr Pro Val Ile Pro Thr Val Glu Gln Lys Leu Gln His Thr Val Ser Leu Ile Ala Gln Gln Va1 Asn Gly Thr Ser Pro Met Asp Thr Leu Asp Ala Phe Tyr Cys Leu Phe Glu Ser Gln Asp Glu Glu Phe Val Gly Gly Ala Leu Lys Arg Phe Gln Glu Val Thr Leu Leu Ile Asn Gln Lys Met Asp Leu Lys Val Ser Ser Tyr Cys Leu Lys His Cys Gln Asn Leu Lys Ala Ile Arg Val Asp Ile Arg Asp Leu Leu Ser Val Asp Asn Thr Leu Glu Leu Cys Pro Val Val Thr Val Gln Glu Thr G1n Cys Lys Pro Leu Leu Met Glu Thr Thr Gly Asn Phe Cys Ser Val Leu Gly Ser Leu Arg Asn Leu Lys Glu Leu Asp Leu Gly Asp Ser Ile Leu Ser Gln Arg Ala Met Lys Ile Leu Cys Leu Glu Leu Arg Asn Gln Ser Cys Arg Tle Gln Lys Leu Thr Phe Lys Ser Ala Glu Val Val Ser Gly Leu Lys His Leu Thr Lys Leu Leu Phe Ser Asn Gln Asn Leu Lys Tyr Leu Asn Leu Gly Asn Thr Pro Met Lys Asp Asp Asp Met Lys Leu Ala Cys Glu Ala Leu Lys His Pro Lys Cys Ser Val Glu Thr Leu Arg Leu Asp Ser Cys Glu Leu Thr Ile Ile Gly Tyr Glu Met Ile Ser Thr Leu Leu Ile Ser Thr Thr Arg Leu Lys Cys Leu Ser Leu Ala Lys Asn Arg Val Gly Val Lys Ser Met Ile Ser Leu Gly Asn Ala Leu Ser Ser Ser Met Cys Leu Leu Gln Lys Leu Ile Leu Asp Asn Cys Gly Leu Thr Pro Ala Ser Cys His Leu Leu Val Ser Ala Leu Phe Ser Asn Gln Asn Leu Thr His Leu Cys Leu 5er Asn Asn Ser Leu Gly Thr Glu Gly Val Gln Gln Leu Cys Gln Phe Leu Arg Asn Pro Glu Cys Ala Leu Gln Arg Leu Ile Leu Asn His Cys Asn Ile Val Asp Asp Ala Tyr Gly Phe Leu Ala Met Arg Leu A1a Asn Asn Thr Lys Leu Thr His Leu Ser Leu Thr Met Asn Pro Val Gly Asp Gly Ala Met Lys Leu Leu Cys Glu Ala Leu Lys Glu Pro Thr Cys Tyr Leu Gln Glu Leu Glu Leu Val Asp Cys Gln Leu Thr Gln Asn Cys Cys Glu Asp Leu Ala Cys Met Ile Thr Thr Thr Lys His Leu Lys Ser Leu Asp Leu Gly Asn Asn Ala Leu Gly Asp Lys Gly Val Ile Thr Leu Cys Glu Gly Leu Lys Gln Ser Ser Ser Ser Leu Arg Arg Leu Gly Leu Gly Ala Cys Lys Leu Thr Ser Asn Cys Cys Glu Ala Leu Ser Leu A1a Ile Ser Cys Asn Pro His Leu Asn Ser Leu Asn Leu Val Lys Asn Asp Phe Ser Thr Ser Gly Met Leu Lys Leu Cys Ser Ala Phe Gln Cys Pro Val Ser Asn Leu Gly Ile Tle Gly Leu Thr Lys Gln Glu Tyr Tyr Ala Arg Val Arg Arg Gln Leu Glu Glu Val Glu Phe Val Lys Pro His Val Val Ile Asp Gly Asp Thr Tyr Ala Ser Asp Glu Asp Asp Arg Asn Thr Thr Lys Asn <210> 7 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 7 tttcacatga acatccttct cc 22 <210> 8 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic 0ligonucleotide <400> 8 agtgctggag gcagaaggaa g 21 <210> 9 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 9 caggaattgg gaaatcggct ctctag 26 <210> 10 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 10 ccaaatgctt tgtgtttatt taattcc 27 <210> 11 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 11 cggaattcgt cactcagcg 19 <210> 12 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 12 agcgcgtgaa tcagatcg 18 <210> 13 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 13 attccctggt agagtccacc ttgc _ 24 <210> 14 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 14 acagcacgat ccttctggct agag 24 <210> 15 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> l5 caagctccgg tgacggagat cat 23 <210> 16 <211> 22 <212> DNA
<2l3> Artificial Sequence <220>
