CA2390491A1 - Crib protein zmse1 - Google Patents

Abstract

The present invention relates to polynucleotide and polypeptide molecules fo r zmse1, a novel human CRIB protein. The polypeptides, and polynucleotides encoding them, may be used for detecting human chromosomal abnormalities and cancers. The present invention also includes antibodies to the zmse1 polypeptides.

Description

Description BACKGROUND OF THE INVENTION
The Ras family of proteins is comprised of small GTPases that are subdivided into several sub-families known to be involved in diverse cellular actions, 1 o such as cell proliferation, differentiation and apoptosis. Moreover, Ras is a known oncogene, and the Ras protein is implicated in oncogenic cell transformation through complex signaling pathways that employ an increasing number of downstream effectors. Some of these effectors are included in Ras sub-families, such as, for example, the Rho subfamily of small GTPases.
The Rho family proteins are implicated in regulating diverse cellular processes as well. One prominent Rho activity comprises effecting actin cytoskeletal organization. Such activities include regulating cell shape, cell attachment and adhesion, cell motility and invasion, cell-cell interactions, cell proliferation, differentiation and apoptosis. For example, Racl, RhoA and Cdc42 are all implicated 2 0 in promoting cell motility and invasion. As such, these proteins may be involved in promoting motility, invasiveness and metastasis of tumor cells. In addition, disassembly of actin stress fibers is associated with malignant transformation.
Moreover, another prominent and distinct Rho activity includes activation of signaling cascades that enhance gene expression through the induction of various transcription 2 5 factors, resulting in cell proliferation, cell cycle progression, differentiation and apoptosis. For Example, the Rho proteins Rac 1 and Cdc42 activate Jun NH2-terminal kinases (JNKs), which in turn activate Jun, ATF-2 and Elk-1 nuclear transcription factors. Rho family proteins can also activate NFoB and SRF transcription factors.
Virally transduced and mutated versions of cellular Fos, Jun, and NFoB were originally 3 0 identified as potent retroviral oncogenes implicated in various tumors and cancerous states (Bishop, J.M., Cell 64:235-238, 1991). Thus, Rho family mediated changes in gene expression likely contribute to their proliferative actions, and play a role in cell transformation and cancer. Moreover, several Rho family proteins have been shown to be important for Ras transforming activity. For reference, see Zohn, LM. et al., Oncogene 17:1415-1438, 1998; Maruta, H. et al., Microsc. Res. Tech. 47:61-66, 1999;
Aspenstrom, P. her. Cell. Res. 246:20-25, 1999; Banyard, J. and Zetter, B.R., Cancer and Metast. Rev. 17:449-458, 1999; and, Michiels, F. and Collard, J.G., Biochem Soc.
Symp. 65:125-146, 1999.
In addition, several effector proteins are known to bind Rho family members, such as Cdc42 and Rac. The effectors that bind Cdc42/Rac have a consensus binding motif designated the Cdc42/Rac Interactive Binding (CRIB) motif (Burbelo, P.D. et al., J. Biol. Chem. 270:29071-29074, 1995). These effectors show GTP-dependent interaction with Cdc42 and/or Racl, and may or may not show kinase activity. For Example, the Cdc42 effector, MSE55 is a non-kinase effector that specifically binds Cdc42 in a GTP-dependent manner, is localized to membrane ruffles, and induces long actin-based protrusions or cellular extensions in fibroblast cells (Burbelo, P.D. et al., Proc. Natl. Acad. Sci. USA 96:9083-9088, 1999). For other references on Cdc2/Rac and their effects on membrane ruffling, actin stress fibers, lamellipodia and the like, see, for example, Ridley, A.J. et al., Cell 70:401-410, 1992;
and Nobes, C.D., and Hall, A. Cell 81:53-62, 1995. Other CRIB proteins are 2 0 implicated in human disease, such as the Wiskott-Aldrich Syndrome, which is an X-linked recessive disorder characterized by thrombocytopenia, recurrent infections due to defective T- and B-cell function, and eczema. The CRIB protein Wiskott-Aldrich Syndrome Protein (WASP) is mutated in this disease, and it is also a Cdc42 effector (Symons, M. et al., Cell 84:723-734, 1996). Because these CRIB proteins influence 2 5 members of the Rho family of proteins, these effectors may also play a role in cell proliferation, transformation, motility and metastasis. For reference, see Zohn, LM. et al., supra..
Considering the importance of this family of proteins, there is a continuing need to discover new Ras and Rho family members and their effector 3 0 proteins that modulate the cytoskeleton, actin polymerization, cell motility and invasion, and the like, and affect proliferation, differentiation, transformation, metastasis and apoptotic pathways. The in vivo activities of both inducers and inhibitors of these pathways illustrate the enormous clinical potential of, and need for, such novel proteins, their agonists and antagonists, for example, in cancer therapy. The present invention addresses this need by providing such polypeptides for these and other uses that should be apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a hydrophobicity plot of zmsel using a Hopp/Woods hydrophilicity profile based on a sliding six-residue window, with buried G, S, and T
residues and exposed H, Y, and W residues ignored.
Figure 2 is an alignment of human zmsel (zmsel) (SEQ 1D N0:2), and mouse zmsel (MUZMSE) (SEQ >D N0:5).
DESCRIPTION OF THE INVENTION
In one aspect, the present invention provides an isolated polynucleotide that encodes a zmsel polypeptide comprising a sequence of amino acid residues that is at least 90% identical to an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence as shown in SEQ >D N0:2 from amino acid number 1 (Met), to amino acid number 147 (Ala); (b) the amino acid sequence as shown in SEQ ., 2 0 ID N0:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser);
(c) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser); and (d) the amino acid sequence as shown in SEQ
>D
N0:2 from amino acid number 1 (Met), to amino acid number 356 (Val), wherein the amino acid percent identity is determined using a FASTA program with ktup=1, gap 2 5 opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62, with other parameters set as default. In one embodiment, the isolated polynucleotide disclosed above is selected from the group consisting of: (a) a polynucleotide sequence as shown in SEQ ID NO:l from nucleotide 199 to nucleotide 639; (b) a polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 640 to nucleotide 1206; (c) a 3 0 polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 640 to nucleotide 1266; and (d) a polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 199 to nucleotide 1266. In another embodiment, the isolated polynucleotide disclosed above comprises nucleotide 1 to nucleotide 1068 of SEQ ID N0:3. In another embodiment, the isolated polynucleotide disclosed above encodes a polypeptide that comprises a sequence of amino acid residues selected from the group consisting of: (a) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1 (Met), to amino acid number 147 (Ala); (b) the amino acid sequence as shown in SEQ ID
N0:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser); (c) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser); and (d) the amino acid sequence as shown in SEQ
ID
N0:2 from amino acid number 1 (Met), to amino acid number 356 (Val).
In a second aspect, the present invention provides an expression vector comprising the following operably linked elements: a transcription promoter; a DNA
segment encoding a zmsel polypeptide as shown in SEQ ID N0:2 from amino acid number 1 (Met), to amino acid number 356 (Val); and a transcription terminator, wherein the promoter is operably linked to the DNA segment, and the DNA
segment is operably linked to the transcription terminator.
In a third aspect, the present invention provides an expression vector as disclosed above, further comprising a secretory signal sequence operably linked to the DNA segment.
2 0 In a fourth aspect, the present invention provides a cultured cell comprising an expression vector as disclosed above, wherein the cell expresses a polypeptide encoded by the DNA segment.
In another aspect, the present invention provides a DNA construct encoding a fusion protein, the DNA construct comprising: a first DNA segment 2 5 encoding a polypeptide comprising a sequence of amino acid residues selected from the group consisting of: (a) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1 (Met), to amino acid number 147 (Ala); (b) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser); (c) the amino acid sequence as shown in SEQ ID N0:2 from amino 3 0 acid number 148 (Asn), to amino acid number 356 (Ser); (d) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 337 (Arg), to amino acid number 356 (Ser); and (e) the amino acid sequence as shown in SEQ >D N0:2 from amino acid number 1 (Met), to amino acid number 356 (Val); and at least one other DNA
segment encoding an additional polypeptide, wherein the first and other DNA segments are connected in-frame; and wherein the first and other DNA segments encode the fusion 5 protein.
In another aspect, the present invention provides an expression vector comprising the following operably linked elements: a transcription promoter; a DNA
construct encoding a fusion protein as disclosed above; and a transcription terminator, wherein the promoter is operably linked to the DNA construct, and the DNA
construct is operably linked to the transcription terminator.
In another aspect, the present invention provides a cultured cell comprising an expression vector as disclosed above, wherein the cell expresses a polypeptide encoded by the DNA construct.
In another aspect, the present invention provides a method of producing a fusion protein comprising: culturing a cell as disclosed above; and isolating the polypeptide produced by the cell.
In another aspect, the present invention provides an isolated polypeptide comprising a sequence of amino acid residues that is at least 90% identical to an amino acid sequence selected from the group consisting of: (a) the amino acid sequence as 2 0 shown in SEQ m N0:2 from amino acid number 1 (Met), to amino acid number (Ala); (b) the amino acid sequence as shown in SEQ m N0:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser); (c) the amino acid sequence as shown in SEQ >D N0:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser);
and (d) the amino acid sequence as shown in SEQ m N0:2 from amino acid number (Met), to amino acid number 356 (Val), wherein the amino acid percent identity is determined using a FASTA program with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62, with other parameters set as default. In one embodiment, the isolated polypeptide disclosed above comprises a sequence of amino acid residues selected from the group consisting of: (a) the amino 3 0 acid sequence as shown in SEQ >D N0:2 from amino acid number 1 (Met), to amino acid number 147 (Ala); (b) the amino acid sequence as shown in SEQ >D N0:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser); (c) the amino acid sequence as shown in SEQ >D N0:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser); and (d) the amino acid sequence as shown in SEQ ID N0:2 from amino acid number 1 (Met), to amino acid number 356 (Val).
In another aspect, the present invention provides a method of producing a zmsel polypeptide comprising: culturing a cell as disclosed above; and isolating the zmse 1 polypeptide produced by the cell.
In another aspect, the present invention provides a method of producing an antibody to zmsel polypeptide comprising: inoculating an animal with a polypeptide 1 o selected from the group consisting of: (a) a polypeptide consisting of 13 to 343 amino acids, wherein the polypeptide is identical to a contiguous sequence of amino acids in SEQ >D N0:2 from amino acid number 1 (Met) to amino acid number 356 (Val); (b) a polypeptide as disclosed above; (c) a polypeptide consisting of the amino acid sequence of SEQ >D N0:2 from amino acid number 337 (Arg) to amino acid number 356 (Val);
(d) a polypeptide consisting of the amino acid sequence of SEQ ID N0:2 from amino acid number 96 (Glu) to amino acid number 101 (Asp); (e) a polypeptide consisting of the amino acid sequence of SEQ m N0:2 from amino acid number 226 (Asp) to amino acid number 231 (Asp); (f) a polypeptide consisting of the amino acid sequence of SEQ
>D N0:2 from amino acid number 346 (Met) to amino acid number 351 (Glu); (g) a 2 0 polypeptide consisting of the amino acid sequence of SEQ m N0:2 from amino acid number 360 (Arg) to amino acid number 365 (Glu); (h) a polypeptide consisting of the amino acid sequence of SEQ >D N0:2 from amino acid number 347 (Asp) to amino acid number 352 (Asp); and (i) a polypeptide consisting of the amino acid sequence of SEQ 1D N0:2 from amino acid number 348 (Glu) to amino acid number 353 (Glu);
and 2 5 wherein the polypeptide elicits an immune response in the animal to produce the antibody; and isolating the antibody from the animal.
In another aspect, the present invention provides an antibody produced by the method disclosed above, which binds to a zmsel polypeptide. In one embodiment, the antibody disclosed above is a monoclonal antibody. In another aspect, 3 0 the present invention provides an antibody which specifically binds to a polypeptide as disclosed above.

In another aspect, the present invention provides An antibody which specifically binds to a polypeptide disclosed above.
In another aspect, the present invention provides a method of detecting, in a test sample, the presence of a modulator of zmsel protein activity, comprising:
culturing a cell into which has been introduced an expression vector as disclosed above, wherein the cell expresses the zmsel protein encoded by the DNA segment in the presence and absence of a test sample; and comparing levels of activity of zmsel in the presence and absence of a test sample, by a biological or biochemical assay;
and determining from the comparison, the presence of modulator of zmsel activity in the test sample.
In another aspect, the present invention provides a method for detecting a genetic abnormality in a patient, comprising: obtaining a genetic sample from a patient; producing a first reaction product by incubating the genetic sample with a polynucleotide comprising at least 14 contiguous nucleotides of SEQ m NO:1 or the complement of SEQ 1D NO:1, under conditions wherein said polynucleotide will hybridize to complementary polynucleotide sequence; visualizing the first reaction product; and comparing said first reaction product to a control reaction product from a wild type patient, wherein a difference between said first reaction product and said control reaction product is indicative of a genetic abnormality in the patient.
2 0 In another aspect, the present invention provides a method for detecting a cancer in a patient, comprising: obtaining a tissue or biological sample from a patient; incubating the tissue or biological sample with an antibody of claim 19 under conditions wherein the antibody binds to its complementary polypeptide in the tissue or biological sample; visualizing the antibody bound in the tissue or biological sample;
2 5 and comparing levels of antibody bound in the tissue or biological sample from the patient to a normal control tissue or biological sample, wherein an increase or decrease in the level of antibody bound to the patient tissue or biological sample relative to the normal control tissue or biological sample is indicative of a cancer in the patient.
In another aspect, the present invention provides a method for detecting 3 0 a cancer in a patient, comprising: obtaining a tissue or biological sample from a patient; labeling a polynucleotide comprising at least 14 contiguous nucleotides of SEQ

1D NO:1 or the complement of SEQ ID NO:1; incubating the tissue or biological sample with under conditions wherein the polynucleotide will hybridize to complementary polynucleotide sequence; visualizing the labeled polynucleotide in the tissue or biological sample; and comparing the level of labeled polynucleotide hybridization in the tissue or biological sample from the patient to a normal control tissue or biological sample, wherein an increase or decrease in the labeled polynucleotide hybridization to the patient tissue or biological sample relative to the normal control tissue or biological sample is indicative of a cancer in the patient.
Within another aspect, the present invention provides a transgenic mouse, wherein the mouse over-expresses residue 1 (Met) to residue 356 (Val) of SEQ
ID N0:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID N0:5. In one embodiment, the transgenic mouse disclosed above expresses residue 1 (Met) to residue 356 (Val) of SEQ ID N0:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID
N0:5 using a tissue-specific or tissue-restricted promoter. In another embodiment, the transgenic mouse disclosed above expresses residue 1 (Met) to residue 356 (Val) of SEQ 1D N0:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID N0:5 using an epithelial-specific, colon-specific, or ovary-specific promoter. In another embodiment, the transgenic mouse disclosed above does not expresses residue 1 (Met) to residue 349 (Val) of SEQ ID N0:5, relative to a normal mouse.
2 0 These and other aspects of the invention will become evident upon reference to the following detailed description of the invention and attached drawings.
Prior to setting forth the invention in detail, it may be helpful to the understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a polypeptide segment 2 5 that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include a poly histidine tract, protein A (Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et al., Methods 30 Enzymol. 198:3, 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA
82:7952-4, 1985), substance P, FIagTM peptide (Hopp et al., Biotechnology 6:1204-10, 1988), streptavidin binding peptide, or other antigenic epitope or binding domain.
See, in general, Ford et al., Protein Expression and Purification 2: 95-107, 1991.
DNAs encoding affinity tags are available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, NJ).
The term "allelic variant" is used herein to denote any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequence. The term allelic variant is also used herein to denote a protein encoded by an allelic variant of a gene.
The terms "amino-terminal" (also, "N-Terminal") and "carboxyl-terminal" (also "C-terminal") are used herein to denote positions within polypeptides.
Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide to denote proximity or relative position. For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a polypeptide is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete polypeptide.
The term "complement/anti-complement pair" denotes non-identical 2 0 moieties that form a non-covalently associated, stable pair under appropriate conditions.
For instance, biotin and avidin (or streptavidin) are prototypical members of a complement/anti-complement pair. Other exemplary complement/anti-complement pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope) pairs, sense/antisense polynucleotide pairs, and the like. Where subsequent dissociation of 2 5 the complement/anti-complement pair is desirable, the complement/anti-complement pair preferably has a binding affinity of <109 M-1.
The term "complements of a polynucleotide molecule" denotes a polynucleotide molecule having a complementary base sequence and reverse orientation as compared to a reference sequence. For example, the sequence 5' ATGCACGGG 3' 3 0 is complementary to 5' CCCGTGCAT 3'.

The term "contig" denotes a polynucleotide that has a contiguous stretch of identical or complementary sequence to another polynucleotide. Contiguous sequences are said to "overlap" a given stretch of polynucleotide sequence either in their entirety or along a partial stretch of the polynucleotide. For example, 5 representative contigs to the polynucleotide sequence 5'-ATGGAGCTT-3' are 5'-AGCTTgagt-3' and 3'-tcgacTACC-5'.
The term "degenerate nucleotide sequence" denotes a sequence of nucleotides that includes one or more degenerate codons (as compared to a reference polynucleotide molecule that encodes a polypeptide). Degenerate codons contain 10 different triplets of nucleotides, but encode the same amino acid residue (i.e., GAU and GAC triplets each encode Asp).
The term "expression vector" is used to denote a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription. Such additional segments include promoter and terminator sequences, and may also include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, etc. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.
The term "isolated", when applied to a polynucleotide, denotes that the 2 0 polynucleotide has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. Such isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones. Isolated DNA molecules of the present invention are free of other genes with 2 5 which they are ordinarily associated, but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tijan, Nature 316:774-78, 1985).
An "isolated" polypeptide or protein is a polypeptide or protein that is 3 0 found in a condition other than its native environment, such as apart from blood and animal tissue. In a preferred form, the isolated polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin. It is preferred to provide the polypeptides in a highly purified form, i.e. greater than 95% pure, more preferably greater than 99% pure. When used in this context, the term "isolated" does not exclude the presence of the same polypeptide in alternative physical forms, such as dimers or alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to DNA segments, indicates that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.
The term "ortholog" denotes a polypeptide or protein obtained from one species that is the functional counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
"Paralogs" are distinct but structurally related proteins made by an organism. Paralogs are believed to arise through gene duplication. For example, a globin, (3-globin, and myoglobin are paralogs of each other.
A "polynucleotide" is a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.
2 0 Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"), nucleotides ("nt"), or kilobases ("kb"). Where the context allows, the latter two terms may describe polynucleotides that are single-stranded or double-stranded. When the term is applied to double-stranded molecules it is used to denote overall length and will be understood to be equivalent to the term "base pairs". It will be recognized by those skilled in the 2 5 art that the two strands of a double-stranded polynucleotide may differ slightly in length and that the ends thereof may be staggered as a result of enzymatic cleavage;
thus all nucleotides within a double-stranded polynucleotide molecule may not be paired.
A "polypeptide" is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 3 0 amino acid residues are commonly referred to as "peptides".

The term "promoter" is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5' non-coding regions of genes.
A "protein" is a macromolecule comprising one or more polypeptide chains. A protein may also comprise non-peptidic components, such as carbohydrate groups. Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell.
Proteins are defined herein in terms of their amino acid backbone structures;
substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
The term "receptor" denotes a cell-associated protein that binds to a bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a mufti-peptide structure, for example, comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. Binding of ligand to receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecules) in the cell. This interaction in turn leads to an alteration in the metabolism of the cell. Metabolic events that are linked to receptor-ligand 2 0 interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospholipids. In general, receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., 2 5 PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF
receptor, erythropoietin receptor and IL,-6 receptor).
The term "secretory signal sequence" denotes a DNA sequence that encodes a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in 3 0 which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.

The term "splice variant" is used herein to denote alternative forms of RNA transcribed from a gene. Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence. The term splice variant is also used herein to denote a protein encoded by a splice variant of an mRNA transcribed from a gene.
Molecular weights and lengths of polymers determined by imprecise analytical methods (e.g., gel electrophoresis) will be understood to be approximate values. When such a value is expressed as "about" X or "approximately" X, the stated value of X will be understood to be accurate to ~10%.
All references cited herein are incorporated by reference in their entirety.
The present invention is based in part upon the discovery of a novel DNA sequence that encodes a protein having a CRIB motif (Burbelo, P.D. et al., J.
Biol. Chem. 270:29071-29074, 1995). The polypeptide has been designated zmsel.
The novel zmse 1 was found and its corresponding cDNA was sequenced. The novel polypeptide encoded by the cDNA showed limited homology with MSE55 (Bahou, W.F., et al., J. Biol. Chem. 267:13986-13992, 1994; Burbelo, P.D. et al., Proc. Natl.
Acad. Sci. USA 96:9083-9088, 1999). The zmsel polynucleotide sequence encodes the entire coding sequence of the predicted protein. Zmsel is a novel protein that may be involved in regulating actin polymerization and resulting structures, cytoskeletal organization, proliferation, cell transformation, motility, cell invasion;
metastasis, transport or secretion, tissue contractility, involved in an apoptotic cellular pathway, or 2 5 the like.
The sequence of the zmsel polypeptide was deduced from a single clone that contained its corresponding polynucleotide sequence. The clone was obtained from a human K562 cell (ATCC Cat. No. CCL 243) library. Other libraries that might also be searched for such sequences include tumor cell and tissue libraries PBLs, testis, 3 0 gastrointestinal, prostate, lung, adrenal gland, and the like.

The nucleotide sequence of a representative human zmsel-encoding DNA is described in SEQ D) NO:1, and its deduced 356 residue amino acid sequence is described in SEQ D) N0:2. In its entirety, the human zmsel polypeptide (SEQ ID
N0:2) represents a full-length polypeptide segment (residue 1 (Met) to 356 (Val) of SEQ ID N0:2). The domains and structural features of the zmsel polypeptide are further described below.
Analysis of the zmse 1 polypeptide encoded by the DNA sequence of SEQ m NO:1 revealed an open reading frame encoding 356 amino acids (SEQ ID
N0:2) comprising a mature polypeptide. Zmsel contains a CRIB motif (SEQ ID
N0:6) comprising amino acid residue number 27 (lle) to amino acid residue number 41 (Gly) of SEQ ~ N0:2. This CRIB motif is conserved and identical in both the human and murine forms of zmsel (see, Figure 1; and, amino acid residue number 27 (Ile) to amino acid residue number 41 (Gly) of SEQ ID N0:2 and SEQ >D NO:S), suggesting that a minor sequence difference therein could affect the binding of this effector with its target. For example, amino acid mutations in the CRIB motif of MSE55 and a single point mutation in the CRIB motif of WASP decrease or abolish Cdc42 binding and hence the biological activity associated therewith (See, Burbelo, P.D. et al., Proc. Natl.
Acad. Sci. USA supra.; and Miki, H. et al., Nature 391:93-96, 1998). However, sequences outside the CRIB motif are also important for the activity of these effector proteins (See, Zohn, LM. et al., Onco ene 17:1415-1438, 1998). Moreover, zmsel contains a highly conserved N-terminal domain of approximately 150 amino acid residues (residues 1 (Met) to 147 (Ala) of SEQ ID N0:2; and residues 1 (Met) to 145 (Ala) of SEQ D) NO:S); and a more variable C-terminal domain of approximately amino acid residues compressing residues 148 (Asn) to 336 (Ser) of SEQ m N0:2, and 2 5 residues 146 (Asp) to 329 (Pro) of SEQ ID NO:S); and a highly conserved C-terminal tail comprising residues 337 (Arg) to 356 (Val) of SEQ >D N0:2, and 329 (Arg) to 350 (Val) of SEQ ID NO:S. Moreover zmsel contains several phosphorylation sites that are conserved between the human and mouse polypeptides, and are shown in SEQ TD
N0:2 as follows: SerZ95-A1a296-~'g297~ Ser86-Lys87-Arggg; Ser,4-LyslS-Argi6; Ser,os-Leu,o6-3 0 Arg,o7; SerBO-Argg~-Lysg2; and Thr3o3-Thr3o4-Arg3os. The corresponding mouse phosphorylation sites can be determined with reference to Figure 2 and SEQ D) NO:S.

As zmse 1 is likely involved in signal transduction, some or all of these phosphorylation sites may be essential for zmsel activity. Those skilled in the art will recognize that these domain boundaries are approximate, and are based on alignments with known proteins and predictions of protein folding. The corresponding polynucleotides 5 encoding the zmse 1 polypeptide regions, domains, motifs, residues and sequences described above are as shown in SEQ ID NO:1 (human zmsel) and SEQ >D N0:4 (mouse zmse 1 ).
The presence of conserved motifs, such as the CRIB motif, and low variance motifs generally correlates with or defines important structural regions in 10 proteins. Regions of low variance (e.g., hydrophobic clusters) are generally present in regions of structural importance (Sheppard, P. et al., su ra. . Such regions of low variance often contain rare or infrequent amino acids, such as Tryptophan. The regions flanking and between such conserved and low variance motifs may be more variable, but are often functionally significant because they may relate to or define important 15 structures and activities such as guanosine nucleotide binding domains, activation domains, biological and enzymatic activity, signal transduction, cell-cell interaction, tissue or intracellular localization domains and the like. For example, alignment of zmsel with related polypeptides, for example MSE55, and the presence of a conserved CRIB motif supports that the correlating structural and functional domains of zmsel are 2 0 significant in determining that zmsel is a Rho family effector.
The regions of conserved amino acid residues in zmsel, described above, can be used as tools to identify new family members. For instance, reverse transcription-polymerase chain reaction (RT-PCR) can be used to amplify sequences encoding the conserved regions from RNA obtained from a variety of tissue sources or cell lines. In particular, highly degenerate primers designed from the zmsel sequences are useful for this purpose. Designing and using such degenerate primers may be readily performed by one of skill in the art.
The present invention also provides polynucleotide molecules, including DNA and RNA molecules, that encode the zmsel polypeptides disclosed herein.
Those 3 0 skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules. SEQ ff~ N0:3 is a degenerate DNA sequence that encompasses all DNAs that encode the human zmsel polypeptide of SEQ 1D N0:2. Those skilled in the art will recognize that the degenerate sequence of SEQ 1D N0:3 also provides all RNA
sequences encoding SEQ >D N0:2 by substituting U for T. Thus, zmsel polypeptide-encoding polynucleotides comprising nucleotide 1 to nucleotide 1068 of SEQ 1D
N0:3 and their RNA equivalents are contemplated by the present invention. Table 1 sets forth the one-letter codes used within SEQ >D N0:3 to denote degenerate nucleotide positions. "Resolutions" are the nucleotides denoted by a code letter.
"Complement"
indicates the code for the complementary nucleotide(s). For example, the code Y
denotes either C or T, and its complement R denotes A or G, A being complementary to T, and G being complementary to C.

