CA2432496A1 - Diagnostic and therapeutic uses of sufu gene - Google Patents

Abstract

The invention relates to the identification of the SUFU (supressor of fused) gene as a tumor suppressor gene and the identification of mutations of the SUFU gene which is associated with the development of cancer, particularly medulloblastoma. The invention provides methods for determining a diagnosis, prognosis or risk of a tumor pathology in a subject involving a SUFU gene mutation, where the method comprises detecting a SUFU gene mutation in DNA from a subject. The SUFU gene comprises exons 1 through 12 and the mutation is associated with the tumor pathology.

Description

DIAGNOSTIC AND THERAPEUTIC USES OF SUFU GENE
Field of the Invention The invention relates to diagnostic methods and therapeutic methods and compositions for use in cancer. More specifically, the invention relates to the identification of the SUFU (supressor of fused) gene as a tumor ~o suppressor gene and the identification of mutations of the SUFU gene which is associated with the development of cancer, particularly medulloblastoma.
Background of the Invention Brain tumors are the second most common cancer in children after leukemia, with the incidence increasing at a rate of 5 to 10 per cent per year.
More than 200 Canadian children are diagnosed with brain tumors each year, with approximately 100 new cases at The Hospital for Sick Children alone.
Despite advances in treatment, survival from brain tumors remains lower than for other forms of cancer. Medulloblastoma is the moss common malignant 2o pediatric brain tumor and accounts for 20 per cent of all pediatric brain tumors and is more common in boys than girls. It is a rapidly growing tumor arising from the external granular cells of the cerebellum.
The sonic hedgehog (SHH) signal transduction pathway directs the embryonic development of many organs and tissues, including the growth and patterning of the cerebellum (1 ) in vertebrates. Disruptions at various locations in the SHH pathway have been linked t;o a variety of malignancies.
SHH is a powerful mitogen for external granular cells of the cerebellum, which give rise to medulloblastomas. SHH binds with the receptor PTCH. PTCH is a transmembrane protein that together with SMOH, a seven transmembrane so protein, forms a receptor complex for SHH. Liga,nd binding results in derepression of signaling from SMOH and subsequently to activation of the transcription factor GLI. Expression of GLI is elE:vated in cells treated with SHH.
Mutations of the SHH receptor gene PTCI-I occur in 50% or more of individuals with nevoid basal cell carcinoma syndrome (NBCCS) who present at birth with an overgrowth syndrome that includes large body size, hypertelorism, frontal bossing and additional malformations such as a flat nasal bridge, bifid ribs, polydactyly and occasionally developmental delay (3-6). Later in life, individuals with NBCCS may develop a spectrum of neoplasms, including basal-cell carcinoma (BCC), medulloblastoma and meningioma. Somatic mutations of the genes PTCN and SIVIOH occur in a subset of sporadic BCCs and medulloblastomas (7-13) and human GU was initially identified as a gene amplified in a human glioblastoma (14). These observations are consistent with those in mice as 14% of PTCH+~ mice develop medulloblastomas (15, 16), and overexpression of human GLl (17), mouse GIi2 (18) or SHH (19) in mouse skin leads to BCC.
Previous studies have identified a gene, the Suppressor-of-Fused (SUFU) gene, which encodes a protein involved in the GLI-1 signaling pathway (Kogerman et al., Nature Cell Biol., 1:312-319, 1999). The SUFU
gene product is a negative regulator of GLI-1 signalling and assists in the nuclear cytoplasmic transport of GLI-1. Both SHH and GLI signaling are 2o involved in brain development. Wild type SUFU sequesters GLI. Mutations have now been identified whereby the normal function of SUFU is disrupted such that transcription continues through GLI unabated.
The SUFU gene has not previously been recognized to play a role in malignancy and furthermore, no underlying mechanisms for the development of medulloblastoma have been previously described.
Summary of the Invention In accordance with the present invention novel mutations of the human SUFU gene have now been identified and associated with the development of so medulloblastoma. Thus the SUFU gene has now been identified as a tumor suppressor gene involved in medulloblastoma.
According to the present invention is an isolated human SUFU gene comprising 12 axons, said gene having a mutation in one or more of axons 1, 2, 8 or 9, wherein said mutation is indicative of a medullobiastoma phenotype.
According to another aspect of the invention is an isolated human SUFU gene comprising one or more mutations selected from the group s consisting of IVS8+1G ->A, IVS1-1G ->T, 1129deITCCGGAG, IVS1-1A ->T
and E1143insA.
According to another aspect of the invention is an isolated human SUFU gene comprising a SUF(212-484) N-terminal deletion.
According to yet another aspect of the invention is a method for determining a diagnosis, prognosis or risk of a tumor pathology in a subject involving a SUFU gene mutation, said method comprising detecting a SUFU
gene mutation in DNA from said subject, wherein said SUFU gene comprises axons 1 through 12 and said mutation is associated with said tumor pathology.
15 According to yet another aspect of the invention is method for determining whether a subject is at risk for development of medulloblastoma, the method comprising the steps of:
(a) obtaining a nucleic acid sample froim the subject; and (b) conducting an assay on the nucleic acid sample to determine 2o the presence or absence of a Suppressor-of-Fused (SUFU) gene mutation associated with medulloblastoma, wherein the presence of a SUFU geroe mutation associated with medulloblastoma indicates that the subject is at risk for development of medullobl~stoma.
2s According to another aspect of the invention is method for determining whether a subject displaying a medulloblastoma phenotype, the method comprising the steps of:
(a) obtaining a nucleic acid sample from the subject;
(b) conducting an assay on the nucleic acid sample to determine 3o the presence or absence of a SUFU gene mutation associated with medulloblastoma, wherein the presence of a SUFU gene mutation associated with medulloblastoma indicates that the subject is suffering from medulloblastoma.
According to still another embodiment of the invention is a method for treating a subject bearing a mutated SUFU gene comprising administering to s the subject an effective amount of an agent selected from the group consisting of:
(a) a nucleotide sequence encoding a normal SUFU gene;
(b) normal SUFU protein or an effectivf~ fragment thereof;
(c) a compound which inhibits SHH signalling; and ~o (d) an antibody that binds to a mutant SUFU protein.
According to a further aspect of the invention is a A method for screening a candidate compound for its potential as a therapeutic for improvement of SUFU function in a subject having a mutated SUFU gene comprising screening the candidate compound for its ability to inhibit SHH
signalling, wherein an ability to inhibit SHH signalling indicates that the compound is a potential therapeutic for said subject.
This invention also provides kits for the detection and/or quantification of SUFU gene or gene product. The kits can include a container containing one or more of identified nucleic acids, amplification primers, and antibodies 2o with or without labels, free, or bound to a solid support as described herein.
The kits can also include instructions for the use of one or more of these reagents in any of the assays described herein.
Other features and advantages of the present invention will become apparent from the following detailed description. 9t should be understood, 2s however, that the detailed description and the specific examples while indicating embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from the detailed description.
Brief Description of the Drawin~~s Embodiments of the present invention will now be described more fully with reference to the accompanying drawings:
Figure 1A-1 D show mutations of the SUFU gene in desmoplastic s medulloblastomas. Figure 1A shows a conserved GT splice-donor site consensus sequence of exon 8 being mutated to AT in the tumor (IVS8+1G~A). No wildtype sequence.was seen, suggesting LOH. Analysis by RT-PCR indicated splicing of exon 7 to exon =1 with a subsequent frameshift and premature stop codon (data not shown). Figure 1B shows a ~ o heterozygous mutation in the conserved AG splice-acceptor site of exon 2, which was mutated to AT (IVS1-1G-~T) in the ge~rmline DNA. The wildtype was absent in a sample from the desmoplastic medulloblastoma of the same individual, consistent with LOH. Analysis by RT-PCR showed splicing of exon 1 to exon 4 with a subsequent frameshift and premature stop codon at the 3' 15 exl of exon 1 (data not shown). Figure 1 C show: that sequence analysis of the tumor DNA showed a deletion of seven nucleotides from exon 9 (1129deITCCGGAG) resulting in a frameshift and premature stop codon, the wildtype allele was absent. Figure 1 D shows hematoxylin and eosin staining that identifies histopathologic features of the tumor with the 20 1129deiTCCGGAG mutation. This small blue cell tumor with nodular, reticulin-free zones was typical of a desmoplastic; medulloblastoma.
Figure 2 shows a diagram of the deletion on chromosome 10q in a subject (a child). Multiple FISH experiments using contiguous BAC clones 2s showed that the delefiion was approximately 2.5-2.8 Mb in size and included at least 28 genes (not all shown here). FISH using a BAC probe that encompassed BTRC indicated that this gene was not included in the deletion (most centromeric gene in this figure).
3o Figures 3A to 3C show western blots. Figure 3A shows western blotting of 293 cells, transfected with Flag-tagged GPI on its own or with Myc-tagged wildtype SUFU (SUFU-wt), SUFU-~ex8 or SUFU(212-484).

