CA2388445A1 - Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of e. coli - Google Patents

Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of e. coli Download PDF

Info

Publication number
CA2388445A1
CA2388445A1 CA002388445A CA2388445A CA2388445A1 CA 2388445 A1 CA2388445 A1 CA 2388445A1 CA 002388445 A CA002388445 A CA 002388445A CA 2388445 A CA2388445 A CA 2388445A CA 2388445 A1 CA2388445 A1 CA 2388445A1
Authority
CA
Canada
Prior art keywords
seq
coli
sequence
strain
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002388445A
Other languages
French (fr)
Inventor
Anne Marie Gilles
Chantal Le Bouguenec
Laurence Du Merle
Christine Bernier
Awa Aidara-Kane
Maria Damian
Yves Germani
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut Pasteur de Lille
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CA002388445A priority Critical patent/CA2388445A1/en
Publication of CA2388445A1 publication Critical patent/CA2388445A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C12Q1/10—Enterobacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention is concerned with genetic and metabolic markers and with methods to identify pathogenic or potentially pathogenic strains of E.
coli.
More particularly, the invention provides nucleotide and amino acid sequences, antibodies, probes, cells, kits and methods concerning genes expressed mostly by pathogenic strains E. coli.

Description

GENETIC MARKERS, METABOLIC MARKERS, AND METHODS FOR
EVALUATING PATHOGENICITY OF STRAINS OF E. COLI
BACKGROUND OF THE INVENTION
a) Field of the invention The present invention is concerned with genetic and metabolic markers and with methods to identify pathogenic or potentially pathogenic strains of E.
coli.
More particularly, the invention provides nucleotide and amino acid sequences, antibodies, probes, cells, kits and methods concerning genes expressed mostly by pathogenic strains E. coli.
b) Brief description of the prior art Escherichia coli is a heterogeneous species consisting of both enteric commensal and pathogenic strains. Different types of E. coli cause different diseases in a range of hosts, including extra-intestinal and enteric infections. For example, enteropathogenic E. coil (EPEC) is the leading cause of severe infantile diarrhea in developing countries, and enterohaemorrhagic E. coli (EHEC) (including the well-known 0157:H7) have recently been shown to be the cause of bloody diarrhea and hemolytic-uremic syndrome in major food-borne outbreaks in the United States, Europe, and Asia (CMR 1998, 11:142).
Over the last five years, studies have been published on the E. coli chromosome. The whole genome sequence of the laboratory strain K-12 MG1655 was published in 1997 (Science 1997, 277:1453). The genome of E, coli 0157: H7 (EHEC strain EDL933) was recently sequenced (Nature 2001, 409:529). Although comparative analysis of these sequences have resulted in the identification of virulence genes and the characterization of pathogenicity islands, the specific virulence regions associated with the pathogenesis of E, coli causing various diseases remains to be elucidated.
Recently, some of the present inventors identified in the genome of S. enferica serovar Typhi, an operon of three genes (deoK operon) regulated by a repressor DeoQ and missing in E. coli K12 (J. Bacteriol., 2000, 182:869-873).
In E. coli strain AL862, sequences similar to the deoK operon have been sequenced (GenBankT"" accession Nos. AF286670 and AF286671 ) but no function has been assigned to these sequences.
Furthermore, although the use of 2-Deoxy-D-ribose by E. coli strains has been previously described (Br. J. Biomed. Sci., 1995; 52: 173), this property was never associated with the pathogenic status of the strains and the genes encoding this function were not identified.
In view of the above, there is a need for methods, nucleic acid molecules, polypeptides, antibodies, vectors and cells useful for the identification of pathogenic strains of E. coli.
The present invention fulfils this need and also other needs as it will be apparent to those skilled in the art upon reading the following specification.
SUMMARY OF THE INVENTION
The present inventors have found that a sugar (deoxyribose) that is not fermented by E. coli K12, is metabolized by a large number of pathogenic isolates belonging to various pathotypes. The present inventors have identified the genes encoding this function and demonstrated that they are conserved among several pathogenic strains. The present inventors have also developed genetic and bacteriological assays to identify deoxyribose-positive E. coli strains.
In general, the invention features an isolated or purified nucleic acid molecule, such as genomic, cDNA, antisense, DNA, RNA or a synthetic nucleic acid molecule that encodes or corresponds to a E. coli deoK polypeptide.
According to a first aspect, the invention features isolated or purified nucleic acid molecules, polynucleotides, polypeptides, E. coli deoK proteins and fragment thereof. Preferred nucleic acid molecules consist of a DNA.
According to another aspect, the invention features a nucleotide probe.
According to another aspect, the invention features a purified antibody. In a preferred embodiment, the antibody is a monoclonal or a polyclonal antibody that specifically binds to a E. coli deoK protein and/or to a fragment thereof.
A further aspect of the invention relate to a method for evaluating pathogenicity of a strain of E. coli, comprising assaying a metabolic activity of the strain. Preferably the metabolic activity consists of metabolization of 2-Deoxy-D-ribose and capacity of the strain to metabolize of 2-Deoxy-D-ribose is assessed.
In another aspect, the present invention further features a method for identifying a pathogenic or potentially pathogenic strain of E. coli. In a related aspect, the invention relates to a method for determining likelihood of pathogenicity of a strain of E. coli. In one embodiment, the method comprises detecting deoxyribokinase enzymatic activity of the strain. Preferably this is done by assaying, under suitable culture conditions, the capabilities of the strain to metabolize 2-Deoxy-D-ribose. In another embodiment, the method comprises assaying the E. coli strain for the presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose. According to the invention ability of E.
coli strains to metabolize 2-Deoxy-D-ribose and/or presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose is indicative that the strain of E. coli is pathogenic or a potentially pathogenic. Of course, both aspects of the method may be carried out simultaneously or in parallel.
In another aspect, the present invention further features a method for identifying a pathogenic or a potentially pathogenic strain of E. coli, the method having a level of specificity of at least 30%, 40%, 45%, 46%, 47%, 48%, 49% or 50% for pathogenic E. coli from some clinical isolates. More preferably, the method detect less than 25%, 20%, 18%, 15% or 10% of commensal E. coli from healthy peoples.
In another related aspect, the invention features a kit for identifying a strain of E. coli or evaluating pathogenicity of a strain of E. coli, the kit comprising preferably an antibody or a probe as defined previously.
The present invention also features a method of treatment of E. coli infections.
One of the greatest advantages of the present invention is that it provides genetic and proteinic markers, antibodies, probes, kits and methods that can be used for identifying pathogenic strains of E. coli and/or for evaluating pathogenicity of a strain of E. coli and eventually treat or prevent E. coli infections.
Other objects and advantages of the present invention will be apparent upon reading the following non-restrictive description of the preferred embodiments thereof and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schema illustrating operon deoK in Escherichia coli.
Figure 2 represents nucleic acids and amino acids sequences of deoK
operon in Escherichia coli - strain AL862. Underlined sequence corresponds to probe A and doubled underlined sequence corresponds to probe B. Bold nucleotides correspond to primers used in PCR assay to amplify probes A and B.
Figure 3 represents nucleic acids and amino acids sequences of deoK
operon in Escherichia coli - strain 55989.
Figure 4 represents nucleic acids sequence of Probe A.
Figure 5 represents nucleic acids sequence of Probe B.
DETAILED DESCRIPTION OF THE INVENTION
A) Definitions Throughout the text, the word "kilobase" is generally abbreviated as "kb", the words "deoxyribonucleic acid" as "DNA", the words "ribonucleic acid" as "RNA", the words "complementary DNA" as "cDNA", the words "polymerase chain reaction" as "PCR", and the words "reverse transcription" as "RT". Nucleotide sequences are written in the 5' to 3' orientation unless stated otherwise.
In order to provide an even clearer and more consistent understanding of the specification and the claims, including the scope given herein to such terms, the following definitions are provided:

Antisense: As used herein in reference to nucleic acids, is meant a nucleic acid sequence, regardless of length, that is complementary to the coding strand of a gene.
Expression: Refers to the process by which gene encoded information is 5 converted into the structures present and operating in the cell. In the case of cDNAs, cDNA fragments and genomic DNA fragments, the transcribed nucleic acid is subsequently translated into a peptide or a protein in order to carry out its function if any. By "positioned for expression" is meant that the DNA molecule is positioned adjacent to a DNA sequence which directs transcription and translation of the sequence (i.e., facilitates the production of, e.g., a deoK
polypeptide, a recombinant protein or a RNA molecule).
Fragment: Refers to a section of a molecule, such as a protein, a polypeptide or a nucleic acid, and is meant to refer to any portion of the amino acid or nucleotide sequence.
Host: A cell, tissue, organ or organism capable of providing cellular components for allowing the expression of an exogenous nucleic acid embedded into a vector. This term is intended to also include hosts which have been modified in order to accomplish these functions. Bacteria, fungi, animal (cells, tissues, or organisms) and plant (cells, tissues, or organisms) are examples of a host.
Isolated or Purified or Substantially pure: Means altered "by the hand of man" from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a protein/peptide naturally present in a living organism is not "isolated", the same polynucleotide separated from the coexisting materials of its natural state, obtained by cloning, amplification and/or chemical synthesis is "isolated" as the term is employed herein. Moreover, a polynucleotide or a protein/peptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated" even if it is still present in said organism.
Nucleic acid: Any DNA, RNA sequence or molecule having one nucleotide or more, including nucleotide sequences encoding a complete gene. The term is intended to encompass all nucleic acids whether occurring naturally or non-naturally in a particular cell, tissue or organism. This includes DNA and fragments thereof, RNA and fragments thereof, cDNAs and fragments thereof, expressed sequence tags, artificial sequences including randomized artificial sequences.
Open reading frame ("ORF"): The portion of a cDNA that is translated into a protein. Typically, an open reading frame starts with an initiator ATG codon and ends with a termination codon (TAA, TAG or TGA).
Percent identity and Percent similarity: Used herein in nucleic acid and/or among amino acid sequences comparisons. Sequence identity is typically measured using sequence analysis software with the default parameters specified therein (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Owl 53705). This software program matches similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
Polypeptide or Protein: Means any chain of more than two amino acids, regardless of post-translational modification such as glycosylation or phosphorylation.
Potentially pathogenic: Refers to a strain which has the capacity to be involved in a pathogenic process. Examples of potentially pathogenic strains are extra-intestinal E. coli strains which are distinct from the commensal and from the intestinal pathogenic strains.
Specifically binds: Means an antibody that recognizes and binds a protein or polypeptide but that does not substantially recognize and bind other molecules in a sample, e.g., a biological sample, that naturally includes protein.
Substantially the same: Refers to nucleic acid or amino acid sequences having sequence variation that do not materially affect the nature of the protein.
With particular reference to nucleic acid sequences, the term "substantially the same" is intended to refer to the coding region and to conserved sequences governing expression, and refers primarily to degenerate codons encoding the same amino acid, or alternate codons encoding conservative substitute amino acids in the encoded polypeptide. With reference to amino acid sequences, the term "substantially the same" refers generally to conservative substitutions and/or variations in regions of the protein that are not involved in determination of structure or function of the protein. "Substantially the same" encompasses "degenerate variants" of nucleic acid or amino acid sequences.
Substantially pure polypeptide: Means a polypeptide that has been separated from the components that naturally accompany it. Typically, the polypeptide is substantially pure when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the polypeptide is at least 75%, 80%, or 85%, more preferably at least 90%, 95% or 97% and most preferably at least 99%, by weight, pure. A substantially pure polypeptide or protein may be obtained, for example, by extraction from a natural source (including but not limited to E. Coh) by expression of a recombinant nucleic acid encoding the polypeptide, or by chemically synthesizing the protein. Purity can be measured by any appropriate method, e.g., by column chromatography, polyacrylamide gel electrophoresis, or HPLC
analysis.
A protein is substantially free of naturally associated components when it is separated from those contaminants which accompany it in its natural state.
Thus, a protein which is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally associated components. Accordingly, substantially pure polypeptides include those derived from eukaryotic organisms but synthesized in E. coli or other prokaryotes. By "substantially pure DNA" is meant DNA that is free of the genes which, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote;
or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA
fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding an additional polypeptide sequence.

Transformed or Transfected or Transduced or Transgenic cell: Refers to a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, an exogenous DNA molecule encoding a polypeptide of interest. By "'transformation" is meant any method for introducing foreign molecules into a cell. Lipofection, calcium phosphate precipitation, retroviral delivery, electroporation, and ballistic transformation are just a few of the teachings which may be used.
Vector: A self-replicating RNA or DNA molecule which can be used to transfer an RNA or DNA segment from one organism to another. Vectors are particularly useful for manipulating genetic constructs and different vectors may have properties particularly appropriate to express proteins) in a recipient during cloning procedures and may comprise different selectable markers. Bacterial plasmids are commonly used vectors. Modified viruses such as adenoviruses and retroviruses are other examples of vectors.
B) General overview of the invention The present inventors have shown that a sugar (deoxyribose) that is not fermented by E. coli K12, is metabolized by a large number of pathogenic isolates belonging to various pathotypes. The present inventors have also identified the genes encoding this function and they demonstrated that they are conserved among several pathogenic strains. The present inventors have further developed genetic and bacteriological assays to identify deoxyribose-positive E, coli strains.
i) Cloning and molecular characterization of deoK operon in E, coli As it will be described hereinafter in the exemplification section of the invention, the inventors have discovered, cloned and sequenced the DNA
encoding the deoK operon in two pathogenic strains of E. coli. The DNA
sequences and the predicted amino acid sequence of the encoded proteins are shown in Figures 2 and 3. Computer analysis revealed four open reading frames (ORF), deoX, deoP, deoK, and deoQ, which mapped to the same loci as had similar sequences to the deoX, deoP, deoK, and deoQ genes from the deoK
operon from Salmonella, respectively (See Figure 1 ).

The function of deoP, deoK, and deoQ is known. These E. coli genes encode a putative 2-Deoxy-D-ribose permease, a deoxyribokinase and a putative repressor protein, respectively. Function of deoX remains to be elucidated.
DeoX
gene encodes a protein of 337 amino acids (A.A.) long. In silico analysis indicates that the protein has the following features: it has a molecular weight of about 38 kDa, an isoelectric point of about 5.2; an instability index of about 45.4 (i.e.
Unstable); an aliphatic index of about 79.6; and a grand average of hydropathicity (GRAVY) of about -0.136.
ii) deoK homology with other genes and proteins As shown in Table 1 on the exemplification section, a blast search indicates that deoK operon in E. coli shares high level of identity with deoK operon in S. Typhi (about 75 to 80%).
Therefore, the present invention concerns an isolated or purified nucleic acid molecule (such as DNA) comprising a sequence selected from the group consisting of a) sequences provided in part or all of SEQ ID NO: 1 or 6;
b) complements of the sequences provided in part or all of SEQ ID NO: 1 or 6;
c) sequences consisting of at least 20 contiguous residues of a sequence provided in SEQ ID NO: 1 or 6;
d) sequences that hybridize to part or all of nucleic acids of SEQ ID NO: 1 or 6, under moderately, preferably high, stringent conditions;
e) sequences having at least 80% identity to part or all of SEQ ID NO: 1 or 6;
f) degenerate variants of a sequence provided in part or all of SEQ ID NO: 1 or 6;
and g) sequences encoding part or all of polypeptides provided in SEQ ID NO: 2-5 and 7-10.
More preferably, the nucleic acid molecule of the invention comprises a sequence selected from the group consisting of:
a) a nucleotide sequence having at least 80%, 85%, 90%, 95% or 97% nucleotide sequence identity with SEQ ID NO: 1 or 6; and b) a nucleotide sequence having at least 80%, 85%, 90%, 95% or 97% nucleotide sequence identity with a nucleic acid encoding an amino acid sequence of SEQ ID NO: 2-5 and 7-10.
More preferably, the nucleic acid molecule comprises a sequence 5 substantially the same or having 100% identity with SEQ ID NO: 1 or 6, or a sequence substantially the same or having 100% identity with nucleic acids encoding an amino acid sequence of SEQ ID NO: 2-5 and 7-10.
The present invention also concerns isolated or purified nucleic acid molecules comprising a sequence encoding a E. coli polypeptide involved in 10 metabolization of 2-Deoxy-D-ribose, or degenerate variants thereof, the E.
coli polypeptide or degenerate variant comprising part or all of SEQ ID N0:2-5 and 7-10.
The present invention also concerns isolated or purified nucleic acid molecule which hybridizes under moderate, preferably high stringency conditions with part or all of any of the nucleic acid molecules of the invention mentioned hereinbefore or with part or all of a complementary sequence thereof. The "hybridizing" nucleic acid could be used as probe or as antisense molecules as it will be described hereinafter.
In a related aspect, the present invention concerns an isolated or purified polypeptide or a protein comprising an amino acid sequence selected from the group consisting of:
a) sequences encoded by a nucleic acid as defined previously;
b) sequences having at least 80% identity to part or all of any of SEQ ID N0:2-and 7-10;
c) sequences having at least 85% homology to part or all of any of SEQ ID
N0:2-5 and 7-10; and d) sequence provided in part or all of any of SEQ ID N0:2-5 and 7-10.
More preferably, the polypeptide comprises an amino acid sequence substantially the same or having 100% identity with any of SEQ ID N0:2-5 and 7-10. Most preferred polypeptides are those having a biological activity that permit E. coli to metabolize 2-Deoxy-D-ribose.