NucleotideResolution Complement Resolution A A T T

C C G G

G G C C

T T A A

R A~G Y C~T

Y C~T R A~G

M A~C K G~T

K G~T M A~C

S CMG S C~G

W A~T W A~T

H A~C~T D A~G~T

B C~G~T V A~C~G

V A~C~G B C~G~T

D A~G~T H A~C~T

N A~C~G~T N A~C~G~T

The degenerate codons used in SEQ >D N0:3, encompassing all possible codons for a given amino acid, are set forth in Table 2.

One Amino Letter Codons Degenerate Acid Code Codon Cys C TGC TGT TGY

Ser S AGC AGT TCA TCC TCG TCT WSN

Thr T ACA ACC ACG ACT ACN

Pro P CCA CCC CCG CCT CCN

Ala A GCA GCC GCG GCT GCN

Gly G GGA GGC GGG GGT GGN

Asn N AAC AAT AAY

Asp D GAC GAT GAY

Glu E GAA GAG GAR

Gln Q CAA CAG CAR

His H CAC CAT CAY

Arg R AGA AGG CGA CGC CGG CGT MGN

Lys K AAA AAG AAR

Met M ATG ATG

Ile I ATA ATC ATT ATH

Leu L CTA CTC CTG CTT TTA TTG YTN

Val V GTA GTC GTG GTT GTN

Phe F TTC TTT TTY

Tyr Y TAC TAT TAY

Trp W TGG TGG

Ter . TAA TAG TGA TRR

Asn~AspB RAY

Glu~GlnZ SAR

Any X NNN

One of ordinary skill in the art will appreciate that some ambiguity is introduced in determining a degenerate codon, representative of all possible codons encoding each amino acid. For example, the degenerate codon for serine (WSN) can, in some circumstances, encode arginine (AGR), and the degenerate codon for arginine (MGN) can, in some circumstances, encode serine (AGY). A similar relationship exists between codons encoding phenylalanine and leucine. Thus, some polynucleotides encompassed by the degenerate sequence may encode variant amino acid sequences, but one of ordinary skill in the art can easily identify such variant sequences by reference to the amino acid sequence of SEQ 1D N0:2. Variant sequences can be readily tested for functionality as described herein.
One of ordinary skill in the art will also appreciate that different species can exhibit "preferential codon usage." In general, see, Grantham, et al., Nuc. Acids Res. 8:1893-912, 1980; Haas, et al. Curr. Biol. 6:315-24, 1996; Wain-Hobson, et al., Gene 13:355-64, 1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm, Nuc.
Acids Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol. 158:573-97, 1982. As used herein, the term "preferential codon usage" or "preferential codons" is a term of art referring to protein translation codons that are most frequently used in cells of a certain species, thus favoring one or a few representatives of the possible codons encoding each amino acid (See Table 2). For example, the amino acid Threonine (Thr) may be encoded by 2 0 ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly used codon; in other species, for example, insect cells, yeast, viruses or bacteria, different Thr codons may be preferential. Preferential codons for a particular species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferential codon sequences into recombinant DNA
2 5 can, for example, enhance production of the protein by making protein translation more efficient within a particular cell type or species. Therefore, the degenerate codon sequence disclosed in SEQ ID N0:3 serves as a template for optimizing expression of polynucleotides in various cell types and species commonly used in the art and disclosed herein. Sequences containing preferential codons can be tested and optimized 3 0 for expression in various species, and tested for functionality as disclosed herein.

Within preferred embodiments of the invention the isolated polynucleotides will hybridize to similar sized regions of SEQ ID NO:1, or a sequence complementary thereto, under stringent conditions. In general, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific 5 sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Numerous equations for calculating Tm are known in the art, and are specific for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying length (see, for example, Sambrook et al., Molecular Cloning: A
Laboratory to Manual, Second Edition (Cold Spring Harbor Press 1989); Ausubel et al., (eds.), Current Protocols in Molecular Biolo~y (John Wiley and Sons, Inc. 1987);
Berger and Kimmel (eds.), Guide to Molecular Cloning Techniques, (Academic Press, Inc.
1987);
and Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227, 1990). Sequence analysis software such as OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 4.0 (Premier 15 Biosoft International; Palo Alto, CA), as well as sites on the Internet, are available tools for analyzing a given sequence and calculating Tm based on user defined criteria. Such programs can also analyze a given sequence under defined conditions and identify suitable probe sequences. Typically, hybridization of longer polynucleotide sequences (e.g., >50 base pairs) is performed at temperatures of about 20-25°C
below the 2 0 calculated Tm. For smaller probes (e.g., <50 base pairs) hybridization is typically carried out at the Tm or 5-10°C below. This allows for the maximum rate of hybridization for DNA-DNA and DNA-RNA hybrids. Higher degrees of stringency at lower temperatures can be achieved with the addition of formamide which reduces the Tm of the hybrid about 1 °C for each 1 % formamide in the buffer solution. Suitable 2 5 stringent hybridization conditions are equivalent to about a 5 h to overnight incubation at about 42°C in a solution comprising: about 40-50% formamide, up to about 6X
SSC, about SX Denhardt's solution, zero up to about 10% dextran sulfate, and about 10-20 pg/ml denatured commercially-available carrier DNA. Generally, such stringent conditions include temperatures of 20-70°C and a hybridization buffer containing up to 3 0 6x SSC and 0-50% formamide; hybridization is then followed by washing filters in up to about 2X SSC. For example, a suitable wash stringency is equivalent to O.1X
SSC to 2X SSC, 0.1% SDS, at 55°C to 65°C. Different degrees of stringency can be used during hybridization and washing to achieve maximum specific binding to the target sequence. Typically, the washes following hybridization are performed at increasing degrees of stringency to remove non-hybridized polynucleotide probes from hybridized complexes. Stringent hybridization and wash conditions depend on the length of the probe, reflected in the Tm, hybridization and wash solutions used, and are routinely determined empirically and experimentally by one of skill in the art.
As previously noted, the isolated polynucleotides of the present invention include DNA and RNA. Methods for preparing DNA and RNA are well l0 known in the art. In general, RNA is isolated from a tissue or cell that produces large amounts of zmsel RNA. Such tissues and cells are identified by Northern blotting (Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and include intestinal tissues, prostate, ovary, testis, spleen, pancreas, heart, skeletal muscle and the like. Total RNA
can be prepared using guanidinium isothiocyanate extraction followed by isolation by centrifugation in a CsCI gradient (Chirgwin et al., Biochemistry 18:52-94, 1979). Poly (A)+ RNA is prepared from total RNA using the method of Aviv and Leder (Proc.
Natl.
Acad. Sci. USA 69:1408-12, 1972). Complementary DNA (cDNA) is prepared from poly(A)+ RNA using known methods. In the alternative, genomic DNA can be isolated. Polynucleotides encoding zmse 1 polypeptides are then identified and isolated 2 0 by, for example, hybridization or PCR.
A full-length clone encoding zmsel can be obtained by conventional cloning procedures. Complementary DNA (cDNA) clones are preferred, although for some applications (e.g., expression in transgenic animals) it may be preferable to use a genomic clone, or to modify a cDNA clone to include at least one genomic intron.
2 5 Methods for preparing cDNA and genomic clones are well known and within the level of ordinary skill in the art, and include the use of the sequence disclosed herein, or parts thereof, for probing or priming a library. Expression libraries can be probed with antibodies to zmsel, ligand fragments, or other specific binding partners.
Zmsel polynucleotide sequences disclosed herein can also be used as 3 0 probes or primers to clone 5' non-coding regions of a zmse 1 gene. In view of the tissue-specific expression observed for zmse 1 by Northern blotting, this gene region may provide for expression in many cell and tissue types. Promoter elements from a zmsel gene could thus be used to direct the ubiquitous expression of heterologous genes in, for example, transgenic animals or patients treated with gene therapy.
Cloning of 5' flanking sequences also facilitates production of zmsel proteins by "gene activation" as disclosed in U.S. Patent No. 5,641,670. Briefly, expression of an endogenous zmsel gene in a cell is altered by introducing into the zmsel locus a DNA
construct comprising at least a targeting sequence, a regulatory sequence, an exon, and an unpaired splice donor site. The targeting sequence is a zmsel 5' non-coding sequence that permits homologous recombination of the construct with the endogenous zmsel locus, whereby the sequences within the construct become operably linked with the endogenous zmsel coding sequence. In this way, an endogenous zmsel promoter can be replaced or supplemented with other regulatory sequences to provide enhanced, tissue-specific, or otherwise regulated expression.
The polynucleotides of the present invention can also be synthesized using DNA synthesis machines. If chemically synthesized double stranded DNA is required for an application such as the synthesis of a DNA or a DNA fragment, then each complementary strand is made separately, for example via the phosphoramidite method known in the art. The production of short polynucleotides (60 to 80 bp) is technically straightforward and can be accomplished by synthesizing the 2 o complementary strands and then annealing them. However, for producing longer polynucleotides (longer than about 300 bp), special strategies are usually employed.
For example, synthetic DNAs (double-stranded) are assembled in modular form from single-stranded fragments that are from 20 to 100 nucleotides in length. One method for building a synthetic DNA involves producing a set of overlapping, complementary 2 5 oligonucleotides. Each internal section of the DNA has complementary 3' and 5' terminal extensions designed to base pair precisely with an adjacent section.
After the DNA is assembled, the process is completed by ligating the nicks along the backbones of the two strands. In addition to the protein coding sequence, synthetic DNAs can be designed with terminal sequences that facilitate insertion into a restriction endonuclease 3 0 site of a cloning vector. Alternative ways to prepare a full-length DNA
are also known in the art. See Glick and Pasternak, Molecular Biotechnology, Principles &

Applications of Recombinant DNA, (ASM Press, Washington, D.C. 1994); Itakura et al., Annu. Rev. Biochem. 53: 323-56, 1984 and Climie et al., Proc. Natl. Acad.
Sci.
USA 87:633-7, 1990.
The present invention further provides counterpart polypeptides and polynucleotides from other species (orthologs). These species include, but are not limited to mammalian, avian, amphibian, reptile, fish, insect and other vertebrate and invertebrate species. Of particular interest are zmsel polypeptides from other mammalian species, including murine, porcine, ovine, bovine, canine, feline, equine, and other primate polypeptides. Orthologs of human zmsel can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses zmsel as disclosed herein.
Suitable sources of mRNA can be identified by probing Northern blots with probes designed from the sequences disclosed herein. A library is then prepared from mRNA of a positive tissue or cell line. A zmsel-encoding cDNA can then be isolated by a variety of methods, such as by probing with a complete or partial human cDNA or with one or more sets of degenerate probes based on the disclosed sequences. A cDNA can also be cloned using the polymerase chain reaction, or PCR (Mullis, U.S. Patent No.
4,683,202), using primers designed from the representative human zmsel sequence 2 0 disclosed herein. Within an additional method, the cDNA library can be used to transform or transfect host cells, and expression of the cDNA of interest can be detected with an antibody to zmsel polypeptide. Similar techniques can also be applied to the isolation of genomic clones.
A polynucleotide sequence for the mouse ortholog of human zmsel has 2 5 been identified and cloned and is shown in SEQ ID N0:4 and the corresponding amino acid sequence shown in SEQ ID NO:S. Analysis of the mouse zmsel polypeptide encoded by the DNA sequence of SEQ ID N0:4 revealed an open reading frame encoding 349 amino acids (SEQ ID NO:S) comprising a CRIB motif, N-terminal domain, C-terminal domain, and C-terminal tail as described above. A
comparison of 3 0 the human and mouse amino acid sequences reveals that both the human and orthologous polypeptides contain corresponding structural features described above (See, Figure 2). There is about 78% identity between the mouse and human amino acid sequences over the entire amino acid sequence corresponding to SEQ >D N0:2 and SEQ ID NO:S. There is about 100% identity over the CRIB motif corresponding to amino acid residue 27 (lle) to amino acid residue 41 (Gly) of SEQ ID N0:2 and SEQ
ID NO:S. There is about 91 % identity a between the mouse and human zmse 1 sequences over the conserved N-terminal domain corresponding to residues 1 (Met) to 147 (Ala) of SEQ ID N0:2; and residues 1 (Met) to 145 (Ala) of SEQ >D NO:S.
There is about 73% identity a between the mouse and human zmsel sequences over the variable C-terminal domain corresponding to residues 148 (Asn) to 336 (Ser) of SEQ
>D N0:2, and residues 146 (Asp) to 329 (Pro) of SEQ >D NO:S). There is about 95%
identity a between the mouse and human zmsel sequences over the conserved C-terminal tail corresponding to residues 337 (Arg) to 356 (Val) of SEQ >D N0:2, and 330 (Arg) to 349 (Val) of SEQ ID NO:S. The above percent identities were determined using a FASTA program with ktup=l, gap opening penalty=12, gap extension penalty=2, and substitution matrix=BLOSUM62, with other parameters set as default.
The corresponding polynucleotides encoding the mouse zmsel polypeptide regions, domains, motifs, residues and sequences described above are as shown in SEQ ID
N0:4.
Those skilled in the art will recognize that the sequence disclosed in 2o SEQ ID NO:I represents a single allele of human zmsel and that allelic variation and alternative splicing are expected to occur. Allelic variants of this sequence can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures. Allelic variants of the DNA sequence shown in SEQ ID
NO:I, including those containing silent mutations and those in which mutations result in 2 5 amino acid sequence changes, are within the scope of the present invention, as are proteins which are allelic variants of SEQ 117 N0:2. cDNAs generated from alternatively spliced mRNAs, which retain the properties of the zmsel polypeptide are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs. Allelic variants and splice variants of these sequences can be 3 0 cloned by probing cDNA or genomic libraries from different individuals or tissues according to standard procedures known in the art.

The present invention also provides isolated zmsel polypeptides that are substantially similar to the polypeptides of SEQ >T7 N0:2 and their orthologs.
The term "substantially similar" is used herein to denote polypeptides having 70%, preferably 80%, more preferably at least 85%, sequence identity to the sequences shown in SEQ
5 >D N0:2 or their orthologs. Such polypeptides will more preferably be at least 90%
identical, and most preferably 95% or more identical to SEQ 1D N0:2 or its orthologs.) Percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc.
Natl. Acad. Sci. USA 89:10915-9, 1992. Briefly, two amino acid sequences are aligned 10 to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff ibid.) as shown in Table 3 (amino acids are indicated by the standard one-letter codes).
The percent identity is then calculated as:
Total number of identical matches 15 x 100 [length of the longer sequence plus the number of gaps introduced into the longer sequence in order to align the two sequences]

H N M
r1 I
N L(1 N N O
I I
d' r-i M N N
I I
G4 C~ r1 r1 d~ M N
I I I I
G4 l4 d~ N N H M ri I I I
In O N ~-1 r1 ri r1 r1 I I I I I
rY, Ll7 f-1 M r1 O r1 M N N
I I I I I I I
d~ N N O M N H N r1 H
I I I I I I
H d' N M r1 O M N r1 M r1 M
I I I I I I
,T, OD M M r1 N r1 N ~-1 N N N M
I I I I I I I I I I
~ N d' d' N M M N O N N M M

W Ill N O M M r~ N M r1 O r1 M N N

Or Ill N N O M N H O M r1 O r1 N c-i N

U O1 M d' M M r1 ri M ri N M r-1 r1 N N r-I
I I I I I I I I I I I I I I I
l0 M O N r1 H M d~ r1 M M r1 O r1 ~ M M
I I I I I I I I I I I I I
l0 H M O O O r1 M M O N M N r1 O ~ N M
I I I I I I I I I
(Y, II) O N M r1 O N O M N N r1 M N r1 H M N M
I I I I I I I I I I I I I
d~ r1 N N O r1 r1 O N r1 H r1 H N ri ~-1 O M N O
I I I I I I I I I I I I I I
r~ rx z a U a w L7 ~'., H I~ x ~ G4 W CJl [-~ 3 ,'~i M
r~
H
111 O II) O

Sequence identity of polynucleotide molecules is determined by similar methods using a ratio as disclosed above.
Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson and Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant zmsel. The FASTA algorithm is described by Pearson and Lipman, Proc. Nat'1 Acad. Sci. USA 85:2444, 1988; and by Pearson, Meth. Enzymol. 183:63, 1990.
Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ ID N0:2) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff" value (calculated by a predetermined formula based upon the length of the sequence and the ktup value), then the trimmed initial regions are examined to 2 0 determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman and Wunsch, J. Mol. Biol. 48:444, 1970; Sellers, SIAM J. Appl. Math. 26:787, 1974), which allows for amino acid insertions and deletions. Preferred parameters for FASTA
2 5 analysis are: ktup=l, gap opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA
program by modifying the scoring matrix file ("SMATR1X"), as explained in Appendix 2 of Pearson, Meth. Enzymol., supra..
FASTA can also be used to determine the sequence identity of nucleic 3 0 acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other FASTA program parameters set as default.
The BLOSUM62 table (Table 3) is an amino acid substitution matrix derived from about 2,000 local multiple alignments of protein sequence segments, representing highly conserved regions of more than 500 groups of related proteins (Henikoff and Henikoff, Proc. Nat'1 Acad. Sci. USA 89:10915, 1992).
Accordingly, the BLOSUM62 substitution frequencies can be used to define conservative amino acid substitutions that may be introduced into the amino acid sequences of the present invention. Although it is possible to design amino acid substitutions based solely upon chemical properties (as discussed below), the language "conservative amino acid substitution" preferably refers to a substitution represented by a BLOSUM62 value of greater than -1. For example, an amino acid substitution is conservative if the substitution is characterized by a BLOSUM62 value of 0, 1, 2, or 3. According to this system, preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 1 (e.g., 1, 2 or 3), while more preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 2 (e.g., 2 or 3).
Variant zmsel polypeptides or substantially similar zmsel polypeptides are characterized as having one or more amino acid substitutions, deletions or additions.
2 0 These changes are preferably of a minor nature, that is conservative amino acid substitutions (see Table 4) and other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically of one to about 30 amino acids; and amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity 2 5 tag. The present invention thus includes polypeptides of from about 330 to about 385 amino acid residues that comprise a sequence that is at least 90%, preferably at least 95%, and more preferably 99% or more identical to the corresponding region of SEQ
>D N0:2. Polypeptides comprising affinity tags can further comprise a proteolytic cleavage site between the zmsel polypeptide and the affinity tag. Preferred such sites 3 o include thrombin cleavage sites and factor Xa cleavage sites.

Table 4 Conservative amino acid substitutions Basic: arginine lysine histidine Acidic: glutamic acid aspartic acid Polar: glutamine asparagine Hydrophobic: leucine isoleucine valine Aromatic: phenylalanine tryptophan tyrosine Small: glycine alanine serine threonine methionine 2 5 The present invention further provides a variety of other polypeptide fusions and related multimeric proteins comprising one or more polypeptide fusions.
For example, a zmsel polypeptide can be prepared as a fusion to a dimerizing protein as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584. Preferred dimerizing proteins in this regard include immunoglobulin constant region domains.
Immunoglobulin-zmsel polypeptide fusions can be expressed in genetically engineered cells to produce a variety of multimeric zmsel analogs. Auxiliary domains can be fused to zmse 1 polypeptides to target them to specific cells, tissues, or macromolecules (e.g., collagen). For example, a zmsel polypeptide or protein could be targeted to a predetermined cell type by fusing a zmse 1 polypeptide to a ligand that specifically binds to a receptor on the surface of the target cell. In this way, polypeptides and proteins can be targeted for therapeutic or diagnostic purposes. A zmsel polypeptide can be fused to two or more moieties, such as an affinity tag for purification and a 5 targeting domain. Polypeptide fusions can also comprise one or more cleavage sites, particularly between domains. See, Tuan et al., Connective Tissue Research 34:1-9, 1996.
The proteins of the present invention can also comprise non-naturally occurring amino acid residues. Non-naturally occurring amino acids include, without 10 limitation, traps-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline, traps-4-hydroxyproline, N methylglycine, allo-threonine, methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine, pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-dimethylproline, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-15 azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins. For example, an in vitro system can be employed wherein nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA are known in the art. Transcription and translation of 2 0 plasmids containing nonsense mutations is carried out in a cell-free system comprising an E. coli S30 extract and commercially available enzymes and other reagents.
Proteins are purified by chromatography. See, for example, Robertson et al., J. Am.
Chem. Soc.
113:2722, 1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung et al., Science 259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-9, 1993). In a 2 5 second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al., J.
Biol. Chem. 271:19991-8, 1996). Within a third method, E. coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acids) (e.g., 2-azaphenylalanine, 3 0 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The non-naturally occurring amino acid is incorporated into the protein in place of its natural counterpart.

See, Koide et al., Biochem. 33:7470-6, 1994. Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification.
Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993).
A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for zmsel amino acid residues.
Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5, 1989;
Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-502, 1991). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity as disclosed below to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., J. Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor or other biochemical interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992;
Smith et 2 0 al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homologies with related phosphodiesterases.
Determining amino acid residues that are within regions or domains that are critical to maintaining structural integrity is within the skill of one in the art. Within these regions one can determine specific residues that will be more or less tolerant of change and maintain the overall tertiary structure of the molecule. Methods for analyzing sequence structure include, but are not limited to, alignment of multiple sequences with high amino acid or nucleotide identity and computer analysis using available software (e.g., the Insight II~ viewer and homology modeling tools;
MSI, San 3 0 Diego, CA), secondary structure propensities, binary patterns, complementary packing and buried polar interactions (Barton, Current Opin. Struct. Biol. 5:372-376, 1995 and Cordes et al., Current Opin. Struct. Biol. 6:3-10, 1996). In general, when designing modifications to molecules or identifying specific fragments determination of structure will be accompanied by evaluating activity of modified molecules.
Amino acid sequence changes are made in zmsel polypeptides so as to minimize disruption of higher order structure essential to biological activity. For example, when the zmsel polypeptide comprises one or more helices, changes in amino acid residues will be made so as not to disrupt the helix geometry and other components of the molecule where changes in conformation abate some critical function, for example, binding of the molecule to its binding partners, or enzymatic function. The effects of amino acid sequence changes can be predicted by, for example, computer modeling as disclosed above or determined by analysis of crystal structure (see, e.g., Lapthorn et al., Nat. Struct. Biol. 2:266-268, 1995). Other techniques that are well known in the art compare folding of a variant protein to a standard molecule (e.g., the native protein). For example, comparison of the cysteine pattern in a variant and standard molecules can be made. Mass spectrometry and chemical modification using reduction and alkylation provide methods for determining cysteine residues which are associated with disulfide bonds or are free of such associations (Bean et al., Anal.
Biochem. 201:216-226, 1992; Gray, Protein Sci. 2:1732-1748, 1993; and Patterson et al., Anal. Chem. 66:3727-3732, 1994). It is generally believed that if a modified 2 0 molecule does not have the same disulfide bonding pattern as the standard molecule folding would be affected. Another well known and accepted method for measuring folding is circular dichrosism (CD). Measuring and comparing the CD spectra generated by a modified molecule and standard molecule is routine (Johnson, Proteins 7:205-214, 1990). Crystallography is another well known method for analyzing folding 2 5 and structure. Nuclear magnetic resonance (NMR), digestive peptide mapping and epitope mapping are also known methods for analyzing folding and structural similarities between proteins and polypeptides (Schaanan et al., Science 257:961-964, 1992).
A Hopp/Woods hydrophilicity profile of the zmsel protein sequence as 3 0 shown in SEQ ID N0:2 can be generated (Hopp et al., Proc. Natl. Acad.
Sci.78:3824-3828, 1981; Hopp, J. Immun. Meth. 88:1-18, 1986 and Triquier et al., Protein Engineering 11:153-169, 1998). The profile is based on a sliding six-residue window.
Buried G, S, and T residues' and exposed H, Y, and W residues were ignored (See, Figure 1). For example, in zmsel, hydrophilic regions include: (1) amino acid number 96 (Glu) to amino acid number 101 (Asp) of SEQ ID N0:2; (2) amino acid number (Asp) to amino acid number 231 (Asp) of SEQ >D N0:2; (3) amino acid number 346 (Met) to amino acid number 351 (Glu) of SEQ >D N0:2; (4) amino acid number 347 (Asp) to amino acid number 352 (Asp) of SEQ >D N0:2; and (5) amino acid number 348 (Glu) to amino acid number 353 (Glu) of SEQ >D N0:2.
Those skilled in the art will recognize that hydrophilicity or hydrophobicity is taken into account when designing modifications in the amino acid sequence of a zmsel polypeptide, so as not to disrupt the overall structural and biological profile. Of particular interest for replacement are hydrophobic residues selected from the group consisting of Val, Leu and lle or the group consisting of Met, Gly, Ser, Ala, Tyr and Trp; for example, residues tolerant of substitution could include such residues as shown in SEQ ID NO: 2. Cysteine residues will be relatively intolerant of substitution.
The identities of essential amino acids can also be inferred from analysis of sequence similarity between known phosphodiesterase family members with zmsel.
Using methods such as "FASTA" analysis described previously, regions of high 2 0 similarity are identified within a family of proteins and used to analyze amino acid sequence for conserved regions. An alternative approach to identifying a variant zmse 1 polynucleotide on the basis of structure is to determine whether a nucleic acid molecule encoding a potential variant zmsel polynucleotide can hybridize to a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1, as discussed above.
2 5 Other methods of identifying essential amino acids in the polypeptides of the present invention are procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081, 1989; Bass et al., Proc. Natl Acad. Sci. USA 88:4498, 1991; Coombs and Corey, "Site-Directed Mutagenesis and Protein Engineering," in Proteins:
Analysis and 3 0 Design, Angeletti (ed.), Academic Press, Inc., pp. 259-311, 1998). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity as disclosed below to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., J. Biol. Chem. 271:4699, 1996.
The present invention also includes functional fragments of zmsel polypeptides and nucleic acid molecules encoding such functional fragments. A
"functional" zmse 1 or fragment thereof defined herein is characterized by its proliferative or differentiating activity, by its ability to induce or inhibit specialized cell functions, or by its ability to bind specifically to an anti-zmsel antibody or zmsel substrate or binding partner (either soluble or immobilized).
Routine deletion analyses of nucleic acid molecules can be performed to obtain functional fragments of a nucleic acid molecule that encodes a zmsel polypeptide. As an illustration, DNA molecules having the nucleotide sequence of SEQ ID NO:1 or fragments thereof, can be digested with Ba131 nuclease to obtain a series of nested deletions. These DNA fragments are then inserted into expression vectors in proper reading frame, and the expressed polypeptides are isolated and tested for zmsel activity, or for the ability to bind anti-zmsel antibodies or zmsel substrate or binding partner. One alternative to exonuclease digestion is to use oligonucleotide directed mutagenesis to introduce deletions or stop codons to specify production of a desired zmse 1 fragment. Alternatively, particular fragments of a zmse 1 polynucleotide 2 0 can be synthesized using the polymerase chain reaction.
Standard methods for identifying functional domains are well-known to those of skill in the art. For example, studies on the truncation at either or both termini of interferons have been summarized by Horisberger and Di Marco, Pharmac.
Ther.
66:507, 1995. Moreover, standard techniques for functional analysis of proteins are 2 5 described by, for example, Treuter et al., Molec. Gen. Genet. 240:113, 1993; Content et al., "Expression and preliminary deletion analysis of the 42 kDa 2-SA
synthetase induced by human interferon," in Biological Interferon Systems, Proceedings of ISIR-TNO Meeti~ on Interferon Systems, Cantell (ed.), Nijhoff, pp. 65-72, 1987;
Herschman, "The EGF Receptor," in Control of Animal Cell Proliferation 1 Boynton et 3 0 al. (eds.), Academic Press, pp. 169-199, 1985; Coumailleau et al., J.
Biol. Chem.

