WO2005047519A2 - Lsamp and nore 1 down-regulation in clear cell renal cell carcinomas - Google Patents

Abstract

Two genes, LSAMP and NORE1 are under expressed or downregulated in one type of kidney cancer, clear cell renal cell carcinoma (CC-RCC). Methods and kits for detecting cells with this property as tumor cells or as precancerous susceptible cells are disclosed.. Also disclosed are methods for inhibiting cancer-associated properties of such cells and for treating subjects in whom such cells are present.

Description

LSAMP AND NOREl DOWN-REGULATION IN CLEAR CELL RENAL CELL CARCINOMAS BACKGROUND OF THE INVENTION

Field of the Invention The present invention in the field of genetics and medicine relates to the under- expression of two genes, LSAMP and NOREl in clear cell renal cell carcinoma (CC-RCC) tissue and exploitation of this property in methods for detecting or treating this type of cancer.

Description of the Background Art Renal carcinoma is known to have different histological types, with distinct genetic profiles (Storkel et al, 1997). Worldwide, approximately 150,000 people are diagnosed with renal carcinoma, resulting in 78,000 deaths annually (Zbar et al, 2002). The most common type is clear cell renal cell carcinoma (CC-RCC). Studies of familial CC-RCC have led to the identification of important tumor suppressor genes such as VHL (Latif et al, 1993). Recently, position cloning also resulted in the discovery of other kidney cancer-related genes BHD, FH, and HRPT2 (Nickerson et al. , 2002; Tomlinson et al. , 2002; Carpten et al. , 2002). While hereditary CC-RCCs are mainly attributed to VHL mutations, there are known CC-RCC families and a significant proportion of sporadic CC-RCCs that are not associated with the VHL (Teh et al, 1997; Woodward et al, 2000), thus pointing to the existence of other CC-RCC-related genes. Since some CC-RCC families are associated with balanced chromosomal translocations, the translocation breakpoint-spanning genes are likely CC-RCC-related candidate genes. The first CC-RCC family with a balanced chromosomal translocation t(3;8)(pl4;q24) was described by Cohen et al. (1979). To date, at least eight such hereditary CC₍-RCC-related chromosomal translocation families have been reported (Cohen et al, 1979; Kovacs et al, 1988; Kovacs et al, 1989; Koolen et al, 1998; van Kessel et al, 2001; Podolski et al, 2001; Kanayama et al, 2001). Interestingly, translocation in all these CC-RCC families is linked to chromosome 3, making constitutional chromosome 3 translocation a predisposing factor (vas Kessel et al, 1999; Bodmer et al, 1998; Bodmer et al, 2002c). The subsequent observation of the loss of translocation derivative chromosome 3 (der(3) chromosome) and somatic VHL mutations in a proportion of familial tumors led to the proposal of a three-step model of CC-RCC rumorigenesis (Schmidt et al, 1995; Bodmer et al, 1998; Bodmer et al, 2002c): initial constitutional chromosome 3 translocation, subsequent somatic loss of the der(3) chromosome leading to the loss of a copy of VHL, and a third hit in the form of random somatic mutation in the second VHL allele. However, loss of the der(3) chromosome was observed only in a subset of the examined samples. Most of the analyzed familial tumors with loss of the der(3) did not cany VHL mutations. Furthermore, neither der(3) loss nor VHL mutations were observed in several tumor biopsies in the affected families (Eleveld et al, 2001; Bodmer et al, 2002b). These observations suggest that the breakpoint-spanning genes in the familial RCC-associated chromosome 3 translocations are also likely implicated in RCC tumorigenesis or act synergistically in the above model in the form of genetic and/or epigenetic alternations. Analysis of the constitutional t(3;8)(pl4;q24) translocation associated with familial CC- RCC led to the identification and extensive investigation of the breakpoint-spanning gene FHIT (fragile histidine triad) on 3pl4 (Ohta et al, 1996). FHIT is thought to be a putative tumor suppressor gene, and aberrant FHIT transcripts and FHIT genomic lesions were observed in a variety of primary tumors and tumor-derived cell lines (Ohta et al, 1996; Siprashvili et al, 1997; Druck et al, 1997). The partner breakpoint-spanning gene TRC8 on the chromosome 8 shows high homology to the Drosophila patched (PTCH) gene and probably also functions as a tumor suppressor (Gemmill et al, 2002). Also, another two breakpoint-spanning genes, DIRC1 on chromosome 2q33 and DIRC2 on 3q21, disrupted respectively in t(2;3)(q33;q21) and t(2;3)(q35;q21) breakpoints, have been identified (Druck et al, 2001; Bodmer et al, 2002a). The role of these genes in CC-RCC tumorigenesis remains to be determined. The present inventors describe here the positional cloning of the t(l ;3)(q32.1 ;ql 3.3) chromosomal breakpoints and the identification of two breakpoint-spanning genes, LSAMP on 3ql3.3 stndNOREl on lq32.1, in a previously reported Japanese hereditary CC-RCC family (Kanayama et al, 2001). LSAMP (limbic-system- associated membrane protein gene) encodes a neuronal surface glycoprotein that belongs to the IgLONs (immunoglobulin LSAMP, OPCML/OBCAM, and neurotrimin) family and is distributed in cortical and subcortical regions of the limbic system (Pimenta et al, 1996). To date, very little is known about LSAMP and its biological role remains unclear. However, its family partner gene OPCML/OBCAM on l lq25 was recently found to be epigenetically inactivated and was regarded as a candidate TSG in epithelial ovarian cancer (Sellar et al, 2003). NOREl was recently identified as a homolog of the tumor suppressor gene RASSF1 at 3p21.3, which is frequently inactivated via promoter hypermethylation in a variety of human tumors (Darnmann et al, 2000; Tommasi et al, 2002). The mouse counterpart Norel is a Ras effector (Vavvas et al, 1998). BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 and its subparts show mapping of the of the t(l;3) breakpoints on chromosomes lq32.1 and 3ql3.3 by FISH. Fig. 1A-1 shows the construction of a contig of nine BAC clones in a 3.6-cM region of lq32.1 (left panel, labeled "lq"). The RPl 1-54L22 was first found to span the breakpoint by FISH split assay. Overlapped BAC clones (CTD-2245C1, -2321B11, and -2278G17) also showed split signals and confine the der(l) breakpoint region to about 30 kb (dotted box). Fig. 1A-2 shows the similar establishment of a contig often BAC clones within a 5-cM region of 3ql3.3 (right panel, labeled "3q"). The breakpoint was found within RPl 1-281N16 and was further mapped to a about 30-kb region (dotted box) using overlapping clones (RPl 1- 149B11, CTD-2246M24, and -2514L8). Fig. IB shows fine mapping of the lq32.1 and 3ql3.3 breakpoints by Southern blot analysis and restriction mapping. Nine specific DNA probes (4-10 kb) flanking the lq breakpoint were synthesized by long-range PCR with specific primers from known-sequence RP11-54L22 and -281N16. Southern blot analyses showed that a 5.6-kb lq-p4 probe (Fig. 1B-1 - left panel, labeled RPl 1-54L22 clone") and a 6.2-kb 3q-p2 probe (Fig. 1B-2 - right panel, labeled "RP11-281N16 clone") span the respective lq32.1 and 3ql3.31 breakpoints, which narrowed both breakpoint regions to approximately 6 kb. Restriction mapping refined the lq and the 3q breakpoints to about 1.5-kb (Fig. 1B-1, left panel) and 2-kb regions, respectively (Fig. 1B-2, right panel). Fig. IC shows representative Southern-blot analyses from both chromosomes showing distinct abenant bands (indicated by arrowheads) after restriction digestion. DNA from two normal controls (Nl, N2) and two patients (FRCC3 and FRCC5) were completely digested and subjected to DNA hybridization analysis. Fig. lC-1 shows the Southern blot from chromosome lq32.1; Fig. 1C-2 shows the Southern blot from chromosome 3ql3.3. Figure 2 shows the cloning of both der(l) (lq32.1) and der(3) (3ql3.31) breakpoints through long-range PCR and DNA sequencing. Fig. 2A shows amplification of der(l) and der(3) breakpoints via long-range PCR. A 2.15-kb der(l) breakpoint fragment (der(l)-BP) and a 3.25-kb der(3) breakpoint fragment (der(3)-BP) were amplified. The breakpoint fragments were sequenced and are shown in the lowest boxes. The normal sequences around the breakpoints on lq32.1 and 3ql3.31 are also shown for comparison. The uppercase sequences are from lq32.1 and the lowercase sequences are from 3ql3.31. The sequences in red on 3ql3.31 are deleted from the breakpoints. Fig. 2B is a schematic illustration of the identification of breakpoint-spanning genes. The translocation breakpoints occur within intron 2 of both breakpoint-spanning genes LSAMP at lq32.1 and NOREl at 3ql3.31, which is accompanied by loss of 52 or 54 bp (red sequences in panel A) from LSAMP and of 2 or 0 bp from NOREl. An insertion of nucleotide G (ins G) in the breakpoint junction and a loss of 2 bp (delTG) in LSAMP in the distal part of breakpoint were also observed. NOREl has two isoforms, NOREl A and NORE1B. LSAMP contains seven exons and sits in the reverse strand of chromosome 3. Figure 3 shows lower expression and promoter methylation of LSAMP and NOREl A in

RCC cell lines and sporadic RCC tumors. Fig. 3 A shows that the expression of LSAMP (Fig. 3A-1) and NOREl A (Fig. 3A-3) in nine RCC cell lines and sporadic tumors (LSAMP; 0.06 ± 0.06 for cell lines and 0.05 ± 0.07 for tumors; NOREl A: 0.19 ± 0.10 for cell lines and 0.27 ± 0.12 for tumors) is significantly lower than that in nine normal kidney tissues (LSAMP; 0.77 ± 0.28; NOREl A; 1.03 ± 0.53) using realtime PCR assay (t-test of SSPS, p < 0.001). Fig. 3A-2 and Fig. 3A-4 (Right panels) show eight RCC cell lines which were demethylated using 5-aza-CdR; the expression of both LSAMP (Fig. 3 A-2) and NOREl A (Fig. 3 A-4) was significantly increased in each line (LSAMP; untreated, 0.35 ± 0.23; 5-aza-CdR, 1.02 ± 0.33; NOREl; untreated, 0.03 ± 0.02; 5-aza-CdR, 0.24 ± 0.10) (t-test of SSPS, /} < 0.001). Fig. 3B shows methylation analysis of the LSAMP promoter. Bisulfite-treated DNA from 53 matched pairs of human CC-RCC tumors and normal DNA samples, 9 RCC cell lines, 2 t(l;3)-positive lymphoblastoid cell lines, and 2 control lymphoblastoid cell lines (NCI and NC2) were amplified and digested with Hhal. The LSAMP promoter (540 bp) contains 28 CpG islands. The analysed 231-bp fragment of the LSAMP promoter contains one Hhal site and digestion leads to fragments of 162 bp and 69 bp. Representative abenant methylation of the LSAMP promoter in sporadic and familial CC-RCC samples and in RCC cell lines are shown. Fig. 3C shows methylation analysis of the NOREl A promoter by restriction digestion with Taql in the same cohort of samples. The examined 335 bp of the promoter contains 35 CpG sequences. The methylated fragment contains two Taql sites and digestion results in bands of 202, 123, and 10 bp. The sizes of molecular weight markers (M) are shown on the left. N, normal kidney sample; T, RCC. Figure 4 shows suppression of LSAMP, NOREIA, and Norel re-expression on cell proliferation characteristics. Fig. 4A shows re-expression and localization of EGFP-LSAMP, -NOREIA, and -Norel fusion protein 2 h after microinjection or 24 h after lipid-mediated transfection of pEGFP- LSAMP, -NOREIA, and -Norel plasmids. Fig. 42B shows a growth inhibition assay. A-498/Caki-l cells were microinjected with pEGFP-LSAMP, -NOREIA, -Norel, or pEGFP-Cl/-Nl vector (negative control). Cell proliferation analysis was performed 2 h after microinjection. Cells were counted at the indicated times. The "proliferation index" on the y-axis represents the number of cells counted at those times divided by the number of cells counted 2 h after injection. Figure 5 and its subparts show cytogenetic analysis of the t(lq32.1;3ql3.3). Fig. 5A shows G-banding and spectral karyotyping analysis. The breakpoints were marked with arrows. Fig. 5B shows representative results of FISH with the BAC clone probes on t(l;3) breakpoint region. Fig. 5B-1 (Left panel) shows FISH with BAC probe CTD-2321B11 (red signal): a split signal was observed in der(3). Fig. 5B-2 (Right panel) shows FISH with probe

RP11-281N16: split signals (red) equally appeared on both der(l) and der(3). A lq subtelomeric PAC probe 160H23 (green signal) was used as a control in all the FISH experiments. Figure 6 and its subparts show two NOREl alterations identified in sporadic tumors T31 and T24. Fig. 6A shows that the codon 189 GTG(Val) was replaced by ATG(Met) in T31. It was also found in 5% of the control chromosomes tested. Fig. 6B shows that the codon 248 CGG(Arg) was replaced by CAG(Gln) in T24, which has not been detected in control samples. In NOREl B, the affected codon number is 95. Figure 7 shows nuclear localization and growth suppression analysis of Norel. Fig. 7A demonstrates that EGFP-Norel is predominantly nuclear in Caki-1 cells (RCC cell line ), by lipid-mediated transfection using a pEGFP-Norel plasmid and LIPOFECTAMLNE 2000 reagent (hivitrogen). EGFP expressed from the empty vector pEGFP-Cl was both nuclear and cytoplasmic. Fig. 7B shows that subcellular fractionation and subsequent Western analysis further indicated that the majority of Norel is localized to the nucleus, while a lesser amount appears at the plasma membrane. Fig. 7C shows that induction of Norel inhibits the growth of 293-T cells. The 293-T cells were transfected with pIND(SPl) -Norel or an empty vector and selected in hygromycin for three weeks. Each point on the growth curve represents the mean of three individual cell count determinations. Fig. 7D shows western analysis of Norel expression; V, vector-transfected cells; M, Norel MaxPl -transfected cells.

