CA2399509A1 - Melanin-concentrating hormone analogs - Google Patents

Abstract

The present invention features truncated MCH analogs active at the MCH
receptor. The truncated MCH analogs are optionally modified peptide derivatives of mammalian MCH. The analogs can bind to the MCH receptor and, preferably, bring about signal transduction. MCH analogs have a variety of different uses including being used as a research tool and being used therapeutically.

Description

TITLE OF THE INVENTION
MELANIN-CONCENTRATING HORMONE ANALOGS
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims priority to provisional application U.S.
Serial No. 60/179,967, filed February 3, 2000, which is hereby incorporated by reference herein.
BACKGROUND OF THE INVENTION
y10 Neuropeptides present in the hypothalamus play a major role in mediating the control of body weight. (Flier, et al., 1998. Cell, 92, 437-440.) Melanin-concentrating hormone (MCH) produced in mammals is a cyclic 19-amino acid neuropeptide synthesized as part of a larger pre-prohormone precursor in the hypothalamus which also encodes neuropeptides NEI and NGE. (Nahon, et al., 1990.
Mol. Efzdocrinol. 4, 632-637; Vaughan, et al., U.S. Patent No. 5,049,655; and Vaughan;~ et al., 1989. EudocriiZOlogy 12~, 1660-1665.) MCH was first identified in salmon pituitary, and in fish ~MCH affects melanin aggregation thus affecting skin pigmentation. In trout and eels MCH has also been shown to be involved in stress induced or CRF-stimulated ACTH release. (Kawauchi, et al., 1983. Nature 305, 321-323.) In humans two genes encoding MCH have been identified that are expressed in the brain. (Breton, et al., 1993. Mol. Brain Res. 18, 297-310.) In mammals MCH has been localized primarily to neuronal cell bodies of the hypothalamus which are implicated in the control of food intake, including perikarya of the lateral hypothalamus and zona inertia. (Knigge, et al., 1996. Peptides 17, 1063-1073.) Pharmacological and genetic evidence suggest that the primary mode of MCH action is to promote feeding (orexigenic). MCH mRNA is up regulated in fasted mice and rats, in the oblob mouse and in mice with targeted disruption in the gene for neuropeptide Y (NPY). (Qu, et al., 1996. Nature 380, 243-247 and Erickson, et al., 1996. Natacre 381, 415-418.) Injection of MCH centrally (ICV) stimulates food intake and MCH antagonizes the hypophagic effects seen with a melanocyte stimulating hormone (ocMSH). (Qu, et al., 1996. Nata~re 380. 243-247.) MCH deficient mice are lean, hypophagic and have increased metabolic rate.
(Shimada, et al., 1998. Nature 396, 670-673.) The administration of MCH has been indicated to useful for promoting eating, appetite or the gain or maintenance of weight. (Maratos-Flier, U.S. Patent No. 5,849,708.) MCH action is not limited to modulation of food intake as effects on the hypothalamic-pituitary-axis have been reported. (Nahon, 1994. Critical Rev. in Neurobiol. 8, 221-262.) MCH may be involved in the body response to stress as MCH can modulate the stress-induced release of CRF from the hypothalamus and ACTH from the pituitary. In addition, MCH neuronal systems may be involved in reproductive or maternal function.
SUMMARY OF THE INVENTION
The present invention features truncated MCH analogs active at the MCH receptor. The truncated MCH analogs are optionally modified peptide derivatives of mammalian MCH. The analogs can bind to the MCH receptor and, preferably, bring about signal transduction. MCH analogs have a variety of different uses including being used as a research tool and being used therapeutically.
Thus, a first aspect of the present invention describes a truncated MCH
analog. The truncated MCH analog is an optionally modified peptide having the structure:
z1_ X1_X2_X3_X4_XS_X6-X7 X8_X9_X10_X11_X12_X13_X14_X15-X16_X17_z2 wherein Xl is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, or glutamic acid, or a derivative thereof;
X2 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, or glutamic acid, or a derivative thereof;
X3 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof;

X4 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, glutamic acid, or norleucine, or a derivative thereof;
XS is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof;
X6 an optionally present amino acid that, if present is either arginine, alanine, leucine, glycine, lysine, proline, asparagine, serine, histidine, nitroarginine, norleucine, or des-amino-arginine, or a derivative thereof, X~ is either cysteine, homocysteine, or penicillamine, or a derivative thereof;
Xg is either methionine, norleucine, leucine, isoleucine, valine, methioninesulfoxide, or methioninesulfone, or a derivative thereof;
X9 is either leucine, isoleucine, valine, alanine, methionine, or 5-aminopentanoic acid, or a derivative thereof;
X10 is either glycine, alanine, leucine, norleucine, cyclohexylalanine, 5-aminopentanoic acid, asparagine, serine, sarcosine, isobutyric, or gamma-aminobutyric acid, or a derivative thereof;
X11 is either arginine, lysine, citrulline, histidine, or nitroarginine, or a derivative thereof;
X12 is either valine, leucine, isoleucine, alanine, or methionine, or a derivative thereof;
X13 is either phenylalanine, tyrosine, D-( p-benzoylphenylalanine), tryptophan, (1')- and (2')-naphthylalanine, cyclohexylalanine, or mono and multi-substituted phenylalanine wherein each substituent is independently selected from the group consisting of O-alkyl, alkyl, OH, N02, NH2, F, I, and Br; or a derivative thereof;
X14 is either arginine, lysine, histidine, norarginine, or 5-aminopentanoic acid or a derivative thereof;
X15 is either proline, alanine, valine, leucine, isoleucine, methionine, sarcosine, or 5-aminopentanoic acid, or a derivative thereof;

X16 is either cysteine, homocysteine, or penicillamine, or a derivative thereof;
X1~ is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof;
Z1 is an optionally present protecting group that, if present, is covalently joined to the N-terminal amino group;
Z2 is an optionally present protecting group that, if present, is covalently joined to the C-terminal carboxy group;
or a labeled derivative of said peptide;
or a pharmaceutically acceptable salt of said peptide or of said labeled derivative.
Unless otherwise stated, those amino acids with a chiral center are provided in the L-enantiomer. Reference to "a derivative thereof ' refers to the corresponding D-amino acid, N-alkyl-amino acid and (3-amino acid.
Another aspect of the present invention describes a method of screening for a compound able to bind a MCH receptor. The method comprises the step of measuring the ability of the compound to effect binding of a truncated MCH
analog to either the MCH receptor, a fragment of the receptor comprising a MCH
binding site, a polypeptide comprising such a fragment, or a derivative of the polypeptide.
Another aspect of the present invention describes a method for increasing weight in a subject. The method comprises the step of administering to the subject an effective amount of a truncated MCH analog to produce a weight increase.
Another aspect of the present invention describes a method for increasing appetite in a subject. The method comprises the step of administering to the subject an effective amount of a truncated MCH analog to produce an appetite increase.
Another aspect of the present invention describes a method for measuring the ability of a compound to decrease weight or appetite in a subject. The method comprising the steps of:
a) administering to the subject an effective amount of a truncated MCH analog to produce a weight increase or appetite increase, b) administering the compound to the subject, and c) measuring the change in weight or appetite of the subject.
Other features and advantages of the present invention are apparent from the additional descriptions provided herein including the different examples.
The provided examples illustrate different components and methodology useful in practicing the present invention. The examples do not limit the claimed invention.
Based on the present disclosure the skilled artisan can identify and employ other components and methodology useful for practicing the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 illustrates the results of an alanine scan where different amino acid residues of human MCH were replaced with alanine. The binding assay was performed by measuring inhibition of (12~I-tyrosine, phenylalaninel3)-MCH
binding to cloned human MCH receptor (CHO clone). Cyclization sites (S-S) are indicated by "*"
DETAILED DESCRIPTION OF THE INVENTION
Truncated MCH analogs contain about 10 to about 17 groups that are amino acids or amino acid derivatives. Using the present application as a guide truncated MCH analogs can be produced having significant MCH receptor activity, and in some cases having activity equal to or better than naturally occurnng mammalian MCH. The smaller size of truncated MCH analogs offers advantages over longer-length MCH such as ease of synthesis and/or increased solubility in physiological buffers.
The MCH receptor is a G-protein coupled receptor that appears to be able to couple to Gi and Gq. Several references describe a receptor that is indicated to be a MCH receptor. (Chambers, et al., 1999. Nature 400, 261-265; Saito, et al., 1999.
Nature 400, 265-269; Bachner, et al., 1999. FEBS Letters 457:522-524; and Shimomura, et al., 1999. Biochemical aiad Biophysical Research Communications 261, 622-626. These references are not admitted to be prior art to the claimed invention.) The nucleic acid encoding for different variants of a MCH receptor is provided for by SEQ. ID. NOS. 1-3. The encoded amino acid sequences of the variants are provided by SEQ. ID. NOS. 4-6. The variants differ from each other by the presence of additional amino acids at the N-terminal. One or more of these variants may be a physiological MCH receptor.
Significant MCH activity is preferably at least about 50%, at least about 75%, at least about 90%, or at least about 95%, the activity of mammalian MCH as determined by a binding assay or MCH receptor activity assay. Examples of such assays are provided below.
MCH analogs have a variety of different uses including being used as a research tool and being used therapeutically. Research tool applications generally involve the use of a truncated MCH analog and the presence of a MCH receptor or fragment thereof. The MCH receptor can be present in different environments such as a mammalian subject, a whole cell, and membrane fragments. Examples of research tool applications of truncated MCH analogs include screening for compounds active at the MCH receptor, determining the presence of the MCH receptor in a sample or preparation, examining the role or effect of MCH, and examining the role or effect of MCH antagonists.
Truncated MCH analogs can be used to screen for both MCH agonists and MCH antagonists. Screening for MCH agonists can be performed, for example, by using a truncated MCH analog in a competition experiment with test compounds.
Screening for MCH antagonists can be performed, for example, by using a truncated MCH analog to produce MCH receptor activity and then measuring the ability of a compound to alter MCH receptor activity.
Truncated MCH analogs can be administered to a subject. A "subject"
refers to a mammal including, for example, a human, a rat, a mouse, or a farm animal.
Reference to subject does not necessarily indicate the presence of a disease or disorder. The term subject includes, for example, mammals being dosed with a truncated MCH analog as part of an experiment, mammals being treated to help alleviate a disease or disorder, and mammals being treated prophylactically to retard or prevent the onset of a disease or disorder.
MCH agonists can be used to achieve a beneficial effect in a subject.
For example, a MCH agonist can be used to facilitate a weight gain, maintenance of weight and/or an appetite increase. Such effects are particularly useful for a patient having a disease or disorder, or under going a treatment, accompanied by weight loss.
Examples of diseases or disorders accompanied by weight loss include anorexia, A)DS, wasting, cachexia, and frail elderly. Examples of treatments accompanied by weight loss include chemotherapy, radiation therapy, and dialysis.