270:29270, 1995; Fukunaga et al., J. Biol. Chem. 270:25291, 1995; Yamaguchi et al., Biochem. Pharmacol. 50:1295, 1995; and Meisel et al., Plant Molec. Biol. 30:1, 1996.
In addition, the proteins of the present invention (or polypeptide fragments thereof) can be joined to other bioactive molecules, particularly other CRIB
5 proteins or Rho effectors, to provide multi-functional molecules. For example, one or more domains or sub-fragments from zmsel can be joined to other CRIB proteins to enhance their biological properties or efficiency of production.
The present invention thus provides a series of novel, hybrid molecules in which a segment comprising one or more of the domains or motifs of zmsel is fused 10 to another polypeptide. Fusion is preferably done by splicing at the DNA
level to allow expression of chimeric molecules in recombinant production systems. The resultant molecules are then assayed for such properties as improved solubility, improved stability, prolonged clearance half life, improved expression and secretion levels, and pharmacodynamics. Such hybrid molecules may further comprise additional amino 15 acid residues (e.g. a polypeptide linker) between the component proteins or polypeptides.
Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA
2 0 86:2152-6, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et al., Biochem. 30:10832-7, 1991; Ladner et al., 2 5 U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA
7:127, 1988).
Variants of the disclosed zmsel DNA and polypeptide sequences can be generated through DNA shuffling as disclosed by Stemmer, Nature 370:389-91, 1994, 3 0 Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-51, 1994 and WIPO Publication WO
97/20078. Briefly, variant DNAs are generated by in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations. This technique can be modified by using a family of parent DNAs, such as allelic variants or DNAs from different species, to introduce additional variability into the process. Selection or screening for the desired activity, followed by additional iterations of mutagenesis and assay provides for rapid "evolution" of sequences by selecting for desirable mutations while simultaneously selecting against detrimental changes.
Mutagenesis methods as disclosed herein can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized 1 o polypeptides in host cells. Mutagenized DNA molecules that encode active polypeptides (e.g., those with CRIB protein activity, that induce signal transduction, that exhibit Cdc42/Rac or other Rho protein binding, that bind anti-zmsel antibodies, and the like) can be recovered from the host cells and rapidly sequenced.
These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.
Using the methods discussed herein, one of ordinary skill in the art can identify and/or prepare a variety of polypeptide fragments or variants of SEQ
ID N0:2 or that retain, for example, CRIB protein-like properties, protein binding activity, 2 0 cytoskeletal rearranging activity, proliferation, induction of actin polymerization, cell motility or invasion, cell-cell communication, or signal transduction activity of the wild-type zmsel protein. For example, using the methods described herein, one could identify a substrate binding domain in addition to the CRIB domain on zmsel;
heterodimeric and homodimeric binding domains; guanosine nucleotide binding 2 5 domains; other enzymatically active domains; other functional or structural domains; or other domains important for protein-protein interactions, biological activity, or signal transduction. Such polypeptides may also include additional polypeptide segments, such as affinity tags, as generally disclosed herein.
For any zmsel polypeptide, including variants and fusion proteins, one 3 0 of ordinary skill in the art can readily generate a fully degenerate polynucleotide sequence encoding that variant using the information set forth in Tables 1 and 2 above.

The zmsel polypeptides of the present invention, including full-length polypeptides, biologically active fragments, and fusion polypeptides, can be produced in genetically engineered host cells according to conventional techniques.
Suitable host cells are those cell types that can be transformed or transfected with exogenous DNA
and grown in culture, and include bacteria, fungal cells, and cultured higher eukaryotic cells. Eukaryotic cells, particularly cultured cells of multicellular organisms, are preferred. Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into a variety of host cells are disclosed by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Ausubel et al., eds., Current Protocols in Molecular Biolo~y, John Wiley and Sons, Inc., NY, 1987.
In general, a DNA sequence encoding a zmsel polypeptide is operably linked to other genetic elements required for its expression, generally including a transcription promoter and terminator, within an expression vector. The vector will also commonly contain one or more selectable markers and one or more origins of replication, although those skilled in the art will recognize that within certain systems selectable markers may be provided on separate vectors, and replication of the exogenous DNA may be provided by integration into the host cell genome.
Selection 2 0 of promoters, terminators, selectable markers, vectors and other elements is a matter of routine design within the level of ordinary skill in the art. Many such elements are described in the literature and are available through commercial suppliers.
To direct a zmsel polypeptide into the secretory pathway of a host cell, a secretory signal sequence (also known as a leader sequence, prepro sequence or pre 2 5 sequence) is provided in the expression vector. The secretory signal sequence may be derived from any secreted protein (e.g., t-PA) or synthesized de novo. The secretory signal sequence is operably linked to the zmsel DNA sequence, i.e., the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide into the secretory pathway of the host cell. Secretory signal sequences are 3 0 commonly positioned 5' to the DNA sequence encoding the polypeptide of interest, although certain secretory signal sequences may be positioned elsewhere in the DNA

sequence of interest (see, e.g., Welch et al., U.S. Patent No. 5,037,743;
Holland et al., U.S. Patent No. 5,143,830).
Cultured mammalian cells are suitable hosts within the present invention. Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978;
Corsaro and Pearson, Somatic Cell Genetics 7:603, 1981: Graham and Van der Eb, Virolo~y 52:456, 1973), electroporation (Neumann et al., EMBO J. 1:841-5, 1982), DEAF-dextran mediated transfection (Ausubel et al., ibid.), and liposome-mediated transfection (Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80, 1993, and viral vectors (Miller and Rosman, BioTechniques 7:980-90, 1989; Wang and Finer, Nature Med. 2:714-6, 1996). The production of recombinant polypeptides in cultured mammalian cells is disclosed, for example, by Levinson et al., U.S. Patent No.
4,713,339; Hagen et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S.
Patent No.
4,579,821; and Ringold, U.S. Patent No. 4,656,134. Suitable cultured mammalian cells include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK
(ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977), NIH 3T3 fibroblasts (ATCC
No.
CRL-1658), Rat2 cells (ATCC No. CRL-1764), and Chinese hamster ovary (e.g. CHO-K1; ATCC No. CCL 61) cell lines. Additional suitable cell lines are known in the art 2 o and available from public depositories such as the American Type Culture Collection, Manassas, VA. In general, strong transcription promoters are preferred, such as promoters from SV-40 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288.
Other suitable promoters include those from metallothionein genes (U.S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late promoter.
2 5 Drug selection is generally used to select for cultured mammalian cells into which foreign DNA has been inserted. Such cells are commonly referred to as "transfectants". Cells that have been cultured in the presence of the selective agent and are able to pass the gene of interest to their progeny are referred to as "stable transfectants." A preferred selectable marker is a gene encoding resistance to the 3 0 antibiotic neomycin. Selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like. Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification."
Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes. A preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate.
Other drug resistance genes (e.g. hygromycin resistance, multi-drug resistance, puromycin acetyltransferase) can also be used. Alternative markers that introduce an altered phenotype, such as green fluorescent protein, or cell surface proteins such as CD4, CDB, Class I MHC, placental alkaline phosphatase may be used to sort transfected cells from untransfected cells by such means as FACS sorting or magnetic bead separation technology.
Other higher eukaryotic cells can also be used as hosts, including plant cells, insect cells and avian cells. The use of Agrobacterium rhizogenes as a vector for expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci.
(Ban ate) 11:47-58, 1987. Transformation of insect cells and production of foreign polypeptides therein is disclosed by Guarino et al., U.S. Patent No. 5,162,222 and WIPO
publication WO 94/06463. Insect cells can be infected with recombinant baculovirus, commonly derived from Autographa californica nuclear polyhedrosis virus (AcNPV). See, King, L.A. and Possee, R.D., The Baculovirus Expression System: A Laboratory Guide, 2 0 London, Chapman & Hall; O'Reilly, D.R. et al., Baculovirus Expression Vectors: A
Laboratory Manual, New York, Oxford University Press., 1994; and, Richardson, C. D., Ed., Baculovirus Expression Protocols. Methods in Molecular Biology, Totowa, NJ, Humana Press, 1995. The second method of making recombinant baculovirus utilizes a transposon-based system described by Luckow (Luckow, V.A, et al., J Virol 67:4566-2 5 79, 1993). This system is sold in the Bac-to-Bac kit (Life Technologies, Rockville, MD). This system utilizes a transfer vector, pFastBaclT"~ (Life Technologies) containing a Tn7 transposon to move the DNA encoding the zmsel polypeptide into a baculovirus genome maintained in E. coli as a large plasmid called a "bacmid."
The pFastBaclT"" transfer vector utilizes the AcNPV polyhedrin promoter to drive the 30 expression of the gene of interest, in this case zmsel. However, pFastBaclT~" can be modified to a considerable degree. The polyhedrin promoter can be removed and substituted with the baculovirus basic protein promoter (also known as Pcor, p6.9 or MP promoter) which is expressed earlier in the baculovirus infection, and has been shown to be advantageous for expressing secreted proteins. See, Hill-Perkins, M.S. and Possee, R.D., J. Gen. Virol. 71:971-6, 1990; Bonning, B.C. et al., J. Gen.
Virol.
5 75:1551-6, 1994; and, Chazenbalk, G.D., and Rapoport, B., J. Biol. Chem.
270:1543-9, 1995. In such transfer vector constructs, a short or long version of the basic protein promoter can be used. Moreover, transfer vectors can be constructed which replace the native zmsel secretory signal sequences with secretory signal sequences derived from insect proteins. For example, a secretory signal sequence from Ecdysteroid 10 Glucosyltransferase (EGT), honey bee Melittin (Invitrogen, Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego, CA) can be used in constructs to replace the native zmsel secretory signal sequence. In addition, transfer vectors can include an in-frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the expressed zmsel polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer, T. et 15 al., Proc. Natl. Acad. Sci. 82:7952-4, 1985). Using a technique known in the art, a transfer vector containing zmsel is transformed into E. coli, and screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus.
The bacmid DNA containing the recombinant baculovirus genome is isolated, using common techniques, and used to transfect Spodoptera frugiperda cells, e.g. Sf9 cells.

20 Recombinant virus that expresses zmsel is subsequently produced.
Recombinant viral stocks are made by methods commonly used the art.
The recombinant virus is used to infect host cells, typically a cell line derived from the fall armyworm, Spodoptera frugiperda. See, in general, Glick and Pasternak, Molecular Biotechnolo~y: Principles and Applications of Recombinant 2 5 DNA, ASM Press, Washington, D.C., 1994. Another suitable cell line is the High FiveOT"" cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent No.5,300,435).
Commercially available serum-free media are used to grow and maintain the cells.
Suitable media are Sf900 I1T"" (Life Technologies) or ESF 921T"" (Expression Systems) for the Sf9 cells; and Ex-ce11O405T"" (JRH Biosciences, Lenexa, KS) or Express 3 0 FiveOT"~ (Life Technologies) for the T. ni cells. The cells are grown up from an inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x 106 cells at which time a recombinant viral stock is added at a multiplicity of infection (MOB of 0.1 to 10, more typically near 3. Procedures used are generally described in available laboratory manuals (King, L. A. and Possee, R.D., ibid.; O'Reilly, D.R. et al., ibid.;
Richardson, C. D., ibid.). Subsequent purification of the zmsel polypeptide from the supernatant can be achieved using methods described herein.
Fungal cells, including yeast cells, can also be used within the present invention. Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica. Methods for transforming S.
cerevisiae cells with exogenous DNA and producing recombinant polypeptides therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311;
Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008;
Welch et al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075.
Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae is the POTI vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media.
Suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311; Kingsman et al., U.S.
2 0 Patent No. 4,615,974; and Bitter, U.S. Patent No. 4,977,092) and alcohol dehydrogenase genes. See also U.S. Patents Nos. 4,990,446; 5,063,154;
5,139,936 and 4,661,454. Transformation systems for other yeasts, including Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago maydis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida 2 5 maltosa are known in the art. See, for example, Gleeson et al., J. Gen.
Microbiol.
132:3459-65, 1986 and Cregg, U.S. Patent No. 4,882,279. Aspergillus cells may be utilized according to the methods of McKnight et al., U.S. Patent No.
4,935,349.
Methods for transforming Acremonium chrysogenum are disclosed by Sumino et al., U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed by 3 0 Lambowitz, U.S. Patent No. 4,486,533.

The use of Pichia methanolica as host for the production of recombinant proteins is disclosed in WIPO Publications WO 97/17450, WO 97/17451, WO
98/02536, and WO 98/02565. DNA molecules for use in transforming P.
methanolica will commonly be prepared as double-stranded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P.
methanolica, it is preferred that the promoter and terminator in the plasmid be that of a P.
methanolica gene, such as a P. methanolica alcohol utilization gene (AUGI or AUG2). Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of the DNA
into the host chromosome, it is preferred to have the entire expression segment of the plasmid flanked at both ends by host DNA sequences. A preferred selectable marker for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21), which allows ade2 host cells to grow in the absence of adenine. For large-scale, industrial processes where it is desirable to minimize the use of methanol, it is preferred to use host cells in which both methanol utilization genes (AUGl and AUG2) are deleted. For production of secreted proteins, host cells deficient in vacuolar protease genes (PEP4 and PRBI ) are preferred. Electroporation is used to facilitate the introduction of a plasmid containing DNA encoding a polypeptide of interest into P. methanolica cells.
It is 2 0 preferred to transform P. methanolica cells by electroporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40 milliseconds, most preferably about 20 milliseconds.
Prokaryotic host cells, including strains of the bacteria Escherichia coli, 2 5 Bacillus and other genera are also useful host cells within the present invention.
Techniques for transforming these hosts and expressing foreign DNA sequences cloned therein are well known in the art (see, e.g., Sambrook et al., ibid.). When expressing a zmsel polypeptide in bacteria such as E. coli, the polypeptide may be retained in the cytoplasm, typically as insoluble granules, or may be directed to the periplasmic space 3 0 by a bacterial secretion sequence. In the former case, the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea. The denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution. In the latter case, the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
Transformed or transfected host cells are cultured according to conventional procedures in a culture medium containing nutrients and other components required for the growth of the chosen host cells. A variety of suitable media, including defined media and complex media, are known in the art and generally include a carbon source, a nitrogen source, essential amino acids, vitamins and minerals. Media may also contain such components as growth factors or serum, as required. The growth medium will generally select for cells containing the exogenously added DNA by, for example, drug selection or deficiency in an essential nutrient which is complemented by the selectable marker carried on the expression vector or co-transfected into the host cell. P. methanolica cells are cultured in a medium comprising adequate sources of carbon, nitrogen and trace nutrients at a temperature of about 25°C
to 35°C. Liquid cultures are provided with sufficient aeration by conventional means, 2 0 such as shaking of small flasks or sparging of fermentors. A preferred culture medium for P. metharcolica is YEPD (2% D-glucose, 2% BactoT~''' Peptone (Difco Laboratories, Detroit, MI), 1% BactoTM yeast extract (Difco Laboratories), 0.004% adenine and 0.006% L-leucine).
It is preferred to purify the polypeptides of the present invention to >_80% purity, more preferably to >_90% purity, even more preferably >_95%
purity, and particularly preferred is a pharmaceutically pure state, that is greater than 99.9% pure with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents. Preferably, a purified polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin.
Expressed recombinant zmsel polypeptides (or chimeric zmsel polypeptides) can be purified using fractionation and/or conventional purification methods and media. For example, the zmsel polypeptides of the present invention can be purified using glutathione affinity chromatography followed by isopropyl-1-thio-(3-D-galactopyranoside, such as that applied to other CRIB proteins (Burbelo, P.D. et al., J. Biol. Chem. 270:29071-29074, 1995). Moreover, other conventional purification methods can be used. Ammonium sulfate precipitation and acid or chaotrope extraction may be used for fractionation of samples. Exemplary purification steps may include hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid chromatography. Suitable chromatographic media include derivatized dextrans, agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI, DEAE, QAE
and Q derivatives are preferred. Exemplary chromatographic media include those media derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF
(Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71 (Toso Haas) and the like. Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene beads, cross-linked polyacrylamide resins and the like that are insoluble under the conditions in which they are to be used. These supports may be modified with reactive groups that allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxyl groups and/or carbohydrate moieties. Examples of coupling chemistries 2 0 include cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, hydrazide activation, and carboxyl and amino derivatives for carbodiimide coupling chemistries. These and other solid media are well known and widely used in the art, and are available from commercial suppliers.
Methods for binding receptor polypeptides, or anti-complementary polypeptides, to 2 5 support media are well known in the art. Selection of a particular method is a matter of routine design and is determined in part by the properties of the chosen support. See, for example, Affinity Chromatography: Principles & Methods, Pharmacia LKB
Biotechnology, Uppsala, Sweden, 1988.
The polypeptides of the present invention can be isolated by exploitation 3 0 of their structural or biochemical properties. For example, immobilized metal ion adsorption (IMAC) chromatography can be used to purify histidine-rich proteins, including those comprising polyhistidine tags. Briefly, a gel is first charged with divalent metal ions to form a chelate (Sulkowski, Trends in Biochem. 3:1-7, 1985).
Histidine-rich proteins will be adsorbed to this matrix with differing affinities, depending upon the metal ion used, and will be eluted by competitive elution, lowering 5 the pH, or use of strong chelating agents. Other methods of purification include purification of glycosylated proteins by lectin affinity chromatography and ion exchange chromatography (Methods in Enzymol., Vol. 182, "Guide to Protein Purification", M. Deutscher, (ed.), Acad. Press, San Diego, 1990, pp.529-39).
Within additional embodiments of the invention, a fusion of the polypeptide of interest and an 10 affinity tag (e.g., maltose-binding protein, an immunoglobulin domain) may be constructed to facilitate purification. Moreover purification methods used to purify mammalian, or other eukaryotic CRIB polypeptides can be used to purify human zmsel polypeptides. See, for example, Burbelo, P.D. et al., supra..
Moreover, using methods described in the art, polypeptide fusions, or 15 hybrid zmsel proteins, are constructed using regions or domains of the inventive zmsel in combination with those of other Rho effector family proteins (e.g. MSE55, PAK, WASP, other CRIB proteins, and the like), or heterologous proteins (Sambrook et al., ibid.; Altschul et al., ibid.; Picard, Cur. Opin. Biology, 5:511-5, 1994, and references therein). These methods allow the determination of the biological importance of larger 2 0 domains or regions in a polypeptide of interest. Such hybrids may alter reaction kinetics, binding, constrict or expand the substrate specificity, alter activity in cytoskeletal reorganization or gene transcription in a cell, alter cytoskeletal organization and cell motility, transformation, or invasiveness, or alter tissue and cellular localization of a polypeptide, and can be applied to polypeptides of unknown structure.
2 5 Fusion proteins can be prepared by methods known to those skilled in the art by preparing each component of the fusion protein and chemically conjugating them. Alternatively, a polynucleotide encoding various components of the fusion protein in the proper reading frame can be generated using known techniques and expressed by the methods described herein. For example, part or all of a domains) 3 0 conferring a structural or biological function may be swapped between zmse 1 of the present invention with the functionally equivalent domains) from another family member. Such domains include, but are not limited to, the CRIB motif, the N-terminal domain, C-terminal domain, or C-terminal tail. Such fusion proteins would be expected to have a biological functional profile that is the same or similar to polypeptides of the present invention or other known Rho effector family proteins (e.g.
binding Cdc42, GTP hydrolysis or binding, increasing or decreasing actin polymerization, cell motility, or transformation, and the like) depending on the fusion constructed. Moreover, such fusion proteins may exhibit other properties as disclosed herein.
Standard molecular biological and cloning techniques can be used to swap the equivalent domains between the zmsel polypeptide and those polypeptides to which they are fused. Generally, a DNA segment that encodes a domain of interest, e.g., a zmsel active polypeptide or motif described herein, is operably linked in frame to at least one other DNA segment encoding an additional polypeptide and inserted into an appropriate expression vector, as described herein. Generally DNA
constructs are made such that the several DNA segments that encode the corresponding regions of a polypeptide are operably linked in frame to make a single construct that encodes the entire fusion protein, or a functional portion thereof. For example, a DNA
construct would encode from N-terminus to C-terminus a fusion protein comprising a signal polypeptide followed by a full length or mature polypeptide; or a DNA
construct would 2 0 encode from N-terminus to C-terminus a fusion protein comprising an N-terminal domain containing a CRIB motif and a C-terminal domain; or a DNA construct would encode from N-terminus to C-terminus a fusion protein comprising an N-terminal domain containing a CRIB motif; or, for example, any of the above as interchanged with equivalent regions from another protein. Such fusion proteins can be expressed, 2 5 isolated, and assayed for activity as described herein.
Zmsel polypeptides or fragments thereof may also be prepared through chemical synthesis. Zmsel polypeptides may be monomers or multimers;
glycosylated or non-glycosylated; pegylated or non-pegylated; and may or may not include an initial methionine amino acid residue.
3 0 Polypeptides of the present invention can also be synthesized by exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. Methods for synthesizing polypeptides are well known in the art. See, for example, Merrifield, J. Am. Chem. Soc. 85:2149, 1963; Kaiser et al., Anal. Biochem. 34:595, 1970. After the entire synthesis of the desired peptide on a solid support, the peptide-resin is with a reagent which cleaves the polypeptide from the resin and removes most of the side-chain protecting groups. Such methods are well established in the art.
The activity of molecules of the present invention can be measured using a variety of assays that measure actin polymerization, GTP binding or hydrolysis, proliferation, cell motility and invasion, metastasis or other CRIB/Rho effector protein activity. Of particular interest are assays that measure changes in cell proliferation, transformation, adhesion, gene expression, apoptosis, generation of nucleotide monophosphates, cell motility and invasion, metastasis, actin stress fiber production, filopodia, lamellipodia, membrane ruffling and others. Moreover CRIB/Rho effector protein activity can be measured using protein or antibody binding assays, scintillation proximity assay (SPA) technology described herein; cAMP assays described herein; as well as other assays described herein. Such assays are well known in the art, and many are described in further detail below.
As a CRIB protein zmsel can affect cytoskeletal reorganization, cell-cell interaction and motility and hence can affect tissues that contract. Moreover, zmsel is expressed in contractile tissues. For example contractile tissues in which zmsel is expressed include testis, prostate, heart and skeletal muscle. The effects of zmsel polypeptide, its antagonists and agonists, on tissue contractility can be measured in vitro using a tensiometer with or without electrical field stimulation. Such assays are known in the art and can be applied to tissue samples, such as aortic rings, muscle 2 5 tissue, and other contractile tissue samples, as well as to organ systems, such as atria, and can be used to determine whether zmsel polypeptide, its agonists or antagonists, enhance or depress contractility. Molecules of the present invention are hence useful for treating dysfunction associated with contractile tissues or can be used to suppress or enhance contractility in vivo. As such, molecules of the present invention have utility 3 0 in treating cardiovascular disease, muscle relaxants or stimulants, infertility, in vitro fertilization, birth control, treating impotence or other male reproductive dysfunction, as well as inducing birth.
The effect of the zmsel polypeptides, antagonists and agonists of the present invention on contractility of tissues including skeletal and smooth muscle tissues, testis, heart, and the like, can be measured in a tensiometer that measures contractility and relaxation in tissues. See, Dainty et al., J. Pharmacol.
100:767, 1990;
Rhee et al., Neurotox. 16: 179, 1995; Anderson, M.B., Endocrinol. 114:364-368, 1984;
and Downing, S.J. and Sherwood, O.D, Endocrinol. 116:1206-1214, 1985. For example, measuring vasodilatation of aortic rings is well known in the art.
Briefly, aortic rings are taken from 4 month old Sprague Dawley rats and placed in a buffer solution, such as modified Krebs solution (118.5 mM NaCI, 4.6 mM KCI, 1.2 mM
MgS04.7H20, 1.2 mM KHZPO4, 2.5 mM CaC12.2H20, 24.8 mM NaHC03 and 10 mM
glucose). One of skill in the art would recognize that this method can be used with other animals, such as rabbits, other rat strains, Guinea pigs, and the like.
The rings are then attached to an isometric force transducer (Radnoti Inc., Monrovia, CA) and the data recorded with a Ponemah physiology platform (could Instrument systems, Inc., Valley View, OH) and placed in an oxygenated (95% OZ, 5% C02) tissue bath containing the buffer solution. The tissues are adjusted to 1 gram resting tension and allowed to stabilize for about one hour before testing. The integrity of the rings can be 2 0 tested with norepinepherin (Sigma Co., St. Louis, MO) and Carbachol, a muscarinic acetylcholine agonist (Sigma Co.). After integrity is checked, the rings are washed three times with fresh buffer and allowed to rest for about one hour. To test a sample for vasodilatation, or relaxation of the aortic ring tissue, the rings are contracted to two grams tension and allowed to stabilize for fifteen minutes. A zmsel polypeptide, 2 5 antagonist or agonist sample is then added to l, 2 or 3 of the 4 baths, without flushing, and tension on the rings recorded and compared to the control rings containing buffer only. Enhancement or relaxation of contractility by zmsel polypeptides, their agonists and antagonists is directly measured by this method, and it can be applied to other contractile tissues such as skeletal and smooth muscle tissue, gastrointestinal tissues, 3 0 uterus, prostate, and testis.