DESCRIPTION OF THE PREFERRED EMBODIMENTS The inventors demonstrate here that the limbic-system-associated membrane protein (LSAMP) gene and the NOREl gene are the breakpoint-spanning genes in a familial clear cell renal cell carcinoma (CC-RCC), and that the expression of these genes is down-regulated in RCC cell lines and sporadic CC-RCCs. Furthermore, expression of LSAMP and NOREIA proteins in CC-RCC cell lines is shown to inhibit cell proliferation. Diagnostic and treatment methods based on the above observations are described below. This invention includes a method for detecting the presence of, or a predisposition

(susceptibility) to, a cancer (e.g., CC-RCC) in a subject, comprising detecting, measuring the amount of, or quantitating LSAMP and/or NOREl gene expression in a sample from the subject, compared to a baseline level of expression, wherein a reduction in the expression of one or both of the genes compared to the baseline level indicates that the subject suffers from, or has a predisposition to, the cancer. As used herein, a "baseline value" or "baseline amount" includes the amount of expression of an LSAMP or a NOREl gene in normal tissue, such as from a "pool" of normal subjects who do not suffer from, or who do not exhibit a predisposition to, the cancer. This value can be determined at the same time as the level in a sample from the subject being studied, or it can be available in a reference database such as a reference standard or a generic database. The expression may be at the level of RNA transcription which can be detected by various means including quantitative hybridization to a suitable probe, or at the level of protein translation, for example by determining the activity of, or the presence of, the protein, using conventional procedures including an immunoassay. Methods for detecting, measuring or quantitating either the RJMA or the protein gene product are conventional and routine. In the following description, reference will be made to various methodologies known to those of skill in the art of immunology, cell biology, and molecular biology. Publications and other materials setting forth such known methodologies to which reference is made are incorporated herein by reference in their entireties as though set forth in full. Standard reference works setting forth the general principles of immunology include A.K. Abbas et al, Cellular and Molecular Immunology (Fourth Ed.), W.B. Saunders Co., Philadelphia, 2000; CA. Janeway et al, Immunobiology. The Immune System in Health and Disease, Fourth ed., Garland Publishing Co., New York, 1999; Roitt, I. et al, Immunology, (cunent ed.) CN. Mosby Co., St. Louis, MO (1999); Klein, J., Immunology, Blackwell Scientific Publications, Inc., Cambridge, MA, (1990). Monoclonal antibodies (mAbs) and methods for their production and use are described in

Kohler and Milstein, Nature 256:495-491 (1975); U.S. Patent No. 4,376,110; Harlow, E. et al, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988); Monoclonal Antibodies and Hybridomas: A New Dimension in Biological Analyses, Plenum Press, New York, NY (1980); H. Zola et al, in Monoclonal Hybridoma Antibodies: Techniques and Applications, CRC Press, 1982)); (Kozbor et al, 1983, Immunol. Today 4:12 (the human B-cell hybridoma technique), and Cole, et al, 1985, h : Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, hie, pp. 77-96 (the EBV-hybridoma technique to produce human mAbs). Interspecies chimeric antibodies are described, for example, in Cabilly et al, U.S. Patents 4,816,567 (3/28/89) and 6,331,415 (12/18/01);; Morrison et al, US Patent 5,807,715 (9/15/98) and Eur. Patent Pub. EP173494 (3/5/86); Taniguchi et al, Eur. Patent Pub. EP171496 (2/19/86); Neuberger et al, PCT Pub. WO86/01533 (3/13/86); Robinson et al, PCT Pub. WO 8702671 (5/7/87); Cabilly et al, Proc. Natl Acad. Sci. USA 81:3213-3271 (1984); Morrison et al, Proc. Natl. Acad. Sci. USA 81:6851-6855 (1984); Boulianne et al, Nature 312:643-646 (1984); Morrison, Science, 229:1202-1201 (1985); Neuberger et al, Nature 314:268-210 (1985); Takeda et al, Nature 314:452-454 (1985); Oi et al, BioTechniques 4:214 (1986); Sun et al, Proc. Natl. Acad. Sci. USA <° :214-218 (1987); Liu et al, J. Immunol. 139:3521-3526 (1987); Better, M., et al, Science 240:1041-1043 (May 20, 1988); and Horwitz, A. H., et al, Proc. Natl. Acad. Sci. USA 85:8616-8682 (1988)). ' Single chain antibodies (scFv) are described, for example, in Skerra, A. et al. (1988) Science, 240: 1038-1041; Pluckthun, A. et al. (1989) Methods Enzymol 178: 497-515; Winter, G. et al. (1991) Nature, 349: 29β-299); Bird et al, (1988) Science 242:423; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879; Jost CR et al,. J Biol Chem. 1994 25P:26267-26273.U.S. Patents No. 4,704,692, 4,853,871, 4,946,778, 5,260,203, 5,455,030; and Jost CR et al. JBiol Chem. 1994 2(5 :26267-26273. Irnmunoassay methods are also described in Coligan, J.E. et al, eds., Current Protocols in Immunology, Sec. 2.4.1, Wiley-Interscience, New York, 1992 or current edition); Butt, W.R. (ed.) Practical Irnmunoassay: The State of the Art, Dekker, New York, 1984; Bizollon, Ch. A., ed., Monoclonal Antibodies and New Trends in Immunoassays, Elsevier, New York, 1984; Butler, J.E., ELISA (Chapter 29), In: van Oss, C.J. et al, (eds), IMMUNOCHEMISTRY, Marcel Dekker, Inc., New York, 1994, pp. 759-803; Butler, J.E. (ed.), Immunochemistry of Solid-Phase Irnmunoassay, CRC Press, Boca Raton, 1991; Weinfraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March,

1986; Work, T.S. et al, Laboratory Techniques and Biochemistry in Molecular Biology, North Holland Publishing Company, NY, (1978) (Chapter by Chard, T., "An Introduction to Radioimmune Assay and Related Techniques"). > In a preferred embodiment, the presence or amount of LSAMP and/or NOREl protein in a cell is detected by binding proteins in the sample to a detectably labeled antibody that is specific for an LSAMP or a NOREl protein. An antibody "specific" for a polypeptide means that the antibody recognizes a defined sequence of amino acids, or epitope, either present in the full length polypeptide, or in a peptide fragment thereof. Any of a variety of antibodies can be used in such methods. Such antibodies include, polyclonal, monoclonal (mAbs), recombinant, humanized or partially humanized, single chain (scFv), Fab, and fragments thereof. The antibodies can be of any isotype, such as IgM, various IgG isotypes such as IgGf IgG _a, etc., and they can be from any animal species that produces antibodies, including goat, rabbit, mouse, chicken or the like. Antibodies are prepared according to conventional methods, which are well known. See, references cited above. Methods of preparing humanized or partially humanized antibodies, and antibody fragments, and methods of purifying antibodies, are conventional (supra). For preparation of mAbs, any technique that provides mAbs produced by cell lines in continuous culture can be used (supra). Techniques described for the production of single chain antibodies (supra) can be adapted to produce scFv antibodies to polypeptide products of this invention. Transgenic animals may be used to express partially or fully humanized antibodies to immunogenic polypeptide products of this invention. Other specific binding partners, such as, e.g., aptamers and peptide nucleic aces (PNA), may be used in place of antibodies. The sample to be assayed in a method of the invention may be any suitable cell or tissue, or extract thereof. A sample of a body fluid such as plasma, serum, urine, saliva, cerebrospinal fluid, etc., may be obtained from the subject being screened. Alternatively, cells expressing the protein on their surface, e.g., suitable neuronal cells for the detection of LSAMP protein, may be obtained by simple, conventional means. If the protein is a receptor or other cell surface structure, it can be detected and quantified by well-known methods such as flow cytometry, immunofluorescence, immunocytochemistry or immunohistochemistry, or the like (see supra). In a preferred embodiment, the detection or diagnosis is performed on a sample from a kidney tumor, e.g., a tissue biopsy, a fresh-frozen sample, or a paraffin-embedded tissue section. Methods of preparing all of these sample types are conventional and well known in the art. Biopsy material and fresh-frozen samples can be extracted by conventional procedures to obtain proteins or polypeptides. In one embodiment, paraffin-embedded blocks are sectioned and analyzed directly without such extraction. Another embodiment of the invention is a method for inhibiting the growth, transformation or other cancer-associated property of a tumor cell, preferably a CC-RCC cell, which is characterized by reduced expression of the LSAMP and/or NOREl genes compared to a normal kidney cell or a baseline value. The method comprises contacting the cell with an effective amount of an agent which stimulates the expression of the LSAMP and/or NOREl polypeptide. By an "effective amount" is meant an amount that leads to a measurable reduction of such expression measured at the RNA or protein level.. Methods of contacting a cell are conventional and include injection or other forms of administration and my be done using liposomes, electroporation, microinjection or the like. The cell may be contacted in vitro or in vivo. Another embodiment is a method for treating a subject suffering from cancer or a tumor, such as CC-RCC, in which at least some of the cells of the subject under-express the LSAMP and/or the NOREl gene compared to a baseline value. The method comprises

(1) administering to the subject an effective amount of LSAMP and/or NOREl polypeptide or active fragment or variant thereof, or a nucleic acid encoding the polypeptide or active fragment or variant thereof which fragment or variant have the desired biological level of the LSAMP or NOREl polypeptide; or

(2) administering an agent which stimulates, promotes or otherwise results in increased expression LSAMP or NOREl polypeptide. Methods of administering the polypeptide are conventional and include, e.g., systemic administration or, preferentially, direct intratumoral administration. The subject may be any suitable animal, preferably a mammal, more preferably a human. h the above nucleic acid embodiments, the polynucleotide being administered comprises sequences which encode the polypeptide (or variant or fragment), and which are operably linked to an expression control sequence such as a promoter. This polynucleotide may be cloned in a suitable vector, many examples of which are well known to those of skill in the art. As used herein, the term "expression control sequence" means a polynucleotide sequence that regulates expression of a polypeptide encoded by a polynucleotide to which the control sequence is functionally ("operably") linked. Expression can be regulated at the level of the mR A or polypeptide synthesis or stability. Thus, the "term expression control sequence" includes mRNA-related elements and protein-related elements, which include promoters, domains within promoters, upstream elements, enhancers, elements that confer tissue or cell specificity, response elements, ribosome binding sequences, transcnptional terminators, etc. An expression control sequence is operably linked to a nucleotide sequence (e.g., a coding sequence) when the expression control sequence is positioned in such a manner to effect or achieve expression of the coding sequence. For example, when a promoter is operably linked 5' to a coding sequence, expression of the coding sequence is driven by the promoter. Suitable expression control sequences will be evident to the skilled worker. Methods for generating polynucleotides and polypeptides for use in the methods, compositions and kits of the invention, are conventional. For example, polynucleotides can be isolated, e.g., using sequence probes conesponding to the sequences indicated in the GenBarik accession numbers provided elsewhere herein. The polynucleotides can be cloned into suitable vectors, and introduced into and replicated and/or expressed in suitable host cells. Procedures for carrying out these steps are conventional. Nucleic acids that have replicated in the cells, and polypeptides expressed in the cells, can be harvested and, if desired, purified, using conventional procedures. Some suitable molecular biology methods, for use in these and other aspects of the invention, are provided e.g., in Sambrook, et al. (1989), Molecular Cloning, a Laboratory Manual, Cold Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Ausubel et al. (1995). Current Protocols in Molecular Biology, N.Y., John Wiley & Sons; Davis et al. (1986), Basic Methods in Molecular Biology, Elsevier Sciences Publishing,, Inc., New York; Hames et al. (1985), Nucleic Acid Hybridization, IL Press; Dracopoli et al. Current Protocols in Human Genetics, John Wiley & Sons, Inc.; and Coligan et al. Current Protocols in Protein Science, John Wiley & Sons, Inc. Methods for providing a polynucleotide to a cell in vitro, i.e., contacting the cell, are conventional and include, transfection, a gene gun, microinjection, electroporation, introduction by liposomes or with viral or non- iral vectors, etc. For gene gun-mediated DNA injection, DNA-coated gold particles (e.g., about 1 μg DNA/bullet) are delivered using a helium-driven gene gun (BioRad, Hercules, CA) with a discharge pressure of, for example, about 400 p.s.i. The Biojector 2000 (Bioject Inc., Portland, OR) is a needle-free jet injection device consisting of an injector and a disposable syringe. The orifice size controls the depth of penetration. For example, DNA (at between about 1 and 100 μg) may be delivered using the Biojector with a syringe nozzle. This may be done intradennally, intramuscularly or intratumorally. Follow-up injections using both methods can be repeated as needed, e.g., at weekly intervals. Methods of gene therapy or nucleic acid therapy, in which a polynucleotide of the invention is provided in a delivery vehicle, are well-known. The gene vehicle may be of viral or non-viral origin (see generally, Jolly, Cancer Gene Therapy 1:51-64 (1994) Kimura, Human Gene Therapy 5:845-852 (1994); Connelly, Human Gene Therapy 1:185-193 (1995); and

Kaplitt, Nature Genetics 6: 148-153 (1994). Vehicles for delivery of nucleic acid constructs including a coding sequence of a therapeutic embodiment of the invention can be administered either locally or systemically. These constructs can utilize viral or non- viral vector approaches. Expression of the coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence can be either constitutive or , regulated. Recombinant retroviruses constructed to cany or express a selected nucleic acid molecule of interest may be used. See, for example, EP 0415731; WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Patent No. 5,219,740; WO 93/11230; WO 93/10218; Vile et al, , Cane Res 53:3860-3864 (1993); Vile et al, Cane. Res. 53:962-967

(1993); Ram et al, Cane. Res. 53:83-88 (1993); Takamiya et al, J. Neurosci. Res. 33:493-503 (1992); Baba et al, J. Neurosurg. 79:729-735 (1993); U.S. Patent No. 4,777,127; GB Patent No. 2,200,651; and EP 0345242. Prefened recombinant retroviruses include those described in WO 91/02805. Packaging cell lines suitable for use with the above-described retro viral vector constructs may be readily prepared (WO 95/30763 and WO 92/05266), and used to create producer cell lines (also termed vector cell lines) for the production of recombinant vector particles. Preferred embodiments of the invention utilize packaging cell lines made from human (such as HT1080 cells) or from mink parent cell lines, that result in production of recombinant retroviruses that survive inactivation in human serum. Alphavirus-based vectors can function as gene delivery vehicles and be constructed from a wide variety of alphavirases, including, for example, Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250 ATCC VR-1249; ATCC VR-532). Representative examples of such vector systems are described in U.S. Patents No. 5,091,309; 5,217,879; and 5,185,440; jmd PCT Publications WO 92/10578; WO 94/21792; WO 95/27069; WO 95/27044; and WO 95/07994. Delivery vehicles of the present invention can also employ parvo virus such as adeno- associated virus (AAV) vectors. See, for example, Srivastava, WO 93/09239, Samulski et al, J. Vir. 63:3822-3828 (1989); Mendelson et α/., Virol. 166:154-165 (1988); and Flotte et α/., P.N.A.S. 90:10613-10617 (1993). Representative examples of adenoviral vectors are described by Berkner, Biotechniques

6:616-621; Rosenfeld et al, Science 252:431-434 (1991); WO 93/19191; Kolls et al, Proc. Natl. AcadSci. USA. 97:215-219 (1994); Kass-Eisler et al, Proc. Natl. Acad Sci. USA 90:11498- 11502 (1993); Guzman et al, Circulation 88:2838-2848 (1993); Guzman et al, Cir. Res. 73:1202-1207 (1993); Zabner et al, Cell 75:207-216 (1993); Li et al, Hum. Gene T er. 4:403- 409 (1993); Cailaud et al, Eur. J. Neurosci. 5: 1287-1291 (1993); Vincent et al, Nat. Genet.

