WO2002092775A2 - Tumor antigen homologous to poly(a) polymerase - Google Patents

Abstract

This disclosure provides a novel poly(A)polymerase, referred to as neo-PAP, and methods of making and using this enzyme. Also provided are methods of ameliorating, treating, detecting, prognosing, and diagnosing diseases and conditions associated with abnormal neo-PAP, such as neoplasia, and methods of eliciting immune responses in animals.

Description

TUMOR ANTIGEN HOMOLOGOUS TO POLY(A) POLYMERASE

REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Patent Application No. 60/291,668, filed May 16, 2001 , the entirety of which is incorporated herein by reference.

FIELD

The present disclosure is generally related to RNA polymerases, particularly a new poly(A)polymerase and nucleic acids that encode it, as well as its uses in vitro and in vivo.

BACKGROUND Post-transcriptional modification of pre-mRNA is a complex and tightly regulated process that is essential for the life of the cell. Polyadenylation of the 3' end of mRNA, in the simplest view, is a two-step process involving cleavage of pre-mRNA and addition of the poly(A) tail. However, this event requires the coordinated interactions of at least a dozen different polypeptides (reviewed in Colgan and Manley, Genes Dev. 11: 2755-2766, 1997; Zhao et al., Microbiol. Mol. Biol. Rev. 63: 405-445, 1999; Minvielle-Sebastia and Keller, Curr. Opin. Cell Biol. 11 : 352-357, 1999; and Shatkin and Manley, Nature Structural Biol. 7: 838-842, 2000). Poly(A) polymerase (PAP, also termed polynucleotide adenylyltransferase) is a single subunit enzyme that catalyzes 3' polyadenylation and also contributes to the endonucleolytic cleavage of pre-mRNA. It gains site-specificity by interacting with the multi-subunit factors, cleavage stimulation factor (CstF) and cleavage/polyadenylation stimulation factor (CPSF), which recognize the 3' G U rich element and the AAUAAA signal sequence in precursor mRNA, respectively. Successful polyadenylation of almost all eukaryotic mRNAs is required for the trafficking of mRNA from the nucleus to the cytoplasm (Huang and Carmichael et al, Mol. Cell. Biol. 16: 1534-1542, 1996), for enhancing the efficiency of translation (Sachs et al, Cell 89: 831-838, 1997), and for regulating mRNA degradation (Carpousis et al, Trends Genet. 15: 24-28, 1999).

PAP is classified as a template-independent polymerase, a category shared only by terminal deoxynucleotidyl transferase. The functional domains of PAP have been studied extensively (Raabe et al, Mol. Cell. Biol. 14: 2946-2957, 1994) and the crystal structures of yeast and bovine PAP complexed with ATP recently have been solved (Martin et al, EMBO J. 19: 4193-4203, 2000; Bard et al, Science 289:1346-1349, 2000). There has been considerable evolutionary conservation of the amino acid (aa) sequence of the N-terminal catalytic domain, with extensive homologies from yeast to human. In vertebrates, the conserved structure of PAP also includes two bipartite nuclear localization signals (NLS) surrounding an S/T rich C-terminal domain (CTD), and a 20-mer peptide at the extreme C-terminus that interacts with RNA splicing factors (Vagner et al, Genes Bevel. 14:403-413, 2000). The CTD of vertebrate PAPs is not conserved among different species to the same extent as the catalytic domain. Hyperphosphorylation of the CTD by the cyclin dependent kinase (cdk) p34^cdo2 /cyclin B represses PAP activity during M-phase, an event perceived as critical to successful cell division since constitutive overexpression of PAP in mammalian cells significantly impedes cell proliferation (Colgan et al, EMBO J. 17: 1053-1062, 1998; Bond et al, Mol. Cell. Biol. 20: 5310-5320, 2000; Zhao and Manley, Mol. Cell. Biol. 18:5010-5020, 1998). Much research has been devoted to characterizing the forms and regulation of mammalian

PAP. Multiple splice variants of mammalian PAP mRNA have been described, some of which do not seem to be translated (Wahle et al, EMBO J. 10:4251-4257, 1991; Thuresson et al, Proc. Natl. Acad. Sci. USA, 91:979-983, 1994; Zhao and Manley, Mol. Cell. Biol. 16:2378-2386, 1996). In addition, PAP activity is regulated by phosphorylation, which produces additional distinct molecular species. Because of this complexity, PAPs have been reported that vary in estimated molecular weight from about 36 kDa to at least 106 kDa. The longest translated variant, PAP II, is thought to be the major functional form of the enzyme.

Recently, a testis-specifϊc PAP, called TPAP, was described and shown to be localized in the cytoplasm of mouse spermatocytes (Kashiwabara et al, Devel. Biol. 228: 106-115, 2000). Interestingly, TPAP appears to be the product of a processed retroposon derived from an alternatively spliced form of PAP mRNA (Zhao and Manley, Mol. Cell. Biol. 16: 2378-2386, 1996). Although the gene encoding TPAP was initially believed to be an inactive pseudogene (Zhao and Manley, Mol. Cell. Biol. 16: 2378-2386, 1996), these more recent results suggest that it is active, and that TPAP may function in cytoplasmic polyadenylation.

SUMMARY OF THE DISCLOSURE This disclosure provides a new poly(A) polymerase, referred to as neo-PAP, which is a cancer-testis antigen. Examples of this polymerase include proteins that have the amino acid sequence shown in SEQ ID NO: 2, sequences having at least 75% sequence identity to that prototypical sequence, or conservative variants of such sequences. In certain embodiments, the polymerase or variant has poly(A) polymerase activity.

Also provided are isolated nucleic acid molecules that encode a neo-PAP protein. Specific examples of such nucleic acid molecules include molecules that include the sequence shown in SEQ ID NO: 1, or a sequence having at least 65% sequence identity with that sequence. Also provided are fragments of such sequences (such as probes or primers), or nucleic acid fusions encoding protein fusions that contain a part of a neo-PAP protein. Such nucleic acid molecules can optionally be functionally connected to a promoter (in sense or antisense orientation), contained within a vector or other recombinant nucleic acid construct, and/or used to transform a cell. The resulting vectors, recombinant constructs, and transformed cells are further provided embodiments. The disclosure also provides methods, including methods of detecting a biological condition associated with an abnormal neo-PAP nucleic acid or an abnormal neo-PAP expression in a subject (such as a neoplasm). Examples of such methods involve determining whether the subject has abnormal neo-PAP nucleic acid or abnormal neo-PAP expression. Further embodiments include kits for detecting neo-PAP protein (or an antibody directed thereto) or encoding nucleic acid, for instance an excess or deficiency of neo-PAP in a subject. Examples of such kits include kits for detecting protein using an antibody, kits for detecting antibody using a protein antigen, kits for detecting a genetic mutation in a neo-PAP encoding sequence, kits for detecting the over (or under) expression of neo-PAP mRNA, and so forth. Specific kits provided in the disclosure are in vitro assay kits for determining whether or not a subject has a biological condition associated with an abnormal neo-PAP expression, for instance for determining whether the subject has or is susceptible to developing neoplasia.

Further embodiments provide methods of modifying a level of expression of a neo-PAP protein in a subject. In such methods, a recombinant genetic construct comprising a promoter operably linked to a nucleic acid molecule is expressed in a cell of the subject, wherein the nucleic acid molecule comprises at least 15 consecutive nucleotides of a neo-PAP encoding sequence (such as that shown in SEQ ID NO: 1). Expression of the nucleic acid molecule changes expression of the neo-PAP protein in the subject. In specific examples of such methods, expression of the neo-PAP protein is increased (e.g., through over-expression) or decreased (e.g., through antisense suppression). The disclosure also provides methods of screening for a compound useful in influencing neo-PAP-mediated poly(A) polymerization in a mammal, which methods involve determining if a test compound binds to or interacts with a neo-PAP protein, or variants or fragments thereof, and selecting a compound that so binds. Certain of these methods will identify compounds that inhibit a biological activity of a neo-PAP protein.

Further embodiments are methods of using the provided neo-PAP proteins as active poly(A) polymerases. Such methods include methods of adding a poly(A) tail to an RNA molecule, involving incubating the RNA molecule with a neo-PAP protein. Other methods enable the addition of a 3' label to an RNA molecule, comprising incubating the RNA molecule with a neo-PAP protein in the presence of a labeled adenine nucleoside.

The disclosure also provides methods of eliciting an immune response in an animal (for instance, a human or other mammal) by introducing into the animal a pharmaceutical composition comprising a neo-PAP protein or immunogenic fragment thereof. The induced immune response, in some embodiments, confers increased resistance of the animal to neoplasia. Pharmaceutical compositions containing an immunologically effective amount of a neo-PAP protein or immunogenic fragment thereof are also provided.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Recognition of neo-PAP peptides by CD4+ T lymphocytes. Fig. 1 A: Synthetic peptides corresponding to the amino acid sequence predicted by the sequence of cDNA library clone IB11 were pulsed onto 1087-EBV-transformed B cells at the concentrations shown, and co-cultured with T cells overnight. Culture supernatants were then assessed for secretion of the cytokine GM- CSF, indicating T cell activation, by ELISA. A minimal 11-mer peptide was identified which conferred T cell recognition. Fig. B: Peptides based on sequences from neo-PAP or classic PAP were assessed for recognition by TIL 1087. Neo-PAP and PAP peptides are identical except for the residues underlined. Only neo-PAP peptides stimulated TIL.

Figure 2. Nucleotide and amino acid sequences of neo-PAP. Fig 2A: Homology between neo-PAP and human PAP II protein sequences. Fig. 2B: Alignment of amino acid sequences of the C-terminal domains of neo-PAP and human PAP II. (*), NLS; bold, non-consensus cdk site; bold and underline, consensus cdk site; (+), conserved amino acid; (-), no amino acid.

Figure 3. Neo-PAP has non-specific polyadenylation activity. Fig. 3A: PAP I and neo-PAP proteins utilized in subsequent experiments were resolved on an 8% SDS-PAGE and Coomassie stained. (Lanes 1, 2) 1.2 μg of recombinant PAP I and neo-PAP expressed in and purified from E. coli. Fig. 3B: Efficiencies of incorporation of [α-³²P]-labeled nucleotides. The relative amounts of incorporated nucleotides [α-³²P]-ATP and [α-³²P]-GTP were measured. Assay conditions are described in Materials and Methods. Fig. 3C: Increasing amounts (1, 2.5, 10, 50 ng) of PAP I (lanes 2-5) and neo-PAP (lanes 7-10) were assayed in a non-specific polyadenylation assay, using a 172 nucleotide ³²P-labeled RNA substrate. RNA products were resolved by denaturing PAGE. Figure 4. Neo-PAP has specific polyadenylation and cleavage activity. Fig.4A: Recombinant PAP I, neo-PAP or purified CPSF, alone or in the indicated combinations, were added to reaction mixtures containing either wild-type (AAUAAA) or mutant (AAAAAA) ³²P-labeled pG3SVL-A pre-RNA. Fig. 4B: Increasing amounts (5, 20 ng) of PAP I (lanes 2, 3) or neo-PAP (lanes 4, 5) were assayed in a reconstitution cleavage assay (see Materials and Methods). Arrows indicate the positions of upstream (5') and downstream (3') cleavage products. In both Fig. 4A and Fig. 4B, RNA products were resolved by denaturing PAGE.

Figure 5. Neo-PAP and classic PAP are differentially phosphorylated. Western blotting with an anti-HA epitope antibody was performed on extracts of 293 cells that were not transfected (DNA "none") or transfected with plasmids encoding green fluorescent protein (GFP), HA-PAP II or HA-neoPAP. Some lysates (+) were treated with potato acid phosphatase prior to loading onto 4- 20% SDS PAGE. Cell equivalents per lane = 1.6 x 10⁵. Results are representative of three separate experiments.

Figure 6. Neo-PAP and PAP are both overexpressed in human cancers, but have distinct splicing patterns. Northern blots containing 10 μg total RNA/lane (upper right and left) or approximately 2 μg poly(A)⁺ RNA/lane (lower right and left) were hybridized with a neo-PAP probe followed by β-actin, then stripped and reprobed with PAP, followed again with β-actin. Blots probed with neo-PAP or PAP were exposed to film for 67 - 72 hours or with β-actin for 2 - 2.5 hours. Lane 1) 1087-mel, 2) 1532-CPTX, 3) 1535-CPTX, 4) 1542-CPTX, 5) CY13, 6) LoVo, 7) SW480, 8) 293 cells 9) 1087-EBV, 10) 1087 PBL, 11) 1532 PBL, 12) 1535 PBL, 13) brain, 14) colon, 15) heart, 16) kidney, 17) liver, 18) lung, 19) muscle, 20) placenta, 21) small intestine, 22) spleen, 23) stomach, 24) testis. Figure 7. Predominant normal tissue expression of neo-PAP is found in testis. Products of RT-PCR with primers specific for neo-PAP or β-actin were stained with ethidium bromide and electrophoresed on a 0.8% agarose gel.

Figure 8. Specific recognition of cDNA IB11 by CD4+ TEL 1087. Genetically modified 293 cells (293IMDR7 for TIL 1087, 293IMDR1 for TIL 1558) were transfected with the indicated plasmids and then co-cultured with CD4+ T cells. TIL 1087 secreted GM-CSF specifically in response to autologous whole 1087-mel cells and to 293 cells transfected with pliSO/IBl l mel or pIi80/IBl 1 EBV.l, but not with the out-of-frame construct pIi80/IBl 1 EBV.2 nor the irrelevant plasmid pli80/ TPI_mut. Conversely, TIL 1558 recognized autologous melanoma cells and 293 cells transfected with the mutated TPI construct, but were not stimulated by IB11 transfectants.

Figure 9. Demonstration of a mutant neo-PAP allele in 1087-mel. Restriction digestion of RT-PCR products demonstrates the presence of a mutated allele in neo-PAP derived from fresh and cultured 1087 melanomas. As a negative control, the last two lanes illustrate that neo-PAP from 888- mel is not cleaved. Bfr I cleavage products were electrophoresed on a 1% agarose gel. Figure 10. Northern blot analysis of neo-PAP expression. Blots probed with a 5' cDNA fragment from neo-PAP were exposed to X-ray film for 4 or 5 days (tumor blot and normal tissue blot, respectively). Blots probed for β-actin were exposed for 7 hours.

Figure 11. Western blot analysis to determine the specificity of anti-neo-PAP antisera. Fig. 11A: Western blot analysis demonstrates the specific staining of the 83 kDa neo-PAP protein using the mouse anti-neo-PAP antiserum. Fig 1 IB: Western blot analysis demonstrates the specific staining of the 83 kDa neo-PAP protein using the rabbit anti-neo-PAP antiserum. Fig. 11C: The neo- PAP protein is apparent at about 83 kDa and the PAP II protein at about 85 kDa in a Coomassie blue stained gel.

SEQUENCE LISTING

The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:

SEQ ID NO: 1 shows the nucleic acid sequence of the neo-PAP cDNA, and the amino acid sequence of the encoded protein. Though not explicitly shown in the sequence listing, the mutant neo-PAP has a C>T substitution at residue 2159. SEQ ID NO: 2 shows the amino acid sequence of the neo-PAP protein. Though not explicitly shown in the sequence listing, the mutant neo-PAP has a P>L substitution at residue 643.

SEQ ID NOs: 3-7 and 9-12 show the nucleic acid sequences of a series of oligonucleotides used in in vitro amplification reactions as described in the Examples. SEQ ID NO: 8 shows the amino acid sequence of a peptide epitope tag. SEQ ID NO: 13 shows the amino acid sequence of a fusion oligonucleotide containing the FLAG epitope tag.

DETAILED DESCRIPTION

Abbreviations aa amino acid

CPSF cleavage/polyadenylation stimulation factor

CstF cleavage stimulation factor

CTD carboxy-terminal domain

FAM 6-carboxyfluorescein

NLS: nuclear localization signal

PAP poly(A) polymerase

TAMRA 6-carboxy-tetramethykhodamine

II. Terms

Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182- 9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

In order to facilitate review of the various embodiments, the following explanations of specific terms are provided:

Antisense, Sense, and An igene: Double-stranded DNA (dsDNA) has two strands, a 5' -> 3' strand, referred to as the plus strand, and a 3' -> 5' strand (the reverse complement), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus strand of the DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).

Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a dsDNA target. cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and transcriptional regulatory sequences. cDNA may also contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA molecule. cDNA is usually synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells. DNA (deoxyribonucleic acid): DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)). The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine (A), guanine (G), cytosine (C), and thymine (T) bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide, or for a stop signal. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.

Unless otherwise specified, any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single-strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double-stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes a specific protein, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence of the disclosed nucleic acid molecules.

Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.

"Specifically hybridizable" and "specifically complementary" are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.

Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na⁺ concentration) of the hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11, herein incorporated by reference. For present purposes, "stringent conditions" encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence. "Stringent conditions" may be broken down into particular levels of stringency for more precise definition. Thus, as used herein, "moderate stringency" conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of "medium stringency" are those under which molecules with more than 15% mismatch will not hybridize, and conditions of "high stringency" are those under which sequences with more than 10% mismatch will not hybridize. Conditions of "very high stringency" are those under which sequences with more than 6% mismatch will not hybridize.

The degree to which a probe hybridizes to a target molecule under various stringency conditions may vary depending on the specific probe selected. For instance, as illustrated in Figures 2B and 2C, an N-terminal region of neo-PAP shares 87% homology to the N-terminal catalytic domain of PAP. In contrast, a more C-terminal region of neo-PAP shares only about 36% homology to classic PAP.

Injectable composition: A pharmaceutically acceptable fluid composition including at least one active ingredient. The active ingredient is usually dissolved or suspended in a physiologically acceptable carrier, and the composition can additionally include minor amounts of one or more non-toxic auxiliary substances, such as emulsifying agents, preservatives, and pH buffering agents and the like. Such injectable compositions that are useful for use with the provided nucleotides and proteins are conventional; appropriate formulations are well known in the art.

Isolated: An "isolated" biological component (such as a nucleic acid molecule, protein or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extra- chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.

Nucleotide: "Nucleotide" includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is one monomer in a polynucleotide. A nucleotide sequence refers to the sequence of bases in a polynucleotide. Oligonucleotide: An oligonucleotide is a plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 500 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.

Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 300 nucleotides in length, for example a sequence (such as DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 or more bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15, 20, or 25 bases.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.

Open reading frame: A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide.

Ortholog: Two nucleic acid or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.

Parenteral: Administered outside of the intestine, e.g., not via the alimentary tract. Generally, parenteral formulations are those that will be administered through any possible mode except ingestion. This term especially refers to injections, whether administered intravenously, intrathecally, intramuscularly, intraperitoneally, or subcutaneously, and various surface applications including intranasal, intradermal, and topical application, for instance.

Peptide Nucleic Acid (PNA): An oligonucleotide analog with a backbone comprised of monomers coupled by amide (peptide) bonds, such as amino acid monomers joined by peptide bonds.

Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful with the compositions provided herein are conventional. Martin, Remingto 's Pharmaceutical Sciences, published by Mack Publishing Co., Easton, PA, 19th Edition, 1995, describes compositions and formulations suitable for pharmaceutical delivery of the nucleotides and proteins herein disclosed.

In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

PoIy(A) polymerase activity: A poly(A) polymerase mediates the addition, specifically or no-specifically, of a string of adenine residues onto an RNA molecule, such as a messenger RNA (mRNA) molecule. Poly(A) polymerase activity can be measured using various assays known to those of ordinary skill in the art, including those assays provided herein in Example 3.

Polymorphism: Variant in a sequence of a gene. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, geographic locations. The term polymorphism also encompasses variations that produce gene products with altered function, i.e., variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also encompasses variations that produce no gene product, an inactive gene product, or increased gene product. The term polymorphism may be used interchangeably with allele or mutation, unless context clearly dictates otherwise. Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule that is linked to the variation (e.g., an alteration of a secondary structure such as a stem-loop, or an alteration of the binding affinity of the nucleic acid for associated molecules, such as polymerases, RNases, and so forth). Probes and primers: Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided as indicators of disease or disease progression. It is also appropriate to generate probes and primers based on fragments or portions of these nucleic acid molecules. Also appropriate are probes and primers specific for the reverse complement of these sequences, as well as probes and primers to 5' or 3' regions. A probe comprises an isolated nucleic acid attached to a detectable label or other reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).

Primers are short nucleic acid molecules, for instance DNA oligonucleotides 10 nucleotides or more in length. Longer DNA oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other in vitro nucleic-acid amplification methods known in the art. Methods for preparing and using nucleic acid probes and primers are described, for example, in Sambrook et al. (In Molecular Cloning: A Laboratoiy Manual, CSHL, New York, 1989), Ausubel et al. (ed.) (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998), and Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990). Amplification primer pairs (for instance, for use with polymerase chain reaction amplification) can be derived from a known sequence such as the neo-PAP sequences described herein, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, MA).