The activity of molecules of the present invention can be measured using a variety of assays that measure stimulation of gastrointestinal cell contractility, modulation of nutrient uptake and/or secretion of digestive enzymes. Of particular interest are changes in contractility of smooth muscle cells, for example, the contractile response of segments of mammalian duodenum or other gastrointestinal smooth muscles tissue (Depoortere et al., J. Gastrointestinal Motility 1:150-159, 1989, incorporated herein by reference). An exemplary in vivo assay uses an ultrasonic micrometer to measure the dimensional changes radially between commissures and longitudinally to the plane of the valve base (Hansen et al., Society of Thoracic Surgeons 60:5384-390, 1995).
Gastric motility is generally measured in the clinical setting as the time required for gastric emptying and subsequent transit time through the gastrointestinal tract. Gastric emptying scans are well known to those skilled in the art, and briefly, comprise use of an oral contrast agent, such as barium, or a radiolabeled meal. Solids and liquids can be measured independently. A test food or liquid is radiolabeled with an isotope (e.g. 99"'Tc), and after ingestion or administration, transit time through the gastrointestinal tract and gastric emptying are measured by visualization using gamma cameras (Meyer et al., Am. J. Di_ .g Dis. 21:296, 1976; Collins et al., Gut 24:1117, 1983;
Maughan et al., Diabet. Med. 13 9 Supp. 5:S6-10, 1996 and Horowitz et al., Arch.
Intern. Med. 145:1467-1472, 1985). These studies may be performed before and after the administration of a promotility agent to quantify the efficacy of the drug.
An in vivo approach for assaying proteins of the present invention involves viral delivery systems. Exemplary viruses for this purpose include adenovirus, herpesvirus, retroviruses, vaccinia virus, and adeno-associated virus (AAV).
2 5 Adenovirus, a double-stranded DNA virus, is currently the best studied gene transfer vector for delivery of heterologous nucleic acid (for review, see T.C. Becker et al., Meth. Cell Biol. 43:161-89, 1994; and J.T. Douglas and D.T. Curiel, Science &
Medicine 4:44-53, 1997). The adenovirus system offers several advantages: (i) adenovirus can accommodate relatively large DNA inserts; (ii) can be grown to high-3 0 titer; (iii) infect a broad range of mammalian cell types; and (iv) can be used with many different promoters including ubiquitous, tissue specific, and regulatable promoters.

Also, because adenoviruses are stable in the bloodstream, they can be administered by intravenous injection.
Using adenovirus vectors where portions of the adenovirus genome are deleted, inserts are incorporated into the viral DNA by direct ligation or by homologous 5 recombination with a co-transfected plasmid. In an exemplary system, the essential E1 gene has been deleted from the viral vector, and the virus will not replicate unless the E1 gene is provided by the host cell (the human 293 cell line is exemplary).
When intravenously administered to intact animals, adenovirus primarily targets the liver. If the adenoviral delivery system has an E1 gene deletion, the virus cannot replicate in the 10 host cells. However, the host's tissue (e.g., liver) will express and process (and, if a secretory signal sequence is present, secrete) the heterologous protein.
Secreted proteins will enter the circulation in the highly vascularized liver, and effects on the infected animal can be determined.
Moreover, adenoviral vectors containing various deletions of viral genes 15 can be used in an attempt to reduce or eliminate immune responses to the vector. Such adenoviruses are E1 deleted, and in addition contain deletions of E2A or E4 (Lusky, M.
et al., J. Virol. 72:2022-2032, 1998; Raper, S.E. et al., Human Gene Therapy 9:671-679, 1998). In addition, deletion of E2b is reported to reduce immune responses (Amalfitano, A. et al., J. Virol. 72:926-933, 1998). Moreover, by deleting the entire 2 0 adenovirus genome, very large inserts of heterologous DNA can be accommodated.
Generation of so called "gutless" adenoviruses where all viral genes are deleted are particularly advantageous for insertion of large inserts of heterologous DNA.
For review, see Yeh, P. and Perricaudet, M., FASEB J. 11:615-623, 1997.
The adenovirus system can also be used for protein production in vitro.
2 5 By culturing adenovirus-infected non-293 cells under conditions where the cells are not rapidly dividing, the cells can produce proteins for extended periods of time.
For instance, BHK cells are grown to confluence in cell factories, then exposed to the adenoviral vector encoding the secreted protein of interest. The cells are then grown under serum-free conditions, which allows infected cells to survive for several weeks 3 0 without significant cell division. Alternatively, adenovirus vector infected 293 cells can be grown as adherent cells or in suspension culture at relatively high cell density to produce significant amounts of protein (See Gamier et al., Cytotechnol. 15:145-55, 1994). With either protocol, an expressed, secreted heterologous protein can be repeatedly isolated from the cell culture supernatant, lysate, or membrane fractions depending on the disposition of the expressed protein in the cell. Within the infected 293 cell production protocol, non-secreted proteins may also be effectively obtained.
Moreover, the activity and effect of zmsel on tumor progression and metastasis can be measured in vivo. Several syngeneic mouse models have been developed to study the influence of polypeptides, compounds or other treatments on tumor progression. In these models, tumor cells passaged in culture are implanted into mice of the same strain as the tumor donor. The cells will develop into tumors having similar characteristics in the recipient mice, and metastasis will also occur in some of the models. Appropriate tumor models for our studies include the Lewis lung carcinoma (ATCC No. CRL-1642) and B 16 melanoma (ATCC No. CRL-6323), amongst others. These are both commonly used tumor lines, syngeneic to the mouse, that are readily cultured and manipulated in vitro. Tumors resulting from implantation of either of these cell lines are capable of metastasis to the lung in C57BL6 mice. The Lewis lung carcinoma model has recently been used in mice to identify an inhibitor of angiogenesis (O'Reilly MS, et al. Cell 79: 315-328,1994).
C57BL6/J mice are treated with an experimental agent either through daily injection of 2 0 recombinant protein, agonist or antagonist or a one time injection of recombinant adenovirus. Three days following this treatment, 105 to 106 cells are implanted under the dorsal skin. Alternatively, the cells themselves may be infected with recombinant adenovirus, such as one expressing zmsel, before implantation so that the protein is synthesized at the tumor site or intracellularly, rather than systemically.
The mice 2 5 normally develop visible tumors within 5 days. The tumors are allowed to grow for a period of up to 3 weeks, during which time they may reach a size of 1500 -1800 mm3 in the control treated group. Tumor size and body weight are carefully monitored throughout the experiment. At the time of sacrifice, the tumor is removed and weighed along with the lungs and the liver. The lung weight has been shown to.
correlate well 3 0 with metastatic tumor burden. As an additional measure, lung surface metastases are counted. The resected tumor, lungs and liver are prepared for histopathological examination, immunohistochemistry, and in situ hybridization, using methods known in the art and described herein. The influence of the expressed polypeptide in question, e.g., zmsel, on the ability of the tumor to recruit vasculature and undergo metastasis can thus be assessed. In addition, aside from using adenovirus, the implanted cells can . be transiently transfected with zmse 1. Use of stable zmse 1 transfectants as well as use of induceable promoters to activate zmsel expression in vivo are known in the art and can be used in this system to assess zmsel induction of metastasis. For general reference see, O'Reilly MS, et al. Cell 79:315-328, 1994; and Rusciano D, et al.
Murine Models of Liver Metastasis. Invasion Metastasis 14:349-361, 1995.
The activation of zmsel polypeptide can be measured by a silicon-based biosensor microphysiometer which measures the extracellular acidification rate or proton excretion associated with zmsel activation and subsequent physiologic cellular responses. An exemplary device is the CytosensorT"' Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA. A variety of cellular responses, such as cell proliferation, signal transduction, ion transport, energy production, inflammatory response, regulatory and receptor activation, and the like, can be measured by this method. See, for example, McConnell, H.M. et al., Science 257:1906-1912, 1992;
Pitchford, S. et al., Meth. Enz.~ 228:84-108, 1997; Arimilli, S. et al., J.
Iminunol.
Meth. 212:49-59, 1998; Van Liefde, I. Et al., Eur. J. Pharmacol. 346:87-95, 1998. The 2 0 microphysiometer can be used for assaying adherent or non-adherent eukaryotic or prokaryotic cells. By measuring extracellular acidification changes in cell media over time, the microphysiometer directly measures cellular responses to various stimuli, including agonists, ligands, or antagonists of the zmsel polypeptide.
Preferably, the microphysiometer is used to measure responses of a zmsel-expressing eukaryotic cell, 2 5 compared to a control eukaryotic cell that does not express zmse 1 polypeptide. Zmse 1-expressing eukaryotic cells comprise cells into which zmsel has been transfected, as described herein, creating a cell that is responsive to zmsel-modulating stimuli; or cells naturally expressing zmsel. Differences, measured by a change in extracellular acidification, for example, an increase or diminution in the response of cells expressing 30 zmsel, relative to a control, are a direct measurement of zmsel-modulated cellular responses. Moreover, such zmsel-modulated responses can be assayed under a variety of stimuli. Also, using the microphysiometer, there is provided a method of identifying agonists and antagonists of zmsel polypeptide, comprising providing cells expressing a zmse 1 polypeptide, culturing a first portion of the cells in the absence of a test compound, culturing a second portion of the cells in the presence of a test compound, and detecting a change, for example, an increase or diminution, in a cellular response of the second portion of the cells as compared to the first portion of the cells.
The change in cellular response is shown as a measurable change extracellular acidification rate.
Antagonists and agonists, including the natural effectors or binding partners of zmsel polypeptide, can be rapidly identified using this method.
In view of the protein family of which zmsel is a member, agonists (including the natural ligand/ substrate/ cofactor/ etc.) and antagonists have enormous potential in both in vitro and in vivo applications. Compounds identified as zmsel agonists and antagonists are useful for modulating tumor cell motility, invasion, and metastasis, modulating actin polymerization and cytoskeletal reorganization, gene transcription, modulating contractility of various tissues as described herein, modulating proliferation (e.g., of cancerous cells), modulating digestion, modulating heart conditions, modulating testicular function and fertility, and the like in vitro and in vivo. For example, zmsel and agonist or antagonist compounds are useful as components of defined cell culture media, and may be used alone or in combination 2 0 with other cytokines and hormones to replace serum that is commonly used in cell culture. Agonists or antagonists are thus useful in specifically promoting the growth and/or development of cell lineages in culture. Alternatively, zmse 1 polypeptides and zmsel agonist or antagonist polypeptides are useful as a research reagent, such as for the expansion of cell lines, or useful as an amino acid source for cell culture.
2 5 The activity of molecules of the present invention can be measured using a variety of assays that measure proliferation and/or differentiation of specific cell types, chemotaxis, adhesion, changes in ion channel influx, pH flux, regulation of second messenger levels and neurotransmitter release, cell motility, protein binding, apoptosis, or the like. Such assays are well known in the art. See, for example, in 3 0 "Basic & Clinical Endocrinology Ser., Vol. 3," Cytochemical Bioassays:
Techniques &
Applications, Chayen; Chayen, Bitensky, eds., Dekker, New York, 1983.

The activity of molecules of the present invention can also be measured using a variety of assays that measure, for example, signal transduction upon binding a ligand or substrate, or antibody binding to the outside of an intact cell and stimulating the signal transduction pathway of zmse 1. For example, zmse 1 polypeptides, complementary binding polypeptides, or anti-zmsel antibodies can be labeled and tested for specific and saturating binding to specific substrates, cell lines or cells.
Identification of positive cells to which zmsel polypeptides, complementary binding polypeptides, or anti-zmsel antibodies binds can be achieved by injecting a radioactively or fluorescently-labeled zmse 1 polypeptide, polypeptide fragments, complementary binding polypeptides, or anti-zmse 1 antibodies and using art-recognized immunohistochemistry methods to visualize a cell or tissue in vivo where zmsel binds or is expressed. After identification of bound positive cells, activity can be tested for zmsel-mediated activation of a signal transduction pathway using methods known in the art. For instance, vector constructs containing a reporter (e.g.
SRE-luciferase, STAT-luciferase, thyroid hormone response element (THRE)-luciferase, SV40 promoter-luciferase or the like) can be introduced into the positive cell lines expressing zmsel; such cell lines, when exposed to conditioned media containing secreted zmsel activating proteins will demonstrate zmsel-mediated signal transduction activity through activation of the measurable reporter. Such assays are 2 0 well known in the art. Specific assays include, but are not limited to, bioassays measuring signal transduction.
The activity of molecules of the present invention can also be measured using a variety of assays that measure, for example, cell motility, adhesion and invasion in vitro and metastasis in vivo. Such assays are known in the art. For example, motility 2 5 assays in NIH 3T3 cells, mouse keratinocytes, and epithelial cells are described in Takiashi, K. et al., Mol. Cell Biol. 13:72-79, 1993; Takiashi, K. et al., Onco~ene 5:273-278, 1994; Ridley, A.J. et al., Mol. Cell Biol. 15:1110-1122, 1995; and Keely, P.J. et al., Nature 360:632-636, 1997. For review and application of in vitro invasion assays;
for example, using hepatoma or lymphoma cells invasion through mesothelial or 3 0 fibroblast cell monolayers, phagokenesis and wound healing assays. For example, see Yoshioka, K. et al., FEBS Lett. 372:25-28, 1995; Wang, W.Z., and Ron D.
Science 272:1347-1349, 1996; Habets, G. Cell 77:537-549, 1994; and Michiels, F. et al., Nature 375:338-340, 1995; Michiels, F. and Collard, J.G., Biochem. Soc. Symp. 65:215-146, 1999; and Keely, P.J. su ra.. Moreover, in vivo metastasis assays can be used to assess zmsel polypeptide, expression, agonist or antagonist activity in vivo in mice 5 (Verschueren, H. Eur. J. Cell Biol. 73:182-187, 1997). Cell adhesion can be assessed by the adherence or non-adherence of normally adherent cell lines to cell culture dishes, amongst other assays known in the art.
Moreover, the activity of molecules of the present invention can also be measured using a variety of assays that measure cytoskeletal reorganization.
Such 10 assays are well known in the art. For example, effects of zmsel on membrane ruffling can be assessed in Swiss 3T3 cells (Ridley, A.J. Cell 70:401-410, 1992). Actin polymerization and cytoskeletal rearrangement including assessment of actin stress fibers, focal complexes, lamellipodia and filopodia, can be assessed by various means including immunofluorescence, and time-lapse imaging amongst other known methods 15 (Symons, M. et al., Cell 84:723-734, 1996; Nobes, C.D., and Hall, A., Cell 81:53-62, 1995; Burbelo, P.D. et al., Proc. Natl. Acad. Sci. USA 96:9083-9088, 1999;
Aspenstrom, P. Exper. Cell. Res. 246:20-25, 1999; Gallo, G., and Letourneau, P.C., Current Biol. 8:880-R82, 1998; and Miki, H. et al., Nature 391:93-96, 1998).
Moreover, the activity of molecules of the present invention can also be 2 0 measured using a variety of assays that measure protein binding. For example, the zmsel polypeptides of the present invention can be assessed for their ability to bind Rho family proteins, such as Cdc42, Rac and Rho, in filter binding assays with GST-rhoGAP as a positive control (Burbelo, P.D. et al., J. Biol. Chem. 270:29071-29074, 1995; and Lancaster, C.A. et al., J. Biol. Chem. 269:1137-1142, 1994.
Moreover, 2 5 guanine nucleotide dependence of such binding can also be determined using a glutathione-agarose bead assay or other method known in the art (for example, see Burbelo, P.D. et al., supra.; and Burbelo, P.D. et al., Proc. Natl. Acad. Sci.
USA
96:9083-9088, 1999). Moreover, GTP hydrolysis can be measured as a product of zmasel activity. Such assays are known in the art.
30 Zmsel can also be used to identify modulators (e.g, agonists or antagonists) of its activity. Test compounds are added to the assays disclosed herein. to identify compounds that inhibit or stimulate the activity of zmsel. In addition to those assays disclosed herein, samples can be tested for inhibition/stimulation of zmsel activity within a variety of assays designed to measure zmsel binding, dimerization, heterodimerization, DNA binding or the stimulation/inhibition of zmsel-dependent cellular responses. For example, zmsel-expressing cell lines can be transfected with a reporter gene construct that is responsive to a zmsel-stimulated cellular pathway.
Reporter gene constructs of this type are known in the art, and will generally comprise a zmsel-DNA response element operably linked to a gene encoding an assay detectable protein, such as luciferase. DNA response elements can include, but are not limited to, cyclic AMP response elements (CRE), hormone response elements (HRE) insulin response element (IRE) (Nasrin et al., Proc. Natl. Acad. Sci. USA 87:5273-7, 1990) and serum response elements (SRE) (Shaw et al. Cell 56: 563-72, 1989). Cyclic AMP
response elements are reviewed in Roestler et al., J. Biol. Chem. 263:9063-6;
1988 and Habener, Molec. Endocrinol. 4:1087-94; 1990. Hormone response elements are reviewed in Beato, Cell 56:335-44; 1989. Candidate compounds, solutions, mixtures or extracts or conditioned media from various cell types are tested for the ability to enhance the activity of zmsel signal transduction as evidenced by an increase in zmsel stimulation of reporter gene expression. Assays of this type will detect compounds that directly stimulate zmsel signal transduction activity through binding the upstream receptor or by otherwise stimulating part of the signal cascade in which zmsel is involved. As such, there is provided a method of identifying agonists of zmsel polypeptide, comprising providing cells expressing zmsel responsive to a zmsel pathway, culturing a first portion of the cells in the absence of a test compound, culturing a second portion of the cells in the presence of a test compound, and detecting 2 5 a increase in a cellular response of the second portion of the cells as compared to the first portion of the cells. Moreover a third cell, containing the reporter gene construct described above, but not expressing zmsel polypeptide, can be used as a control cell to assess non-specific, or non-zmsel-mediated, stimulation of the reporter.
Agonists are useful to stimulate or increase zmse 1 polypeptide function.
3 0 Moreover, 'compounds or other samples can be tested for direct blocking of zmsel binding to another protein or substrate, e.g., a heterodimer described below, using zmsel tagged with a detectable label (e.g., ~25I, biotin, horseradish peroxidase, FITC, and the like). Within assays of this type, the ability of a test sample to inhibit the binding of labeled zmsel to the other protein or substrate is indicative of inhibitory activity, which can be confirmed through secondary assays. Proteins used within binding assays may be cellular proteins or isolated, immobilized proteins.
Zmse 1 activation can be detected by: ( 1 ) measurement of adenylate cyclase activity (Salomon et al., Anal. Biochem. 58:541-48, 1974; Alvarez and Daniels, Anal. Biochem. 187:98-103, 1990); (2) measurement of change in intracellular cAMP
levels using conventional radioimmunoassay methods (Steiner et al., J. Biol.
Chem.
247:1106-13, 1972; Harper and Brooker, J. Cyc. Nucl. Res. 1:207-18, 1975); or (3) through use of a cAMP scintillation proximity assay (SPA) method (Amersham Corp., Arlington Heights, IL). These methods provide sensitivity and accuracy.
An alternative assay system involves selection of polypeptides that are able to induce expression of a cyclic AMP response element (CRE)-luciferase reporter gene, as a consequence of elevated cAMP levels, in cells expressing a zmsel polypeptide, but not in cells lacking zmsel expression, analogous to such assays employing calcitonin receptor as described in U.S. patent No. 5,622,839, U.S.
Patent No. 5,674,689, and U.S. patent No. 5,674,981.
In addition, polypeptides of the present invention can be assayed and used for their ability to modify inflammation. As zmsel may induce cell migration and/or affect contractility in tissues, it may be involved in migration of inflammatory cells. Methods to determine proinflammatory and anti-inflammatory qualities of zmsel polypeptide, its agonists or antagonists, are known in the art and discussed herein. For example, suppression of cAMP production is an indication of anti-inflammatory effects (Nihei, Y., et al., Arch. Dermatol. Res., 287:546-552, 1995). Suppression of cAMP and inhibition of ICAM and HLA-Dr induced by IFN-y in keratinocytes can be used to assess inhibition of inflammation. Alternatively, enhancement of cAMP
production and induction of ICAM and HLA-Dr in this system can be an measurement of proinflammatory effects of a protein. As a member of a signal transduction cascade, 3 0 zmsel, likewise can exhibit similar inflammatory effects, and may exert these effects in tissues in which it is expressed, or indirectly in other tissues. For example, zmsel is expressed in the heart and skeletal muscle, and can be useful in promoting wound healing in this tissue, or exhibit anti-bacterial or anti-viral effects.
Moreover, zmsel, its agonists or antagonists can be useful in treatment of inflammatory heart or cardiovascular conditions, muscle inflammation, inflammation during and after surgery, arthritis, asthma, inflammatory bowel disease, diverticulitis, and the like.
Moreover, direct measurement of zmsel polypeptide and anti-zmsel antibodies can be useful in diagnosing inflammatory diseases such as reperfusion ischemia, inflammatory bowel disease, diverticulitis, asthma, pelvic inflammatory disease (PID), psoriasis, arthritis, melanoma, and other inflammatory diseases. Moreover zmsel antagonists can be useful in treatment of myocarditis, atherosclerosis, pelvic inflammatory disease, (PID), psoriasis, arthritis, eczema, scleroderma, and other inflammatory diseases.
As such, zmsel polypeptide, agonists or its antagonists, have potential uses in inflammatory diseases such as asthma and arthritis. For example, if zmsel is proinflammatory, antagonists would be valuable in asthma therapy or other anti-inflammatory therapies where migration of lymphocytes is damaging. In addition, zmsel can serve other important roles in lung function, for instance, bronchodilation, tissue elasticity, recruitment of lymphocytes in lung infection and damage.
Assays to assess the activity of zmsel in lung cells are discussed in Laberge, S. et al., Am. J.
Respir. Cell Mol. Biol. 17:193-202, 1997; Rumsaeng, V. et al., J. Immunol., 159:2904-2 0 2910, 1997; and Schluesener, H.J. et al., J. Neurosci. Res. 44:606-611, 1996. Methods to determine proinflammatory and antiinflammatory qualities of zmsel its agonists or its antagonists are known in the art. Moreover, other molecular biological, immunological, and biochemical techniques known in the art and disclosed herein can be used to determine zmsel activity and to isolate agonists and antagonists.
2 5 The activity of molecules of the present invention may be measured using a variety of assays that, for example, measure neogenesis or hyperplasia (i.e., proliferation) of cardiac or other cells based on the potential effects of activity of zmse 1 in those tissues. Additional activities likely associated with the polypeptides of the present invention include proliferation of endothelial cells, cardiomyocytes, fibroblasts, 3 0 skeletal myocytes directly or indirectly through other growth factors;
action as a chemotaxic factor for endothelial cells, fibroblasts and/or phagocytic cells;
osteogenic factor; and factor for expanding mesenchymal stem cell and precursor populations.
Proliferation can be measured in vitro using cultured cells or in vivo by administering molecules of the present invention to the appropriate animal model.
Generally, proliferative effects are seen as an increase in cell number, and may include inhibition of apoptosis as well as stimulation of mitogenesis. Cultured cells for use in these assays include cardiac fibroblasts, cardiac myocytes, skeletal myocytes, and human umbilical vein endothelial cells from primary cultures, among other cell types.
Suitable established cell lines include: NIH 3T3 fibroblasts (ATCC No. CRL-1658), CHH-1 chum heart cells (ATCC No. CRL-1680), H9c2 rat heart myoblasts (ATCC No.
CRL-1446), Shionogi mammary carcinoma cells (Tanaka et al., Proc. Natl. Acad.
Sci.
89:8928-8932, 1992), and LNCap.FGC adenocarcinoma cells (ATCC No. CRL-1740.) Assays measuring cell proliferation are well known in the art. For example, assays measuring proliferation include such assays as chemosensitivity to neutral red dye (Cavanaugh et al., Investi~ational New Dru:g_s 8:347-354, 1990), incorporation of radiolabeled nucleotides (Cook et al., Analytical Biochem. 179:1-7, 1989), incorporation of 5-bromo-2'-deoxyuridine (BrdU) in the DNA of proliferating cells (Porstmann et al., J. Immunol. Methods 82:169-179, 1985), and use of tetrazolium salts (Mosmann, J. Immunol. Methods 65:55-63, 1983; Alley et al., Cancer Res. 48:589-601, 2 0 1988; Marshall et al., Growth Rep. 5:69-84, 1995; and Scudiero et al., Cancer Res.
48:4827-4833, 1988).
Differentiation is a progressive and dynamic process, beginning with pluripotent stem cells and ending with terminally differentiated cells.
Pluripotent stem cells that can regenerate without commitment to a lineage express a set of 2 5 differentiation markers that are lost when commitment to a cell lineage is made.
Progenitor cells express a set of differentiation markers that may or may not continue to be expressed as the cells progress down the cell lineage pathway toward maturation.
Differentiation markers that are expressed exclusively by mature cells are usually functional properties such as cell products, enzymes to produce cell products, and 3 0 receptors. The stage of a cell population's differentiation is monitored by identification of markers present in the cell population. Myocytes, osteoblasts, adipocytes, chrondrocytes, fibroblasts and reticular cells are believed to originate from a common mesenchymal stem cell (Owen et al., Ciba Fdn. Sym~ 136:42-46, 1988). Markers for mesenchymal stem cells have not been well identified (Owen et al., J. of Cell Sci.
87:731-738, 1987), so identification is usually made at the progenitor and mature cell 5 stages. The novel polypeptides of the present invention may be useful for studies to isolate mesenchymal stem cells and myocyte or other progenitor cells, both in vivo and ex vivo.
There is evidence to suggest that factors that stimulate specific cell types down a pathway towards terminal differentiation or dedifferentiation affect the entire 10 cell population originating from a common precursor or stem cell. Thus, the present invention includes stimulating or inhibiting the proliferation of myocytes, smooth muscle cells, osteoblasts, adipocytes, chrondrocytes and endothelial cells.
Molecules of the present invention for example, may while stimulating proliferation or differentiation of cardiac myocytes, inhibit proliferation or differentiation of adipocytes, by virtue of 15 the affect on their common precursor/stem cells. Thus molecules of the present invention may have use in inhibiting chondrosarcomas, atherosclerosis, restenosis and obesity.
Assays measuring differentiation include, for example, measuring cell markers associated with stage-specific expression of a tissue, enzymatic activity, 2 0 functional activity or morphological changes (Watt, FASEB, 5:281-284, 1991; Francis, Differentiation 57:63-75, 1994; Raes, Adv. Anim. Cell Biol. Technol.
Bioprocesses, 161-171, 1989; all incorporated herein by reference). Alternatively, zmsel polypeptide itself can serve as an additional cell-surface marker associated with stage-specific expression of a tissue. As such, direct measurement of zmsel polypeptide, or its loss of 2 5 expression in a tissue as it differentiates, can serve as a marker for differentiation of tissues.
Similarly, direct measurement of zmsel polypeptide, or its loss of expression in a tissue can be determined in a tissue or cells as they undergo tumor progression. As the Ras and Rho family, and their effectors are involved with increases 3 0 in invasiveness and motility of cells, the gain or loss of expression of zmesl in a pre-cancerous or cancerous condition, in comparison to normal tissue, can serve as a diagnostic for transformation, invasion and metastasis in tumor progression.
As such, knowledge of a tumor's stage of progression or metastasis will aid the physician in choosing the most proper therapy, or aggressiveness of treatment, for a given individual cancer patient. Methods of measuring gain and loss of expression (of either mRNA or protein) are well known in the art and described herein and can be applied to zmsel expression. For example, appearance or disappearance of polypeptides that regulate cell motility can be used to aid diagnosis and prognosis of prostate cancer (Banyard, J.
and Zetter, B.R., Cancer and Metast. Rev. 17:449-458, 1999). As an effector of cell motility, zmsel gain or loss of expression may serve as a diagnostic for prostate and other cancers.
Zmsel can also be used to identify inhibitors (antagonists) of its activity.
Test compounds are added to the assays disclosed herein to identify compounds that inhibit the activity of zmsel. In addition to those assays disclosed herein, samples can be tested for inhibition of zmsel activity within a variety of assays designed to measure receptor binding or the stimulation/inhibition of zmsel-dependent cellular responses.
For example, zmsel-expressing cell lines can be transfected with a reporter gene construct that is responsive to a zmsel-stimulated cellular pathway. Reporter gene constructs of this type are known in the art, and will generally comprise a zmsel-DNA
response element operably linked to a gene encoding an assayable protein, such as 2 0 luciferase. DNA response elements can include, but are not limited to, cyclic AMP
response elements (CRE), hormone response elements (HRE) insulin response element (IRE) (Nasrin et al., Proc. Natl. Acad. Sci. USA 87:5273-7, 1990) and serum response elements (SRE) (Shaw et al. Cell 56: 563-72, 1989). Cyclic AMP response elements are reviewed in Roestler et al., J. Biol. Chem. 263:9063-6; 1988 and Habener, Molec.
2 5 Endocrinol. 4:1087-94; 1990. Hormone response elements are reviewed in Beato, Cell 56:335-44; 1989. Candidate compounds, solutions, mixtures or extracts are tested for the ability to inhibit the activity of zmsel on the target cells as evidenced by a decrease in zmsel stimulation of reporter gene expression. Assays of this type will detect compounds that directly block effectors that bind zmsel (or proteins to which zmsel is 3 0 an effector), as well as compounds that block processes in the cellular pathway upstream or subsequent to receptor-ligand binding. In the alternative, compounds or other samples can be tested for direct blocking of zmsel binding to receptor using zmsel tagged with a detectable label (e.g., ~25I, biotin, horseradish peroxidase, FITC, and the like). Within assays of this type, the ability of a test sample to inhibit the binding of labeled zmsel to the receptor is indicative of inhibitory activity, which can be confirmed through secondary assays. Receptors used within binding assays may be cellular receptors or isolated, immobilized receptors.
A role for zmsel in the induction of cell motility suggests a role in spermatogenesis, a process that is remarkably similar to the development of blood cells (hematopoiesis). Briefly, spermatogonia undergo a maturation process similar to the differentiation of hematopoietic stem cells. Moreover, in view of cell motility effects, zmsel polypeptides, agonists and antagonists have enormous potential in both in vitro and in vivo applications. For example, cell motility and polypeptides associated therewith have been implicated as a critical determinants in prostate cancer metastasis (Banyard, J. and Zetter, B.R., Cancer and Metast. Rev. 17:449-458, 1999). As an effector of cell motility, zmsel may serve as a diagnostic for such cancers, and zmselpolypeptides, agonists and antagonists have therapeutic potential to treat such diseases. Zmsel polypeptides, agonists and antagonists may also prove useful in modulating spermatogenesis and thus aid in overcoming infertility, or as therapeutics or diagnostics for male reproductive cancers such as prostate and testicular cancers.
2 0 Antagonists are useful as research reagents for characterizing sites of ligand-receptor interaction. In vivo, zmsel polypeptides, agonists or antagonists may find application in the treatment of male infertility, reproductive cancers, or as a male contraceptive agents.
The zmsel polypeptides, antagonists of agonists, of the present 2 5 invention can also modulate sperm capacitation. Before reaching the oocyte or egg and initiating an egg-sperm interaction, the sperm must be activated. The sperm undergo a gradual capacitation, lasting up to 3 or 4 hours in vitro, during which the plasma membrane of the sperm head and the outer acrosomal membrane fuse to form vesicles that facilitate the release of acrosomal enzymes. The acrosomal membrane surrounds 3 0 the acrosome or acrosomal cap which is located at the anterior end of the nucleus in the sperm head. In order for the sperm to fertilize egg the sperm must penetrate the oocyte.