<223> Sythetic Oligonucleotide <400> 16 agctggaggc agaaggaaga tg 22 <210> 17 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 17 tctggcctca gccctcgtca gcttgac 27 <210> 18 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 18 ccaaatgctt tgtgtttatt taattcc 27 <210> 19 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 19 tctggcctca gccctcgtca g 21 <210> 20 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 20 actgaagtta ttctgcacca g 21 <210> 21 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 21 tgacttctga ttgctgtgag 2f <210> 22 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Synthetic Oligonucleotide <400> 22 ttccaccagt accggtcatc 2p <210> 23 <211> 3900 <212> DNA
<213> Homo sapiens <220>
<221> CDS
<222> (1)..(3600) <223> , <400> 23 atg aag gtt gca gga gga ctt gaa ctt gga get get get ctg ctc tca 48 Met Lys Val Ala Gly Gly Leu Glu Leu Gly Ala Ala Ala Leu Leu Ser gca tca cca cgt get ctt gtc act ctt tcc aca ggt cct act tgc tct 96 Ala Ser Pro Arg Ala Leu Val Thr Leu Ser Thr Gly Pro Thr Cys Ser atatta ccaaagaat cca ttcccccaa ctgagc tctcagcct 144 ctt aac IleLeu ProLysAsn Pro PheProGln LeuSer SerGlnPro Leu Asn tgtatc aagatggaa gga aaatcgctc ttttcc agctacggg 192 gac acc CysIle LysMetGlu Gly LysSerLeu PheSer SerTyrGly Asp Thr ctgcaatggtgt ctctatgag ctagacaag gaagaattt cagaca ttc 240 LeuGlnTrpCys LeuTyrGlu LeuAspLys GluGluPhe GlnThr Phe aaggaattacta aagaagaaa tcttcagaa tcgaccaca tgctct att 288 LysG1uLeuLeu LysLysLys SerSerGlu SerThrThr CysSer Ile ccacagtttgaa atcgagaat gccaacgtg gaatgtctg gcactc ctc 336 ProGlnPheGlu IleGluAsn AlaAsnVal GluCysLeu AlaLeu Leu ttgcatgagtat tatggagca tcgctggcc tgggetacg tccatt agc 384 LeuHisGluTyr TyrGlyAla SerLeuAla TrpAlaThr SerIle Ser atctttgaaaac atgaacctg cgaaccctc tcggagaag gcacgg gat 432 IlePheGluAsn MetAsnLeu ArgThrLeu SerGluLys AlaArg Asp gacatgaaaaga cattcacca gaagatcct gaagcaacg atgact gac 480 AspMetLysArg HisSerPro GluAspPro GluAlaThr MetThr Asp caaggaccaagc aaggaaaaa gtgccagga atttcacaa getgtg caa 528 GlnGlyProSer LysGluLys ValProGly IleSerGln AlaVal Gln caagatagtgcc acagetgca gagacaaaa gaacaggaa atttca caa 576 GlnAspSerAla ThrAlaA1a GluThrLys GluGlnGlu IleSer Gln getatggaacaa gaaggtgcc acagcagca gagacagaa gaacaa gaa 624 AlaMetGluGln GluGlyAla ThrA1aAla GluThrGlu GluGln Glu atttcacaaget atggaacaa gaaggtgcc acagcagca gagaca gaa 672 IleSerGlnAla MetGluGln GluGlyAla ThrAlaAla GluThr Glu gaacaaggacat ggaggtgac acatgggac tacaagagt cacgtg atg 720 GluGlnGlyHis GlyGlyAsp ThrTrpAsp TyrLysSer HisVal Met accaaattcget gaggaggag gatgtacgt cgtagtttt gaaaac act 768 ThrLysPheAla GluGluGlu AspValArg ArgSerPhe GluAsn Thr getgetgactgg ccggaaatg caaacgttg getggtget tttgat tca 816 AlaAlaAspTrp ProGluMet GlnThrLeu AlaGlyAla PheAsp Ser gaccggtggggc ttccggcct cgcacggtg gttctgcac ggaaag tca 864 Asp Trp Gly Phe Pro Thr Val Val His Gly Lys Ser Arg Arg Arg Leu gga ggg aaa tcg cta aga agg atc ctg tgc tgg gcg 912 att get gcc gtg Gly Gly Lys Ser Leu Arg Arg Ile Leu Cys Trp Ala Ile Ala Ala Val caaggtggactc taccaggga atgttctcc tacgtcttc ttccte ccc 960 GlnGlyGlyLeu TyrGlnGly MetPheSer TyrValPhe PheLeu Pro 305 310 ~ 315 320 gttagagagatg cagcggaag aaggagagc agtgtcaca gagttc atc 1008 ValArgGluMet GlnArgLys LysGluSer SerValThr GluPhe Ile tecagggagtgg ccagactec caggetecg gtgacggag ateatg tce 1056 SerArgGluTrp ProAspSer GlnAlaPro ValThrGlu IleMet Ser cgaccagaaagg ctgttgttc atcattgac ggtttcgat gacctg ggc 1104 ArgProGluArg LeuLeuPhe IleI1eAsp GlyPheAsp AspLeu Gly tctgtcctcaac aatgacaca aagctctgc aaagactgg getgag aag 1152 SerValLeuAsn AsnAspThr LysLeuCys LysAspTrp AlaGlu Lys cagcctccgttc accctcata cgcagtctg ctgaggaag gtcctg ctc 120.0 GlnProProPhe ThrLeuIle ArgSerLeu LeuArgLys ValLeu Leu cctgagtccttc ctgatcgtc accgtcaga gacgtgggc acagag aag 1248 ProGlu5erPhe LeuIleVal ThrValArg AspValGly ThrGlu Lys ctcaagtcagag