One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 30 consecutive nucleotides of a neo-PAP protein encoding nucleotide will anneal to a target sequence, such as another homolog of the designated neo-PAP protein, with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in order to obtain greater specificity, probes and primers can be selected that comprise at least 20, 23, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of a neo-PAP protein- encoding nucleotide sequences.

Also provided are isolated nucleic acid molecules that comprise specified lengths of the disclosed neo-PAP nucleotide sequences. Such molecules may comprise at least 10, 15, 20, 23, 25, 30, 35, 40, 45 or 50 or more (e.g., at least 100, 150, 200, 250, 300 and so forth) consecutive nucleotides of these sequences or more. These molecules may be obtained from any region of the disclosed sequences (e.g., a neo-PAP nucleic acid may be apportioned into halves or quarters based on sequence length, and isolated nucleic acid molecules may be derived from the first or second halves of the molecules, or any of the four quarters, etc.). A neo-PAP cDNA or other encoding sequence also can be divided into smaller regions, e.g. about eighths, sixteenths, twentieths, fiftieths, and so forth, with similar effect. Another mode of division, provided by way of example is to divide a neo-PAP encoding sequence based on the regions of the sequence that are relatively more or less homologous to the classic PAP sequence. Thus, nucleic acid molecules, for instance to be used as hybridization probe molecules, may be selected from the N-terminal region (e.g., about residues 232-2100, or a fragment thereof) of the human neo-PAP-cDNA shown in SEQ ID NO: 1, or from a C-terminal region (e.g., about residues 2100-2442, or a fragment thereof).

Another mode of division is to select the 5' (upstream) and/or 3' (downstream) region associated with a neo-PAP gene.

Nucleic acid molecules may be selected that comprise at least 10, 15, 20, 25, 30, 35, 40, 50, 100, 150, 200, 250, 300 or more consecutive nucleotides of any of these or other portions of a human neo-PAP nucleic acid molecule, such as those disclosed herein, and associated flanking regions.

Thus, representative nucleic acid molecules might comprise at least 10 consecutive nucleotides of the human neo-PAP cDNA shown in SEQ ID NO: 1. Protein: A biological molecule expressed by a gene or recombinant or synthetic coding sequence and comprised of amino acids.

Purified: The term "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell or within a production reaction chamber (as appropriate).

Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.

Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.

Homologs or orthologs of human neo-PAP protein, and the corresponding cDNA or gene sequence, will possess a relatively high degree of sequence identity when aligned using standard methods. This homology will be more significant when the orthologous proteins or genes or cDNAs are derived from species that are more closely related (e.g., human and chimpanzee sequences), compared to species more distantly related (e.g., human and C. elegans sequences).

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman Adv. Appl Math. 2: 482, 1981; Needleman & Wunsch J. Mol. Biol. 48: 443, 1970; Pearson & Lipman Proc. Natl. Acad. Sci. USA 85: 2444, 1988; Higgins & Sharp Gene, Ti: 237-244, 1988; Higgins & Sharp CABIOS 5: 151- 153, 1989; Corpet et α/. Nuc. Acids Res. 16, 10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al. Meth. Mol. Bio. 24, 307-31, 1994. Altschul et al. (J. Mol. Biol. 215:403-410, 1990) presents a detailed consideration of sequence alignment methods and homology calculations.

The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. J. Mol. Biol. 215:403-410, 1990) is available from several sources, including the National Center for

Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. By way of example, for comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment is performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence- dependent and are different under different environmental parameters. Generally, stringent conditions are selected to be about 5° C to 20° C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence remains hybridized to a perfectly matched probe or complementary strand. Conditions for nucleic acid hybridization and calculation of stringencies can be found in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Tijssen (Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes Part I, Chapter 2, Elsevier, New York, 1993). Nucleic acid molecules that hybridize under stringent conditions to a human neo-PAP protein-encoding sequence will typically hybridize to a probe based on either an entire human neo-PAP protein-encoding sequence or selected portions of the encoding sequence under wash conditions of 2x SSC at 50° C. Nucleic acid sequences that do not show a high degree of sequence identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein.

Specific binding agent: An agent that binds substantially only to a defined target. Thus a protein-specific binding agent binds substantially only the specified protein. By way of example, as used herein, the term "neo-PAP-protein specific binding agent" includes anti-neo-PAP protein antibodies (and functional fragments thereof) and other agents (such as soluble receptors) that bind substantially only to the neo-PAP protein.

Anti-neo-PAP protein antibodies may be produced using standard procedures described in a number of texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). The determination that a particular agent binds substantially only to the specified protein may readily be made by using or adapting routine procedures. One suitable in vitro assay makes use of the Western blotting procedure (described in many standard texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988)). Western blotting may be used to determine that a given protein binding agent, such as an anti-neo-PAP protein monoclonal antibody, binds substantially only to the neo-PAP protein.

Shorter fragments of antibodies can also serve as specific binding agents. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to a specified protein would be specific binding agents. These antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab')2, a dimer of two Fab' fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (6) single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine.

Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals. Target sequence: "Target sequence" is a portion of ssDNA, dsDNA or RNA that, upon hybridization to a therapeutically effective oligonucleotide or oligonucleotide analog, results in the inhibition of expression. For example, hybridization of therapeutically effectively oligonucleotide to a neo-PAP target sequence results in inhibition of neo-PAP expression. Either an antisense or a sense molecule can be used to target a portion of dsDNA, since both will interfere with the expression of that portion of the dsDNA. The antisense molecule can bind to the plus strand, and the sense molecule can bind to the minus strand. Thus, target sequences can be ssDNA, dsDNA, and RNA. Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including fransfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.

Tumor: A neoplasm that may be either malignant or non-malignant. "Tumors of the same tissue type" refers to primary tumors originating in a particular organ (such as breast, prostate, bladder or lung). Tumors of the same tissue type may be divided into tumor of different sub-types (a classic example being bronchogenic carcinomas (lung tumors) which can be an adenocarcinoma, small cell, squamous cell, or large cell tumor). Breast cancers can be divided histologically into scirrhous, infiltrative, papillary, ductal, medullary and lobular.

Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art.

Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in practice or testing, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

III. Overview

Processing of mRNA precursors, a critical step in gene expression, comprises an integrated series of reactions mediated by large and complex set of factors (Hirose and Manley, Genes Dev. 14: 1415-1429, 2000). Poly(A) polymerase is a critical player in RNA processing: it not only catalyzes poly(A) synthesis and participates in endonucleolytic cleavage of pre-mRNA, but it also interacts with other proteins, including for example splicmg factors that may help coordinate polyadenylation and splicing (Vagner et al, Genes Devel. 14: 403-413, 2000).

The current disclosure demonstrates the existence of a novel poly(A) polymerase, neo-PAP, which shares many of the characteristics of the originally described enzyme. Common to both PAPs are their protein domain organization, subcellular nuclear localization, and in vitro functions. Northern blotting data disclosed herein demonstrate that both PAPs are overexpressed in human tumors, a finding consistent with previous studies of PAP. Overexpression of classic PAP mRNA has been demonstrated in human carcinomas originating in breast, colon, ovary and pancreas, compared to expression in nonnal tissue counterparts (Pendurthi et al, Proc. Natl. Acad. Sci. USA 94: 12598-12603, 1997). Furthermore, the polyadenylation activity of crude or partially purified cell extracts has been shown to be significantly enhanced in acute leukemias as compared to chronic leukemias and normal lymphocytes (Trangas et al, Cancer Res. 44: 3691-3697, 1984), and in aggressive as compared to more indolent forms of breast cancer (Scorilas et al, Cancer Res. 60: 5427-5433, 2000), indicating that PAP levels might correlate with clinical prognosis. A role for classic PAP in sustaining activated or hyperproliferative cell states has also been postulated on the basis of experiments showing elevated polyadenylation activity or enhanced PAP mRNA in PHA- stimulated human lymphocytes (Courtis et al, Mol. Cell. Biochem. 75: 33-42, 1987) and factor VII- stimulated human fibroblasts (Pendurthi et al, Proc. Natl. Acad. Sci. USA 94: 12598-12603, 1997), respectively. In retrospect, while previous investigations conducted with Northern blotting were specific for PAP, assays for enzymatic activity in cell extracts could have reflected expression of PAP, neo-PAP, or both.

The factors required for polyadenylation of nuclear mRNA precursors have been extensively studied in both mammals and yeast. Nearly all the factors have been cloned during the last decade, beginning with PAP in 1991 (Lingner et al, Nature 354: 496-498, 1991; Raabe et al, Nature 353: 229-234, 1991; Vagner et al, Genes Devel. 14: 403-413, 2000). Sequencing of bovine cDNAs led to the investigation of PAP isoforms, created by alternative splicing, which was confirmed by more detailed analysis of the mouse gene and cDNAs (Zhao and Manley, Mol. Cell. Biol. 16: 2378-2386, 1996). However, there was until very recently no evidence for a second PAP gene, or indeed any indications that more than a single gene existed for any of the known polyadenylation factors. Although no significant differences in the biochemical properties of neo-PAP relative to PAP have yet been identified, neo-PAP may have unique properties in vivo that allow it to modulate the efficiency of 3' end formation or poly(A) tail length of specific genes. Alternatively, it may be functionally equivalent to PAP but exist to allow precise quantitative control of PAP levels in different tissues and/or cell growth states. It is known that PAP levels must be tightly regulated (Zhao and Manley, Mol. Cell. Biol. 18: 5010-5020, 1998), and it may be that a second gene allows more precise control under a variety of conditions.

Neo-PAP went undiscovered for a decade after identification of PAP. Purification of PAP and cloning of PAP cDNAs was from bovine tissues (Raabe et al, Nature 353: 229-234, 1991; Wahle et al, EMBO J. 10: 4251-4257, 1991), and it is conceivable that neo-PAP is not present in bovine or not expressed in the tissues analyzed. Alternatively, neo-PAP may behave poorly during extraction or purification. Whatever the reason, it now seems that similar or related proteins exist for many factors that function in gene expression in metazoans (Tuppler et al, Nature 409: 832-833, 2001). This includes not only gene-specific regulatory factors, but also many of the general factors that participate in transcription, splicing and, as mentioned above, polyadenylation.

The existence of multiple forms of a polymerase is unexpected, but is consistent with the idea that PAP plays an important role in gene control (e.g., Zhao and Manley, Mol. Cell. Biol. 18: 5010-5020, 1998). Key elements of the PAP regulatory region, such as the dual NLSs, putative cdk phosphorylation sites, and the very C-terminal splicing factor interaction domain, are well conserved in neo-PAP. On the other hand, none of these motifs are 100% identical, and it is possible that future studies will reveal differences in the behavior of PAP and neo-PAP.

Despite their similarities, neo-PAP and PAP demonstrate unique properties. One difference is their mRNA splicing patterns: on Northern blots, neo-PAP displayed only the longest of the splice variants observed for PAP. Neo-PAP does not seem to be susceptible to the same regulatory controls as PAP. Although neo-PAP contains a conserved cyclin recognition motif (Bond et al, Mol. Cell. Biol. 20: 5310-5320, 2000) and multiple C-terminal cdk phosphorylation sites, (Colgan et al, Nature 384: 282-285, 1996; Colgan et al., EMBOJ. 17: 1053-1062, 1998) phosphorylation of neo-PAP could not be demonstrated in Western blots of transient or stable transfectants of proliferating human cells. Coupled with overexpression of neo-PAP message in cancers, it is believed that neo-PAP is an aberrantly regulated polymerase enzyme that supports rapid cell proliferation. The existence of such an enzyme was postulated by Jacob et al, (Cancer Res. 49: 2827-2833, 1989), who purified nuclear protein fractions with polyadenylation activity from rat hepatomas or normal rat liver and described their distinct properties. However, the much smaller molecular weight, signature amino acid composition, and hyperphosphorylated state of the rat hepatoma PAP are inconsistent with prior characterization of neo-PAP (Jacob et al, Cancer Res. 49: 2827-2833, 1989; Rose et al, Eur. J. Biochem. 67: 11-21, 1976). IV. Identification and Characterization of neo-PAP

The current disclosure describes a novel form of vertebrate poly(A) polymerase, identified by molecular cloning from a human tumor cell cDNA library. Due to its identification and overexpression in human neoplasms, this molecule is designated neo-poly(A) polymerase (neo-PAP). Neo-PAP is indistinguishable in vitro from the original PAP in its biochemical functions. However, significant sequence dissimilarities in the CTD of neo-PAP compared to PAP, as well as marked differences in the phosphorylation of these two molecules, indicate that each may be influenced by distinct regulatory controls.

Neo-PAP was identified as a new melanoma tumor antigen, which is recognized by a tumor infiltrating lymphocyte ("TIL" 1087). Wildtype neo-PAP peptides that are recognized by TIL 1087 were identified ( for example, residues 724-734 of SEQ ID NO: 1); this confirms that neo-PAP is the antigenic protein recognized by TIL 1087. A cryptic nonmutated HLA-DRβl*0701-restricted neo- PAP epitope was determined to be processed through the endogenous class II pathway. In addition, a single nucleotide polymorphism (SNP) has been identified. This mutation, the result of a C>T nucleotide substitution (residue 2159 of SEQ ID NO: 1), replaces a proline with a leucine residue (at position 643 of SEQ ID NO: 2) at a site 80 amino acids upstream from the nonmutated T cell epitope, revealing a normally silent epitope for immune recognition. Fortuitously, this point mutation creates a new and identifiable restriction site (for restriction endonuclease Bfr I) within the neo-PAP coding region, thereby facilitating detection of this SNP. In other words, this SNP also can be used as a restriction fragment length polymorphism (RFLP) marker.

Using Northern blot analysis, the tissue expression pattern of neo-PAP has been characterized. Neo-PAP cDNA is expressed at a high level in all tumor cell lines tested, as well as in normal human testis tissue. Only very low expression is seen in other "normal" human tissues. Thus, neo-PAP behaves as a so-called "cancer-testis" antigen, one category of melanoma-associated antigens (MAAs) that are recognized by cytotoxic T-lymphocytes (Castelli et al, J. Cell. Phys., 182:323-331, 2000). Other representatives of the class of cancer-testis antigens are the MAGE superfamily and NY-ESO- 1 (see, Castelli et al. , 2000 ; Chen and Old, Cancer J. Sci. Am., 5:16-17, 1999; Jager et al, J. Exp. Med., 187:265-270, 1998). Melanoma-associated antigens are being used to develop immunotherapy-based cancer treatments (e.g., anti-cancer vaccines).

V. Neo-PAP Protein and Nucleic Acid Sequences

Neo-PAP proteins and neo-PAP nucleic acid molecules, including cDNA sequences, are provided.

Neo-poly(A) polymerase (neo-PAP), a novel template-independent RNA polymerase, was cloned from a tumor-derived cDNA library. The cDNA sequence of 3.7 kb encoded an 82.8 kD protein bearing 71% overall homology to human PAP, and having a similar organization of putative functional domains. Neo-PAP and PAP were indistinguishable in in vitro assays of specific and nonspecific polyadenylation and endonucleolytic cleavage of pre-RNA, consistent with significant sequence conservation between their N-terminal catalytic domains. Nuclear localization of wildtype and mutant neo-PAP, demonstrated by immunofluorescence microscopy, was predicted by conserved NLS motifs at residues 488-506 and 644-659 of SEQ ID NO: 2. However, notable sequence disparities in the C-terminal domains (CTD) of neo-PAP versus PAP indicate that these molecules are differentially regulated.

While PAP is phosphorylated throughout the cell cycle and hyperphosphorylated during M phase, neo-PAP did not show evidence of phosphorylation on Western blot analysis. This was unexpected in the context of a conserved cyclin recognition motif and multiple cdk phosphorylation motifs in neo-PAP. Putative phosphorylation sites include residues 541-548, 552-555, 599-602, 620- 623, 642-645, 648-651, and 654-657 of SEQ ID NO: 2. Northern blot analysis demonstrated distinct mRNA splicing patterns in the two PAPs but a similar degree of overexpression in human cancers, compared to normal or virally transformed cells. Thus, while neo-PAP was shown to be an RNA polymerase that is overexpressed in malignant cells, its regulation is different from classic PAP.

The invention is illustrated by, but not limited by, the following non-limiting Examples.

EXAMPLES

EXAMPLE 1: Isolation of Human Neo-PAP as a Novel Melanoma Antigen and Identification of the Epitope Recognized by CD4+ TIL 1087

This example provides an explanation of how human neo-PAP was first isolated and demonstrates how the neo-PAP epitope that is recognized by CD4+ TIL 1087 cells was identified.

Materials and Methods Cell Cultures.

T cell, EBV-transformed B cell, and melanoma cell lines were initiated from specimens derived from patient 1087, a 41 -year-old Caucasian male with metastatic melanoma. Tumor infiltrating lymphocytes (TIL) were cultured from a lymph nodal metastasis according to methods described (Topalian et al. J. Immunol. Methods 102:127-141, 1987). After immunodepletion of CD8+ T cells from growing bulk cultures by panning, TIL 1087 cultures were >95% CD4+ by

FACS. CD4+ TIL 1087 manifested specific lysis and secretion of the cytokines GM-CSF and IFNγ when co-cultured with autologous fresh or cultured melanoma targets (Markus et al, J. Inter. Cyto. Res. 15:739-746, 1995). CD4+ TIL 1558, derived from another melanoma patient, recognize an HLA-DRβl*0101-restricted mutant epitope derived from triosephosphate isomerase (TPI_mut) (Pieper et al, J. Exp. Med. 189:757-765, 1999) and were used as a control in some experiments. The cell line 293IMDR7 was generated for the purpose of cDNA library screening, as follows: cDNA encoding DRβ 1*0701 was amplified from 1087-mel by RT-PCR, ligated into the eukaryotic expression vector pEF6 (Invitrogen) and sequenced. The plasmid pEF6/DR7 was then transfected into 293 cells previously engineered to express the molecules Ii, DMA, DMB and DRA (Wang et al, Science 284:1351-1354, 1999). 293IMDR7 cells were cloned by limiting dilution and maintained in RPMI 1640 + 10% FCS with blasticidin 10 ug/ml for selection. Cell surface expression of HLA-DR7 was confirmed by flow cytometry with a DR7-specific mAb (PelFreez). HLA Typing.

HLA genotyping of tumor and B cell lines was performed by the National Institutes of Health HLA Laboratory (Topalian et al, Int. J. Cancer 58:69-79, 1994). The class II genotype of patient 1087 was found to be DRβl*0701, 12; DQβl*02, 0301; DRβ3*02; DRβ4*01. cDNA Library Construction and Screening. Total RNA was prepared from cultured 1087-mel cells using the Trizol reagent (GIBCO

BRL), and mRNA was twice purified using the PolyATract mRNA Isolation System (Promega). A directional oligo dT-primed cDNA library was then constructed with the Superscript Plasmid System for cDNA Synthesis and Plasmid Cloning (GIBCO BRL) following the manufacturers instructions, except that a Bst XI adapter was substituted for the Sal I adapter provided in the kit. cDNA inserts were ligated into the vector pli80, consisting of the plasmid pEAK8 (Edge Biosystems) plus a DNA sequence encoding the invariant chain fragment Ii 1-80, for expression of endosomally targeted Ii fusion proteins in mammalian cells (Wang et al, J. Exp Med. 189:1659-1667, 1999). The cDNA library was electroporated into DH10B E. coll (GIBCO BRL), and pools of 100 bacterial colonies were grown in deep 96-well blocks (Edge Biosystems). Plasmid DNA was then purified from these pools using the QIAprep 96 Turbo Miniprep Kit (Qiagen) and transfected into subconfluent

293IMDR7 cells growing as adherent monolayers in 96-well flat bottom plates, using the Effectene reagent (Qiagen). After 24 hours, the Effectene/DNA mixture was removed and CD4+ TIL 1087 were added to the plates at 2 x 10⁵ cells/well in RPMI 1640 medium + 2% heat-inactivated human AB serum, with IL2 120 IU/ml (Chiron). Twenty-four hours later, culture supernatants were harvested and assessed for the presence of secreted GM-CSF by ELISA (R+D Systems). DNA Sequencing.

DNA sequencing was performed using the Big Dye Terminator Cycle Sequencing Kit (Perkin-Elmer/ABI). Sequences were determined with an ABI Prism 310 Genetic Analyzer (Perkin- Elmer). Database searches for nucleotide and deduced amino acid sequence similarities were performed with the BLAST program (http ://www.ncbi.nlm.nih. gov/blasf). Peptide Synthesis and T Cell Recognition Assays.