To enable this process the sperm must undergo acrosomal exocytosis, also known as the acrosomal reaction, and release the acrosomal enzymes in the vicinity of the oocyte.
These enzymes enable the sperm to penetrate the various oocyte layers, (the cumulus oophorus, the corona radiata and the zona pellucida). The released acrosomal enzymes include hyaluronidase and proacrosin, in addition to other enzymes such as proteases.
During the acrosomal reaction, proacrosin is converted to acrosin, the active form of the enzyme, which is required for and must occur before binding and penetration of the zona pellucida is possible. A combination of the acrosomal lytic enzymes and sperm tail movements allow the sperm to penetrate the oocyte layers. Numerous sperm must reach the egg and release acrosomal enzymes before the egg can finally be fertilized.
Only one sperm will successfully bind to, penetrate and fertilize the egg, after which the zona hardens so that no other sperm can penetrate the egg (Zaneveld, in Male Infertility Chapter 11, Comhaire (Ed.), Chapman & Hall, London, 1996). Peptide hormones, such as insulin homologs are associated with sperm activation and egg-sperm interaction.
For instance, capacitated sperm incubated with relaxin show an increased percentage of progressively motile sperm, increased zona penetration rates, and increased percentage of viable acrosome-reacted sperm (Carrell et al., Endocr. Res. 21:697-707, 1995).
Similarity of the zmsel polypeptide structure to signal transduction molecules and the potential of zmsel effects on indirectly effecting cell-cell interaction in the testis, prostate and uterus suggests that the zmsel polypeptides described herein play a role in these and other reproductive processes.
Accordingly, proteins of the present invention can have applications in enhancing fertilization during assisted reproduction in humans and in animals.
Such assisted reproduction methods are known in the art and include artificial insemination, 2 5 in vitro fertilization, embryo transfer and gamete intrafallopian transfer. Such methods are useful for assisting men and women who have physiological or metabolic disorders preventing natural conception or can be used to enhance in vitro fertilization. Such methods are also used in animal breeding programs, such as for livestock breeding and could be used as methods for the creation of transgenic animals. Proteins of the present 3 0 invention can be combined with sperm, an egg or an egg-sperm mixture prior to fertilization of the egg. In some species, sperm capacitate spontaneously during in vitro fertilization procedures, but normally sperm capacitate over an extended period of time both in vivo and in vitro. It is advantageous to increase sperm activation during such procedures to enhance the likelihood of successful fertilization. The washed sperm or sperm removed from the seminal plasma used in such assisted reproduction methods has been shown to have altered reproductive functions, in particular, reduced motility and zona interaction. To enhance fertilization during assisted reproduction methods sperm is capacitated using exogenously added compounds. Suspension of the sperm in seminal plasma from normal subjects or in a "capacitation media" containing a cocktail of compounds known to activate sperm, such as caffeine, dibutyl cyclic adenosine monophosphate (dbcAMP) or theophylline, have resulted in improved reproductive function of the sperm, in particular, sperm motility and zonae penetration (Park et al., Am. J. Obstet. Gynecol. 158:974-9, 1988; Vandevoort et al., Mol. Repro.
Develop.
37:299-304, 1993; Vandevoort and Overstreet, J. Androl. 16:327-33, 1995). The presence of immunoreactive relaxin in vivo and in association with cryopreserved semen, was shown to significantly increase sperm motility (Juang et al., Anim.
Reprod.
Sci. 20:21-9, 1989; Juang et al., Anim. Reprod. Sci. 22:47-53, 1990). Porcine relaxin stimulated sperm motility in cryopreserved human sperm (Colon et al., Fertil.
Steril.
46:1133-39, 1986; Lessing et al., Fertil. Steril. 44:406-9, 1985) and preserved ability of washed human sperm to penetrate cervical mucus in vitro (Brenner et al., Fertil. Steril.
2 0 42:92-6, 1984). Polypeptides of the present invention can used in such methods to enhance viability of cryopreserved sperm, enhance sperm motility and enhance fertilization, particularly in association with methods of assisted reproduction.
A zmsel polypeptide can be expressed as a fusion with an immunoglobulin heavy chain constant region, typically an Fc fragment, which contains 2 5 two constant region domains and lacks the variable region. Methods for preparing such fusions are disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584. Such fusions are typically secreted as multimeric molecules wherein the Fc portions are disulfide bonded to each other and two non-Ig polypeptides are arrayed in closed proximity to each other.
Fusions of this type can be used to affinity purify ligand or binding partners, as an in 3 0 vitro assay tool, or a zmse 1 ligand antagonist. For use in assays, the chimeras are bound to a support via the Fc region and used in an ELISA format.

A zmsel polypeptide can also be used for purification of ligand, biomolecular substrates, or other proteins or antibodies that bind it. The zmsel polypeptide or a polypeptide fragment containing the zmsel CRIB motif can be used.
The polypeptide is immobilized on a solid support, such as beads of agarose, cross-5 linked agarose, glass, cellulosic resins, silica-based resins, polystyrene, cross-linked polyacrylamide, or like materials that are stable under the conditions of use.
Methods for linking polypeptides to solid supports are known in the art, and include amine chemistry, cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, and hydrazide activation. The resulting medium will 10 generally be configured in the form of a column, and fluids containing ligand, cell lysates, membrane preparations, or lipid preparations, are passed through the column one or more times to allow ligand to bind to the receptor polypeptide. The ligand is then eluted using changes in salt concentration, chaotropic agents (guanidine HCl), or pH to disrupt ligand-receptor binding.
15 An assay system that uses a ligand-binding receptor (or an antibody, one member of a complement/ anti-complement pair) or a binding fragment thereof, and a commercially available biosensor instrument (BIAcore, Pharmacia Biosensor, Piscataway, NJ) may be advantageously employed. Such receptor, antibody, member of a complement/anti-complement pair or fragment is immobilized onto the surface of a 2 o receptor chip. Use of this instrument is disclosed by Karlsson, J.
Immunol. Methods 145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol. 234:554-63, 1993. A
receptor, antibody, member or fragment is covalently attached, using amine or sulfhydryl chemistry, to dextran fibers that are attached to gold film within the flow cell. A test sample is passed through the cell. If a ligand, epitope, or opposite member 25 of the complement/anti-complement pair is present in the sample, it will bind to the immobilized receptor, antibody or member, respectively, causing a change in the refractive index of the medium, which is detected as a change in surface plasmon resonance of the gold film. This system allows the determination of on- and off-rates, from which binding affinity can be calculated, and assessment of stoichiometry of 3 0 binding.

Ligand-binding receptor polypeptides can also be used within other assay systems known in the art. Such systems include Scatchard analysis for determination of binding affinity (see Scatchard, Ann. NY Acad. Sci. 51: 660-72, 1949) and calorimetric assays (Cunningham et al., Science 253:545-48, 1991;
Cunningham et al., Science 245:821-25, 1991).
Zmsel polypeptides can also be used to prepare antibodies that bind to zmsel epitopes, peptides or polypeptides. The zmsel polypeptide or a fragment thereof serves as an antigen (immunogen) to inoculate an animal and elicit an immune response. One of skill in the art would recognize that antigenic, epitope-bearing polypeptides contain a sequence of at least 6, preferably at least 9, and more preferably at least 15 to about 30 contiguous amino acid residues of a zmsel polypeptide (e.g., SEQ m N0:2). Polypeptides comprising a larger portion of a zmsel polypeptide, i.e., from 30 to 10 residues up to the entire length of the amino acid sequence are included.
Antigens or immunogenic epitopes can also include attached tags, adjuvants and carriers, as described herein. Suitable antigens include the zmsel polypeptide encoded by SEQ >D N0:2 from amino acid number 1 (Met) to amino acid number 356 (Val), or a contiguous 13 to 343 amino acid fragment thereof. Other suitable antigens include the CRIB motif, N-terminal domain, variable C-terminal domain, and C-terminal tail as 2 0 disclosed herein. Preferred peptides to use as antigens are hydrophilic peptides such as those predicted by one of skill in the art from a hydrophobicity plot, determined, for example, from a Hopp/Woods hydrophilicity profile based on a sliding six-residue window, with buried G, S, and T residues and exposed H, Y, and W residues ignored (See, Figure 1). Zmsel hydrophilic peptides include peptides comprising amino acid 2 5 sequences selected from the group consisting of: ( 1 ) amino acid number 96 (Glu) to amino acid number 101 (Asp) of SEQ ID N0:2; (2) amino acid number 226 (Asp) to amino acid number 231 (Asp) of SEQ >D N0:2; (3) amino acid number 346 (Met) to amino acid number 351 (Glu) of SEQ >D N0:2; (4) amino acid number 347 (Asp) to amino acid number 352 (Asp) of SEQ >D N0:2; and (5) amino acid number 348 (Glu) 3 0 to amino acid number 353 (Glu) of SEQ >D N0:2. Antibodies from an immune response generated by inoculation of an animal with these antigens can be isolated and purified as described herein. Methods for preparing and isolating polyclonal and monoclonal antibodies are well known in the art. See, for example, Current Protocols in Immunolo~y, Cooligan, et al. (eds.), National Institutes of Health, John Wiley and Sons, Inc., 1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, 1989; and Hurrell, J. G. R., Ed., Monoclonal Hybridoma Antibodies: Techniques and Applications, CRC Press, Inc., Boca Raton, FL, 1982.
As would be evident to one of ordinary skill in the art, polyclonal antibodies can be generated from inoculating a variety of warm-blooded animals such as horses, cows, goats, sheep, dogs, chickens, rabbits, mice, and rats with a zmsel polypeptide or a fragment thereof. The immunogenicity of a zmsel polypeptide may be increased through the use of an adjuvant, such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant. Polypeptides useful for immunization also include fusion polypeptides, such as fusions of zmsel or a portion thereof with an immunoglobulin polypeptide or with maltose binding protein. The polypeptide immunogen may be a full-length molecule or a portion thereof. If the polypeptide portion is "hapten-like", such portion may be advantageously joined or linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for immunization.
As used herein,-the term "antibodies" includes polyclonal antibodies, affinity-purified polyclonal antibodies, monoclonal antibodies, and antigen-binding fragments, such as F(ab')2 and Fab proteolytic fragments. Genetically engineered intact antibodies or fragments, such as chimeric antibodies, Fv fragments, single chain antibodies and the like, as well as synthetic antigen-binding peptides and polypeptides, 2 5 are also included. Non-human antibodies may be humanized by grafting non-human CDRs onto human framework and constant regions, or by incorporating the entire non-human variable domains (optionally "cloaking" them with a human-like surface by replacement of exposed residues, wherein the result is a "veneered" antibody).
In some instances, humanized antibodies may retain non-human residues within the human 3 0 variable region framework domains to enhance proper binding characteristics. Through humanizing antibodies, biological half life may be increased, and the potential for adverse immune reactions upon administration to humans is reduced. Moreover, human antibodies can be produced in transgenic, non-human animals that have been engineered to contain human immunoglobulin genes as disclosed in WIPO
Publication WO 98/24893. It is preferred that the endogenous immunoglobulin genes in these animals be inactivated or eliminated, such as by homologous recombination.
Antibodies are considered to be specifically binding if: 1) they exhibit a threshold level of binding activity, and 2) they do not significantly cross-react with known related polypeptide molecules. A threshold level of binding is determined if anti-zmse 1 antibodies herein bind to a zmse 1 polypeptide, peptide or epitope with an affinity at least 10-fold greater than the binding affinity to control (non-zmsel) polypeptide. It is preferred that the antibodies exhibit a binding affinity (Ka) of 106 M
1 or greater, preferably 107 M 1 or greater, more preferably 108 M 1 or greater, and most preferably 109 M 1 or greater. The binding affinity of an antibody can be readily determined by one of ordinary skill in the art, for example, by Scatchard analysis (Scatchard, G., Ann. NY Acad. Sci. 51: 660-672, 1949).
Whether anti-zmsel antibodies do not significantly cross-react with known related polypeptide molecules is shown, for example, by the antibody detecting zmsel polypeptide but not known related polypeptides using a standard Western blot analysis (Ausubel et al., ibid.). Examples of known related polypeptides are those 2 0 disclosed in the prior art, such as known orthologs, and paralogs, and similar known members of a protein family, Screening can also be done using non-human zmsel, and zmse 1 mutant polypeptides. Moreover, antibodies can be "screened against"
known related polypeptides, to isolate a population that specifically binds to the zmsel polypeptides. For example, antibodies raised to zmsel are adsorbed to related polypeptides adhered to insoluble matrix; antibodies specific to zmsel will flow through the matrix under the proper buffer conditions. Screening allows isolation of polyclonal and monoclonal antibodies non-crossreactive to known closely related polypeptides (Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988; Current Protocols in Immunology, Cooligan, et al.
3 0 (eds.), National Institutes of Health, John Wiley and Sons, Inc., 1995).
Screening and isolation of specific antibodies is well known in the art. See, Fundamental Immunology, Paul (eds.), Raven Press, 1993; Getzoff et al., Adv. in Immunol.
43: 1-98, 1988; Monoclonal Antibodies: Principles and Practice, Goding, J.W. (eds.), Academic Press Ltd., 1996; Benjamin et al., Ann. Rev. Immunol. 2: 67-101, 1984.
Specifically binding anti-zmsel antibodies can be detected by a number of methods in the art, and disclosed below.
A variety of assays known to those skilled in the art can be utilized to detect antibodies which bind to zmsel proteins or polypeptides. Exemplary assays are described in detail in Antibodies: A Laboratory Manual, Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988. Representative examples of such assays include: concurrent immunoelectrophoresis, radioimmunoassay, radioimmuno-precipitation, enzyme-linked immunosorbent assay (ELISA), dot blot or Western blot assay, inhibition or competition assay, and sandwich assay. In addition, antibodies can be screened for binding to wild-type versus mutant zmse 1 protein or polypeptide.
Alternative techniques for generating or selecting antibodies useful herein include in vitro exposure of lymphocytes to zmsel protein or peptide, and selection of antibody display libraries in phage or similar vectors (for instance, through use of immobilized or labeled zmsel protein or peptide). Genes encoding polypeptides having potential zmsel polypeptide binding domains can be obtained by screening 2 0 random peptide libraries displayed on phage (phage display) or on bacteria, such as E.
coli. Nucleotide sequences encoding the polypeptides can be obtained in a number of ways, such as through random mutagenesis and random polynucleotide synthesis.
These random peptide display libraries can be used to screen for peptides which interact with a known target which can be a protein or polypeptide, such as a ligand or receptor, 2 5 a biological or synthetic macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide display libraries are known in the art (Ladner et al., US Patent NO. 5,223,409; Ladner et al., US Patent NO.
4,946,778; Ladner et al., US Patent NO. 5,403,484 and Ladner et al., US Patent NO.
5,571,698) and random peptide display libraries and kits for screening such libraries are 3 0 available commercially, for instance from Clontech (Palo Alto, CA), Invitrogen Inc.
(San Diego, CA), New England Biolabs, Inc. (Beverly, MA) and Pharmacia LKB