MCH antagonists can also be used to achieve a beneficial effect in a patient. For example, a MCH antagonist can be used to facilitate weight loss, appetite decrease, weight maintenance, cancer (e.g., colon or breast) treatment, pain reduction, stress reduction and/or treatment of sexual dysfunction.
Truncated MCH Analo A truncated MCH analog is an optionally modified peptide having the structure:
z1_ X1_X2_X3_X4_XS_X6-X7 X8_X9_X10_X11_X12_X13_X14_X15-X16_X17_z2 wherein X1 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, or glutamic acid, or a derivative thereof;
preferably, X1 if present is aspartic acid or glutamic acid; more preferably, X1 if present is aspartic acid; and more preferably, X1 is not present;
X2 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, or glutamic acid, or a derivative thereof; preferably, X2 if present is phenylalanine or tyrosine; more preferably, X2 if present is phenylalanine;
and more preferably, X2 is not present;
X3 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof; preferably, X3 if present is aspartic acid or glutamic acid; more preferably, X3 if present is aspartic acid; and more preferably, X3 is not present;
X4 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, glutamic acid, or norleucine, or a derivative thereof;
preferably, X4 if present is methionine, leucine, isoleucine, valine, alanine or norleucine;
more preferably, X4 if present is methionine; and more preferably, X4 is not present;
XS is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof; preferably, XS if present is leucine, methionine, isoleucine, valine or alanine; more preferably, XS if present is leucine; and more preferably, XS is not present;
X6 is an optionally present amino acid that, if present is either arginine, alanine, leucine, glycine, lysine, proline, asparagine, serine, histidine, nitroarginine, norleucine, or des-amino-arginine, or a derivative thereof;
preferably X6 is not present or is either arginine, D-arginine, D-norleucine, D-proline, D-serine, or D-asparagine; more preferably X6 is arginine or D-arginine;
X~ is either cysteine, homocysteine, or penicillamine, or a derivative thereof; preferably, X~ is cysteine;
Xg is either methionine, norleucine, leucine, isoleucine, valine, methioninesulfoxide, or methioninesulfone, or a derivative thereof;
preferably, Xg is methionine, norleucine, or N-methyl norleucine;
X9 is either leucine, isoleucine, valine, alanine, methionine, or 5-aminopentanoic acid, or a derivative thereof; preferably, X9 is leucine;
X10 is either glycine, alanine, leucine, norleucine, cyclohexylalanine, 5-aminopentanoic acid, gamma-aminobutyric acid, asparagine, serine, sarcosine, or isobutyric or a derivative thereof; preferably, X10 is either glycine, alanine, leucine, norleucine, asparagine, serine, D-norleucine, D-proline, gamma-aminobutyric acid, or sarcosine; more preferably X10, is either glycine, leucine, norlecine, asparagine, or serene;
X11 is either arginine, lysine, citrulline, histidine, or nitroarginine, or a derivative thereof; preferably, X11 is arginine;
X12 is either valine, leucine, isoleucine, alanine, or methionine, or a derivative thereof; preferably, X12 is valine;
X13 is either phenylalanine, tyrosine, D-( p-benzoylphenylalanine), tryptophan, ( 1' )- and (2' )-naphthylalanine, cyclohexylalanine, or mono and multi-substituted phenylalanine wherein each substituent is independently selected from the group consisting of O-alkyl, alkyl, OH, N02, NH2, F, I, and Br; or a derivative thereof; preferably, X13 is phenylalanine, (2')napthylalanine, p-fluoro-phenylalanine, tyrosine, or cyclohexylalanine;
X14 is either arginine, lysine, histidine or norarginine, or 5-aminopentanoic acid, or a derivative thereof; preferably, X14 is arginine;
X15 is either proline, alanine, valine, leucine, isoleucine, methionine, sarcosine, or 5-aminopentanoic acid, or a derivative thereof; preferably, X15 is proline or sarcosine;
X16 is either cysteine, homocysteine, or penicillamine, or a derivative thereof; preferably, X16 is cysteine or D-cysteine;
X1~ is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof;
preferably, X1~ if present is tyrosine or tryptophan; more preferably X1~ is not present;
Z1 is an optionally present protecting group that, if present, is covalently joined to the N-terminal amino group;
Z2 is an optionally present protecting group that, if present, is covalently joined to the C-terminal carboxy group;
or a labeled derivative of said peptide;
or a pharmaceutically acceptable salt of said peptide or of said labeled derivative.
The present invention is meant to comprehend diastereomers as well as their racemic and resolved enantiomerically pure forms. Truncated MCH analogs can contain D-amino acids, L-amino acids or a combination thereof. Preferably, amino acids present in a truncated MCH analog are the L-enantiomer.
In different embodiments, MCH analogs contain a preferred (or more preferred) group at one or more different locations. More preferred embodiments contain preferred (or more preferred) groups in each of the different locations.
A protecting group covalently joined to the N-terminal amino group reduces the reactivity of the amino terminus under ira vivo conditions. Amino protecting groups include optionally substituted -C1_lo alkyl, optionally substituted -Ca-to alkenyl, optionally substituted aryl, -C1_~ alkyl optionally substituted aryl, -C(O)-(CHZ)1_~-COOH, -C(O)- C1_6 alkyl, -C(O)-optionally substituted aryl, -C(O)-O-C1_~ alkyl, or -C(O)-O-optionally substituted aryl. Preferably, the amino terminus protecting group is acetyl, propyl, succinyl, benzyl, benzvloxycarbonyl or t-butyloxycarbonyl.
A protecting group covalently joined to the C-terminal carboxy group reduces the reactivity of the carboxy terminus under in vivo conditions. The carboxy terminus protecting group is preferably attached to the a-carbonyl group of the last amino acid. Carboxy terminus protecting groups include amide, methylamide, and ethylamide.
"Alkyl" refers to carbon atoms joined by carbon-carbon single bonds.
The alkyl hydrocarbon group may be straight-chain or contain one or more branches or cyclic groups. Preferably, the alkyl group is 1 to 4 carbons in length.
Examples of alkyl include methyl, ethyl, propyl, isopropyl, cyclopropyl, butyl, and t-butyl. Alkyl substituents are selected from the group consisting of halogen (preferably -F
or -Cl) -OH, -CN, -SH, -NHZ, -NO2, -C1_2 alkyl substituted with 1 to 6 halogens (preferably -F or -Cl, more preferably -F), -CF;, -OCH3, or -OCF3.
"Alkenyl" refers to a hydrocarbon group containing one or more carbon-carbon double bonds. The alkenyl hydrocarbon group may be straight-chain or contain one or more branches or cyclic groups. Preferably, the alkenyl group is 2 to 4 carbons in length. Alkenyl substituents are selected from the group consisting of halogen (preferably -F or -Cl), -OH, -CN, -SH, -NHS, -NO2, -C1_~ alkyl substituted with I to 5 halogens (preferably -F or -Cl, more preferably -F), -CF;, -OCH3, or -OCF3.
"Aryl" refers to an optionally substituted aromatic group with at least one ring having a conjugated pi- electron system, containing up to two conjugated or fused ring systems. Aryl includes carbocyclic aryl. heterocyclic aryl and biaryl groups. Preferably, the aryl is a 5 or 6 membered ring, more preferably benzyl. Aryl substituents are selected from the group consisting of -C,_4 alkyl, -C~_4 alkoxy, halogen (preferably -F or -Cl), -OH, -CN, -SH, -NHS, -NO~, -CI_2 alkyl substituted with 1 to 5 halogens (preferably -F or -Cl, more preferably -F), -CF3, or -OCF;.
A labeled derivative indicates the alteration of a substituent with a detectable label. Examples of detectable labels include luminescent, enzymatic, and radioactive labels. A preferred radiolabel is l2sI. Both the type of label and the position of the label can effect MCH activity. Labels should be selected so as not to substantially alter the activity of the truncated MCH analog at the MCH
receptor. The effect of a particular label on MCH activity can be determined using assays measuring MCH activity and/or binding.
In naturally occurring full length MCH, alteration of the tyrosine at position 13 by labeling with lzsl substantially effects MCH activity. (Drozdz, et al., 1995. FEES letters 359, 199-202.) lz'I labeled analogs of full length mammalian MCH having substantial activity can be produced, for example, by replacing the tyrosine at position 13 with a different group, then replacing valine at position 19 with tyrosine, and labeling the tyrosine. Examples of such analogs include [lz'I][Phel3, Tryl9]-MCH and (D-(p-benzoylphenylalanine)13, tyrosinel9)-MCH. (Drozdz, et al., FEBS letters 359, 199-202, 1995; and Drozdz, et al., J. Peptide Sci. 5, 234-242, 1999.) In preferred embodiments the optionally modified peptide has the structure:
Zl_ X6-X7 X8_X9_X10_X11_X12_X13_X14_X15-X16_X17_z2 wherein the different groups, and preferred groups, are as described above.
In different embodiments the truncated MCH analog is a peptide of SEQ. ID. NOS. 7, 8, 9, or 10, a labeled derivative of said peptide or a pharmaceutically acceptable salt of said peptide or of said labeled derivative. SEQ.
)D. NOS. 7-12 are made up of L-amino acids and have the following sequences ("*"
indicates cyclization (S-S)):
* *
SEQ. >D. NO. 7: Ac-Arg-Cys-Met-Leu-Gly-Arg-Val-Tyr-Arg-Pro-Cys-amide;
SEQ. ID. NO. 8: Ac-Arg-Cys-Met-Leu-Gly-Arg-Val-Phe-Arg-Pro-Cys-Tyr-amide;
*
SEQ. ID. NO. 9: Ac-Cys-Met-Leu-Gly-Arg-Val-Tyr-Arg-Pro-Cys-amide;
SEQ. >D. NO. 10:
* x Asp-Phe-Asp-Met-Leu-Arg-Cys-Met-Leu-Gly-Arg-Val-Tyr-Arg-Pro-Cys-amide;