gtcgtgtct ccccgttac ctgttagtt agagga atc 1296 LeuLys5erGlu Va1ValSer ProArgTyr LeuLeuVal ArgGly Ile tccggggaacaa agaatccac ttgctcctt gagcgcggg attggt gag 1344 SerGlyGluGln ArgIleHis LeuLeuLeu GluArgGly IleG1y Glu catcagaagaca caagggttg cgtgcgatc atcaacaac cgtgag ctg 1392 HisGlnLysThr GlnGlyLeu ArgA1aIle IleAsnAsn ArgGlu Leu ctcgaccagtgc caggtgccc gccgtgggc tctctcatc tgcgtg gcc 1440 LeuAspGlnCys GlnValPro AlaValGly SerLeuTle CysVal A1a ctgcagctgcag gacgtggtg ggggagagc gtcgccccc ttcaac caa 1488 LeuGlnLeuGln AspValVal GlyGluSer ValAlaPro PheAsn Gln acgctcaca~ggcctgcacgcc gettttgcg tttcatcag cteacc cet 1536 ThrLeuThrGly LeuHisAla AlaPheAla PheHisGln LeuThr Pro cgaggcgtggtc cggcgctgt ctcaatctg gaggaaaga gttgtc ctg 1584 ArgGlyValVal ArgArgCys LeuAsnLeu GluGluArg ValVal Leu aagcgc ttctgccgt atggetgtg gagggagtg tggaat aggaagtca 1632 LysArg PheCysArg MetAlaVal G1uGlyVal TrpAsn ArgLysSer gtgttt gatggtgac gacctcatg gttcaagga ctcggg gagtctgag 1680 ValPhe AspGlyAsp AspLeuMet ValGlnGly LeuGly GluSerGlu ctccgt getctgttt cacatgaac atccttctc ccagac agccactgt 1728 LeuArg AlaLeuPhe HisMetAsn IleLeuLeu ProAsp SerHisCys gaggag tactacacc ttcttccac ctcagtctc caggac ttctgtgcc 1776 GluGlu TyrTyrThr PhePheHis LeuSerLeu GlnAsp PheCysAla gccttg tactacgtg ttagagggc ctggaaatc gagcca getctctgc 1824 AlaLeu TyrTyrVa1 LeuGluGly LeuGluIle GluPro AlaLeuCys cctctg tacgttgag aagacaaag aggtccatg gagctt aaacaggca 1872 ProLeu TyrVa1Glu LysThrLys ArgSerMet GluLeu LysGlnAla ggcttc catatccac tcgctttgg atgaagcgt ttcttg tttggcctc 1920 GlyPhe HisIleHis SerLeuTrp MetLysArg PheLeu PheGlyLeu gtgagc gaagacgta aggaggcca ctggaggtc ctgctg ggctgtccc 1968 ValSer GluAspVal ArgArgPro LeuG1uVal LeuLeu GlyCysPro gttccc ctgggggtg aagcagaag cttctgcac tgggtc tctctgttg 2016 ValPro LeuGlyVal LysGlnLys LeuLeuHis TrpVal SerLeuLeu ggtcag cagcctaat gccaccacc ccaggagac accctg gacgccttc 2064 GlyGln GlnProAsn AlaThrThr ProGlyAsp ThrLeu AspAlaPhe cactgt cttttcgag actcaagac aaagagttt gttcgc ttggcatta 2112 HisCys LeuPheGlu ThrGlnAsp LysGluPhe ValArg LeuA1aLeu aacagc ttccaagaa gtgtggctt ccgatt aaccagaacctg gacttg 2160 AsnSer PheGlnGlu ValTrpLeu ProIle AsnGlnAsnLeu AspLeu atagca tcttccttc tgcctccag cactgt ccgtatttgcgg aaaatt 2208 IleAla SerSerPhe CysLeuGln HisCys ProTyrLeuArg LysIle cgggtg gatgtcaaa gggatcttc ccaaga gatgagtccget gaggca 2256 ArgVal AspValLys GlyI1ePhe ProArg AspGluSerAla GluAla tgtcct gtggtccct ctatggatg cgggat aagaccctcatt gaggag 2304 CysPro ValValPro LeuTrpMet ArgAsp LysThrLeuIle GluGlu cagtgg gaagatttc tgctccatg cttggcacc cacccacac ctgcgg 2352 GlnTrp GluAspPhe CysSerMet LeuGlyThr HisProHis LeuArg cagctg gacctgggc agcagcatc ctgacagag cgggccatg aagacc 2400 GlnLeu AspLeuGly SerSerIle LeuThrGlu ArgAlaMet LysThr ctgtgt gccaagctg aggcatccc acctgcaag atacagacc ctgatg 2448 LeuCys AlaLysLeu ArgHisPro ThrCysLys IleGlnThr LeuMet tttaga aatgcacag attacccct ggtgtgcaa cacctctgg agaatc 2496 PheArg AsnAlaGln IleThrPro G1yValGln HisLeuTrp ArgIle gtcatg gccaaccgt aacctaaga tccctcaac ttgggaggc acccac 2544 ValMet AlaAsnArg AsnLeuArg SerLeuAsn LeuGlyGly ThrHis ctgaaggaagag gatgtaagg atggcgtgt gaagcctta aaacaccca 2592 LeuLysGluGlu AspValArg MetAlaCys GluAlaLeu LysHisPro aaatgtttgttg gagtctttg aggctggat tgctgtgga ttgacccat 2640 LysCysLeuLeu GluSerLeu ArgLeuAsp CysCysG1y LeuThrHis gcctgttacctg aagatctcc caaatcctt acgacctcc cccagcctg 2888 AlaCysTyrLeu LysIleSer GlnIleLeu ThrThrSer ProSerLeu aaatctctgagc ctggcagga aacaaggtg acagaccag ggagtaacg 2736 LysSerLeuSer LeuAlaGly