5:130-134 (1993); Jaffe et al, Nat. Genet. 1:372-378 (1992); and Levrero et al, Gene 101:195- 202 (1992). Exemplary adenoviral nucleic acid therapy vectors useful herein are described in WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655. Administration of DNA linked to killed adenovirus is described in Curiel, Hum. Gene Ther. 3:147-154 (1992). Other delivery vehicles and methods may be employed, including polycationic condensed DNA linked or unlinked to killed adenovirus alone, for example, Curiel (supra); ligand-linked DNA, for example, see Wu, J. Biol. Chem. 264:16985-16987 (1989); eukaryotic cell delivery vehicles (U.S.S.N. 08/240,030, filed May 9, 1994, and 08/404,796); deposition of photopolymerized hydrogel materials; hand-held gene transfer particle gun (U.S. Patent

5,149,655); ionizing radiation (U.S. Patent No. 5,206,152 and WO 92/11033; nucleic acid charge neutralization or fusion with cell membranes. Additional approaches are described in Philip, Mol. Cell Biol. 14:2411-2418 (1994) and Woffendin, Proc. Natl. Acad. Sci. USA 91:1581-1585 (1994) (a mechanical delivery system). Naked DNA may also be employed. See, for example, WO 90/11092 and U.S. Patent 5,580,859. Uptake efficiency may be improved using biodegradable latex beads. DNA coated latex beads are efficiently transported into cells after endocytosis initiation by beads. The method may be improved further by treatment of the beads to increase hydrophobicity and thereby facilitate disruption of the endosome and release of the DNA into thr cytoplasm. Use of liposomes as DNA delivery vehicles are described in U.S. Patent 5,422,120, PCT Patent Pub. WO 95/13796, WO 94/23697 and WO 91/14445, and EP 0 524 968. Effective dosages and routes of administration of polypeptides or polynucleotides of the invention are conventional. The exact amount (effective dose) of the agent will vary from subject to subject, depending on the species, age, weight and general or clinical condition of the subject, the severity or mechanism of any disorder being treated, the particular agent or vehicle used, the method and scheduling of administration, and the like. A therapeutically effective dose can be determined empirically, by conventional procedures known to those of skill in the art. See, e.g., Tlie Pharmacological Basis of Therapeutics, Goodman and Gilman, eds., Macmillan Publishing Co., New York. For example, an effective dose can be 'estimated initially either in cell culture assays or in suitable animal models. The animal model may also be used to determine the appropriate concentration ranges and routes of administration. Such information can then be used to determine useful doses and routes for administration in humans. A therapeutic dose can also be selected by analogy to dosages for comparable therapeutic agents. In general, effective doses include between about 10 ng to about 100 mg up to a total dose of about 5g, depending on the route of administration, number of repeat administrations and other factors as noted above. A variety of routes of administration may be used, including oral, respiratory, intranasal, intrarectal, intravaginal, sublingual, transdermal, extracorporeal, topical, intravenous, subcutaneous, intramuscular, intramedullary, or intraperitoneal injection, other parenteral routes, or the like. One of skill in the art will recognize particular cells, tissues or organs into which therapeutic agents of the invention can be administered, as appropriate for particular indications. Another embodiment of the invention is a pharmaceutical composition comprising (a) an LSAMP and/or NOREl polypeptide, or an active fragment or variant thereof, or (b) a polynucleotide encoding an LSAMP and/or NOREl polypeptide, or encoding an active fragment or variant of the polypeptide, wherein the polynucleotide is operably linked to an expression control sequence; and a pharmaceutically acceptable carrier. Another embodiment of the invention is a kit, suitable for carrying out any method of the invention. For example, the invention includes a kit for detecting the presence and/or amount of an LSAMP and/or a NOREl polypeptide in a tumor or pre-cancerous sample, such as CC-RCC or normal kidney cells susceptible of transformation to become CC-RCC, wherein the cells are characterized by a reduced amount compared to a baseline value of one or both of these polypeptides. The kit comprises one or more reagents for detecting the polypeptide, preferably an antibody specific for the polypeptide, which is preferably detectably labeled, and, optionally, one or more reagents for testing the binding of the antibody to a sample polypeptide and/or that one that facilitates detection of antibody binding. Another embodiment is a kit for detecting the presence and/or amount of a polynucleotide encoding LSAMP and/or NOREl polypeptide in a tumor or pre-cancerous sample, such as a CC-RCC tumor cells or normal kidney cells susceptible of transformation to become CC-RCC. Such cells are characterized by under-expression of LSAMP and/or NOREl compared to a baseline value which is indicative that the cells are susceptible of development into cancer cells, primarily CC-RCC cells. The kit comprises a nucleic acid probe specific for a LSAMP- or NOREl -encoding polynucleotide, and, optionally, one or more reagents that facilitate hybridization of the probe to the sample polynucleotide, and/or that facilitate detection of the hybridized polynucleotide.

Another embodiment is a kit useful for inhibiting or reducing a cancer-associated property of a cell, comprising an LSAMP and/or NOREl polypeptide, or an active fragment or variant thereof, and, optionally, means for introducing the polypeptide into the cell and/or for measuring the cancer-associated property. In another embodiment, the kit is suitable for treating a subject suffering from a cancer such as CC-RCC, the kit comprising an LSAMP and/or NOREl polypeptide, or an active fragment or variant thereof, and, optionally, means for admii istering the polypeptide to the subject. In other embodiments, the kit comprises, instead of the polypeptides, a nucleic acid encoding LSAMP and/or NOREl, or encoding active fragments or variants of the polypeptides, wherein the polynucleotides are operably linked to expression control sequences. Optionally, kits of the invention comprise instructions for performing the method for which the kit is intended and/or for analyzing and/or evaluating the assay results as generated by the method. A kit may further compose a support on which a cell can be propagated (e.g., a tissue culture vessel) or a support to which a reagent used in the method is immobilized. Other optional elements of the present kit include suitable buffers, media components, or the like; reagents for performing suitable controls; a computer or computer-readable medium for storing and/or evaluating the assay results; containers; or packaging materials. The reagents of the kit may be in containers in which the reagents are stable, e.g., in lyophilized form or stabilized liquids. The reagents may also be in single use form, e.g., in single dosage form for use as therapeutics, or in single reaction form for diagnostic use. Another embodiment of the invention is an antibody specific for an epitope of the LSAMP or he NOREl polypeptide. Such antibodies are useful, not only for diagnostic procedures, as discussed above, but also for experimental purposes, e.g., for elucidating the mechanisms of CC-RCC carcinogenesis. Some of the types of suitable antibodies, and methods for using them, were discussed above. EXAMPLES EXAMPLE I Mapping of Breakpoints The inventors have previously mapped the constitutional t(l;3)-associated breakpoints to bands lq32.1 and 3ql3.3 in a family with four cases of CC-RCC (Kanayama et al, 2001). In this study, the inventors cloned the breakpoints of t(l;3)(q32.1;ql3.3) by using a strategy that combined FISH, Southern blot, long-range PCR, and DNA sequencing. FISH experiments allowed narrowing of the breakpoint regions to a 20- to 30-kb range on both affected chromosomes (Figure 1 A). These were further refined via Southern blot analyses and restriction mapping to approximately 2 kb (Figure IB and IC). Assisted by information from human genome sequence databases and BAC clone databases, several sets of specific primers were designed around the breakpoints and long-range PCR was performed to amplify the breakpoint f agments (Figure 2A). A 2.15 kb der(l)-breakpoint and a 3.25 kb der(3)-breakpoint were amplified and subcloned into TA-cloning vector (Invitrogen, USA) (Figure 2A). Subsequent DNA sequencing of the breakpoint fragments resulted in the identification of both breakpoints (Figure 2; also see Table 1). Table 1. Sequences and positions of the synthetic ohgonucleotides used in the study. SEQ ID Target Direction Sequence (5^'-3 ) NO: For genόmic PCR of the fusion genes 1

NORE1-LSAMP Forward GGAGAAAGAGAGACCAGGACAAA (NOREl) 2 NORE1-LSAMP Reverse GCTTCCCAGGTTCAAGTGATTC (LSAMP) Sequencing 3

NORE1-LSAMP Forward AGCGATCATCCTGCCTTG (NOREl) Sequencing 4

NORE1-LSAMP Forward CATGCCAGGCCCATAAATAG (NOREl) Sequencing 5

NORE1-LSAMP Forward GTGGCCTGCAAAACCTAAC (NOREl) 6

LSAMP-NORE1A Forward AATCCAGGTCTCTCTGCTCCAA (LSAMP) 7

LSAMP-NORE1A Reverse CTCTGAGTGAGTCACGTGGCTT (NOREl) 8

LSAMP-NORE1A Forward CCTTCCTTTTCTCCATAGCACT (LSAMP) 9

LSAMP-NORE1A Forward ATTGTGGAAAATGGAGCTTC (LSAMP) For fusion transcript analyses 10

NORE1A-LSAMP Forward AGTCAGCAGGAGGGTTTATCC (NORElA) 11 NORE1A-LSAMP Reverse CCCTTCCAGTTGGTGTAAGGT (LSAMP) 12 LSAMP-NORE1A Forward TTCTCTGGAATACAGCCTCCG (LSAMP) GCGTGTTGTAGCTGTCGATC (NORElA) 13 LSAMP-NORE1A Reverse 14 NORE1B-LSAMP Forward GCAGCATGAGCAGTGGGTAC (NORElB) TTTGCCTGACTGCTCCCTG (LSAMP) 15 NORE1B-LSAMP Reverse For mutation analyses 16

NOREIgene 17

NORE1A Exon 1 Forward TCCTTCCTGCCACTCCGACTC 18 NORE1A Exon 1 Reverse TCCCAAGAACTCACAACAAAACC Sequencing 19

NORE1A Exon 1 Forward TCCTTCCTGCCACTCCGACT Sequencing 20

NORE1A Exon 1 Reverse TCCTCGCGCCTCTGTGTCCC 21 NORE1A Exon 2 Forward , TCCAAGGTTATTTCTCTGGGTG 22 NORE1A Exon 2 Reverse GAGTTCTCTGTGTCACTTCCCC 23 NORE1A Exon 3 Forward CTGGATGCTCACTTCTTGGTTAG 24 NORE1A Exon 3 Reverse CAGAATTCAGAGTGAGGGCAG 25 NORE1A Exon 4 Forward AGAACTCAAGGAGACAGGTGGG SEQ ID Target Direction Sequence (5^'-3 ) NO: 26

NORE1A Exon 4 Reverse AGATCTGAACACCACATGGGC 27 NORE1A Exon 5 Forward CACCTCTGCATTTCCAATCCTT 28 NORE1A Exon 5 Reverse GTGGCTCCCACCTATGTGAG 29 NORE1A Exon 6 Forward CAGGGTCTCTCAGGTCGTGTCA 30 NORE1A Exon 6 Reverse CCCCCATGCAAACACTTGTC 31 NORE1B Exonl Forward CCCGCTGAAAGAAACGCAGG 32 NORE1B Exonl Reverse ATGCTCAGCCCTCAGGGCAA LSΛ/WPgene 33 LS/4MP Exonl Forward AGTGGAAAGGACCATAAACTGGC 34 LSAMP Exonl Reverse TGGAGTTCAAGGAGATCAGACAC 35 LSΛ/WP Exon2 Forward ATGACATCCATCCACTGGATG TGCAACTCCCACCTCTTTCTTA 36 LSΛMP Exon2 Reverse 37 LSAMP Exon3 Forward AGATGGCAAGCATGGGTCTTA 38 LSAMP Exon3 Reverse TCAGCAGAATTCCAGGAGCA 39 LSAMP Exon4 Forward CTGCTTCTGTGGAATCTGATGTC 40 LSAMP Exon4 Reverse CAAAGACCAAGTCCTGCCCTT 41 LSAMP Exonδ Forward CTCCCTTCCTGCCTCTCTCTAA 42 LSAMP Exonδ Reverse GCTTAAGAGCTACAGGCCCC 43 LSAMP Exonθ Forward TCCTTTTCCTCCAGTGTCAGG TGCTATGCACAGGAGTTGAGAA 44 LSAMP Exon6 Reverse 45 LSΛMP Exon7 Forward CTTCTTGGGCTGCACATAAGTG 46 LS/AMP Exon7 Reverse ACGGTCTCCCCCATCTCTCT VHL gene TGTAAAACGACGGCCAGTCGAAGAGTACGGCCCTGAAGA 47 VHL Exonl Forward AGAC CAGGAAACAGCTATGACCCAGTACCCTGGATGTGTCCTG 48 VHL Exonl Reverse CCTC TGTAAAACGACGGCCAGTAGACGAGGTTTCACCACGTTA 49 VHL Exon2 Forward GC CAGGAAACAGCTATGACCGTCCTCTATCCTGTACTTACC 50 VHL Exon2 Reverse AC TGTAAAACGACGGCCAGTCTGAGACCCTAGTCTGCCACT 51 VHL Exon3 Forward GAGGAT CAGGAAACAGCTATGACCCAAAAGCTGAGATGAAACAGT 52 VHL Exon3 Reverse GTAAGT SEQ ID Target Direction Sequence (5^'-3 ) NO: Forgenomic PCR of the fusion genes 53

NORE1-LSAMP Forward GGAGAAAGAGAGACCAGGACAAA (NOREl) 54 NORE1-LSAMP Reverse GCTTCCCAGGTTCAAGTGATTC (LSAMP) Sequencing 55

NORE1-LSAMP Forward AGCGATCATCCTGCCTTG (NOREl) Sequencing 56

NORE1-LSAMP Forward CATGCCAGGCCCATAAATAG (NOREl) Sequencing 57

NORE1-LSAMP Forward GTGGCCTGCAAAACCTAAC (NOREl) 58

LSAMP-NORE1A Forward AATCCAGGTCTCTCTGCTCCAA (LSAMP) 59

LSAMP-NORE1A Reverse CTCTGAGTGAGTCACGTGGCTT (NOREl) 60

LSAMP-NORE1A Forward CCTTCCTTTTCTCCATAGCACT (LSAMP) 61

LSAMP-NORE1A Forward ATTGTGGAAAATGGAGCTTC (LSAMP) For fusion transcript analyses 62

NORE1A-LSAMP Forward AGTCAGCAGGAGGGTTTATCC (NORElA) 63 NORE1A-LSAMP Reverse CCCTTCCAGTTGGTGTAAGGT (LSAMP) 64 LSAMP-NORE1A Forward TTCTCTGGAATACAGCCTCCG (LSAMP) GCGTGTTGTAGCTGTCGATC (NORElA) 65 LSAMP-NORE1A Reverse 66 NORE -LSAMP Forward GCAGCATGAGCAGTGGGTAC (NORElB) TTTGCCTGACTGCTCCCTG (LSAMP) 67 NORE1B-LSAMP Reverse For mutation analyses

NOREIgene 69

NORE1A Exon 1 Forward TCCTTCCTGCCACTCCGACTC 71 NORE1A Exon 1 Reverse TCCCAAGAACTCACAACAAAACC Sequencing 72

NORE1A Exon 1 Forward TCCTTCCTGCCACTCCGACT Sequencing 73

NORE1A Exon 1 Reverse TCCTCGCGCCTCTGTGTCCC 74 NORE1A Exon 2 Forward TCCAAGGTTATTTCTCTGGGTG 75 NORE1A Exon 2 Reverse GAGTTCTCTGTGTCACTTCCCC 76 NORE1A Exon 3 Forward CTGGATGCTCACTTCTTGGTTAG 77 NORE1A Exon 3 Reverse CAGAATTCAGAGTGAGGGCAG 78 NORE1A Exon 4 Forward AGAACTCAAGGAGACAGGTGGG 79 NORE1A Exon 4 Reverse AGATCTGAACACCACATGGGC SEQ ID Target Direction Sequence (5^'-3 ) NO: 80