i'VO 01/57070 PCT/USO1/03293 * *
SEQ. )17. NO. 12: Ac-Cys-Met-Leu-Gly-Arg-Val-Tyr-Arg-Pro-Cys-Trp-Gln-Val;
SEQ. >D. NO. 13:
*
Asp-Phe-Asp-Nle-Leu-Arg-Cys-Nle-Leu-Gly-Arg-V al-Tyr-Arg-Pro-Cys-Trp-Gln-Val;
SEQ. >D. NO. 14:
* *
Asp-Phe-Ala-Met-Leu-Arg-Cys-Met-Leu-Gly-Arg-Val-Phe-Arg-Pro-Cys-Trp-Gln-Tyr.
In additional embodiments the peptide has a sequence selected from the group consisting of SEQ. >D. NOs. 7, 8, 10, 15, 24, 25, 27, 28, 30-49, 51, 52, 56, 57, 61, 62, 63, 65-67, 69-72, and 77, is a labeled derivative of said peptide or a pharmaceutically acceptable salt of said peptide or of said labeled derivative.
Preferred sequences are those with an IC50 less than 0.3 nM, preferably less than 0.1 nM; and/or those having a % activation greater than about 90%, preferably greater than 100%. Examples of preferred sequences are provided in Example 4, Tables 1-7.
Truncated MCH analogs can be produced using techniques well known in the art. For example, a polypeptide region of a truncated MCH analog can be chemically or biochemically synthesized and, if desired modified to produce a blocked N-terminus and/or blocked C-terminus. Techniques for chemical synthesis of polypeptides are well known in the art. (See e.g., Vincent, in Peptide and Protein Drug Delivery, New York, N.Y., Dekker, 1990.) Examples of techniques for biochemical synthesis involving the introduction of a nucleic acid into a cell and expression of nucleic acids are provided in Ausubel, Current Protocols in Molecular-Biology, John Wiley, 1987-1998, and Sambrook, et al., in Molecular Cloning, A
Laboratory Manual, 2°d Edition, Cold Spring Harbor Laboratory Press, 1989.
MCH Receptor Binding Assay Assays measuring the ability of a compound to bind a MCH receptor employ a MCH receptor, a fragment of the receptor comprising a MCH binding site, a polypeptide comprising such a fragment, or a derivative of the polypeptide.
Preferably, the assay uses the MCH receptor or a fragment thereof.
A polypeptide comprising a MCH receptor fragment that binds MCH
can also contain one or more polypeptide regions not found in a MCH receptor.
A
S derivative of such a polypeptide comprises a MCH receptor fragment that binds MCH
along with one or more non-peptide components.
The MCH receptor amino acid sequence involved in MCH binding can be readily identified using labeled MCH or truncated MCH analogs and different receptor fragments. Different strategies can be employed to select fragments to be tested to narrow down the binding region. Examples of such strategies include testing consecutive fragments about 15 amino acids in length starting at the N-terminus, and testing longer length fragments. If longer length fragments are tested, a fragment binding MCH can be subdivided to further locate the MCH binding region.
Fragments used for binding studies can be generated using recombinant nucleic acid techniques.
Binding assays can be performed using individual compounds or preparations containing different numbers of compounds. A preparation containing different numbers of compounds having the ability to bind to the MCH receptor can be divided into smaller groups of compounds that can be tested to identify the compounds) binding to the MCH receptor. In an embodiment of the present invention a test preparation containing at least 10 compounds is used in a binding assay.
Binding assays can be performed using recombinantly produced MCH
receptor polypeptides present in different environments. Such environments include, for example, cell extracts and purified cell extracts containing the MCH
receptor polypeptide expressed from recombinant nucleic acid or naturally occurring nucleic acid; and also include, for example, the use of a purified MCH receptor polypeptide produced by recombinant means or from naturally occurnng nucleic acid which is introduced into a different environment.
Screening for MCH Receptor Active Compounds Screening for MCH active compounds is facilitated using a recombinantly expressed MCH receptor. Using recombinantly expressed MCH
receptor polypeptides offers several advantages such as the ability to express the receptor in a defined cell system so that response to MCH receptor active compounds can more readily be differentiated from responses to other receptors. For example, the MCH receptor can be expressed in a cell line such as HEK 293, COS 7, and CHO
not normally expressing the receptor by an expression vector, wherein the same cell line without the expression vector can act as a control.
Screening for MCH receptor active compounds is facilitated through the use of a truncated MCH analog in the assay. The use of a truncated MCH
analog in a screening assay provides for MCH receptor activity. The effect of test compounds on such activity can be measured to identify, for example, allosteric modulators and antagonists. Additionally, such assays can be used to identify agonists.
MCH receptor activity can be measured using different techniques such as detecting a change in the intracellular conformation of the MCH
receptor, Gi or Gq activity, and/or intracellular messengers. Gi activity can be measured using techniques well known in the art such as a melonaphore assay, assays measuring cAMP production, inhibition of cAMP accumulation, and binding of 35S-GTP.
cAMP can be measured using different techniques such as radioimmunoassay and indirectly by cAMP responsive gene reporter proteins.
Gq activity can be measured using techniques such as those measuring intracellular Ca2+. Examples of techniques well known in the art that can be employed to measure Ca2+ include the use of dyes such as Fura-2 and the use of Ca2+-bioluminescent sensitive reporter proteins such as aequorin. An example of a cell line employing aequorin to measure G-protein activity is HEK293/aeql7.
(Button, et a1.,1993. Cell Calcium 14, 663-671, and Feighner, et al., 1999.
Science 284, 2184-2188, both of which are hereby incorporated by reference herein.) Chimeric receptors containing a MCH binding region functionally coupled to a G protein can also be used to measure MCH receptor activity. A
chimeric MCH receptor contains an N-terminal extracellular domain; a transmembrane domain made up of transmembrane regions, extracellular loop regions, and intracellular loop regions; and an intracellular carboxv terminus.
Techniques for producing chimeric receptors and measuring G protein coupled responses are provided for in, for example, International Application Number WO
97/05252, and U.S. Patent Number 5,264,565, both of which are hereby incorporated by reference herein.

Weight or Appetite Alteration Truncated MCH analogs can be used in methods to increase or maintain weight and/or appetite in a subject. Such methods can be used, for example, as part of an experimental protocol examining the effects of MCH antagonists, to achieve a beneficial effect in a subject and/or to further examine the physiological effects of MCH.
Experimental protocols examining the effects of MCH antagonists can be performed, for example, by using a sufficient amount of a truncated MCH
analog to produce a weight or appetite increase in a subject and then examining the effect of a test compound. Changes in weight and appetite can be measured using techniques well known in the art.
Increasing weight or appetite can be useful for maintaining weight or producing a weight or appetite gain in an under weight subject, or in a patient having a disease or undergoing treatment that effects weight or appetite. In addition, for example, farm animals such as pigs, cows and chickens can be treated to gain weight.
Under weight subjects include those having a body weight about 10%
or less, 20% or less, or 30% or less, than the lower end of a "normal" weight range or Body Mass Index ("BMI"). "Normal" weight ranges are well known in the art and take into account factors such as a patient age, height, and body type.
BMI measures your height/weight ratio. It is determined by calculating weight in kilograms divided by the square of height in meters. The BMI
"normal"
range is 19-22.
Administration Truncated MCH analogs can be formulated and administered to a subject using the guidance provided herein along with techniques well known in the art. The preferred route of administration ensures that an effective amount of compound reaches the target. Guidelines for pharmaceutical administration in general are provided in, for example, Remiizgton's Pharmaceutical Sciences 18''' Edition, Ed.
Gennaro, Mack Publishing, 1990, and Modern Pharmaceutics 2nd Edition, Eds.
Banker and Rhodes, Marcel Dekker, Inc., 1990, both of which are hereby incorporated by reference herein.
Truncated MCH analogs can be prepared as acidic or basic salts.
Pharmaceutically acceptable salts (in the form of water- or oil-soluble or dispersible products) include conventional non-toxic salts or the quaternary ammonium salts that are formed, e.g., from inorganic or organic acids or bases. Examples of such salts include acid addition salts such as acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, tosylate, and undecanoate; and base salts such as ammonium salts, alkali metal salts such as sodium and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, salts with organic bases such as dicyclohexylamine salts, N-methyl-D-glucamine, and salts with amino acids such as arginine and lysine.
Truncated MCH analogs can be administered using different routes including oral, nasal, by injection, transdermal, and transmucosally. Active ingredients to be administered orally as a suspension can be prepared according to techniques well known in the art of pharmaceutical formulation and may contain microerystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners/flavoring agents. As immediate release tablets, these compositions may contain microcrystalline cellulose, dicalcium phosphate, starch, magnesium stearate and lactose and/or other excipients, binders, extenders, disintegrants, diluents and lubricants.
Truncated MCH analogs may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form. When administered by injection, the injectable solution or suspension may be formulated using suitable non-toxic, parenterally-acceptable diluents or solvents, such as Ringer's solution or isotonic sodium chloride solution, or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
Suitable dosing regimens are preferably determined taking into factors well known in the art including type of subject being dosed; age, weight, sex and medical condition of the subject; the route of administration; the renal and hepatic function of the subject; the desired effect; and the particular compound employed.