_g_ Immunoprecipitation using antibody against the Myc epitope (1P a-Myc), followed by SDS-PAGE and western blotting with antibody against the Flag epitope (western a-Flag), showed that whereas ~nrildtype SUFU (SUFU-wt) could bind GLI, the ~ex8 mutant and the SUFU(212-484) mutant could not.
Figure 3B shows a Western blot demonstrating the presence of equal amounts of immunoprecipitated wildtype SUFU, ~~ex8 and SUFU(212-484), confirmed by stripping and reprobing the IP a-Myc, western a-Flag blot from Figure 3A with an antibody against Myc. Figure 3C shows a Western blot of transfected 293 cells, co-transfected alone and in combination with Flag-~o tagged GLI2 and Myc-tagged wildtype SUFU, SUiFU-~ex8 and SUFU(212-484). Immunoprecipitations against the Flag epitope followed by SDS-PAGE
and western blotting against the Myc epitope showed that whereas GL12 immunoprecipitated SUFU-wt, it did not bind SUFU-~ex8 or SUFU(212-484).
Figures 4A and 4B show micrographs of tr~ansfected cells and a graph representing transcription levels of transfected cells. Figure 4A,shows photomicrographs of CH3T10112 cells transfected with Flag-GLI and either Myc-SUFU wt or Myc-SUFU-oex8, and stained for immunofluorescence with monoclonal antibody against Flag and polyclonal antibody against Myc 2o followed (as secondary antibodies) by rhodamine-labeled antibody against rabbit and FITC-labelled antibody against mouse IgG. Cells were also stained with DAPI for visualization of the nucleus. Figure 4B, shows CH3T10112 cells transfected with a GLI-responsive promoter construct (8*GLI) and various doses of GLI, and either the empty pcDNA 3,1 (+) vector (control), SUFU-wt or 2s SUFU-Dex8. SUFU-wt strongly inhibited transcription promoted by GLI at very low dosages, whereas SUFU-aex8 had no Effect as compared with the control. Very high doses of SUFU-oex8 blocked transcription from the 8*GLl reporter to a moderate degree, but not neariy as much as SUFU-vvt. Error bars, ~ s.e.m.
Detailed Description of the Invention _7_ The present invention relates to the identification of the SUFU gene as a tumor suppresser gene involved in medulloblastoma. Mutations in the human SUFU gene have now been identified andl associated with medulloblastoma. This knowledge now enables diagnostic methods for detecting alterations in the wild type SUFU gene for the diagnosis, prognosis and identification of subjects having or at risk for developing medullobiastoma.
This also enables methods for the treatment of medulloblastoma and the screening of candidate drug compounds for their ability to block SHH
signalling and restore SUFU function.
The invention in general, enables the diagnosis of cancers involving a mutation in the SUFU gene. In aspects, this includes inappropriate SHH
signalling where SUFU is required to control such signalling. Such cancers may include but are not limited to medulloblastoma, nevoid basal cell carcinoma {NBCCS), basal cell carcinoma (BCC), meningioma, colon cancer, muscle tumors and sarcomas.
Both germline and somatic SUFU mutations have been identified accompanied by loss of heterozygosity (L~H) of 'the wild type allele. Several of the observed mutant genes encode truncated proteins which are unable to export transcription factors of the GLI family from nucleus to cytoplasm, 2o resulting in an increase in SHH signaling.
The mutations of the SUFU gene and predicted protein are shown in Table 1 and summarized as follows: IVSB+1 G -=~A; IVS1-1 G ->T;
1129deITCCGGAG; IVS1-1A ->T; E1 143insA; and a 2.5-2.8 Mb deletion on chromosome 10q. Also identified were two missense mutations identified as likely polymorphisms in Table 1: C44-I' and G10'18T. A further mutation of SUFU(212-484), a N-terminal deletion was also made and resulted in the expression of a mutant non-functional protein.
Identification of SUFU gene Mutations 3o Frequent loss of heterozygosity (L~H) on chromosome 10q24 in medulloblastomas suggests that this region contains one or more tumor-suppresser genes (20). SUFU was mapped to cl'~romosome 10q24.3 by fluorescent in situ hybridization (FISH). Radiation-hybrid mapping of SUFU
and BTRC (encoding a ubiquitin ligase involved in both SHH and Wnt signaling) showed an identical map location for both genes at chromosome 10q24.3 (data not shown) distal to the tumor-suppresser gene PTEN on chromosome 10q23.31. Human genome sequence data indicated that BTRC
is approximately 1 megabase (Mb) centromeric to SUFU. Screening the Roswell Park human genomic bacterial artificial chromosome (BAC) library with a SUFU cDNA probe led to the identification of two BACs containing genomic SUFU: 2F13 and 124618. Subcloning and sequence analysis of 1o these BACs revealed that SUFU has 12 exons shown in Table 2.
Mutational analyses of PTEN [phosphatas,e and tensin homologue deleted in chromosome 10] and BTRC [beta-transducing repeat-containing protein gene] indicated no mutations in two series of 21 and 36 sporadic medulloblastomas, respectively. Truncating mutations of SUFU were ~ 5 identified in 4 of 46 samples (9%) of medulloblastoma by sequence analysis of exons 1-12 and their surrounding intronic sequences. This mutation frequency is comparable to that observed for PTCH (9%) and CTNNB1 (encoding [i-catenin; 5°/~ (7,21 ). Sequence analysis and RT-PCR
analyses revealed that these four SUFU mutations predicted truncated protein products 20 (Figure 1 and Table 1 ). Two missense mutations were also identified, the nonconservative P15L near the amino terminus and the relatively conservative A340S (Table 1 ). All four truncating mutations and the P15L
mutation were accompanied by LOH and/or loss of the wildtype allele (Figure 1 A-1 C and Table 1 ), but no LOH was detected of the A340S variant. All four z5 medulloblastomas with SUFU tn.rncating mutations were of the desmoplastic subtype (Figure 1 D and Table 1 ). Desmoplastic tumors make up about 20-30% of medulloblastomas and have a more nodular architecture than 'classical' medulloblastoma and may have a bettE;r prognosis. Activation of the SHH pathway is particularly high in desmoplastic medulloblastomas, as so shown by increased expression of the SHH target genes GLI, SMOH and PTCH12. Based on these experimental results it was concluded that SUFU
functions as a tumor-suppresser gene in at least a subset of desmoplastic _g_ medulloblastomas.
The individual with a medulloblastoma bearing the IVSB+1 GSA intron 8 truncating mutation was a 4-year-old boy with some phenotypic characteristics suggestive of NBCCS, including frontal bossing, prominent jaw s and hypertelorism but did not exhibit odontogenic cysts, falx calcification, skin pits or BCCs (these characteristics may not arise until later in life in people with NBCCS). This child also had severe developmental delay: he was unable to walk and speak, and did not recognize his parents as his primary care-givers. Although some degree of cognitive impairment may follow treatment for rnedulloblastoma, the child's examination and history were more in keeping with a developmental syndrome. Neither parent had any evidence of NBCCS and there was no family history of cancer.
The IVS8+1 GSA mutation detected in thi:~ boy's medulloblastoma was not present in his germline DNA. Southern blotting using an SUFU cDNA
~ 5 probe revealed no differences in the child's DNA compared with controls (data not shown). Metaphase FISH was carc~ied out using a BAC clone encompassing SUFU in its entirety on lymphoblastoid cell lines from both parents and child. Only one chromosome 10q24 signal was observed for the child but two signals for each parent (data not shown). FISH of the child's 2o peripheral blood lymphocytes confirmed this finding. Haplotyping indicated that part of the paternal chromosome was lost in the child (data not shown).
Additional FISH experiments using contiguous BAC clones in the region of chromosome 10q24.3 showed that the child had a deletion of 2.5-2.8 Mb that encompassed chromosomal sub-bands 1 Oq23.32 -1 Oq25.1, including at least 25 28 genes but sparing the centromeric BTRC (Figure 2). Some individuals with cytogenetic interstitial deletions of 10q22-10q26 share some of the phenotypic characteristics observed in the child with the somatic IVS8+1 G--~A mutation, including psychomotor retardation, hypertelorism and a broad nasal bridge (23). In this child, loss of contiguous genes at 10q-including SUFU-was 3o therefore associated with both medulloblastoma and a NBCCS-like phenotype with profound developmental delay.
Peripheral blood DNA was sequenced from individuals with medulloblastomas bearing SUFU mutations and demonstrated that the axon 2 splice-site mutation (IVS1-1A-~T) and the axon 1 insertion (143insA) were present in lymphocyte ~NA. in each case, the wildtype allele was either deleted or mutated in the corresponding tumor (Table '1 ). The individual with the iVS1-1A-~T mutation was adopted, and his biological family history was unavailable. The individual with the 143insA mutation (Table 1 ) had no known family history cf any cancer. Six years after radiotherapy for his medulloblastoma, however, he developed a meningioma in the region of the radiation field. These two individuals with heterozygous germline point mutations of SUFU had no discernible developmental abnormalities; this is consistent with the very subtle phenotypic alterations seen in Grosophila homozygous SUFU mutants.
To study the functional consequences of the SUFU truncation mutants, the SUFU IVS8+1 G--~A variant was employed. l-he corresponding protein ~5 lacks the carboxy-terminal half of SUFU (designated SUFU-Bex8). A
corresponding N-terminal deletion mutant protein, designated SUFU(212-484)-Myc was constructed. Transfection of epitope-tagged wildtype SUFU, aex8 or O-212 mutants together with either GLI or GL12 showed that wildtype SUFU can bind GLI and GL12, whereas the ~ex8 and O-212 mutants cannot 20 (Figure 3A-3C). The distribution of SUFU and GL_I in the nucleus and cytoplasm was studied by transfecting expression vectors bearing either wildtype oex8 mutant SUFU together with GLI into C3HT10112 cells.
Fluorescence microscopy showed that GLI transfected by itself was predominantly localized in the nucleusw Wildtype SUFU was primarily found in 25 the cytoplasm and, in its presence, GLI was also localized in the cytoplasm and hence nonactive (Figure 4A). In contrast, the: ~ex8 mutant localized in the nucleus, and in its presence GLI accumulated substantially in the nucleus in all of the cells observed (Figure 4A). Administration of leptomycin B, a CRM-1-dependent inhibitor of nuclear export, blocked the effects of wildtype so SUFU so that both wildtype SUFU and GLI accumulated in the nucleus (Figure 4A). As predicted, leptomycin B has no effect on SUFU-Dex8 and GLI