iii) Anti-deoK antibodies The invention features purified antibodies that specifically bind to a protein encoded by the E. colt deoK operon. The antibodies of the invention may be prepared by a variety of methods using the deoK proteins or polypeptides described above. For example, the deoK polypeptide, or antigenic fragments thereof, may be administered to an animal in order to induce the production of polyclonal antibodies. Alternatively, antibodies used as described herein may be monoclonal antibodies, which are prepared using hybridoma technology (see, e.g., Hammerling et al., In Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, NY, 1981 ).
The invention features antibodies that specifically bind E. colt deoK operon polypeptides, or fragments thereof. In particular, the invention features "neutralizing" antibodies. By "neutralizing" antibodies is meant antibodies that interfere with any of the biological activities of any of the E. colt deoK
operon polypeptides, particularly the ability of E. colt to metabolize 2-Deoxy-D-ribose. The neutralizing antibody may reduce the ability of E. colt deoK proteins to metabolize 2-Deoxy-D-ribose by, preferably 50%, more preferably by 70%, and most preferably by 90% or more. Any standard assay of 2-Deoxy-D-ribose metabolization, including those described herein, may be used to assess potentially neutralizing antibodies. Once produced, monoclonal and polyclonal antibodies are preferably tested for specific deoK proteins recognition by Western blot, immunoprecipitation analysis or any other suitable method.
In addition to intact monoclonal and polyclonal anti-deoK antibodies, the invention features various genetically engineered antibodies, humanized antibodies, and antibody fragments, including F(ab')2, Fab', Fab, Fv and sFv fragments. Antibodies can be humanized by methods known in the art. Fully human antibodies, such as those expressed in transgenic animals, are also features of the invention.
Antibodies that specifically recognize deoK proteins (or fragments deoK), such as those described herein, are considered useful to the invention. Such an antibody may be used in any standard immunodetection method for the detection, quantification, and purification of deoK proteins. The antibody may be a monoclonal or a polyclonal antibody and may be modified for diagnostic purposes.
The antibodies of the invention may, for example, be used in an immunoassay to monitor deoK expression levels, to determine the subcellular location of a deoK or deoK fragment produced by E. coli, to determine the amount of deoK or fragment thereof in a biological sample and evaluate the pathogenicity of a strain of E. coli.
In addition, the antibodies may be coupled to compounds for diagnostic and/or therapeutic uses such as gold particles, alkaline phosphatase, peroxidase for imaging and therapy The antibodies may also be labeled (e.g.
immunofluorescence) for easier detection.
iv) Identification of E. coli pathogenic strains According to the present invention, the ability of the E. coli strain to metabolize 2-Deoxy-D-ribose and/or the presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose in the E. coli strain is indicative that this strain is pathogenic or at least potentially pathogenic.
Therefore, the invention provides a method for evaluating pathogenicity of a strain of E. coli comprising assaying a metabolic activity of that strain.
Preferably, the metabolic activity consists of metabolization of 2-Deoxy-D-ribose and the assessment step consists of growing the strain of a minimal medium comprising 2-Deoxy-D-ribose as a sole source of carbon.
The antibodies described above and probes described hereinafter rnay be used to monitor deoK protein expression and/or to identify a pathogenic strain of E, coli in a biological sample or in a human or an subject. Accordingly, the invention provides a method for identifying a pathogenic strain of E, coli and/or for evaluating likelihood of pathogenicity of a strain of E. coli as compared to a commensal strain.
According to a first embodiment, the method comprises assaying the E. coli strain for the presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose. Preferably, oligonucleotides such as probes, or cloned nucleotide (RNA
or DNA) fragments corresponding to unique portions of genes and proteins from operon deoK are used to assess deoK proteins cellular levels or detect deoK

mRNAs (both indicative of E. coli pathogenicity). Such an assessment may also be done in vifro using well-known methods (Northern analysis, PCR, quantitative PCR, microarrays, etc.). The methods of the invention may be carried out by contacting, in vitro or in vivo, an E, coli isolate or a biological sample (such as a urine sample, feces, blood, cerebral spinal fluid, from an individual or an individual or an animal suspected of harboring pathogenic E. coli. or an extract thereof, witty an anti-deoK antibody or a probe according to the invention, in order to determine the presence or evaluate the amount of deoK proteins or gene in the sample or the cells therein.
According to a preferred embodiment, the method comprises assessment of the E, coli strain for the presence of a nucleic acid sequence selected from the group consisting of:
a) sequences provided in part or all of SEQ ID NO: 1 or 6;
b) complements of the sequences provided in part or all of SEQ ID NO: 1 or 6;
a) sequences consisting of at least 20 contiguous residues of a sequence provided in SEQ ID NO: 1 or 6;
b) sequences that hybridize to part or all of nucleic acids of SEQ ID NO: 1 or 6, under moderately, preferably high, stringent conditions;
c) sequences having at least 80% identity to part or all of SEQ ID NO: 1 or 6;
d) degenerate variants of a sequence provided in part or all of SEQ ID NO: 1 or 6;
and e) sequences encoding part or all of polypeptides provided in SEQ ID NO: 2-5 and 7-10.
According to another preferred embodiment, the method comprises assessment of the E. coli strain for the presence of a polypeptide comprising an amino acid sequence selected from the group consisting of:
a) sequences encoded by a nucleic acid as defined in claim 7;
b) sequences having at least 80% identity to part or all of any of SEQ ID N0:2-and 7-10;
c) sequences having at least 85% homology to part or all of any of SEQ ID N0:2-5 and 7-10; and d) sequence provided in part or all of any of SEQ ID N0:2-5 and 7-10.

Accordingly, the invention encompasses nucleotide probes comprising a sequence of at least 15, 20, 25, 30, 40, 50, 75, 100 or more sequential nucleotides cf SEQ ID NO: 1 or 6, or of a sequence complementary to SEQ ID NO: 1 or 6.
More preferably, the probe consists of SEQ ID NO: 11 or 12.
Of course, it may be preferable to further assay the presence (or absence) of other genes/proteins in order to increase sensitivity and/or specificity of the method.
According to another embodiment, the method for identifying a pathogenic strain of E. coli comprises detecting deoxyribokinase enzymatic activity of the strain. Preferably this is done by assaying, under suitable culture conditions, the capabilities of the strain to metabolize 2-Deoxy-D-ribose. This may be achieved by grow'ng in vitro an E. coli isolate or a biological sample suspected of harboring pathogenic E. coli on a minimal medium comprising 2-Deoxy-D-ribose as a sole source of carbon and evaluating bacteria growth and survival in that medium.
Preferably, the minimal medium comprises from about 0.01 % 2-Deoxy-D-ribose and the bacteria are cultured in the minimal medium for about 24h to about 48h.
Assay kits for determining the amount of deoK genes and proteins in a sample and/or for identifying a pathogenic strain of E. coli, are also within the scope of the present invention. According to one embodiment, such a kit would preferably comprises anti-deoK antibody(ies) or probes) according to the invention and other elements) selected such as instructions for using the kit, assay tubes, enzymes, reagents or reaction buffers}, enzymes}. In another embodiment, the kit would comprises means for assaying capabilities of a strain of E. coli to metabolize 2-Deoxy-D-ribose.
A non-limitative example of use for the methods, kits and probes of the invention is the detection of pathogenic or potentially pathogenic E. coli bacteria in food which may be contaminated by E. coli.
v) Downmodulation of deoK proteins expression As mentioned previously, expression of proteins of the deoK operon allows E. coli to metabolize 2-Deoxy-D-ribose. Modulation of deoK may be useful.