Peptides were synthesized using standard Fmoc chemistry and analyzed for sequence and purity as described (Topalian et al, J. Exp. Med. 183:1965-1971, 1996). To test peptides for recognition by CD4+ TIL 1087, 1087-EBV B cells were dispensed into flat bottom 96-well plates at 1.5 x 10⁵ cells/well in RPMI 1640 + 10% human AB serum. Peptides dissolved in PBS + 1% DMSO were added directly to the wells at various concentrations, for a 20 hour incubation at 37°C. The following day, TIL were added at 2 x 10⁵ cells/well in the presence of IL2 120 IU/ml for another overnight incubation. Then, culture supernatants were harvested and tested for the presence of secreted GM-CSF by ELISA.

Results CD4+ T cells infiltrating a lymph nodal melanoma metastatsis were cultured in the presence of IL2 but without antigen restimulation for up to 100 days. They specifically recognized whole autologous tumor cells (fresh or cultured) expressing MHC class II molecules, as manifested by cytolysis or by release of the cytokines GM-CSF and IFNγ (Markus et al, J. Inter. Cyto. Res. 15:739- 746, 1995). Autologous EBV-B cells were not recognized, nor were allogeneic melanomas sharing various class II molecules with TIL 1087, suggesting that the tumor-specific antigen might be mutated. Significantly, 1087-EBV could not function as an antigen presenting cell (APC) for exogenously pulsed lysates of 1087-mel (Topalian et al., Int. J. Cancer 58:69-79, 1994), nor could allogeneic EBV-B cells that shared class II elements with TIL 1087 and that were capable of processing other exogenous antigens. These results suggested that the tumor antigen recognized by CD4+ TIL 1087 was processed through the endogenous but not the exogenous class II pathway. It was determined that molecular cloning would be the preferred strategy for identifying this antigen, since the alternative biochemical purification approach depends on pulsing sequentially purified protein fractions onto APC for processing through the exogenous pathway for T cell recognition (Pieper etα/., J. Exp. Med. 189:757-765, 1999). In order to apply a molecular cloning approach, it was necessary to determine the MHC class II restriction element for the 1087-mel antigen (Wang et al, Science 284:1351-1354, 1999). Anti-MHC monoclonal antibodies were used to inhibit recognition of 1087-mel by autologous CD4+ T cells, and recognition was abrogated by the monoclonal antibody L243 specific for all HLA-DR molecules (Markus et al, J. Inter. Cyto. Res. 15:739-746, 1995). Genotyping showed that 1087-mel had the potential to express the DR molecules βl*0701, βl*12, β3*02, and β4*01, and monoclonal antibodies specific for each of these were not available. However, by sequencing individual cDNA clones obtained with RT-PCR using one set of primers capable of amplifying all of these DR molecules, we detected the presence of only DRβl*0701 and DRβ4*01, and DRβl*0701 clones predominated. Flow cytometric analysis with a DR7-specific monoclonal antibodies confirmed expression ofthis MHC molecule on the surface of 1087-mel cells. Thus DRβl*0701 was selected as the restriction element for the initial cDNA library screening, and this molecule was transfected stably into 293 cells already engineered to express other components of the class II processing pathway: full length Ii, DMA, DMB, and DRA (Wang et al, Science 284:1351-1354, 1999). The resulting 293IMDR7 cells were used as host cells for transient fransfection of a cDNA library prepared from 1087-mel and ligated into the expression vector pli80. This vector was designed for translation of protein products fused at the N-terminus to the first 80 amino acids of Ii, containing an endosomal targeting sequence for efficient processing of class II-restricted epitopes (Wang et al, Science 284:1351-1354, 1999; Wang et al, J. Exp. Med. 189:1659-1667, 1999; Sanderson et al, Proc. Natl. Acad. Sci. USA 92:7217-7221, 1995).

A library of 1 x 10⁵ cDNA clones from 1087-mel was screened in pools of 100 clones for CD4+ T cell recognition, and a single pool was identified that repeatedly stimulated cytokine secretion from TIL. After subcloning, a 1.8 kb cDNA clone designated IB11 was isolated that conferred T cell recognition upon fransfection into 293IMDR7 cells. DNA sequencing and database searching revealed that the IB11 cDNA sequence did not bear significant similarity to any sequence encoding a human protein of known function. However, it shared 97-100% identity with sequences in the human EST and genome project databases derived from melanoma as well as from fetus, placenta, and a wide range of cancers arising from brain, lung, stomach, endomefrium, prostate, and other sites, suggesting that the encoded protein might be widely expressed in human malignancies. In cDNA IB11, the longest open reading frame of 0.5 kb was not preceded by an initiation codon but was in frame with the Ii 1-80 fusion tag, and was thus predicted to encode a 167 amino acid C- terminal protein fragment. To determine if the recognized epitope derived from 1087-mel was mutated, sequence specific oligonucleotide primers were used for RT-PCR amplification of the same partial cDNA fragment from autologous EBV-transformed B cells, for ligation into the pli80 vector. Surprisingly, although TIL 1087 recognize whole autologous melanoma cells but not whole EBV-B cells, the partial cDNAs derived from both 1087-mel and 1087-EBV had identical sequences, and both encoded proteins that were recognized by CD4+ TIL 1087 after transient fransfection into 293IMDR7 cells (Figure 8). Notably, while an EBV-derived clone ligated in-frame with the Ii fusion sequence was well recognized by T cells (pIi80/IBl 1 EBV.l), an out-of-frame clone was not recognized (EBV.2). As a control, none of these constructs when transfected into 293IMDR1 cells was recognized by DR1 -restricted CD4+ TIL 1558, which instead were specific for mutated TPI (Pieper et al, J. Exp. Med. 189:757-765, 1999). In addition, the reactivity of CD4+ TIL 1087 against

293IMDR7 transfectants was inhibited by the anti-DR mAb L243, and TIL1087 failed to recognize cDNA IB11 when transfected into MHC incompatible 293IMDR1 cells (not shown). Taken together, these results suggest that CD4+ TIL 1087 recognize an HLA-DR7-restricted nonmutated epitope encoded by cDNA clone IB11. To identify the DR7-restricted peptide recognized by TIL 1087, 15-mers overlapping by 10 amino acids were synthesized spanning the putative 167 amino acid sequence encoded by cDNA IB11. These were tested for their ability to stimulate TIL 1087 after being pulsed onto autologous B cells. One stimulatory peptide was identified, at the extreme C-terminus of the molecule. As shown in Figure 1A, a series of shorter overlapping peptides based on this sequence were then synthesized and tested for T cell recognition, identifying a minimal 11-mer epitope with the sequence RVIKNSIRLTL that stimulated cytokine secretion from T cells. EXAMPLE 2: Identification of the Human Neo-PAP cDNA

This example provides an explanation of how the human neo-PAP cDNA was identified, isolated, and characterized.

Materials and Methods

Sequence Derivation and Analysis

Neo-PAP was first isolated as a 1.8 kb cDNA containing 0.5 kb of a partial 3' coding sequence (CDS) and 1.3 kb of 3' untranslated region (UTR). This cDNA was cloned from an oligo d(T)-primed library derived from 1087-mel, a human malignant melanoma cell line. The cDNA was identified by the property that its protein product specifically stimulated CD4⁺ T lymphocytes from a patient with metastatic melanoma (described in Example 1). Using sequence-specific primers, two rounds of 5' RACE were performed on total RNA extracted from 1087-mel or the autologous Epstein Barr virus-transformed B lymphocyte line 1087-EBV (Trizol reagent, GIBCO BRL, Rockville, MD) to isolate the 5' CDS and 5' UTR of neo-PAP, according to the manufacturer's instructions (5' RACE System for Rapid Amplification of cDNA Ends, GIBCO BRL). The entire cDNA sequence of neo- PAP, verified in multiple RACE clones derived from 1087-mel and 1087-EBV and in the original cDNA clone, contained 3752 bp. To further validate this sequence, oligonucleotide PCR primers based on sequences derived from the 5' RACE segment as well as from the original library clone were used to amplify cDNA clones containing the longest open reading frame of neo-PAP (2.2 kb), by performing RT-PCR on total RNA from 1087-mel or 1087-EBV. The forward PCR primer 5'- GGTTGGATGCCTCAGCCATAGTAAG-3' (SEQ ID NO: 3) terminated 125 bp upstream from the initiation codon, and the reverse primer 5'-GATTGCTTGTTCACTTAAGTGAGG-3' (SEQ ID NO: 4) ended 14 bp downstream of the stop codon. PCR was performed using a proofreading DNA polymerase (Vent DNA polymerase, New England Biolabs, Beverly, MA). PCR products were ligated into the pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, InVitrogen,

Carlsbad, CA) and DNA sequencing was performed on seven individual cDNA clones, including 6 clones derived from 1087-mel and one from 1087-EBV, using the Big Dye Terminator Cycle Sequencing Kit (Perkin-Elmer/ABI). Sequences were determined with an ABI Prism 310 Genetic Analyzer (Perkin-Elmer). The complete neo-PAP cDNA sequence of 3.7 kb was deposited in GenBank under Accession Number AF312211. Database searches for nucleotide and deduced amino acid sequence homologies were performed with the Blast program (http://www.ncbi.nlm.nih.gov/blast). Plasmid Constructs

For expression of neo-PAP protein in E. coli and subsequent purification, its CDS was cloned into the prokaryotic expression vector pET-14b, which encodes an N-terminal polyhistidine fusion tag for affinity purification (Novagen, Madison, WI). The neo-PAP CDS was amplified by PCR, using cDNA ligated into the pCR-Blunt II-TOPO vector (see above) as the template. The forward PCR primer 5'-CAGCTCGAGATGAAAGAGATGTCTGC-3ΪSEO ID NO: 5) and the reverse PCR primer 5'-TATCTCGAGTTACCGATTAAGGGTCAGTCG-3' (SEQ ID NO: 6) contained Xho I restriction sites (underlined) and translation initiation and termination codons (bold). Complete DNA sequencing was performed on the neo-PAP insert after ligation into pET14b. For expression and detection of neo-PAP in eukaryotic cells, the CDS was again amplified by PCR and cloned into the pEAK8 vector (Edge Biosystems, Gaithersburg, MD). The forward primer 5'-

CACCACGATATCCACCATGTACCCATACGATGTTCCAGATTACGCTATGAAAGAGATGTCT

GC-3' (SEQ ID NO: 7) contained an EcoR V restriction site (underlined) and a 30 bp sequence encoding an N-terminal influenza virus hemagglutinin (HA) epitope tag for antibody-mediated detection (italics) (Chen et al, Proc. Natl. Acad. Sci. USA 90: 6508-6512, 1993). The reverse PCR primer contained a Not I restriction site. Using a similar strategy, a cDNA encoding bovine PAP II with an N-terminal HA fusion tag was cloned into the Hind III and Not I sites of pEAK8. The bovine PAP II cDNA sequence corresponds to GenBank accession X61585 (Wahle et al, EMBOJ. 10:4251- 4257, 1991), and the translated protein is 98.5% identical to human PAP II.

Results

The neo-PAP cDNA sequence contains 3752 bp predicted to encode a protein of 736 aa with a predicted apparent molecular weight of 82.8 kD (Figure 2A). This sequence has been submitted to GenBank under accession no. AF312211. Database queries for nucleotide homologies with molecules having known functions revealed the most significant homology with human PAP (GenBank X76770), which showed regions of up to 86% nucleotide identity, followed by non-human PAPs with somewhat lower segmental identities. However, searching the expressed sequence tag (est) and genome project databases revealed dozens of nucleotide entries with 95-100% identities to neo-PAP. Most of these sequences were derived from human placenta, fetus, or a wide variety of neoplasms including leukemias, melanoma, and cancers originating from brain, colon, lung, stomach, endomefrium, and pancreas. Hence, rather than representing a previously unrecognized splice variant of PAP, neo-PAP is transcribed from a gene distinct from the original PAP. This was confirmed by searching the human genome database (for instance, as found at http://www.ncbi.nlm.nih.gov/genome/guide/) and finding that neo-PAP cDNA was nearly 100% identical in its entirety to sequences located on chromosome 2 (working draft NT_005399.1). In contrast, the original human PAP gene is located on chromosome 14 (Yamauchi et al, Hum. Genet. 44:253-255, 1999). The apparent organization of the neo-PAP gene into 22 exons on chromosome 2 recapitulates the intron-exon structure defined for murine PAP (Zhao and Manley, Mol. Cell. Biol. 16:2378-2386, 1996).

The deduced neo-PAP protein sequence of 736 aa was found, through protein database searching, to have an overall homology of 71% to human PAP (Swissprot P51003). It also had approximately the same degree of homology to non-human PAPs, which was expected due to the high degree of amino acid sequence conservation among the vertebrate PAPs. However, neo-PAP was not significantly homologous to other molecules with known functions. Neo-PAP appeared to be organized into functional domains that recapitulated those of the original PAP (Figure 2B). An N- terminal region of almost 500 aa was 87% homologous to the N-terminal catalytic domain of PAP, suggesting that neo-PAP might have a similar polymerase function.

Also similar to PAP, neo-PAP contained two bipartite NLSs (Dingwall and Laskey, Trends Biochem. Sci. 16:478-481, 1991) predicting nuclear localization of this protein. In the original PAP, the two NLSs surround an S/T rich CTD containing multiple cdk phosphorylation sites critical for regulating polymerase function. However, the aa homology between neo-PAP and PAP declined sharply in this region to 36%, suggesting that these two molecules might be regulated differently. Figure 2C aligns the aa sequences of neo-PAP and PAP, commencing at NLS1 and continuing through the C-terminus. The original human PAP II contains 7 cdk phosphorylation sites, including 2 consensus (T/SPXK/R) and five nonconsensus sites (T/SP), and it has been shown that full phosphorylation of all of these sites is required to repress enzymatic function during M phase (Colgan et al, EMBO J. 17: 1053-1062, 1998). In comparison, neo-PAP contains 9 cdk motifs, of which two are consensus sites. Thus, conservation of cdk sites by neo-PAP is significant, even more so when considered in context of the percent S+T in this region: neo-PAP contains only 23% S+T, compared to 34% for PAP. These findings support the belief that regulation of neo-PAP function occurs through a phosphorylation mechanism, although there are striking sequence dissimilarities between neo-PAP and PAP in this region. The extreme C-terminal 20-mer peptide implicated in splicmg regulation (Vagner et al, Genes Devel. 14:403-413, 2000) is highly conserved between the two molecules.

Further inspection of the protein sequence of human PAP (Swissprot P51003) revealed a C- terminal peptide that was highly similar in location and sequence to the neo-PAP epitope recognized by TIL 1087. However, as shown in Figure IB, an 11-mer peptide derived from human PAP failed to stimulate CD4+ T cells despite sharing 8 of 11 residues with the neo-PAP homolog. These results indicate the specificity of TIL 1087 for neo-PAP.

To examine the possibility that the S/T rich CTD of neo-PAP, bearing the signature of a regulatory domain, might harbor cancer-associated mutations, DNA sequencing was performed directly on RT-PCR products spanning this region (see Figure 7). PCR products were gel-purified prior to sequencing. A total of 21 samples were analyzed, including six melanomas, five prostate cancers, four colon cancers, three transformed immortalized cell lines, and three fresh PBL. Of note, 1087-mel was found to contain two alleles of neo-PAP, one of which had a C>T mutation at position 2159. This caused a P>L missense mutation, destroying a consensus cdk phosphorylation site immediately preceding NLS2. The C>T substitution in one allele in 1087-mel did not seem to represent a polymorphism, since it was not observed in 1087-EBV or 1087 PBL. Aside from one silent point mutation discovered in 293 cells, no other mutations or polymorphisms were identified in these samples.

In another instance to determine whether 1087-mel expressed a mutant form of neo-PAP, multiple cDNA clones of neo-PAP were amplified from 1087-mel and 1087-EBV using a proofreading DNA polymerase, as described (Topalian et al, Mol. Cell. Biol. 21:5614-5623, 2001). DNA sequencing revealed a C>T point mutation that occurred in 5 of 15 melanoma clones, but none of 7 B-cell clones sequenced. This mutation was predicted to cause a nonconservative P>L amino acid substitution at residue 643 situated in a putative phosphorylation site, immediately preceding the second nuclear localization sequence. The disruption of a phosphorylation site or of a nuclear localization motif could impact on protein stability and/or trafficking, suggesting mechanisms by which antigen processing might be influenced. The C>T nucleotide mutation also created a new Bfr I enzymatic cleavage site (cctaag>cttaag), allowing for the rapid screening of other tissues for its presence. As shown in Figure 9, RT-PCR products of 0.9 kb encoding the C-terminus of neo-PAP were partially cleaved by Bfr I into fragments of 0.3 + 0.6 kb if derived from the fresh cryopreserved 1087 melanoma tumor or from the cultured 1087-mel cell line. No cleavage was observed in DNA amplified from an allogeneic melanoma line, 888-mel. These results demonstrate that the 1087 tumor expresses mRNA encoding both the wild type (uncut) and mutant alleles of neo-PAP, and that the presence of this mutation in the 1087-mel cell line used to make the cDNA library is not an artifact of in vitro culture.

EXAMPLE 3: Functional Analysis of Neo-PAP

This example provides a method for characterizing the function of neo-PAP.

Materials and Methods

Preparation of PAP I and Neo-PAP proteins

N-terminally His-tagged PAPs were expressed for 18 hours at 15 °C in 400 ml LB buffer plus 200 mg/ml ampicillin. E. coli BL21 (DE3) cells were pelleted, resuspended in 12 ml of Binding Buffer (20 mM Tris-HCl pH 7.4, 100 mM NaCl, 0.05% NP-40, 5 mM imidazole, 0.5 mM PMSF), and sonicated. The supernatants were rocked for 2 hours with 0.4 ml Ni²⁺-NTA agarose (Qiagen Inc., Valencia, CA), washed with 20 column volumes of High-salt Buffer (20 mM Tris-HCl ph7.4, 500 mM NaCl, 0.05% NP-40, 5 mM imidazole, 0.5 mM PMSF), five column volumes of High-salt Buffer containing 15 mM imidazole instead of 5 mM imidazole, and eluted with High-salt Buffer containing 200 mM imidazole instead of 5 mM imidazole. Preparations were dialyzed against Buffer D (20 mM HEPES pH 7.9, 50 mM (NH₄)₂S0₄, 20% glycerol, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF). RNA Substrates. Polyadenylation and Cleavage Assays

Plasmids pG3SVL-A and pG3L3-A, which contain the SV40 late and adenovirus-2 L3 polyadenylation sites (Takagak et al, Cell 52: 731-742, 1980), respectively, were digested with appropriate restriction enzymes and used as templates to synthesize ³²P-labeled RNA substrates. Specific polyadenylation with the SV40 substrate was assayed in 12.5 μl reaction volumes containing 1-2 ng of labeled pre-RNA, 0.4 μl of purified CPSF fraction (Murthy and Manley, J. Biol Chem. 267: 14804-14811, 1992), 10 mM HEPES pH 7.9, 0.5 mM MgCl_2; 1 mM ATP, 25 mM (NH₄)₂S0₄, 0.1 mM EDTA, 0.25 mM DTT, 0.25 mM PMSF, 2.5% (w/v) polyvinyl alcohol, 400 ng tRNA, 0.16 U RNasin (Promega, Madison, WI), 100 ng BSA, and the indicated amounts of recombinant PAPs. Specific cleavage with the L3 substrate was performed in 12.5 μl reaction volumes containing 1-2 ng of labeled pre-RNA, 3.7 μl of purified or partially purified proteins (CstF, CPSF, CFI, CFII), 30 ng recombinant murine GST-CTD, 9.6 mM HEPES pH 7.9, 2 mM MgCl_2; 1 mM dATP, 24 mM (NH₄)₂S0₄, 0.12 mM EDTA, 0.24 mM DTT, 0.24 mM PMSF, 2.5% (w/v) polyvinyl alcohol, 250 ng tRNA, 0.25 U RNasin, 500 ng BSA, and the indicated amounts of recombinant PAPs (Hirose and Manley, Nature 395: 93-96, 1998). All reaction mixtures were incubated for 90 minutes at 30° C, , and RNA products were isolated and fractionated on 5% polyacrylamide, 8.3 M urea gels. Incorporation of rα-³²P1-labeled Nucleotides: Non-specific Polyadenylation Assay Incorporation of [α-³²P]-labeled nucleotides was done in 25 μl of Buffer HMN (lOmM

HEPES pH 7.9, 1 mM MnCl₂, 0.1% NP-40, 250 ng BSA, 0.1 mM EDTA, 0.25 mM DTT, 0.25 mM PMSF, 0.5 mM ATP, 0.3 pmol labeled nucleotides). Transfer RNA (100 nM) as substrate and 50 nM PAPs were present in the reaction. Reaction mixtures were incubated at 37° C and terminated by application of the complete reaction mixture to a DE81 paper. The paper was washed with 0.5 M Na₂HP0₄ pH 7.0, 70% ethanol, and counted in a scintillation counter. Non-specific polyadenylation was also carried out as described for the specific polyadenylation assays, except that 1 mM MnCl₂ replaced 0.5 mM MgCl₂, purified CPSF was omitted, and reaction mixtures were incubated for 30 minutes at 30° C.