cotransfectants, as both proteins were already localized in the nucleus (Figure 4A). Finally, transfection of wildtype SUFU repressed transcriptional activation by GLI from a GLI-responsive promoter (8*3°GLI-BS-Luc) with very small amounts of input DNA, whereas transfection of SUFU-~ex8 produced s results no different from transfection of an empty vector control (Figure 4B).
We deduced that the SUFU-~ex8 mutant protein does not block GLI-mediated transcriptional activation at physiological doses (24).
The SUFU protein can repress Wnt signalling by binding (3-catenin and exporting it from the nucleus (25). It is demonstrated that the 1o medulloblastoma-derived SUFU-~ex8 mutant does not suppress Wnt signaling (data not shown). The present data supports a model in which the tumor-derived SUFU-oex8 is unable to bind GLI transcription factors and export them from the nucleus, resulting in activation of SHN target genes.
This is a new mechanism of tumor suppression that entails modulation of the 15 nuclear-cytoplasmic shuttling of transcription factors.
Identification of Further Mutations The identification of the SUFU mutations as described herein may now lead to the identification of further mutations in the SUFU gene leading to 2o medulloblastoma and associated cancer development and diagnosis and thus are within the scope of the present invention. Mutated SUFU gene or gene products as described herein are characterized by premature stop codons, deletions, insertions or change of particular amino acids. Premature stop codons and deletions are detected by decreased size of the gene or gene 25 product (mRNA transcript or cDNA). Similarly, insertions can be detected by increased size of the gene or gene product. Alternatively, mutations can be determined by sequencing of the gene or gene product according to standard methods. Such methods have been used herein to identify the noted mutations.
Amplification assays and hybridization probes can be selected to specifically target particular abnormalities. For example, where the abnormality is a deletion, nucleic acid probes or amplification primers can be selected that specifically hybridize to or amplify, respectively, the nucleic acid sequence that is deleted in the abnormal gene. The probe wilt fail to hybridize, or the amplification reaction wilt fail to provide specific amplification, to abnormal versions of the suppresser of fused nucleic acids which have the s deletion. Alternatively, the probe or amplification reaction can be designed to span the entire deletion or either end of the deletion (deletion junction).
Similarly, probes and amplification primers can be selected that specifically target point mutations or insertions. Methods for detecting specific mutations are described in, for example, U.S. 5,512,441. In the case of PCR
1o amplification primers can be designed to hybridize to a portion of the suppresser of fused gene but the terminal nucleotide at the 3° end of the primer can be used to discriminate between the mutant and wild-type forms of the SUFU gene. If the terminal base matches the point mutation or the wild-type sequence, polymerase dependent extension can proceed and an ~s amplification product is detected (Sorr:mer et al., (1989) Mayo Clin. Proc.
64:1361-1372). By using appropriate controls, one can develop a kit having both positive and negative amplification products. The products can be detected using specific probes or by simply detecting their presence or absence. A variation of the PCR method uses LGR where the point of 2o discrimination, i.e., either the point mutation or the wild-type bases fall between the LCR oligonucleotides. The ligation of the oligonucleotides becomes the means for discriminating between the mutant and wild-type forms of the suppresser of fused gene.
A variety of automated solid-phase detection techniques are also 25 appropriate for detecting the presence or absence of further mutations in the SUFU gene. For instance, very large scale immobilized polymer arrays (VLSIPSTM available from Affymetrix, Inc. Santa Glara, GA) are used for the detection of nucleic acids having specific sequences of interest (Fodor et al.
(1991 ) Science, 251: 767-777; Sheldon et al. (1993) Clinical Chemistry 39(4):
so 718-719. and Kozal et al. (1996) Natural Medicine 2(7): 753-759). Further methods for detecting mutations are also described in, for example, Tijssen (1993) Laboratory Techniques in biochemistry and molecular biology, hybridization with nucleic acid probes parts I and Il, Elsevier, New York, and Choo (ed) (1994) Methods In Molecular Biology Volume 33-In situ Hybridization Protocols, Humana Press Inc., Nevr Jersey.
Transcription levels (and thereby expression) of a mutated SUFU gene may be assessed in a sample, the nucleic acid sample is one in which the concentration of the mRNA transcripts) of the suppressor of fused gene, or the concentration of the nucleic acids derived from the mRNA transcript(s), is proportional to the transcription level (and therefore expression level) of that gene. Similarly, it is preferred that the hybridization signal intensity be proportional to the amount of hybridized nucleic acid. While it is preferred that the proportionality be relatively strict (e.g., a doubling in transcription rate results in a doubling in mRNA transcript in the sample nucleic acid pool and a doubling in hybridization signal), one of skill will appreciate that the proportionality can be more relaxed and even non-linear. Where more precise quantification is required appropriate controls carp be run to collect for variations introduced in sample preparation and hybridization as described herein. In addition, serial dilutions of '°standard" target mRNAs can be used to prepare calibration curves according to methods well known to those of skill in the art. Of course, where simple detection of the presence or absence of a 2o transcript is desired, no elaborate control or calibration is required.
The expression of the human SUFU gene, both normal wild type and mutated (where the mutation leads to a protein product) can also be detected and/or quantified by detecting or quantifying the expressed SUFU
polypeptide. SUFU polypeptides can be detected and quantified by any of a number of means well known to those of skill in the art. These may include analytic biochemical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatcagrapt-~y (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like, or various immunological methods such as fluid or gel precipiting reactions, so immunodiffusion (single or double); immunoelectrophoresis, radioimmunoassay(RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, Western blotting, and the like. In embodiments, the SUFU wild type or mutant polypeptides may be detected using gel electrophoresis or detected using an immunoassay. The immunoassay is being characterized by detection of specific binding of a SUFU polypeptide to SUFU fused antibody as opposed to the use of other physical or chemical properties to isolate, target, and quantify the anafyte. The presence or absence of a SUFU polypeptide in a biological sample can be determined using electrophoretic methods and may indicate the presence of a nucleic acid deletion leading to the absence of protein expression. Means of detecting proteins using electrophoretic techniques are well known to those of skill in the art (see generally, R. Scopes (1982) Protein Purification, Springer-Verlag, N.Y.; Deutscher, (1990) Methods in Enzymology Vol. '182: Guide to Protein Purification., Academic Press, Inc., N.Y.).
Diagnostic Methods The present invention now enablos diagnostic methods for detecting ~5 alterations of the wild type human SUFU gene and human SUFU cDNA, such alterations indicating a predisposition to medulloblastoma and related tumors or, in a subject presenting with a brain tumor, provide a means of differential diagnosis of medulloblastoma. Medulloblastoma is corrrmonly referred to as a primitive neuroectodermal tumor also referred to as an undifferentiated 2o neuroectodermal tumor of the cerebellum. As such, the present invention would provide for the diagnosis of any medulloblastoma or related tumor that involves a SUFU mutation. A "mutation" as herein described would lead to a medulloblastoma phenotype. Furthermore, the invention encompasses the diagnosis of tumors which show disruption of the SHH signaling pathway and 25 may be amenable to treatment by the methods and pharmaceutical compositions described herein and include skin cancers such as basal cell carcinoma, colon cancers, muscle tumors and sarcomas.
Members of a family with a history of medulfoblastoma, or other SUFU
mutation-associated tumors, may now be screened for alterationslmutations so from normal in the SUFU gene, alterations indicating a possible predisposition to tumor development or that tumor development is in the early stage should the subject be otherwise asymptomatic. Those members in whom a gene alteration is detected may then be kept under careful scrutiny, so that early tumor detection can facilitate early treatment. Screening may be carried out prenatally, on a fetus.
Where a subject already shows tumor development, examination of s tumor and other tissues allows the identification of a germline mutation and possible predisposition to further tumor development, again requiring careful follow up.
Detection of alterations from the wild type SUFU gene may be detected by many different methods known to those of skill in the art. The cDNA
~o sequence of the SUFU gene has been described (GenBank Accession Number AY081818). The axon structure of human SUFU and flanking intron sequences are shown in Table 2.
"Alterations" of the wild type SUFU gene include mutations of the gene, including deletions, insertions, inversions or point mutations, either in the ~ 5 regulatory regions or the coding regions of the gene. Testing for alterations may be carried out on ~NA br RNA from a biological sample such as blood, tissue biopsies or tumor biopsies obtained from the subject to be tested.
In one embodiment, the invention provides a method for determining whether a subject is at risk for development or has a tumor associated with an 2o alteration of the SUFU gene, for example a medulloblastoma, the method comprising the steps of:
(a) obtaining a nucleic acid sample from the subject; and (b) conducting an assay on the nucleic acid sample to determine the presence or absence of a SUFU gene mutation associated with tumor 25 development, wherein the presence of such a SUFU gene mutation indicates that the subject is at risk for development of a tumor.
In other embodiments of the invention is a method for the diagnosis of a tumor associated with a mutation in a SUFU gene, the method comprising:
- detecting in the sample from a subject suspected of having a tumor, a 3o mutation in the SUFU gene or a protein encoded thereby, wherein detection of mutation in the gene or the protein encoded thereby is indicative of having the tumor.

As described herein, mutations of the SUFU gene can be detected using different assays, for example, by sequencing exons and introns of the gene, restriction fragment length polymorphisms (RFLP) analysis, PCR-RFLP
analysis, allele-specific hybridizations, mutation specific polymerise chain s reactions (MSPGR), or by single stranded conformational polymorphism (SSCP) detection. Many suitable assays are known to those of skill in the art and described for example in U.S. 6,475,723, 6,361,949, and 6,558,013 (the disclosures of which are herein incorporated by reference in their entirety).
The nucleic acid may be RNA or DNA, for example mRNA or genomic DNA.
1o Where the method is used to determine risk for rnedulloblastoma, the SUFU
mutations listed in Table 1, for example, are indicative of a subject at risk for development of medulloblastoma.
The SUFU gene may, for example, be analysed for mutations as described herein.
Therapeutic Methods The invention also enables therapeutic methods and compositions for the treatment of medulloblastoma or another tumor associated with a SUFU
mutation, in a mammal, including a human.
2o Methods of treatment in accordance with the invention are aimed at restoring normal SUFU function in cells in which a mutation is disrupting function, far example in medulloblastoma cells in a subject suffering from a SUFU mutation-associated medulloblastoma.
Such methods include gene therapy to restore normal function to the cells at the gene level and delivery of normal SUFU protein to circumvent the effects of the malfunctioning gene. Gene therapy may, for example, involve administration to the subject of a construct comprising an expression vector containing a nucleotide sequence encoding a wild type SUFU protein.
Suitable expression vectors include retroviral, adenoviral and vaccinia virus ~o vectors. Administration may be intravenous, oral, subcutaneous, intramuscular, intraperitoneal or directly into the tumor or its supplying blood vessels.