WO 01/57070 PCT/USOi/03293 Optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug. The daily dose for a subject is expected to be between 0.01 and 1,000 mg per subject per day.
Truncated MCH analogs can be provided in kit. Such a kit typically contains an active compound in dosage forms for administration. A dosage form contains a sufficient amount of active compound such that a weight or appetite increase can be obtained when administered to a subject during regular intervals, such as 1 to 6 times a day, during the course of 1 or more days. Preferably, a kit contains instructions indicating the use of the dosage form for weight or appetite increase and the amount of dosage form to be taken over a specified time period.
EXAMPLES
Examples are provided below to further illustrate different features of the present invention. The examples also illustrate useful methodology for practicing the invention. These examples do not limit the claimed invention.
Example 1: Synthesis of MCH Analog-s MCH analogs were produced using the procedures described below and varying the stepwise addition of amino acid groups. Other procedures for producing and modifying peptides are well known in the art.
Elongation of peptidyl chains on 4-(2',4'-dimethoxyphenyl-Fmoc-aminomethyl)-phenoxy resin and the acetylation of the N-terminal amino groups of the peptides was performed on a 431A ABI peptide synthesizer. Manufacture-supplied protocols were applied for coupling of the hydroxybenzotriazole esters of amino acids in N-methylpyrrolidone (NMP). The fluorenylmethyloxycarbonyl (Fmoc) group was used as a semipermanent alpha-amino protecting group. whereas the side chains protecting groups were: tert-butyl for aspartic acid and tyrosine, 2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl (Pbf) for arginine, and trityl for cysteine.
Peptides were cleaved from the resin with TFA containing ~ % of anisole. After 2 hours at room temperature the resin was filtered, washed with TFA
and the combined filtrates were evaporated to dryness in vacuo. The residue was triturated with ether, the precipitate which formed was filtered off. washed with ether, and dried.
Crude peptides were dissolved in 5 % acetic acid in water, and the pH
of the solutions were adjusted to ca. 8.2 with diluted ammonium hydroxide. The reaction mixtures were stirred vigorously while 0.05 % solution of potassium ferricyanide (K3Fe(CN)6) in water was added dropwise till the reaction mixture remained yellow for about 5 minutes. After an additional 20 minutes oxidation was terminated with ca. 1 ml of acetic acid and the reaction mixtures were lyophilized.
Crude lyophilized peptides were analyzed by analartical reverse-phase high-pressure liquid chromatography (RP HPLC) on a C18 Vydac column attached to a Waters 600E system with automatic Wisp 712 injector and 991 Photodiode Array detector. A standard gradient system of 0-100% buffer B in 30 minutes was used for analysis: buffer A was 0.1 % trifluoroacetic acid in water and buffer B was 0.1 %
trifluoroacetic acid in acetonitrile. HPLC profiles were recorded at 210 nm and 280 nm. Preparative separations were performed on a Waters Delta Prep 4000 system with a semipreparative C18 RP Waters column. The above-described solvent system of water and acetonitrile, in a gradient of 20-80 % buffer B in 60 minutes, was used for separation. The chromatographically homogenous compounds were analyzed by electrospray mass spectrometry.
Example 2: Aequorin Bioluminescence Functional Assay The aequorin bioluminescence assay is a reliable test for measuring the activity of G protein-coupled receptors that couple through the Ga protein subunit family consisting of Gq and G11 and leads to the activation of phospholipase C, mobilization of intracellular calcium and activation of protein kinase C.
Measurement of MCH receptor activity in the aequorin-expressing stable reporter cell line 293-AEQ17 (Button et al., Cell Calcium 14:663-671, 1993) was performed using a Luminoskan RT luminometer (Labsystems Inc., Gaithersburg, MD). 293-AEQ17 cells (8 x 105 cells plated 18 hours before transfection in a flask) were transfected with 22 ~g of human MCH receptor plasmid using 264 ~g lipofectamine. The open reading frame cDNA (SEQ. ID. NO. 1 ) encoding the human MCH receptor inserted in the mammalian expression vector pcDNA-3 (Invitrogen, Carlsbad, CA) was used for expression studies. Following approximately 40 hours of expression the apo-aequorin in the cells was charged for 4 hours with coelenterazine (10 p,M) under reducing conditions (300 ~M reduced glutathione) in ECB buffer (140 mM NaCI, 20 mM KCI, 20 mM HEPES-NaOH [pH=7.4], 5 mM glucose, 1 mM
MgCl2, 1 mM CaCl2, 0.1 mg/ml bovine serum albumin).
The cells were harvested, washed once in ECB medium and resuspended to X00,000 cells/ml. 100 ~l of cell suspension (corresponding to Sx104 cells) was then injected into the test plate containing MCH or MCH analogs, and the integrated light emission was recorded over 30 seconds, in 0.5 second units.
20 ~uL of lysis buffer (0.190 final Triton X-100 concentration) was then injected and the integrated light emission recorded over 10 seconds, in 0.5 second units. The "fractional response" values for each well were calculated by taking the ratio of the integrated response to the initial challenge to the total integrated luminescence including the Triton X-100 lysis response.
Example 3: Radiolabeled MCH-R Binding Assay Activity of truncated MCH analogs was assayed by measuring the ability of the analog to inhibit binding of [lzsl]-human MCH (Phel3, Tyri9 substituted) to membranes prepared from cells stably expressing the human MCH
receptor. Human MCH (Phe~3, Tyrl~ substituted) used in the assay was radiolabeled with lzsI at l9Tyr to a specific activity of 2000 Ci/mmol (NEN Life Science Products, Boston, MA).
Cell membranes were prepared on ice. Each T-75 flask was rinsed twice with 10 ml of Enzyme-free Cell Dissociation Buffer (Specialty Media, Lavallette, NJ), and the cell monolayer was detached in an additional 10 ml of Enzyme-free Cell Dissociation Buffer by incubation at room temperature for 10 minutes. Dissociated cells were centrifuged (500 x g for 10 minutes at 4°C), resuspended in ~ ml homogenization buffer (10 mM Tris-HCI, pH 7.4, 0.01 mM
Pefabloc, 10 p.M phosphoramidon, 40 p.g/ml bacitracin) and then homogenized using a glass homogenizer (10-15 strokes). The homogenate was centrifuged for 10 minutes (1,000 x g at 4°C). The resulting supernatant was then centrifuged at 38,700 x g for 15 minutes at 4°C. Pelleted membranes were resuspended (passed through 25 gauge needle 5 times), snap-frozen on liquid nitrogen, and stored at -80°C
until use.
Binding was performed in a 96-well filter assay or Scintillation Proximity Assay (SPA)-based format using cell membranes from a stable CHO or HEK-293 cell line expressing the MCH receptor. For the filter assay, reactions were performed at 20°C for 1 hour in a total volume of 0.2 ml containing:
0.05 ml of membrane suspension (~3 ~.g protein), 0.02 ml of ['25I]-human MCH (Phel3, Tyr'~

substituted; 30 pM), 0.01 ml of competitor and 0.12 ml of binding buffer (50 mM
Tris-HC1, pH 7.4, 10 mM MgCl2, 2 mM EDTA, 200 ~g/ml bacitracin, 1 ~,M
phosphoramidon).
Bound radioligand was separated by rapid vacuum filtration (Packard Filtermate 96-well cell harvester) through GF/C filters pretreated for 1 hour with 1 %
polyethylenimine. After application of the membrane suspension to the filter, the filters were washed 3 times with 3 ml each of ice-cold 50 mM Tris-HCI, pH 7.4, mM MgCl2, 2 mM EDTA, 0.04 % Tween 20 and the bound radioactivity on the filters was quantitated by scintillation counting (TopCount device). Specific binding (>80 % of total) is defined as the difference between total binding and non-specific binding conducted in the presence of 100 nM unlabeled human MCH.
For the SPA-based assay, WGA-PVT beads (NEN Life Sciences Products) were resuspended in Dulbecco's PBS with calcium and magnesium (500 mg beads in 4 ml PBS). For each 96-well assay plate, 0.18 ml of beads was pre-coated with MCH receptor by mixing with 0.2 ml MCH receptor CHO cell membranes (~ 0.2-4 mg protein) and 1.5 ml SPA assay buffer (50 mM Tris-HCI, pH
7.4, 10 mM MgCl2, 2 mM EDTA, 0.1 % BSA, 12 % glycerol). The suspension was mixed gently for 20 minutes, 12.3 ml of assay buffer and protease inhibitors were added (final concentration given): 2 ~g/ml leupeptin, 10 qM phosphoramidon, 40 ~g/ml bacitracin, 5 ~.g/ml aprotinin, 0.1 mM Pefabloc.
Coated beads were kept on ice until use. For each well, 0.145 ml of beads were added to Optiplate assay plates (Packard 6005190), followed by 0.002-0.004 ml of competitor and 0.05 ml of [l2sl]-human MCH (Phel', Tyrl~
substituted;
pM). Binding reactions were allowed to proceed at room temperature for 3 hours.
25 Quantitation was performed by scintillation counting (TopCount device).
Example 4: MCH Activity The activity of different MCH analogs was measured using the procedures described in Examples 2 and 3 above. Tables 1-7 illustrate the activity of 30 different truncated MCH analogs and mammalian MCH (SEQ. ID. NO. 11). Figure illustrates the results of replacing different amino acids of mammalian MCH
with alanine. Based on the guidance provided herein, additional MCH analogs active at the MCH receptor can be obtained.