NORE1A Exon 5 Forward CACCTCTGCATTTCCAATCCTT 81 NORE1A Exon δ Reverse GTGGCTCCCACCTATGTGAG 82 NORE1A Exon 6 Forward CAGGGTCTCTCAGGTCGTGTCA 83 NORE1A Exon 6 Reverse CCCCCATGCAAACACTTGTC 84 NORE1B Exonl Forward CCCGCTGAAAGAAACGCAGG 85 NORE1B Exonl Reverse ATGCTCAGCCCTCAGGGCAA LSAMPgene 86 LSAMP Exonl Forward AGTGGAAAGGACCATAAACTGGC 87 LSAMP Exonl Reverse TGGAGTTCAAGGAGATCAGACAC 88 LSAMP Exon2 Forward ATGACATCCATCCACTGGATG TGCAACTCCCACCTCTTTCTTA 89 LSAMP Exon2 Reverse 90 LSΛMP Exon3 Forward AGATGGCAAGCATGGGTCTTA 91 LSAMP Exon3 Reverse TCAGCAGAATTCCAGGAGCA 92 LSAMP Exon4 Forward CTGCTTCTGTGGAATCTGATGTC 93 LSAMP Exon4 Reverse CAAAGACCAAGTCCTGCCCTT 94 LSAMP Exonδ Forward CTCCCTTCCTGCCTCTCTCTAA 95 LSAMP Exonδ Reverse GCTTAAGAGCTACAGGCCCC 96 LSAMP Exon6 Forward TCCTTTTCCTCCAGTGTCAGG TGCTATGCACAGGAGTTGAGAA 97 LSAMP Exonδ Reverse 98 LSAMP Exon7 Forward CTTCTTGGGCTGCACATAAGTG 99 LSAMP Exon7 Reverse ACGGTCTCCCCCATCTCTCT VHL gene TGTAAAACGACGGCCAGTCGAAGAGTACGGCCCTGAAGA 100 VHL Exonl Forward AGAC CAGGAAACAGCTATGACCCAGTACCCTGGATGTGTCCTG 101 VΗL Exonl Reverse CCTC TGTAAAACGACGGCCAGTAGACGAGGTTTCACCACGTTA 102 VHL Exon2 Forward GC CAGGAAACAGCTATGACCGTCCTCTATCCTGTACTTACC 103 VΗL Exon2 Reverse AC TGTAAAACGACGGCCAGTCTGAGACCCTAGTCTGCCACT 104 VΗL Exon3 Forward GAGGAT CAGGAAACAGCTATGACCCAAAAGCTGAGATGAAACAGT 105 VHL Exon3 Reverse GTAAGT The cloning of the breakpoints led to the identification of two breakpoint-spanning genes, NOREl on lq32.1 and LSAMP on 3ql3.3 (Figure 2B). To investigate whether fusion proteins resulting from the chromosome translocation are involved in tumorigenesis of CC- RCC, Northern blot analysis and RT-PCR were carried out to detect any fusion transcript of NOREl and LSAMP (see Table A in supplemental data). No detectable fusion transcripts were found in the FRCC3 and FRCC5 cell lines from two patients in the t(l ;3) family. The possible sequence combination from NOREl and LSAMP were also tested. Since NOREl lies in the positive DNA strand and LSAMP in the reverse strand, there is little likelihood for them to form say NOREl -LSAMP or LSAMP-NORE1 fusion proteins. Given the association between chromosome 3 translocations and CC-RCC susceptibility

(van Kessel et al, 1999; Bodmer et al, 2002c), the gene LSAMP was investigated. LSAMP is composed of seven exons and is disrupted in intron 2ι by the breakpoint (Figure 2B). To elucidate whether genetic changes in LSAMP play a role in CC-RCC, LSAMP mutation analysis was performed in 9 CC-RCC cell lines and in 53 sporadic and 4 familial tumors. No LSAMP mutation was detected. However, epigenetic silencing in association with hypermethylation, the most common form of inactivation for many tumor suppressor genes (Jones et al, 2002), could still occur. First, RT-PCR analysis showed that LSAMP was down-regulated in all nine RCC cell lines (Figure 3 A). Furthermore, the LSAMP promoter was methylated in 7/9 CC-RCC cell lines (78%), 14/53 sporadic CC-RCCs (26%), and all 4 familial CC-RCCs tumors from the t(l;3) family (Figure 3B). In association with the promoter-methylation status, LSAMP expression in ten examined tumors with LSAMP-pxomoteτ methylation was also down-regulated (Figure 3A). Of the Z&4 P-promoter-methylated cell lines and tumors, all presented complete methylation except two cell lines and one sporadic tumor. Furthermore, in the four familial tumors (FT1 to FT4), one LSAMP allele was breakpoint-disrupted followed by the loss of the der(3) chromosome shown in our previous study (Kanayama et al, 2001), and the other copy was hypermethylated (Figure 3B), implying LSAMP may undergo bi-allelic inactivation. These observations suggest that LSAMP is involved in CC-RCC, though further functional studies are needed to elucidate its mechanism. The lq32.1 breakpoint-disrupted gene, NOREl, also appeared to be an excellent candidate CC-RCC suppressor gene. NOREl undergoes alternative splicing, resulting in two isoforms, NOREIA and NORE1B. The breakpoint disrupted both NOREIA and NOREl B (Figure 2B). NOREl is homologous to a family of RAS binding proteins, including RASSF1, rat Maxpl, and murine Norel (Vawas et al, 1998; Dammann et al, 2000; Vos et al, 2000; Ortiz- Vega et al, 2002; Tommasi et al, 2002) that have been proposed to be effectors for the small GTPase. Maxpl, Norel and RASSF1 have been shown to induce apoptosis (Vos et al, 2000; Khokhlatchev et al, 2002). Other studies, however, have shown that Norel family members are cytostatic and modulate cyclinDl levels, thereby influencing the activity of cell cycle-dependent kinases (Khokhlatchev et al, 2002). RASSF1 maps to 3p21, a region of frequent LOH in CC-RCC (van den Berg et al, 1997; Dammann et al, 2000), and this gene has recently been shown to be epigenetically inactivated in kidney cancer (Dreijerink et al, 2001; Morrissey et al, 2001; Yoon et al, 2001). Thus, the inventors proceeded to investigate NOREl as a candidate RCC suppressor. Mutation screening and methylation analysis were performed on NOREl in all the RCC cell lines and tumors. Two alterations, GTG(Vall89)>ATG(Metl89) and CGG(Arg248)>CAG(GTn248), were identified (see Figure 6). The former was present in 5% of the 100 tested normal subjects, whereas the latter was not found in any of them. As both were also present in the matched normal kidney tissues, it is likely that they represent polymorphisms. The inventors then perceived that NOREIA expression was also down-regulated in the 9 RCC cell lines, and the NOREIA promoter was methylated in 6/9 RCC cell lines and 17/53 (32%) sporadic RCC tumors (Figure 3 A and 3C), whereas methylation in the NOREl B promoter was detected only in RCC cell lines A-498 and A-704. NOREIA expression in examined 10 of the 17 affected tumors was also down-regulated (Figure 3A). Two normal kidney control samples (N3 and N44) also showed NOREIA promoter methylation at lower extents compared with their matched tumors (3T and 44T), probably due to contamination from the tumor tissues. Interestingly, NOREIA -promoter methylation does not overlap with J&fMP-promoter methylation except in four tumors. These results suggest that NOREIA is also associated with sporadic CC-RCC. Yet, unlike the methylation situation in LSAMP, only 1/4 hereditary tumors showed even slight NOREIA promoter methylation, indicating one wild-type allele of NOREl A still exists in these hereditary tumors. Whether NOREIA undergoes haploinsufficiency in tumorigenesis remains undetermined. In addition, 7/14 tumors (50%) with J&i P-promoter methylation showed loss of heterozygosity (LOH) of the LSAMP locus. However, LOH was also observed in 17/39 tumors (44%) without J&4MP-promoter methylation. Similar LOH results were obtained on NOREIA (methylated, 5/17 [29%]; unmethylated, 8/36, [22%]), indicating that the LOH maybe correlated with CC-RCC tumorigenesis, but is not methylation-dependent. Promoter methylation in both LSAMP and NOREIA may also be linked to other types of cancers. NOREIA -promoter methylation has recently been detected in cancer cell lines and in 24% NSCLC (Hesson et al, 2003). Here the inventors found that the LSAMP promoter was methylated in 5/19 (26%) colorectal cancers. The exact role of these genes in tumorigenesis is unclear. Without wishing to be bound to any particular mechanism, potential roles for these genes are discussed below. In the familial cases, the underlying mechanism appears to be the three-step model of chromosome 3 translocation-related hereditary CC-RCC tumorigenesis (Bodmer et al, 1998; Kanayama et al, 2001; Bodmer et al, 2002c). Considering the complexity of the multistep process in , tumorigenesis, the possibility exists that the breakpoint-disrupted genes, especially LSAMP, may contribute to the occmrence of familial tumors by acting as components in the three-step model of tumorigenesis of hereditary CC-RCC. The inventors have previously demonstrated that four examined familial CC-RCC tumors lost the der(3) chromosome and two of them cany VHL mutations, supporting the three-step model of tumorigenesis (Kanayama et al, 2001). Here, the inventors supplement this model with our LSAMP and NOREIA data. The constitutional translocation t(lq;3q) and disruption of a copy each of LSAMP and NOREl, as the first set of steps of tumorigenesis, act as the predisposing factors in development of CC-RCC. The translocation also results in the increased susceptibility to somatic loss of the chromosome der(3). The following non-disjunctional loss of der(3) deletes a copy each of the RCC-related genes in chromosome 3 (e.g., VHL, RASSF1A), which further increases the predisposition to CC-RCC. This second set of steps will accelerate the transformation process and cellular growth, leading to the third set of steps involving either the inactivation of the other VHL allele (e.g. somatic mutation) or the genetic/epigenetic alternations in other CC-RCC-related genes including LSAMP in the remaining copy of chromosome 3. These factors may act synergistically and finally lead to the occmrence of CC-RCC. Epigenetic inactivation of these genes can be reversed by demethylation treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine (5-aza-CdR). The demethylation treatment resulted in significantly increased expression of LSAMP and NOREl in eight cell lines (Figure 3 A), indicating that repression is at least in part mediated by methylation. Finally, to further evaluate the role of LSAMP and NOREl as tumor suppressor candidates in cancer, enhanced green fluorescent protein EGFP-LSAMP, -NOREIA, and -Norel expression plasmids were microinjected or transfected into two RCC cell lines, A-498 and/or Caki-1, in which the LSAMP and NOREIA promoters were methylated, cells were then counted at indicated times, and were monitored for cell number and/or proliferation. Alternatively, cells were monitored by epi-fluorescence/phase-contrast microscopy to evaluate proliferation, fluorescent protein expression, or apoptosis. While cells expressing EGFP continued to proliferate at rates similar to those of uninjected neighbors, cells expressing EGFP-LSAMP, - NOREIA and -Norel failed to divide (Figure 4B). There was no evidence of apoptosis in any of the experiments. This growth inhibition role was also demonstrated in 293-T cells stably transformed with an inducible Norel gene by lipid-mediated transfection (see Figure 7C). The inventors also observed that EGFP-LSAMP seemed to be cytoplasmic, and EGFP- NORE1 A appeared in both cytosol and nucleus. EGFP -Norel was predominantly nuclear and tended to occupy discrete puncta within the nucleus (Figure 4A). This was observed in both formaldehyde-fixed and living cells; thus, the localization was unlikely to be due to a fixation artifact. Furthermore, the nuclear localization of EGFP-Norel was also confirmed in the transfected Caki-1 RCC cell line and in the 293-T cells by nuclear fractionation (see Figures 7Aa and 7B). These observations are consistent with a growth suppression role for LSAMP, NOREIA, and NOREl . Also, despite the presence of a putative Ras-association region, the results suggest that this nuclear Norel protein may not be a bonafide Ras effector, whose family members tend to be lipid-modified, membrane-bound, positive regulators of cell proliferation. Further investigation into its role in growth regulation (potentially through the regulation of cyclin DI and Gl/S progression) and its role in the nucleus are desirable. Based on these data, LSAMP, and NOREIA (a homolog of 3p21-tumor suppressor

RASSF1A), represent new tumor suppressor candidates, and presumably act as components in the multistep process of CC-RCC tumorigenesis. Inactivation or reduced expression of both LSAMP and NOREIA also appears to be involved in the occmrence of other types of tumors. Further studies of these genes may lead to the elucidation of novel mechanisms of tumorigenesis. GenBank accession numbers and Sequences of NOREIA, LSAMP, etc. NOREIA: GenBank Accession No. NM_031437

Nucleic Acid: SEQ ID NO: 120 (coding: 64-1236); Amino acid: SEQ LD NO: 121, 1 cgggagtagc gcagtcgcca aagccgccgc tgccaaagct gccgccacta gccgggcatg 61 gccatggcgt ccccggccat cgggcagcgc ccgtacccgc tactcttgga ccccgagccg 121 ccgcgctatc tacagagcct gagcggcccc gagctaccgc cgccgccccc cgaccggtcc 181 tcgcgcctct gtgtcccggc gcccctctcc actgcgcccg gggcgcgcga ggggcgcagc 241 gcccggaggg ctgcccgggg gaacctggag cccccgcccc gggcctcccg acccgctcgc 301 ccgctccggc ctggtctgca gcagagactg cggcggcggc ctggagcgcc ccgaccccgc 361 gacgtgcgga gcatcttcga gcagccgcag gatcccagag tcccggcgga gcgaggcgag 421 gggcactgct tcgccgagtt ggtgctgccg ggcggccccg gctggtgtga cctgtgcgga 481 cgagaggtgc tgcggcaggc gctgcgctgc actaactgta aattcacctg tcacccagaa 541 tgccgcagcc tgatccagtt ggactgcagt cagcaggagg gtttatcccg ggacagaccc 601 tctccagaaa gcaccctcac cgtgaccttc agccagaatg tctgtaaacc tgtggaggag 661 acacagcgcc cgcccacact gcaggagatc aagcagaaga tcgacagcta caacacgcga 721 gagaagaact gcctgggcat gaaactgagt gaagacggca cctacacggg tttcatcaaa 781 gtgcatctga aactccggcg gcctgtgacg gtgcctgctg ggatccggcc ccagtccatc 841 tatgatgcca tcaaggaggt gaacctggcg gctaccacgg acaagcggac atccttctac 901 ctgcccctag atgccatcaa gcagctgcac atcagcagca ccaccaccgt cagtgaggtc 961 atccaggggc tgctcaagaa gttcatggtt gtggacaatc cccagaagtt tgcacttttt