Biotechnology Inc. (Piscataway, NJ). Random peptide display libraries can be screened using the zmsel sequences disclosed herein to identify proteins which bind to zmsel.
These "binding polypeptides" which interact with zmsel polypeptides can be used for tagging cells; for isolating homolog polypeptides by affinity purification;
they can be 5 directly or indirectly conjugated to drugs, toxins, radionuclides and the like. These binding polypeptides can also be used in analytical methods such as for screening expression libraries and neutralizing activity, e.g., for blocking interaction between ligand and receptor. The binding polypeptides can also be used for diagnostic assays for determining circulating levels of zmsel polypeptides; for detecting or quantitating 10 soluble zmsel polypeptides as marker of underlying pathology or disease.
These binding polypeptides can also act as zmsel "antagonists" to block zmsel binding and signal transduction in vitro and in vivo. These anti-zmsel binding polypeptides would be useful for inhibiting zmsel activity or protein-binding.
Antibodies to zmsel may be used for tagging cells that express zmsel;
15 for isolating zmsel by affinity purification; for diagnostic assays for determining circulating levels of zmse 1 polypeptides; for detecting or quantitating soluble zmse 1 as marker of underlying pathology or disease; in analytical methods employing FACS; for screening expression libraries; for generating anti-idiotypic antibodies; and as neutralizing antibodies or as antagonists to block zmsel activity in vitro and in vivo.
2 0 Suitable direct tags or labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like; indirect tags or labels may feature use of biotin-avidin or other complement/anti-complement pairs as intermediates. Antibodies herein may also be directly or indirectly conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for in 25 vivo diagnostic or therapeutic applications. Moreover, antibodies to zmsel or fragments thereof may be used in vitro to detect denatured zmsel or fragments thereof in assays, for example, Western Blots or other assays known in the art.
Antibodies or polypeptides herein can also be directly or indirectly 3 0 conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for irc vivo diagnostic or therapeutic applications. For instance, polypeptides or antibodies of the present invention can be used to identify or treat tissues or organs that express a corresponding anti-complementary molecule (receptor or antigen, respectively, for instance). More specifically, zmsel polypeptides or anti-zmsel antibodies, or bioactive fragments or portions thereof, can be coupled to detectable or cytotoxic molecules and delivered to a mammal having cells, tissues or organs that express the anti-complementary molecule.
Suitable detectable molecules may be directly or indirectly attached to the polypeptide or antibody, and include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like. Suitable cytotoxic molecules may be directly or indirectly attached to the polypeptide or antibody, and include bacterial or plant toxins (for instance, diphtheria toxin, Pseudomonas exotoxin, ricin, abrin and the like), as well as therapeutic radionuclides, such as iodine-131, rhenium-188 or yttrium-90 (either directly attached to the polypeptide or antibody, or indirectly attached through means of a chelating moiety, for instance). Polypeptides or antibodies may also be conjugated to cytotoxic drugs, such as adriamycin. For indirect attachment of a detectable or cytotoxic molecule, the detectable or cytotoxic molecule can be conjugated with a member of a complementary/ anticomplementary pair, where the other member is bound to the polypeptide or antibody portion. For these purposes, biotin/streptavidin is an 2 0 exemplary complementary/ anticomplementary pair.
In another embodiment, polypeptide-toxin fusion proteins or antibody-toxin fusion proteins can be used for targeted cell or tissue inhibition or ablation (for instance, to treat cancer cells or tissues). Alternatively, if the polypeptide has multiple functional domains (i.e., an activation domain or a ligand binding domain, plus a 2 5 targeting domain), a fusion protein including only the targeting domain may be suitable for directing a detectable molecule, a cytotoxic molecule or a complementary molecule to a cell or tissue type of interest. In instances where the domain only fusion protein includes a complementary molecule, the anti-complementary molecule can be conjugated to a detectable or cytotoxic molecule. Such domain-complementary 3 0 molecule fusion proteins thus represent a generic targeting vehicle for cell/tissue-specific delivery of generic anti-complementary-detectable/ cytotoxic molecule conjugates.
In another embodiment, zmsel-cytokine fusion proteins or antibody cytokine fusion proteins can be used for enhancing in vivo killing of target tissues (for example, blood, bone marrow or other cancers), if the zmsel polypeptide or anti-zmsel antibody targets the hyperproliferative blood or bone marrow cell (See, generally, Hornick et al., Blood 89:4437-47, 1997). Hornick et al. described fusion proteins that enable targeting of a cytokine to a desired site of action, thereby providing an elevated local concentration of cytokine. Suitable zmse 1 polypeptides or anti-zmse 1 antibodies can target an undesirable cell or tissue (i.e., a tumor or a leukemia), and the fused cytokine mediate improved target cell lysis by effector cells. Suitable cytokines for this purpose include interleukin 2 and granulocyte-macrophage colony-stimulating factor (GM-CSF), for instance.
In yet another embodiment, if the zmse 1 polypeptide or anti- zmse 1 antibody targets vascular cells or tissues, such polypeptide or antibody may be conjugated with a radionuclide, and particularly with a beta-emitting radionuclide, to reduce restenosis. Such therapeutic approach poses less danger to clinicians who administer the radioactive therapy. For instance, iridium-192 impregnated ribbons placed into stented vessels of patients until the required radiation dose was delivered 2 0 showed decreased tissue growth in the vessel and greater luminal diameter than the control group, which received placebo ribbons. Further, revascularisation and stent thrombosis were significantly lower in the treatment group. Similar results are predicted with targeting of a bioactive conjugate containing a radionuclide, as described herein.
2 5 The bioactive polypeptide or antibody conjugates described herein can be delivered intravenously, intraarterially or intraductally, or may be introduced locally at the intended site of action.
The polypeptides, antagonists, agonists, nucleic acid antibodies of the present invention can be used in treatment of disorders associated with cancer, 3 0 metastasis, vasoconstriction, heart arrhythmia, heart inflammation, congestive heart disease, muscle spasms and fatigue, inflammation, testicular function, fertility, birth control, and the like. The molecules of the present invention can be used to modulate contractility or inflammation or to treat or prevent development of pathological conditions in diverse tissues. In particular, certain syndromes/diseases may be amenable to such diagnosis, treatment or prevention.
Diagnostic methods of the present invention involve the detection of zmsel polypeptides in the serum or tissue biopsy of a patient undergoing analysis of heart, spleen, testicular or muscle function or evaluation for possible cancers. Such polypeptides can be detected using immunoassay techniques and antibodies, described herein, that are capable of recognizing polypeptide epitopes. More specifically, the present invention contemplates methods for detecting zmsel polypeptides comprising:
exposing a test sample potentially containing zmsel polypeptides to an antibody attached to a solid support, wherein said antibody binds to a first epitope of a zmse 1 polypeptide;
washing the immobilized antibody-polypeptide to remove unbound contaminants;
exposing, the immobilized antibody-polypeptide to a second antibody directed to a second epitope of a zmsel polypeptide, wherein the second antibody is associated with a detectable label; and detecting the detectable label. Altered levels of zmsel polypeptides in a 2 o test sample, such as serum sweat, saliva, biopsy, tumor biopsy, and the like, can be monitored as an indication of heart, spleen, testicular or muscle function or of cancer, invasion or metastasis or other disease, when compared against a normal control.
Additional methods using probes or primers derived, for example, from the nucleotide sequences disclosed herein can also be used to detect zmsel expression 2 5 in a patient sample, such as a blood, saliva, sweat, tissue sample, or the like. For example, probes can be hybridized to tumor tissues and the hybridized complex detected by in situ hybridization. Zmsel sequences can also be detected by PCR
amplification using cDNA generated by reverse translation of sample mRNA as a template (PCR Primer A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold 3 0 Spring Harbor Press, 1995). When compared with a normal control, both increases or decreases of zmsel expression in a patient sample, relative to that of a control, can be monitored and used as an indicator or diagnostic for disease.
Polynucleotides encoding zmsel polypeptides are useful within gene therapy applications where it is desired to increase or inhibit zmsel activity. For example, in disease states where cell migration or motility is impaired or deficient, introduction of a zmsel gene could be used as a therapeutic. If a mammal has a mutated or absent zmsel gene, the zmsel gene can be introduced into the cells of the mammal. In one embodiment, a gene encoding a zmsel polypeptide is introduced in vivo in a viral vector. Such vectors include an attenuated or defective DNA
virus, such as, but not limited to, herpes simplex virus (HSV), retroviruses, papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
Defective viruses, which entirely or almost entirely lack viral genes, are preferred. A
defective virus is not infective after introduction into a cell. Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells. Examples of particular vectors include, but are not limited to, a defective herpes simplex virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell.
Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al., J. Clin. Invest. 90:626-30, 1992; and a defective adeno associated virus vector (Samulski et al., J. Virol. 61:3096-101, 1987;
Samulski et al., J.
2 0 Virol. 63:3822-8, 1989).
In another embodiment, a zmsel gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann et al. Cell 33:153, 1983; Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S.
Patent No.
4,980,289; Markowitz et al., J. Virol. 62:1120, 1988; Temin et al., U.S.
Patent No.
5,124,263; International Patent Publication No. WO 95/07358, published March 16, 1995 by Dougherty et al.; and Kuo et al., Blood 82:845, 1993. Alternatively, the vector can be introduced by lipofection in vivo using liposomes. Synthetic cationic lipids can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7, 1987; Mackey et al., Proc. Natl.
3 0 Acad. Sci. USA 85:8027-31, 1988). The use of lipofection to introduce exogenous genes into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. More particularly, directing transfection to particular cells represents one area of benefit. For instance, directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids 5 may be chemically coupled to other molecules for the purpose of targeting.
Targeted peptides (e.g., hormones or neurotransmitters), proteins such as antibodies, or non-peptide molecules can be coupled to liposomes chemically.
It is possible to remove the target cells from the body; to introduce the vector as a naked DNA plasmid; and then to re-implant the transformed cells into the 10 body. Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun or use of a DNA vector transporter. See, e.g., Wu et al., J. Biol. Chem.
267:963-7, 1992; Wu et al., J. Biol. Chem. 263:14621-4, 1988.
15 Antisense methodology can be used to inhibit zmsel gene transcription, such as to inhibit cell proliferation in vivo. Polynucleotides that are complementary to a segment of a zmsel-encoding polynucleotide (e.g., a polynucleotide as set forth in SEQ
>D NO:1) are designed to bind to zmsel-encoding mRNA and to inhibit translation of such mRNA. Such antisense polynucleotides are used to inhibit expression of zmsel 2 0 polypeptide-encoding genes in cell culture or in a subject.
'The present invention also provides reagents which will find use in diagnostic applications. For example, the zmse 1 gene, a probe comprising zmse or RNA or a subsequence thereof can be used to determine if the zmsel gene is present on chromosome 17 or if a mutation has occurred. Zmse 1 is located at the 17q24. l 2 5 region of chromosome 17 (see, Example 3). Detectable chromosomal aberrations at the zmsel gene locus include, but are not limited to, aneuploidy, gene copy number changes, translocations, insertions, deletions, restriction site changes and rearrangements. Such aberrations can be detected using polynucleotides of the present invention by employing molecular genetic techniques, such as restriction fragment 3 0 length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR techniques, and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian, Chest 108:255-65, 1995).
The precise knowledge of a gene's position can be useful for a number of purposes, including: 1) determining if a sequence is part of an existing contig and obtaining additional surrounding genetic sequences in various forms, such as YACs, BACs or cDNA clones; 2) providing a possible candidate gene for an inheritable disease which shows linkage to the same chromosomal region; and 3) cross-referencing model organisms, such as mouse, which may aid in determining what function a particular gene might have.
1 o The zmse 1 gene is located at the 17q24.1 region of chromosome 17.
Several genes of known function map to this region. Moreover, one of skill in the art would recognize that the 7q24 region is involved in several cancers, and that translocations, loss of heterogeneity (LOH) and other chromosomal abnormalities are often found in cancers. Thus, a marker in the 17q24.1 locus, such as provided by the polynucleotides of the present invention, would be useful in detecting translocations, aneuploidy, rearrangements, LOH other chromosomal abnormalities involving this region that are present in cancers. For example, zmsel polynucleotide probes can be used to detect abnormalities or genotypes associated with the cancer susceptibility marker BRCA1, localized to 17q21, which is associated with breast, ovarian and 2 0 prostate cancers (Hall, J.M. et al., Science 250:1684-1689, 1990). Zmsel is localized to the 17q24.1, is likely a Rho family effector, and could also be directly involved in breast cancer or other tumors. Moreover, there is evidence for cancer resulting from mutations in the 17q24 region: the somatostatin receptor 2 gene (17q24) may be associated with cancers, such as small cell lung cancer (Zhang, C.-Y. et al., Biochem.
2 5 Biophys. Res. Commun. 210:805-815, 1995); and esophageal cancers (Hennies, H.-C.
et al., Genomics 29:537-540, 1995).
Moreover, zmsel polynucleotide probes can be used to detect abnormalities or genotypes associated with pituitary and placental human growth hormone (GH), which maps to the 17q22-q24 region of chromosome 17. Mutations 3 0 and deletions in the GH gene can create GH deficiencies and other diseases in humans, and such a diagnostic could assist physicians in determining the type of GH
disease and appropriate associated therapy. As such, use of inventive anti-zmsel antibodies, polynucleotides, and polypeptides can be used for the detection of zmsel polypeptide, mRNA or anti-zmsel antibodies, thus serving as markers and be directly used for detecting or diagnosing growth hormone deficiencies or cancers using methods known in the art and described herein. For example, zmsel can be used to detect abnormalities or genotypes associated with the cyclin-dependent kinase 3 (CDK3) gene, involved in controlling cell cycle and intracellular signaling, maps to 17q22-qter, and is likely involved in human cancer (Bullrich, F. et al., Cancer Res. 55:1199-1205, 1995).
Moreover, Zmsel polynucleotide probes can be used to detect abnormalities or genotypes associated with dipeptidyl carboxypeptidase 1 (DCP1) (17q23), also known as Angiotensin I Converting Enzyme (ACED, such as those that are implicated in heart disease, hypertension and male infertility (for example., see, Arbustini, E.
et al., Brit.
Heart J. 74:584-591, 1995; Cambien, F. et al., Nature 359:641-644, 1992; and Hagaman, J.R. et al., Proc. Natl. Acad. Sci. 95:2552-2557. 1998). Further, zmsel polynucleotide probes can be used to detect abnormalities or genotypes associated with chromosome 17q24 deletions and translocations associated with human diseases, such as in the myeloperoxidase locus (17q23.1), or in cancers. Moreover, amongst other genetic loci, those for myeloperoxidase deficiency, (17q23.1), loci associated with cataracts (17q24), defects in sodium channel voltage-gated type 2 (resulting in several different syndromes) (17q23.1-q25.3), all manifest themselves in human disease states as well as map to this region of the human genome. See the Online Mendellian Inheritance of Man (OMIM) gene map, and references therein, for this region of chromosome 17 on a publicly available WWW server (http://www3.ncbi.nlm.nih.gov/htbin-post/Omim/getmap?chromosome=17q24.1). All 2 5 of these serve as possible candidate genes for an inheritable disease which show linkage to the same chromosomal region as the zmsel gene. Thus, zmsel polynucleotide probes can be used to detect abnormalities or genotypes associated with these defects.
Similarly, defects in the zmsel gene itself may result in a heritable human disease state. Molecules of the present invention, such as the polypeptides, 3 0 antagonists, agonists, polynucleotides and antibodies of the present invention would aid in the detection, diagnosis prevention, and treatment associated with a zmsel genetic defect.
A diagnostic could assist physicians in determining the type of disease and appropriate associated therapy, or assistance in genetic counseling or diagnosing cancer. As such, the inventive anti-zmse 1 antibodies, polynucleotides, and polypeptides can be used for the detection of zmsel polypeptide, mRNA or anti-zmsel antibodies, thus serving as markers and be directly used for detecting or genetic diseases or cancers, as described herein, using methods known in the art and described herein. Further, zmse 1 polynucleotide probes can be used to detect abnormalities or genotypes associated with chromosome 17q24.1 deletions and translocations associated with human diseases, such as those described above, or other translocations involved with malignant progression of tumors or other 17q24.1 mutations, which are expected to be involved in chromosome rearrangements in malignancy; or in other cancers.
Similarly, zmsel polynucleotide probes can be used to detect abnormalities or genotypes associated with chromosome 17q24.1 trisomy and chromosome loss associated with human diseases or spontaneous abortion. Thus, zmsel polynucleotide probes can be used to detect abnormalities or genotypes associated with these defects.
As discussed above, defects in the zmsel gene itself may result in a heritable human disease state. Molecules of the present invention, such as the 2 0 polypeptides, antagonists, agonists, polynucleotides and antibodies of the present invention would aid in the detection, diagnosis prevention, and treatment associated with a zmse 1 genetic defect. In addition, zmse 1 polynucleotide probes can be used to detect allelic differences between diseased or non-diseased individuals at the zmsel chromosomal locus. As such, the zmsel sequences can be used as diagnostics in 2 5 forensic DNA profiling.
In general, the diagnostic methods used in genetic linkage analysis, to detect a genetic abnormality or aberration in a patient, are known in the art.
Analytical probes will be generally at least 20 nt in length, although somewhat shorter probes can be used (e.g., 14-17 nt). PCR primers are at least 5 nt in length, preferably 15 or more, 3 0 more preferably 20-30 nt. For gross analysis of genes, or chromosomal DNA, a zmsel polynucleotide probe may comprise an entire exon or more. Exons are readily determined by one of skill in the art by comparing zmsel sequences (SEQ >17 NO:1) with the human genomic DNA for zmsel (Genbank Accession No. AC026091). In general, the diagnostic methods used in genetic linkage analysis, to detect a genetic abnormality or aberration in a patient, are known in the art. Most diagnostic methods comprise the steps of (a) obtaining a genetic sample from a potentially diseased patient, diseased patient or potential non-diseased carrier of a recessive disease allele; (b) producing a first reaction product by incubating the genetic sample with a zmsel polynucleotide probe wherein the polynucleotide will hybridize to complementary polynucleotide sequence, such as in RFLP analysis or by incubating the genetic sample with sense and antisense primers in a PCR reaction under appropriate PCR
reaction conditions; (iii) Visualizing the first reaction product by gel electrophoresis and/or other known method such as visualizing the first reaction product with a zmsel polynucleotide probe wherein the polynucleotide will hybridize to the complementary polynucleotide sequence of the first reaction; and (iv) comparing the visualized first reaction product to a second control reaction product of a genetic sample from wild type patient. A difference between the first reaction product and the control reaction product is indicative of a genetic abnormality in the diseased or potentially diseased patient, or the presence of a heterozygous recessive carrier phenotype for a non-diseased patient, or the presence of a genetic defect in a tumor from a diseased patient, or the presence of 2 0 a genetic abnormality in a fetus or pre-implantation embryo. For example, a difference in restriction fragment pattern, length of PCR products, length of repetitive sequences at the zmsel genetic locus, and the like, are indicative of a genetic abnormality, genetic aberration, or allelic difference in comparison to the normal wild type control. Controls can be from unaffected family members, or unrelated individuals, depending on the test 2 5 and availability of samples. Genetic samples for use within the present invention include genomic DNA, mRNA, and cDNA isolated form any tissue or other biological sample from a patient, such as but not limited to, blood, saliva, semen, embryonic cells, amniotic fluid, and the like. The polynucleotide probe or primer can be RNA or DNA, and will comprise a portion of SEQ m NO:1, the complement of SEQ >D NO:1, or an 3 0 RNA equivalent thereof. Such methods of showing genetic linkage analysis to human disease phenotypes are well known in the art. For reference to PCR based methods in diagnostics see see, generally, Mathew (ed.), Protocols in Human Molecular Genetics (Humana Press, Inc. 1991), White (ed.), PCR Protocols: Current Methods and Applications (Humana Press, Inc. 1993), Cotter (ed.), Molecular Diagnosis of Cancer (Humana Press, Inc. 1996), Hanausek and Walaszek (eds.), Tumor Marker Protocols 5 (Humana Press, Inc. 1998), Lo (ed.), Clinical Applications of PCR (Humana Press, Inc.
1998), and Meltzer (ed.), PCR in Bioanalysis (Humana Press, Inc. 1998)).
Mutations associated with the zmsel locus can be detected using nucleic acid molecules of the present invention by employing standard methods for direct mutation analysis, such as restriction fragment length polymorphism analysis, short 10 tandem repeat analysis employing PCR techniques, amplification-refractory mutation system analysis, single-strand conformation polymorphism detection, RNase cleavage methods, denaturing gradient gel electrophoresis, fluorescence-assisted mismatch analysis, and other genetic analysis techniques known in the art (see, for example, Mathew (ed.), Protocols in Human Molecular Genetics (Humana Press, Inc. 1991), 15 Marian, Chest 108:255 (1995), Coleman and Tsongalis, Molecular Diagnostics (Human Press, Inc. 1996), Elles (ed.) Molecular Diagnosis of Genetic Diseases (Humana Press, Inc. 1996), Landegren (ed.), Laboratory Protocols for Mutation Detection (Oxford University Press 1996), Birren et al. (eds.), Genome Analysis, Vol. 2:
Detecting Genes (Cold Spring Harbor Laboratory Press 1998), Dracopoli et al.
(eds.), 2 0 Current Protocols in Human Genetics (John Wiley & Sons 1998), and Richards and Ward, "Molecular Diagnostic Testing," in Principles of Molecular Medicine, pages 83-88 (Humana Press, Inc. 1998)). Direct analysis of an zmsel gene for a mutation can be performed using a subject's genomic DNA. Methods for amplifying genomic DNA, obtained for example from peripheral blood lymphocytes, are well-known to those of 25 skill in the art (see, for example, Dracopoli et al. (eds.), Current Protocols in Human Genetics, at pages 7.1.6 to 7.1.7 (John Wiley & Sons 1998)).
Mice engineered to express the zmsel gene, referred to as "transgenic mice," and mice that exhibit a complete absence of zmse 1 gene function, referred to as "knockout mice," may also be generated (Snouwaert et al., Science 257:1083, 1992;
3 0 Lowell et al., Nature 366:740-42, 1993; Capecchi, M.R., Science 244: 1288-1292, 1989; Palmiter, R.D. et al. Annu Rev Genet. 20: 465-499, 1986). For example, transgenic mice that over-express zmsel, either ubiquitously or under a tissue-specific or tissue-restricted promoter can be used to ask whether over-expression causes a phenotype. For example, over-expression of a wild-type zmse 1 polypeptide, polypeptide fragment or a mutant thereof may alter normal cellular processes, resulting in a phenotype that identifies a tissue in which zmsel expression is functionally relevant and may indicate a therapeutic target for the zmsel, its agonists or antagonists.
For example, a preferred transgenic mouse to engineer is one that over-expresses the full length human zmsel polypeptide (residue 1 (Met) to residue 356 (Val) of SEQ ID
N0:2); or more preferably the full length mouse zmsel polypeptide (residue 1 (Met) to residue 349 (Val) of SEQ >D NO:S). Preferred tissue-specific or tissue-restricted promoters include lymphoid-restricted, epithelial-specific, colon-specific, ovary-specific and skin-restricted promoters. Moreover, such over-expression may result in a phenotype that shows similarity with human diseases. Similarly, knockout zmsel mice can be used to determine where zmsel is absolutely required in vivo. A
transgenic mouse that is a knockout mouse would not expresses residue 1 (Met) to residue (Val) of SEQ ID NO:S, because they would exhibit a complete absence of endogenous zmsel gene function. The phenotype of knockout mice is predictive of the in vivo effects of that a zmsel antagonist, such as those described herein, may have.
The murine zmsel mRNA, and cDNA is isolated (SEQ >D N0:4) and can be used to isolate mouse zmsel genomic DNA (Genbank Accession No. AC026091) , which are subsequently used to generate knockout mice. These transgenic and knockout mice may be employed to study the zmsel gene and the protein encoded thereby in an in vivo system, and can be used as in vivo models for corresponding human or animal diseases (such as those in commercially viable animal populations). The mouse models of the present invention are particularly relevant as tumor models for the study of cancer biology and progression. Such models are useful in the development and efficacy of therapeutic molecules used in human cancers. Because increases in zmsel expression, as well as decreases in zmsel expression are associated with specific human cancers, both transgenic mice and knockout mice would serve as useful animal models for 3 0 cancer. Moreover, in a preferred embodiment, zmse 1 transgenic mouse can serve as an animal model for specific tumors, particularly colon cancer, ovarian cancer, leukemia or melanoma. Moreover, transgenic mice expression of zmsel antisense polynucleotides or ribozymes directed against zmsel, described herein, can be used analogously to transgenic mice described above.
The invention is further illustrated by the following non-limiting examples.
EXAMPLES
Example 1 Isolation and Cloning of the Human Zmsel A. Using an EST Seguence to Obtain Full-length human zmsel Scanning of a translated human cDNA database resulted in identification of an expressed sequence tag (EST) sequence which was used to identify a human full length cDNA from a K562 cDNA library prepared in house (K562 cells;
ATCC No. CCL-243).
Confirmation of the full length human cDNA sequence was made by sequence analyses of the cDNA from which the EST originated. This cDNA was contained in a plasmid. The human zmsel cDNA clone was sequenced using the following primers: ZC18489 (SEQ ID N0:21) , ZC18106 (SEQ ID N0:22), ZC18438 (SEQ ID N0:23), ZC 18165 (SEQ ID N0:24), ZC 18214 (SEQ ID N0:25), ZC 18275 (SEQ ID N0:26), ZC18213 (SEQ ID N0:27), ZC18285 (SEQ ID N0:28), ZC18388 (SEQ >D N0:29), ZC 18105 (SEQ >D N0:30), ZC 18452 (SEQ ID N0:31 ), and vector primers ZC6,768 (SEQ ID N0:17), and ZC694. (SEQ ID N0:18). Sequencing results 2 5 indicated a 3076 by insert with a 1068 by open reading frame beginning with an initiating Met and ending with a stop signal. The sequence analyses revealed that the cDNA encompassed the entire coding region of the DNA encoding human zmsel. The cDNA sequence is shown in SEQ ID NO:1 and the corresponding deduced polypeptide sequence is shown in SEQ ID N0:2.

Example 2 Tissue Distribution of zmsel in Human Tissues A. Human tissue blots probed with a human zmsel probe Northern blot analysis was performed using Human Multiple Tissue Blots (MTN I, MTN II, and MTN III) (Clontech, Palo Alto, Ca). A full length human zmsel probe, based directly on the zmsel cDNA (Example 1) was generated by PCR.
The PCR fragment was gel purified using QIAquick gel extraction kit (Qiagen, Santa Clarita, Ca.). The probe was radioactively labeled with 32P using the Rediprime II
DNA Labeling system (Amersham, UK) according to Manufacturer's specifications.
The probe was purified using a Nuctrap push column (Stratagene cloning system, La Jolla, Ca). Expresshyb (Clontech) solution was used for the hybridizing solution for the blots. Hybridization took place overnight at 65°C. The blots were then washed 4X in 2X SCC and 0.05% SDS at RT, followed by two washes in O.1X SSC and 0.1% SDS at 50°C. One transcript size was detected at approximately 3.6 kb. Signal intensity was ubiquitous for those tissues tested.
A Dot Blot was also performed using Human RNA Master BlotsT""
(Clontech). The methods and conditions for the Dot Blot were the same as for the Multiple Tissue Blots disclosed above. Again, signal intensity was ubiquitous for those tissues tested.
Example 3 Chromosomal Assignment and Placement of Human Zmsel Zmsel was mapped to human chromosome 17 using the commercially available version of the "Stanford G3 Radiation Hybrid Mapping Panel"
(Research 2 5 Genetics, Inc., Huntsville, AL). The "Stanford G3 RH Panel" contains DNAs from each of 83 radiation hybrid clones of the whole human genome, plus two control DNAs (the RM donor and the A3 recipient). A publicly available WWW server (http://shgc-www.stanford.edu) allows chromosomal localization of markers.
For the mapping of Zmsel with the "Stanford G3 RH Panel", 20 ~,1 3 0 reactions were set up in a 96-well microtiter plate (Stratagene, La Jolla, CA) and used in a "RoboCycler Gradient 96" thermal cycler (Stratagene). Each of the 85 PCR
reactions consisted of 2 ~ul lOX KlenTaq PCR reaction buffer (CLONTECH Laboratories, Inc., Palo Alto, CA), 1.6 ~,l dNTPs mix (2.5 mM each, PERKIN-ELMER, Foster City, CA), 1 ~.1 sense primer, ZC18,859 (SEQ ID N0:7), 1 ~1 antisense primer, ZC18,860 (SEQ
ll~
N0:8), 2 ~,1 "RediLoad" (Research Genetics, Inc., Huntsville, AL), 0.4 ~,1 SOX
Advantage KlenTaq Polymerase Mix (Clontech Laboratories, Inc.), 25 ng of DNA
from an individual hybrid clone or control and ddH20 for a total volume of 20 ~1.
The reactions were overlaid with an equal amount of mineral oil and sealed. The PCR cycler conditions were as follows: an initial 1 cycle 5 minute denaturation at 94oC, 35 cycles of a 45 seconds denaturation at 94oC, 45 seconds annealing at 66°C and 1 minute and 15 seconds extension at 72oC, followed by a final 1 cycle extension of 7 minutes at 72oC.
The reactions were separated by electrophoresis on a 2% agarose gel.
The results showed linkage of Zmsel to the human chromosome 17 framework marker SHGC-11717 with a LOD score of 15.36 and at a distance of 8.98 cR_10000 from the marker. The use of surrounding genes/markers positions Zmsel in the 17q24.3-q25 chromosomal region.
Example 4 Isolation and Cloning of Murine zmsel Extension of EST Sequence 2 0 Scanning of a translated DNA database using a protein sequence consisting of the translated open reading frame of human zmsel as a query resulted in identification of EST1166173, a murine expressed sequence tag (EST) found to be an ortholog of the human zmse 1 (Example 1 ) (SEQ ID NO: l ; SEQ ID N0:2). The mouse ortholog was designated muzmse 1.
2 5 Confirmation of the EST sequence was made by sequence analyses of the cDNA from which the EST originated. This cDNA was contained in a plasmid.
The mouse zmsel cDNA clone was sequenced using the following primers: ZC19,115 (SEQ ID N0:9) ,ZC 19,119 (SEQ ID NO:10), ZC 19,190 (SEQ ID NO:11 ), ZC 19,191 (SEQ ID N0:12), ZC19,192 (SEQ ID N0:13), ZC19,193 (SEQ B7 N0:14), ZC19,278 3 0 (SEQ ID NO:15), ZC 19,270 (SEQ ID N0:16), and vector primers ZC6,768 (SEQ
ID
N0:17), and ZC694. (SEQ ID N0:18). Sequencing results indicated a 2925 by insert with a 1050 by open reading frame beginning with an initiating Met and ending with a stop signal. The sequence analyses revealed that the cDNA encompassed the entire coding region of the DNA encoding muzmsel. The cDNA sequence is shown in SEQ
ID N0:4 and the corresponding deduced polypeptide sequence is shown in SEQ ID
5 NO:S.
Example 5 Generation of Unta~~ed zmsel Recombinant Adenovirus A. Preparation of DNA construct for Qeneration of Adenovirus 10 The protein coding region of murine zmse 1 was used to generate recombinant adenovirus. The 1050 by mouse zmsel cDNA was released from the TG12-8 vector (Example 6) using FseI and AscI enzymes. The cDNA was isolated on a 1 % low melt SeaPlaque GTGTM (FMC, Rockland, ME) gel and was then excised from the gel and the gel slice melted at 70°C, extracted twice with an equal volume of Tris 15 buffered phenol, and EtOH precipitated. The DNA was resuspended in 10 p.1 H20.
The zmse 1 cDNA was cloned into the FseI-AscI sites of pAdTrack CMV (He, T-C. et al., PNAS 95:2509-2514, 1998) in which the native polylinker was replaced with FseI, EcoRV, and AscI sites. Ligation was performed using the Fast-LinkTM DNA ligation and screening kit (Epicentre Technologies, Madison, WI).
In 2 0 order to linearize the plasmid, approximately 5 pg of the pAdTrackTM CMV
mouse zmse 1 plasmid was digested with PmeI. Approximately 1 p.g of the linearized plasmid was cotransformed with 200 ng of supercoiled pAdEasyTM (He et al., su ra. into BJS 183 cells. The co-transformation was done using a Bio-Rad Gene Pulser at 2.SkV, 200 ohms and 25 pF. The entire co-transformation was plated on 4 LB plates 2 5 containing 25 p.g/ml kanamycin. The smallest colonies were picked and expanded in LB/kanamycin and recombinant adenovirus DNA identified by standard DNA
miniprep procedures. Digestion of the recombinant adenovirus DNA with FseI-AscI
confirmed the presence of zmsel. The recombinant adenovirus miniprep DNA was transformed into DH10B competent cells and DNA prepared using a Qiagen maxi prep kit as per kit 3 0 instructions.