More particularly downmodulation of deoK proteins could be used to prevent and/or treat E. coli infections. Therefore, the invention also relates to methods for preventing or treating E. Coli infections comprising downmodulating expression or biological activity of deoK proteins or genes. This may be achieved 5 by administering a molecule or compound having such property.
vii) Vectors and Cells The invention is also directed to a host, such as a genetically modified cell, comprising any of the nucleic acid sequence according to the invention and more 10 preferably, a host capable of expressing the peptide/protein encoded by this nucleic acid.
The host cell may be any type of cell (a transiently-transfected mammalian cell line, an isolated primary cell, or a bacterium (such as E. coh). More preferably the host is Escherichia coli bacterium and it is selected from the Escherichia coli 15 bacteria filed on May 14, 2002 at the CNCM under accession numbers I-2867 and I-2867.
A number of vectors suitable for stable transfection of mammalian cells and bacteria are available to the public (e.g. plasmids, adenoviruses, adeno-associated viruses, retroviruses, Herpes Simplex Viruses, Alphaviruses, Lentiviruses), as are methods for constructing such cell lines. The present invention encompasses any type of vector comprising any of the nucleic acid molecule of the invention and more particularly the vectors capable of directing expression of the peptide encoded by such nucleic acid in a vector-containing cell.
The cells of the invention may be particularly useful for diagnostic purposes and for drug screening (by measuring effect of a compound on expression or activity levels of deoK genes of proteins for instance).
vii) Synthesis of E. coli deoK proteins and functional derivative thereof ;knowledge of E. coli deoK operon gene sequences open the door to a series of applications. For instance, the characteristics of the cloned E.
coli deoK
genes sequences may be analyzed by introducing the sequence into various cell types or using in vitro extracellular systems. The function of E. coli deoK
genes may then be examined under different physiological conditions. The deoK cDNA
sequences may be manipulated in studies to understand the expression of the gene and gene product. Alternatively, cell lines may be produced which overexpress the gene product allowing purification of deoK proteins for biochemical characterization, large-scale production, antibody production, and patient therapy.
For protein expression, eukaryotic and prokaryotic expression systems may be generated in which the deoK operon gene sequences is introduced into a plasmid or other vector which is then introduced into living cells. Gonstructs in which the deoK cDNA sequences containing the entire open reading frame inserted in the correct orientation into an expression plasmid may be used for protein expression. Alternatively, portions of the sequence, including wild-type or mutant deoK sequences, may be inserted. Prokaryotic and eukaryotic expression systems allow various important functional domains of the protein to be recovered as fusion proteins and then used for binding, structural and functional studies and also for the generation of appropriate antibodies. The deoK DNA sequences may be altered by using procedures such as restriction enzyme digestion, DNA
polymerase fill-in, exonuclease deletion, terminal deoxynucleotide transferase extension, ligation of synthetic or cloned DNA sequences and site directed sequence alteration using specific oligonucleotides together with PCR.
Accordingly, the invention also concerns a method for producing a polypeptide involved in E. coli metabolization of 2-Deoxy-D-ribose. The method comprises the steps of: (i) providing a cell transformed with a nucleic acid sequence encoding the polypeptide positioned for expression in the cell; (ii) culturing the transformed cell under conditions suitable for expressing the nucleic acid; (iii) producing the polypeptide; and optionally, (iv) recovering the polypeptide produced.
Once the recombinant protein is expressed, it is isolated by, for example, affinity chromatography. In one example, an anti-deoK polypeptide antibody, which may be produced by the methods described herein, can be attached to a column and used to isolate the deoK proteins. Lysis and fractionation of deoK-harboring cells prior to affinity chromatography may be performed by standard methods.
Once isolated, the recombinant protein can, if desired, be purified further.
Methods and techniques for expressing recombinant proteins and foreign sequences in prokaryotes and eukaryotes are well-known in the art and will not be described in more detail. One can refer, if necessary to Joseph Sambrook, David W. Russell, Joe Sambrook Molecular Cloning: A Laboratory Manual 2.001 Cold Spring Harbor Laboratory Press. Those skilled in the art of molecular biology will understand that a wide variety of expression systems may be used to produce the recombinant protein. The precise host cell used is not critical to the invention. The deoK proteins may be produced in a prokaryotic host (e.g., E. coh) or in a eukaryotic host. These cells are publicly available, for example, from the American Type Culture Collection, Rockville, MD. The method of transduction and the choice of expression vehicle will depend of the host system selected.
Polypeptides of the invention, particularly short deoK fragments, may also be produced by chemical synthesis. These general techniques of polypeptide expression and purification can also be used to produce and isolate useful deoK
fragments or analogs, as described herein.
Skilled artisans will recognize that a deoK polypeptide, or a fragment thereof (as described herein), may serve for various purposes, in diagnostic kits and methods, and for the obtaining of anti-deoK antibodies for instance.
viii) Identification of Molecules that Modulate deoK Proteins Expression deoK cDNAs may be used to facilitate the identification of molecules that increase or decrease deoK genes expression. In one approach, candidate molecules are added, in varying concentration, to the culture medium of cells expressing deoK mRNA. deoK expression is then measured (or capabilities of the cell to metabolize 2-Deoxy-D-ribose), for example, by Northern blot analysis using a deoK cDNA, or cDNA or RNA fragment, as a hybridization probe. The level of deoK expression (or cell metabolizing activity) in the presence of the candidate molecule is compared to the level of deoK expression (or cell metabolizing activity) in the absence of the candidate molecule, all other factors (e.g. cell type and culture conditions) being equal.