SEQ. ID. Binding AssayECSp (nM) % Activation at 10 NO. IC50 (nM) ~M

11 0.3 36 100 7 0.12 18 123 ;

8 0.16 36 123 9 1.6 300 74 0.3 99 j 12 6.4 492 3 I

13 1.5 65.9 14 0.5 62.2 ICSp was determined using a SPA based assay.
ECSp (nM) and % Activation at 10 ~M were determined using aequorin functional assays.
Table 2 illustrates the affect of different D-amino acids.

Ac-Arg6-Cys~-Met$-Leu9-G
1y' -Arg"-Val' 2-Tyr' 3-Arg' 4-Pro' 5-Cys' Activit SEQ. ID. Compound ICSp ECSp Activation NO. (nM) (nM) %

11 0.3 30.9 100 7 0.5 20 99 D-ArQ 0.46 45 86 16 D-C s 7.78 909 34 17 D-Met >1000 Inactive 18 D-Leu 1520 Inactive 19 D-ArQ >1000 Inactive D-Val 381 Inactive 21 D-T r >1000 Inactive 22 D-Ar 368 Inactive 23 D-Pro 584 Inactive 24 D-Cys 0.8 133 76 Table 3 illustrates the effect of different N-methyl-amino acids.

Ac-Args-Cys~-M
et$-Le ug-G lye -Arg' 1-Val 12-Tyre 3-Arg' 4-P ro ~ 5-Cys16-N

Activit SEQ. ID. Compound IC50 EC50 Activation NO. (nM) (nM) 11 0.3 30.9 100 7 1.4 20 99 25 N-Me-Nle 0.16 20 110 26 N-Me-Leu 1070 > 10000 3 @ 1 27 Sar 2.3 140 95 28 N-Me-Ars 43 10 110 29 N-Me-Ara 643 >1000 30 Sar ' 0.36 25 113 , j Table 4 illustrates the affect of different alterations to position 6 of the SEQ. >D. NO. 7 MCH analog.

Xs-Cys~-Met$-Leu9-Glyi-Argi 1_Va112-Tyrl3-Argl4-Pro1'-Cysl6-NH2 Activit SEQ. ID. Position IC50 ECSp Activation NO. 6 (~) (nM) modification 11 0.3 30.9 100 7 1.4 20 99 31 Ac-Ala 27 114 135 32 Ac-Nle 40 117 107 33 Ac-Pro 3.4 59 133 34 Ac-Asn 2.6 150 96 35 Ac-Ser 4.5 207 120 36 Ac-Glu 19 935 113 38 Ac 1.6 144 82 39 Ars 0.13 14 106 40 4 NH,-Ar~0.48 38.5 49 41 Ac-D-Ara 0.46 45 86 42 Ac-D-Nle 1.2 110 97 43 Ac-D-Pro 0.82 60 96 44 Ac-D-Asn 3 340 94 45 Ac-D-Ser 2.3 170 93 46 Ac-D-Glu 8 ~ 820-Table 5 illustrates the affect of different alterations to position 10 of the SEQ. >D. NO. 7 MCH analog.
TART.F 5 Ac-Arg6-Cys~-Met$-Leu9-1 -Arg11-Va112-Tyre 3-Arg t 4-P rot 5-Cys~ 6-N

Activit SEQ. ID. Position 10 IC50 ECSp Activation NO. modification ~nMl (~) %

11 0.3 30.9 100 7 0.5 20 99 47 Ala 0.59 31 104 48 Leu 0.06 23 106 49 Nle 0.04 15 106 50 Pro 700 519 4 51 Asn 0.23 23 106 52 Ser 0.32 65 104 53 L s 110 4500 25 54 Glu 190 > 10000 12 55 D-Leu 16 750 23 56 D-Nle 2.4 215 33 57 D-Pro 1.2 190 90 58 D-Glu 40% @ > 10000 59 D-L s >1000 >10000 60 -Ala 390 >1000 3.2 61 -Abu 2.1 30.6 101 Table 6 illustrates the affect of different alterations to position 13 of the SEQ. >D. NO. 7 MCH analog.

Ac-Arg6-Cys~-Met$-Leu9-G
1y1 -Arg"-Val~
2-Tyrl3-Argl4-ProlS-Cys16-N

Activit SEQ. ID. Position 13 ICSp ECSp Activation NO. modification 11 0.3 30.9 100 7 1.4 20 99 62 Phe 1 46 96 63 T 3.8 890 83 64 His 13.1 3400 66 65 (2~Na1 0.15 54 105 66 Phe( F) 0.6 108 98 67 Phe( NH2) I 3.2 610 88 68 Phe( COON) > 1000 > 10000 I 69 Cha 0.09 122 93 Table 7 illustrates the affect of some alteration combinations and some alterations to position 8 of the SEQ. >I7. NO. 7 MCH analog.

Ac-Args-Cys~-Met$-Leu9-G
lye -Arg' 1-Val12-Tyr13-Arg~
4-P ro15-Cys16-N

Activit SEQ. ID. NO. Compound ICSp ECSp Activation (~) (nM) %

11 0.3 30.9 100 7 1.4 20 99 70 Ava ' 3.7 587 82 71 D-Ar ,Ava' 3.7 1080 72 72 Ava ' 6.2 406 75 73 D-Ar ,Ava ' ' 19.5 1300 28 74 D-Pro ,Ava '' 700 1530 3 75 DAr ,Ava '' 250 >10000 3 76 Ava ' , Ava ' ' S0 > 10000 3 77 Nle 0.5 44 105 78 DAr~ ,D-Nle 25 72 ( 4 WO 01/57070 PCT/USOi/03293 Other embodiments are within the following claims. While several embodiments have been shown and described, various modifications may be made without departing from the spirit and scope of the present invention.

SEQUENCE LISTING
<110> Merck & Co., Inc.
<120> MELANIN-CONCENTRATING HORMONE ANALOGS
<130> 20590Y PCT
<150> 60/179,967 <151> 2000-02-03 <160> 78 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 1062 <212> DNA
<213> Human <400>

atggacctggaagcctcgctgctgcccactggtcccaacgccagcaacacctctgatggc 60 cccgataacctcacttcggcaggatcacctcctcgcacggggagcatctcctacatcaac 120 atcatcatgccttcggtgttcggcaccatctgcctcctgggcatcatcgggaactccacg 180 gtcatcttcgcggtcgtgaagaagtccaagctgcactggtgcaacaacgtccccgacatc 240 ttcatcatcaacctctcggtagtagatctcctctttctcctgggcatgcccttcatgatc 300 caccagctcatgggcaatggggtgtggcactttggggagaccatgtgcaccctcatcacg 360 gccatggatgccaatagtcagttcaccagcacctacatcctgaccgccatggccattgac 420 cgctacctggccactgtccaccccatctcttccacgaagttccggaagccctctgtggcc 480 accctggtgatctgcctcctgtgggccctctccttcatcagcatcacccctgtgtggctg 540 tatgccagactcatccccttcccaggaggtgcagtgggctgcggcatacgcctgcccaac 600 ccagacactgacctctactggttcaccctgtaccagtttttcctggcctttgccctgcct 660 tttgtggtcatcacagccgcatacgtgaggatcctgcagcgcatgacgtcctcagtggcc 720 cccgcctcccagcgcagcatccggctgcggacaaagagggtgacccgcacagccatcgcc 780 atctgtctggtcttctttgtgtgctgggcaccctactatgtgctacagctgacccagttg 840 tccatcagccgcccgaccctcacctttgtctacttatacaatgcggccatcagcttgggc 900 tatgccaacagctgcctcaacccctttgtgtacatcgtgctctgtgagacgttccgcaaa 960 cgcttggtcctgtcggtgaagcctgcagcccaggggcagcttcgcgctgtcagcaacgct 1020 cagacggctgacgaggagaggacagaaagcaaaggcacctga 1062 <210>