AsnLysVa1 ThrAspGln G1yValThr cctctcagtgat gccttgagg gtctcccag tgcgccctg cagaagctg 2784 ProLeuSerAsp A1aLeuArg ValSerGln CysAlaLeu GlnLysLeu atactggaggac tgtggcatc acagccacg ggttgccag agtctggcc 2832 IleLeuGluAsp CysGlyIle ThrAlaThr GlyCysG1n SerLeuAla tcagccctcgtc agcaaccgg agcttgaca cacctgtgc ctatccaac 2880 SerAlaLeuVal SerAsnArg SerLeuThr HisLeuCys LeuSerAsn aacagcctgggg aacgaaggt gtaaatcta ctgtgtcga tccatgagg 2928 AsnSerLeuGly AsnGluGly ValAsnLeu LeuCysArg SerMetArg cttccccactgt agtctgcag aggctgatg ctgaatcag tgccacctg 2976 LeuProHisCys SerLeuGln ArgLeuMet LeuAsnGln CysHisLeu gacacggetggc tgtggttct cttgcactt gcgcttatg ggt 3024 aac tca AspThrAlaG1y CysGlySer LeuAlaLeu A1aLeuMet Gly Asn Ser tggctg acg cacctgagc ctt agcatg aaccctgtg gaa gacaat 3069 TrpLeu Thr HisLeuSer Leu SerMet AsnProVal Glu AspAsn ggcgtg aag cttcogtgc gag gtcatg agagaacca tct tgtcat 3114 GlyVal Lys LeuLeuCys Glu ValMet ArgGluPro Ser CysHis ctccag gac ctggagttg gta aagtgt catctcacc gcc gcgtgc 3159 LeuGln Asp LeuGluLeu Val LysCys HisLeuThr Ala AlaCys tgtgag agt ctgtcctgt gtg atctcg aggagcaga cac ctgaag 3204 CysGlu Ser LeuSerCys Val IleSer ArgSerArg His LeuLys agcctg gat ctcacggac aat gccctg ggtgacggt ggg gttget 3249 SerLeu Asp LeuThrAsp Asn AlaLeu GlyAspGly Gly ValAla gcgctg tgc gagggactg aag caaaag aacagtgtt ctg acgaga 3294 AlaLeu Cys GluGlyLeu Lys GlnLys AsnSerVal Leu ThrArg ctcggg ttg aaggcatgt gga ctgact tctgattgc tgt gaggca 3339 LeuGly Leu LysAlaCys Gly LeuThr SerAspCys Cys GluAla ctctcc ttg gccctttcc tgc aaccgg catctgacc agt ctaaac 3384 LeuSer Leu AlaLeuSer Cys AsnArg HisLeuThr Ser 2euAsn ctggtg cag aataacttc agt cccaaa ggaatgatg aag ctgtgt 3429 LeuVal Gln AsnAsnPhe Ser ProLys GlyMetMet Lys LeuCys tcggcc ttt gcctgtccc acg tctaac ttacagata att gggctg 3474 SerAla Phe AlaCysPro Thr SerAsn LeuGlnIle Ile GlyLeu tggaaa tgg cagtaccct gtg caaata aggaagctg ctg gaggaa 3519 TrpLys Trp GlnTyrPro Val GlnIle ArgLysLeu Leu GluGlu gtgcag cta ctcaagccc cga gtcgta attgacggt agt tggcat 3564 ValG1n Leu LeuLysPro Arg ValVa1 IleAspGly Ser TrpHis tctttt gat gaagatgac cgg tactgg tggaaaaac tgaagatacg 9610 SerPhe Asp GluAspAsp Arg TyrTrp TrpLysAsn gaaacctgcc ccactcacac ccatctgatg gaggaacttt aaacgctgtt ttctcagagc 3670 aagctatgca cctgggagtt ccttctcaaa gatggagaat gatttctgat tctcacaaag 3730 ccctcaatgg tagtgattct tctgtgttca ctctacgttg gttactggat ttgaaggcta 3790 gagaccttca agtcatagga ctcagtatct gtgaaatgtc cgtcatatct cagagcatat 3850 agagggaatt aaataaacac aaagcatttg gaaaaaaaaa aaaaaaaaaa 3900 <210> 24 <211> 1200 <212> PRT
<213> Homo sapiens <400> 24 Met Lys Val Ala Gly Gly Leu Glu Leu Gly Ala Ala Ala Leu Leu Ser Ala Sex Pro Arg Ala Leu Val Thr Leu Ser Thr Gly Pro Thr Cys Ser Ile Leu Pro Lys Asn Pro Leu Phe Pro Gln Asn Leu Ser Ser Gln Pro Cys Ile Lys Met G1u Gly Asp Lys Ser Leu Thr Phe Ser Ser Tyr Gly Leu Gln Trp Cys Leu Tyr Glu Leu Asp Lys Glu Glu Phe Gln Thr Phe Lys Glu Leu Leu Lys Lys Lys Ser Ser Glu Ser Thr Thr Cys Ser Ile Pro Gln Phe Glu Ile Glu Asn Ala Asn Val Glu Cys Leu Ala Leu Leu Leu His Glu Tyr Tyr Gly Ala Ser Leu Ala Trp Ala Thr Ser Ile Ser 115 120 l25 Ile Phe Glu Asn Met Asn Leu Arg Thr Leu Ser Glu Lys Ala Arg Asp Asp Met Lys Arg His Ser Pro Glu Asp Pro Glu Ala Thr Met Thr Asp Gln Gly Pro Ser Lys Glu Lys Val Pro Gly I1e Ser Gln A1a Val Gln Gln Asp Ser Ala Thr Ala Ala Glu Thr Lys G1u Gln G1u Ile Ser Gln Ala Met Glu Gln Glu Gly Ala Thr Ala Ala Glu Thr Glu Glu Gln Glu Ile Ser Gln Ala Met Glu Gln Glu Gly A1a Thr Ala Ala Glu Thr Glu Glu Gln