1021 aagcggatac acaaggacgg acaagtgctc ttccagaaac tctccattgc tgaccgcccc

1081 ctctacctgc gcctgcttgc tgggcctgac acggaggtcc tcagctttgt gctaaaggag

1141 aatgaaactg gagaggtaga gtgggatgcc ttctccatcc ctgaacttca gaacttcctc

1201 tcctcctggt gcattcagat ttatttgtat tattaattat tattttgcaa cagacacttt

1261 ttctcaggac atctctggca ggtgcatttg tgcctgccca gcagttccag ctgtggcaaa

1321 agtctcttcc atggacaagt gtttgcacga gggttcagct gtgcccgccc ccaggctgtg

1381 ccccaccaca gattctgcca aggatcagaa ctcatgtgaa acaaacagct gacgtcctct

1441 ctcgatctgc aagcctttca ccaaccaaat agttgcctct ctcgtcacca aactggaacc

1501 tcacaccagc cggcaaagga aggaagaaag gttttagagc tgtgtgttct ttctctggca

1561 ttgattcctc tttgagttct cttacttgcc acgtacagga ccattattta tgagtgaaaa

1621 gttgtagcac attccttttg caggtctgag ctaagcccct gaaagcaggg taatgctcat

1681 aaaaggactg ttcccgcggc cccaaggtgc ctgttgttca cacttaaggg aagtttataa

1741 agctactggc cccagatgct cagggtaagg agcaccaaag ctgaggctgg ctcagagatc

1801 tccagagaag ctgcagcctg ccctggccct ggctctggcc ctggcccaca ttgcacatgg

1861 aaacccaaag gcatatatct gcgtatgtgt ggtacttagt cacatctttg tcaacaaact

1921 gttcgttttt aagttacaaa tttgaattta atgttgtcat catcgtcatg tgtttcccca

1981 aagggaagcc agtcattgac catttaaaaa gtctcctgct aagtatggaa atcagacagt

2041 aagagaaagc caaaaagcaa tgcagagaaa ggtgtccaag ctgtcttcag ccttccccag

2101 ctaaagagca gaggagggcc tgggctactt gggttcccca tcggcctcca gcactgcctc

2161 cctcctccca ctgcgactct gggatctcca ggtgctgccc aaggagttgc cttgattaca

2221 gagaggggag cctccaattc ggccaacttg gagtcctttc tgttttgaag catgggccag

2281 acccggcact gcgctcggag agccggtggg cctggcctcc ccgtcgacct cagtgccttt

2341 ttgttttcag agagaaatag gagtagggcg agtttgcctg aagctctgct gctggcttct

2401 cctgccagga agtgaacaat ggcggcggtg tgggagacaa ggccaggaga gcccgcgttc

2461 agtatgggtt gagggtcaca gacctccctc ccatctgggt gcctgagttt tgactccaat

2521 cagtgatacc agaccacatt gacagggagg atcaaattcc tgacttacat ttgcactggc

2581 ttcttgttta ggctgaatcc taaaataaat tagtcaaaaa attccaacaa gtagccagga

2641 ctgcagagac actccagtgc agagggagaa ggacttgtaa ttttcaaagc agggctggtt

2701 ttccaaccca gcctctgaga aaccatttct ttgctatcct ctgccttccc aagtccctct

2761 tgggtcggtt caagcccaag cttgttcgtg tagcttcaga agttccctct ctgacccagg

2821 ctgagtccat actgcccctg atcccagaag gaatgctgac ccctcgtcgt atgaactgtg

2881 catagtctcc agagcttcaa aggcaacaca agctcgcaac tctaagattt ttttaaacca

2941 caaaaaccct ggttagccat ctcatgctca gccttatcac ttccctccct ttagaaactc

3001 tctccctgct gtatattaaa gggagcaggt ggagagtcat tttccttcgt cctgcatgtc

3061 tctaacatta atagaaggca tggctcctgc tgcaaccgct gtgaatgctg ctgagaacct

3121 ccctctatgg ggatggctat tttatttttg agaaggaaaa aaaaagtcat gtatatatac 3181 acataaaggc atatagctat atataaagag ataagggtgt ttatgaaatg agaaaattat 3241 tggacaattc agactttact aaagcacagt tagacccaag gcctatgctg aggtctaaac 3301 ctctgaaaaa agtatagtat cgagtacccg ttccctccca gaggtgggag taactgctgg 3361 tagtgccttc tttggttgtg ttgctcagtg tgtaagtgtt tgtttccagg atattttctt 3421 tttaaatgtc tttcttatat gggttttaaa aaaaagtaat aaaagcctgt tgcaaaaatg 3481 aaaaaaaaaa aaaaaaaa\

MASPAIGQRP YPLLLDPEPP RYLQSLSGPE LPPPPPDRSS RLCVPAPLST APGAREGRSA RRAARGNLEP PPRASRPARP LRPGLQQRLR RRPGAPRPRD VRSIFEQPQD PRVPAERGEG HCFAELVLPG GPGWCDLCGR EVLRQALRCT NCKFTCHPEC RSLIQLDCSQ QEGLSRDRPS PESTLTVTFS QNVCKPVEET QRPPTLQEIK QKIDSYNTRE KNCLGMKLSE DGTYTGFIKV HLKLRRPVTV PAGIRPQSIY DAIKEVNLAA TTDKRTSFYL PLDAIKQLHI SSTTTVSEVI QGLLKKFMVV DNPQKFALFK RIHKDGQVLF QKLSIADRPL YLRLLAGPDT EVLSFVLKEN ETGEVE DAF SIPELQNFLS SWCIQIYLYY

N0RE1B: GenBank Accession No. AF445801

Nucleic acid - SEQ ID NO: 122 (coding: 411-1208); Amino acid: SEQ ID NO: 123 1 gaactgcttt cgcgagggg caaggaaagg cgcgggaggc gggggaggtg cggagatggc 61 gctctgcacg gcggcggagg gagggcgctg gcgccgggga cacgaaaccg cagagcccgg 121 acgagtcagg gagtgaggcg cgagccgggc gcccggggct ctgcaggcgc aggcggcgcg 181 gggacaggag caggttaccg ggccgcccga gcgctcgcac cccgctgaaa aaaacgcagg 241 cggcccgccg gctttgcctg gtccgatacc cgaccagctc ccggctcggg gctcagagct 301 aggggcttac gccaagcgga gcccggggag gggtgcccac ctccctccgc cgcatcccaa 361 gcccggcccc cttgatgcgc tggcggcctc ggccgggaac tccggggtag atgaccgtgg 421 acagcagcat gagcagtggg tactgcagcc tggacgagga actggaagac tgcttcttca 481 ctgctaagac tacctttttc agaaatgcgc agagcaaaca tctttcaaag aatgtctgta 541 aacctgtgga ggagacacag cgcccgccca cactgcagga gatcaagcag aagatcgaca 601 gctacaacac gcgagagaag aactgcctgg gcatgaaact gagtgaagac ggcacctaca 661 cgggtttcat caaagtgcat ctgaaactcc ggcggcctgt gacggtgcct gctgggatcc 721 ggccccagtc catctatgat gccatcaagg aggtgaacct ggcggctacc acggacaagc 781 ggacatcctt ctacctgccc ctagatgcca tcaagcagct gcacatcagc agcaccacca 841 ccgtcagtga ggtcatccag gggctgctca agaagttcat ggttgtggac aatccccaga 901 agtttgcact ttttaagcgg atacacaagg acggacaagt gctcttccag aaactctcca 961 ttgctgaccg ccccctctac ctgcgcctgc- ttgctgggcc tgacacggag gtcctcagct

1021 ttgtgctaaa ggagaatgaa actggagagg tagagtggga tgccttctcc atccctgaac

1081 ttcagaactt cctaacaatc ctggaaaaag aggagcagga caaaatccaa caagtgcaaa

1141 agaagtatga caagtttagg cagaaactgg aggaggcctt aagagaatcc cagggcaaac

1201 ctgggtaacc agtcctgctt cctctcctcc tggtgcattc agatttattt gtattattaa

1261 ttattatttt gcaacagaca ctttttctca ggacatctct ggcaggtgca tttgtgcctg

1321 cccagcagtt ccagctgtgg caaaagtctc ttccatggac aagtgtttgc acgggggttc

1381 agctgtgccc gcccccaggc tgtgccccac cacagattct gccaaggatc agaactcatg

1441 tgaaacaaac agctgacgtc ctctctcgat ctgcaagcct ttcaccaacc aaatagttgc

1501 ctctctcgtc accaaactgg aacctcacac cagccggcaa aggaaggaag aaaggtttta

1561 gagctgtgtg ttctttctct ggctttgatt cttctttgag ttctcttact tgccacgtac

1621 aggaccatta tttatgagtg aaaagttgta gcacattcct tttgcaggtc tgagctaaac

1681 ccctgaaagc agggtaatgc tcataaaagg actgttcccg cggccccaag gtgcctgttg

1741 ttcacactta agggaagttt ataaagctac tggccccaga tgctcagggt aaggagcacc

1801 aaagctgagg ctggctcaga gatctccaga gaagctgcag cctgccctgg ccctggctct

1861 ggccctggcc cacattgcac atggaaaccc aaaggcatat atctgcgtat gtgtggtact

1921 tagtcacatc tttgtcaaca aactgttcgt ttttaagtta caaatttgaa tttaatgttg

1981 tcatcatcgt catgtgtttc cccaaaggga agccagtcat tgaccattta aaaagtctcc

2041 tgctaagtat ggaaatcaga cagtaagaga aagccaaaaa gcaatgcaga gaaaggtgtc

2101 caagctgtct tcagccttcc ccagctaaag agcagaggag ggcctgggct acttgggttc

2161 cccatcggcc tccagcactg cctccctcct cccactgcga ctctgggatc tccaggtgct

2221 gcccaaggag ttgccttgat tacagagagg ggagcctcca attcggccaa cttggagtcc

2281 tttctgtttt gaagcatggg ccagacccgg cactgcgctc ggagagccgg tgggcctggc 2341 ctccccgtcg acctcagtgc ctttttgttt tcagagagaa ataggagtag ggcgagtttg

2401 cctgaagctc tgctgctggc ttctcctgcc aggaagtgaa caatggcggc ggtgtgggag

2461 acaaggccag gagagcccgc gttcagtatg ggttgagggt cacagacctc cctcccatct

2521 gggtgcctga gttttgactc caatcagtga taccagacca cattgacagg gaggatcaaa 2581 ttcctgactt acatttgcac tggcttcttg tttaggctga atcctaaaat aaattagtca

2641 aaaaattcca acaagtagcc aggactgcag agacactcca gtgcagaggg agaaggactt

2701 gtaattttca aagcagggct ggttttccaa cccagcctct gagaaaccat ttctttgcta

2761 tcctctgcct tcccaagtcc ctcttgggtc ggttcaagcc caagcttgtt cgtgtagctt

2821 cagaagttcc ctctccgacc caggctgagt ccatactgcc cctgatccca gaaggaatgc 2881 tgacccctcg tcgtatgaac tgtgcatagt ctccagagct tcaaaggcaa cacaagctcg

2941 caactctaag atttttttaa accacaaaaa ccctggttag ccatctcatg ctcagcctta

3001 tcacttccct cccttttaga aaactctctc cctgctgtat attaaaggga gcaggtggag

3061 agtcattttc cttcgtcctg catgtctcta acattaatag aaggcatggc tcctgctgca

3121 accgctgtga atgctgctga gaacctccct ctatggggat ggctatttta tttttgagaa 3181 ggaaaaaaaa agtcatgtat atatacacat aaaggcatat agctatatat aaagagataa

3241 gggtgtttat gaaatgagaa aattattgga caattcagac tttactaaag cacagttaga

3301 cccaaggcct atgctgaggt ctaaacctct gaaaaaagta tagtatcgag tacccgttcc

3361 ctcccagagg tgggagtaac tgctggtagt gccttctttg gttgtgttgc tcagtgtgta

3421 agtgtttgtt tccaggatat tttcttttta aatgtctttc ttatatgggt tttaaaaaaa 3481 agtaataaaa gcctgttgc

MTVDSSMSSG YCSLDEELED CFFTAKTTFF RNAQSKHLSK NVCKPVEETQ RPPTLQEIKQ KIDSYNTREK NCLGMKLSED GTYTGFIKVH LKLRRPVTVP AGIRPQSIYD AIKEVNLAAT TDKRTSFYLP LDAIKQLHIS STTTVSEVIQ GLLKKFMWD NPQKFALFKR IHKDGQVLFQ KLSIADRPLY LRLLAGPDTE VLSFVLKENE TGEVE DAFS IPELQNFLTI LEKEEQDKIQ QVQKKYDKFR QKLEEALRES QGKPG

LSAMP NM_002338 cDNA

Nucleic acid: SEQ LD NO: 124 (coding: 501-1517); Amino acid SEQ IDNO:125 1 ggggagagag gctctgggtt gctgctgctt ctgctgctgc tgctgctgtg tggctgtttc 61 tgtacactca ctggcaggct tggtgccggc tccctcgccc gcccgcccgc cagcctggga 121 aagtgggtta cagagcgaag gagctcagct cagacactgg cagaggagca tccagtcaca 181 gagagaccaa acaagaaccc tttcctttgg cttcctcttc agctcttcca gagggcttgc 241 tatttgcact ctctcttttg aaattgtgtt gcttttactt ttcacccttc tgcttgggtt 301 ttatgagggc tttgttaagt cttagaggga aaagagactg agcgagggaa agagagaggc 361 aaagtggaaa ggaccataaa ctggcaaagc ccgctctgcg ctcgctgtgg atgaaagccc 421 cgtgttggtg aagcctctcc tcgcgagcag cgcgcacccc tccagagcac cccgcggacc 481 cgcacctcgg cgtggccacc atggtcagga gagttcagcc ggatcggaaa cagttgccac 541 tggtcctact gagattgctc tgccttcttc ccacaggact gcctgttcgc agcgtggatt 601 ttaaccgagg cacggacaac atcaccgtga ggcaggggga cacagccatc ctcaggtgcg 661 ttgtagaaga caagaactca aaggtggcct ggttgaaccg ttctggcatc atttttgctg 721 gacatgacaa gtggtctctg gacccacggg ttgagctgga gaaacgccat tctctggaat 781 acagcctccg aatccagaag gtggatgtct atgatgaggg ttcctacact tgctcagttc 841 agacacagca tgagcccaag acctcccaag tttacttgat cgtacaagtc ccaccaaaga 901 tctccaatat ctcctcggat gtcactgtga atgagggcag caacgtgact ctggtctgca 961 tggccaatgg ccgtcctgaa cctgttatca cctggagaca ccttacacca actggaaggg

1021 aatttgaagg agaagaagaa tatctggaga tccttggcat caccagggag cagtcaggca

1081 aatatgagtg caaagctgcc aacgaggtct cctcggcgga tgtcaaacaa gtcaaggtca

1141 ctgtgaacta tcctcccact atcacagaat ccaagagcaa tgaagccacc acaggacgac 1201 aagcttcact caaatgtgag gcctcggcag tgcctgcacc tgactttgag tggtaccggg

1261 atgacactag gataaatagt gccaatggcc ttgagattaa gagcacggag ggccagtctt

1321 ccctgacggt gaccaacgtc actgaggagc actacggcaa ctacacctgt gtggctgcca

1381 acaagctggg ggtcaccaat gccagcctag tccttttcag acctgggtcg gtgagaggaa

1441 taaatggatc catcagtctg gccgtaccac tgtggctgct ggcagcatct ctgctctgcc 1501 ttctcagcaa atgttaatag aataaaaatt taaaaataaa aaaaaaaaaa aaaaaaaaaa

1561 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1621 aaaaaaaaaa aaaaaaaaaa