<211>

<212>
DNA

<213>
Human <400>

atgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacg 60 gaggaagacccccttcccaactgcggggcttgcgctccgggacaaggtggcaggcgctgg 120 aggctgccgcagcctgcgtgggtggaggggagctcagctcggttgtgggagcaggcgacc 180 ggcactggctggatggacctggaagcctcgctgctgcccactggtcccaacgccagcaac 240 acctctgatggccccgataacctcacttcggcaggatcacctcctcgcacggggagcatc 300 tcctacatcaacatcatcatgccttcggtgttcggcaccatctgcctcctgggcatcatc 360 gggaactccacggtcatcttcgcggtcgtgaagaagtccaagctgcactggtgcaacaac 420 gtccccgacatcttcatcatcaacctctcggtagtagatctcctctttctcctgggcatg 480 cccttcatgatccaccagctcatgggcaatggggtgtggcactttggggagaccatgtgc 540 accctcatcacggccatggatgccaatagtcagttcaccagcacctacatcctgaccgcc 600 atggccattgaccgctacctggccactgtccaccccatctcttccacgaagttccggaag 660 ccctctgtggccaccctggtgatctgcctcctgtgggccctctccttcatcagcatcacc 720 cctgtgtggctgtatgccagactcatccccttcccaggaggtgcagtgggctgcggcata 780 cgcctgcccaacccagacactgacctctactggttcaccctgtaccagtttttcctggcc 840 WO 01/5'7070 PCT/USO1/03293 tttgccctgccttttgtggtcatcacagccgcatacgtgaggatcctgcagcgcatgacg 900 tcctcagtggcccccgcctcccagcgcagcatccggctgcggacaaagagggtgacccgc 960 acagccatcgccatctgtctggtcttctttgtgtgctgggcaccctactatgtgctacag "020 ctgacccagttgtccatcagccgcccgaccctcacctttgtctacttatacaatgcggcc .080 atcagcttgggctatgccaacagctgcctcaacccctttgtgtacatcgtgctctgtgag 1140 acgttccgcaaacgcttggtcctgtcggtgaagcctgcagcccaggggcagcttcgcgct "200 gtcagcaacgctcagacggctgacgaggagaggacagaaagcaaaggcacctga "-254 <210>

<211>

<212>
DNA

<213>
Human <400>

atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagc 60 ggctgccaggctacggaggaagacccccttcccaactgcggggcttgcgctccgggacaa 120 ggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctcggttg 180 tgggagcaggcgaccggcactggctggatggacctggaagcctcgctgctgcccactggt 240 cccaacgccagcaacacctctgatggccccgataacctcacttcggcaggatcacctcct 300 cgcacggggagcatctcctacatcaacatcatcatgccttcggtgttcggcaccatctgc 360 ctcctgggcatcatcgggaactccacggtcatcttcgcggtcgtgaagaagtccaagctg 420 cactggtgcaacaacgtccccgacatcttcatcatcaacctctcggtagtagatctcctc 480 tttctcctgggcatgcccttcatgatccaccagctcatgggcaatggggtgtggcacttt 540 ggggagaccatgtgcaccctcatcacggccatggatgccaatagtcagttcaccagcacc 600 tacatcctgaccgccatggccattgaccgctacctggccactgtccaccccatctcttcc 660 acgaagttccggaagccctctgtggccaccctggtgatctgcctcctgtgggccctctcc 720 ttcatcagcatcacccctgtgtggctgtatgccagactcatccccttcccaggaggtgca 780 gtgggctgcggcatacgcctgcccaacccagacactgacctctactggttcaccctgtac 840 cagtttttcctggcctttgccctgccttttgtggtcatcacagccgcatacgtgaggatc 900 ctgcagcgcatgacgtcctcagtggcccccgcctcccagcgcagcatccggctgcggaca 960 aagagggtgacccgcacagccatcgccatctgtctggtcttctttgtgtgctgggcaccc 1020 tactatgtgctacagctgacccagttgtccatcagccgcccgaccctcacctttgtctac 1080 ttatacaatgcggccatcagcttgggctatgccaacagctgcctcaacccctttgtgtac 1140 atcgtgctctgtgagacgttccgcaaacgcttggtcctgtcggtgaagcctgcagcccag 1200 gggcagcttcgcgctgtcagcaacgctcagacggctgacgaggagaggacagaaagcaaa 1260 ggcacctga <210>

<211>

<212>
PRT

<213>
Human <400> 4 Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Ala Ser Asn Thr Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg Thr Gly Ser Ile Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly Thr Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Thr Val Ile Phe Ala Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met Pro Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Glu Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Thr Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Thr Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Pro Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Gly Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe Thr Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile Thr Ala Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala Pro Ala Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly Thr <210> 5 <211> 417 <212> PRT
<213> Human <400> 5 Met Lys Lys Gly Val Gly Arg Ala Val Gly Leu Gly Gly Gly Ser Gly Cys Gln Ala Thr Glu Glu Asp Pro Leu Pro Asn Cys Gly Ala Cys Ala Pro Gly Gln Gly Gly Arg Arg Trp Arg Leu Pro Gln Pro Ala Trp Val Glu Gly Ser Ser Ala Arg Leu Trp Glu Gln Ala Thr Gly Thr Gly Trp Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Ala Ser Asn Thr Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg Thr Gly Ser Ile Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly Thr Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Thr Val Ile Phe Ala Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met Pro Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Glu Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Thr Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Thr Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Pro Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Gly Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe Thr Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile Thr Ala Ala Tyr Val Arg Ile Leu Gln Arg Met Ti-ir Ser Ser Val Ala Pro Ala Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly Thr <210> 6 <211> 422 <212> PRT
<213> Human <400> 6 Met Ser Val Gly Ala Met Lys Lys Gly Val Gly Arg Ala Val Gly Leu Gly Gly Gly Ser Gly Cys Gln Ala Thr Glu Glu Asp Pro Leu Pro Asn Cys Gly Ala Cys Ala Pro Gly Gln Gly Gly Arg Arg Trp Arg Leu Pro Gln Pro Ala Trp Val Glu Gly Ser Ser Ala Arg Leu Trp Glu Gln Ala Thr Gly Thr Gly Trp Met Asp Leu Glu Ala Ser Leu Leu Pro Thr Gly Pro Asn Ala Ser Asn Thr Ser Asp Gly Pro Asp Asn Leu Thr Ser Ala Gly Ser Pro Pro Arg Thr Gly Ser Ile Ser Tyr Ile Asn Ile Ile Met Pro Ser Val Phe Gly Thr Ile Cys Leu Leu Gly Ile Ile Gly Asn Ser Thr Val Ile Phe Ala Val Val Lys Lys Ser Lys Leu His Trp Cys Asn Asn Val Pro Asp Ile Phe Ile Ile Asn Leu Ser Val Val Asp Leu Leu Phe Leu Leu Gly Met Pro Phe Met Ile His Gln Leu Met Gly Asn Gly Val Trp His Phe Gly Glu Thr Met Cys Thr Leu Ile Thr Ala Met Asp Ala Asn Ser Gln Phe Thr Ser Thr Tyr Ile Leu Thr Ala Met Ala Ile Asp Arg Tyr Leu Ala Thr Val His Pro Ile Ser Ser Thr Lys Phe Arg Lys Pro Ser Val Ala Thr Leu Val Ile Cys Leu Leu Trp Ala Leu Ser Phe Ile Ser Ile Thr Pro Val Trp Leu Tyr Ala Arg Leu Ile Pro Phe Pro Gly Gly Ala Val Gly Cys Gly Ile Arg Leu Pro Asn Pro Asp Thr Asp Leu Tyr Trp Phe Thr Leu Tyr Gln Phe Phe Leu Ala Phe Ala Leu Pro Phe Val Val Ile Thr Ala Ala Tyr Val Arg Ile Leu Gln Arg Met Thr Ser Ser Val Ala Pro Ala Ser Gln Arg Ser Ile Arg Leu Arg Thr Lys Arg Val Thr Arg Thr Ala Ile Ala Ile Cys Leu Val Phe Phe Val Cys Trp Ala Pro Tyr Tyr Val Leu Gln Leu Thr Gln Leu Ser Ile Ser Arg Pro Thr Leu Thr Phe Val Tyr Leu Tyr Asn Ala Ala Ile Ser Leu Gly Tyr Ala Asn Ser Cys Leu Asn Pro Phe Val Tyr Ile Val Leu Cys Glu Thr Phe Arg Lys Arg Leu Val Leu Ser Val Lys Pro Ala Ala Gln Gly Gln Leu Arg Ala Val Ser Asn Ala Gln Thr Ala Asp Glu Glu Arg Thr Glu Ser Lys Gly Thr <210> 7 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<221> ACETYLATION
<222> (1)...(1) <221> AMIDATION
<222> (11)...(11) <221> DISULFID
<222> (2)...(11) <223> MCH Analog <400> 7 Arg Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 8 <211> 12 <212> PRT
<213> Artificial Sequence <220>
<221> ACETYLATION
<222> (1)...(1) <221> AMIDATION
<222> (12)...(12) <221> DISULFID
<222> (2)...(11) <223> MCH Analog <400> 8 Arg Cys Met Leu Gly Arg Val Phe Arg Pro Cys Tyr <210> 9 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<221> ACETYLATION
<222> (1)...(1) <221> AMIDATION
<222> (10)...(10) <221> DISULFID
<222> (1)...(10) <223> MCH Analog <400> 9 Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 10 <211> 16 <212> PRT
<213> Artificial Sequence <220>
<221> AMIDATION
<222> (16)...(16) <221> DISULFID
<222> (7)...(16) <223> MCH Analog <400> 10 Asp Phe Asp Met Leu Arg Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 11 <211> 19 <212> PRT
<213> Human <220>
<221> DISULFID
<222> (7)...(16) <400> 11 Asp Phe Asp Met Leu Arg Cys Met Leu Gly Arg Val Tyr Arg Pro Cys Trp Gln Val <210> 12 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> DISULFID
<222> (1)...(10) <221> ACETYLATION
<222> (1)...(1) <400> 12 Cys Met Leu Gly Arg Val Tyr Arg Pro Cys Trp Gln Val <210> 13 <211> 19 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> DISULFID
<222> (7)...(16) <221> MOD_RES
<222> (4) ..(4) <223> Xaa = Norleucine <221> MOD_RES
<222> (8) ..(8) <223> Xaa = Norleucine <400> 13 Asp Phe Asp Xaa Leu Arg Cys Xaa Leu Gly Arg Val Tyr Arg Pro Cys Trp Gln Val <210> 14 <211> 19 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> DISULFID
<222> (7)...(16) <400> 14 Asp Phe Ala Met Leu Arg Cys Met Leu Gly Arg Val Phe Arg Pro Cys Trp Gln Tyr <210> 15 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analogs <221>DISULFID