Results

In view of the significant degree of homology between the amino acid sequences of the N- terminal region of neo-PAP and the catalytic domain of PAP, neo-PAP was studied to determine if it functions like PAP in several in vitro functional assays. To this end, a his-tagged derivative of neo- PAP was first expressed in E. coli, and the protein purified alongside an identically tagged version of bovine PAP I (as described in e.g., Colgan et al, Nature 384: 282-285, 1996). Figure 3A is an image of a silver-stained SDS gel of the two purified proteins.

The activity of the two PAPs was then compared in so-called "non-specific" poly(A) synthesis assays. Such assays measure the ability of PAP to catalyze primer-dependent poly(A) synthesis independent of both other polyadenylation factors and the sequence of the RNA primer, a property of the enzyme facilitated by the inclusion of Mn^""^" instead of Mg^""^" in reaction mixtures (e.g., Raabe et al, Nature 353: 229-234, 1991). Figure 3B displays a time course measuring the ability of each enzyme to incorporate γ-³²P ATP onto an unlabeled RNA primer. Both PAPs displayed equivalent activities, and as expected for an authentic PAP, were unable to utilize GTP instead of ATP as a substrate. A related non-specific assay utilizes a ³²P-labeled RNA primer and unlabeled ATP as substrate, and measures po!y(A) synthesis by the change in size of the RNA primer. Figure 3C shows that increasing concentrations of each PAP resulted in comparable increases in size of the primer. (The slight differences observed in size reflect the very sensitive nature of the assay, and were not reproducible.) The two PAPs where then compared in a specific polyadenylation assay, which requires an AAUAAA-containing RNA primer and CPSF. Figure 4A displays the results of such an assay, utilizing a ³²P-labeled SV40 late pre-mRNA containing either an intact AAUAAA (wt) or a U → A mutation in the hexanucleotide (pm), purified CPSF and 5 ng of either PAP I (lanes 1-3) or neo-PAP (lanes 4-6). Both PAPs displayed significant polyadenylation activity with the wt RNA that was reduced to background levels with the pm RNA. Note that low levels of poly(A) synthesis were detected with both PAPs in the absence of CPSF, and this activity was slightly higher with neo-PAP (lanes 1 and 4). This reflects non-specific poly(A) synthesis, analogous to that shown in Figure 3. This low activity was also observed with the pm RNA, but was reduced by the presence of CPSF (lanes 3 and 6), reflecting a well-established activity of CPSF, which is to inhibit non-specific poly(A) synthesis under conditions that stimulate AAUAAA-dependent polyadenylation (e.g., Ryner et al, Mol. Cell. Biol. 9: 4229-4238, 1989). But the significant result is that neo-PAP, like PAP I, was highly active in AAUAAA-and CPSF-dependent polyadenylation. The length of the poly(A) synthesized by neo-PAP was slightly shorter than that synthesized by PAP I. Finally, PAP is also known to be required with most pre-mRNAs for the first step of polyadenylation, endonucleolytic cleavage (e.g., Takagaki et al, Cell 52: 731-742, 1988). To determine whether neo-PAP is able to activate cleavage, 3' cleavage reactions were reconstituted with purified CPSF, CstF and neo-PAP or PAP I, plus partially purified CFI and CFII, using a ³²P-labeled adenovirus L3 pre-mRNA (Figure 4B). In the absence of PAP, cleavage was essentially undetectable (lane 1), but increasing concentrations of PAP I (lanes 3-4) or neo-PAP (lanes 5-6) resulted in significant cleavage. Cleavage was induced at two nearby sites, generating distinct 5' and 3' cleavage products. Significantly, this pattern, which has been observed previously in similar reconstitution assays (Hirose and Manley et al, J. Biol. Chem. 272: 29636-29642, 1997), was identical with both PAPs. Taken together, these data indicate that the properties of bovine PAP I and human neo-PAP are essentially biochemically indistinguishable. This finding supports the belief that neo-PAP has the potential to function in nuclear pre-mRNA 3' processing.

EXAMPLE 4: Subcellular Localization of Human Neo-PAP Protein This example provides a method for examining the subcellular localization of human neo-

PAP protein.

Materials and Methods Immunofluorescent Staining and Confocal Microscopy Exponentially growing HeLa cells (human cervical cancer; ATCC, Manassas, VA) were plated on glass coverslips in 24-well tissue culture plates and incubated overnight at 37° C, 5% C0₂. The following day, cells were transfected with 0.5 μg per well of the plasmid pEAK8/HA-neoPAP using Lipofectamine Plus (GIBCO BRL). Twenty to 48 hours later, cells were rinsed in PBS, fixed in 4% paraformaldehyde/PBS and permeabilized with 1% Triton X-100 (Sigma, St. Louis, MO) in 0.2% BSA/PBS. After blocking with 20% goat serum at 37° C for 30 minutes and then rinsing in 0.2% BSA/PBS, samples were stained with 5 μg/ml of a FITC-conjugated rat mAb specific for the HA epitope YPYDVPDYA (SEQ ID NO: 8; clone 3F10, Roche Molecular Biochemicals, Indianapolis, IN) for one hour at room temperature. Coverslips were rinsed with PBS and mounted onto microscope slides using GelMount (Biomeda Corp., Foster City, CA). Stained cells were examined on a Zeiss Axioplan microscope using the lOOX/1.4 oil immersion objective (total magnification 1400X). Confocal images were generated on a Zeiss laser-scanning microscope (LSM 510).

Results Immunofluorescence microscopy was used to examine directly whether the conserved nuclear localization sequence motifs in neo-PAP caused this protein to traffic to the nucleus, ordinarily the site of mRNA processing in somatic cells. Twenty to 48 hr after fransfection with the plasmid pEAK/HA-neoPAP, adherent HeLa cells were stained with a FITC-conjugated monoclonal antibody specific for the engineered N-terminal HA fusion tag. Immunofluorescence microscopy demonstrated that the transiently expressed neo-PAP protein localized exclusively to the nuclei of HeLa cells. Similar results were obtained with transiently transfected COS-7 cells and stable transfectants of 293 cells. These results are similar to those of previously published experiments with bovine PAP I and PAP II, showing exclusively nuclear localization of those proteins (Raabe et al, Mol. Cell. Biol. 14: 2946-2957, 1994).

EXAMPLE 5: Subcellular Localization of Wildtype and Mutant Neo-PAP

This example provides as method of comparing the subcellular localization of wildtype and mutant neo-PAP.

Materials and Methods In order to further study the intracellular localization of wild type and mutant neo-PAPs, epitope tags permitting mAb-mediated detection were engineered onto the N and C termini of these molecules using PCR. The forward oligonucleotide PCR primer contamed an Eco RV resfriction site and a 30 bp sequence encoding an N-terminal influenza virus HA epitope tag in-frame with the 5' coding sequence of neo-PAP, and has been described in Example 2. The reverse primer, shown in SEQ ID NO: 13, contained a Not I restriction site (residues 7 through 14) and stop codon (residues 15 through 17), followed by a sequence encoding the 8-mer FLAG epitope (residues 18 through 41) (Pieper et al, J. Exp. Med. 189:757-765, 1999) in-frame with a sequence encoding the C-terminus of neo-PAP. DNA templates for PCR reactions were cDNA clones encoding full length wild type or mutant neo-PAPs that had been amplified from 1087-mel, ligated into the pCR-Bluntll-TOPO vector (Invitrogen) and completely sequenced (Topalian et al, Mol. Cell. Biol. 21:5614-5623, 2001). The new PCR products were ligated into the eukaryotic expression plasmid pEAK8, and their DNA sequences were confirmed. The plasmids pEAK8/HA-neoPAP-FLAG wild type or mutant were transfected into exponentially growing HeLa cells (human cervical cancer; American Type Culture Collection) adherent to glass coverslips in 24-well culture plates using the Lipofectamine Plus reagent (Invitrogen). Twenty hours later, cells were fixed, permeabilized, and blocked as described above (Example 4) and then stained with 5 ug/ml of a FITC-conjugated rat mAb directed against the HA epitope (clone 3F10; Roche Molecular Biochemicals) for 1 hour at room temperature. After 3 washes with PBS, the cells were stained with 20 ug/ml of the anti-FLAG M2 murine mAb (Sigma) followed by 3 more washes, and then cells were counter-stained with 20 ug/ml Texas Red-X conjugated goat anti-mouse mAb. Antibodies were diluted in PBS containing 2% goat serum and 2% BSA. Coverslips were washed 3 times in PBS and mounted onto microscope slides using GelMount (Biomeda Corp.). Stained cells were examined on a Zeiss Axioplan microscope with a lOOx/1.4 oil immersion objective, and confocal images were generated using an LSM510 scanning laser microscope (Zeiss) with laser excitation at 488 and 543 nm. Multitracking was used to prevent bleed through between the fluorescein and Texas red channels. The total magnification was 980x.

Results In an effort to determine the mechanism by which the mutation of neo-PAP found in 1087- mel could lead to processing of the nomnutated immunogenic epitope, immunofluorescence microscopy was used to examine the subcellular localization of both the wild type and mutant proteins. Lacking a monoclonal antibody specific for neo-PAP, epitope tags detectable by specific monoclonal antibodies were engineered onto wild type and mutant neo-PAPs for this purpose. It has been demonstrated that wild type neo-PAP localizes exclusively to the nucleus in HeLa cells transiently transfected with an N-terminal HA epitope-tagged molecule (Example 4). Because the mutation associated with TIL recognition has the potential to result in altered trafficking or cleavage of neo-PAP, a FLAG tag was added to the C-terminus juxtaposed to the recognized 11-mer peptide, theoretically allowing discrimination of stable cleavage products trafficking to different intracellular compartments with two-colored staining. After a 20 hour fransfection in HeLa cells, both the wild type and the mutant neo-PAP molecules seemed to localize to the cell nucleus, with complete co- localization of the N-termini stained by an anti-HA monoclonal antibody and the C-termini stained by an anti-FLAG monoclonal antibody. No significant staining of the cytoplasm was observed. Thus both molecules appeared to localize similarly during the period of observation. In addition, Western blotting on lysates of transiently transfected 293 cells failed to demonstrate cleavage products from the mutant or wild type neo-PAPs, whether staining was done with the anti-HA or anti-FLAG mAb (data not shown). EXAMPLE 6: Differential Phosphorylation of Neo-PAP vs. PAP H

This example provides methods for examining the phosphorylation state of neo-PAP, particularly in comparison to classical PAP

Materials and Methods

Western Blots

Subconfluent 293 cells (adenovirus-transformed human embryonic kidney epithelium; ATCC, Manassas, VA) were transfected with the plasmids pEAK8/HA-neoPAP or pEAK8/HA- bovine PAP II, using the Effectine™ reagent according to the manufacturer's instructions (Qiagen Inc., Valencia, CA). Forty-eight hours later, cells were harvested, washed, and lysed in RIPA buffer (Boehringer Mannheim, Indianapolis, IN) containing detergents and the protease inhibitor PMSF, at a concentration of 2 x 10⁷ cells/ml. Following centrifugation at 10,000 x g for 10 minutes, supernatants were boiled for three minutes under non-reducing conditions before loading into an 8% tris-glycine acrylamide gel (Novex, San Diego, CA). Electrophoretically separated proteins were blotted onto a nitrocellulose membrane, which was incubated for one hr with a peroxidase-conjugated mAb specific for HA (clone 3F10, Roche Biochemicals), 125 ng/ml. Protein visualization was achieved with chemical development.

Results Previous work has demonstrated that hyperphosphorylation of classic PAP is an important mechanism by which its enzymatic activity is coordinately repressed during cell division (Colgan et al, Nature 384: 282-285, 1996). Western blots performed on extracts of human cells expressing PAP, or cells transfected with plasmids encoding HA-tagged PAP, have consistently demonstrated the apparent molecular weight (m.w.) of PAP to be approximately 20 kD greater than that predicted by protein sequence. Site directed mutagenesis or phosphatase treatment of cell extracts has shown that the low-mobility forms of classic PAP observed on Western blots reflect phosphorylation of multiple cdk sites in the CTD (Colgan et al, EMBO J. 17: 1053-1062, 1998; Raabe et al, Mol Cell. Biol. 14: 2946-2957, 1994; Thuresson et al, Proc. Natl. Acad. Sci. USA 91: 979-983, 1994).

The phosphorylation state of neo-PAP was demonstrated by performing Western blots on extracts of 293 cells after a 48 hr fransfection with pEAK/HA-neoPAP or pEAK/HA-PAP II (Figure 5). Unexpectedly, neo-PAP was detected as only a single protein band migrating at its predicted m.w. of 82.8 kD. In contrast, bovine PAP II (predicted m.w. 82.4 kD, protein sequence 98.5% identical to human PAP II) presented as multiple bands in the range of 100 kD. Neo-PAP does not appear to be phosphorylated under the same conditions that caused hyperphosphorylation of PAP. A single neo-PAP form migrating at its true m.w. was also observed in Western blots performed on extracts of stable transfectants of 293 cells and transiently transfected EBV-transformed B cell lines, further suggesting that the predominant form of this enzyme is not phosphorylated. To address this issue directly, extracts of transiently transfected 293 cells were treated with acid phosphatase prior to Western blotting. As shown in Figure 5, the migration of neo-PAP was not influenced by phosphatase treatment, while the migration of PAP II shifted to a smear of partially to completely dephosphorylated species in the 80 - 100 kD range. These results provide direct evidence that neo-PAP and PAP are differentially phosphorylated, and hence differentially regulated. This result is surprising because both neo-PAP and PAP contain a conserved cyclin recognition motif (Bond et al, Mol. Cell. Biol. 20: 5310-5320, 2000) and multiple consensus and non-consensus cdk phosphorylation sites that would predict similar, and not disparate, modes of regulation.

EXAMPLE 7: Expression of Human Neo-PAP Transcript

This example illustrates methods for determining what cell types express neo-PAP cDNA, and the relative level of transcript in different cell types and conditions, such as disease states.

Methods and Materials Northern Blot Analysis (I)

Total RNA was isolated from a variety of cultured cell lines and fresh peripheral blood lymphocytes (PBL), using the Trizol method (GIBCO-BRL) or the RNeasy Midi Kit (Qiagen). Cell lines initiated in our laboratory included the malignant melanoma from which neo-PAP was cloned (1087-mel) and its autologous transformed B cell line (1087-EBV), and the prostate cancer cell lines 1532-CPTX, 1535-CPTX, and 1542-CPTX. Fresh cryopreserved PBL from patients no. 1087, 1532, and 1535 were autologous to the tumor cell lines mentioned above. The colon cancer cell lines CY13, LoVo, and Sw480 were obtained from the ATCC (Manassas, VA), as were 293 cells. Total RNA 10 μg per lane was electrophoresed in a 1% agarose formaldehyde gel and transferred to a nylon membrane (Nytran, Schleicher & Schuell Inc., Keene, NH). In addition, a Northern blot containing approximately 2 μg/lane of poly(A)⁺ RNA isolated from 12 different fresh human tissues was purchased from OriGene Technologies (Rockville, MD). Hybridization of blots with radiolabeled oligonucleotide probes was performed at 68° C for two hours, according to the QuikHyb protocol (Stratagene, La Jolla, CA). After washing with 2X SSC/0.1% SDS, blots were subjected to a high stringency wash with O.lx SSC/0.1% SDS at 60° C for 30 minutes, then autoradiography was performed at -70° C. To synthesize oligonucleotide probes specific for neo-PAP or human PAP, RT- PCR was performed on total RNA from 1087-mel. The neo-PAP probe contained bp 27 - 325 (5' to 3') of the sequence shown in Figure 2A, corresponding to a portion of 5' UTR as well as 5' CDS, and had no significant homology to PAP. The PAP probe corresponded to bp 10 - 341 in the extreme 5' coding region of human PAP, GenBank accession no. X76770 (Thuresson et al, Proc. Natl. Acad. Sci. USA 91 : 979-983 1994). Probes were radiolabeled by the random priming method (Lofsfrand Labs, Gaithersburg, MD). Blots were hybridized first with the probe for neo-PAP, then β-actin, following which they were stripped and then hybridized with the probe for human PAP, then β-actin again. Northern Blot Analysis (7)

Northern blotting was performed as described above, using a radiolabeled 298-bp PCR product, corresponding to a portion of the 5' UTR and CDS of neo-PAP, as the probe. Each lane contained 10 μg of total RNA isolated from cultured cell lines. The melanomas 1087-mel, 586-mel, 624-mel, 888-mel, 938-mel and 1558-mel were generated in the laboratory, as were the B cell line 1087-EBV, the prostate cancer cell line 1669-CPTX (Bright etal, Cancer Res. 57:995-1002, 1997), and the modified 293IMDR7 cells. The cultured colon cancer line WiDr was obtained from the ATCC. In addition, a Northern blot containing approximately 2 μg/lane of poly(A)⁺ RNA isolated from 12 different fresh human tissues was purchased from OriGene Technologies. First, blots were hybridized with the probe specific for neo-PAP and autoradiography was performed at -70°C for 4 to 5 days, after which blots were hybridized with a probe for β-actin and then autoradiography was carried out for 7 hours. Blots were not stripped between the two hybridizations. RT-PCR to Assess Normal Tissue Expression of Neo-PAP

To further investigate the profile of neo-PAP mRNA expression in various normal adult and fetal human tissues, RT-PCR was performed using the Human Rapid-Scan Gene Expression Panel kit according to the manufacturer's instructions (OriGene Technologies, Rockville, MD). This kit includes duplicate 96-well PCR plates containing first strand cDNAs derived from 24 different human tissues, normalized to β-actin concentration and serially diluted over a 4-log range. PCR for neo-PAP was performed with a forward oligonucleotide primer corresponding to bases 1558-1576 (5' to 3') and a reverse primer corresponding to bases 2477-2464 (5' to 3'; see Figure 2A), yielding a product of approximately 0.9 kb encoding the C-terminus of neo-PAP. In the duplicate 96-well plate, PCR for β-actin was performed with primers covering the entire 1.1 kb coding region. For both neo- PAP and β-actin, 35 cycles of PCR were carried out at 94° C x 30 sec, 55° C x 30 sec, and 72° C x 2 minutes. Approximately one third the volume of each PCR reaction was electrophoresed in a 0.8% agarose/TBE gel and stained with ethidium bromide.

Results Having cloned and sequenced neo-PAP from one patient's melanoma cells and virus- transformed B cells, the profile of gene expression was determined in other malignant, transformed and normal human cells and tissues. Figure 6 shows Northern blots hybridized first with a probe specific for portions of the 5' UTR and extreme 5' CDS of neo-PAP, and then stripped and hybridized with a probe for a similar but non-homologous region in human PAP. Immediately apparent are the different splicing patterns of neo-PAP versus PAP. With PAP, two dominant mRNA species of approximately 4.4 and 1.3 kb were observed, similar to those previously described for bovine PAP II (Wahle et al, EMBO J. 10:4251-4257, 1991). In contrast, neo-PAP had one dominant mRNA species of approximately 4 kb (consistent with the cDNA sequence of 3.7 kb), but no smaller species were apparent. The significance of a faint 8 kb mRNA species observed only for neo-PAP and not PAP is unclear, but this could represent an alternatively processed mRNA with a very long UTR. In a separate experiment, a Northern blot containing total RNAs derived from various tumors and transformed cells was hybridized with the 5' neo-PAP probe described above, and then stripped and hybridized again with a neo-PAP probe specific for the 3' end of the CDS and entire 3' UTR. Both probes revealed a dominant 4 kb mRNA species and minor band at 8 kb, similar to the pattern shown in Figure 6. Hence, unlike PAP, neo-PAP does not seem to generate splice variants.

Despite apparent dissimilarities in RNA splicmg, both neo-PAP and PAP were overexpressed by tumors compared to virally transformed or normal cells. The upper portion of Figure 6 demonstrates, in one Northern blot, significantly greater expression of both neo-PAP and PAP mRNAs in seven cancers, compared to two transformed cell lines and three fresh PBL specimens. In addition to the tumor specimens assayed in Figure 6 (one melanoma, 3 prostate cancers, 3 colon cancers), RNAs from 5 other melanomas, two additional prostate cancers, and another colon cancer were assessed for neo-PAP expression by Northern blotting, and all were significantly positive. The lower portion of Figure 6 demonstrates that, among 12 different fresh normal human tissues, neo-PAP was poorly expressed and PAP could not be detected at all, even after prolonged film exposure. In this and repeat Northern blot experiments, neo-PAP was expressed predominantly in testis (lane 24). In the experiment displayed in Figure 6, weaker signals were also seen in brain (lane 13) and lung (lane 18). Taken together, the data indicate that both PAP and neo- PAP mRNAs are expressed at low levels in normal tissues and overexpressed in tumors.