B. Transfection of 293A Cells with Recombinant DNA
Approximately 5 ~,g of recombinant adenoviral DNA was digested with PacI enzyme (New England Biolabs) for 3 hours at 37°C in a reaction volume of 100 ~.1 containing 20-30U of PacI. The digested DNA was extracted twice with an equal volume of phenol/chloroform and precipitated with ethanol. The DNA pellet was resuspended in 10 p.1 distilled water. A T25 flask of QBI-293A cells (Quantum Biotechnologies, Inc. Montreal, Qc. Canada), inoculated the day before and grown to 60-70% confluence, were transfected with the PacI digested DNA. The PacI-digested DNA was diluted up to a total volume of 50 ~l with sterile HBS (150mM NaCI, 20mM
HEPES). In a separate tube, 20 ~l DOTAP (Boerhinger Mannheim, 1 mg/ml) was diluted to a total volume of 100 p.1 with HBS. The DNA was added to the DOTAP, mixed gently by pipeting up and down, and left at room temperature for 15 minutes.
The media was removed from the 293A cells and washed with 5 ml serum-free MEMalpha (Gibco BRL) containing 1mM Sodium Pyruvate (GibcoBRL), 0.1 mM
MEM non-essential amino acids (GibcoBRL) and 25mM HEPES buffer (GibcoBRL).
5 ml of serum-free MEM was added to the 293A cells and held at 37°C .
The DNA/lipid mixture was added drop-wise to the T25 flask of 293A cells, mixed gently and incubated at 37°C for 4 hours. After 4 h the media containing the DNA/lipid mixture was aspirated off and replaced with 5 ml complete MEM containing 5%
fetal 2 0 bovine serum. The transfected cells were monitored for Green Fluorescent Protein (GFP) expression and formation of foci, i.e., viral plaques.
Seven days after transfection of 293A cells with the recombinant adenoviral DNA, the cells expressed the GFP protein and started to form foci.
These foci are viral "plaques" and the crude viral lysate was collected by using a cell scraper 2 5 to detach all of the 293A cells. The lysate was transferred to a 50 ml conical tube. To release most of the virus particles from the cells, three freeze/thaw cycles were done in a dry ice/ethanol bath and a 37° water bath.
C. Amplification of Recombinant Adenovirus (rAdV) 30 The crude lysate was amplified (Primary (1°) amplification) to obtain a working "stock" of zmsel rAdV lysate. Ten lOcm plates of nearly confluent (80-90%) 293A cells were set up 20 hours previously, 200 ~,1 of crude rAdV lysate added to each lOcm plate and monitored for 48 to 72 hours looking for CPE under the white light microscope and expression of GFP under the fluorescent microscope. When all of the 293A cells showed CPE (Cytopathic Effect) this 1° stock lysate was collected and freeze/thaw cycles performed as described under Crude rAdV Lysate.
Secondary (2°) Amplification of zmsel rAdV was obtained as follows:
Twenty l5cm tissue culture dishes of 293A cells were prepared so that the cells were 80-90% confluent. All but 20 mls of 5%MEM media was removed and each dish was inoculated with 300-500 p1 1° amplified rAdv lysate. After 48 hours the 293A cells were lysed from virus production and this lysate was collected into 250 ml polypropylene centrifuge bottles and the rAdV purified.
D. AdV/cDNA Purification NP-40 detergent was added to a final concentration of 0.5% to the bottles of crude lysate in order to lyse all cells. Bottles were placed on a rotating platform for 10 min. agitating as fast as possible without the bottles falling over. The debris was pelleted by centrifugation at 20,000 X G for 15 minutes. The supernatant was transferred to 250 ml polycarbonate centrifuge bottles and 0.5 volumes of 20%PEG8000/2.SM NaCI solution added. The bottles were shaken overnight on ice.
2 0 The bottles were centrifuged at 20,000 X G for 15 minutes and supernatant discarded into a bleach solution. The white precipitate in two vertical lines along the wall of the bottle on either side of the spin mark is the precipitated virus/PEG. Using a sterile cell scraper, the precipitate from 2 bottles was resuspended in 2.5 ml PBS. The virus solution was placed in 2 ml microcentrifuge tubes and centrifuged at 14,000 X
G in the 2 5 microfuge for 10 minutes to remove any additional cell debris. The supernatant from the 2 ml microcentrifuge tubes was transferred into a 15 ml polypropylene snapcap tube and adjusted to a density of 1.34 g/ml with cesium chloride (CsCI). The volume of the virus solution was estimated and 0.55 g/ml of CsCI added. The CsCI was dissolved and 1 ml of this solution weighed 1.34 g. The solution was transferred polycarbonate 3 0 thick-walled centrifuge tubes 3.2 ml (Beckman #362305) and spin at 80,000 rpm (348,000 X G) for 3-4 hours at 25°C in a Beckman Optima TLX
microultracentrifuge with the TLA-100.4 rotor. The virus formed a white band. Using wide-bore pipette tips, the virus band was collected.
The virus from the gradient has a large amount of CsCI which must be removed before it can be used on cells. Pharmacia PD-10 columns prepacked with Sephadex G-25M (Pharmacia) were used to desalt the virus preparation. The column was equilibrated with 20 ml of PBS. The virus was loaded and allowed it to run into the column. 5 ml of PBS was added to the column and fractions of 8-10 drops collected. The optical densities of 1:50 dilutions of each fraction was determined at 260 nm on a spectrophotometer. A clear absorbance peak was present between fractions 7-12. These fractions were pooled and the optical density (OD) of a 1:25 dilution determined. A formula is used to convert OD into virus concentration:
(OD at 260nm)(25)(1.1 x 1012) = virions/ml. The OD of a 1:25 dilution of the zmsel rAdV
was 0.164, giving a virus concentration of 4.5 X 1012 virions/ml.
To store the virus, glycerol was added to the purified virus to a final concentration of 15%, mixed gently but effectively, and stored in aliquots at -80°C .
E. Tissue Culture Infectious Dose at 50% CPE (TCm 50) Viral Titration Assay A protocol developed by Quantum Biotechnologies, Inc. (Montreal, Qc.
Canada) was followed to measure recombinant virus infectivity. Briefly, two 96-well tissue culture plates were seeded with 1X104 293A cells per well in MEM
containing 2% fetal bovine serum for each recombinant virus to be assayed. After 24 hours fold dilutions of each virus from 1X10 2 to 1X10 14 were made in MEM
containing 2% fetal bovine serum. 100 ~,1 of each dilution was placed in each of 20 wells. After 5 days at 37°C , wells were read either positive or negative for Cytopathic Effect (CPE) 2 5 and a value for "Plaque Forming Units/ml" (PFU) is calculated.
TCID50 formulation used was as per Quantum Biotechnologies, Inc., above. The titer (T) is determined from a plate where virus used is diluted from 10 2 to 10 14, and read 5 days after the infection. At each dilution a ratio (R) of positive wells for CPE per the total number of wells is determined.

To Calculate titer of the undiluted virus sample: the factor, "F" = 1+d(S-0.5); where "S" is the sum of the ratios (R); and "d" is LoglO of the dilution series, for example, "d" is equal to 1 for a ten-fold dilution series. The titer of the undiluted sample is T = 10(1+F) = TC~50/ml. To convert TCID50/ml to pfu/ml, 0.7 is subtracted from the exponent in the calculation for titer (T).
The murine zmse 1 adenovirus had a titer of 7.1 X 1010 pfu/ml.
Example 6 Generation of Construct for Transgenic Expression of Mouse zmsel (muzmsel) Oligonucleotides were designed to generate a PCR fragment containing a consensus Kozak sequence and the mouse zmsel coding region. These oligonucleotides were designed with an FseI site at the 5' end and an AscI
site at the 3' end to facilitate cloning into pTGl2-8, our standard transgenic vector. PMT12-contains the mouse MT-1 promoter and a 5' rat insulin II intron upstream of the FseI
site.
PCR reactions were carried out with 200 ng mouse zmsel template (Example 4) and oligonucleotides ZC19,514 (SEQ ID N0:19) and ZC19,515 (SEQ ID
N0:20). PCR reaction conditions were as follows: one cycle at 95°C for 5 minutes;
followed by 15 cycles at 95°C for 1 min., 58°C for 1 min., and 72°C for 1.0 min.;
2 0 followed by 72°C for 7 min.; followed by a 4°C soak. PCR
products were separated by agarose gel electrophoresis and purified using a QiaQuickT"~ (Qiagen) gel extraction kit. The isolated, 1050 bp, DNA fragment was digested with FseI and AscI
(Boerhinger-Mannheim), phenol/chloroform extracted, ethanol precipitated, resuspended in TE, and ligated into pTGl2-8 that was previously digested with FseI
and AscI. The pTGl2-8 plasmid, designed for expression of a gene of interest in transgenic mice, contains an expression cassette flanked by 10 kb of MT-1 5' DNA and 7 kb of MT-1 3' DNA. The expression cassette comprises the MT-1 promoter, the rat insulin II intron, a polylinker for the insertion of the desired clone, and the human growth hormone poly A sequence.
3 0 About one microliter of the ligation reaction was electroporated into DH10B ElectroMaxT"" competent cells (GIBCO BRL, Gaithersburg, MD) according to manufacturer's direction and plated onto LB plates containing 100 ~.g/ml ampicillin, and incubated overnight. Colonies were picked and grown in LB media containing ~.g/ml ampicillin. Miniprep DNA was prepared from the picked clones and screened for the zmsel insert by restriction digestion with EcoRI, and subsequent agarose gel 5 electrophoresis. Maxipreps of the correct pTG-zmsel construct were performed. A
positive clone was sequenced to verify thar the sequence was correct. A SaII
fragment containing with 5' and 3' flanking sequences, the MT-1 promoter, the rat insulin II
intron, zmsel cDNA and the human growth hormone poly A sequence are prepared and to be used for microinjection into fertilized murine oocytes.
10 Qiagen Maxi Prep protocol (Qiagen) was used as per manufacturer'.s instruction to generate mumse 1 DNA to use for further subcloning, for example, into adenovirus vectors described above (Example 5).
Example 7 15 Expression of zmsel in Cancer Tissues Using NCI60 Cancer Microarray A. Determination of genes having correlated expression with zmsel Gene expression profile information for zmsel was obtained from oligonucleotide and cDNA microarrays. Microarrays show the mRNA expression level of a large number of genes across a large number of cell types or cells exposed to 2 0 various conditions, or cells in various replication steps, depending on the experiment.
Because all of the information for all of the genes on any given microarray is obtained from the same biological experiment, and all biological experiments employing the same microarray provide results on the same set of genes, it is possible to compare the mRNA expression patterns of different genes to each other, as well as the expression 2 5 pattern of a given gene in various tissues, cell lines, or cancers.
Briefly, microarray experiments are conducted by extracting the mRNA
from reference tissues(s) or cell lines) and from experimental sample tissues) or cell line(s). The reference mRNA is reverse transcribed to cDNA in a reaction along with a fluorescent dye label. The sample mRNA is likewise reverse transcribed to cDNA, but 3 0 in the presence of a dye label with a different emission wavelength from the reference.
The two cDNA samples are then mixed and hybridized to the microarray. The microarray itself has thousands of unlabeled cDNA clones covalently bound as spots (also called 'features') on its surface. The labeled cDNAs then bind to their respective microarray spots. If a particular gene is transcribed at a higher level in the experimental sample relative to the reference, then the spot will fluoresce to a greater degree in the experimental sample dye wavelength channel. Conversely, if the gene in the experimental sample is down regulated, then the wavelength channel of the reference dye will be stronger. Finally, the microarrays are scanned at the wavelengths of both dyes and the results for each spot are recorded and stored electronically.
Large numbers of microarray experiments are typically done together using the same reference cDNA, but varying the experimental conditions, cell lines, tissues, time points, and the like.
Raw and/or processed microarray expression information was obtained from a subscription data set that was electronically downloaded. Publicly available, purchased, or in-house custom designed software can be used to analyze the microarray data (E.g., the publicly available NCI60 Cancer Microarray Project (Stanford University, Palo Alto, CA) world-wide-web resource http://genome-www.stanford/nci60/search.shtml). Prior to analysis, spots were examined to exclude experimental artifacts (dust spots, substrate imperfections, incomplete or uneven hybridization washes, etc.) and absorbence was adjusted to take into account background fluorescence of the microarray substrate at both wavelengths. Very weak 2 0 and very strong signals beyond the linear range response of the microarray reader were likewise excluded from analysis. Analyses were typically done on the ratio of the absorbance intensities of the reference and sample wavelength channels for each spot.
These absorbance ratios were normalized to log base 2. Microarray information for zmsel was found in Ross et al. using a 'NCI60' microarray (Ross, DT et al., Nature 2 5 Genet. 24:227-235, 2000). The reference mRNA was composed of a mixture of equal quantities of mRNA from HL-60, K562, NCI-H226, COLO 205, SNB-19, LOX-IMVI, OVCAR-3, OVCAR-4, CAKI-l, PC-3, MCF7, and Hs578T cells. See, Ross et al.
supra. for details of this method.
A cDNA clone corresponding to the 3' end of zmsel cDNA (and 3 0 corresponding mRNA was included on the 'NCI60' microarray chip set (Ross et al.
su ra. . The zmsel cDNA clone (IMAGE clone 486682; Incyte Pharmaceuticals, Palo Alto, CA; Genbank Accession No.'s AA044169 and AA044269) corresponds to zmse 1 nucleotide positions 2435 to 3076 of SEQ .ID NO:1. This chip set contained additional cloned cDNAs. Ross et al: performed 68 hybridization experiments with this chip set against 60 cancer cell lines. The data from the NCI60 microarray was purchased through the SUTECHTM Microarray Expression Database Subscription Program from Stanford Sequencing and Technology Center's Technology Development Group, (Stanford University, Palo Alto, CA) (http://otl.stanford.edu/tech/sutech.html).
Analysis was done by obtaining the Pearson correlation (R) between all pairs of spots in the entire set of microarray experiments. The Pearson correlation comprises a value from 1 to -1. A value of 1 shows that the expression in the two compared spots are positively correlated (both either are increased or decreased). A
value of -1 shows that the expression in the two compared spots are negatively correlated (when one goes up, the other goes down, or visa versa). A value of 0 shows that the items are not correlated over the range of experiments. Although values between 0 and 1, or 0 and -1 can be considered positively or negatively correlated respectively, in the current analysis, correlations greater than 0.5 or less than -0.5 were considered to be significant. A similar analysis was performed by Ross et al, supra..
Their results were also queried electronically by the NCI60 Cancer Microarray Project (Stanford University, Palo Alto, CA) world-wide-web resource (http://genome-www.stanford/nci60/search.shtml). Thus genes potentially co-regulated or coexpressed with zmse 1 were evaluated.
Table 5 shows the results of correlated cDNA clones in the NCI60 microarray that have a Pearson's R correlation of expression greater than 0.5 or less than -0.5 with a zmsel expression. Expressed genes are indexed by their accession 2 5 number, and the corresponding protein, if known, is described.
Our analysis of the data showed that zmsel had correlated expression (Pearson's R < -0.5 or > 0.5) with 39 other cDNA clones (Table 5). The clones having correlated expression with zmse 1 included cytoskeletal, cell cycle control, and other genes. For example, Zmsel was coexpressed with epithelial cytoskeletal proteins such 3 0 as paxillin, uroplakin, and zonaula occludens protein. It also showed co-expression with the nucleotide metabolism gene, cytosolic hydroxymethyltransferase, and a negative correlation with adenylosuccinate lyase. Examination of the results obtained by our analysis, in conjunction with the results obtained from Stanford Genomic Resources (Stanford University, Palo Alto, CA) (http://genome-www.stanford.edu/) reveals that zmsel is coexpressed with several cytoskeletal and cell junction genes:
cytoskeletal protein (HCYT), tight junction (zonula occludens) protein ZO-1, domain protein (CLP), syndecan-1, SH3 binding protein, amphiglycan, and paxillin.
These results showing that zmsel is co-expressed with cytoskeletal proteins strongly reinforces that zmse 1 is involved in cytoskeletal organization as described herein.
Additionally, zmsel expression is correlated with cytosolic serine hydroxymethyltransferase and cdc2Ll, and anti-correlated with adenylosuccinate lyase, DNA-directed polymerase II, and cdc25A. These results likewise suggest that zmsel has a role in cell cycle control and cancer.
Table 5.
Genbank Accession Pearson's Description No. R

W46185 0.623538 unknown W30779-N94432 0.621390 cytoskeletal protein (HCYT) 879559-879560 0.592573 tight junction (zonula occludens) protein AA053648-AA053259 0.557682 cytosolic serine hydroxymethyltransferase N47464-N47465 0.549652 unknown ' 899701-899596 0.545722 unknown W81425 0.543336 LIM domain protein (CLP) 801486-800830 0.532809 syndecan-1 W94188-W74616 0.524556 breast tumor-associated protein AA031793-AA031660 0.524266 serine/threonine kinase, NEK4a AA024925-AA024819 0.522498 protein tyrosine phosphatase, LAR

T39472-T40608 0.519872 SH3 binding protein 853149-853062 0.518507 unknown AA043212-AA043213 0.517950 HREV 107-like protein 809663-809550 0.512873 amphiglycan N50356-N51577 0.512019 unknown W31174-N98734 0.510772 unknown AA047159-AA047298 0.509458 unknown W73440-W73379 0.509449 unknown H24396 0.507807 unknown AA034388-AA034389 0.507472 immunogenic prostate tumor protein AA011515-AA011682 0.504750 unknown W44684-W44685 0.504525 maguk p55 subfamily member 3 (mpp3 protein) AA040884-AA040885 0.503192 calcyclin W38993-N93209 0.502568 T84 colon carcinoma cell IL-lbeta regulated AA004976-AA004863 0.500155 Na,K-ATPase beta subunit (ATP1B) N77727-N58359 -0.501752 RNA-associated protein-8 (RNAAP-8) N41802-N32849 -0.508249 unknown W95242-W95124 -0.508527 neuroblastoma apoptosis-related RNA
binding protein (NAPOR-1) W24524-N92340 -0.511351 MLC-1V/Sb isoform AA052965 -0.511973 bone marrow protein BM034 AA057262-AA058707 -0.513009 unknown AA043037-AA042937 -0.513606 unknown H59306-H59260 -0.518568 cdc25A

N80399-N67978 -0.527630 unknown W79319-W79419 -0.533025 DNA-directed polymerase II

AA010077 -0.542907 unknown H99588 -0.548033 lymphoid nuclear protein (LAF-4) W92381-W92325 -0.573708 adenylosuccinate lyase (ADSL) B. Determination of zmsel expression in cell and tissue types, and cancers Zmsel expression in the microarray hybridization data described above was also analyzed for expression in various tissue types and cancers. Table 6 shows the Ratio of expression of zmsel relative to the reference standard. The ratio of expression is another was to view the data. For each spot on the microarray, the ratio of fluorescence of the reference and sample wavelengths is a measure of the level of induction or repression of the test sample relative to the control (Ratio =
[sample 5 fluorescence/control reference fluorescence]). If there is no change in mRNA
expression level of a given gene in the control and test samples, then the ratio for the corresponding spot will be 1. If the sample expression is induced in the test sample then the ratio of fluorescence for that spot will be greater than l; if it is repressed then the ratio will be less than 1. The results indicated that zmsel is up-regulated in colon 10 cancer cell lines, and ovarian cancer cell lines. This data also indicated a down-regulation of zmsel in leukemia and melanoma cancer cell lines. Prostate, CNS, renal, breast, and non small cell lung cancer cell lines generally showed mixed or weak changes in zmsel expression relative to the control level. Zmsel expression was highest in the LOX-1MVI (melanoma cell line), HOP-92 (non-small cell lung 15 carcinoma cell line), BC2 (clinical sample of a lymph node metastasis of breast cancer), and COL0205 (colon cancer cell line). Zmsel expression was lowest in the CCRF-CEM, RPMI-8226, MOLT-4 (leukemia cell lines), and the M-14 (melanoma cell line).
These results show that a zmsel increase or decrease in expression is correlated with certain human cancers. As such, detection of zmsel expression increase or decrease 2 0 can be used as a diagnostic for human cancers. Moreover, in a preferred embodiment, zmsel can serve as a marker for certain tissue-specific tumors particularly colon cancer, ovarian cancer, leukemia or melanoma. Use of polynucleotides, polypeptides, and antibodies of the present invention for such diagnostic purposes are known in the art, and disclosed herein.
Table 6 Cell Line Description Ratio of Zmsel expression or to reference Tissue HS 578T breast cancer cell 0.51 line MDA-N breast cancer cell 0.59 line MDA-MB-435 breast cancer cell 0.63 line BT-549 breast cancer cell 0.8 line MDA-MB-231 breast cancer cell 0.96 line MCF7 breast cancer cell 1.15 line T-47D breast cancer cell 1.57 line MCF7 breast cancer cell 0.78 line MCF7 breast cancer cell 1.13 line BC2 breast cancer lymph1 node metastasis BC 16 breast cancer tissue1.08 biopsy BC2 breast cancer tissue2.47 biopsy Normal Breastbreast tissue biopsy,1.57 normal SF-539 CNS cancer cell 0.7 line SF-295 CNS cancer cell 1 line SF-268 CNS cancer cell 1.03 line SNB-19 CNS cancer cell 1.15 line U251 CNS cancer cell 1.22 line SW-620 colon cancer cell 0.83 line HCT-15 colon cancer cell 1.02 line KM12 colon cancer cell 1.19 line HCT-116 colon cancer cell 1.38 line HCC-2998 colon cancer cell 1.42 line COL0205 colon cancer cell 3.1 line HT-29 colon cancer cell 1.13 line MOLT-4 leukemia cell line 0.16 RPMI-8226 leukemia cell line 0.35 CCRF-CEM leukemia cell line 0.43 HL-60 leukemia cell line 0.52 K-562 leukemia cell line 0.53 SR leukemia cell line 0.98 K562 leukemia cell line 0.61 K562 leukemia cell line 0.62 M-14 melanoma cell line 0.27 SK-MEL-2 melanoma cell line 0.62 SK-MEL-5 melanoma cell line 0.7 SK-MEL-28 melanoma cell line 0.71 UACC-257 melanoma cell line 0.71 UACC-62 melanoma cell line 0.77 MALME-3M melanoma cell line 0.89 LOXIMVI melanoma cell line 1.86 NCI-H23 non-small cell lung0.53 cancer (NSCLC) cell line NCI-H322 NSCLC cell line 0.69 EKVX NSCLC cell line 0.74 NCI-H522 NSCLC cell line 0.82 NCI-H460 NSCLC cell line 1 A549 NSCLC cell line 1.08 HOP-62 NSCLC cell line 1.12 NCI-H226 NSCLC cell line 1.29 HOP-92 NSCLC cell line 2.31 OVCAR-4 ovarian cancer cell0.73 line OVCAR-3 ovarian cancer cell1.04 line OVCAR-8 ovarian cancer cell1.04 line OVCAR-5 ovarian cancer cell1.35 line IGROV1 ovarian cancer cell1.39 line SK-OV-3 ovarian cancer cell1.49 line DU-145 prostate cancer 1.1 cell line PC-3 prostate cancer 1.19 cell line UO-31 renal cancer cell 0.61 line RXF-393 renal cancer cell 0.81 line SNB-75 renal cancer cell 1 line 786-0 renal cancer cell 1.06 line SN12C renal cancer cell 1.06 line CAKI-1 renal cancer cell 1.09 line ACHN renal cancer cell 1.17 line A498 renal cancer cell 1.34 line TK-10 renal cancer cell 1.38 line ADR-RES unknown 1.28 From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> NOUEL CRIB PROTEIN ZMSEl <130> 99-76PC
<150> US 09/438,564 <151> 1999-11-10 <160> 31 <170> FastSEQ for Windows Version 3.0 <210>1 <211>3076 <212>DNA

<213>Homo sapiens <220>
<221> CDS
<222> (199)...(1266) <400> 1 gacaggggcc gccagcccct ccgccgcgcg gagcccacga aggggacagc gcagccggcc 60 cagagctcgg gtctccgggg accgagcctt atgatctcct cattgcgtcc ccctctgccc 120 actggacttg gacttcagat ctgaccccag acctgccggc tacctcggga gggcccacct 180 ccccgcccat ccagcaag atg cca atc ctc aag caa ctg gtg.tcc agc tcg 231 Met Pro Ile Leu Lys Gln Leu Ual Ser Ser Ser gtg cac tcc aag cgc cgt tcc cga gcg gac ctc acg gcc gag atg atc 279 Ual His Ser Lys Arg Arg Ser Arg Ala Asp Leu Thr Ala Glu Met Ile agc gcc ccg ctg ggc gac ttc cgc cac acc atg cac gtt ggc cgg gcc 327 Ser Ala Pro Leu Gly Asp Phe Arg Nis Thr Met His Ual Gly Arg Ala gga gac gcc ttt ggg gac acc tcc ttc ctc aat agc aag get ggc gag 375 Gly Asp Ala Phe Gly Asp Thr Ser Phe Leu Asn Ser Lys Ala Gly Glu ccc gac ggc gag tcc ttg gac gaa cag ccc tct tct tca tct tcc aaa 423 Pro Asp Gly Glu Ser Leu Asp Glu Gln Pro Ser Ser Ser Ser Ser Lys cgc agt ctc ctg tcc agg aag ttc cgg ggc agc aag cgg tca cag tcg 471 Arg Ser Leu Leu Ser Arg Lys Phe Arg Gly Ser Lys Arg Ser Gln Ser gtg acc agg ggg gag cgg gag cag cgt gac atg ctg ggc tcc ctg cgg 519 Val Thr Arg Gly Glu Arg Glu Gln Arg Asp Met Leu Gly Ser Leu Arg gac tcg gcc ctg ttt gtc aag aat gcc atg tcc ctg ccc cag ctc aat 567 Asp Ser Ala Leu Phe Ual Lys Asn Ala Met Ser Leu Pro Gln Leu Asn gag aag gag gcc gcg gag aag ggc acc agt aag ctg ccc aag agc ctg 615 Glu Lys Glu Ala Ala Glu Lys Gly Thr Ser Lys Leu Pro Lys Ser Leu tca tcc agc ccc gtg aag aag gcc aat gac ggg gag ggc ggc gat gag 663 Ser Ser Ser Pro Ual Lys Lys Ala Asn Asp Gly Glu Gly Gly Asp Glu gag gcg ggc acg gag gag gca gtg ccc cgt cgg aat ggg gcc gcg ggt 711 Glu Ala Gly Thr Glu Glu Ala Ual Pro Arg Arg Asn Gly Ala Ala Gly cca cat tcc cct gac ccc ctc ctc gat gag cag gcc ttt ggg gat ctg 759 Pro His Ser Pro Asp Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu aca gat ctg cct gtc gtg ccc aag gcc acg tac ggg ctg aag cat gcg 807 Thr Asp Leu Pro Ual Ual Pro Lys Ala Thr Tyr Gly Leu Lys His Ala gag tcc atc atg tcc ttc cac atc gac ctg ggg ccc tcc atg ctg ggt 855 Glu Ser Ile Met Ser Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly gac gtc ctc agc atc atg gac aag gag gag tgg gac ccc gag gag ggg 903 Asp Val Leu Ser Ile Met Asp Lys Glu Glu Trp Asp Pro Glu Glu Gly gag ggt ggt tac cat ggc gat gag ggc gcc get ggc acc atc acc cag 951 Glu Gly Gly Tyr His Gly Asp Glu Gly Ala Ala Gly Thr Ile Thr Gln get ccc ccg tac gcc gtg gcg gcc cct ccc ctg gca agg cag gaa ggc 999 Ala Pro Pro Tyr Ala Val Ala Ala Pro Pro Leu Ala Arg Gln Glu Gly aag get ggc cca gac ttg ccc tcc ctc ccc tcc cat get ctg gag gat 1047 Lys Ala Gly Pro Asp Leu Pro Ser Leu Pro Ser His Ala Leu Glu Asp gag ggg tgg gca gca gcg gcc ccc agc ccc ggc tca gcc cgc agc atg 1095 Glu Gly Trp Ala Ala Ala Ala Pro Ser Pro Gly Ser Ala Arg Ser Met ggc agc cac acc aca cgg gac agc agc tcc ctc tcc agc tgc acc tca 1143 Gly Ser His Thr Thr Arg,Asp Ser Ser Ser Leu Ser Ser Cys Thr Ser ggc atc ctg gag gag cgc agc cct gcc ttc cgg ggg ccg gac agg gcc 1191 Gly Ile Leu Glu Glu Arg Ser Pro Ala Phe Arg Gly Pro Asp Arg Ala cgg get get gtc tca aga cag cca gac aag gag ttc tcc ttc atg gat 1239 Arg Ala Ala Val Ser Arg Gln Pro Asp Lys Glu Phe Ser Phe Met Asp gag gag gag gag gat gaa atc cgt gtg tgaggcggac agtgggtggc 1286 Glu Glu Glu Glu Asp Glu Ile Arg Val caccgggagctcttggctgcatcttctccctgcccccaccccactatgacctttgaccct1346 acggcgcaggggcagccaggacccttgattcagaccatggaccctggaccttgtagatga1406 gggacactggcctggccctcgggtcttcggaggacgtagggggctggcatgggtgccgac1466 tggctgcctgacttcatcatgctccctgcacttaggctgcgtgggacaagggctgtgttg1526 tcacagcaggaataggttttcctctgttggcctccctttcctccaccctggcctcaaatg1586 gatgccagatgccaaccccagttctggccacgtacagccagcgggtcagcccagaggcag1646 cctcagctccagggctaaggactctcggctcccattttctctgctggcgtttctgctgtg1706 cccagcagtggctgctggggaagcagctgcagcaggagggagacggtcttgcctctcagc1766 ccctccctgccccaccccagctcctgccctggaaatctggagccccttggagctgagctg1826 gacggggggccagctgcgagcatgtgcactaaacgcagccctttccaggggaagagaaca1886 ggatggagaatggaaggaaagccccccaggcttcgtgaattgcaagaagggacccttcca1946 ggatgacactaggaacagggctagggcactcgctcagtccctaggggcttgtttgttctt2006 tattattgtgtttaaatccttatagagcaatatcaggatggtgttaataggtctgcctca2066 gaatgagaatcaatccttttagaaaacctttatactaagcctcctcttcgaaattcacag2126 tggcgattagcggactggagtctggtggcgattagcggactggagtctggggacatccgt2186 ggcaaagacaccagctcaactttagtgcttcccaactttatttagaatgacatggggtgg2246 gtgtctggtgtgtgtgttttccctacgcacctcccatagctattaacaactgaggaaggc2306 cagtgcagaatatttttggagaacgattttttttttaaataatatatcattcctatgggg2366 ggaaagccttttttttctttttggctgagttattccctccctcccctcaataccctcagt2426 actgactacttccctttcttttctcaggcctccccccaccgacttttgaggccagggttg2486 gccagatttagcaaaaccaaaacagagtgctgagttaaacgcaaatttcaggtaaacaaa2546 agataattttctagcattaatatgccccacgcaatatttggaacacttatgtgaaaaatg2606 atttgtttttctgaaattcacgtttctctctgagtcctgtaactgtccccgaggggattg2666 agcagaagctcgggtatgagccctgaggttgactgccggttatttttctgtcctgggaac2726 agcctgacccacctccctgtctccatgtagccagtgaggggagggggagacacagaacca2786 accacagccaggggcgtccccatggcgactgtggcccggcccctcctctcttgcctgact-2846 ctcctctcttgcctgactctagacactaacttagttccaggttcggtgccctgttggtgc2906 tcctgtttccaatagcttaggtcccatggtgggggaggaacctcaggggctatgcagccc2966 ccgccagctgccctcgaatcccgtccaggccaattccagattctaaactgatttttttca3026 tgatattgtcaaaacagtgaggaaacattaaaaaaaaaagccctaaagca 3076 <210>2 <211>356 <212>PRT