MVRRVQPDRK QLPLVLLRLL CLLPTGLPVR SVDFNRGTDN ITVRQGDTAI LRCVVEDKNS KVA LNRSGI IFAGHDKWSL DPRVELEKRH SLEYSLRIQK VDVYDEGSYT CSVQTQHEPK TSQVYLIVQV PPKISNISSD VTVNEGSNVT LVCMANGRPE PVITWRHLTP TGREFEGEEE YLEILGITRE QSGKYECKAA NEVSSADVKQ VKVTVNYPPT ITESKSNEAT TGRQASLKCE ASAVPAPDFE WYRDDTRINS ANGLEIKSTE GQSSLTVTNV TEEHYGNYTC VAANKLGVTN ASLVLFRPGS VRGINGSISL AVPLWLLAAS LLCL

ASSF1A. GenBank Accession No. AF132675;

Nucleic acid: SEQ ID NO: 126 (coding: 39-1061); Amino acid SEQ ID NO:127 1 agcgcccaaa gccagcgaag cacgggccca accgggccat gtcgggggag cctgagctca 61 ttgagctgcg ggagctggca cccgctgggc gcgctgggaa gggccgcacc cggctggagc 121 gtgccaacgc gctgcgcatc gcgcggggca ccgcgtgcaa ccccacacgg cagctggtcc 181 ctggccgtgg ccaccgcttc cagcccgcgg ggcccgccac gcacacgtgg tgcgacctct 241 gtggcgactt catctggggc gtcgtgcgca aaggcctgca gtgcgcgcat tgcaagttca 301 cctgccacta ccgctgccgc gcgctcgtct gcctggactg ttgcgggccc cgggacctgg 361 gctgggaacc cgcggtggag cgggacacga acgtggacga gcctgtggag tgggagacac 421 ctgacctttc tcaagctgag attgagcaga agatcaagga gtacaatgcc cagatcaaca 481 gcaacctctt catgagcttg aacaaggacg gttcttacac aggcttcatc aaggttcagc 541 tgaagctggt gcgccctgtc tctgtgccct ccagcaagaa gccaccctcc ttgcaggatg 601 cccggcgggg cccaggacgg ggcacaagtg tcaggcgccg cacttccttt tacctgccca 661 aggatgctgt caagcaccta catgtgctgt cacgcacaag ggcacgtgaa gtcattgagg 721 ccctgctgcg aaagttcttg gtggtagatg acccccgcaa gtttgcactc tttgagcgcg 781 ctgagcgtca cggccaagtg tacttgcgga agctgttgga tgatgagcag cccctgcggc 841 tgcggctcct ggcagggccc agtgacaagg ccctgagctt tgtcctgaag gaaaatgact 901 ctggggaggt gaactgggac gccttcagca tgcctgaact acataacttc ctacgtatcc 961 tgcagcggga ggaggaggag cacctccgcc agatcctgca gaagtactcc tattgccgcc

1021 agaagatcca agaggccctg cacgcctgcc cccttgggtg acctcttgta cccccaggtg

1081 gaaggcagac agcaggcagc gccaagtgcg tgccgtgtga gtgtgacagg gccagtgggg

1141 cctgtggaat gagtgtgcat ggaggccctc ctgtgctggg ggaatgagcc cagagaacag

1201 cgaagtagct tgctccctgt gtccacctgt gggtgtagcc aggtatggct ctgcacccct

1261 ctgccctcat tactgggcct tagtgggcca gggctgccct gagaagctgc tccaggcctg

1321 cagcaggagt ggtgcagaca gaagtctcct caatttttgt ctcagaagtg aaaatcttgg

1381 agaccctgca aacagaacag ggtcatgttt gcaggggtga cggccctcat ctatgaggaa

1441 aggttttgga tcttgaatgt ggtctcagga tatccttatc agagctaagg gtgggtgctc

1501 agaataaggc aggcattgag gaagagtctt ggtttctctc tacagtgcca actcctcaca

1561 caccctgagg tcagggagtg ctggctcaca gtacagcatg tgccttaatg cttcatatga

1621 ggaggatgtc cctgggccag ggtctgtgtg aatgtgggca ctggcccagg ttcatacctt

1681 atttgctaat caaagccagg gtctctccct caggtgtttt ttatgaagtg cgtgaatgta

1741 tgtaatgtgt ggtggcctca gctgaatgcc tcctgtgggg aaaggggttg gggtgacagt

1801 catcatcagg gcctggggcc tgagagaatt ggctcaataa agatttcaag atccaaaaaa

1861 aaaaaaaaaa aaa

MSGEPELIEL RELAPAGRAG KGRTRLERAN ALRIARGTAC NPTRQLVPGR GHRFQPAGPA THTWCDLCGD FIWGVVRKGL QCAHCKFTCH YRCRALVCLD CCGPRDLGWE PAVERDTNVD EPVEWETPDL SQAEIEQKIK EYNAQINSNL FMSLNKDGSY TGFIKVQLKL VRPVSVPSSK KPPSLQDARR GPGRGTSVRR RTSFYLPKDA VKHLHVLSRT RAREVIEALL RKFLVVDDPR KFALFERAER HGQVYLRKLL DDEQPLRLRL LAGPSDKALS FVLKENDSGE VNWDAFSMPE LHNFLRILQR EEEEHLRQIL QKYSYCRQKI QEALHACPLG Norel, AF053959;

Nucleic acid: SEQ ID NO: 128 (coding: 31-1272); AminO Acid: SEQ ID NO: 129 1 gtagctgcgc cgctgactga ggccttggcc atggcttccc cggccatcgg gcaacgtccc 61 tacccgctgc tcctagatcc cgagccgccg cggtatctgc agagtctggg tggcaccgag 121 ccgccacctc ccgcccggcc gcgccgctgc atccccacgg ccctgatccc cgcggccggg 181 gcgtcagagg atcgcggtgg caggaggagt ggccggaggg accccgaacc cacgccccga 241 gactgccgac acgctcgccc tgtccggccc ggtctgcagc cgagactgcg gctgcgacct 301 gggtcacacc gaccccgcga cgtgaggagc atcttcgagc agccgcagga tccccgcgtc 361 ttggccgaga gaggcgaggg gcaccgtttc gtggaactgg cgctgcgggg cggtccgggc 421 tggtgtgacc tgtgcggacg agaggtgctg cggcaggcgc tgcgctgcgc taattgtaaa 481 ttcacctgcc actcggagtg ccgcagcctg atccagttgg actgcagaca gaaggggggc 541 cctgccctgg atagacgctc tccaggaagc accctcaccc caaccttgaa ccagaatgtc 601 tgtaaggcag tggaggagac acagcacccg cccacgatac aggagatcaa gcagaagatt 661 gacagctata acagcaggga gaagcactgc ctgggcatga agctgagtga agatggcacc 721 tacacaggtt tcatcaaagt gcatttgaag ctccgacggc cagtgacggt gcccgctgga 781 tccggcccca gtccatctat ggatgccatt aaggaagtga accctgcagc caccacagac 841 aagcggactt ccttctacct gccactcgat gccatcaagc agctacatat cagcagcacc 901 accacggtta gtgaggtcat ccaggggctg ctcaagaagt tcatggttgt ggacaaccca 961 cagaagtttg cactttttaa gcggatacac aaagatggac aagtgctctt ccagaaactc 1021 tccattgctg actatcctct ctaccttcgt ctgctcgctg ggcctgacac cgatgttctc

1081 agctttgtgc taaaggagaa tgaaactgga gaggtggagt gggatgcctt ttccattcct

1141 gaactccaga actttttaac tatcctggaa aaagaggagc aggacaagat ccatcaactg

1201 caaaagaagt acaacaaatt ccgtcagaaa ctggaagagg cattacgaga gtcccaaggg

1261 aagccggggt aaccagccga cttcctgtcc tctcagtgcc ctccaattta ttttattgtt 1321 aattattttg caacaaagag ttactgttaa gacacctctg gtggttccac cagtcgcctg

1381 cccagcagtt aacagatgtg gcacaaagtc tcttccacgc agtgtctatg cagggttccg 1441 attcctgcta acccaccaca ccatggctct ggagagcttc ccgcctggga tcagaactcc 1501 tgtggaatga ccagtgtttc cctgctcagt ctgctggcct ctcagaaacc aaatagttgc 1561 ctctctggtc accaaactcc aatcaatcac cagccggcaa aaggaaagaa aggtttcaga 1621 gcctgtgtgt tctttctctg gatttactct tcagttcctc ttttggtttg tttggttggt 1681 tttttttggc cacgtatagt atatttaagg atcaaatgtg gcatattcat tctagctaag 1741 tccttgaaag caggaaaatg ctcatgaaag gactgtcctt gccccaaggt gcctcttctt 1801 ctctagtact agacactcag ggtcagcctg agatttcaag aggctacagc ctgaccaggc 1861 cgtcttctta ttacccagca ggctgtgtgc atgcaaaccc aaagacatat atgcacatct 1921 gtgtggtatt tcagcatgtc tctgtccaat gtttgatatg ttaacatttg aatttaatgc 1981 tgtcctcctt atgggtttct accaaagaga aaccagccac ttatcaattt tagtttcttg 2041 ctgagctgcc agaaagtatt acagagaagc acatccaagc tgtctgtggc ctacgcctgc 2101 agggggtggg gggcctgaat ctccttggcc ttcagttcca cctccacctc tggctttagg 2161 gtctccagct gttgcctgag tagtagcttt gattacagcg gtaaagtcct ccaacttgga 2221 gtcctttctg gtgggaagca tggtctgctc gcagcacagc actgagcaga cccgtgggcc 2281 tgacttccct ggtgacttca gtgccttttt gtttgcagag aaaagagtgg ggcactttgc 2341 ttgaagctct ctgctggctt gcccctggca ggaagtggac aatggtgcta tagagccaag 2401 gacacagcct cagagcacag ggtgattgat gatcagcctc tttcccatca agcttcccgg 2461 tcaggctttg actttgaaga tgcgaggtta ctagactgca ttgacagcat cagattatga 2521 ctccaactct tgagtagttc agacttaaaa ccaatcagcc agagtagcca ggactgcaaa 2581 gacactcaat acagatggag aaaaacttgt ccctttaaaa gagggccagt gtttcaattg 2641 agcctccaga ggagaccact ttcatgttgt gcttgccttt ccataccctt tcctcgggtt 2701 gttttaagcc caagcttctc cgtgtagcct aaaaagttcc ctaccagccc agctgaagcc 2761 acactgctcc cgtcccagaa gaacgccaaa tccttgtcat tcaaactgtg catcgtttgc 2821 agagctgcaa aaagcaacat gagctagcga ctctgaggtt gtgcacgcca tcagcccctt

2881 ggctgcctga ggtctcatgc ccagccttac acctctctcc cttaagaagc ccccgtcctg 2941 ctgtgtacta caggggcacg tggaatcatt cccttcatcc tgcatgtctg tagcgttagg

3001 agaaggcatg gctcctgc MASPAIGQRP YPLLLDPEPP RYLQSLGGTE PPPPARPRRC IPTALIPAAG ASEDRGGRRS GRRDPEPTPR DCRHARPVRP GLQPRLRLRP GSHRPRDVRS IFEQPQDPRV LAERGEGHRF VELALRGGPG WCDLCGREVL RQALRCANCK FTCHSECRSL IQLDCRQKGG PALDRRSPGS TLTPTLNQNV CKAVEETQHP PTIQEIKQKI DSYNSREKHC LGMKLSEDGT YTGFIKVHLK LRRPVTVPAG SGPSPSMDAI KEVNPAATTD KRTSFYLPLD AIKQLHISST TTVSEVIQGL LKKFMWDNP QKFALFKRIH KDGQVLFQKL SIADYPLYLR LLAGPDTDVL SFVLKENETG EVEWDAFSIP ELQNFLTILE KEEQDKIHQL QKKYNKFRQK LEEALRESQG KPG

VHL GenBank Accession No. NM 000551 Nucleic acids: SEQ ID NO: 129 (coding 2145-855); Amino acids 1 cctcgcctcc gttacaacgg cctacggtgc tggaggatcc ttctgcgcac gcgcacagcc 61 tccggccggc tatttccgcg agcgcgttcc atcctctacc gagcgcgcgc gaagactacg 121 gaggtcgact cgggagcgcg cacgcagctc cgccccgcgt ccgacccgcg gatcccgcgg 181 cgtccggccc gggtggtctg gatcgcggag ggaatgcccc ggagggcgga gaactgggac 241 gaggccgagg taggcgcgga ggaggcaggc gtcgaagagt acggccctga agaagacggc 301 ggggaggagt cgggcgccga ggagtccggc ccggaagagt ccggcccgga ggaactgggc 361 gccgaggagg agatggaggc cgggcggccg cggcccgtgc tgcgctcggt gaactcgcgc 421 gagccctccc aggtcatctt ctgcaatcgc agtccgcgcg tcgtgctgcc cgtatggctc 481 aacttcgacg gcgagccgca gccctaccca acgctgccgc ctggcacggg ccgccgcatc 541 cacagctacc gaggtcacct ttggctcttc agagatgcag ggacacacga tgggcttctg 601 gttaaccaaa ctgaattatt tgtgccatct ctcaatgttg acggacagcc tatttttgcc 661 aatatcacac tgccagtgta tactctgaaa gagcgatgcc tccaggttgt ccggagccta 721 gtcaagcctg agaattacag gagactggac atcgtcaggt cgctctacga agatctggaa 781 gaccacccaa atgtgcagaa agacctggag cggctgacac aggagcgcat tgcacatcaa 841 cggatgggag attgaagatt tctgttgaaa cttacactgt ttcatctcag cttttgatgg 901 tactgatgag tcttgatcta gatacaggac tggttccttc cttagtttca aagtgtctca 961 ttctcagagt aaaataggca ccattgctta aaagaaagtt aactgacttc actaggcatt

1021 gtgatgttta ggggcaaaca tcacaaaatg taatttaatg cctgcccatt agagaagtat

1081 ttatcaggag aaggtggtgg catttttgct tcctagtaag tcaggacagc ttgtatgtaa

1141 ggaggtttgt ataagtaatt cagtgggaat tgcagcatat cgtttaattt taagaaggca

1201 ttggcatctg cttttaatgg atgtataata catccattct acatccgtag cggttggtga

1261 cttgtctgcc tcctgctttg ggaagactga ggcatccgtg aggcagggac aagtctttct

1321 cctctttgag accccagtgc ctgcacatca tgagccttca gtcagggttt gtcagaggaa

1381 caaaccaggg gacactttgt tagaaagtgc ttagaggttc tgcctctatt tttgttgggg

1441 ggtgggagag gggaccttaa aatgtgtaca gtgaacaaat gtcttaaagg gaatcatttt

1501 tgtaggaagc attttttata attttctaag tcgtgcactt tctcggtcca ctcttgttga

1561 agtgctgttt tattactgtt tctaaactag gattgacatt ctacagttgt gataatagca

1621 tttttgtaac ttgccatccg cacagaaaat acgagaaaat ctgcatgttt gattatagta

1681 ttaatggaca aataagtttt tgctaaatgt gagtatttct gttccttttt gtaaatatgt

1741 gacattcctg attgatttgg gtttttttgt tgttgttgtt ttgttttgtt ttgttttttt

1801 gagatggagt ctcactcttg tcacccaggc tggagtgcag tggcgccatc tcggctcact

1861 gcaacctctg cctcctgggt tcacgtaatc ctcctgagta gctgggatta caggcgcctg

1921 ccaccacgct ggccaatttt tgtactttta gtagagacag tgtttcgcca tgttggccag

1981 gctggtttca aactcctgac ctcaggtgat ccgcccacct cagcctccca aaatggtggg

2041 attacaggtg tgtgggccac cgtgcctggc tgattcagca ttttttatca ggcaggacca

2101 ggtggcactt ccacctccag cctctggtcc taccaatgga ttcatggagt agcctggact

2161 gtttcatagt tttctaaatg tacaaattct tataggctag acttagattc attaactcaa

2221 attcaatgct tctatcagac tcagtttttt gtaactaata gatttttttt tccacttttg

2281 ttctactcct tccctaatag ctttttaaaa aaatctcccc agtagagaaa catttggaaa

2341 agacagaaaa ctaaaaagga agaaaaaaga tccctattag atacacttct taaatacaat

2401 cacattaaca ttttgagcta tttccttcca gcctttttag ggcagatttt ggttggtttt

2461 tacatagttg agattgtact gttcatacag ttttataccc tttttcattt aactttataa

2521 cttaaatatt gctctatgtt agtataagct tttcacaaac attagtatag tctccctttt

2581 ataattaatg tttgtgggta tttcttggca tgcatcttta attccttatc ctagcctttg

2641 ggcacaattc ctgtgctcaa aaatgagagt gacggctggc atggtggctc ccgcctgtaa

2701 tcccagtact ttgggaagcc aaggtaagag gattgcttga gcccagaact tcaagatgag 2761 cctgggctca tagtgagaac ccatctatac aaaaaatttt taaaaattag catggcggca