<222>(2)...(11) <221>ACETYLATION

<222>(1)...(1) <221>MOD_RES

<222>(1)...(1) <223>Xaa = D-Arginine <221>AMIDATION

<222>(11)...(11) <400>15 Xaa Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>16 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>DISULFID

<222>(2)...(11) <221>MOD_RES

<222>(2)...(2) <223>Xaa = D-Cysteine <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <400>16 Arg Tyr Arg Pro Xaa Cys Met Leu Gly Arg Val <210>17 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>DISULFID

<222>(2)...(11) <221>MOD
RES

<222>_ (3) ..(3) _g_ <223> Xaa = D-Methionine <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <400>17 Arg Tyr Arg Pro Cys Cys Xaa Leu Gly Arg Val <210>18 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>DISULFID

<222>(2)...(11) <221>MOD
RES

<222>_ (4) .. (4) <223>Xaa = D-Leucine <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <400>18 Arg Tyr Arg Pro Cys Cys Met Xaa Gly Arg Val <210>19 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>DISULFID

<222>(2)...(11) <221>RES
MOD

<222>_ (6) ..(6) <223>Xaa = D-Arginine <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <400>19 Arg Tyr Arg Pro Cys Cys Met Leu Gly Xaa Val <210> 20 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> DISULFID
<222> (2)...(11) <221> MOD_RES
<222> (7) ..(7) <223> Xaa = D-Valine <221> ACETYLATION
<222> (1)...(1) <221> AMIDATION
<222> (11)...(11) <400> 20 Arg Cys Met Leu Gly Arg Xaa Tyr Arg Pro Cys <210> 21 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> DISULFID
<222> (2)...(11) <221> MOD_RES
<222> (8) ..(8) <223> Xaa = D-Tyrosine <221> ACETYLATION
<222> (1)...(1) <221> AMIDATION
<222> (11)...(11) <400> 21 Arg Cys Met Leu Gly Arg Val Xaa Arg Pro Cys <210> 22 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> ACETYLATION
<222> (1)...(1) <221> MOD RES

<222>(9) . . . (9) <223>Xaa = D-Arginine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>22 Arg Tyr Xaa Pro Cys Cys Met Leu Gly Arg Val <210>23 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1) . . . (1) <221>MOD_RES

<222>(10)...(10) <223>Xaa = D-Proline <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>23 Arg Tyr Arg Xaa Cys Cys Met Leu Gly Arg Val <210>24 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD_RES

<222>(11)...(11) <223>Xaa = D-Cysteine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>24 Arg Tyr Arg Pro Cys Xaa Met Leu Gly Arg Val <210>25 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (3) ..(3) <223>Xaa = N-Me-Norleucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>25 Arg Tyr Arg Pro Cys Cys Xaa Leu Gly Arg Val <210>26 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>RES
MOD

<222>_ (4) . . (4) <223>Xaa = N-Me-Leucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>26 Arg Tyr Arg Pro Cys Cys Met Xaa Gly Arg Val <210>27 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = MeGly <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>27 Arg Tyr Arg Pro Cys Cys Met Leu Xaa Arg Val <210>28 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (6) ..(6) <223>Xaa = N-Me-Arginine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>28 Arg Tyr Arg Pro Cys Cys Met Leu Gly Xaa Val <210>29 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (9) ..(9) <223>Xaa = N-Me-Arginine <221>DISUI~FID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400> 29 Arg Tyr Xaa Pro Cys Cys Met Leu Gly Arg Val <210>30 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD_RES

<222>(10)...(10) <223>Xaa = MeGly <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>30 Arg Tyr Arg Xaa Cys Cys Met Leu Gly Arg Val <210>31 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>31 Ala Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>32 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>MOD
RES

<222>_ (1) ..(1) <223>Xaa = Norleucine <221> DISULFID

<222> (2)...(11) <221>AMIDATION

<222>(11)...(11) <221>ACETYLATION

<222>(1)...(1) <400>32 Xaa Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>33 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>33 Pro Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>34 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>34 Asn Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>35 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>35 Ser Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>36 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>36 Glu Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>37 <211>10 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>AMIDATION

<222>(10)...(10) <221>DISULFID

<222>(1)...(10) <400>37 Cys Arg Pro Cys Met Leu Gly Arg Val Tyr <210>38 <211>10 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221> DISULFID
<222> (1)...(10) <221> AMIDATION
<222> (10)...(10) <400> 38 Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 39 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> AMIDATION
<222> (11)...(11) <221> DISULFID
<222> (2)...(11) <400> 39 Arg Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 40 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> MOD_RES
<222> (1) ..(1) <223> Xaa = Des-Amino-Arginine <221> DISULFID
<222> (2)...(11) <221> AMIDATION
<222> (11)...(11) <400> 40 Xaa Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 41 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> MOD_RES
<222> (1) ..(1) <223> Xaa = D-Arginine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <221>ACETYLATION

<222>(1)...(1) <400>41 Xaa Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>42 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>MOD
RES

<222>_ (1) ..(1) <223>Xaa = D-Norleucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <221>ACETYLATION

<222>(1)...(1) <400>42 Xaa Tyr Arg Pro Cys Cys Met Leu Gly Arg Val <210>43 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>MOD
RES

<222>_ (1) ..(1) <223>Xaa = D-Proline <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <221>ACETYLATION

<222>(1)...(1) <400> 43 Xaa Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 44 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> MOD_RES
<222> (1) ..(1) <223> Xaa = D-Asparagine <221> DISULFID
<222> (2)...(11) <221> AMIDATION
<222> (11)...(11) <221> ACETYLATION
<222> (1)...(1) <400> 44 Xaa Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 45 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> MOD_RES
<222> (1) ..(1) <223> Xaa = D-Serine <221> DISULFID
<222> (2)...(11) <221> AMIDATION
<222> (11)...(11) <221> ACETYLATION
<222> (1)...(1) <400> 45 Xaa Cys Met Leu Gly Arg Val Tyr Arg Pro Cys <210> 46 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> MOD RES

<222>(1)...(1) <223>Xaa = D-Glutamic Acid <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <221>ACETYLATION

<222>(1)...(1) <400>46 Xaa Pro Cys Cys Met Leu Gly Arg Val Tyr Arg <210>47 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <221>ACETYLATION

<222>(1)...(1) <400>47 Arg Pro Cys Cys Met Leu Ala Arg Val Tyr Arg <210>48 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>48 Arg s Met Leu Leu Arg Val Pro Cy Tyr Arg Cys <210>49 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>RES
MOD

<222>_ (5) ..(5) <223>Xaa = Norleucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>49 Arg Pro Cys Cys Met Leu Xaa Arg Val Tyr Arg <210>50 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>50 Arg Pro Cys Cys Met Leu Pro Arg Val Tyr Arg <210>51 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMLDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>51 Arg Pro Cys Cys Met Leu Asn Arg Val Tyr Arg <210>52 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>52 Arg Tyr Arg Pro Cys Cys Met Leu Ser Arg Val <210>53 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>53 Arg Tyr Arg Pro Cys Cys Met Leu Lys Arg Val <210>54 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400> 54 Arg Cys Met Leu Glu Arg Val Tyr Arg Pro Cys <210> 55 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> ACETYLATION
<222> (1)...(1) <221> MOD_RES
<222> (5) ..(5) <223> Xaa = D-Leucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>55 Arg Tyr Arg Pro Cys Cys Met Leu Xaa Arg Val <210>56 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = D-Norleucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>56 Arg Tyr Arg Pro Cys Cys Met Leu Xaa Arg Val <210>57 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221> ACETYLATION

<222> (1)...(1) <221>RES
MOD

<222>_ (5) ..(5) <223>Xaa = D-Proline <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>57 Arg Tyr Arg Pro Cys Cys Met Leu Xaa Arg Val <210>58 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = D-Glutamic Acid <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>58 Arg Tyr Arg Pro Cys Cys Met Leu Xaa Arg Val <210>59 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = D-Lysine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>59 Arg ys Met Leu Xaa Arg Val Pro C Tyr Arg Cys <210>60 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = bAla <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>60 Arg Pro Cys Cys Met Leu Xaa Arg Val Tyr Arg <210>61 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = Gamma-Aminobutyric Acid <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>61 Arg Pro Cys Cys Met Leu Xaa Arg Val Tyr Arg <210>62 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>62 Arg Phe Arg Pro Cys Cys Met Leu Gly Arg Val <210>63 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>63 Arg Trp Arg Pro Cys Cys Met Leu Gly Arg Val <210>64 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>AMIDATION

<222>(11)...(11) <221>DISULFID

<222>(2)...(11) <400>64 Arg His Arg Pro Cys Cys Met Leu Gly Arg Val <210>65 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (8) ..(8) <223>Xaa = (2')Naphthylalanine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>65 Arg Pro Cys Cys Met Leu Gly Arg Val Xaa Arg <210>66 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (8) ..(8) <223>Xaa = P-Fluoro-Phenylalanine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>66 Arg Pro Cys Cys Met Leu Gly Arg Val Xaa Arg <210>67 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (8) ..(8) <223>Xaa = P-Amino-Phenylalanine <221>DISULFID