<213>Homo Sapiens <400> 2 Met Pro Ile Leu Lys Gln Leu Val Ser Ser Ser Val His Ser Lys Arg Arg Ser Arg Ala Asp Leu Thr Ala Glu Met Ile Ser Ala Pro Leu Gly Asp Phe Arg His Thr Met His Val Gly Arg Ala Gly Asp Ala Phe Gly Asp Thr Ser Phe Leu Asn Ser Lys Ala Gly Glu Pro Asp Gly Glu Ser Leu Asp Glu Gln Pro Ser Ser Ser Ser Ser Lys Arg Ser Leu Leu Ser Arg Lys Phe Arg Gly Ser Lys Arg Ser Gln Ser Val Thr Arg Gly Glu Arg Glu Gln Arg Asp Met Leu Gly Ser Leu Arg Asp Ser Ala Leu Phe Ual Lys Asn Ala Met Ser Leu Pro Gln Leu Asn Glu Lys Glu Ala Ala Glu Lys Gly Thr Ser Lys Leu Pro Lys Ser Leu Ser Ser Ser Pro Ual Lys Lys Ala Asn Asp Gly Glu Gly Gly Asp Glu Glu Ala Gly Thr Glu Glu Ala Ual Pro Arg Arg Asn Gly Ala Ala Gly Pro His Ser Pro Asp Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu Thr Asp Leu Pro Ual Ual Pro Lys Ala Thr Tyr Gly Leu Lys His Ala Glu Ser Ile Met Ser Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly Asp Ual Leu Ser Ile Met Asp Lys Glu Glu Trp Asp Pro Glu Glu Gly Glu Gly Gly Tyr His Gly Asp Glu Gly Ala Ala Gly Thr Ile Thr Gln Ala Pro Pro Tyr Ala Ual Ala Ala Pro Pro Leu Ala Arg Gln Glu Gly Lys Ala Gly Pro Asp Leu Pro Ser Leu Pro Ser His Ala Leu Glu Asp Glu Gly Trp Ala Ala Ala Ala Pro Ser Pro Gly Ser Ala Arg Ser Met Gly Ser His Thr Thr Arg Asp Ser Ser Ser Leu Ser Ser Cys Thr Ser Gly Ile Leu Glu Glu Arg Ser Pro Ala Phe Arg Gly Pro Asp Arg Ala Arg Ala Ala Ual Ser Arg Gln Pro Asp Lys Glu Phe Ser Phe Met Asp Glu Glu Glu Glu Asp Glu Ile Arg Ual <210> 3 <211> 1068 <212> DNA
<213> Artificial Sequence <220>
<223> Degenerate polynucleotide seuence for human zmsel <221> misc_feature <222> (1). .(1068) <223> n = A,T,C or G
<400> 3 atgccnathytnaarcarytngtnwsnwsnwsngtncaywsnaarmgnmgnwsnmgngcn60 gayytnacngcngaratgathwsngcnccnytnggngayttymgncayacnatgcaygtn120 ggnmgngcnggngaygcnttyggngayacnwsnttyytnaaywsnaargcnggngarccn180 gayggngarwsnytngaygarcarccnwsnwsnwsnwsnwsnaarmgnwsnytnytnwsn240 mgnaarttymgnggnwsnaarmgnwsncarwsngtnacnmgnggngarmgngarcarmgn300 gayatgytnggnwsnytnmgngaywsngcnytnttygtnaaraaygcnatgwsnytnccn360 carytnaaygaraargargcngcngaraarggnacnwsnaarytnccnaarwsnytnwsn420 wsnwsnccngtnaaraargcnaaygayggngarggnggngaygargargcnggnacngar480 gargcngtnccnmgnmgnaayggngcngcnggnccncaywsnccngayccnytnytngay540 garcargcnttyggngayytnacngayytnccngtngtnccnaargcnacntayggnytn600 aarcaygcngarwsnathatgwsnttycayathgayytnggnccnwsnatgytnggngay660 gtnytnwsnathatggayaargargartgggayccngargarggngarggnggntaycay720 ggngaygarggngcngcnggnacnathacncargcnccnccntaygcngtngcngcnccn780 ccnytngcnmgncargarggnaargcnggnccngayytnccnwsnytnccnwsncaygcn840 ytngargaygarggntgggcngcngcngcnccnwsnccnggnwsngcnmgnwsnatgggn900 wsncayacnacnmgngaywsnwsnwsnytnwsnwsntgyacnwsnggnathytngargar960 mgnwsnccngcnttymgnggnccngaymgngcnmgngcngcngtnwsnmgncarccngay1020 aargarttywsnttyatggaygargargargargaygarathmgngtn 1068 <210>4 <211>2868 <212>DNA

<213>Mus musculus <220>
<221> CDS
<222> (173)...(1219) <400> 4 cgaggcgcca agcacaccga ggggagcgta cagccgcacc tggtctgcgc tcggggagct 60 ggggaccgag ccctctgatt gccctgtcta ccctttgcat tgctggactt cagatctgac 120 cccatacctg cctgttgcct tgggagtgcc cagctccccc gcagccagca cg atg ccc 178 Met Pro att ctc aaa cag ctg gtg tcc agc tct gtg aac tcg aag cgc cgc tca 226 Ile Leu Lys G.ln Leu Val Ser Ser Ser Val Asn Ser Lys Arg Arg Ser cgt gcg gac ctc aca gcc gag atg atc agt gcc ccg ctg ggt gac ttc 274 Arg Ala Asp Leu Thr Ala Glu Met Ile Ser Ala Pro Leu Gly Asp Phe cgc cac acc atg cat gtg ggc cgg get ggg gac gcc ttt ggg gac acc 322 Arg His Thr Met His Val Gly Arg Ala Gly Asp Ala Phe Gly Asp Thr tcc ttc ctc act agc aag gcc agg gag gca gac gac gag tcc ctg gat 370 Ser Phe Leu Thr Ser Lys Ala Arg Glu Ala Asp Asp Glu Ser Leu Asp gag cag gcc tcc get tcc aag ctc agc ctc ctg tcc agg aag ttc cgg 418 Glu Gln Ala Ser Ala Ser Lys Leu Ser Leu Leu Ser Arg Lys Phe Arg ggc agc aaa cgt tca cag tcc gtg acc aga ggg gac cgg gag cag aga 466 Gly Ser Lys Arg Ser Gln Ser Val Thr Arg Gly Asp Arg Glu Gln Arg gac atg ctg ggc tcc ctg cgg gac tca gca ctg ttt gtc aag aat gcc 514 Asp Met Leu Gly Ser Leu Arg Asp Ser Ala Leu Phe Val Lys Asn Ala 100 105 . 110 atg tcc ctg cct cag ctc aat gag aag gaa gcc gcg gag aag gac tcg 562 Met Ser Leu Pro Gln Leu Asn Glu Lys Glu Ala Ala Glu Lys Asp Ser agc aag ctg ccc aag agc ctg tcg tcc agc cct gtg aag aag gca gac 610 Ser Lys Leu Pro Lys Ser Leu Ser Ser Ser Pro Val Lys Lys Ala Asp get aga gat ggt ggc ccg aag agt ccc cat cgg aac ggg gcc aca ggc 658 Ala Arg Asp Gly Gly Pro Lys Ser Pro His Arg Asn Gly Ala Thr Gly ccc aac tca cct gac cca ctc ctt gac gag cag gcc ttt ggg gac ctg 706 Pro Asn Ser Pro Asp Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu atg gat ctg ccc atc atg ccc aaa gtc agc tac ggg ctg aag cat gca 754 Met Asp Leu Pro Ile Met Pro Lys Val Ser Tyr Gly Leu Lys His Ala gag tcg atc ctg tcc ttc cac atc gac ctg ggg cct tcc atg ctg gga 802 Glu Ser Ile Leu Ser Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly gat gtt ctc agc atc atg gac aag gac cag tgg ggc tca gag gag gag 850 Asp Val Leu Ser Ile Met Asp Lys Asp Gln Trp Gly Ser Glu Glu Glu gag gaa get ggc ggg tac cgt gac aag gaa ggc ccc agc agc att gtc 898 Glu Glu Ala Gly Gly Tyr Arg Asp Lys Glu Gly Pro Ser Ser Ile Val cag gca ccc cct gtg ctg gag gtg gtt cct cct cta ggg aga cag gaa 946 Gln Ala Pro Pro Val Leu Glu Ual Val Pro Pro Leu Gly Arg Gln Glu agc aag gcc agc tgg gac cag gcc tct atg ctg ccc ccc cac get gtg 994 Ser Lys Ala Ser Trp Asp Gln Ala Ser Met Leu Pro Pro His Ala Val gag gat gac gga tgg gcg gtg gta gcc ccc agc ccc agc tca gca cgc 1042 Glu Asp Asp Gly Trp Ala Val Val Ala Pro Ser Pro Ser Ser Ala Arg agt gtg ggc agc cac acc acg cgg gac agc agc tcc ctg tcc agc tac 1090 Ser Val Gly Ser His Thr Thr Arg Asp Ser Ser Ser Leu Ser Ser Tyr acc tca ggc gtc ctt gag gag cgc agc cca get ttc aga ggc cca gac 1138 Thr Ser Gly Val Leu Glu Glu Arg Ser Pro Ala Phe Arg Gly Pro Asp agg gtg gca get get ccc cca agg cag cca gac aag gaa ttc tgc ttc 1186 Arg Val Ala Ala Ala Pro Pro Arg Gln Pro Asp Lys Glu Phe Cys Phe atg gat gag gag gag gaa gat gag atc cga gtt tgaggctgga ccgaaagttg 1239 Met Asp Glu Glu Glu Glu Asp Glu Ile Arg Val aaagtcgccttcacatctctgggctgcatcttttccctgctgctgctgccgccttctcta1299 tgacctttgaccttactctgtaggtgcagctaagaggctcattggagtagaccctggacc1359 tcagggattggggtgccagagaagtaaagtagcaggggcactggcgcctggtggcctgac1419 tctgacctaaccttccttaccgcaccagcctgggacggatccgagccccagcgggaagcc1479 attctcttccgggccctttgctctcagcctggcctcagatggatgccagatgttagtttg1539 agttgctgccgcaatggcagggaagccaggtgtgggcttctctccaaggtcatggacact1599 tggctcccttctgttcaccttgtgtctgcagcctacccaggagatatatgcagcaggagg1659 caggggtgctcacgtgtttgagctcctccttcttccacctctggctcctcactgaagcct1719 ggtgttctttggggttcagctgaagccaggggacagcctcaactattacactaaatgcag1779 cctgtcccagaggctgcatcccaggacaggatggggcacagaaggaacgaacaccccctg1839 cttctagcttcttgggttctcaagacactaggaacaggaaaggggccagctctgcccatg1899 ggtgtgtttgttccttgttactatgttttaaacctgaatagagcactgccaaaatcccct1959 gccaggagactagtgaccgtcttggtggctgagtgactgttatctcacctgaatctggtg2019 tacagaccctgcccaggttggactgtggcagggcagccaccaccagtgtttgtcccggaa2079 cccccacctccatagctgttagtggctgaaggagggctgtgtaagaaaagttctggaata2139 cgatgcttaaatgatacattattccctggggtgtgagctgcgctttggctagttagtggc2199 ctctccttgggctctgggccaggcctcgcaaaaacacaaaacaagatgggactgtatttg2259 attggaattccaggggttttttgtttgtttgtttttggctttttgggatacggtctcact2319 ctgtagcccaagctggcctcaagctcatagcgagcctcccttaccctaggagcttcggtt2379 gcaagtgtgcaccactgctcctggctgttttgttcttctgaaagctgttttgctcagctc2439 ctgtaactctacccagaacgctagtagaggcaggggcctgagccctgggggtggtagctc2499 attactttcctatgctgggagcaggctgacctgctccctggtctagcacagccagtggga2559 atctggggagagagcaagctagattacaagcagagtctggccagatggtggccagccatg2619 ggctgctgtgcttccagaggccaccctcctagattcagaccctgaagtgctcactgggcc2679 cctgactggtgctcctacgcaggtaggcagtgactgagctacagagctgtgtctctggcc2739 agcagtacacacacaacacacacacacccctctcctaaatctacctggttggttctaaac2799 tctaaactttgtatttttttccatgacattgaaaaagcagtaagaaaacattaaaatttc2859 ctcctaaca 2868 <210>5 <211>349 <212>PRT

<213>Mus musculus <400> 5 Met Pro Ile Leu Lys Gln Leu Val Ser Ser Ser Val Asn Ser Lys Arg Arg Ser Arg Ala Asp Leu Thr Ala Glu Met Ile Ser Ala Pro Leu Gly Asp Phe Arg His Thr Met His Val Gly Arg Ala Gly Asp Ala Phe Gly Asp Thr Ser Phe Leu Thr Ser Lys Ala Arg Glu Ala Asp Asp Glu Ser Leu Asp Glu Gln Ala Ser Ala Ser Lys Leu Ser Leu Leu Ser Arg Lys Phe Arg Gly Ser Lys Arg Ser Gln Ser Val Thr Arg Gly Asp Arg Glu Gln Arg Asp Met Leu Gly Ser Leu Arg Asp Ser Ala Leu Phe Val Lys Asn Ala Met Ser Leu Pro Gln Leu Asn Glu Lys Glu Ala Ala Glu Lys Asp Ser Ser Lys Leu Pro Lys Ser Leu Ser Ser Ser Pro Val Lys Lys Ala Asp Ala Arg Asp Gly Gly Pro Lys Ser Pro His Arg Asn Gly Ala Thr Gly Pro Asn Ser Pro Asp Pro Leu Leu Asp Glu Gln Ala Phe Gly Asp Leu Met Asp Leu Pro Ile Met Pro Lys Val Ser Tyr Gly Leu Lys His Ala Glu Ser Ile Leu Ser Phe His Ile Asp Leu Gly Pro Ser Met Leu Gly Asp Val Leu Ser Ile Met Asp Lys Asp Gln Trp Gly Ser Glu Glu Glu Glu Glu Ala Gly Gly Tyr Arg Asp Lys Glu Gly Pro Ser Ser Ile Val Gln Ala Pro Pro Val Leu Glu Val Val Pro Pro Leu Gly Arg Gln Glu Ser Lys Ala Ser Trp Asp Gln Ala Ser Met Leu Pro Pro His Ala Val Glu Asp Asp Gly Trp Ala Val Val Ala Pro Ser Pro Ser Ser Ala Arg Ser Val Gly Ser His Thr Thr Arg Asp Ser Ser Ser Leu Ser Ser Tyr Thr Ser Gly Val Leu Glu Glu Arg Ser Pro Ala Phe Arg Gly Pro Asp Arg Val Ala Ala Ala Pro Pro Arg Gln Pro Asp Lys Glu Phe Cys Phe Met Asp Glu Glu Glu Glu Asp Glu Ile Arg Val <210> 6 <211> 16 <212> PRT
<213> Artificial Sequence <220>

<223> Consensus CRIB motif (Bubelo, PD et al..
J.Biol.Chem. 270:29071-29074, p. 29073. 1995) <221> VARIANT
<222> (1)...(16) <223> Xaa = Any Amino Acid <400> 6 Ile Ser Xaa Pro Xaa Xaa Xaa Xaa Phe Xaa His Xaa Xaa His Ual Gly <210> 7 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18859 <400> 7 ggggcagcaa gcggtcac 18 <210> 8 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18860 <400> 8 tccgcggcct ccttctca 18 <210> 9 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19115 <400> 9 tgcccaagag cctgtcgtcc 20 <210> 10 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19119 <400> 10 ctggctgtgc tagaccaggg 20 <210> 11 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19190 <400> 11 acggtcacta gtctcctggc 20 <210> 12 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19191 <400> 12 gctttcagag gcccagacag 20 <210> 13 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19192 <400> 13 tcgtcaagga gtgggtcagg 20 <210> 14 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19193 <400> 14 gatacggtct cactctgtag 20 <210> 15 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19278 <400> 15 acagagtaag gtcaaaggtc 20 <210> 16 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19270 <400> 16 aggctgcatc ccaggacagg 20 <210> 17 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC6768 <400> 17 gcaattaacc ctcactaaag ggaac 25 <210> 18 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC694 <400> 18 taatacgact cactataggg 20 <210> 19 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19514 <400> 19 gcgcgcggcc ggccaccatg cccattctca as 32 <210> 20 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19515 <400> 20 gcgcgcggcg cgcctcaaac tcggatctca tc 32 <210> 21 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18489 <400> 21 tcatcgccat ggtaaccac 19 <210> 22 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18106 <400> 22 aaacgcagtc tcctgtccag 20 <210> 23 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18438 <400> 23 gcatttgagc tcaaacctcc 20 <210> 24 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18165 <400> 24 aagcatgcgg agtccatcat g 21 <210> 25 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Oligonucleotide primer ZC18214 <400> 25 tgctgtctca agacagccag 20 <210> 26 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18275 <400> 26 ttagtgcaca tgctcgcagc 20 <210> 27 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18213 <400> 27 tattctgcac tggccttcct c 21 <210> 28 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18285 <400> 28 tggcctcaaa tggatgccag 20 <210> 29 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18388 <400> 29 tgttaatagg tctgcctcag 20 <210> 30 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18105 <400> 30 agtcaacctc agggctcata c 21 <210> 31 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC18452 <400> 31 agagtgctga gttaaacgc 19

Claims (24)

What is claimed is:

1. An isolated polynucleotide that encodes a polypeptide comprising a sequence of amino acid residues from the group of:

(a) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met), to amino acid number 147 (A1a);

(b) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser);

(c) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser); and (d) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met), to amino acid number 356 (Val).

2. An isolated polynucleotide according to claim 1, wherein the polynucleotide is from the group of:

(a) a polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 199 to nucleotide 639;

(b) a polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 640 to nucleotide 1206;

(c) a polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 640 to nucleotide 1266; and (d) a polynucleotide sequence as shown in SEQ ID NO:1 from nucleotide 199 to nucleotide 1266.

3. An isolated polynucleotide sequence according to claim 1, wherein the polynucleotide comprises nucleotide 1 to nucleotide 1068 of SEQ ID NO:3.

4. An expression vector comprising the following operably linked elements:

a transcription promoter;

a DNA segment encoding a polypeptide as shown in SEQ ID NO:2 from amino acid number 1 (Met), to amino acid number 356 (Val); and a transcription terminator, wherein the promoter is operably linked to the DNA segment, and the DNA
segment is operably linked to the transcription terminator.

5. An expression vector according to claim 4, further comprising a secretory signal sequence operably linked to the DNA segment.

6. A cultured cell comprising an expression vector according to claim 4, wherein the cell expresses a polypeptide encoded by the DNA segment.

7. A DNA construct encoding a fusion protein, the DNA construct comprising:

a first DNA segment encoding a polypeptide comprising a sequence of amino acid residues from the group of:

(a) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met), to amino acid number 147 (Ala);

(b) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser);

(c) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser);

(d) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 337 (Arg), to amino acid number 356 (Ser); and (e) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met), to amino acid number 356 (Val); and at least one other DNA segment encoding an additional polypeptide, wherein the first and other DNA segments are connected in-frame; and wherein the first and other DNA segments encode the fusion protein.

8. An expression vector comprising the following operably linked elements:

a transcription promoter;
a DNA construct encoding a fusion protein according to claim 7; and a transcription terminator, wherein the promoter is operably linked to the DNA construct, and the DNA
construct is operably linked to the transcription terminator.

9. A cultured cell comprising an expression vector according to claim 8, wherein the cell expresses a polypeptide encoded by the DNA construct.

10. A method of producing a fusion protein comprising:
culturing a cell according to claim 9; and isolating the polypeptide produced by the cell.

11. An isolated polypeptide comprising a sequence of amino acid residues from the group of:

(a) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met), to amino acid number 147 (Ala);

(b) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 148 (Asn), to amino acid number 336 (Ser);

(c) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 148 (Asn), to amino acid number 356 (Ser); and (d) the amino acid sequence as shown in SEQ ID NO:2 from amino acid number 1 (Met), to amino acid number 356 (Val).

12. A method of producing a polypeptide comprising:
culturing a cell according to claim 6; and isolating the polypeptide produced by the cell.

13. A method of producing an antibody comprising:

inoculating an animal with a polypeptide from the group of:

(a) a polypeptide according to claim 11; and wherein the polypeptide elicits an immune response in the animal to produce the antibody; and isolating the antibody from the animal.

14. An antibody produced by the method of claim 13, which specifically binds to a polypeptide of claim 11.

15. The antibody of claim 14, wherein the antibody is a monoclonal antibody.

16. An antibody that specifically binds to a polypeptide of claim 11.

17. A method of detecting, in a test sample, the presence of a modulator of zmsel protein activity, comprising:

culturing a cell into which has been introduced an expression vector according to claim 4, wherein the cell expresses the zmsel protein encoded by the DNA
segment in the presence and absence of a test sample; and comparing levels of activity of zmsel in the presence and absence of a test sample, by a biological or biochemical assay; and determining from the comparison, the presence of modulator of zmse 1 activity in the test sample.

18. A method for detecting a genetic abnormality in a patient, comprising:
obtaining a genetic sample from a patient;
producing a first reaction product by incubating the genetic sample with a polynucleotide comprising at least 14 contiguous nucleotides of SEQ ID NO:1 or the complement of SEQ ID NO:1, under conditions wherein said polynucleotide will hybridize to complementary polynucleotide sequence;
visualizing the first reaction product; and comparing said first reaction product to a control reaction product from a wild type patient, wherein a difference between said first reaction product and said control reaction product is indicative of a genetic abnormality in the patient.

19. A method for detecting a cancer in a patient, comprising:
obtaining a tissue or biological sample from a patient;
incubating the tissue or biological sample with an antibody that binds SEQ ID
NO:2 under conditions wherein the antibody binds to its complementary polypeptide in the tissue or biological sample;
visualizing the antibody bound in the tissue or biological sample; and comparing levels of antibody bound in the tissue or biological sample from the patient to a normal control tissue or biological sample, wherein an increase or decrease in the level of antibody bound to the patient tissue or biological sample relative to the normal control tissue or biological sample is indicative of a cancer in the patient.

20. A method for detecting a cancer in a patient, comprising:
obtaining a tissue or biological sample from a patient;
labeling a polynucleotide comprising at least 14 contiguous nucleotides of SEQ ID NO:1 or the complement of SEQ ID NO:1;
incubating the tissue or biological sample with under conditions wherein the polynucleotide will hybridize to complementary polynucleotide sequence;
visualizing the labeled polynucleotide in the tissue or biological sample; and comparing the level of labeled polynucleotide hybridization in the tissue or biological sample from the patient to a normal control tissue or biological sample, wherein an increase or decrease in the labeled polynucleotide hybridization to the patient tissue or biological sample relative to the normal control tissue or biological sample is indicative of a cancer in the patient.

21. A transgenic mouse, wherein the mouse over-expresses residue 1 (Met) to residue 356 (Val) of SEQ ID No:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID NO:5.

22. A transgenic mouse according to claim 21, wherein the expression of residue 1 (Met) to residue 356 (Val) of SEQ ID NO:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID NO:5 is expressed using a tissue-specific or tissue-restricted promoter.

23. A transgenic mouse according to claim 21, wherein the expression of residue 1 (Met) to residue 356 (Val) of SEQ ID NO:2) or residue 1 (Met) to residue 349 (Val) of SEQ ID NO:5 is expressed using an epithelial-specific, colon-specific, or ovary-specific promoter.

24. A transgenic mouse according to claim 21, wherein the mouse does not expresses residue 1 (Met) to residue 349 (Val) of SEQ ID NO:5, relative to a normal mouse.