2821 cacatctgta atcctagcta cttggcaggc tgaggtgaga agatcattgg agtttaggaa

2881 ttggaggctg cagtgagcca tgagtatgcc actgcactcc agcctggggg acagagcaag 2941 accctgcctc aaaaaaaaaa aaaaaaaa

MPRRAENWDE AEVGAEEAGV EEYGPEEDGG EESGAEESGP EESGPEELGA EEEMEAGRPR PVLRSVNSRE PSQVIFCNRS PRVVLPVWLN FDGEPQPYPT LPPGTGRRIH SYRGHLWLFR DAGTHDGLLV NQTELFVPSL NVDGQPIFAN ITLPVYTLKE RCLQVVRSLV KPENYRRLDI VRSLYEDLED HPNVQKDLER LTQERIAHQR MGD

Experimental procedures Family with CC-RCC and t(l;3)(q32.1;ql3.3), paired CC-RCC tumors/normal kidney tissues, and cell lines The clinical and genetic details of the Japanese kindred with familial CC-RCC have been previously published (Kanayama et al, 2001). The EBV-transformed lymphoblastoid cell lines

FRCC3 and FRCC5 used in this study were established from two affected translocation carriers. Four tumors were from three members of the t(l;3) family, and 53 matched pairs of CC- RCC were collected from the University of Tokushima in Japan. Nine established RCC cell lines were purchased from ATCC: A-498, A-704, Caki-1,

Caki-2, SW-839, ACHN, 786-O, 769-P, and SW-156.

Construction of BAC contigs and FISH analyses Forty-four lq32.1 and 3ql3.3 BAC clones were obtained from the BACPAC Resource

Center (Children's Hospital, Oakland Research Institute) or ResGen Invitrogen Corporation. The clones were selected based on information in the BAC clone mapping databases and Human

Genome Sequence Draft database. The details of the BACs are listed in the Supplemental

Experimental Procedures. Standard dual-color FISH was performed by hybridizing each of the 44 BAC clones to metaphase slides prepared from FRCC3 or FRCC5. In all hybridizations, the PAC clone 160H23 from the lq subtelomere (Cytocell Ltd, UK) was included as a marker of the normal chromosome 1 and the der(3) chromosome.

Long-range PCR, Southern blot analysis, and Northern blot analysis Long-range PCR was used for the amplification of the breakpoints and the generation of

DNA probes for Southern blot analysis with an Advantage Genomic PCR kit (Clontech, USA). PCR was carried out following the manufacturer's user manual. Southern blot and Northern blot analyses were performed following the standard protocol. Human multiple tissue Northern blots were purchased from Clontech (Cat. #7780-1). Details of these analyses can be found in the

Supplemental Experimental Procedures.

Mutation analysis Mutation analysis of LSAMP, NOREIA, and NOREIB was performed in the 53 sporadic CC-RCCs and 9 RCC cell lines. Each exon of LSAMP, NOREIA, and NOREIB was amplified by PCR using primers derived from the flanking intronic or UTR sequences (see Table A in the

Supplemental Data). The PCR products were then purified and subjected to direct DNA sequencing using PE Applied Biosystems.

Real-time quantitative RT-PCR Total RNA from normal kidney tissues, RCC cell lines, and sporadic tumors was subjected to real-time quantitative PCR using an ABI PRISM 7700 Sequence Detection System.

Specific primer and probe were designed for LSAMP and NOREIA using Primer Express vl.5a

(Applied Biosystems). The primer sequences and the details of the real-time RT-PCR analysis are described in the Supplemental Experimental Procedures. DNA methylation analysis and demethylation treatment by 5-aza-2'-deoχycytidine (5-aza- CdR) Methylation analysis was performed for the promoter CpG islands of LSAMP and

NOREIA. Bisulfite-PCR followed by restriction enzyme digestion analysis was used. Eight RCC cell lines were demethylated by 5-aza-CdR (Sigma, USA) treatment. The primers and the details of the analyses are given in the Supplemental Experimental Procedures.

LOH analysis LOH detection for LSAMP and NOREl was performed by genotyping the 53 paired normal/tumor DNA samples. The microsatellite markers flanking the LSAMP locus are

D3S3681, D3S1271, D3S1267, and D3S1292. NOREl locus markers include D1S413 and D1S249. All the markers were obtained from ABI Prism Linkage Mapping Set version 2, panel

1 and 2 (Applied Biosystems). The details of LOH analysis are described in the supplemental experimental procedures.

Cell growth assay Expression plasmids pEGFP-LSAMP, -NOREIA, and -Norel were generated by ligating cDNAs of LSAMP, NOREIA, and murine Norel to N- or C-terminal enhanced green fluorescent protein vectors (pEGFP-Nll-Cl) (Clontech, USA). Expression plasmids were microinjected and transfected into two RCC cell lines, A-498 and/or Caki-1, for cell growth-suppression assay. Inducible experiments and nuclear fractionation assays were also performed for the nuclear location of Norel. Detailed methods are provided in the Supplemental Data. URLs. University of California, Santa Cruz (UCSC) Human Genome Browser at the web site: www.genome.ucsc.edu; Discovery System Human Genome Browser: at the web site: www.cds.celera.com; Human Genome Browser NCBI: at the web site ncbi.nlm.nih.gov. Supplemental Experimental Procedures BAC clones used for construction of BAC contigs and FISH analyses The 20 BAC clones from lq32.1 are RPll-196B7, RPl l-70G20, RPll-219P13, RPll- 45F21, RP11-104A2, RP11-124A11, RP11-149C8, RP11-237N7, RP11-142B3, RP11-421E17, RPl 1-54L22, RPl 1-262N9, RPl 1-237C22, RPl 1-145113, RPl 1-57117, RPl 1-534L20, CTD- 2245C1, CTD-2321B11, CTD-2278G17, and RPll-343H5. The 24 BAC clones from 3ql3.3 are RP11-138N21, RP11-58D2, RP11-324H4, RP11- 165B13, RP4-635B5, RPl 1-484M3, RPl 1-829114, RPl 1-641123, RPl 1-643A3, RPl 1-891 J4, RP11-281N16, RP11-50N14, RP11-728O20, RP11-899P8, RP11-716E6, RP11-1115L2, RP11- 60P15, RP11-47C16, CTD-2246M24, RP11-149B11, CTD-2514L8, CTD-2016D14, CTC- 804P8, and CTC-2006J5. Long-range PCR, Southern blot analysis, and Northern blot analysis \ Long-range PCR was used for the amplification of the breakpoints and the generation of DNA probes for Southern blot analysis with an Advantage Genomic PCR kit (K1906-Y, CLONTECH Laboratories, Inc., USA). PCR was carried out following the manufacturer's user manual. BAC clones spanning the lq32.1 (RP11-54L22) and 3ql3.3 (RP11-281N16) breakpoints were used as PCR templates. Four approximately 10-kb and five 4- to 6-kb DNA probes were synthesized for lq breakpoint mapping and six 5- to7- kb DNA probes were generated for Southern blot analysis in 3q breakpoint mapping. Two EBV-transformed lymphoblastoid cell lines of two patients from the t(lq;3q) family and two normal EBV- transformed lymphoblastoid cell lines were used for Southern blot analysis. Fifteen microgram aliquots of genomic DNA were digested using BamBI, EcoRI, Hindlϊl, Stul, EcoKY, Xbal, BgU, and Bglϊ . Completely digested DNA samples were separated by size on a 0.8% agarose in 1 x TBE buffer. Southern blot to nylon membrane and subsequent hybridization were performed following the standard protocol. For Northern blot analysis, human multiple tissue Northern blots were purchased from Clontech (USA, Cat. #7780-1). Northern blots were also prepared with RNA from normal kidney (Clontech) and with RNA extracted from the nine RCC cell lines, the EBV lines FRCC3 and FRCC5, two EBV lines from normal individuals, and normal kidney tissues from two patients with sporadic CC-RCC. Total RNA was extracted using the Trizol Reagent kit (Invifrogen), and 15 μg of total RNA of each sample was for the Northern blots. Probes specific for NOREIA (exon lα), NOREIB (exon 2β), LSAMP (exon 1), and β-actin were synthesized by PCR labeled with α-³²P and hybridized to the Northern filters under stringent conditions. RT-PCR RT-PCR was performed using 5 μg of total RNA isolated from the nine RCC cell lines and nine normal kidney tissues, Superscript-II RT (h vitrogen), random hexamer primers, and specific primer pairs. Specific primers from LSAMP and NOREIA were used for fusion transcripts analysis. The primer sequences are given in Table A of supplemental data online. PCR was carried out at 95°C for 5 min, followed by 95°C for 30 s, 58°C for 30 s and 72°C for 45 s, for 35 cycles. LOH analysis PCR was performed according to the manufacturer's protocol. For each individual, 1 μl of PCR product from each marker was then pooled. One microliter of this mixture was added to 10 μL of Hi-Di formamide and 0.1 μl of ROX 400HD size standard and denatured at 95 °C for 5 min before loading the samples into an ABI Prism 3700 DNA Analyzer (Applied Biosystems). Analysis of raw data and assessment of LOH were performed with Genescan v. 3.7 and Genotyper v. 3.7 software, respectively (Applied Biosystems). LOH was defined according to the following formula: LOH index = (T2/T1)/(N2/N1), where T was the tumour sample, N was the matched normal sample, and 1 and 2 were the intensities of smaller and larger alleles, respectively. If the ratio was less than 0.67 or more than 1.3, the result was determined to be LOH. Real-time quantitative RT-PCR Two micrograms of total RNA from 9 normal kidney tissues, the 9 RCC cell lines, and 16 sporadic tumors with LSAMP and/or NOREIA promoter methylation (RNA from other tumors was not available for analysis) were reverse-transcribed in a 100 μl reaction mixture using MultiScribe Reverse Transcriptase following the manufacturer's instruction (Applied Biosystems). Real-time quantitative PCR was performed using an ABI PRISM 7700 Sequence Detection System. Specific primer and probe sequences were designed for LSAMP and NOREIA using Primer Express vl.5a (Applied Biosystems). LSAMP forward primer: 5'-CAATGGCCGTCCTGAACCT-3' (SEQ ID NO:106); LSAMP reverse primer: 5'-CAAATTCCCTTCCAGTTGGTGTA-3' (SEQ ID NO: 107); LSAMP Taqman probe: 5'-6FAM-TTATCACCTGGAGACACC-MGBNFQ (SEQ ID NO: 108); NOREIA forward primer: 5'-GCGCTGCACTAACTGTAAATTCA-3' (SEQ ID NO:109); NOREIA reverse primer: 5'-GGGATAAACCCTCCTGCTGACT-3' (SEQ ID NO: 110);

NOREIA taqman probe: 5'-6FAM-TCACCCAGAATGCCGCA-MGBNFQ-3' (SEQ ID NO: 111). Of each sample, 100 ng was amplified using the following PCR conditions: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. A series of five 1 :2 dilutions of pooled normal sample served as a standard curve for relative quantification. Each tumor sample was normalized to an endogenous control, β-actin, and then normalized to the standard curve. Reported are values of fold change from pooled normal. I

DNA methylation analysis Two μg of genomic DNA from each cell line, tumor and normal kidney tissue was denatured in 0.3 M NaOH for 15 min at 37°C. Cytosines were sulfonated in 5 mM hydroquinone (Sigma) and 3.12 M sodium bisulfite (Sigma) for 16 h at 50°C. The DNA samples were desalted through columns, desulfonated in 0.3 M NaOH and precipitated with ethanol. DNA sequences were amplified by nested PCR. Approximately 50 ng of bisulfite-treated DNA was firstly amplified in a reaction volume of 30 μl with respective outer primer pairs: LSAMP-BISF-OF (5'-TGGTAGAGGAGTATTTAGTTATAGAGAGA-3') (SEQ ID NO:l 12), LSAMP-BISF-ORl (5'-TCTCAATAAAACCAATAACAACTATTTC-3') (SEQ ID NO: 113),

NOREl A-BISF-OF2 (5'-AAGAGGTAGGGTTGAAGGTTTAGGGTTT-3') (SEQ ID NO: 114), and NOREl A-BISF-OR2 (5'-CTCRAAACCRCTCAAACTCTATAAATAAC-3') (SEQ JD NO: 115). PCR was canied out at 95°C for 8 min, followed by 95°C for 30 s, 58°C for 30 s and 72°C for 1 min, for 30 cycles. A nested PCR was performed using 1 μl of the initially amplified products and the respective internal primer pairs:

LSAMP-BISF-IF (5'-TGTTTGGGTTTTATGAGGGTTTTGT-3') (SEQ ID NO: 116) and LSAMP-BISF-IR (5'-CRACTAAACTCTCCTAACCATAATAACCAC-3') (SEQ ID NO:l 17), NOREl A-BISF-IF2 (5'-GAATTTTGTAGTTGTTTTAGGTGAAGA-3') (SEQ ID NO: 118), and NOREl A-IR2 (5'-CRACRACTCRAAATCCAATAATAA-3') (SEQ ID NO: 119) with similar conditions as described for the preceding PCR amplification. The PCR products were purified using Microcon YM-100 (Millipore Corporation, USA). For isoform NOREIB, methylation analysis was performed as described in Tommasi et al. 2002. For restriction enzyme analysis of PCR products from bisulfite-treated DNA, 30 ng of the PCR products was digested with 10 units of Taql (Invifrogen, USA) and separated by size on a 2.0% TAE gel. Demethylation of LSAMP and NOREIA by 5-aza-2'-deoxycytidine (5-aza-CdR) treatment Eight RCC cell lines (except the slow-growing A-704 cell line) were subjected to 5-aza- CdR (Sigma Chemical Co., St. Louis, MO) treatment. Approximately 5 x 10⁵ cells for each line were seeded on a 100-mm plate and incubated for 24 h. The cells were cultured up to 14 d in complete media which contained 2.5 μM of 5-aza-CdR, and media was changed at 2-d intervals. Isolated total cellular RNAs from RCC cell lines treated and untreated with 5-aza-CdR were analyzed with real-time quantitative RT-PCR. Cell growth assay RCC cell lines A-498 and/or Caki-1, growing logarithmically on glass coverslips and maintained in 10% fetal calf serum, were microinjected or lipid-mediated transfection with pEGFP-LSAMP,pEGFP-NORElA, pEGFP-Norel or the vector control pEGFP-Cl/pEGFP-Nl (50 ng/ml). Two hours after injection or 24 h after lipid-mediated transfection (Lipofectamine2000 reagents, Invitrogen), EGFP/EGFP-Norel -expressing cells were fixed and stained with Texas Red-labeled phalloidin to reveal F-actin architecture and Hoechst 33342 (blue) to visualize DNA (nuclei). To monitor proliferation in cells expressing EGFP-LSAMP, EGFP-NORE1 A, and Norel fusion proteins or EGFP, 40-60 cells were microinjected with expression plasmids for the indicated protein, and returned to the incubator for 2 h. The number of successfully injected/expressing cells were then counted on an inverted epifluorescence microscope and thereafter at the selected times.