In a second Northern blot analysis, a 5' fragment of neo-PAP cDNA was used as a probe for Northern blotting to test a variety of human tumors, transformed cells and normal tissues for neo- PAP expression. Figure 10 demonstrates detection of full length neo-PAP message in 1087-mel, which is recognized by TIL 1087, as well as in 1087-EBV and 293IMDR7 cells, which are not recognized by TIL 1087 and which do not contain the mutant allele. In addition, a variety of other tumors expressed mRNA for neo-PAP, as shown. In contrast, no significant expression was observed in fresh normal tissues with the exception of testis, demonstrating a pattern of expression reminiscent of the Acancer/testis≡ tumor antigens. These results indicate that neo-PAP is overexpressed in human cancers (melanomas, prostate cancers, colon cancers) and, among normal tissues, in testis.

To further explore the normal tissue distribution of neo-PAP, RT-PCR was performed on 24 different adult and fetal human tissues. Figure 7 shows that, consistent with the Northern blot results, testicular expression was dominant, but most other tissues also showed weak expression of neo-PAP after 35 cycles of PCR. By visual assessment of RT-PCR products generated from cDNAs diluted over a 4-log range, the intensity of neo-PAP expression was estimated to be 1 - 2% that of β-actin. Neo-PAP expression in the testis is particularly interesting since a testis-specific PAP has been described, which is thought to catalyze cytoplasmic polyadenylation of mRNAs in spermatocytes (GenBank AF218840) (Kashiwabara et al, Devel. Biol. 228: 106-115, 2000).

EXAMPLE 8: Quantitation of Neo-PAP mRNA with Real-time Taqman RT-PCR

This example provides a method for quantitating neo-PAP mRNA. Real-time PCR allows for the formation of a PCR product that is monitored continuously during amplification by means of fluorescent primers, fluorogenic probes or fluorescent dyes that bind to the PCR product. Compared to analyzing the level of a PCR product at the end of the cycling reaction, real-time PCR quantitation is more accurate as the measurements are made during the exponential phase of the reaction before amplification becomes vulnerable to limiting reagents, amplicon reannealing and cycling variability. In addition, post-PCR handling is reduced, thereby minimizing sample contamination. Thus, real-time PCR is an important tool for the accurate comparison of the expression of cancer-related genes, as well as genes involved in other diseases, in both normal and diseased tissues. Two different primer-probe sets for quantifying neo-PAP mRNA were developed:

Set 1: forward primer 5'-CTTCTGTAGGAGAAACAGAAAGGAATAGT-3' (residues 1889 - 1917 of SEQ ID NO: 1) reverse primer 5'-GGGCTGGTGGTACACTCAGTG-3' (reverse complement of residues 1949 - 1969 of SEQ ID NO: 1) probe 5'(FAM)-CTGAGCCTGCTGCTGTAATTGTGGAGAA-(TAMRA)3' (residues 1919 - 1946 of SEQ ID NO: 1) Set 2: forward primer 5'-GGAGAGGGAGACGCAGGAA-3' (residues 210 - 228 of SEQ ID NO: 1) reverse primer 5'-CTTTTGTTGACGCTGGCTGTC-3' (reverse complement of residues 261 - 282 of SEQ ID NO: 1) probe 5'(FAM)-ATGAAAGAGATGTCTGC-(TAMRA)3' (residues 232 -248 of SEQ ID NO: l) Two template-specific primers in each set define the endpoints of the neo-PAP amplicons.

The sequences of the primers and probes were carefully selected to ensure that they did not overlap the classic PAP sequence. Each labeled oligonucleotide probe hybridized to a neo-PAP amplicon during the annealing/extension phase of the PCR. The probes for each set, above, were labeled with two different flourochromes, a 5' terminus reporter fluorochrome (6-carboxyfluorescein, FAM) and a 3' terminus quenching fluorochrome (6-carboxy-tetramethyl-rhodamine, TAMRA). As long as both fluorochromes were on the probe, the quencher molecule stopped all fluorescence by the reporter. However, as Taq polymerase extended the primer, the intrinsic nuclease activity of Taq degraded the probe, releasing the reporter fluorochrome. Thus, the amount of fluorescence released during the amplification cycle was proportional to the amount of product generated in each cycle. Briefly, total RNA was isolated from cell pellets using the RNeasy Mini Kit (Qiagen,

Valencia, CA), yielding approximately 6 μg RNA from each cell pellet. Twenty-five percent of the total RNA recovered (about 1.5 μg) was reverse transcribed to cDNA using random hexamer primers and a cDNA transcription kit (Perkin-Elmer, Foster City, CA). cDNA was stored at -20°C until PCR was performed. Neo-PAP gene expression was measured using the ABI Prism 7500 Sequence Detection System to perform qRT-PCR as already described in detail (Kammula et al., 1999). PCR was conducted in 25 μl volumes using 10% of the recovered cDNA as the template, with 800 nM neo-PAP-specific primers (see primer pairs above) and 200 nM of a neo-PAP-specific fluorochrome- labeled probe (see probes above), to detect eithe 80 or 54 base pair neo-PAP amplicons, depending on the primer pair used. Cycling parameters were 95° C for 10 minutes, followed by 40 cycles of 95° C for 15 seconds, and 60° C for 1 minute. Duplicate PCR reactions were conducted from each cDNA sample, and the results were averaged.

EXAMPLE 9: Methods of Making Human Neo-PAP cDNA

The original means by which the neo-PAP cDNA was identified and obtained is described above. With the provision of the sequence of the neo-PAP protein (SEQ ID NOs: 1 and 2) and cDNA (SEQ ID NO: 1), in vitro nucleic acid amplification (such as polymerase chain reaction (PCR)) now may be utilized in a simple method for producing the neo-PAP cDNA. The following example provides techniques for preparing cDNA in this manner.

Total RNA is extracted from human cells by any one of a variety of methods well known to those of ordinary skill in the art. Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992) provide descriptions of methods for RNA isolation. Because neo-PAP is expressed in tumors and testis tissue, human cell lines derived from tumors or testis tissue can be used as a source of such RNA. The extracted RNA is then used as a template for performing reverse transcription-polymerase chain reaction (RT-PCR) amplification of cDNA. Methods and conditions for RT-PCR are described in Kawasaki et al, (In PCR Protocols, A Guide to Methods and Applications, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California, 1990).

The selection of amplification primers will be made according to the portion(s) of the cDNA that is to be amplified. Primers may be chosen to amplify a segment of a cDNA or the entire cDNA molecule. Variations in amplification conditions may be required to accommodate primers and amplicons of differing lengths and composition; such considerations are well known in the art and are discussed for instance in Innis et al. (PCR Protocols, A Guide to Methods and Applications,

Academic Press, Inc., San Diego, CA, 1990). By way of example, the coding portion of the human neo-PAP cDNA molecule (approximately 2.2 kb) may be amplified using the following combination of primers:

5'-primer (overlapping the initiation codon): 5'-ATG AAA GAG ATG TCT GCA AAC-3' (SEQ ID NO.: 9); 3'-primer (overlapping the termination codon): 5'-TTA CCG ATT AAG GGT CAG TCG-3' (SEQ ID NO.: 10). Similarly, the following set of four primers can be used to amplify the complete human neo- PAP cDNA:

5'-primer: 5'-CAG GCT GGA AGC GGC GCC AT-3' (SEQ ID NO.: 11) 3'-primer:

5'-AAG GTT TTA AAC GTT TCT CT-3' (SEQ ID NO.: 12).

These primers are illustrative only; one skilled in the art will appreciate that many different primers may be derived from the provided cDNA sequence in order to amplify particular regions of neo-PAP cDNA, as well as the complete sequence of the human neo-PAP cDNA.

Re-sequencing of PCR products obtained by these amplification procedures is advantageous to facilitate confirmation of the amplified sequence and provide information about natural variation of this sequence in different populations or species. Oligonucleotides derived from the provided neo- PAP sequences may be used in such sequencing methods. Orthologs of human neo-PAP can be cloned in a similar manner, where the starting material consists of cells taken from a non-human species. Orthologs will generally share at least 65% sequence identity with the disclosed human neo-PAP cDNA. Where the non-human species is more closely related to humans, the sequence identity will in general be greater. Closely related orthologous neo-PAP molecules may share at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 91%, at least 93%, at least 95%, or at least 98% sequence identity with the disclosed human sequences.

Oligonucleotides derived from the human neo-PAP cDNA sequence (e.g., SEQ ID NOs: 3-7 and 9-12), or fragments of this cDNA, are encompassed within the scope of the present disclosure. Such oligonucleotides may comprise a sequence of at least 15 consecutive nucleotides of the neo- PAP nucleic acid sequence. If these oligonucleotides are used with an in vitro amplification procedure (such as PCR), lengthening the oligonucleotides may enhance amplification specificity. Thus, oligonucleotide primers comprising at least 25, 30, 35, 40, 45 or 50 consecutive nucleotides of these sequences may be used. These primers for instance may be obtained from any region of the disclosed sequences. By way of example, the human neo-PAP cDNA, ORF and gene sequences may be apportioned into about halves or quarters based on sequence length, and the isolated nucleic acid molecules (e.g., oligonucleotides) may be derived from the first or second halves of the molecules, or any of the four quarters. The murine neo-PAP cDNA, shown in SEQ ID NO: 1, can be used to illustrate this. The human neo-PAP cDNA is 3752 nucleotides in length and so may be hypothetically divided into about halves (nucleotides 1-1876 and 1877-3752) or about quarters (nucleotides 1-938, 939-1876, 1877-2814 and 2815-3752).

Nucleic acid molecules may be selected that comprise at least 15, 20, 23, 25, 30, 35, 40, 50 or 100 consecutive nucleotides of any of these or other portions of the human neo-PAP cDNA. Thus, representative nucleic acid molecules might comprise at least 15 consecutive nucleotides of the human neo-PAP cDNA (SEQ^' ID NO: 1).

EXAMPLE 10: Cloning of the Neo-PAP Genomic Sequence (or Gene) The neo-PAP cDNA sequence and fragments described above does not contain infrons, upstream transcriptional promoter or regulatory regions or downstream transcriptional regulatory regions of the neo-PAP gene. It is possible that some mutations in the neo-PAP gene that may lead to defects in normal tissue development (e.g., testis tissue development), infertility, or tumor formation or progression are not included in the cDNA but rather are located in other regions of the neo-PAP - gene. Mutations located outside of the open reading frame that encodes the neo-PAP protein are not likely to affect the functional activity of the protein, but rather are likely to result in altered levels of the protein in the cell. For example, mutations in the promoter region of the neo-PAP gene may prevent transcription of the gene and therefore lead to the complete absence of the neo-PAP protein in the cell. Additionally, mutations within intron sequences in the genomic gene may also prevent expression of the neo-PAP protein. Following transcription of a gene containing introns, the intron sequences are removed from the RNA molecule in a process termed splicing prior to translation of the RNA molecule which results in production of the encoded protein. When the RNA molecule is spliced to remove the introns, the cellular enzymes that perform the splicing function recognize sequences around the infron/exon border and in this manner recognize the appropriate splice sites. If there is a mutation within the sequence of the intron close to the junction of the intron with an exon, the enzymes may not recognize the junction and may fail to remove the intron. If this occurs, the encoded protein will likely be defective. Thus, mutations inside the intron sequences within the neo- PAP gene (termed "splice site mutations") may also lead to defects in tissue development and/or neoplasia. However, knowledge of the exon structure and intronic splice site sequences of the neo- PAP gene is required to define the molecular basis of these abnormalities. The provision herein of the neo-PAP cDNA sequence enables the cloning of the entire neo-PAP gene (including the promoter and other regulatory regions and the intron sequences) and the determination of its nucleotide sequence. With this information in hand, diagnosis of a genetic predisposition to tumor formation or progression based on DNA analysis will comprehend all possible mutagenic events at the neo-PAP locus.

The neo-PAP gene may be isolated by one or more routine procedures, including direct sequencing of one or more BAG or PAC clones that contain the neo-PAP sequence.

With the sequences of human neo-PAP cDNA and gene in hand, primers derived from these sequences may be used in diagnostic tests (described below) to determine the presence of mutations in any part of the genomic neo-PAP gene of a patient. Such primers will be oligonucleotides comprising a fragment of sequence from the neo-PAP gene (intron sequence, exon sequence or a sequence spanning an infron-exon boundary) and may include at least 10 consecutive nucleotides of the neo-PAP cDNA or gene. It will be appreciated that greater specificity may be achieved by using primers of greater lengths. Thus, in order to obtain enhanced specificity, the primers used may comprise 15, 17, 20, 23, 25, 30, 40 or even 50 consecutive nucleotides of the neo-PAP cDNA or gene. Furthermore, with the provision of the neo-PAP intron sequence information the analysis of a large and as yet untapped source of patient material for mutations will now be possible using methods such as chemical cleavage of mismatches (Cotton et al, Proc. Natl. Acad. Sci. USA 85:4397-4401, 1985; Montandon et al, Nucleic Acids Res. 9:3347-3358, 1989) and single-strand conformational polymorphism analysis (Orita et al, Genomics 5:874-879, 1989).

Using the information disclosed herein, the regulatory elements flanking the neo-PAP gene can be identified and characterized. These regulatory elements may be characterized by standard techniques including deletion analyses wherein successive nucleotides of a putative regulatory region are removed and the effect of the deletions are studied by either transient or long-term expression analyses experiments. The identification and characterization of regulatory elements flanking the genomic neo-PAP gene may be made by functional analysis (deletion analyses, etc.) in mammalian cells by either transient or long-term expression analyses.

It will be apparent to one skilled in the art that either the genomic clone or the cDNA or sequences derived from these clones may be utilized in applications, including but not limited to, studies of the expression of the neo-PAP gene, studies of the function of the neo-PAP protein, the generation of antibodies to the neo-PAP protein diagnosis and therapy of neo-PAP deleted or mutated patients to prevent or treat the defects in cell and tissue development, such as neoplasia. Descriptions of applications describing the use of neo-PAP cDNA, or fragments thereof, are therefore intended to comprehend the use of the genomic neo-PAP gene.

It will also be apparent to one skilled in the art that homologs of this gene may now be cloned from other species, such as the rat or a monkey, by standard cloning methods. Such homologs will be useful in the production of animal models of tumor formation and progression. In general, such orthologous neo-PAP molecules will share at least 65% sequence identity with the human neo- PAP nucleic acid disclosed herein; more closely related orthologous sequences will share at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% sequence identity with this sequence.

EXAMPLE 11: Neo-PAP Sequence Variants

With the provision of human neo-PAP protein and corresponding nucleic acid sequences herein, the creation of variants of these sequences is now enabled.

Variant neo-PAP proteins include proteins that differ in amino acid sequence from the human neo-PAP sequences disclosed but that share at least 72% amino acid sequence identity with the provided human neo-PAP protein. Other variants will share at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% amino acid sequence identity. Manipulation of the nucleotide sequence of neo-PAP using standard procedures, including for instance site-directed mutagenesis or PCR, can be used to produce such variants. The simplest modifications involve the substitution of one or more amino acids for amino acids having similar biochemical properties. These so-called conservative substitutions are likely to have minimal impact on the activity of the resultant protein. Table 1 shows amino acids that may be substituted for an original amino acid in a protein, and which are regarded as conservative substitutions.

Table 1

Original Residue Conservative Substitutions Ala ser Arg lys

Asn gin; his

Asp glu

Cys ser

Gin asn Glu asp

Gly pro

His asn; gin

He leu; val

Leu ile; val Lys arg; gin; glu

Met leu; ile

Phe met; leu; tyr

Ser thr

Thr ser Tip tyr

Tyr trp; phe

Val ile; leu

More substantial changes in enzymatic function or other protein features may be obtained by selecting amino acid substitutions that are less conservative than those listed in Table 2. Such changes include changing residues that differ more significantly in their effect on maintaining polypeptide backbone structure (e.g., sheet or helical conformation) near the substitution, charge or hydrophobicity of the molecule at the target site, or bulk of a specific side chain. The following substitutions are generally expected to produce the greatest changes in protein properties: (a) a hydrophilic residue (e.g., seryl or threonyl) is substituted for (or by) a hydrophobic residue (e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl); (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain (e.g., lysyl, arginyl, or histadyl) is substituted for (or by) an electronegative residue (e.g., glutamyl or aspartyl); or (d) a residue having a bulky side chain (e.g., phenylalanine) is substituted for (or by) one lacking a side chain (e.g., glycine).

The classic mammalian PAP has been well studied as relates to regions of functionality, including residues that are involved in the polymerizing function, molecule stability, and regulation (such as phosphorylation). See, for instance, Bond et al, Mol Cell. Biol. 20:5310-5320, 2000; Zhao and Manley, Mol. Cell. Biol. 18:5010-5020, 1998; Colgan et al, EMBO J. 17:1052-1062, 1998; Colgan et al, Nature 384:282-285, 1996; and Raabe et al, Mol. Cell. Biol. 14:2946-2957, 1994. Amino acid residues to mutate in order to change (or not change) neo-PAP function and/or stability can be selected, for instance, by reference to these publications.

Variant neo-PAP encoding sequences may be produced by standard DNA mutagenesis techniques, for example, M13 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989), Ch. 15. By the use of such techniques, variants may be created that differ in minor ways from the human neo- PAP sequences disclosed. DNA molecules and nucleotide sequences that are derivatives of those specifically disclosed herein, and which differ from those disclosed by the deletion, addition, or substitution of nucleotides while still encoding a protein that has at least 65% sequence identity with the human neo-PAP encoding sequence disclosed (SEQ ID NO: 1), are comprehended by this disclosure. Also comprehended are more closely related nucleic acid molecules that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% nucleotide sequence identity with the disclosed neo-PAP sequences. In their most simple form, such variants may differ from the disclosed sequences by alteration of the coding region to fit the codon usage bias of the particular organism into which the molecule is to be introduced.

Alternatively, the coding region may be altered by taking advantage of the degeneracy of the genetic code to alter the coding sequence such that, while the nucleotide sequence is substantially altered, it nevertheless encodes a protein having an amino acid sequence substantially similar to the disclosed human neo-PAP protein sequences. For example, because of the degeneracy of the genetic code, four nucleotide codon triplets - (GCT, GCG, GCC and GCA) - code for alanine. The coding sequence of any specific alanine residue within the human neo-PAP protein, therefore, could be changed to any of these alternative codons without affecting the amino acid composition or characteristics of the encoded protein. Based upon the degeneracy of the genetic code, variant DNA molecules may be derived from the cDNA and gene sequences disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. Thus, this disclosure also encompasses nucleic acid sequences that encode a neo-PAP protein, but which vary from the disclosed nucleic acid sequences by virtue of the degeneracy of the genetic code.

Variants of the neo-PAP protein may also be defined in terms of their sequence identity with the prototype human neo-PAP protein. As described above, human neo-PAP proteins share at least 72%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% amino acid sequence identity with the human neo-PAP protein (SEQ ID NO: 2). Nucleic acid sequences that encode such proteins/fragments readily may be determined simply by applying the genetic code to the amino acid sequence of an neo-PAP protein or fragment, and such nucleic acid molecules may readily be produced by assembling oligonucleotides corresponding to portions of the sequence. Nucleic acid molecules that are derived from the human neo-PAP cDNA nucleic acid sequences include molecules that hybridize under stringent conditions to the disclosed prototypical neo-PAP nucleic acid molecules, or fragments thereof. Stringent conditions are hybridization at 65° C in 6 x SSC, 5 x Denhardt's solution, 0.5% SDS and 100 μg/ml sheared salmon testes DNA, followed by 15-30 minute sequential washes in 2 x SSC, 0.5% SDS, followed by 1 x SSC, 0.5% SDS and finally 0.2 x SSC, 0.5% SDS, at 65° C.

Low stringency hybridization conditions (to detect less closely related homologs) are performed as described above but at 50°C (both hybridization and wash conditions); however, depending on the strength of the detected signal, the wash steps may be terminated after the first 2 x SSC wash.

Human neo-PAP nucleic acid encoding molecules (including the cDNA shown in SEQ ID NO: 1, and nucleic acids comprising this sequence), and orthologs and homologs of these sequences, may be incorporated into transformation or expression vectors.

EXAMPLE 12: Expression of neo-PAP Protein

With the provision of human neo-PAP cDNA sequence fragments, and methods for determining and cloning the full length human neo-PAP cDNA, the expression and purification of the neo-PAP protein by standard laboratory techniques is now enabled. Purified human neo-PAP protein may be used for functional analyses, antibody production, diagnostics, and patient therapy.