Gly His Gly Gly Asp Thr Trp Asp Tyr Lys Ser His Val Met Thr Lys Phe Ala Glu Glu Glu Asp Val Arg Arg Ser Phe Glu Asn Thr Ala Ala Asp Trp Pro Glu Met Gln Thr Leu Ala Gly A1a Phe Asp Ser Asp Arg Trp Gly Phe Arg Pro Arg Thr Val Val Leu His G1y Lys Ser Gly Ile Gly Lys Ser Ala Leu Ala Arg Arg Ile Val Leu Cys Trp Ala Gln Gly Gly Leu Tyr Gln Gly Met Phe Ser Tyr Val Phe Phe Leu Pro 305 3l0 315 320 Val Arg G1u Met Gln Arg Lys Lys Glu Ser Ser Val Thr Glu Phe Ile Ser Arg Glu Trp Pro Asp Ser G1n Ala Pro Val Thr Glu 21e Met Ser Arg Pro Glu Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Asp Leu Gly Ser Val Leu Asn Asn Asp Thr Lys Leu Cys Lys Asp Trp Ala Glu Lys G1n Pro Pro Phe Thr Leu Ile Arg Ser Leu Leu Arg Lys Val Leu Leu Pro Glu Ser Phe Leu Ile Val Thr Val Arg Asp Val Gly Thr Glu Lys Leu Lys Ser Glu Val Val Ser Pro Arg Tyr Leu Leu Val Arg Gly Ile Ser Gly Glu Gln Arg Ile His Leu Leu Leu G1u Arg Gly Ile Gly Glu His Gln Lys Thr Gln Gly Leu Arg A1a Ile Tle Asn Asn Arg Glu Leu Leu Asp Gln Cys Gln Val Pro Ala Val Gly Ser Leu Ile Cys Val Ala Leu Gln Leu Gln Asp Val Val Gly Glu Ser Val Ala Pro Phe Asn Gln Thr Leu Thr Gly Leu His Ala Ala Phe Ala Phe His Gln Leu Thr Pro Arg Gly Val Val Arg Arg Cys Leu Asn Leu Glu Glu Arg Val Val Leu Lys Arg Phe Cys Arg Met Ala Val Glu Gly Va1 Trp Asn Arg Lys Ser Val Phe Asp Gly Asp Asp Leu Met Val Gln Gly Leu Gly Glu Ser Glu Leu Arg Ala Leu Phe His Met Asn I1e Leu Leu Pro Asp Ser His Cys Glu Glu Tyr Tyr Thr Phe Phe His Leu Ser Leu Gln Asp Phe Cys Ala Ala Leu Tyr Tyr Val Leu Glu Gly Leu Glu Ile Glu Pro Ala Leu Cys Pro Leu Tyr Val Glu Lys Thr Lys Arg Ser Met Glu Leu Lys G1n Ala Gly Phe His Ile His Ser Leu Trp Met Lys Arg Phe Leu Phe Gly Leu Val Ser Glu Asp Val Arg Arg Pro Leu Glu Val Leu Leu Gly Cys Pro Val Pro Leu Gly Val Lys Gln Lys Leu Leu His Trp Val Ser Leu Leu Gly Gln Gln Pro Asn Ala Thr Thr Pro Gly Asp Thr Leu Asp Ala Phe His Cys Leu Phe Glu Thr Gln Asp Lys Glu Phe Val Arg Leu Ala Leu Asn Ser Phe Gln Glu Val Trp Leu Pro Ile Asn Gln Asn Leu Asp Leu Ile Ala Ser Ser Phe Cys Leu Gln His Cys Pro Tyr Leu Arg Lys Ile Arg Val Asp Val Lys Gly Ile Phe Pro Arg Asp Glu Ser Ala Glu Ala Cys Pro Val Val Pro Leu Trp Met Arg Asp Lys Thr Leu Ile Glu Glu Gln Trp Glu Asp Phe Cys Ser Met Leu Gly Thr His Pro His Leu Arg Gln Leu Asp Leu Gly Ser Ser Ile Leu Thr Glu Arg Ala Met Lys Thr Leu Cys Ala Lys Leu Arg His Pro Thr Cys Lys Ile Gln Thr Leu Met Phe Arg Asn Ala Gln Ile Thr Pro Gly Va1 Gln His Leu Trp Arg Ile Val Met Ala Asn Arg Asn Leu Arg Ser Leu Asn Leu Gly Gly Thr His Leu Lys Glu Glu Asp Val Arg Met Ala Cys Glu Ala Leu Lys His Pro Lys Cys Leu Leu Glu Ser Leu Arg Leu Asp Cys Cys Gly Leu Thr His Ala Cys Tyr Leu Lys Ile Ser Gln Ile Leu Thr Thr Ser Pro Ser Leu Lys Ser Leu Ser Leu Ala Gly Asn Lys Val Thr Asp Gln G1y Val Thr Pro Leu Ser Asp Ala Leu Arg Val Ser G1n Cys Ala Leu Gln Lys Leu Ile Leu Glu Asp Cys Gly Ile Thr Ala Thr Gly Cys Gln Ser Leu Ala Ser Ala Leu Val Ser Asn Arg Ser Leu Thr His Leu Cys Leu Ser Asn Asn Ser Leu Gly Asn Glu Gly Val Asn Leu Leu Cys Arg Ser Met Arg Leu Pro His Cys Ser Leu Gln Arg Leu Met Leu Asn Gln Cys His Leu Asp Thr Ala Gly Cys Gly Ser Leu Ala Leu Ala Leu Met Gly Asn Ser Trp Leu Thr His Leu Ser Leu Ser Met Asn Pro Val Glu Asp Asn Gly Val Lys Leu Leu Cys Glu Val Met Arg Glu Pro Ser Cys His Leu Gln Asp Leu Glu Leu Val Lys Cys His Leu Thr Ala Ala Cys Cys Glu Ser Leu Ser Cys Val Ile Ser Arg Ser Arg His Leu Lys Ser Leu Asp Leu Thr Asp Asn Ala Leu Gly Asp Gly Gly Val