<222>(2)...(11) <221> AMIDATION

<222> (11)...(11) <400> 67 Arg Cys Met Leu Gly Arg Val Xaa Arg Pro Cys <210> 68 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> ACETYLATION
<222> (1)...(1) <221> MOD_RES
<222> (8) ..(8) <223> Xaa = P-Carboxy-Phenylalanine <221> DISULFID
<222> (2)...(11) <221> AMIDATION
<222> (11)...(11) <400> 68 Arg Cys Met Leu Gly Arg Val Xaa Arg Pro Cys <210> 69 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> ACETYLATION
<222> (1)...(1) <221> MOD_RES
<222> (8) . . (8) <223> Xaa - Cyclohexylalanine <221> DISULFID
<222> (2)...(11) <221> AMIDATION
<222> (11)...(11) <400> 69 Arg Cys Met Leu Gly Arg Val Xaa Arg Pro Cys <210> 70 <211> 11 <212> PRT
<213> Artificial Sequence <220>

<223> MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (4) ..(5) <223>Xaa = 5-Aminopentanoic Acid <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>70 Arg Pro Cys Cys Met Xaa Xaa Arg Val Tyr Arg <210>71 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (1) ..(1) <223>Xaa = D-Arginine <221>MOD
RES

<222>_ (4) ..(5) <223>Xaa = 5-Aminopentanoic Acid <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>71 Xaa Pro Cys Cys Met Xaa Xaa Arg Val Tyr Arg <210>72 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (9) ..(10) <223>Xaa = 5-Aminopentanoic Acid <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>72 Arg Tyr Xaa Xaa Cys Cys Met Leu Gly Arg Val <210>73 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (1) ..(1) <223>Xaa = D-Arginine <221>MOD
RES

<222>_ (9) ..(10) <223>Xaa = 5-AminopentanoicAcid <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>73 Xaa Tyr Xaa Xaa Cys Cys Met Leu Gly Arg Val <210>74 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = D-Proline <221>MOD
RES

<222>_ (9) ..(10) <223>Xaa = 5-AminopentanoicAcid <221>DISULFID

<222>(2)...(11) <221> AMIDATION
<222> (11)...(11) <400> 74 Arg Cys Met Leu Xaa Arg Val Tyr Xaa Xaa Cys <210> 75 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> ACETYLATION
<222> (1)...(1) <221> MOD_RES
<222> (1) ..(1) <223> Xaa = Des-Amino-Arginine <221> MOD_RES
<222> (9) ..(10) <223> Xaa = 5-Aminopentanoic Acid <221> DISULFID
<222> (2)...(11) <221> AMIDATION
<222> (11)...(11) <400> 75 Xaa Cys Met Leu Gly Arg Val Tyr Xaa Xaa Cys <210> 76 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> MCH Analog <221> ACETYLATION
<222> (1)...(1) <221> MOD_RES
<222> (4) ..(5) <223> Xaa = 5-Aminopentanoic Acid <221> MOD_RES
<222> (9) ..(10) <223> Xaa = 5-Aminopentanoic Acid <221> DISULFID
<222> (2)...(11) <221> AMIDATION
<222> (11)...(11) <400> 76 Arg Xaa Cys Cys Met Xaa Xaa Arg Val Tyr Xaa <210>77 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (3) ..(3) <223>Xaa = Norleucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>77 Arg Pro Cys Cys Xaa Leu Gly Arg Val Tyr Arg <210>78 <211>11 <212>PRT

<213>Artificial Sequence <220>

<223>MCH Analog <221>ACETYLATION

<222>(1)...(1) <221>MOD
RES

<222>_ (1) ..(1) <223>Xaa = Des-Amino-Arginine <221>MOD
RES

<222>_ (5) ..(5) <223>Xaa = D-Norleucine <221>DISULFID

<222>(2)...(11) <221>AMIDATION

<222>(11)...(11) <400>78 Xaa Pro Cys Cys Met Leu Xaa Arg Val Tyr Arg

Claims (16)

WHAT IS CLAIMED IS:

1. An optionally substituted peptide having the structure:

herein X1 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, or glutamic acid, or a derivative thereof;
X2 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, or glutamic acid, or a derivative thereof;
X3 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof;
X4 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid, glutamic acid, or norleucine, or a derivative thereof;
X5 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof;
X6 is an optionally present amino acid that, if present is either arginine, alanine, leucine, glycine, lysine, proline, asparagine, serine, histidine, nitroarginine, norleucine, or des-amino-arginine, or a derivative thereof, X7 is either cysteine, homocysteine, or penicillamine, or a derivative thereof;
X8 is either methionine, norleucine, leucine, isoleucine, valine, methioninesulfoxide, or methioninesulfone, or a derivative thereof;

X9 is either leucine, isoleucine, valine, alanine, methionine, or 5-aminopentanoic acid, or a derivative thereof;
X10 is either glycine, alanine, leucine, norleucine, cyclohexylalanine, 5-aminopentanoic acid, asparagine, serine, sarcosine, isobutyric, or gamma-aminobutyric acid, or a derivative thereof;
X11 is either arginine, lysine, citrulline, histidine, or nitroarginine, or a derivative thereof;
X12 is either valine, leucine, isoleucine, alanine, or methionine, or a derivative thereof;
X13 is either phenylalanine, tyrosine, D-( p-benzoylphenylalanine), tryptophan, (1')- and (2')-naphthylalanine, cyclohexylalanine, or mono and multi-substituted phenylalanine wherein each substituent is independently selected from the group consisting of O-alkyl, alkyl, OH, NO2, NH2, F, I, and Br; or a derivative thereof;
X14 is either arginine, lysine, histidine, norarginine, or 5-aminopentanoic acid or a derivative thereof;
X15 is either proline, alanine, valine, leucine, isoleucine, methionine, sarcosine, or 5-aminopentanoic acid, or a derivative thereof;
X16 is either cysteine, homocysteine, or penicillamine, or a derivative thereof;
X17 is an optionally present amino acid that, if present, is either alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, methionine, glycine, serine, threonine, tyrosine, cysteine, asparagine, glutamine, lysine, arginine, histidine, aspartic acid or glutamic acid, or a derivative thereof;
Z1 is an optionally present protecting group that, if present, is covalently joined to the N-terminal amino group;
Z2 is an optionally present protecting group that, if present, is covalently joined to the C-terminal carboxy group;
or a labeled derivative of said peptide;
or a pharmaceutically acceptable salt of said peptide or of said labeled derivative.

2. The peptide of claim 1, wherein X1, X2, X3, X4, and X5 are not present; X6 is arginine; and X17 is tyrosine or tryptophan.

3. The peptide of claim 1, wherein X1, X2, X3, X4, X5, and X17are not present; and X6 is arginine.

4. The peptide of claim 3, wherein Z1 is -C(O)CH3 and Z2 is -NH2.

5. The peptide of claim 1, wherein said peptide is either SEQ. ID. NO. 7, SEQ. ID. NO. 8, SEQ. ID. NO. 9, SEQ. ID. NO. 10, or a pharmaceutically acceptable salt thereof.

6. The peptide of claim 1, wherein said peptide is either SEQ. ID. NO. 7, SEQ. ID. NO. 8, or a pharmaceutically acceptable salt thereof.

7. The peptide of claim 1, wherein X1, X2, X3, X4, X5 and X17 are not present;
X6 is either arginine, D-arginine, D-norleucine, D-proline, D-serine, or D-asparagine;
X7 is cysteine;
X8 is either methionine, norleucine, or N-methyl norleucine;
X9 is leucine;
X10 is either glycine, alanine, leucine, norleucine, asparagine, serine, D-norleucine, D-proline, gamma-aminobutyric acid, or sarcosine;
X11 is arginine;
X12 is valine;
X13 is phenylalanine, (2')napthylalanine, p-fluoro-phenylalanine, tyrosine, or cyclohexylalanine;
X14 is arginine;
X15 is either proline or sarcosine; and X16 is either cysteine or D-cysteine.

8. The peptide of claim 1, wherein said peptide consists of a sequence selected from the group consisting of: 7, 8, 10, 15, 24, 25, 27, 28, 30-49, 51, 52, 56, 57, 61, 62, 63, 65-67, 69-72, and 77.

9. A method of screening for a compound able to bind a MCH
receptor comprising the step of measuring the ability of said compound to effect binding of the peptide of any one of claims 1-8 to either said receptor, a fragment of said receptor comprising a MCH binding site, a polypeptide comprising said fragment, or a derivative of said polypeptide.

10. The method of claim 9, wherein said method measures the ability of said peptide to bind to said receptor or said fragment thereof.

11. The method of claim 10, wherein said peptide is radiolabeled.

12. The method of claim 9, wherein said peptide is a radiolabeled derivative of SEQ. ID. NO. 8 or a pharmaceutically acceptable salt thereof.

13. A method for increasing weight in a subject comprising the step of administering to said subject an effective amount of the peptide of any one of claims 1-8 to produce a weight increase.

14. A method for increasing appetite in a subject comprising the step of administering to said subject an effective amount of the peptide of any one of claims 1-8 to produce an appetite increase.

15. A method for measuring the ability of a compound to decrease weight or appetite in a subject comprising the steps of:

a) administering to said subject an effective amount of the peptide of any one of claims 1-8 to produce a weight increase or appetite increase, b) administering said compound to said subject, and c) measuring the change in weight or appetite of said subject.

16. The method of claim 15, wherein said subject is either a rat or a mouse.