A large number of gene delivery methods are well known to those of skill in the art and may include, for example liposome-based gene delivery {Debs and Zhu (1993) WO 93/24640; Mannino and Gould-Fogerite (1988) BioTechniques 6(7): 682-691; Rose U.S. Pat No.. 5,279,833; Brigham (1991) s WO 91106309; and Felgner et al. (1987) Proc. Natl. Acad Sci. USA 84: 7413-7414), and replication-defective retroviral vectors harboring a therapeutic polynucleotide sequence as part of the retroviral genome (see, e.g., Miller et al. (1990) Mol. Cell. Biol. 10:4239 (1990); Kolberg (1992) J. NIH Res. 4:43, and Cornetta et a!. Hum. Gene Ther. 2:215 (1991 )). Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof. See, e.g., Buchscher et al.
(1992) J. Virol. 66(5) 2731-2739; Johann et al. (1992) J" Virol. 66 (5):1635-1640 {1992); Sommerfelt et al., (1990) Virol. 176:58-59; Wilson et al. (1989) J.
~ 5 Virol. 63:2374-2378; Miller et al., J. Virol. 65:2220-2224 (1991 ); Wong-Staal et al., PCTlUS94/05700, and Rosenburg and Fauci (1993) in Fundamental Immunology, Third Edition Paul (ed) Raven Press., Ltd., New York and the references therein, and Yu et al., Gene Therapy (1994) supra).
AAV-based vectors are also used to transduce cells with target nucleic 2o acids, e.g., in the in vitro production of nucleic acids and peptides, and in in vivo and ex vivo gene therapy procedures. See, West et al. (1987) Virology 160:38-47; Carter et al. (1989) U.S. Pat. No. 4,797,368; Carter et al. WO
93/24641 (1993); Kotin (1994) Human Gene Therapy 5:793-801; Muzyczka (1994) J. Clin. Invest. 94:1351 and Samulski (supra) for an overview of AAV
25 vectors. Construction of recombinant AAV vectors are described in a number of publications, including Lebkowski, U.S. Pat. No. 5,173,414; Tratschin et al.
(1985) Mol. Cell. Biol. 5(11 ):3251-3260; Tratschin, et al. (1984) Mol. Cell.
Biol.
4:2072-2081; Hermonat and Muzyczka (1984) Proc. Natl. Acad. Sci. USA
81:6466-6470; McLaughlin et al. (1988) and Samulski et al. (1989) J. Vir~I.
30 63:03822-3828. Cell lines that can be transformed by rAAV include those described in Lebkowski et al. (1988) Mol. Cell. Biol. 8: 3988-3996.
In a further embodiment of the invention there is provided therapy through removal or blocking of the mutant gene product, as well as supplementation with the normal gene product by amplification, by genetic and recombinant techniques or by immunotherapy. Correction or modification of the defective gene product by protein treatment immunotherapy (using antibodies to the defective protein) or knock-out of the mutated gene is within the scope of the invention.
For immunotherapy and isolated of the SUFU protein, there are available many methods of making antibodies which are known to persons of skill in the art. A number of immunogens may be used to produce antibodies specifically reactive with SUFU polypeptides. Recombinant or synthetic polypeptides of 10 amino acids in length, or greater, selected from amino acid sub-sequences of the human sequence of Table 2 are the preferred polypeptide immunogen (antigen) for the production of monoclonal or polyclonal antibodies. 1n one class of preferred embodiments, an ~5 immunogenic peptide conjugate is also included as an immunogen. Naturally occurring polypeptides are also used either in pure or impure form.
Recombinant polypeptides are expressed in eukaryotic or prokaryotic cells (as described below) and purified using standard techniques. The polypeptide, or a synthetic version thereof, is then injected into an animal capable of 2o producing antibodies. Either monoclonal or polycional antibodies can be generated for subsequent use in immunoassays to measure the presence and quantity of the polypeptide.
Methods of producing polyclonal antibodies are known to those of skill in the art. In brief, an immunogen (antigen), preferably a purified polypeptide, 25 a polypeptide coupled,to an appropriate carrier (e.g., GST, keyhole limpet hemanocyanin, etc.), or a polypeptide incorporated into an immunization vector such as a recombinant vaccinia virus (see, U.S. Pat. No. 4,722,848) is mixed with an adjuvant and animals are immunized with the mixture. The animal°s immune response to the immunogen preparation is monitored by so taking test bleeds and determining the titer of reactivity to the polypeptide of interest. When appropriately high titers of antibody to the immunogen are obtained, blood is collected from the animal and antisera are prepared.

_1g_ Further fractionation of the antisera to enrich for antibodies reactive to the polypeptide is performed where desired (see, e.g., Coligan (1991 ) Current Protocols in Immunology Wiley/Greene, NY; and Harlow and Lane (1989) Antibodies: A Laboratory Manual Cold Spring Harbor Press, NY).
Antibodies, including binding fragments and single chain recombinant versions thereof, against predetermined fragments of SUFU polypeptides are raised by immunizing animals, e.g., with conjugates of the fragments with carrier proteins as described above. Typically, the immunogen of interest is a peptide of at least about 5 amino acids, more typically the peptide is 10 amino 1o acids in length, preferably, the fragment is 15 amino acids in length and more preferably the fragment is 20 amino acids in length or greater. The peptides are typically coupled to a carrier protein (e.g., as a fusion protein), or are recombinantly expressed in an immunization vector. Antigenic determinants on peptides to which antibodies bind are typically 3 to 10 amino acids in length.
Monoclonal antibodies are prepared from cells secreting the desired antibody. These antibodies are screened for binding to normal or modified polypeptides, or screened for agonistic or antagonistic activity, e.g., activity mediated through a SUFU protein. in some instances, it is desirable to 2o prepare monoclonal antibodies from various mammalian hosts, such as mice, rodents, primates, humans, etc. Description of techniques for preparing such monoclonal antibodies are found in, e.g., Stites et al. (eds.) Basic and Clinical Immunology (4th ed.) Lange Medical Publications, Los Altos, Calif., and references cited therein; Harlow and Lane, supra; Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed.) Academic Press, New York, N.Y.;
and Kohler and Milstein (1975) Nature 256: 495-497. The poiypeptides and antibodies of the present invention are used with or without modification, and include chimeric antibodies such as humanized marine antibodies. Other suitable techniques involve selection of libraries of recombinant antibodies in so phage or similar vectors (see, e.g., Huse et al. (1989) Science 246: 1275-1281; and Ward, et al. (1989) Nature 341: 544-546; and Vaughan et al. (1996) Nature Biotechnology, 14: 309-314).

Frequently, the polypeptides and antibodiies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature.
Suitable labels include radionucleotides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Patents teaching the use of such labels include U.S.
Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,990,345; 4,277,437; 4,275,149;
and 4,366,241. Also, recombinant immunoglobulins may be produced. See, Cabilly, U.S. Pat. N~. 4,816,567; and Queen et al. (1989) Proc. Nat'1 Acad.
Sci. USA 86: 10029-10033. Antibodies specific for a SUFU protein are also used for affinity chromatography in isolating SUFU polypeptides. Columns are prepared, e.g., with the antibodies linked to a solid support, e.g., particles, such as agarose, Sephadex, or the like, where a cell lysate is passed through ~ s the column, washed, and treated with increasing concentrations of a mild denaturant, whereby purified SUFU polypeptides are released.
The antibodies can be used to screen expression libraries for particular expression products such as normal or abnormal human SUFU protein.
Usually the antibodies in such a procedure are labeled with a moiety allowing 2o easy detection of presence of antigen by antibody binding. Antibodies raised against SUFU polypeptides can also be used to raise antiidiotypic antibodies.
These are useful for detecting or diagnosing various pathological conditions related to the presence of the respective antigen s.
The anti-SUFU antibodies can be administered to an organism (e.g., a 25 human patient) for therapeutic purposes (e.g., to block the action a non-functional mutated SUFU polypeptide or as targe~ting.molecules when conjugated or fused to effector molecules such as labels, cytotoxins, enzymes, growth factors, drugs, etc.). Antibodies administered to an organism other than the species in which they are raised are often immunogenic. Thus, 3o for example, murine antibodies administered to a human often induce an immunologic response against the antibody (e.g., the human anti-mouse antibody (HAMA) response) on multiple administrations The immunogenic properties of the antibody are reduced by altering portions, or all, of the antibody into characteristically human sequences thereby producing chimeric or human antibodies, respectively. Methods of generating chimeric antibodies are well known to those of skill in the art (see, e.g., U.S. Pat. Nos.

5,502,167, 5,500,362, 5,491,088, 5,482,856, 5,472,693, 5,354,847, 5,292,867, 5,231,026, 5,204,244, 5,202,238, 5,159,939, 5,081,235, 5,075,431, and 4,975,369).
A further method of treatment for a subject determined to have medulloblastoma includes method of RNAi (RNA interference) that may be used to inhibit the expression of the mutant SUFU gene and this may be done in conjunction with administration of normal SUFU gene by gene therapy or administration of normal SUFU protein. RNAi, RNA interference, is a mechanism of post-transcriptional gene silencing. Specific gene silencing is mediated by short strands of duplex RNA of approximately 21 nucleotides in ~ 5 length (termed small interfering RNA or siRNA) that target the cognate mRNA
sequence for degradation. This technique is relatively simple, giving rise to an knock down phenotype that can be confirmed with many antibody based detection systems (such as ELISA or Western Blotting), or if an antibody is not available, by RT-PCR or functional assays. The siRNA can be administed 2o alone as a composition and targeted to a mutated SUFU gene. The siRNA
may also be contained within a plasmid or vector that results in the production of the siRNA. Methods for making siRNA and cell transformation are described for example in U.S. Patent Application 2002/0173478, U.S. Patent Application 2002/0162126, PCT/US01I10188, PCTIEP01I13968 and in 25 Simeoni F., et al., 2003 Nucleic Acids Res Jun 1;31 (11 ):2717-24 (the disclosures of which are incorporated herein in their entirety). Methods for making siRNA plasmids or vectors are also known and described for example in U.S. Patent Application 2003/0104401, in Morris M.C., et al., 1997.
Nucleic Acid Res. Jul 15:25(14):2730-6 and in Van De Wetering M., et al., 30 2003, EMBO Jun;4(6):609-15 (the disclosures of which are incorporated herein in their entirety). Suitable lipid-based vectors may include but are not limited to lipofectamine, lipofectin, oligofectamine and GenePorterT"~.