Compounds that modulate the level of deoK expression (or cell metabolizing activity) may be purified, or substantially purified, or may be one component of a mixture of compounds such as an extract or supernatant obtained from cells. In an assay of a mixture of compounds, deoK expression (or cell metabolizing activity) is tested against progressively smaller subsets of the compound pool (e.g., produced by standard purification techniques such as HPLC
or FPLC) until a single compound or minimal number of effective compounds is demonstrated to modulate deoK expression (or cell metabolizing activity).
The effect of candidate molecules on deoK-biological activity may, instead, be measured at the level of translation by using the general approach described above with standard protein detection techniques, such as Western blotting or immunoprecipitation with a deoK-specific antibody (for example, the anti-deoK
antibody described herein).
Another method for detecting compounds that modulate the activity of deoK
is to screen for compounds that interact physically with a given deoK
polypeptide.
Depending on the nature of the compounds to be tested, the binding interaction may be measured using methods such as enzyme-linked immunosorbent assays (ELISA), filter binding assays, FRET assays, scintillation proximity assays, microscopic visualization, immunostaining of the cells, in situ hybridization, PCR, etc.
A molecule that decreases deoK activity is considered particularly useful to the invention; such a molecule may be used, for example, as a therapeutic to decrease and/or block proliferation of pathogenic bacteria (see section (v) hereinbefore).
Molecules that are found, by the methods described above, to effectively modulate deoK gene expression or polypeptide activity, may be tested further in animal models. If they continue to function successfully in an in vivo setting, they may be used as therapeutics to prevent or treat bacterial infections.
EXAMPLES
The following examples are illustrative of the wide range of applicability of the present invention and is not intended to limit its scope. Modifications and variations can be made therein without departing from the spirit and scope of the invention. Although any method and material similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred methods and materials are described.
EXAMPLE 1: Cloning and expression of deoxyribose-catalyzing genes in E. coli strains.
Introduction Escherichia coli is a heterogeneous species consisting of both enteric commensal and pathogenic strains. Different types of E. coli cause different diseases in a range of hosts, including extra-intestinal and enteric infections.
Extra-intestinal infections due to E. coli are common in groups of age and can involve almost any organ or anatomical site. Typically extra-intestinal infections include urinary tract infection (UTI), meningitis (mostly in neonates and after neurosurgery), diverse intra-abdominal infections, pneumonia (particularly in hospitalized and institutionalized patients), intravascular-device infection, osteomyelitis, and soft-tissue infection, which usually occurs when the tissue is compromised. Bacteremia can accompany infection at any of these sites (JID
2000, 181:1753; JID 2001,183:596). In 1999, extra-intestinal pathogenic E.
coli strains were the most frequently isolated organisms in US patients receiving antimicrobials (JAMA, 2001, 285: 1565). Bacterial UTI are second in incidence only to those causing respiratory infections. E. coli accounts for up to 90 %
of all UTIs in non-hospitalized patients (5th ed. Williams & Wilkins, Baltimore, Md.1997).
85 to 95 % of uncomplicated cystitis in pre-menopausal women are due to E.
coli strains; they globally represent 150-300 million cases per year in the world (Est. $
6 billion dollars direct cost/ year in US) (JID 2001;183:51). In US, there are at least 250,000 cases of uncomplicated pyelonephritis per year, allowing to 100,000 hospitalizations and an E. coli estimate cost of $ 175 million dollars /year (JAMA, 2001; 283:1583). E, coli is responsible for one third of all cases of neonatal meningitis with an incidence rate of 0.1 per 1,000 live births (JAC 1994, 34 (suppl.
A):61). The extra-intestinal E. coli strains are epidemiologically and phylogenetically distinct from both the commensal and the intestinal pathogenic strains; they appear to be unable of causing enteric disease, but they can stably colonize the host intestinal tract. In contrast, intestinal pathogenic strains of E. coli are rarely encountered in the fecal flora of healthy hosts and, instead, appear to be essentially obligate pathogens, causing gastroenteritis or colitis when ingested in 5 sufficient quantities by a naive host. Various pathotypes of E. coli are responsible for significant worldwide diarrheal disease (to date, six have been well characterized). For example, enteropathogenic E. coli (EPEC) are the leading cause of severe infantile diarrhea in developing countries, and enterohaemorrhagic E. coli (EHEC) (including the well-known 0157:H7) have 10 recently been shown to be the cause of bloody diarrhea and hemolytic-uremic syndrome in major food-borne outbreaks in the United States, Europe, and Asia (CMR 1998, 11:142). Although there is some overlap between certain diarrhoeagenic pathotypes, with respect to virulence traits, each pathotype possesses a unique combination of virulence traits that results in a distinctive 15 pathogenic mechanism. Recent studies have identified other categories of pathogenic E. coli, such as strains isolated from diarrhoeagenic stools of HIV-positive patients, and E. coli that were abnormally predominant in early and chronic ileal lesions of patients with Crohn's disease.
Knowledge of the pathogenic or non-pathogenic status of an isolate may be 20 of use for clinicians for diagnosis, especially in cases of opportunistic pathogens.
Isolation of an E. coli strain from a clinical specimen does not, by itself, confer the designation of pathogenic isolate, since commensal strains of E. coli can cause infections (in particular extraintestinal infections) when the host is compromised.
However, no single virulence factor is limited to (or absolutely required for) infection at any one given site or for any particular syndrome. Consequently, multiple phenotypic and genotypic assays are necessary to identify the pathotype of clinical isolates. The aim was to identify genes encoding functions that are conserved in all pathogenic strains but are absent in commensal E. coli and to use these data to develop new diagnostic and therapeutic tools.
Over the last five years, studies have been published on the E. coli chromosome. The whole genome sequence of the laboratory strain K-12 MG1655 was published in 1997 (Science 1997, 277:1453), and the size of E. coli ?_ 1 chromosome was shown to var~~ from 4.5 to 5.5 megabases (Mb) (1A1 1999, 19:230). Comparative restriction mapping among the chromosome of E. coli K-12, newborn sepsis-associated strain RS218, and uropathogenic strain J96, showed that the overall gene order is conserved in the three strains, that large accessory segments (some carrying virulence genes) are unique to the chromosome of pathogenic strains, and that some segments are only absent from the chromosome of pathogenic strains (1A1 1999, 19:230). Comparison of the E. coli K-12 genome and those of different pathogenic E. coli allowed us to identify the major differences. The genome of E. coli 0157: H7 (EHEC strain EDL933) was recently sequenced (Nature 2001, 409:529). Comparison with the E. coli K-12 reference strain genome confirmed that the two chromosomes share a common 4.1 Mb 'backbone' sequence and lineage-specific segments (specific islands) were found throughout both genomes in clusters of up to 88 kilobases. Roughly 26%
of the EDL933 genome lies completely within these specific islands, and 33% of these contain genes of unknown function. The Genome Center of Wisconsin is currently sequencing the genome of the newborn sepsis-associated strain RS218, the uropathogenic strain CFT073 and three strains belonging to different pathotypes of diarrhoeagenic E. coli [enterotoxigenic E. coli (ETEC), EPEC, and enteroaggregative E. coli (EAEC) (http://genome.wisc.edu)). It will take probably several years before information from the comparison of the pathogenic specific islands of various pathogenic E. coli isolates becomes available.
Most studies on pathogenic E. coli strains concern the identification of specific virulence regions associated with the pathogenesis of E. coli causing various diseases. Virulence genes have been identified, and pathogenicity islands have been characterized and sequenced. The first studies that investigated the relationship between groups of pathogenic and non-pathogenic E. coli strains were based on multilocus enzyme electrophoresis analysis (1A1 1997, 65:2685) and sequencing of housekeeping genes (Nature 2000, 406.64). They suggested that pathogenic isolates do not have a single evolutionary origin within E. coli but that they arose many times and that the high virulence of clones is a recent, derived state resulting from the acquisition of virulence genes rather than an ancestral condition of primitive E. coli.