Ala Ala Leu Cys Glu Gly Leu Lys Gln Lys Asn Ser Val Leu Thr Arg Leu Gly Leu Lys Ala Cys Gly Leu Thr Ser Asp Cys Cys G1u Ala Leu Ser Leu Ala Leu Ser Cys Asn Arg His Leu Thr Ser Leu Asn Leu Val Gln Asn Asn Phe Ser Pro Lys Gly Met Met Lys Leu Cys Ser Ala Phe Ala Cys Pro Thr Ser Asn Leu Gln Ile Ile Gly Leu Trp Lys Trp GIn Tyr Pro Val Gln Ile Arg Lys Leu Leu Glu Glu Val Gln Leu Leu Lys Pro Arg Val Val Ile Asp Gly Ser Trp His Ser Phe Asp Glu Asp Asp Arg Tyr Trp Trp Lys Asn <210> 25 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 25 tcttttaaag gta agc gag a 20 Val Ser Glu <210> 26 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 26 tgtcttccag gtt aga ggg g 20 Val Arg Gly , <210> 27 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223> ' <400> 27 tcttttgcag gtg aat gaa a 20 Val Asn Glu <210> 28 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10j <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 28 tcttttgcag gtg tgg aaa a 20 Val Trp Zys <210> 29 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<22l> exon <222> (11) . . (20) <223>
<400> 29 tcttttgcag gtg agg aaa a 20 Val Arg Lys <210> 30 <211> 20 <212> DNA
<213> Homo sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 30 ctgactccag gtg agt acc c 20 Val Ser Thr <210> 31 <211> 20 <212> DNA
<213> Homo sapiens <220>
<221> Intron <222> (1) . . (10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 31 cctgacatag gta agg ctg c 20 Val Arg Leu <210> 32 <211> 20 <212> DNA
<213> Homo sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11) . . (20) <223>
<400> 32 cccattgcag gta cgt ctc t 20 Val Arg Leu <210> 33 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
r <400> 33 gtctctgcag gtg agt gcc a 20 Val Ser Ala <210> 34 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 34 cttcttgcag gtg agt ctg g 20 Val Ser Leu <210> 35 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<22l> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11) . . (20) <223>
<400> 35 tgccccacag gtg agt ttc c 20 Val Sex Phe <210> 36 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 36 cctcttgcag gta act tcc t 20 Val Thr Ser <210> 37 <211> 20 <212> DNA
<213> Homo Sapiens <220>
<221> Intron <222> (1) . . (10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 37 gaccctgcag gta agt cgc c 20 Val Ser Arg <210> 38 <211> 20 <212> DNA
<213> Homo sapiens <220>
<22l> Intron <222> (1)..(10) <223>
<220>
<221> exon <222> (11)..(20) <223>
<400> 38 gcctccccag gtt gtc aag t ' 20 Val Val Zys <210> 39 <211> 17 <212> DNA
<213> Homo sapiens <400> 39 gcatgggtca gaaggat 17 <210> 40 <211> 17 <212> DNA
<213> Homo sapiens <400> 40 gtccagtagt ggtaacc 17 <210> 41 <211> 21 <212> DNA
<213> Homo sapiens <400> 41 tgacttctga ttgctgtgag g 21 <210> 42 <211> 20 <212> DNA
<213> Homo Sapiens <400> 42 ctactggcca tgaccacctt 20
Claims (31)
1. An isolated variant MATER protein comprising an amino acid sequence (a) having at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO:
24, and comprising at least one variant amino acid in a recognized MATER
protein domain; or (b) having at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO:
24, and comprising at least one variant amino acid in a region outside of a recognized MATER
protein domain; or (c) having at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO:
24, and comprising at least one variant amino acid in a recognized MATER
protein domain and at least one variant amino acid outside of a recognized MATER protein domain.