In a further embodiment of the invention, treatment of medulloblastoma or a tumor involving inappropriate SHH signalling can be performed by replacing the mutant protein with normal protein., or by modulating the function of the mutant protein. 1t may also be possible to modify the pathophysiologic pathway (eg. a signal transduction pathway) in which the protein participates in order to correct the physiological defect. To replace the mutant protein with normal protein, or with a protein bearing a deliberate counterbalancing mutation it is necessary to obtain large amounts of pure SUFU protein from cultured cell systems which can express the protein. Delivery of the protein to the affected brain areas or other tissues can then be accomplished using appropriate packaging or administrating systems..
SUFU protein, or an active portion thereon, may be prepared by conventional recombinant methods, using the cDNA sequence of ATCC
Accession Number AY081818 or a selected portion thereof and used in therapeutic methods to try to provide adequate SUFU functioning such that SHH signalling is not abnormal leading to tumor formation.
A pharmaceutical composition according to the invention will include a therapeutically effective amount of the wild-type SUFU protein with a carrier.
A therapeutically effective amount is considered 'that amount which, when 2o administered to a subject, provides a therapeutic benefit to the patient.
Methods of treatment may also involve administration of a therapeutic composition comprising a compound which can block SFiH signaling. Such compounds have been described and include, for example, the steroid alkaloid cyclopamine (Cooper et al., (1998), Science, v. 280, pp. 1603-7).
The SUFU polypeptides, SUFU polypeptide subsequences, anti-SUFU
antibodies, and anti-SUFU antibody-effector (e.g., enzyme, toxin, hormone, growth factor, drug, etc.) conjugates or fusion proteins may be used for parenterai, topical, oral, or focal administration, such as by aerosol or transdermally, for prophylactic and/or therapeutic treatment. The pharmaceutical compositions can be administered in a ~rariety of unit dosage forms depending upon the method of administration. For example, unit dosage forms suitable for oral administration include powder, tablets, pills, capsules and lozenges. It is recognized that the SUFU polypeptides when administered orally, should be protected from digestion. This is typically accomplished either by complexing the protein vuith a composition to render it resistant to acidic and enzymatic hydrolysis or by packaging the protein in an appropriately resistant carrier such as a liposome. Means of protecting proteins from digestion are well known in the art.
The pharmaceutical compositions of this invention are particularly useful for administration to treat tumors associated with abnormal SUFU gene functioning. In another embodiment, tile compositions are useful for 1 o parenteral administration, such as intravenous administration or administration into a body cavity or lumen of an organ. The compositions for administration will commonly comprise a solution of the SUFU polypeptide, antibody or antibody chimera/fusion dissolved in a pharmaceutically acceptable carrier, preferably an aqueous carrier. A variety of aqueous ~5 carriers can be used, e.g., buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and 2o buffering agents, toxicity adjusting agents and the like, for example., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of chimeric molecule in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of 25 administration selected and the patient's needs.
Typical pharmaceutical compositions for intravenous administration may be about 0.1 to 10 mg per patient per day. dosages from 0.1 up to about 100 mg per patient per day may be used, particularly when the drug is administered to a secluded site and not into the blood stream, such as into a 3o body cavity or into a lumen of an organ. Substantially higher dosages are possible in topical administration. Actual methods for preparing parenterally administrable compositions will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa.
(1980).
Compositions containing the SUFU polypeptides, antibodies or s antibody chimerlfusions, or a cocktail thereof (i.e., with other proteins), can be administered for therapeutic treatments. In therapeutic applications, compositions are administered to a patient suffering from a disease (e.g., medulfoblastoma) in an amount sufficient to cure or at least partially arrest the disease and its complications. An amount adequate to accomplish this is defined as a "therapeutically effective dose." Amounts effective for this use will depend upon the severity of the disease and the general state of the patient's health. Single or multiple administrations of the compositions may be administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a 15 sufficient quantity of the proteins of this invention to effectively treat the patient.
Screening for Candidate Drug Compounds The invention further enables a method of screening candidate drug 2o compounds for their ability to block SHH signaling and r estore normal SUFU
function. Compounds shown to have the ability to block SHH signaling and restore normal SUFU function are candidate pharmaceuticals for the treatment of medulloblastoma and other tumors associated with an altered SUFU gene. Suitable methods for screening candidate compounds are 25 described for example in U.S. 6,413,797 (the disclosure of which is incorporated herein in its entirety).
Compounds that may prevent excessive GLI-induced transcription through activation of SUFU or by aiding the sequestering of SUFU and GLI
from the nucleus can be tested in assays such as those described herein.
3o The inventors transfected C3H10T1I2 cells with plasmid DNA containing wild type or Bex8 mutant together with GLI. Immunofluorescence was carried out as described herein. Also examined was transcription using cells similarly transfected as above but including the reporter gene GLI-BS-o51 Lucl I.
The immunofluorescence assay localizes GLI and SUFU whereas the promoter assay indicates the effects of SUFU (wild type or mutant) on GLI-induced transcription.
s Localization of SUFU and/or GLI may be undertaken before and after drug treatment. Functional significance of the drug may be tested using the promoter assay. Decreased transcription in the cell culture model using expression of the mutated SUFU indicates a candidate compound with therapeutic potential.
The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific Examples. These Examples are described solely for purposes of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.
EXAIUIPLES
2o Example 1: Tumor samples and isolation of nucleic acids.
Samples of pediatric medulloblastoma under the guidelines of the Hospital for Sick Children Research Ethics Board were collected, flash-frozen directly after surgical removal and stored the samples in liquid nitrogen.
Additional tumor samples came from the Brain Tumor Tissue Bank (London, 2s Ontario, Canada), the Pediatric Co-operative Human Tissue Network of the US National Cancer Institute (Bethesda, Maryland), the Tissue Bank of the Brain Tumor Research Center at UCSF (San Francisco, USA) and the Children's National Medical Center (Washington, USA). Individuals with NBCCS but no mutations in PTCH were identified in a National Cancer Institute study (6,26) or at the University of Queensland (Australia)(27). In every case, affected individuals or their guardian: provided informed consent and/or took part in protocols approved by local or national institutional review -~6-boards.
Total RNA was isolated using Trizol reagent (Gibco-BRL), and genomic DNA was isolated by overnight digestion in proteinase K followed by standard phenol/chloroform extraction. After dissecting tumor tissue from paraffin s slides and preparing DNA by xylene extraction, digestion was carried out in proteinase K at 55°C overnight.
Exam~ale 2 - Determination of genomic structure and chromosomal location of SUFU and BTRC beta-transducin repeat-containin~protein ene~.
~o Using SUFU cDNA as a probe, clones 12~.G18 and 2F13 were isolated from the Roswell Park Cancer Institute human genomic BAC library, and subclones sequenced to determine intron-axon boundaries. PCR was used to screen a BAC library specific for chromosome 1 Gq (Genome Systems) for clones containing human BTRC and carried out radiation hybrid mapping of 15 SUFU and BTRC with the GB4 panel (Research Genetics). All primer sequences are available on request.
cDNAs were generated using Superscript II RT (Gibco-BRL) with both oligo-dT and SUFU-specific primers. Two nested PCRs were performed to amplify axons 1-4 and axons 4-12, respectively, the PCR products were 2o subcloned with a TA cloning Kit (Invitrogen) and sequenced using the Cy-5I5.5-labeled M13 primer.
Example 3 - Fluorescence in situ hybridization (FISH) Lymphocytes were cultured from peripheral blood or cell lines infected 2s with Epstein-Barr virus and incubated the cells for 30 min with colcemid (0.1 ~glml) before harvesting. A contiguous series of BAC clones from chromosome 10q24-q25 was labelled with biotin using the BioNick Labeling system, and BAC RP11-59D04 on chromosome 10p15 was labelled with digoxigenin as a control. FISH signals were detected with fluorescein-avidin 3o D (Vector) and fluorescein-labeled antibody against avidin D (Vector) for biotin-labeled probes, and with antibody against digoxigenin, digoxigenin-labeled antibody against mouse Ig, and rhodamine-labeled antibody against digoxigenin (Boehringer Mannheim) for digoxigenin-labeled probes.
Example 4 - Mutational analysis.
Using intronic primers designed to include an 5'- M13 sequencing cassette for all 12 exons of SUFU, PCR reactions were carried out in a PTC-100 Programmable Thermal Controller for 35-4.0 cycles, usually at an annealing temperature of 60°C. In some cases, nested PCR was performed using a second set of intronic primers. Amplified products were sequenced as previously described (28). Primer sequences and protocols are available on request.
Using single-strand conformation polymorphism (SSCP) as previously described (29), 36 medulloblastomas were screened for each exon of BTRC
and sequenced exons that migrated aberrantly through the SSCP gel (11 of 38). LOH was measured of the markers D10S215, D1 OS520 and D10S540 ~5 near PTEN (phosphatase and tensin homologue deleted in chromosome 10) in 21 medulloblastomas and sequenced genomic DNA for all coding exons of PTEN from the corresponding tumors29 Example 5 - SUFU expression constructs.
2o SUFU cDNA was amplied from the Marathon fetal brain cDNA
(Clonetech) into pTAdv (Clonetech), created an ire-frame N-terminal Myc tag by PCR of the SUFU cDNA, and cloned the Myc-SUFU cDNA into pcDNA3.1 (Invitrogen). The mutant SUFU-oex8 transcript (amplified from cDNA of medulloblastoma HMB2) was shuttled into the pcDNA3.1 wildtype SUFU-Myc 25 construct. The SUFU(212-484)-Myc expression erector was constructed by PCR and both strands of each expression construct were sequenced to rule out PCR errors. pCMV-Flag-GL11 and pCMV-Flag-GL12 have previously been described (30).
so Example 6 - Co-precipitation assay.
293 cells were transfected with pCMV-Flagl-GL11 or pCMV-Flag-GL12 and either pcDNA 3.1-Myc-SUFU, pcDNA 3.1-Myc-SUFU-~ex8 or pcDNA 3.1-Myc-SUFU(212-484) using Superfect (Qiagen). Cells were lysed in 500m1 lysis buffer (50 mM HEPES, pH 7.5, 150 mM NaCI, 10% glycerol, 1 % Triton X-100 and 1 mM EDTA), and the lysates incubated overnight at 4°C
with 2w1 monoclonal antibody against Myc (UBI), or 2~,1 monoclonal antibody against , Flag M2 (Sigma) and 50,120% protein G-Sepharose beads (Sigma). After washing the beads five times in 1P washing buffer (50 mM HEPES, pH 7.4, 150 mM NaCI, 100 ~M ZnGl2, 2 mM EDTA, 1 % Nonidet P-40 and 10%
glycerol), beads were re-suspended and boiled in Laemmli sample buffer. The samples were resolved by SDS-PAGE (immunoprecipitate/lysate ratio 50:1 ), and the gel transferred to polyvinylidene difluoride membranes (Immobilon-P) which were subsequently probed with monoclona8 antibody against Flag-M2 (Sigma) or monoclonal antibody against Myc (UBi) and the signals visualized using enhanced chemiluminescence.
~5 Example 7 -Immunofluorescence.
C3H10T112 cells were grown on glass cover slips and transfected with plasmid DNA using Eugene 6 (Roche). After 24 llours the cells were fixed in 4% paraformaldehyde at 37°C for 10 minutes and rendered permeable by incubation in methanol for 2 minutes. The samples were incubated in blocking 2o solution (PBS with 10% goat serum) for 1 hour at room temperature, with primary antibodies (rabbit antibody against Myc (Santa Cruz) andlor mouse antibody against Flag-M5 (Sigma)) for 1 hour at room temperature, and with secondary antibodies (FITC-labeled goat antibody against mouse IgG and rhodamine-labeled goat antibody against rabbit) overnight at 4°C. After z5 counterstaining nuclei with DAPI fluorescent images were acquired using a Leica DMIRE2 inverted fluorescent microscope with Open Lab software (Improvision).
Example 8 - Promoter assay.
so C3H10T112 cells were plated at a density of 5 x104 cells/well in six-well plates and transfected them using Eugene (Roche) with the reporter gene _29!
8*GLI-BS-051 Lucll (24), a reference plasmid pCMV-(~-gal, appropriate expression constructs and sufficient pcDNA 3.1 to achieve an equal amount of DNA in each well. At 36 hours after transfection, cells were harvested and luciferase activity normalized with respect to (3-galactosidase activity. All transfections were repeated in at least two independent experiments, which gave reproducible results.
GenBank accession numbers. The axons and surrounding intronic sequences for SUFU have been submitted to GenBank under the accession 1o numbers AY081818, AY081819, AY081820, AY081821, AY081822, AY081823, AY081824, AY081825, AY081826, AY081827, AY081828 and AY081829.
Although preferred embodiments have been described herein in detail it is understood by those of skill in the art that using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein can be made. Such equivalents are intended to be encompassed by the scope of the claims appended hereto.