E. coli strains expressing the K1 polysaccharide colonize the large intestine of newborn infants and are the leading cause of gram-negative septicaemia and meningitis during the neonatal period. A recent study used signature-tagged rnutagenesis to identify E. coli K1 genes that are required for colonization of the gastrointestinal tract, which is one of the initial steps in the development of enteric, urinary and systemic infections caused by E. coli (MM 2000, 37:1293). One of these genes is absent from the genome of E. coli K-12, although related sequences have been found in some representative pathogenic strains (uropathogenic E. coli, EAEC, and EPEC). The sequence of this gene is not available. These data strongly suggest that common (or strongly related) sequences that are absent from the genome of commensal E. coli, are present in all pathogenic E. coli strains.
A comparative analysis of metabolic functions expressed by pathogenic and commensal strains of E. coli was developed. The inventors showed that a sugar (deoxyribose) that is not fermented by E. coli K12, is metabolized by a large number of pathogenic isolates belonging to various pathotypes. The inventors identified the genes encoding this function and demonstrated that they are conserved among several pathogenic strains. They have developed genetic and bacteriological assays to identify deoxyribose-positive E. coli strains.
Materials and Methods Bacterial strains, cosmids, and culture conditions E. coli K-12/MG1655 (Blattner et al., 1997, Science 277:1453-1474) was used as a host for maintaining cosmid clones.
E. coli strains were routinely grown in Luria broth with glucose (10 g of tryptone, 5 g of yeast extract, and 5 g of NaCI per liter (pH 7.0] or on Luria agar plates (containing 1.5 % agar) at 37°C. E. coli-harboring cosmid clones were grown with 100 ~g of carbenicillin per ml.
Collections of human commensal and pathogenic E, coli strains were used in this study. One hundred fifteen E. coli strains were isolated from blood cultures from cancer patients. These strains were previously partially characterized (J. Clin.
Microbiol., 2001, 30:1738; Infect. A Immun., 2000, 68:3983). One hundred E.
coli 2' J
strains were isolated from urine specimen from patients (children and adults) clinically diagnosed with pyelonephritis. They were previously partially characterized and were from various geographical origin (France, USA, Romania).
Thirty six isolates were from urine specimen from patients with cystitis. They were isolated in Romania and USA. Twenty five strains were from the stools of patients with CD4 lymphocyte counts <400 cells/mm presenting persistent diarrhea.
Eleven isolates were from diarrhoeagenic stools of children in Brazil. Commensal E.
coli strains were isolated from normal flora of healthy people in France, Romania, Senegal (children), and Central African Republic.
Expression of deoxyribose-catalyzing genes by E. coli strains.
The capacity of bacteria to grow on a minimal medium (K5) (J Bacteriol 1971, 108:639) supplemented with 2-Deoxy-D-ribose 0,1 % as sole source of carbon was tested by inoculating agar plates with a bacterial suspension and incubating the plates at 37°C for 24 and 48 h. Inoculations of those plates were performed with a loop from a 1 ml bacterial suspension (in water) prepared with a loop of bacteria grown on LB agar plates.
The fermentation (Methodes de laboratoire pour ('identification des enterobacteries, 1e Minor et Richard, Institut Pasteur, p 169) of 2-Deoxy-D-ribose by E. coli strains was tested as follows: a drop (15 ~I) of an overnight culture in LB
broth was inoculated in 3 ml of peptone water containing 1,5% (v/v) of bromothymol blue and 1 % (w/v) of 2-Deoxy-D-ribose in a 12 x 120 mm glass tube.
The suspension was incubated 24 h at 37°C without shaking.
Activity assay: 2-Deoxy-D-ribose is phosphorylated by deoxyribokinase to deoxyribose-5 phosphate which is subsequently cleaved to acetaldehyde and glyceraldehyde-3phosphate by deoxyribose-5P aldolase also called phosphopentose aldolase. Deoxyribose-5P aldolase activity was determined by coupling deoxyribose-5P cleavage to NADH oxidation using glycerophosphate dehydrogenase and triosephosphate isomerase as coupling enzymes. The reaction medium (0.5 ml final volume) contains 50 mM Tris-HCI (pH 7.4); 0.2 mM
NADH; 9U and 3U of glycerophosphate dehydrogenase and triosephosphate isomerase respectively. The reaction was started with crude material extract followed by 1 mM deoxyribose-5Phosphate, then the absorption decrease at 334 nm was monitored with an EppendortT"" PCP6121 photometer thermostated at 30°C. One unit of deoxyribose-5P aldolase corresponds to 1 mole of product formed per minute.
DNA analysis and genetic technigues.
Cosmid libraries were previously constructed from the genomic DNA from E. coli AL862 isolated from the blood of a cancer patient (1A1, 2001;69:937) and from E. coli 55989 isolated from the stools of a patient with persistent diarrhea (C. Bernier, P. Gounon, and C. Le Bouguenec, In press, IAI august 2002). Sau3A
restriction fragments (35 to 50 kb) were sized on a sucrose gradient and ligated to the BamHl-digested and alkaline phosphatase-treated cosmid vector pHC79 (Collins J, 1979, Methods Enzymol., 68:309-326) DNA . The recombinant cosmids pILL1272 and pILL1287 resulted from cloning of DNA from AL862 and 55989 strains, respectively.
Recombinant cosmids were routinely isolated by alkaline lysis. The sequence of the primers to amplify probe A (GenBankT"" AF286671) and probe B
(GenBankT"~ AF286670) were derived from the partial sequence of PAI IA~ss2 (1A1, 2001 69:937, and Erratum in IAI June 2002). The sequences of the primers to amplify probe A were 5'-ATCAGATGCCTAAAGAAGGAGAAAC-3' and 5'-CAATACTCGGATAAGATGATTGC-3' and the size of the amplicon was 831 by (see Figure 4; SEQ 1D N0:11). The sequences of the primers to amplify the probe B were 5'-GGACGATAATGTGATCGTCTATAAG-3' and 5'-GTGGAAGA
TACTCATCTGCTACACG-3' and the size of the amplicon was 816 by (see Figure 5; SEQ ID N0:12). The cycling conditions were initial denaturation at 95°C
for 5 min followed by 30 cycles at 95°C for 30 s, 60°C or 65°C (for amplification of probe A and probe B, respectively) for 30 s, and 72°C for 1 min.
Hybridization.
Bacteria grown for 3 h on nitrocellulose filters were used for colony hybridization. Hybridization was performed under stringent conditions (overnight at 65°C), with PCR products labeled with 32P using the MegaprimeT"" DNA
labeling system (Amersham International) as probes. The 100 ml hybridization solution contained: 2 ml EDTA 0.5M; 20 mg ATP; and 10 ml 20x SSC.
DNA seauencina.
5 Double-stranded DNA was sequenced by Genome Express (France).
Multiple sequence alignments were generated with the CLUSTAL W program.
Statistical analysis Proportions were compared by using the chi-square test.
Results Presence of the deoK operon in the pathogenic E. coli isolates.
While a large number of bacteria are able to use the 2'-deoxyribosyl moiety of 2'-deoxyribonucleosides as carbon and energy sources via the well-known deo-operon, few organisms as Salmonella are able to use 2-Deoxy-D-ribose (dRib) as the sole carbon source through deoxyribokinase which catalyses the ATP-dependant phosphorylation of dRib to dRib-5 phosphate. Recently, the inventors identified in the genome of S. enterica serovar Typhi, not only the gene encoding deoxyribokinase, deoK but a whole operon (deoK operon) of three genes regulated by a repressor DeoQ (J. Bacteriol., 2000, 182:869-873). Searches in databanks showed that this operon was fully represented in one Citrobacter freundii strain and partially present in Agrobacterium tumefaciens, Rhodobacter sphaeroides, and the pathogenic E. coli strain AL862 isolated from a blood culture.
Use of 2-Deoxy-D-ribose by E. coli strains has been previously described (Br.
J.
Biomed. Sci., 1995; 52: 173), however this property was never associated with the pathogenic status of the strains and the genes encoding this function were not identified.
In strain AL862, the sequences similar to the deoK operon corresponded to ORF3', ORF4, ORFS and ORF 6 of the partial (and not continuous) sequence of a pathogenicity island (PAI IA~ss2)(GenBankT"" Nos. AF286670 and AF286671). No function was previously assigned to these sequences. Two probes derived from this PAI IA~862 region (probes A and B) corresponded to the deoK homologous sequences. Analysis of the distribution of PAI IA~as2 among pathogenic E. coli isolates strongly suggested that the A and B regions are widely distributed among pathogenic strains (1A1, 2001, 69: 937-948; IAI June 2002 Errata).
To confirm the presence of the deoK operon in pathogenic E. coli strains, the inventors sequenced again the region of PAI IA~asz that previously showed similarities to the deoK operon of Salmonella. The sequencing was performed on the recombinant cosmid pILL1272 (see Material and Methods). They identified a 4486-pb linear region displaying similarities to the entire deoK operon of Salmonella. Computer analysis revealed four open reading frames (ORF), deoX, deoP, deoK, and deoQ, which mapped to the same loci as had similar sequences to the deoX, deoP, deoK, and deoQ genes from the deoK operon from Salmonella, respectively (See Figure 1 ). These results confirmed that the genetic organization of the deoK operon from E. coli was similar to that of the deoK operon from Salmonella.
The detailed sequence analysis of E. coli - strain AL862 is presented in Figure 2. The deoK operon from E. coli strain AL862 displayed 78 % identity with that from Salmonella (4486 bp14517 bp).
The position and sequence (determined here) of the two probes (probe A
and probe B) that were used in the hybridization experiments are indicated in Figure 2 (single and doubled underline respectively). In both cases, the sequence of the primers used in PCR assays are indicated in bold. These primer sequences are identical to those previously described and used (IAI, 2001, 69:937-948;
IAI
June 2002 Errata). Probes A and B are PCR products obtained from strain AL862.
To study the degree of conservation of the deoK operon among pathogenic E. coli isolates, the inventors determined the nucleotide sequence of the deoK
region in E. coli strain 55989 isolated from the stools of a patient with persistent diarrhea. This isolate was shown to belong to the EAEC pathotype of pathogenic intestinal E. coli. A cosmid library from the genomic DNA of strain 55989 was previously constructed (Bernier et al., In press, IAI August 2002). The recombinant cosmid pILL1287 resulted from the screening of the 55989 cosmid library with both the probe A and the probe B. The sequence of the chromosomal region from strain 55989 that carries the deoK operon is presented in Figure 3.

The deoK operon from E. coli strain AL862 and strain 55989 showed 98%
identity (4486 bp/4489 bp). The degrees of identities of the deo genes from E.
coli and Salmonella strains are summarized in Table 1.
TABLE 1: Degrees of identities of the deo genes from E, coli and Salmonella strains Strains % of identity No. of nucleotides 55989 / AL862 98 % 4489bp/4486bp 55989 / S. Typhi 78 % 4489bp/4517bp AL862 / S. Typhi 78 % 4486bp/4517bp Genes % of identity No. of nucleotides deoX 55989 / AL862 99% 1014bp/1014bp deoX 55989 / S. Typhi75% 1014bp/1014bp deoXAL862 / S. Typhi75% 1014bp/1014bp deoP 55989 I AL862 99% 1317bp/1317bp deoP 55989 / S. Typhi83% 1317bp/1317bp deoP AL862 / S. Typhi82% 1317bp/1317bp deoK 55989 / AL862 99% 921 bp/921 by deoK 55989 / S, Typhi80% 921 bp/921 by deoK AL862 / S, Typhi80% 921 bp/921 by deoQ 55989 / AL862 96% 783bp/783bp deoQ 55989 / S. Typhi77% 783bp/786bp deoQ AL862 / S. Typhi76% 783bp1786bp Expression of the deoK operon in E. coli strains.
The inventors demonstrated the expression of the deoK operon in clinical isolates 55989 and AL862, as well as in the recombinant strain MG1655 carrying either the cosmid pILL1272 or the cosmid pILL1287. All these four strains were able to grow on K5 plates containing 2-Deoxy-D-ribose as a carbon source. The growth of the strains was evident after 48 h of incubation at 37°C. As a negative control, strain MG1655 alone did not grow on such medium. Deoxyribose-5P

aldolase activity, easier to determine than that of deoxyribokinase, is reported in Table 2.
Table 2: Deoxyribose-5P aldolase activity in E. coli strains Strain Deoxyribose-5P aldolase +dR -dR

AL862 0.47 Ulmg 0.06 U/mg 55989 0.45 U/mg 0.08 U/mg K-12 MG1655 (+1272)0.36 U/mg 0.10 U/mg K-12 MG1655 (+1287)0.24 U/mg 0.10 U/mg Analysis of the distribution of deoK operon among commensal and pathogenic E.
coli isolates To determine whether deoK operon sequences were specific for pathogenic E. coli, the frequency of occurrence of the A and B regions (corresponding to parts of deoK and deoX genes, respectively) was investigated. These regions were amplified from strain AL862 DNA and used as probes to screen by colony hybridization collections of E. coli isolates. The strains were also tested for their ability to use 2-Deoxy-D-ribose as a carbon source.
These collections comprised strains representative of the various pathotypes of pathogenic E. coli. Archetypal ExPEC (extraintestinal pathogenic E.
coh~ familiar to investigators in the field include strains CFT073 (pyelonephritis isolate), 536 (pyelonephritis isolate), J96 (pyelonephritis isolate), RS218 (neonatal meningitis isolate). Prototype strains of the various diarrheagenic E. coli pathotypes are also considered: EDL933 (EHEC), EDL1493 (ETEC), E2348/69 EPEC), 042 and JM221 (EAEC), C1845 (diffusely-adherent E. coli (DAEC)). As shown in Table 3, the results indicated that the deoK operon is carried by pathogenic strains belonging to various pathotypes of E. coli and associated with both extra-intestinal and intestinal infections.