24, and comprising at least one variant amino acid in a recognized MATER
protein domain; or (b) having at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO:
24, and comprising at least one variant amino acid in a region outside of a recognized MATER
protein domain; or (c) having at least 90% sequence identity to SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO:
24, and comprising at least one variant amino acid in a recognized MATER
protein domain and at least one variant amino acid outside of a recognized MATER protein domain.
2. The isolated variant MATER protein of claim 1, wherein the sequence of the protein comprises at least one variant amino acid in a Leucine-rich repeat.
3. The isolated variant MATER protein of claim 1, wherein the sequence of the protein comprises at least one variant amino acid in the PAAD-DAPIN domain.
4. The isolated variant MATER protein of claim 1, wherein the sequence of the protein comprises at least one variant amino acid in the aldo ket red domain.
5. The isolated variant MATER protein of claim 1, wherein the sequence of the protein comprises at least one variant amino acid in the ATP-/GTP-binding domain.
6. The isolated variant MATER protein of claim 1, wherein the sequence of the protein comprises at least one variant amino acid outside of a recognized MATER protein domain.
7. An isolated nucleic acid molecule encoding a protein according to claim 1.
8. A recombinant nucleic acid molecule comprising a promoter sequence operably linked to nucleic acid molecule according to claim 7.
9. A cell transformed with a recombinant nucleic acid molecule according to claim 8.
10. A method of detecting in a subject a biological condition associated with an abnormal MATER nucleic acid, comprising reacting at least one MATER nucleic acid in a clinical sample from the subject with a reagent comprising a MATER-specific nucleic acid binding agent to form a MATER:agent complex, and detecting the complex.
11. The method of claim 10, wherein the MATER-specific nucleic acid binding agent is a MATER oligonucleotide.
12. The method of claim 11, wherein the MATER oligonucleotide comprises at least 10 contiguous nucleotides of a human MATER intron sequence.
13 The method of claim 11, wherein the MATER oligonucleotide comprises a sequence as shown in any one of SEQ ID NOs: 25 through 38.
14. The method of claim 10, further comprising quantifying the MATER:agent complex and comparing the quantity of the MATER:agent complex with the quantity of an equivalent MATER:agent complex formed in a reference sample.
15. The method of claim 14, wherein the reference sample is a sample from a reference subject known to have the biological condition.
16. The method of claim 14, wherein the reference sample is a sample from a reference subject known not to have the biological condition.
17. The method of claim 10, wherein the clinical sample comprises a reproductive cell.
18. The method of claim 10, wherein the method is used for detecting a predisposition to infertility or reduced fertility or for presymptomatic screening of an individual for infertility or reduced fertility.
19. The method of claim 10. which is a method of evaluating a cause of female infertility.
20. The method of claim 10, further comprising in vitro amplifying a Mater nucleic acid prior to detecting the abnormal Mater nucleic acid.
21. The method of claim 10, wherein the Mater nucleic acid is in vitro amplified using at least one oligonucleotide primer derived from a MATER protein encoding sequence.
22. The method of claim 10, wherein the oligonucleotide primer comprises a sequence comprising an intron-exon boundary of human MATER.
23. The method of claim 22, wherein the oligonucleotide primer comprises a sequence as shown in any on of SEQ ID NOs: 25 through 38.
24. An oligonucleotide primer used in the method of claim 22.
25. The method of claim 10, wherein the MATER:agent complex is detected by nucleotide hybridization.
26. The method of claim 10, wherein the agent is a labeled nucleotide probe.
27. The method of claim 26, wherein the nucleotide probe comprises a sequence as shown in any one of SEQ ID NOs: 25 through 38.
28. A labeled nucleotide probe used in the method of claim 26.
29. A kit for detection of a genetic mutation in a sample of nucleic acid, comprising:
(a) a first container containing an oligonucleotide capable of specifically hybridizing with a MATER nucleic acid, which oligonucleotide has a sequence comprising at least 10 contiguous nucleotides from an human MATER intron; and (b) a second container containing a fluorescent labeled nucleic acid probe that is fully complementary to the oligonucleotide.