REFERENCES
1. Dahmane, N. & Ruiz-i-Altaba, A. Sonic hedgehog regulates the growth and patterning of the cerebellum. Development 126, 3089-3100 (1999).
2. Wechsler-Reya, R.J. & Scott, M.P. Control of neuronal precursor proliferation in the cerebellum by Sonic Hedgehog. Neuron 22, 103-114 (1999).
3. Hahn, H. et al. Mutations of the human homolog of Drosophila 1o patched in the nevoid basal cell carcinoma syndrome. CeBI 85, 841-851 (1996).
4. Johnson, R.~. et al. Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 272; 1668-1671 (1996).
5. Gorlin, R.J. Nevoid basal-cell carcinoma syndrome. Medicine (Baltimore) 66, 98-113 (1987).

6. Kimonis, V.E. et al. Clinical manifestations in 105 persons with nevoid basal cell carcinoma syndrome. Am. J. Med. Genet. 69, 299-308 (1997).

7. Raffel, C. et al. Sporadic medulloblastornas contain PTCH
2o mutations. Cancer Res. 57, 842-845 (1997).

8. Unden, A.B. et al. Mutations in the human homologue of Drosophila patched (PTCH) in basal cell carcinomas and the Gorlin syndrome: different in vivo mechanisms of PTCH inactivation. Cancer Res. 55, 4562-4565 (1996).

9. Wolter, M., Reifenberger, J., Summer, C:., Ruzicka, T. &
Reifenberger, G. Mutations in the human homologue of the Drosophila segment polarity gene patched (PTCH) in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumors of the central nervous system.
Cancer Res. 57, 2581-2585 (1997).

10. Zurawel, R.H. et al. Analysis of PTCH/SM~/SHH pathway genes in 3o medulloblastoma. Genes Chromosom. Cancer 27, 44-51 (2000).

11. Taylor, M.D., Mainprize, T.G. & Rutka, J.T. Molecular insight into medulloblastoma and central nervous system primitive neuroectodermal tumor biology from hereditary syndromes: a review. Neurosurgery 47, 888-901 (2000).

12. Reifenberger, J. et al. Missense mutaitions ire SM~H in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumors of the s central nervous system. Cancer Res. 58, 1798-1803 (1998).

13. Xie, J. et al. Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 391, 90-92 (1998).

14. Kinzler, K.W. et al. Identification of an amplified, highly expressed gene in a human glioma. Science 236, 70-73 (1987).

15. Goodrich, L.!/., Milenkovic, L., Higgins~, K.M. & Scott, M.P. Altered neural cell fates and medulloblastoma in mouse patched mutants. Science 277, 1109-1113 (1997).

16. Hahn, H. et al. Rhabdomyosarcomas and radiation hypersensitivity in a mouse model of Gorlin syndrome.. Nature Mc~d. 4, 619-622 (1998).

17. Nilsson, M. et al. Induction of basal cell carcinomas and trichoepitheliomas in mice overexpressing GLI-1.. Proc. Natl Acad. Sci. USA
97, 3438-3443. (2000).

18. Grachtchouk, M. et al. Basal cell carcinomas in mice overexpressing GIi2 in skin. Nature Genet. 24, 2'15-217 (2000).

19. ~ro, A.E. et al. Basal cell carcinomas iin micE=. overexpressing sonic hedgehog. Science 276, 817-821 (1997) 20. Bayani, J. et al. Moiecular cytogenetic analysis of medulloblastornas and supratentorial primitive ne:uroectodermal tumors by using conventional banding, comparative genomic hybridization, and spectral 2s karyotyping. J. Neurosurg. 93, 437-448 (2000).

21. Zurawel, R.H., Chiappa, S.A., Allen, C. ~ Raffei, C. Sporadic medulloblastomas contain oncogenic beta-catenin mutations. Cancer Res. 58, 896-899 (1998).

22. Pomeroy, S.L. et ai. Prediction of central ner~rous system 3o embryonal tumour outcome based on gene expression. Nature 415, 436-442 (2002).

23. Lobo, S., Cervenka, J., London, A. & P'lerpor~t, M.E. Interstitial deletion of 10q: clinical features and literature review. Am. J. Med. Genet.
43, 701-703 (1992).

24. Sasaki, H., Hui, C., Nakafuku, M. & Kondoh, H. A binding site for Gli proteins is essential for HNF-3(i floor plate enhancer activity in transgenics s and can respond to SHH in vitro. Development 124, 1313-1322 (1997).

25. Meng, X. et al. Suppresser of fused negatively regulates ~-catenin signaling. J.Biol. Chem. 276, 40113-40119 (2001 ).

26. Chidambaram, A. et al. Mutations in tree hurrsan homologue of the Drosophila patched gene in Caucasian and African-American nevoid basal ~o cell carcinoma syndrome patients. Cancer Res. ~i6, 4599-4601 (1996).

27. Wicking, C. et al. Most germ-line mutations in the nevoid basal cell carcinoma syndrome lead to a premature termination of the PATCHED
protein, and no genotype-phenotype correlations are evident. Am. J. Hum.
Genet. 60, 21-26 (1997).
15 28. Liu, L. et al. Mutation of the CDKN2A 5' UTR creates an aberrant initiation codon and predisposes to melanoma. Nature Genet. 21, 128-132 (1999).
29. Raffel, C. et al. Analysis of oncogene and tumor suppresser gene alterations in pediatric malignant astrocytomas reveals reduced survival for 2o patients with PTEN mutations. Clin. Cancer Res. 5, 4085-4090 (1999).
30. Ding, Q. et al. Mouse suppresser of fused is a negative regulator of sonic hedgehog signaling and alters the subcellullar distribution of GIi1.
Curr.
Biol. 9, 1119-1122 (1999).