Supplemental inducible experiments and nuclear fractionation assay for nuclear location of Norel To confirm the nuclear location of Norel, me performed experiments by cloning Norel into the pIND(SPl)-Hygro vector (Invitrogen, Carlsbad, CA) and transfecting the plasmid into

293-T cells using Lipofectamine2000 reagents (Invitrogen). After selection in hygromycin, cell populations were pooled at an early passage and assayed for the effects of Norel induction on cell proliferation by growth curve analysis. Selected cells were plated at a cell density of 2.5 x

10⁵ cells/well in triplicate and induced with Ponasterone A 24 h later. Cells were counted using a Coulter counter every 24 h. Western analysis was performed on lysates at each time point. For nuclear fractionation assay, 293-T cells were transfected with 1 μg of pcDNAFlag-

Norei using CaPO4 (Invitrogen, Carlsbad CA). Forty-eight hours later cells were harvested and processed for subcellular fractionation. Protein determinations were made for each fraction and equivalent amounts were loaded on to gel. The cytoplasmic, membrane and nuclear fractions were then subjected to Western analysis using an anti-FLAG antibody (Sigma, St. Louis. MO). References for Examples Bodmer, D et al. , (2002a). Disruption of a novel MFS transporter gene, DIRC2, by a familial renal cell carcinoma-associated t(2;3)(q35;q21). Hum. Mol. Genet. 11, 641-649.

Bodmer, D. et al, (2002b). Cytogenetic and molecular analysis of early stage renal cell carcinomas in a family with a translocation (2;3)(q35;q21). Cancer Genet. Cytogenet. 134, 6-12.

Bodmer, D. et al, (1998). An alternative route for multistep tumorigenesis in a novel case of hereditary renal cell cancer and a t(2;3)(q35;q21) chromosome translocation. Am. J. Hum. Genet. 62, 1475-1483.

Bodmer, D., et al. (2002c). Understanding familial and non-familial renal cell cancer. Hum. Mol Genet. 11, 2489-2498.

Carpten, J. D. et al, Nat. Genet. 32, 676-680.

Cohen, AJ. et al (1979). Hereditary renal-cell carcinoma associated with a chromosomal translocation. N. Engl. J. Med. 301, 592-595.

Dammann, R. et al. (2000). Epigenetic inactivation of a RAS association domain family protein from the lung tumor suppressor locus 3p21.3. Nat. Genet. 25, 315-319.

Dreijerink, K et al. (2001). The candidate tumor suppressor gene, RASSF1A, from human chromosome 3p21.3 is involved in kidney tumorigenesis. Proc. Natl. Acad. Sci. USA 98, 7504-7509. Druck, T. et al. (1997). Structure and expression of the human FHIT gene in normal and tumor cells. Cancer Res 57, 504-512.

Druck, T. et al. (2001). The DIRC1 gene at chromosome 2q33 spans a familial RCC-associated t(2;3)(q33;q21) chromosome translocation. J. Hum. Genet. 46, 583-589.

Eleveld, MJ. et al. (2001). Molecular analysis of a familial case of renal cell cancer and a t(3;6)(ql2;ql5). Genes Chromosomes Cancer 31, 23-32.

Gemmill, R.M. et al, (2002). The TRC8 hereditary kidney cancer gene suppresses growth and functions with VHL in a common pathway. Oncogene 21, 3507-3516.

Hesson, L. et al. (2003). NOREIA, a homologue of RASSF1A tumor suppressor gene is inactivated in human cancers. Oncogene 22, 947-954. Jones, P.A. et al (2002). The fundamental role of epigenetic events in cancer. Nat. Rev. Genet. 3, 415- 428.

Kanayama, H. et al (2001). Association of a novel constitutional translocation t(lq;3q) with familial renal cell carcinoma, J. Med. Genet. 38, 165-170.

Khokhlatchev, A. et al Curr. Biol. 12, 253-265. Koolen, M.I. et al. (1998). A familial case of renal cell carcinoma and a t(2;3) chromosome translocation. Kidney Int. 53, 273-275.

Kovacs, G. et al. (1989). Tissue-specific expression of a constitutional 3;6 translocation: development of multiple bilateral renal-cell carcinomas. Int. J. Cancer 43, 422-427.

Kovacs, G. et al. (1988). Loss of der(3) in renal carcinoma cells of a patient with constitutional t(3;12). Hum Genet 78, 148-150. Latif, F. et al. (1993). Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 260, 1317-1320.

Monissey, C et al. (2001). Epigenetic inactivation of the RASSFIA 3p21.3 tumor suppressor gene in both clear cell and papillary renal cell carcinoma. Cancer Res. 61, 7277-7281. Nickerson, M.L. et al (2002). Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with the Birt-Hogg-Dube syndrome. Cancer Cell 2, 157-164.

Ohta, M. et al. (1996). The FHIT gene, spanning the chromosome 3pl4.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell 84, 587-597.

Ortiz- Vega, S. et al. (2002). The putative tumor suppressor RASSFIA homodimerizes and heterodimerizes with the Ras-GTP binding protein Nore 1. Oncogene 21, 1381-1390.

Pimenta, A.F. et al. (1996). cDNA cloning and structural analysis of the human limbic-system- associated membrane protein (LAMP). Gene 170, 189-195.

Podolski, J. et al. (2001). Characterization of a familial RCC-associated t(2;3)(q33;q21) chromosome translocation. J. Hum. Genet. 46, 685-693. Schmidt, L. et al. (1995). Mechanism of tumorigenesis of renal carcinomas associated with the constitutional chromosome 3;8 translocation. C I ancer J. Sci. Am. 1, 191.

Sellar, G. C. et al. (2003). OPCML at 1 lq25 is epigenetically inactivated and has tumor-suppressor function in epithelial ovarian cancer. Nat. Genet. 34, 337-343.

Siprashvili, Z. et al. (1997). Replacement of Fhit in cancer cells suppresses tumorigenicity. Proc Natl Acad Sci U S A 94, 13771-13776.

Storkel, S et al. (1997). Classification of renal cell carcinoma: Workgroup No. 1. Union Internationale Contre le Cancer (UICC) and the American Joint Committee on Cancer (AJCC). Cancer 80, 987-989.

Teh, B.T. et al. (1997). Familial non-VHL non-papillary clear-cell renal cancer. Lancet 349, 848-849.

Tomlinson, IP. et al. (2002). Germline mutations in FH predispose to dominantly inherited uterine fibroids, skin leiomyomata and papillary renal cell cancer. Nat. Genet. 30, 406-410.

Tommasi, S. et al. (2002). RASSF3 and NOREl : identification and cloning of two human homologues of the putative tumor suppressor gene RASSF1. Oncogene 21, 2713-2720. van den Berg, A. et al. (1997). Involvement of multiple loci on chromosome 3 in renal cell cancer development. Genes Chromosomes Cancer 19, 59-76. van Kessel, A.G. et al. (1999). Renal cell cancer: chromosome 3 translocations as risk factors. J. Natl. Cancer Inst. 91, 1159-1160.

Vawas, D . et al. (1998). Identification of Norel as a potential Ras effector. J. Biol. Chem. 273, 5439- 5442.

Vos, M.D. et al. (2000). Ras uses the novel tumor suppressor RASSF1 as an effector to mediate apoptosis. J. Biol. Chem. 275, 35669-35672.

Woodward, E.R et al. (2000). Familial clear cell renal cell carcinoma (FCRC): clinical features and mutation analysis of the VHL, MET, and CUL2 candidate genes. J. Med. Genet. 37, 348-353.

Yoon, J.H. et al.. (2001). Hypermethylation of the CpG island of the RASSFIA gene in ovarian and renal cell carcinomas. Int. J. Cancer 94, 212-217. Zbar, B. et al. (2003). Studying cancer families to identify kidney cancer genes. Annu. Rev. Med. 54, 217-233. From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make changes and modifications of the invention to adapt it to various usage and conditions. Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The preceding preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. The entire disclosure of all applications, patents and publications, cited above and in the figures are hereby incorporated in their entirety by reference.

Claims

WHAT IS CLAIMED IS:

1. A method for detecting the presence of clear cell renal cell carcinoma (CC-RCC) in a subject, or the susceptibility of the subject for developing CC-RCC comprising detecting or measuring LSAMP and/or NOREl gene expression in a sample from the subject, and comparing the expression with a baseline level of expression, wherein a reduction in the expression of one or both of said genes compared to the baseline level indicates that the subject suffers from, or is susceptible to CC-RCC.

2. The method of claim 1 wherein the expression is detected or measured as transcription of mRNA encoded by the LSAMP and/or NOREl gene, by detecting or measuring the presence or amount of said RNA in said sample.

3. The method of claim 1 wherein the expression is detected or measured as a polypeptide product encoded by the LSAMP or NOREl gene, by detecting of measuring the presence or amount of LSAMP or NOREl polypeptide in said sample.

4. The method of claim 3 wherein said detecting or measuring is performed with a binding partner for said LSAMP 1 or NOREl polypeptide.

5. The method of claim 4 wherein said binding partner is an antibody specific for an epitope of said LSAMP 1 or NOREl polypeptide and said detecting or measuring is by an irnmunoassay.

6. The method of any of claims 1-5 wherein said sample is a cell, tissue or tissue extract.

7. The method of any of claims 1-5 wherein said sample is a body fluid selected from the group consisting of blood, plasma, serum, urine, saliva or cerebrospinal fluid.

8. The method of claim 7 wherein said sample is a kidney tumor.

9. The method of claim 8 wherein said sample is section of a paraffin embedded tissue section of said kidney tumor.

10. A method for inhibiting a cancer-associated property of a cell in which the expression of the LSAMP and/or NOREl genes is reduced compared to a baseline value, comprising providmg to the cell an effective amount of LSAMP and or NOREl polypeptide or active fragment or variant thereof, wherein said polypeptide fragment or variant augments the level of LSAMP and/or NOREl gene products in the cell, thereby inliibiting said cancer- associated property.

11. The method of claim 10 wherein the providing is by microinjection, liposome- mediated introduction, or electroporation.

12. A method for inhibiting a cancer-associated property of a cell in which the expression of the LSAMP and/or NOREl genes is reduced compared to a baseline value, comprising providing to the cell an effective amount of (a) an LSAMP and/or NOREl polypeptide or active fragment or active variant thereof; (b) an expressible polynucleotide encoding said LSAMP and/or NOREl polypeptide, fragment or variant; or (c) an agent that induces or increases expression of the LSAMP and/or NOREl genes; wherein said polypeptide, fragment or variant, said polynucleotide or said agent results in an increased level ol LSAMP and/or NOREl gene products in the cell, thereby inlribiting said cancer-associated property.

13. The method of claim 12 wherein said property is tumor growth.

14. The method of claim 12 wherein the providing is by microinjection, liposome- mediated transfer, electroporation or microinjection.

15. A method for treating a subject with CC-RCC in whom CC-RCC cells under- express the LSAMP and/or the NOREl gene compared to a baseline value, which method comprises administering to the subject an effective amount of (a) an LSAMP and/or NOREl polypeptide or active fragment or active variant thereof; (b) an expressible polynucleotide encoding said LSAMP and/or NOREl polypeptide, fragment or variant; or (c) an agent that induces or increases expression of the LSAMP and/or NOREl genes; wherein said polypeptide, fragment or variant, said polynucleotide or said agent results in an increased level of LSAMP and/or NOREl gene product in the under-expressing CC-RCC cells, thereby treating said subject.

16. The method of claim 15, wherein the polypeptide, active fragment, active variant, or agent is admimstered systemically or infratumorally.

17. The method of claim 15 wherein the polynucleotide being administered comprises a sequence encode the polypeptide, fragment or variant operably linked to an expression control sequence which promotes or induces expression of the polypeptide in said subject.

18. The method of claim 15 or 17 wherein the polynucleotide is admimstered by injection, by gene gun administration, or by needle-free jet injection.

19. The method of claim 18 wherein the polynucleotide is administered intramuscularly or intratumorally.

20. A pharmaceutical composition comprising (a) as an active moiety, an LSAMP and/or NOREl polypeptide, or an active fragment or variant thereof, or a polynucleotide encoding an LSAMP and/or NOREl polypeptide, or encoding an active fragment or variant of the polypeptide, wherein the polynucleotide is operably linked to an expression control sequence; and (b) a pharmaceutically acceptable carrier.

21. The pharmaceutical composition o f claim 20 wherein the active moiety is said polynucleotide.

22. A kit, suitable for a method of detecting the presence and/or measuring amount of an LSAMP and/or a NOREl polypeptide in a sample, comprising one or more reagents for detecting the polypeptide, and optionally

23. The kit of claim 22 wherein said detecting reagent is an antibody specific for an epitope of the LSAMP or NOREl polypeptide.

24. The kit of claim 23 further comprising one or more reagents for testing the binding of the antibody to a sample polypeptide and/or for facilitating detection of antibody binding.

25. A kit useful in a method detecting the presence and/or amount of a polynucleotide encoding LSAMP and/or NOREl polypeptide in a sample, comprising a nucleic acid probe specific for a LSAMP- or NOREl -encoding DNA or RNA, and, optionally, one or more reagents that facilitate hybridization of the probe to the sample DNA or RNA, and/or that facilitate detection of the hybridized probe.

26. A kit useful in a method for treating a subject with CC-RCC, comprising (a) an LSAMP and/or NOREl polypeptide or active fragment or active variant thereof; (b) an expressible polynucleotide encoding said LSAMP and/or NOREl polypeptide, fragment or variant; or (c) an agent that induces or increases expression of the LSAMP and/or NOREl genes; and optionally, (i) a means for administering the polypeptide to the subject and (ii) instructions for using the kit.

27, The kit of any of claims 21-26 comprising any one or more of: instractions for perfonning the method for which the kit is intended and/or for analyzing and/or evaluating the results of the method, a support on which a cell can be propagated, a support to which a reagent used in the method is immobilized, suitable buffers, media components, or other reagents for performing suitable controls, a computer, a computer-readable medium for storing and/or evaluating the assay results, containers or packaging materials.

28. An antibody specific for an epitope of the LSAMP or a NOREl polypeptide which is useful in a the method of claim 5.