(a) a first container containing an oligonucleotide capable of specifically hybridizing with a MATER nucleic acid, which oligonucleotide has a sequence comprising at least 10 contiguous nucleotides from an human MATER intron; and (b) a second container containing a fluorescent labeled nucleic acid probe that is fully complementary to the oligonucleotide.
30. The kit of claim 29, wherein the fluorescent labeled nucleic acid probe has a length of between 5 and 500 nucleotides.
31. The kit of claim 29, wherein the oligonucleotide comprises a sequence as shown in any one of SEQ ID NOs: 25 through 38.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/US2001/010981 WO2002032955A1 (en) | 2000-10-18 | 2001-04-04 | Human gene critical to fertility |
USPCT/US01/10981 | 2001-04-04 | ||
PCT/US2002/009776 WO2002081492A1 (en) | 2001-04-04 | 2002-03-29 | Human gene critical to fertility |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2443341A1 true CA2443341A1 (en) | 2002-10-17 |
Family
ID=21742470
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002443341A Abandoned CA2443341A1 (en) | 2001-04-04 | 2002-03-29 | Human gene critical to fertility |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1490381A4 (en) |
JP (1) | JP2004533229A (en) |
CA (1) | CA2443341A1 (en) |
WO (1) | WO2002081492A1 (en) |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
ES2534430T3 (en) * | 2006-08-28 | 2015-04-22 | The University Of Western Australia | Modulation method of epidermal growth factor receptor (EGFR) expression that involves miRNA |
US20110071033A1 (en) * | 2009-09-23 | 2011-03-24 | Celmatix, Inc. | Methods and devices for assessing infertility and/or egg quality |
US10162800B2 (en) | 2012-10-17 | 2018-12-25 | Celmatix Inc. | Systems and methods for determining the probability of a pregnancy at a selected point in time |
US9177098B2 (en) | 2012-10-17 | 2015-11-03 | Celmatix Inc. | Systems and methods for determining the probability of a pregnancy at a selected point in time |
US9836577B2 (en) | 2012-12-14 | 2017-12-05 | Celmatix, Inc. | Methods and devices for assessing risk of female infertility |
EP3052110A4 (en) * | 2013-10-02 | 2017-07-12 | Northeastern University | Methods and compositions for generation of developmentally-incompetent eggs in recipients of nuclear genetic transfer |
JP2017526345A (en) | 2014-07-17 | 2017-09-14 | セルマティックス, インコーポレイテッド | Methods and systems for assessing infertility and related pathologies |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7217811B2 (en) * | 2000-10-18 | 2007-05-15 | The United States Of America As Represented By The Department Of Health And Human Services | Human gene critical to fertility |
AU2002243234A1 (en) * | 2000-11-15 | 2002-06-24 | Incyte Genomics, Inc. | Embryogenesis associated proteins |
-
2002
- 2002-03-29 CA CA002443341A patent/CA2443341A1/en not_active Abandoned
- 2002-03-29 EP EP02723673A patent/EP1490381A4/en not_active Withdrawn
- 2002-03-29 WO PCT/US2002/009776 patent/WO2002081492A1/en not_active Application Discontinuation
- 2002-03-29 JP JP2002579478A patent/JP2004533229A/en not_active Withdrawn
Also Published As
Publication number | Publication date |
---|---|
WO2002081492A1 (en) | 2002-10-17 |
JP2004533229A (en) | 2004-11-04 |
EP1490381A1 (en) | 2004-12-29 |
EP1490381A4 (en) | 2005-06-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7531635B2 (en) | MATER-protein specific antibodies and methods of use | |
AU2001249852A1 (en) | Human gene critical to fertility | |
US20150045307A1 (en) | Identification of a novel bhd gene | |
US20080293116A1 (en) | Ovary-specific genes and proteins | |
US6326484B1 (en) | Nucleic acids encoding regulators of FGF-2 transcription (RFT) and variants thereof | |
CA2443341A1 (en) | Human gene critical to fertility | |
US20020042926A1 (en) | Ovary-specific genes and proteins | |
DE DK et al. | MENSCHLICHES GEN ZUR FRUCHTBARKEIT ENTSCHEIDEND GENE HUMAIN INDISPENSABLE A LA FERTILITE | |
AU2002254442A1 (en) | Human gene critical to fertility | |
US6995251B1 (en) | Ovary-specific genes and proteins | |
US20090081779A1 (en) | Tumor suppressor gene, p28ing5 | |
US20030143601A1 (en) | Methods and compositions for the detection of bovine pregnancy which utilize members of the 1-8 family of interferon inducible genes | |
US6500940B1 (en) | Lifeguard (LFG) polynucleotides and polypeptides and methods of use thereof | |
EP1645562A1 (en) | Ovary-specific genes and proteins | |
WO2003064591A2 (en) | Abca8 nucleic acids and proteins, and uses thereof | |
AU2002259026A1 (en) | Ovary-specific genes and proteins | |
WO2002092775A2 (en) | Tumor antigen homologous to poly(a) polymerase |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FZDE | Discontinued |