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: THE HOSPITAL FOR SICK CHILDREN
(ii) TITLE OF INVENTION: DIAGNOSTIC AND THERAPEUTIC USES OF SUFU GENE
(iii) NUMBER OF SEQUENCES: 13 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Sim & McBurney (B) STREET: 6th Floor, 330 University Avenue (C) CITY: Toronto (D) PROVINCE: Ontario (E) POSTAL CODE: MSG 1R7 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn version 3.1 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2,432,496 (B) FILING DATE: 2003-06-16 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 60/388,305 (B) FILING DATE: 2002-06-14 (viii) PATENT AGENT INFORMATION:
(A) NAME: Patricia A. Rae (Dr.) (B) REFERENCE NUMBER: 3206-232/PAR
(2) INFORMATION FOR SEQ ID N0: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 623 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
ctattgtcaa gtcacacctt ccctgcctgt gactggcaca gacattagcc aatgggtgct 60 tggatagggt gcgccggcgc cccgcccccc ttagcgcccc gccgccccga ggcaccctct 120 ggcagactcg gcggcggcga cagcctgggc ggacagtgcg ccgtgcgcag gcgcggagct 180 agacctcgct gcagccccca tcgcctcggg gagtctcacc caccgagtcc gcccgctggc 240 ccgtcagtgc tctccccgtc gtttgccctc tccagttccc ccagtgcctg ccctacgcac 300 cccgatggcg gagctgcggc ctagcggcgc ccccggcccc accgcgcccc cggcccctgg 360 cccgactgcc cccccggcct tcgcttcgct ctttcccccg ggactgcacg ccatctacgg 420 agagtgccgc cgcctttacc ctgaccagcc gaacccgctc caggttaccg ctatcgtcaa 480 gtactggtat gctctgggcc gcggggagac ggacaggcgc gggctggaaa gggttaaagc 540 gccgagggcg aagtaatttg tgggaggtgg gaggaggggt agagaatggt taaagcactc 600 agaaggaggg cttcttgctg cga 623 (2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 264 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGTNAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 2:
caaagtagagcgccttagcttgacattgtctgatttccaggcttacactaacacccctgt 60 gttttgttttttgcaggttgggtggcccagaccccttggactatgttagcatgtacagga 120 atgtggggagcccttctgctaacatccccgagcactggcactacatcagcttcggcctga 180 gtgatctctatggtgacaacagagtccatgagtgagtatatgccacctgttctttatcca 240 gagccttattcctgaggtcttcct 264 (2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 275 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 3:
gggagaactttagactttcaagagagtgtttttcctaaggtaattgagcttaaaacactt 60 gctttttatgtctttcaggtttacaggaacagatggacctagtggttttggctttgagtt 120 gacctttcgtctgaagagagaaactggggagtctgccccaccaacatggcccgcagagtt 180 aatgcagggcttggcacgatacgtgttccagtcaggtaggaggccagggctggctgctgt 240 gctggtccttttgccatgagcctggttgactttga 275 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 400 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 4:
aagcctccca gcctgggcta gtgagatccc agcccagatt ccaggcctgg atctggggcc 60 ttgaacaatg aggatccttg tatctctccc acagagaaca ccttctgcag tggggaccat 120 gtgtcctggc acagcccttt ggataacagt gagtcaagaa ttcagcacat gctgctgaca 180 gaggacccac agatgcagcc cgtgcagaca ccctttgggg tagttacctt cctccaggtg 240 aggcacaggt tggacgctgg ctcaagcctt cctgtgggaa gggtcctggg aggacaagga 300 ggcttgagga gggggagtga agggagtggg aggtttcctt tggcctcgtc ctgatttctg 360 tttcctctga tggtttgtca ggtagattca gatggtctga 400 (2) INFORMATION FOR SEQ ID N0: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 205 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
tggggggtgg ccattaacac acaatgggct ttctatcctg ggcctcagat cgttggtgtc 60 tgcactgaag agctacactc agcccagcag tggaacgggc agggcatcct ggagctgctg 120 cggacagtgc ctatgtgagt acccatgcaa ggtgggagcg cggctccctg ggcctggggg 180 tgggagtccc tccactaccc tccat 205 (2) INFORMATION FOR SEQ ID N0: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 286 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
tccctgaccacgaactattcccctgtgtcctaggcctggggcagcaaacagggcaggctg 60 taggcccagcccatcagccccagaccctcagttaccattgtatcccctttccttgtccac 120 agtgctggcggcccctggctgataactgacatgcggaggggagagaccatatttgagatc 180 gatccacacctgcaagtatgtcttgagtgaggaaaacctttctagcaccctgtgcctagg 240 cctcttccaaataacactggctttcatcctgggaaaacagaggacc 286 (2) INFORMATION FOR SEQ ID N0: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 361 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 7:
ttgtcccatg ctcagcacca caagggctca gtaaatactg taagagcagt ggctgaaagg 60 gtggtcacct tgggtcacca gttctctgaa agaactctgg ctctttggtt cttttcaagc 120 aggagagagt tgacaaaggc atcgagacag atggctccaa cctgagtggt gtcagtgcca 180 agtgtgcctg ggatgacctg agccggcccc ccgaggatga cgaggacagc cggagcatct 240 gcatcggcac acagccccgg cgactctctg gcaaaggtgg gagccatcac tcagcattcc 300 accagccttc ctccttcctt ttccccaggg cctggtttcc agtctctcta ggatgggtct 360 c 361 (2) INFORMATION FOR SEQ ID N0: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 274 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO; 8:
aggtttcaagagcggggtgagaattgctgggagcccactgggccactgggcaacttagtg 60 gtgtcgttgcagacacagagcagatccgggagaccctgaggagaggactcgagatcaaca 120 gcaaacctgtccttccaccaatcaaccctcagcggcagaatggcctcgcccacgaccggg 180 ccccgtaagttccccagtgtccctgggctggaacaagaggacgacttttttctgaagggc 240 ctgtccctgtggattgcatgagagagaacaatgc 274 (2) INFORMATION FOR SEQ ID N0: 9:
(i) SEQUENCE CHARACTERISTICS;
(A) LENGTH: 266 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 9:
tccctgagcttttcaccttgtgccgaaccttttcctgtgcttgcttcacaggagccgcaa 60 agacagcctggaaagtgacagctccacggccatcattccccatgagctgattcgcacgcg 120 gcagcttgagagcgtacatctgaaattcaaccaggagtccggagccctcattcctctctg 180 cctaaggtgagcgagacagccctgccacacagtttaccccacagcacccagctcagcctc 240 cagggggcacttcagagcctccccag 266 (2) INFORMATION FOR SEQ ID N0: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 375 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID N0: 10:
gcctgctgtg cttggaactg tttccaagcc cagctcctca ctgtctccat gttcccatct 60 ccaggggcag gctcctgcat ggacggcact ttacatataa aagtatcaca ggtgacatgg 120 ccatcacgtt tgtctccacg ggagtggaag gcgcctttgc cactgaggag catccttacg 180 cggctcatgg accctggtta caagtgagaa ggcccttttt cttctccctc cttcctttca 240 tagacttcct tgcccacccc tcctcttctc ccttggcagc tcttgatggc accccttcct 300 ggggggctgg tcatgaatgc ctcatggatt cagggcctgg ggcctgtgtg taggtatgga 360 gtgtggatgc tgcta 375 (2) INFORMATION FOR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 275 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
cttccctgtg tcccttgaac agatcacagt gagctcatct ctcctccatg gtcagaagag 60 aggtataacg cttggtggtt ggcaaaaaga tcatacattt aaaaataata ataaaagcct 120 gccttgtgcc ttcacagatt ctgttgaccg aagagtttgt agagaaaatg ttggaggatt 180 tagaagattt gacttctcca gaggaagtaa gcttgtttga cttttcctga caacaggtcc 240 cgtctctggg accatgtgtg tgcgtgcgtg tgcac 275 (2) INFORMATION FOR SEQ ID N0: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 280 (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
ggcctgtcct atccctagct ccccggggac aggcctgggc aatctctgga aagaccacgg 60 tgtattctgc taaccactca cactcctggt ctgtgcttgc tccctccaca gttcaaactt 120 cccaaagagt acagctggcc tgaaaagaag ctgaaggtct ccatcctgcc tgacgtggtg 180 ttcgacagtc cgctacacta gcctgggctg ggccctgcag tggccagcag ggagcccagc 240 tgctccccag tgacttccag tgtaacagtt gtgtcaacga 280 (2) INFORMATION FOR SEQ ID N0: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 484 (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:
Met Ala Glu Leu Arg Pro Ser Gly Ala Pro Gly Pro Thr Ala Pro Pro Ala Pro Gly Pro Thr Ala Pro Pro Ala Phe Ala Ser Leu Phe Pro Pro Gly Leu His Ala Ile Tyr Gly Glu Cys Arg Arg Leu Tyr Pro Asp Gln Pro Asn Pro Leu Gln Val Thr Ala Ile Val Lys Tyr Trp Leu Gly Gly Pro Asp Pro Leu Asp Tyr Val Ser Met Tyr Arg Asn Val Gly Ser Pro Ser Ala Asn Ile Pro Glu His Trp His Tyr Ile Ser Phe Gly Leu Ser Asp Leu Tyr Gly Asp Asn Arg Val His Glu Phe Thr Gly Thr Asp Gly Pro Ser Gly Phe Gly Phe Glu Leu Thr Phe Arg Leu Lys Arg Glu Thr Gly Glu Ser Ala Pro Pro Thr Trp Pro Ala Glu Leu Met Gln Gly Leu Ala Arg Tyr Val Phe Gln Ser Glu Asn Thr Phe Cys Ser Gly Asp His Val Ser Trp His Ser Pro Leu Asp Asn Ser Glu Ser Arg Ile Gln His Met Leu Leu Thr Glu Asp Pro Gln Met Gln Pro Val Gln Thr Pro Phe Gly Val Val Thr Phe Leu Gln Ile Val Gly Val Cys Thr Glu Glu Leu His Ser Ala Gln Gln Trp Asn Gly Gln Gly Ile Leu Glu Leu Leu Arg Thr Val Pro Ile Ala Gly Gly Pro Trp Leu Ile Thr Asp Met Arg Arg Gly Glu Thr Ile Phe Glu Ile Asp Pro His Leu Gln Glu Arg Val Asp Lys Gly Ile Glu Thr Asp Gly Ser Asn Leu Ser Gly Val Ser Ala Lys Cys Ala Trp Asp Asp Leu Ser Arg Pro Pro Glu Asp Asp Glu Asp Ser Arg Ser Ile Cys Ile Gly Thr Gln Pro Arg Arg Leu Ser Gly Lys Asp Thr Glu Gln Ile Arg Glu Thr Leu Arg Arg Gly Leu Glu Ile Asn Ser Lys Pro Val Leu Pro Pro Ile Asn Pro Gln Arg Gln Asn Gly Leu Ala His Asp Arg Ala Pro Ser Arg Lys Asp Ser Leu Glu Ser Asp Ser Ser Thr Ala Ile Ile Pro His Glu Leu Ile Arg Thr Arg Gln Leu Glu Ser Val His Leu Lys Phe Asn Gln Glu Ser Gly Ala Leu Ile Pro Leu Cys Leu Arg Gly Arg Leu Leu His Gly Arg His Phe Thr Tyr Lys Ser Ile Thr Gly Asp Met Ala Ile Thr Phe Val Ser Thr Gly Val Glu Gly Ala Phe Ala Thr Glu Glu His Pro Tyr Ala Ala His Gly Pro Trp Leu Gln Ile Leu Leu Thr Glu Glu Phe Val Glu Lys Met Leu Glu Asp Leu Glu Asp Leu Thr Ser Pro Glu Glu Phe Lys Leu Pro Lys Glu Tyr Ser Trp Pro Glu Lys Lys Leu Lys Val Ser Ile Leu Pro Asp Val Val Phe Asp Ser Pro Leu His