Furthermore, the DNA sequence of the neo-PAP cDNA can be manipulated in studies to understand the expression of the gene and the function of its product. Mutant forms of the human neo-PAP may be isolated based upon information contained herein, and may be studied in order to detect alteration in expression patterns in terms of relative quantities, cellular localization, tissue specificity and functional properties of the encoded mutant neo-PAP protein. Partial or full-length cDNA sequences, which encode for the subject protein, may be ligated into bacterial expression vectors. Methods for expressing large amounts of protein from a cloned gene introduced into Escherichia coli (E. colt) may be utilized for the purification, localization and functional analysis of proteins. For example, fusion proteins consisting of amino terminal peptides encoded by a portion of the E. coli lacZ or trpE gene linked to neo-PAP proteins may be used to prepare polyclonal and monoclonal antibodies against these proteins. Thereafter, these antibodies may be used to purify proteins by immunoaffinity chromatography, in diagnostic assays to quantitate the levels of protein and to localize proteins in tissues and individual cells by immunofluorescence. Such antibodies may be specific for epitope tags, which can be added to the expression construct for identification and/or purification purposes. Intact native protein may also be produced in E. coli in large amounts for functional studies.

Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al. (Sambrook et al, In Molecular Cloning: A Laboratory Manual, Ch. 17, CSHL, New York, 1989). Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response. Native proteins can be produced in bacteria by placing a sfrong, regulated promoter and an efficient ribosome binding site upstream of the cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy. Suitable methods are presented in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and are well known in the art. Often, proteins expressed at high levels are found in insoluble inclusion bodies. Methods for extracting proteins from these aggregates are described by Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Ch. 17, CSHL, New York, 1989). Vector systems suitable for the expression of lacZ fusion genes include the pUR series of vectors (Ruther and Muller- Hill, EMBOJ. 2:1791, 1983), pEXl-3 (Stanley and Luzio, EMBOJ. 3:1429, 1984) and pMRlOO

(Gray et al, Proc. Natl. Acad. Sci. USA 79:6598, 1982). Vectors suitable for the production of intact native proteins include pKC30 (Shimatake and Rosenberg, Nature 292:128, 1981), pKK177-3 (Amann and Brosius, Gene 40:183, 1985) and pET-3 (Studiar and Moffatt, J. Mol. Biol. 189:113, 1986). Neo-PAP fusion proteins may be isolated from protein gels, lyophilized, ground into a powder and used as an antigen. The DNA sequence can also be transferred from its existing context to other cloning vehicles, such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al, Science 236:806-812, 1987). These vectors may then be introduced into a variety of hosts including somatic cells, and simple or complex organisms, such as bacteria, fungi (Timberlake and Marshall, Science 244:1313-1317, 1989), invertebrates, plants, and animals (Pursel et al, Science 244:1281-1288, 1989), which cells or organisms are rendered transgenic by the introduction of the heterologous neo-PAP cDNA.

For expression in mammalian cells, the cDNA sequence may be ligated to heterologous promoters, such as the simian virus (SV) 40 promoter in the pSV2 vector (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981), and introduced into cells, such as monkey COS-1 cells (Gluzman, Cell 23: 175- 182, 1981), to achieve transient or long-term expression. The stable integration of the chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J. Mol. Appl. Genet. 1:327-341, 1982) and mycophenolic acid (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981).

DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence- alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with nucleic acid amplification.

The cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques. These vectors are designed to permit the transcription of the cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA and ensure its proper splicing and polyadenylation. Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan et al, Proc. Natl. Acad. Sci. USA 78:1078-2076,

1981; Gorman et al, Proc. Natl Acad. Sci USA 78:6777-6781, 1982). The level of expression of the cDNA can be manipulated with this type of vector, either by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S. frugiperda cells (Summers and Smith, In Genetically Altered Viruses and the Environment, Fields et al. (Eds.) 22:319-328, CSHL Press, Cold Spring Harbor, New York, 1985) or by using vectors that contain promoters amenable to modulation, for example, the glucocorticoid-responsive promoter from the mouse mammary tumor virus (Lee et al, Nature 294:228, 1982). The expression of the cDNA can be monitored in the recipient cells 24 to 72 hours after introduction (transient expression).

In addition, some vectors contain selectable markers such as the gpt (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981) or neo (Southern and Berg, J. Mol. Appl Genet. 1:327-341, 1982) bacterial genes. These selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vectors (and therefore the cDNA). The vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses, such as papilloma (Sarver et al., Mol. Cell Biol. 1 :486-496, 1981) or Epstein-Barr (Sugden et al, Mol. Cell Biol. 5:410-413, 1985). Alternatively, one can also produce cell lines that have integrated the vector into genomic DNA. Both of these types of cell lines produce the gene product on a continuous basis. One can also produce cell lines that have amplified the number of copies of the vector (and therefore of the cDNA as well) to create cell lines that can produce high levels of the gene product (Alt et al, J. Biol. Chem. 253:1357-1370, 1978).

The transfer of DNA into eukaryotic, in particular human or other mammalian cells, is now a conventional technique. Recombinant expression vectors can be introduced into the recipient cells as pure DNA (fransfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, Virology 52:466, 1973) or strontium phosphate (Brash et al, Mol. Cell Biol. 7:2013,

1987), electroporation (Neumann et al, EMBO 1:841, 1982), lipofection (Feigner et al, Proc. Natl. Acad. Sci USA 84:7413, 1987), DEAE dextran (McCuthan et al, J. Natl. Cancer Inst. 41:351, 1968), microinjection (Mueller et al, Cell 15:579, 1978), protoplast fusion (Schafher, Proc. Natl. Acad. Sci. USA 77:2163-2167, 1980), or pellet guns (Klein et al, Nature 327:70, 1987). Alternatively, the cDNA, or fragments thereof, can be introduced by infection with virus vectors. Systems are developed that use, for example, retroviruses (Bernstein et al, Gen. Engr'g 7:235, 1985), adenoviruses (Ahmad et al, J. Virol. 57:267, 1986), or Herpes virus (Spaete et al, Cell 30:295, 1982). Techniques of use in packaging long transcripts can be found in Kochanek et al. (Proc. Natl. Acad. Sci. USA 93:5731-5739, 1996) Parks et al (Proc. Natl. Acad. Sci. USA 93:13565-13570, 1996) and Parks and Graham (J. Virol. 71:3293-3298, 1997). Neo-PAP encoding sequences can also be delivered to target cells in vitro via non-infectious systems, for instance liposomes.

These eukaryotic expression systems can be used for studies of neo-PAP encoding nucleic acids and mutant forms of these molecules, the neo-PAP protein and mutant forms of this protein. Such uses include, for example, the identification of regulatory elements located in the 5' region of the neo-PAP gene on genomic clones that can be isolated from human genomic DNA libraries using the information contained herein. The eukaryotic expression systems also may be used to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring or artificially produced mutant proteins. Using the above techniques, expression vectors containing the neo-PAP gene sequence or cDNA, or fragments or variants or mutants thereof, can be introduced into human cells, mammalian cells from other species or non-mammalian cells, as desired. The choice of cell is determined by the purpose of the treatment. For example, monkey COS cells (Gluzman, Cell 23: 175-82, 1981) that produce high levels of the SV40 T antigen and permit the replication of vectors containing the SV40 origin of replication may be used. Similarly, Chinese hamster ovary (CHO), mouse NIH 3T3 fibroblasts or human fibroblasts or lymphoblasts may be used.

Embodiments described herein thus encompass recombinant vectors that comprise all or part of a neo-PAP encoding sequence, such as the neo-PAP gene or cDNA or variants thereof, for expression in a suitable host. The neo-PAP DNA is operatively linked in the vector to an expression control sequence in the recombinant DNA molecule so that the neo-PAP polypeptide can be expressed. The expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof. The expression control sequence may be specifically selected from the group consisting of the lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of fd coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter of the yeast alpha-mating factors and combinations thereof. The host cell, which may be transfected with a vector, may be selected from the group consisting of E. coli, Pseudomonas, Bacillus subtilis, Bacillus stear other jnophilus or other bacilli; other bacteria; yeast; fungi; insect; mouse or other animal; or plant hosts; or human tissue cells.

It is appreciated that for mutant or variant neo-PAP DNA sequences, similar systems are employed to express and produce the mutant product.

EXAMPLE 13: Production of an Antibody to Neo-PAP Protein

Monoclonal or polyclonal antibodies may be produced to either the normal neo-PAP protein or mutant forms of this protein. Optimally, antibodies raised against the neo-PAP protein would specifically detect the neo-PAP protein. That is, such antibodies would recognize and bind the neo- PAP protein and would not substantially recognize or bind to other proteins found in human cells. Antibodies the human neo-PAP protein may recognize neo-PAP from other species, such as murine neo-PAP, and vice versa.

The determination that an antibody specifically detects the neo-PAP protein is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique (Sambrook et al, In Molecular Cloning: A Laboratoiy Manual, CSHL, New York, 1989). To determine that a given antibody preparation (such as one produced in a mouse) specifically detects the neo-PAP protein by Western blotting, total cellular protein is extracted from human cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel. The proteins are then transferred to a membrane (for example, nitrocellulose or PVDF) by Western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of (by way of example) an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase. Application of an alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immunolocalized alkaline phosphatase. Antibodies that specifically detect the neo-PAP protein will, by this technique, be shown to bind to the neo-PAP protein band (which will be localized at a given position on the gel determined by its molecular weight, which is approximately 125 kDa based on gel-mobility estimation for murine neo-PAP. Non-specific binding of the antibody to other proteins may occur and may be detectable as a weak signal on the Western blot. The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody- neo-PAP protein binding. Substantially pure neo-PAP protein suitable for use as an immunogen is isolated from the transfected or transformed cells as described above. The concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon (Millipore, Bedford, Massachusetts) or similar filter device, to the level of a few micrograms per milliliter. Monoclonal or polyclonal antibody to the protein can then be prepared as follows:

A. Monoclonal Antibody Production by Hybridoma Fusion

Monoclonal antibody to epitopes of the neo-PAP protein identified and isolated as described can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495-497, 1975) or derivative methods thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused with mouse myeloma cells using polyethylene glycol, and the excess un-fused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). Successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate, where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol. 70(A):419-439, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). Hybridomas were generated from immunized mice according to standard methods. These hybridomas show reactivity against the immunizing neo-PAP peptide in ELISAs. B. Polyclonal Antibody Production by Immunization

Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein (Example 12), which Optionally can be modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than others and may require the use of carriers and adjuvants, examples of which are known. Also, host animals vary in response to site of inoculations and dose, with either inadequate or excessive doses of antigen resulting in low titer antisera. A series of small doses (ng level) of antigen administered at multiple intradermal sites appear to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis et al. (J. Clin. Endocrinol. Metab. 33:988-991, 1971).

Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof begins to fall, as determined semi-quantitatively (for example, by double immunodiffusion in agar against known concentrations of the antigen). See, for example, Ouchterlony et al. (In Handbook of Experimental Immunology, Wier, D. (ed.) chapter 19. Blackwell, 1973). Plateau concentration of antibody is usually in the range of about 0.1 to 0.2 g/ml of serum (about 12 μM). Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Immunology, Ch. 42, 1980).

C. Antibodies Raised against Synthetic Peptides A third approach to raising antibodies against the neo-PAP protein is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence of the neo-PAP protein. Polyclonal antibodies can be generated by injecting such peptides into, for instance, mice or rabbits.

By way of example, mice were immunized with the following immunogen: [KLH carrier]- CSVGETERNSAEPAAVIVEKPLSV, which includes a neo-PAP peptide corresponding to amino acid positions 554 - 576 (SEQ ID NO: 2) conjugated to the carrier KLH (keyhole limpet hemocyanin) through an added N-terminal cysteine residue (shown in bold). KLH is a high molecular weight antigen that is extremely immunogenic and is well known in the art as a standard carrier or adjuvant for animal immunizations. Mice were immunized every 14 days and sera collected after day 56 were analyzed for neo-PAP specificity by Western blot analysis.

Rabbits were immunized with the following N-terminal neo-PAP peptide: CKEMSANTVLDSQRQQK corresponding to amino acid positions 2 - 17 of SEQ ID NO: 2 conjugated to the carrier KLH (keyhole limpet hemocyanin) through an added N-terminal cysteine residue (shown in bold). The immunizing peptide was synthesized and conjugated to KLH by Research Genetics, Invifrogen Corp. (Carlsbad, CA). The conjugated peptide was then dissolved in water to a concentration of 1 mg/ml. It was then sent to Cocalico Biologicals (Reamstown, PA) where it was used to immunize rabbits in order to generate rabbit anti-neo-PAP polyclonal antiserum. The resultant antibodies were characterized using standard techniques, essentially as follows: fifty nanograms of purified recombinant neo-PAP protein expressed in bacteria was prepared as described in Example 3 and loaded in each lane of a Tris-glycine acrylamide gel. Classic PAP II was loaded in lane 1 and neo-PAP was loaded in lane 2. Electrophoretically separated proteins (Topalian et al, Mol. Cell. Biol. 21 :5614-5623, 2001) were blotted onto a nitrocellulose membrane that was incubated with mouse anti-neo-PAP antiserum at a 1 :2000 dilution followed by incubation with a peroxidase-conjugated sheep anti-mouse IgG.

Fifty nanograms of purified recombinant neo-PAP was loaded in lane 1, and 50 ng of purified PAP II was loaded in lane 3 of a Tris-glycine acrylamide gel. Electrophoretically separated proteins (Topalian et al, Mol. Cell. Biol. 21:5614-5623, 2001) were blotted onto a nitrocellulose membrane that was incubated with rabbit anti-neo-PAP antiserum at a 1 : 1000 dilution and developed with a peroxidase-conjugated donkey anti-rabbit IgG.

Five hundred nanograms of the following purified proteins were loaded: lane 3, neo-PAP; lane 4, PAP II; and lane 5, BSA (bovine serum albumin) as a control. Electrophoretically separated proteins were stained with Coomassie blue.

Western blot analysis demonstrated specific staining of the 83 kDa neo-PAP protein using the mouse and rabbit anti-neo-PAP antisera (Fig. 11 A and Fig 1 IB). The neo-PAP protein is visualized at about 83 kDa, and the PAP II protein at about 85 kDa in the Coomassie blue stained gel (Fig. 11C). D. Antibodies Raised by Injection of neo-PAP Encoding Sequence

Antibodies may be raised against the neo-PAP protein by subcutaneous injection of a recombinant DNA vector that expresses the neo-PAP protein into laboratory animals, such as mice. Delivery of the recombinant vector into the animals may be achieved using a hand-held form of the Biolistic system (Sanford et al, Particulate Sci. Technol 5:27-37, 1987), as described by Tang et al. (Nature 356:152-154, 1992). Expression vectors suitable for this purpose may include those that express the neo-PAP encoding sequence under the transcriptional control of either the human β-actin promoter or the cytomegalovirus (CMV) promoter.

Antibody preparations prepared according to these protocols are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample.

EXAMPLE 14: DNA-Based Diagnosis The neo-PAP sequence information presented herein can be used in the area of genetic testing for predisposition to tumor formation or progression owing to defects in neo-PAP, such as deletion, duplication, over-expression, disregulation, or mutation. The gene sequence of the neo-PAP gene, including intron-exon boundaries is also useful in such diagnostic methods. Individuals carrying mutations in the neo-PAP gene (or a portion thereof), or having duplications or heterozygous or homozygous deletions of the neo-PAP gene, may be detected at the DNA level with the use of a variety of techniques. For such a diagnostic procedure, a biological sample of the subject, which biological sample contains either DNA or RNA derived from the subject, is assayed for a mutated, duplicated or deleted neo-PAP gene. Suitable biological samples include samples containing genomic DNA or RNA obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material. The detection in the biological sample of either a mutant neo-PAP gene, a mutant neo-PAP RNA, or a duplicated or homozygously or heterozygously deleted neo-PAP gene, may be performed by a number of methodologies, examples of which are discussed below.

One embodiment of such detection techniques for the identification of unknown mutations is the amplification (e.g., polymerase chain reaction amplification) of reverse transcribed RNA (RT- PCR) isolated from a subject, followed by direct DNA sequence determination of the products. The presence of one or more nucleotide differences between the obtained sequence and the prototypical neo-PAP cDNA sequence, and especially, differences in the ORF portion of the nucleotide sequence, are taken as indicative of a potential neo-PAP gene mutation.

Alternatively, DNA extracted from a biological sample may be used diregtly for amplification. Direct amplification from genomic DNA would be appropriate for analysis of the entire neo-PAP gene including regulatory sequences located upstream and downstream from the open reading frame, or infron/exon borders. Reviews of direct DNA diagnosis have been presented by Caskβy (Science 236: 1223-1228, 1989) and by Laαdegren et αl. (Science 242:229-237, 1989).

Other mutation scanning techniques appropriate for detecting unknown within amplicons derived from DNA or cDNA could also be performed. These techniques include direct sequencing (without sequencing), single-strand conformational polymorphism analysis (SSCP) (for instance, see Hongyo et αl, Nucleic Acids Res. 21 :3637-3642, 1993), chemical cleavage (including HOT cleavage) (Bateman et α/., Am. J. Med. Genet. 45:233-240, 1993; reviewed in Ellis et αl, Hum. Mutαt. 11:345- 353, 1998), denaturing gradient gel electrophoresis (DGGE), ligation amplification mismatch protection (LAMP), and enzymatic mutation scanning (Taylor and Deeble, Genet. Anal. 14:181-186, 1999), followed by direct sequencing of amplicons with putative sequence variations. Though the initial study reported herein did not find that neo-PAP mutation is common in tumors, further studies of neo-PAP genes/coding sequences isolated from tumor samples may reveal particular mutations, genomic amplifications, or deletions, which occur at a high frequency within this population of individuals. In such case, rather than sequencing the entire neo-PAP gene, DNA diagnostic methods can be designed to specifically detect the most common, or most closely disease- linked, neo-PAP defects.

The detection of specific DNA mutations may be achieved by methods such as hybridization using allele specific oligonucleotides (ASOs) (Wallace et al, CSHL Symp. Quant. Biol. 51:257-261, 1986), direct DNA sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995, 1988), the use of restriction enzymes (Flavell et al, Cell 15:25-41, 1978; Geever et al, 1981), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, Cold Spring Harbor Symp. Quant. Biol. 51:275-284, 1986), RNase protection (Myers et al, Science 230:1242-1246, 1985), chemical cleavage (Cotton et al, Proc. Natl. Acad. Sci. USA 85:4397-4401, 1985), and the ligase-mediated detection procedure (Landegren et al, Science 241:1077-1080, 1988).

Oligonucleotides specific to normal or mutant sequences are chemically synthesized using commercially available machines. These oligonucleotides are then labeled radioactively with isotopes (such as ³²P) or non-radioactively, with tags such as biotin (Ward and Langer, Proc. Natl. Acad. Sci. USA 78:6633-6657, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis. These specific sequences are visualized by methods such as autoradiography or fluorometric (Landegren et al, Science 242:229-237, 1989) or colorimefric reactions (Gebeyehu et al, Nucleic Acids Res. 15:4513-4534, 1987). Using an ASO specific for a normal allele, the absence of hybridization would indicate a mutation in the particular region of the gene, or deleted neo-PAP gene. In contrast, if an ASO specific for a mutant allele hybridizes to a clinical sample, this would indicate the presence of a mutation in the region defined by the ASO.

Sequence differences between normal and mutant forms of the neo-PAP gene may also be revealed by the direct DNA sequencing method of Church and Gilbert (Proc. Natl Acad. Sci. USA 81:1991-1995, 1988). Cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with nucleic acid amplification, e.g., PCR (Wrichnik et al, Nucleic Acids Res. 15:529-542, 1987; Wong et al, Nature 330:384-386, 1987; Stoflet et al, Science 239:491-494, 1988). In this approach, a sequencing primer that lies within the amplified sequence is used with double-stranded PCR product or single-stranded template generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotides or by automatic sequencing procedures with fluorescent tags.

Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or may eliminate existing restriction sites. Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization (Southern, J. Mol. Biol. 98:503-517, 1975). DNA fragments carrying the restriction site (either normal or mutant) are detected by their reduction in size or increase in corresponding restriction fragment numbers. Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme; fragments of different sizes are then visualized under UV light in the presence of ethidium bromide after gel electrophoresis.

Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing reagent. Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis. For example, a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8% non-denaturing polyacrylamide gel (WO 91/10734; Nagamine et al, Am. J. Hum. Genet. 45:337- 339, 1989). DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al, Science 230:1242-1246, 1985). Alternatively, a method of detecting a mutation comprising a single base , substitution or other small change could be based on differential primer length in a PCR. For example, an invariant primer could be used in addition to a primer specific for a mutation. The PCR products of the normal and mutant genes can then be differentially detected in acrylamide gels. In addition to conventional gel-electrophoresis and blot-hybridization methods, DNA fragments may also be visualized by methods where the individual DNA samples are not immobilized on membranes. The probe and target sequences may be both in solution, or the probe sequence may be immobilized (Saiki et al, Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989). A variety of detection methods, such as autoradiography involving radioisotopes, direct detection^'of radioactive decay (in the presence or absence of scintillant), specfrophotometry involving calorigenic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes.

If multiple mutations are encountered frequently in the neo-PAP gene, a system capable of detecting such multiple mutations likely will be desirable. For example, a nucleic acid amplification reaction with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al, Nucl Acids Res. 16: 1141-1155, 1988). The procedure may involve immobilized sequence-specific oligonucleotide probes (Saiki et al, Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989).

EXAMPLE 15: Quantitation of Neo-PAP Protein

An alternative method of diagnosing neo-PAP gene deletion, amplification, or mutation is to quantitate the level of neo-PAP protem in the cells of a subject. This diagnostic tool would be useful for detecting reduced levels of the neo-PAP protein that result from, for example, mutations in the promoter regions of the neo-PAP gene or mutations within the coding region of the gene that produce truncated, non-functional or unstable polypeptides, as well as from deletions of the entire neo-PAP gene. Alternatively, duplications of the neo-PAP gene may be detected as an increase in the expression level of this protein. The determination of reduced or increased neo-PAP protein levels would be an alternative or supplemental approach to the direct determination of neo-PAP gene deletion, duplication or mutation status by the methods outlined above. The availability of antibodies specific to the neo-PAP protein will facilitate the quantitation of cellular neo-PAP protein by one of a number of immunoassay methods, which are well known in the art and are presented herein and in, for instance, Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). For the purposes of quantitating the neo-PAP protein, a biological sample of the subject, which sample includes cellular proteins, is used. Such a biological sample may be obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, amniocentesis samples, surgical specimens, and autopsy material. In particular, tumor cells are appropriate samples. Quantitation of neo-PAP protein is achieved by immunoassay and compared to levels of the protein found in healthy cells (e.g., cells from a subject known not to suffer from a tumor). A significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) reduction in the amount of neo- PAP protein in the cells of a subject compared to the amount of neo-PAP protein found in normal human cells would be taken as an indication that the subject may have deletions or mutations in the neo-PAP gene locus, whereas a significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) increase would indicate that a duplication or enhancing mutation had occurred.

EXAMPLE 16: Detection of Serum Antibody against Neo-PAP Protein

The human neo-PAP protein was first identified in a patient suffering from a neoplasm, particularly melanoma. With the provision herein of human neo-PAP protein sequences and encoding nucleic acids, methods for the detection and diagnosis of such neoplasms are now enabled. Autoantibodies that recognize an epitope of the human neo-PAP protein can be detected in samples from a subject, for instance serum or other fluid, using known immunological techniques. The presence of such autoantibodies (e.g., circulating autoantibodies specific for a neo-PAP epitope) indicates that the subject suffers from a neo-PAP-mediated neoplastic disease or predisposition to development of neoplasm, or has an increased susceptibility to suffer from one of these conditions.

Many techniques are commonly known in the art for the detection and quantification of antigen. Most commonly, the purified antigen will be bound to a substrate, the antibody of the sample will bind via its Fab portion to this antigen, the substrate will then be washed and a second, labeled antibody will then be added which will bind to the Fc portion of the antibody that is the subject of the assay. The second, labeled antibody will be species specific, i.e., if the serum is from a human, the second, labeled antibody will be anti-human-IgG antibody. The specimen will then be washed and the amount of the second, labeled antibody that has been bound will be detected and quantified by standard methods. Examples of methods for the detection of antibodies in biological samples, including methods employing dip strips or other immobilized assay devices, are disclosed for instance in the following patents: U.S. Patents No. 5,965,356 (Herpes simplex virus type specific seroassay); 6,114,179 (Method and test kit for detection of antigens and/or antibodies); 6,077,681 (Diagnosis of motor neuropathy by detection of antibodies); 6,057,097 (Marker for pathologies comprising an auto- immune reaction and/or for inflammatory diseases); and 5,552,285 (Immunoassay methods, compositions and kits for antibodies to oxidized DNA bases). EXAMPLE 17: Suppression of Neo-PAP Expression

A reduction of neo-PAP protein expression in a transgenic cell may be obtained by introducing into cells an antisense construct based on the neo-PAP encoding sequence, including the human neo-PAP cDNA (SEQ ID NO: 1) or gene sequence or flanking regions thereof. For antisense suppression, a nucleotide sequence from a neo-PAP encoding sequence, e.g. all or a portion of the neo-PAP cDNA or gene, is arranged in reverse orientation relative to the promoter sequence in the transformation vector. Other aspects of the vector may be chosen as discussed above (Example 12). The introduced sequence need not be the full-length human neo-PAP cDNA (SEQ ID NO: 1) or gene, and need not be exactly homologous to the equivalent sequence found in the cell type to be transformed. Thus, portions or fragments of the human cDNA (SEQ ID NO: 1) could also be used to knock out expression of the human neo-PAP gene. Generally, however, where the introduced sequence is of shorter length, a higher degree of identity to the native neo-PAP sequence will be needed for effective antisense suppression. The introduced antisense sequence in the vector may be at least 15 nucleotides in length, and improved antisense suppression typically will be observed as the length of the antisense sequence increases. The length of the antisense sequence in the vector advantageously may be greater than 100 nucleotides, and can be up to about the full length of the human neo-PAP cDNA or gene. For suppression of the neo-PAP gene itself, transcription of an antisense construct results in the production of RNA molecules that are the reverse complement of mRNA molecules transcribed from the endogenous neo-PAP gene in the cell. Although the exact mechanism by which antisense RNA molecules interfere with gene expression has not been elucidated, it is believed that antisense RNA molecules bind to the endogenous mRNA molecules and thereby inhibit translation of the endogenous mRNA.

Suppression of endogenous neo-PAP expression can also be achieved using ribozymes. Ribozymes are synthetic RNA molecules that possess highly specific endoribonuclease activity. The production and use of ribozymes are disclosed in U.S. Patent No. 4,987,071 to Cech and U.S. Patent No. 5,543,508 to Haselhoff. The inclusion of ribozyme sequences within antisense RNAs may be used to confer RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that bind to the antisense RNA are cleaved, which in turn leads to an enhanced antisense inhibition of endogenous gene expression. Finally, dominant negative mutant forms of neo-PAP may be used to block endogenous neo-

PAP activity.

EXAMPLE 18: Neo-PAP Knockout and Overexpression Transgenic Animals

Mutant organisms that under-express or over-express neo-PAP protein are useful for research. Such mutants allow insight into the physiological and/or pathological role of neo-PAP in a healthy and/or pathological organism. These mutants are "genetically engineered," meaning that information in the form of nucleotides has been transferred into the mutant's genome at a location, or in a combination, in which it would not normally exist. Nucleotides transferred in this way are said to be "non-native." For example, a non-neo-PAP promoter inserted upstream of a native neo-PAP gene would be non-native. An extra copy of a neo-PAP gene or other encoding sequence on a plasmid, transformed into a cell, would be non-native, whether that extra copy was neo-PAP derived from the same, or a different species. Mutants may be, for example, produced from mammals, such as mice, that either over- express or under-express neo-PAP protein, or that do not express neo-PAP at all. Over-expression mutants are made by increasing the number of neo-PAP-encoding sequences (such as genes) in the organism, or by introducing an neo-PAP-encoding sequence into the organism under the control of a constitutive or inducible or viral promoter such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter or the metallothionein promoter. Mutants that under-express neo-PAP may be made by using an inducible or repressible promoter, or by deleting the neo-PAP gene, or by destroying or limiting the function of the neo-PAP gene, for instance by disrupting the gene by fransposon insertion.

Antisense genes may be engineered into the organism, under a constitutive or inducible promoter, to decrease or prevent neo-PAP expression, as discussed above in Example 17.

A gene is "functionally deleted" when genetic engineering has been used to negate or reduce gene expression to negligible levels. When a mutant is referred to herein as having the neo-PAP gene altered or functionally deleted, this refers to the neo-PAP gene and to any ortholog of this gene. When a mutant is referred to as having "more than the normal copy number" of a gene, this means that it has more than the usual number of genes found in the wild-type organism, e.g., in the diploid mouse or human.

A mutant mouse over-expressing neo-PAP may be made by constructing a plasmid having the neo-PAP gene driven by a promoter, such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter. This plasmid may be introduced into mouse oocytes by microinjection. The oocytes are implanted into pseudopregnant females, and the litters are assayed for insertion of the transgene. Multiple strains containing the fransgene are then available for study.

WAP is quite specific for mammary gland expression during lactation, and MMTV is expressed in a variety of tissues including mammary gland, salivary gland and lymphoid tissues. Many other promoters might be used to achieve various patterns of expression, e.g., the metallothionein promoter.

An inducible system may be created in which the subject expression construct is driven by a promoter regulated by an agent that can be fed to the mouse, such as tetracycline. Such techniques are well known in the art.

A mutant knockout animal (e.g., mouse) from which the neo-PAP gene is deleted or otherwise disabled can be made by removing coding regions of the neo-PAP gene from embryonic stem cells. The methods of creating deletion mutations by using a targeting vector have been described (see, for instance, Thomas and Capecch, Cell 51:503-512, 1987). EXAMPLE 19: Nucleic Acid-Based Neo-PAP Therapy

Gene therapy approaches for combating neo-PAP-mediated cell development defects in subjects, such as uncontrolled or disregulated cell growth or neoplasm, are now made possible.

Retroviruses have been considered a preferred vector for experiments in gene therapy, with a high efficiency of infection and stable integration and expression (Orkin et al, Prog. Med. Genet. 7:130-142, 1988). The full-length neo-PAP gene or cDNA can be cloned into a retroviral vector and driven from either its endogenous promoter or, for instance, from the retroviral LTR (long terminal repeat). Other viral fransfection systems may also be utilized for this type of approach, including adenovirus, adeno-associated virus (AAV) (McLaughlin et al, J. Virol. 62:1963-1973, 1988), Vaccinia virus (Moss et al, Annu. Rev. Immunol. 5:305-324, 1987), Bovine Papilloma virus

(Rasmussen et al, Methods Enzymol 139:642-654, 1987) or members of the herpesvirus group such as Epstein-Barr virus (Margolskee et al, Mol. Cell. Biol. 8:2837-2847, 1988).

More recent developments in gene therapy techniques include the use of RNA-DNA hybrid oligonucleotides, as described by Cole-Strauss, et al. (Science 273:1386-1389, 1996). This technique may allow for site-specific integration of cloned sequences, thereby permitting accurately targeted gene replacement.

In addition to delivery of neo-PAP to cells using viral vectors, it is possible to use non- infectious methods of delivery. For instance, lipidic and liposome-mediated gene delivery has recently been used successfully for fransfection with various genes (for reviews, see Templeton and Lasic, Mol. Biotechnol. 11:175-180, 1999; Lee and Huang, Crit. Rev. Ther. Drug Carrier Syst.

14:173-206; and Cooper, Semin. Oncol. 23:172-187, 1996). For instance, cationic liposomes have been analyzed for their ability to ttansfect monocytic leukemia cells, and shown to be a viable alternative to using viral vectors (de Lima et al, Mol. Membr. Biol. 16:103-109, 1999). Such cationic liposomes can also be targeted to specific cells through the inclusion of, for instance, monoclonal antibodies or other appropriate targeting ligands (Kao et al, Cancer Gene Ther. 3:250- 256, 1996).

EXAMPLE 20: Kits

Kits are provided which contain the necessary reagents for determining neo-PAP gene copy number, for determining abnormal expression of neo-PAP mRNA or neo-PAP protein, or for detecting polymorphisms in neo-PAP alleles. Instructions provided in the diagnostic kits can include calibration curves, diagrams, illustrations, or charts or the like to compare with the determined (e.g., experimentally measured) values or other results.

A. Kits for Detection of neo-PAP Genomic Sequences

The nucleotide sequences disclosed herein, and fragments thereof, can be supplied in the form of a kit for use in detection of neo-PAP genomic sequences and/or diagnosis of neoplastic disease, tumor formation, and/or progression of such conditions. In such a kit, an appropriate amount of one or more of the neo-PAP-specific oligonucleotide primers is provided in one or more containers. The oligonucleotide primers may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance. The container(s) in which the oligonucleotide(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles. In some applications, pairs of primers may be provided in pre- measured single use amounts in individual, typically disposable, tubes or equivalent containers. With such an arrangement, the sample to be tested for the presence of neo-PAP genomic amplification can be added to the individual tubes and in vitro amplification carried out directly.

The amount of each oligonucleotide primer supplied in the kit can be any appropriate amount, depending for instance on the market to which the product is directed. For instance, if the kit is adapted for research or clinical use, the amount of each oligonucleotide primer provided would likely be an amount sufficient to prime several in vitro amplification reactions. Those of ordinary skill in the art know the amount of oligonucleotide primer that is appropriate for use in a single amplification reaction. General guidelines may for instance be found in Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990), Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989), and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).

A kit may include more than two primers, in order to facilitate the PCR in vitro amplification of neo-PAP sequences, for instance the neo-PAP gene, specific exon(s) or other portions of the gene, or the 5' or 3' flanking region thereof.

In some embodiments, kits may also include the reagents necessary to carry out PCR in vitro amplification reactions, including, for instance, DNA sample preparation reagents, appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Written instructions may also be included. Kits may in addition include either labeled or unlabeled oligonucleotide probes for use in detection of the in vitro amplified neo-PAP sequences. The appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the in vitro amplification reaction. It may also be advantageous to provide in the kit one or more control sequences for use in the amplification reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.

B. Kits for Detection of neo-PAP mRNA Expression

Kits similar to those disclosed above for the detection of neo-PAP genomic sequences can be used to detect neo-PAP mRNA expression levels. Such kits may include an appropriate amount of one or more of the oligonucleotide primers for use in reverse transcription amplification reactions, similarly to those provided above, with art-obvious modifications for use with RNA. In some embodiments, kits for detection of neo-PAP mRNA expression levels may also include the reagents necessary to carry out RT-PCR in vitro amplification reactions, including, for instance, RNA sample preparation reagents (including e.g., an RNAse inhibitor), appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Written instructions may also be included.

Kits in addition may include either labeled or unlabeled oligonucleotide probes for use in detection of the in vitro amplified target sequences. The appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the PCR reaction. It also may be advantageous to provide in the kit one or more control sequences for use in the RT-PCR reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.

Alternatively, kits may be provided with the necessary reagents to carry out quantitative or semi-quantitative Northern analysis of neo-PAP mRNA. Such kits include, for instance, at least one neo-PAP-specific oligonucleotide for use as a probe. This oligonucleotide may be labeled in any conventional way, including with a selected radioactive isotope, enzyme substrate, co-factor, ligand, chemiluminescent or fluorescent agent, hapten, or enzyme.

C. Kits For Detection of neo-PAP Protein or Peptide Expression

Kits for the detection of neo-PAP protein expression, include for instance at least one target protein specific binding agent (e.g., a polyclonal or monoclonal antibody or antibody fragment) and may include at least one control. The neo-PAP protein specific binding agent and control may be contained in separate containers. The kits may also include means for detecting neo-PAP:agent complexes, for instance the agent may be detectably labeled. If the detectable agent is not labeled, it may be detected by second antibodies or protein A for example, which may also be provided in some kits in one or more separate containers. Such techniques are well known.

Additional components in some kits include instructions for carrying out the assay. Instructions will allow the tester to determine whether neo-PAP expression levels are altered, for instance in comparison to a control sample. Reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits. By way of example only, an effective and convenient immunoassay kit such as an enzyme- linked immunosorbent assay can be constructed to test anti-neo-PAP antibody in human serum, as reported for detection of non-specific anti-ovarian antibodies (Wheatcroft et al, Gin. Exp. Immunol. 96:122-128, 1994; Wheatcroft et al, Hum. Reprod. 12:2617-2622, 1997). Expression vectors can be constructed using the human neo-PAP cDNA to produce the recombinant human neo-PAP protem in either bacteria or baculovirus (as described in Example 12). By affinity purification, unlimited amounts of pure recombinant neo-PAP protein can be produced. An assay kit could provide the recombinant protein as an antigen and enzyme-conjugated goat anti-human IgG as a second antibody as well as the enzymatic substrates. Such kits can be used to test if the patient sera contain antibodies against human neo-PAP.

D. Kits for Detection ofHomozygous versus Heterozygous Allelism Also provided are kits that allow differentiation between individuals who are homozygous versus heterozygous for polymorphisms of neo-PAP. Such kits provide the materials necessary to perform oligonucleotide ligation assays (OLA), for instance as described at Nickerson et al. (Proc. Natl. Acad. Sci. USA 87:8923-8927, 1990). In specific embodiments, these kits contain one or more microtiter plate assays, designed to detect polymorphism(s) in the neo-PAP sequence of a subject, as described herein.

Additional components in some of these kits may include instructions for carrying out the assay. Instructions will allow the tester to determine whether an neo-PAP allele is homozygous or heterozygous. Reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits. It may also be advantageous to provide in the kit one or more control sequences for use in the OLA reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.

EXAMPLE 21: Neo-PAP as an Active Poly(A) Polymerase With the demonstration herein that neo-PAP is an active poly(A) polymerase, the use of this activity is now enabled. For instance, isolated neo-PAP can be used for research purposes, for instance for adding poly-A tails to RNA molecules, or for adding 3' label molecules (such as radioactive adenosine) to RNA. For instance, neo-PAP can be used in vitro to incorporate a label (such as a radioactive label) into nucleic acid molecules, for instance to assist in quantitation or visualization of the labeled molecule or a molecule to which the labeled nucleic acid hybridizes. Also, the addition of a poly-A tail is known to increase the stability of an RNA molecule. Thus, neo-PAP can be used to increase the stability of a target ribonucleic acid molecule. By way of example, the immune stimulatory methods of the Gilboa laboratory (see, e.g., Gilboa et al, Cancer Immunol Immunother 46:82-7, 1998; Heiser et al. J Immunol. 166(5):2953-60, 2001; Boczkowski et al, Cancer Res. 60(4): 1028-34, 2000), in which dendritic cells are stimulated in vitro through application of mRNA, could be enhanced by first elongating the tails of the mRNA using neo-PAP. More generally, the poly(A) polymerase activity of neo-PAP can be usefully employed in any method in which it is beneficial to increase the length of the poly(A) tail or a message, and/or increase the expected duration of that message. Methods are provided herein (Example 3) for using neo-PAP in vitro as both a non-specific poly(A) and a specific poly(A) polymerase. EXAMPLE 22: Neo-PAP as an Immunogenic Agent

With the discovery, disclosed herein, that neo-PAP is a cancer-testis type antigen, the use of this protein as an immunogenic agent, for instance in the treatment, amelioration, or prevention of neoplasms, is now enabled. The provided immunostimulatory proteins or peptides, derived from neo-PAP are combined with a pharmaceutically acceptable carrier or vehicle for administration as an immunostimulatory composition or a vaccine to human or animal subjects. In some embodiments, more than one protein or peptide fragment may be combined to form a single preparation.

The immunogenic formulations may be conveniently presented in unit dosage form and prepared using conventional pharmaceutical techniques. Such techniques include the step of bringing into association the active ingredient and the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers. Formulations suitable for parenteral administration include aqueous and non- aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non- aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets commonly used by one of ordinary skill in the art.

In certain embodiments, unit dosage formulations are those containing a dose or unit, or an appropriate fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients particularly mentioned above, formulations encompassed herein may include other agents commonly used by one of ordinary skill in the art.

The compositions provided herein, including those for use as immunostimulatory agents or vaccines, may be administered through different routes, such as oral, including buccal and sublingual, rectal, parenteral, aerosol, nasal, intramuscular, subcutaneous, intradermal, and topical. They may be administered in different forms, including but not limited to solutions, emulsions and suspensions, microspheres, particles, microparticles, nanoparticles, and liposomes.

The volume of administration will vary depending on the route of administration. By way of example, intramuscular injections may range from about 0.1 ml to 1.0 ml. Those of ordinary skill in the art will know appropriate volumes for different routes of administration.