Claims (36)

1. A method for determining a diagnosis, prognosis or risk of a tumor pathology in a subject involving a SUFU gene mutation, said method comprising detecting a SUFU gene mutation in DNA from said subject, wherein said SUFU gene comprises exons 1 through 12 and said mutation is associated with said tumor pathology.

2. The method of claim 1, wherein said mutation is present in exon 8 or 9 of said SUFU gene.

3. The method of claim 1, wherein said mutation is present in exon 1 or 2 of said SUFU gene.

4. The method of claim 1, wherein said mutation is a deletion of a portion of said SUFU gene.

5. The method of claim 4, wherein said deletion is a deletion of seven nucleotides from exon 9.

6. The method of claim 4, wherein said deletion is a N-carboxy terminal deletion.

7. The method of claim 1, wherein said mutation is selected from the group consisting of:

IVS8+1G ->A, IVS1-1G ->T, 1129deITCCGGAG, IVS1-1A->T, E1 143insA, a 2.5-2.8 Mb deletion on chromosome 10q and SUFU(212-484) being a N-terminal deletion, and combinations thereof.

8. The method of claim 1, wherein said mutation is a missense mutation selected from C44T and G1018T.

9. The method of claim 1, wherein said DNA is genomic DNA or cDNA.

10. The method of claim 9, wherein a mutation is detected by an assay selected from the group consisting of probe hybridization, direct sequencing, restriction enzyme fragment analysis and fragment electrophoretic mobility.

11. The method of claim 1, wherein said tumor pathology is selected from the group consisting of medulloblastoma, nevoid basal cell carcinoma, basal cell carcinoma, meningioma, colon cancer, muscle tumors and sarcomas.

12. The method of claim 1, wherein said method further comprises detecting expression of a SUFU gene product from said genomic DNA by a method selected from the group consisting of electrophoresis, HPLC, TLC, immunodiffusion, immunoelectrophoresis, RIA, ELISA, immunofluorescence and western blotting.

13. A method for determining whether a subject is at risk for development of medulloblastoma, the method comprising the steps of:

(a) obtaining a nucleic acid sample from the subject; and (b) conducting an assay on the nucleic acid sample to determine the presence or absence of a Suppressor-of-Fused (SUFU) gene mutation associated with medulloblastoma, wherein the presence of a SUFU gene mutation associated with medulloblastoma indicates that the subject is at risk for development of medulloblastoma.

14. The method of claim 13, wherein the assay is selected from the group consisting of probe hybridization, direct sequencing, restriction enzyme fragment analysis and fragment electrophoretic mobility.

15. The method of claim 14, wherein the nucleic acid sample is an RNA
sample and the assay is a direct sequencing assay.

16. The method of claim 14, wherein the assay comprises the steps of:

(a) reverse transcribing the RNA sample to produce a corresponding cDNA;

(b) performing at least one polymerise chain reaction with suitable oligonucleotide primers to amplify the SUFU cDNA;

(c) obtaining the nucleotide sequence of the amplified SUFU cDNA;
and (d) determining the presence or absence of a SUFU gene mutation associated with NBCCS in said nucleotide sequence.

17. The method of claim 16, wherein step (d) comprises determining the presence or absence of a mutation of the polynucleotide of Table 2, the mutation being selected from the group consisting of: IVS8+1G ->A, IVS1-1G ->T, 1129deITCCGGAG, IVS1-1A->T, E1 143insA, a 2.5-2.8 Mb deletion on chromosome 10q and SUFU(212-484) being a N-terminal deletion, and combinations thereof.

18. The method of claim 14, wherein the nucleic acid sample is a DNA
sample.

19. The method of claim 18, wherein the DNA sample is a genomic DNA
sample and the assay comprises the steps of:

(a) amplifying a target portion of the nucleotide sequence of the genomic DNA;

(b) obtaining the nucleotide sequence of said amplified target portion; and (c) determining the presence or absence of a SUFU gene mutation associated with medulloblastoma in said target portion nucleotide sequence.

20. The method of claim 19, wherein step (c) comprises determining the presence or absence of a mutation of the polynucleotide of the SUFU nucleic acid sequence shown in Table 2, the mutation being selected from the group consisting of: IVS8+1G ->A, IVS1-1G ->T, 1129deITCCGGAG, IVS1-1A ->T, E1 143insA, a 2.5-2.8 Mb deletion on chromosome 10q and SUFU(212-484) being a N-terminal deletion, and combinations thereof.

21. A method for determining whether a subject displaying a medulloblastoma phenotype, the method comprising the steps of:

(a) obtaining a nucleic acid sample from the subject;

(b) conducting an assay on the nucleic acid sample to determine the presence or absence of a SUFU gene mutation associated with medulloblastoma, wherein the presence of a SUFU gene mutation associated with medulloblastoma indicates that the subject is suffering from medulloblastoma.

22. The method of claim 21, wherein the assay is selected from the group consisting of probe hybridization, direct sequencing, restriction enzyme fragment analysis and fragment electrophoretic mobility.

23. The method of claim 22, wherein the nucleic acid sample is an RNA
sample and the assay is a direct sequencing assay.

24. The method of claim 23, wherein the assay comprises the steps of:

(a) reverse transcribing the RNA sample to produce a corresponding cDNA;

(b) performing at least one polymerase chain reaction with suitable oligonucleotide primers to amplify the SUFU cDNA;

(c) obtaining the nucleotide sequence of the amplified SUFU cDNA;
and (d) determining the presence or absence of a SUFU gene mutation associated with NBCCS in said nucleotide sequence.

25. The method of claim 24, wherein step (d) comprises determining the presence or absence of a mutation of the polynucleotide shown in Table 2, the mutation being selected from the group consisting of: IVS8+1G ->A, IVS1-1G ->T, 1129deITCCGGAG, IVS1-1A ->T, E1 143insA, a 2.5-2.8 Mb deletion on chromosome 10q and SUFU(212-484) being a N-terminal deletion, and combinations thereof.

26. The method of claim 25, wherein the nucleic acid sample is a DNA
sample.

27. The method of claim 26, wherein the DNA sample is a genomic DNA
sample and the assay comprises the steps of:

(a) amplifying a target portion of the nucleotide sequence of the genomic DNA;

(b) obtaining the nucleotide sequence of said amplified target portion; and (c) determining the presence or absence of a SUFU gene mutation associated with NBCCS in said target portion nucleotide sequence.

28. The method of claim 27, wherein step (c) comprises determining the presence or absence of a mutation of the polynucleotide shown in Table 2, the mutation being selected from the group consisting of: IVS8+1G ->A, IVS1-1G ->T, 1129deITCCGGAG, IVS1-1A->T, E1 143insA, a 2.5-2.8 Mb deletion on chromosome 10q and SUFU(212-484) being a N-terminal deletion, and combinations thereof.

29. The method of claim 1 wherein the subject is a human.

30. A method for treating a subject bearing a mutated SUFU gene comprising administering to the subject an effective amount of an agent selected from the group consisting of:

(a) a nucleotide sequence encoding a normal SUFU gene;

(b) normal SUFU protein or an effective fragment thereof;

(c) a compound which inhibits SHH signalling; and (d) an antibody that binds to a mutant SUFU protein.

31. The method of claim 30, wherein a SUFU protein encoded by the nucleic acid SUFU sequence of Table 2 is administered to the subject.

32. The method of claim 30, wherein the subject is a human.

33. A method for screening a candidate compound for its potential as a therapeutic for improvement of SUFU function in a subject having a mutated SUFU gene comprising screening the candidate compound for its ability to inhibit SHH signalling, wherein an ability to inhibit SHH signalling indicates that the compound is a potential therapeutic for said subject.

34. An isolated human SUFU gene comprising 12 exons, said gene having a mutation in one or more of exons 1, 2, 8 or 9, wherein said mutation is indicative of a medulloblastoma phenotype.

35. An isolated human SUFU gene comprising one or more mutations selected from the group consisting of: IVS8+1G ->A, IVS1-1G ->T, 1129deITCCGGAG, IVS1-1A ->T, E1 143insA, a 2.5-2.8 Mb deletion on chromosome 10q and SUFU(212-484) being a N-terminal deletion, and combinations thereof.

36. A kit for the detection and/or quantification of SUFU gene or gene product by the method of claim 16, the kit comprising one or more nucleic acids and amplification primers and instructions for the use.