The amount of protein in each vaccine dose is selected as an amount that induces an immunoprotective response without significant, adverse side effects. Such amount will vary depending upon which specific immunogen is employed and how it is presented. Initial injections may range from about 1 μg to 1 mg, with some embodiments having a range of about 10 μg to 800 μg, and still other embodiments a range of from approximately 25 μg to 500 μg. Following an initial vaccination, subjects may receive one or several booster immunizations, adequately spaced. Booster injections may range from 1 μg to 1 mg, with other embodiments having a range of approximately 10 μg to 750 μg, and still others a range of about 50 μg to 500 μg. Periodic boosters at intervals of 1-5 years, for instance three years, may be desirable to maintain the desired levels of protective immunity.

As described in WO 95/01441, the course of the immunization may be followed by in vitro proliferation assays of PBL (peripheral blood lymphocytes) co-cultured with ESAT6 or ST-CF, and especially by measuring the levels of IFN-released from the primed lymphocytes. The assays are well known and are widely described in the literature, including in U.S. Patent Nos. 3,791,932; 4,174,384 and 3,949,064.

A recent development in the field of vaccines is the direct injection of nucleic acid molecules encoding peptide antigens (broadly described in Janeway & Travers, Immunobiology: The Immune System In Health and Disease, page 13.25, Garland Publishing, Inc., New York, 1997; and McDonnell & Askari, N. Engl. J. Med. 334:42-45, 1996). Plasmids that include nucleic acid molecules described herein, or that include a nucleic acid sequence encoding an immunogenic peptide or peptide fragment of neo-PAP or derived from neo-PAP, may be utilized in such DNA vaccination methods.

Thus, the terms "immunostimulatory preparation" and "vaccine" as used herein also include nucleic acid vaccines in which a nucleic acid molecule encoding a neo-PAP polypeptide is administered to a subject in a pharmaceutical composition. For genetic immunization, suitable delivery methods known to those skilled in the art include direct injection of plasmid DNA into muscles (Wolff et al, Hum. Mol. Genet. 1:363, 1992), delivery of DNA complexed with specific protein carriers (Wu et al., J. Biol. Chem. 264:16985, 1989), co-precipitation of DNA with calcium phosphate (Benvenisty and Reshef, Proc. Natl. Acad. Sci. 83:9551, 1986), encapsulation of DNA in liposomes (Kaneda et al., Science 243:375, 1989), particle bombardment (Tang et al., Nature

356:152, 1992) and (Eisenbraun et al, DNA Cell Biol. 12:791, 1993), and in vivo infection using cloned retroviral vectors (Seeger et al., Proc. Natl. Acad. Sci. 81:5849, 1984).

Similarly, nucleic acid vaccine preparations can be administered via viral carrier.

It is also contemplated that the provided immunostimulatory molecules and preparations can be administered to a subject indirectly, by first stimulating a cell in vitro, which stimulated cell is thereafter administered to the subject to elicit an immune response.

EXAMPLE 23: Immunological and Pharmaceutical Compositions

Immunological compositions, including immunological elicitor compositions and vaccines, and other pharmaceutical compositions containing the neo-PAP polypeptides or antigenic fragments thereof described herein are useful for reducing, ameliorating, treating, or possibly preventing neo- PAP-mediated biological conditions, such as neoplasia. One or more of the polypeptides are formulated and packaged, alone or in combination with adjuvants or other antigens, using methods and materials known to those skilled in the vaccine art. An immunological response of a subject to such an immunological composition may be used therapeutically or prophylactically, and in certain embodiments provides antibody immunity and/or cellular immunity such as that produced by T lymphocytes such as cytotoxic T lymphocytes or CD4⁺ T lymphocytes. To enhance immunogenicity, one or more immunogenic polypeptides or fragments (e.g., haptens) may be conjugated to a carrier molecule. Immunogenic carrier molecules include proteins, polypeptides or peptides such as albumin, hemocyanin, thyroglobulin and derivatives thereof, particularly bovine serum albumin (BSA) and keyhole limpet hemocyanin (KLH), polysaccharides, carbohydrates, polymers, and solid phases. Other protein-derived or non-protein-derived substances are known to those of ordinary skill in the art. An immunogenic carrier typically has a molecular weight of at least 1,000 Daltons, and in some embodiments greater than 10,000 Daltons. Carrier molecules often contain a reactive group to facilitate covalent conjugation to the hapten. The carboxylic acid group or amine group of amino acids or the sugar groups of glycoproteins are often used in this manner. Carriers lacking such groups can often be reacted with an appropriate chemical to produce them. Alternatively, a multiple antigenic polypeptide comprising multiple copies of the protein or polypeptide, or an antigenically or immunologically equivalent polypeptide may be sufficiently antigenic to improve immunogenicity without the use of a carrier.

The neo-PAP polypeptides may be administered with an adjuvant in an amount effective to enhance the immunogenic response against the conjugate. At this time, the only adjuvant widely used in humans has been alum (aluminum phosphate or aluminum hydroxide). Saponin and its purified component Quil A, Freund's complete adjuvant and other adjuvants used in research and veterinary applications have toxicities which limit their potential use in human vaccines. However, chemically defined preparations such as muramyl dipeptide, monophosphoryl lipid A, phospholipid conjugates such as those described by Goodman-Snitkoff et al. (J. Immunol. 147:410-415, 1991), encapsulation of the conjugate within a proteohposome as described by Miller et al. (J. Exp. Med. 176:1739-1744, 1992), and encapsulation of the protein in lipid vesicles may also be useful.

The compositions provided herein, including those formulated to serve as vaccines, may be stored at temperatures of from about -100° C to 4° C. They may also be stored in a lyophilized state at different temperatures, including higher temperatures such as room temperature. The preparation may be sterilized through conventional means known to one of ordinary skill in the art. Such means include, but are not limited to filtration, radiation and heat. The preparations also may be combined with bacteriostatic agents, such as thimerosal, to inhibit bacterial growth.

A variety of adjuvants known to one of ordinary skill in the art may be administered in conjunction with the protein(s) in the provided vaccine composition. Such adjuvants include but are not limited to the following: polymers, co-polymers such as polyoxyethylene-polyoxypropylene copolymers, including block co-polymers; polymer P1005; Freund's complete adjuvant (for animals); Freund's incomplete adjuvant; sorbitan monooleate; squalene; CRL-8300 adjuvant; alum; QS 21, muramyl dipeptide; CpG oligonucleotide motifs and combinations of CpG oligonucleotide motifs; frehalose; bacterial extracts, including mycobacterial extracts; detoxified endotoxins; membrane lipids; or combinations thereof.

In a particular embodiment, a vaccine is packaged in a single dosage for immunization by parenteral (i.e., intramuscular, inttadermal or subcutaneous) administration or nasopharyngeal (i.e., intranasal) administration. In certain embodiments, the vaccine is injected intramuscularly into the deltoid muscle. The vaccine may be combined with a pharmaceutically acceptable carrier to facilitate administration. The carrier is, for instance, water, or a buffered saline, with or without a preservative. The vaccine may be lyophilized for resuspension at the time of administration or in solution.

The carrier to which the polypeptide may be conjugated may also be a polymeric delayed release system. Synthetic polymers are particularly useful in the formulation of a vaccine to effect the controlled release of antigens.

Microencapsulation of the polypeptide will also give a controlled release. A number of factors contribute to the selection of a particular polymer for microencapsulation. The reproducibility of polymer synthesis and the microencapsulation process, the cost of the microencapsulation materials and process, the toxicological profile, the requirements for variable release kinetics and the physicochemical compatibility of the polymer and the antigens are all factors that must be considered. Examples of useful polymers are polycarbonates, polyesters, polyurethanes, polyorthoesters polyamides, poly (d,l-lactide-co-glycolide) (PLGA) and other biodegradable polymers. Doses for human administration of a pharmaceutical composition or a vaccine may be from about 0.01 mg/kg to 10 mg/kg, for instance approximately 1 mg/kg. Based on this range, equivalent dosages for heavier (or lighter) body weights can be determined. The dose may be adjusted to suit the individual to whom the composition is administered, and may vary with age, weight, and metabolism of the individual, as well as the health of the subject. Such determinations are left to the attending physician or another familiar with the subject and/or the specific situation. The vaccine may additionally contain stabilizers or physiologically acceptable preservatives, such as thimerosal (ethyl(2-mercaptobenzoate-S)mercury sodium salt) (Sigma Chemical Company, St. Louis, MO).

Embodiments of this disclosure provide neo-PAP proteins and nucleic acid molecules, and methods of isolating, making, and using these molecules. Further embodiments provide methods for ameliorating, treating, detecting, prognosing and diagnosing diseases related to neo-PAP. It will be apparent that the precise details of the methods described may be varied or modified without departing from the spirit of the described invention. We claim all such modifications and variations that fall within the scope and spirit of the claims below.

Claims

We claim:

1. An isolated neo-PAP protein comprising an amino acid sequence as set forth in

(a) SEQ ID NO: 2;

(b) sequences having at least 75% sequence identity to (a); or

(c) conservative variants of (a) or (b), wherein t thhee nneeoo--PAP protein has poly(A) polymerase activity. 2 2.. The protein of claim 1, wherein the protein is a cancer-testis antigen.

3 3.. The protein of claim 1, wherein the protein is expressed in a tumor cell.

4. The protein of claim 1, comprising the amino acid sequence as set forth in SEQ ID

NO: 2.

5 5.. The protein of claim 1, comprising an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 2.

6. The protein of claim 1, comprising an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 2.

7. The protein of claim 1, comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 2. 8. An isolated neo-PAP protein comprising the amino acid sequence as set forth in

SEQ ID NO: 2.

9. An isolated nucleic acid molecule encoding the protein according to claim 1.

10. The isolated nucleic acid molecule of claim 9, comprising a nucleotide sequence as set forth in: (a) SEQ ID NO: 1;

(b) sequences having at least 90% sequence identity with (a).

11. The isolated nucleic acid molecule of claim 9, having a sequence which comprises at least 200 contiguous nucleotides having a nucleotide sequence as set forth in SEQ ID NO: 1.

12. The isolated nucleic acid molecule of claim 9, comprismg a nucleotide sequence as set forth in SEQ ID NO: 1.

13. The isolated nucleic acid molecule of claim 9, comprising a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 1.

14. The isolated nucleic acid molecule of claim 9, comprising a nucleotide sequence having at least 85% sequence identity with SEQ ID NO: 1. 15. A recombinant nucleic acid molecule comprising a promoter sequence operably linked to nucleic acid molecule according to claim 9.

16. A cell transformed with a recombinant nucleic acid molecule according to claim

17. A method of detecting a biological condition associated with an abnormal neo-PAP nucleic acid or an abnormal neo-PAP expression in a subject, comprising determining whether the subject has an abnormal neo-PAP nucleic acid or abnormal neo-PAP expression.

18. The method of claim 17, which is a method of detecting neoplasia. 19. The method of claim 17, wherein the abnormal neo-PAP nucleic acid or abnormal neo-PAP expression comprises an alteration in a cellular level of neo-PAP nucleic acid or neo-PAP protein, in comparison to a normal level.

20. The method of claim 17, wherein the abnormal neo-PAP nucleic acid comprises a neo-PAP polymorphism. 21. The method of claim 17, which is a method of predicting a predisposition to neoplasm in a subject, comprising: determining whether the subject has a polymorphism in a neo-PAP sequence, wherein presence of the polymorphism indicates the predisposition to the neoplasm.

22. The method of claim 21, further comprising determining whether the subject is homozygous or heterozygous for the polymorphism.

23. The method of claim 17, comprising: determining whether the subject has circulating autoantibodies that recognize an epitope of a neo-PAP protein, wherein the presence of such autoantibodies indicates neoplasia in the subject, or an increased susceptibility of the subject to neoplasia. 24. The method of claim 17, wherein the abnormal neo-PAP expression comprises an increased or decreased expression of neo-PAP in a subject.

25. The method of claim 17, comprising: reacting at least one neo-PAP molecule contained in a clinical sample from the subject with a reagent comprising a neo-PAP-specific binding agent to form a neo-PAP:agent complex.

26. The method of claim 25, wherein the neo-PAP molecule is a neo-PAP encoding nucleic acid or a neo-PAP protein.

27. The method of claim 25, wherein the neo-PAP specific binding agent is a neo-PAP oligonucleotide or a neo-PAP protein specific binding agent. 28. The method of claim 25, wherein the sample comprises a neoplastic cell.

30. The method of claim 17, further comprising in vitro amplifying a neo-PAP nucleic acid prior to detecting the abnormal neo-PAP nucleic acid.

31. The method of claim 17, wherem the neo-PAP nucleic acid is in vitro amplified using at least one oligonucleotide primer derived from a neo-PAP-protein encoding sequence.

32. The method of claim 31 , wherein at least one oligonucleotide primer comprises at least 15 contiguous nucleotides from SEQ ID NO: 1.

33. The method of claim 31 , wherein at least one oligonucleotide primer comprises a sequence as represented by SEQ ID NO: 3, 4, 5, 6, 7, 9, 10, 11, or 12.

34. An oligonucleotide primer used in the method of claim 32.

35. A recombinant DNA vector comprising the oligonucleotide primer according to claim 34.

36. A recombinant nucleic acid molecule comprising a promoter sequence operably linked to the oligonucleotide primer sequence according to claim 34.

37. The recombinant nucleic acid molecule according to claim 35 wherein the nucleic acid sequence is in antisense orientation relative to the promoter sequence. 38. A cell transformed with the recombinant nucleic acid molecule according to claim

36.

39. A transgenic non-human animal, comprising the recombinant nucleic acid molecule according to claim 35.

40. The method of claim 26, wherein the neo-PAP molecule is a neo-PAP encoding nucleic acid sequence.

41. The method of claim 40, wherein the agent is a labeled nucleotide probe.

42. The method of claim 41, wherein the nucleotide probe has a sequence selected from the group consisting of:

(a) SEQ ID NO: 1; (b) nucleic acid sequences having at least 65% sequence identity with (a); and

(c) fragments of (a) or (b) at least 15 nucleotides in length.

43. An nucleotide probe used in the method of claim 41.

44. The method of claim 26, wherein the neo-PAP molecule is a neo-PAP protein.

45. The method of claim 44, wherein the complexes are detected by Western blot assay.

46. The method of claim 44, wherein the complexes are detected by ELISA.

47. The method of claim 44, wherein the neo-PAP protein comprises a sequence selected from the group consisting of:

(a) SEQ ID NO: 2; (b) amino acid sequences having at least 75% sequence identity with (a); and

(c) conservative variants of (a) or (b).

48. The method of claim 46, wherein the neo-PAP-specific binding agent is a neo- PAP-specific antibody or a functional fragment thereof.

49. The agent of claim 48, wherein the agent is an antibody. 50. The antibody of claim 49, wherein the antibody is a monoclonal antibody.

51. A kit for detecting an excess or deficiency of neo-PAP protein in a subject using the method of claim 44, comprising a neo-PAP protein specific binding agent.

52. The kit of claim 53, wherein the agent is capable of specifically binding to an epitope within:

(a) the amino acid sequence shown in SEQ ID NO: 2;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions;

(c) the amino acid sequences having at least 75% sequence identity to the sequences specified in (a); or

(d) antigenic fragments of (a), (b), or (c).

53. The kit of claim 51 , further comprising a means for detecting binding of the neo- PAP protein binding agent to a neo-PAP polypeptide.

54. The kit of claim 51 , wherein the subject is a mammal. 55. The kit of claim 54, wherein the mammal is a human.

56. The kit of claim 51, wherein the overabundance or underabundance results in neoplasia. 57. The kit of claim 51, wherein the neo-PAP protein binding agent is an antibody.

58. A kit for detection of a genetic mutation in a sample of nucleic acid, comprising:

(a) a first container containing an oligonucleotide capable of specifically hybridizing with a neo-PAP nucleic acid; and

(b) a second container containing a labeled nucleic acid probe that is fully complementary to the oligonucleotide.

59. The kit of claim 58, wherein the labeled nucleic acid probe has a length of between 5 and 500 nucleotides.

60. A kit for determining whether or not a subject has a biological condition associated with an abnormal neo-PAP expression by detecting an overabundance of neo-PAP protein in a sample of tissue and/or body fluids from the subject, comprising: a container comprising an antibody specific for neo-PAP protein; and instructions for using the kit, the instructions indicating steps for: performing a method to detect the presence of neo-PAP protein in the sample; and analyzing data generated by the method, wherein the instructions indicate that overabundance of neo-PAP protein in the sample indicates that the individual has or is predisposed to the biological condition.

61. The kit of claim 60, further comprising a container that comprises a detectable antibody capable of binding to the neo-PAP protein specific antibody. 62. The kit of claim 60, wherein the biological condition associated with abnormal neo-

PAP expression is neoplasm.

63. An in vitro assay kit for determining whether or not a subject has a biological condition associated with an abnormal neo-PAP expression, the kit comprising: a container comprising a neo-PAP protein specific antibody; a container comprising a negative control sample; and instructions for using the kit, the instructions indicating steps for: performing a test assay to detect a quantity of neo-PAP protein in a test sample of tissue and/or bodily fluid from the subject, performing a negative control assay to detect a quantity of neo-PAP protein in the negative control sample; and comparing data generated by the test assay and negative control assay, wherein the instructions indicate that a quantity of neo-PAP protein in the test sample more than the quantity of neo-PAP protein in the negative control sample indicates that the subject has the biological condition.

64. The kit of claim 63 further comprising a container that comprises a detectable antibody that binds to the antibody specific for neo-PAP protein.

65. The kit of claim 63, wherein the biological condition associated with an abnormal neo-PAP expression is neoplasm.

66. An isolated nucleic acid molecule according to claim 9, wherein the molecule hybridizes with a nucleic acid probe comprising the sequence shown in SEQ ID NO: 1 under wash conditions of 55° C, 0.2 x SSC and 0.1% SDS.

67. An isolated nucleic acid molecule according to claim 9, wherein the molecule hybridizes with a nucleic acid probe comprising the sequence shown in SEQ ID NO: 1 under wash conditions of 50° C, 2 x SSC, 0.1 % SDS.

68. A method of modifying a level of expression of a neo-PAP protein in a subject, comprising expressing in the subject a recombinant genetic construct comprising a promoter operably linked to a nucleic acid molecule, wherein the nucleic acid molecule comprises at least 15 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 1, or a sequence at least 90% identical to SEQ ID NO: 1, and expression of the nucleic acid molecule changes expression of the neo-PAP protein.

69. The method of claim 68 wherein the nucleic acid molecule is in antisense orientation relative to the promoter. 70. A method of screening for a compound useful in influencing neo-PAP -mediated poly(A) polymerization in a mammal, comprising determining if a test compound binds to or interacts with the protein according to claim 1, or variants or fragments thereof, and selecting a compound that so binds.

71. The method of claim 70, wherein binding of the compound inhibits a neo-PAP protein biological activity.

72. The method of claim 70, wherein the test compound is applied to a test cell.

73. A compound selected by the method of claim 70.

74. The compound of claim 73, for use as a therapeutic agent.

75. A composition comprising at least one antigenic fragment of the protein of claim 1.

76. The composition of claim 75 wherein the antigenic fragment comprises an amino acid sequence as shown in at least four consecutive amino acids shown in SEQ ID NO: 2.

77. The composition of claim 75 wherein the antigenic fragment is a recombinant polypeptide.

78. A method of eliciting an immune response against an antigenic epitope in a subject, comprising introducing into the subject the composition of claim 75, or a composition comprising a nucleic acid molecule encoding the antigenic fragment in the composition of claim 75.

79. The method of claim 78, wherein the elicited immune response results in decreased susceptibility of the subject to neoplasm.

80. A methods of adding a ρoly(A) tail to an RNA molecule, comprising incubating the RNA molecule with the protein of claim 1.

81. A method of adding a 3 ' label to an RNA molecule, comprising incubating the RNA molecule with the protein of claim 1 in the presence of a labeled adenine nucleoside. 82. A pharmaceutical composition, comprising an immunogenically effective amount of an immunogenic fragment of the protein of claim 1 and a pharmaceutically acceptable carrier or diluent.

83. The pharmaceutical composition of claim 82, wherein the composition is a vaccine effective in stimulating an immune response to a neoplasm. 84. A method of eliciting an immune response in an animal, comprising introducing into the animal the pharmaceutical composition of claim 82.

85. The method of claim 84, wherein the immune response is an immune response that confers increased resistance to neoplasia.

86. The method of claim 84, wherein the method is a method of immunizing an animal. 87. The method of claim 86, further comprising administrating an adjuvant to the animal.

88. The method of claim 84, wherein the animal is a human.

89. A phaπnaceutical composition, comprising a nucleic acid encoding a fragment of the protein of claim 1, and a pharmaceutically acceptable carrier or diluent. 90. The method of claim 41 , wherein the labeled nucleic acid probe comprises at least two different fluorochromes.

91. The method of claim 48, wherein the antibody is reactive to an epitope of the sequence of residues 554 - 576 or residues 2 - 17 of SEQ ID NO: 2.