Table 3: Frequency of occurrence of the A (deoK) and B (deo~ regions in various E, coli strains E. coli strains Probe Probe Deoxyribose utilization A B

CFT073 (pyelonephritis) + + +

536 (pyelonephritis) + + +

J96 (pyelonephritis) - - -RS218 (meningitis) - - -EDL933 (EHEC) - - -EDL 1493 (ETEC) + + +

E2348/69 (EPEC) - - -042 (EAEC) + + +

JM221 (EAEC) + + +

C1845 (DAEC) - - -The collections studied also comprised clinical isolates from 115 human with septicemia (isolated in France), 100 clinical isolates from patients with pyelonephritis (origin France, USA, Romania), 36 clinical isolates from patients with cystitis (origin USA, Romania), 25 EAEC isolated from HIV-positive patients with persistent diarrhea (origin Central African Republic and Senegal), 11 EPEC
with a diffuse adherent pattern (DA-EPEC) on epithelial cells isolated from infants with diarrhea in Brazil. We also investigated 257 commensal E. coli strains isolated from normal flora of healthy patients (origin France (36), Romania, Senegal, Central African Republic). The results are summarized in Table 4.

Table 4: Percentage of occurrence of the A (deol~ and B (deo~ regions in various E, coli clinical isolates E. coli strains Probe Probe Probe DeoxyriboseProbe A
A + + 2-A B Probe utilizationDeoxy-D-B

(level of ribose significance)utilization Septicemia 49 48 48 50 46 (n = 115) (p<0.0001 ) Pyelonephritis 50 53 48 50 48 (n = 100) (p<0.0001 ) Cystitis (n = 7 10 7 8 7 36) (0.2<p<0.4) Diarrhea (EAEC) 13 13 13 12 12 (n = 25) (p<0.0001 ) Diarrhea (DA-EPEC)11 11 11 11 11 (n - 11 ) (NA) Commensal (France)10 11 10 9 8 (n = 36) Cornmensal ~ NT NT NT 31 NT

(Romania, Senegal, Central African Republic) (n =
221 ) NT, not tested; NA, not appiicaoie.
5 The sensitivity of the two DNA probes appeared equivalent: 43%, and 45%
of the strains were positive with the A and B probes, respectively.
A total of 147 isolates (36 commensal strains and 113 pathogenic E. coli ) were tested for both the growth on K5 plates containing 2-Deoxy-D-ribose and fermentation of this sugar. A 100 % correlation was observed between the two 10 bacteriological tests; all the strains that grew on K5 plates with 2-Deoxy-D-ribose showed the ability to ferment the sugar. The 2-Deoxy-D-ribose utilization test appeared sensitive but, at a small extend, less specific than the genetic detection of the deoK operon (53 % of positive strains). Using both molecular and bacteriological approaches (probe A and growth on K5 plates with deoxyribose) a total of 40.8 % of the strains are positive.
Taking account of all the data, a significant association of the deoK operon with pyelonephritis- and septicemia-associated isolates, as well as with diarrhea associated EAEC isolates was evidenced.
Conclusion This work confirmed that metabolic characters may be specific of E. coli strains and that those expressed by pathogenic isolates may be considered as virulence-associated factors. Utilization of 2-Deoxy-D-ribose by some E. coli isolates has been previously reported. Here, the inventors identified the genes involved in utilization of 2-Deoxy-D-ribose by E. coli strains. These genes are organized in an operon (deoK) that is highly related to that previously identified in Salmonella enterica strains. Analysis of the sequences adjacent to the deoK in several E. coli isolates and in Salmonella strongly suggested that E. coli strains acquired the deoK operon by horizontal transfer from Salmonella strains. The inventors demonstrated that the deoK operon is highly conserved among E. coli strains. From this observation, the inventors defined two probes that were used to study the distribution of the deoK operon among collections of commensal and pathogenic E, coli isolates. Preliminary studies indicated an association of the deoK operon with strains belonging to various pathotypes of E. coli including strains causing pyelonephritis, septicemia, and some type of diarrhea in children.
If 40 to 50% of strains associated with pyelonephritis, septicemia, and diarrhea (EAEC and DA-EPEC strains) carry the deoK operon, we also detected it in 14 to 22 % of commensal isolates. This may be explained by the fact that commensal strains of E. coil can be potential pathogens when the host is compromised. It is interesting to note that the deoK operon is less prevalent in commensal strains from Romania, Senegal and Central African Republic than in French commensal strains.
In conclusion, the inventors have identified a metabolic character significantly associated with some pathogenic E, coil. The inventors have developed bacteriological and molecular tests to identify strains expressing this character. These tests could be associated with others in a future diagnostic kit for the identification of the pathogenic status of an E. coli isolate.
While several embodiments of the invention have been described, it will be understood that the present invention is capable of further modifications, and this application is intended to cover any variations, uses, or adaptations of the invention, following in general the principles of the invention and including such departures from the present disclosure as to came within knowledge or customary practice in the art to which the invention pertains, and as may be applied to the essential features hereinbefore set forth and falling within the scope of the invention or the limits of the appended claims.

2003-07-08 Listage pour 1e BdB corrige.txt SEQUENCE LISTING
(1) GENERAL INFORMATION;
(i) APPLICANT:
(A) NAME: Inst:il:ut Pasteur (B) STREET: 25-:?8 rue' du Docte~ur Roux (C) CITY: Paris (E) COUNTRY: France (F) POSTAL CODE (ZIP): 75724 (ii) TITLE OF INVENTIC)N: Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of E.coli (iii) NUMBER OF SEQUENCES: 1?.
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: RobiC
(B) STRE:E:T': 55 St-J'acqueS
(C) CTTY: ~l~ont,real ( D ) STAT ~; . QC
(E) COUNTRY: Canada (F) ZIP: H2Y 3X<?
{G) TFLEPH~~IVE: 'i19-987-6242 (H) 'fELEc'A.k: 514-895-7874 ( v ) COMPU'1 ER RF~ADABLI=, FORM
(A) MhDTUNi TYPE:: ~?:i.sk 3.5" / 1.44 Ml3 (B) COMPU'CER: Tt=,M ?C compatible {C) (:)J?ERA~C:ING S'~S'fh)M: fC-DOS/MS-DO:, (D) SOFTWARE: T:~'I' ?,SCI
(vi) CURREN'P APPLICAT.CON DATA:
(A) Al?PLIC:ATION 'JCJMEIER: 2.388.945 (B) r':CLING DATE: :32 May 2002 ( 2 ) INFORMATI02J FOR SEQ I L; J() : 1 (i) SEQUEPJCE CHARACTER:CSTICS:
(A) LHNGTH: 4489 nucleotides (B) "..""PE: nucle:_c: ~:xcid (ii) MOLECULE TYPE: D~dA
(vi) ORIGICJ~1L SG(JRCE:
(A) ORGANISM: Escherichia coli (B) STRAIN: 5'i9t39 ( xi ) SEQUENCE DESCRI P'I':I C)PJ : SEQ I D NO : l ggacgataatgtgat:cgtctatangcJgcaacgctatcatagt:cttgtcctg'gcgggtaaa60 aaagcgcgcttaccta ataagcgcgccgctgttcaggccttgagtggttattcaat 120 aacg tcctgtggtgactgt:aaaagtgcclcdt:ttgcr_gcggtgcaacctgaatcagcgtgccatt 180 acgttgcgcggcaactatacc:ccta:a<7gccgacaggttgcaggtaatgcaaaggcggctac 240 ctgttgctctccgt:t:ataaaggatcc::aagc~~Itgtcac:ataattta<Ittcagcactgtagaa 300 acgagtaacaaacgt.agtgccatc:gggagagatcat~g~-gaaactctggctgatctgtata 360 agcgtccagtttgt.cagcaaaga~:uJac.;aat:t:tctggaJ:cat.aaaattccggttgactcag 920 cgtcgacagagaggcatctcCCtgCdfaatccgttgattaaacgccagccactgagcggt 480 gggattaacatgcgaggcactgat:tcacgcaatct:taat:at.t r_<:gtccgggatattctg 540 gctgaatgtagcat.t.tggtatatat-_qr:ataattcatgtggcacatatattgtagtggcat 600 atctacagaagccactattggttar.Jclc:catcataat:atr_c~aacagtgta3gaggatttgtg 660 aaggaccactgttgcrttgagccac~:~t:aatgatgaccgaaacccattacatactcgtaacg 720 Page:

2003- 07-08 BdB corrige.txt Tistage pour 1e ccggttaaggcgtaacatatctc:c,gtctaat.accagc~catget:tcatccatcgcggcaca780 ggccatttcaccgtgtagcagat:gagtat:cttccgcagatgggcagccattagccagcaa840 acctgaatgaaaagcaaaacagccataggtctctatcacctctgtcgccggtttaggctg900 gcgaaacatattgcacatggtgac~gccgt:gt.ccat:caaattgc:gcatc:ccaaatcatctg960 ccccatccagggaagaataatcaaaat:gtcc:ac:gactc3tt.tgcaatttt:aagcccctcgac1020 accgctgtcatagcgaaaagacgi:gacagt.aaaatcactattt.:tccagcaagatacgagg1080 tttctcgccaaaaagcgcccgcc<zcaaat:t:aatacgcgtactc.,at:aacggttctcctcag1140 gacgctgtgacttcagcc::3gtgcc;gt:accttacattgc:tttcac.;gccagaagtagactccg1200 acatagacaaagcagagcatagaaaccaggaatgaaagctgtagtgagtggaacatatct1260 gcaatatatccctgaattgccggaaccaccgcggcaccgacaatagcc:ataacaatgact1320 gctcctgccatttctgtat:gt:tegtt:atcaacagtatccagtctttcct:gcatagatcgtc1380 gcccagcaagggccaaacaaaae,act:taccaggacggr_gacat:agaccgcgctgaaactt1440 ggagccagtgcaacatatgccaggaacagcgcccctataacggaatagagaatcaatact1500 ttttccggattaaaacgcgtcataaggat.gtt:ggctataaact:tc~ccaat:aaagaagcag1560 gcaaagctatagac:catg<3ac~tt:t:gaagcatcacgttcgttgatatcgc~~caactccagc1620 gccagacggatggtaaatgaccatactgc.gacctgcatacccacataaaggaactgcgcc1680 acaataccgcgacc~aaagcgcggatt.tca:agccagat.agcgcaigcgt<it<:cattgctgac1740 gggcgtttatagt~acttc~tctgtc;<~~racattacagc~ti:gggaagcgggttaaaaggaac1800 aacaccatgaccacaaccaaatcataatcatatact.tataccTgttcaagggtgttctct1860 g aacatcagcacctt:aaagt:tgtga,nt:tt:gctcggcgtt:cattcvcggacatc;t:gcttctca1920 aggctttccccctc:ggag<saaaccagatat:t:tgcccaataaaataccagacgcagcacca1980 atcggataaaaggtctgg<.tgatattgagc:cgcaatgtggcat:aggct.tctggaccgatc2040 attgaactgtatgtgttcc~ctgc:agtttcaaggaaactcaggccaatcgc;aatcgcaaaa2100 atagctgcaagga._i::ata<.~tgtactgt:t:gcc:at;atgcga~ggcac~ggaaaaaaagtgtacaa2160 ccaccaatatacagcgtcagccaattaaaattgccaccatat.aactggtctttttaatc2220 g acaagggatgctggtattgcaatt:aaaaaataacctccataaaatgcgctcagcaccaat2280 gctgaagcaaagtt~ctt;~gcgaaaatacact:ttt:gaattgacttgattaat~atgtcattt2340 aatgcagctgcgc~tcccc:atagc:gggaataaacacgataac~aaaataaactggaacaag2400 ggagtcttattcag.stac<:catr._cggcatctgaatgatgtttt.tatcgttcatagtgcta2460 cctttaactgtgca~~gat<~at:tatt.cgti,taaggttaaaaatt.c,attaaai:t:gttcaata2.520 ctcggataagatg,~ttgccttacct tt gtgacgct:gaaacrcggcaaaa<lagagcggct2580 ccc:t tttttcaaagcggcttcaacatc.;cccgctttgaacataataatgggaaaagcaaccaata2640 aatgcgtcaccagc:gccac::tagt,utcaa<::agcat:ttactttgaatgcagctaacatgga<a2700 tcctgatcgcgggt~~atcc:ataatgcgcca:t.tttc:gctcatc~gtaacaat:aatattgtt:c2760 agccctttatcaactaacgaacgt:gcggccaaacgaatatgatcataagt:atcaaccgac2820 ataccggttaatatatccagttct<~r.ttcattcgggataaagaaatcacat:ta gcaggca2880 taagacatatcta:a..-.tcar:gc:aat.g;:~.~:ggagccggatt:taa~aac:acttc::aataccattt2940 ttcttaccaaacti::~atcc7cgtgcat.aaac:.tgtttccac3ttg:3acttccac~tagtaaaacg3000 atcaatttgcattTvttcagatcttctgcagctcgatcgarat.cttccgc~ggaaagaaat3060 ttattcgctccct~::aattatt:aa~atartattgctcgagtt:ggcattaac::~aagatcggt3120 gcaacaccactgc,:ggtacagggr~a::'~~t:tctcaac_-ataagtgqtattaat:t:ccccatgat3180 tcaagattacgaat:agtai.tatccg~caaaaatatcatcacctactttagt:cagcatcagg3240 acttttgaattca<.u~ttacaccgc~gwcac:r.gcttgatt:agcacctttccc:accacatccg3300 attttgaaggcag<~~:gcti:cag<sg-t cctt:.ttt:aggc~atctgattagtgtaagt:a3360 ~~ wtc:t atgagatccaccat~attgc,aaccaataac.tgcaatgt~catttcactacctcttataaac3420 tttcgcataacaat::c~gtat:ttaa:~t;~.~c:att:agcatgt.tact:tttgcatcatttgtgac:t3480 gagatcgcgattac,c:acat:caacc:c~at::gt.Matt taatagactr_ccagtctcatcactc3590 aggccaacactat<~t:aatc:ataagcaacctaacaagattagtgcccaaaactcagcagcc3600 tataccctttcatttcaaagggcycc~gtcgtatagtat.ggr_:.atgaaaac:aatgtttact3660 t aacgccaaaatgti::atttt:tata:~c:~r_t.cttacggagaga~fiagtl:gatgctaa.acgaagc:a3720 aaaagagcgtatccgacgtttgatggaeactgcttaag:~aaa:.cgacagaatccatttgaa3'780 agacgcagcgcgaai:gctcrgaagt_vct.gtaatga,~tattc:;tcgcgatctccatcagga3840 agatgaacct ctgcc,actcaaccci:.-ic:.:t:c;ggv:ggcar_attctt:aai:ggtg~~ataaacccgc3900 gccatccatgcca<xt:aatc:c~atga:gi~t:cc<3aaa<iatc;at.ytgatgactt: acctattgc3960 aattctggctgccggaatggttaatgaaaatgat.r_-.tg~,t.ctt:ctttgatGatggccagga4020 gataccactcgtt<_t:aagcatgat:-:c::;;gg~-~tgcaatc::cctt:caccggc~::t:cagtt:acts4080 acatcgcgtcttt<;i:tgcgtt:gaatca<3aaagcctaatgt:a_~::ag.aatac:t:ttgtggtgg4140 tacgtatcgtgccagaagt.gatgc:tl~tt.tacgatgccagtaactcttcgc:cattagactc4200 tctcaatccgcgaaaaatatttat:ti=c-cgccagcggtgtgcataatcactttggcgtcag42.60 ctggtttaaccctgaagat:cttgcca~t.aagcgt:~iaacxcga':gaaccgtggactacggaa4320 aattttgctcgcccqccacgcgt~:gt!=c:gat_gaag':ggcct:ag.~~cagcrt:cgcaccgat4380 ctctgcatttgacqt_tctgattactcc~atcc~i:ccg~taccggcagattatc_~ttacgcactg4440 ccagaatggttctctt:aaagateat:ta<,acctgat:tcaaa~s;rricg.,~atga 4489 Paste 2 2003-07-~~i8 Listage pour 1e BdEj corrige.txt (2) INFORMATION FOR SEQ TC: NO; 2:
( i ) SEQUE;~IOE CF~ARACTE.',RI STICS
(A) LENGTH: 33~ am:irw acids (B) 'TYPE: amino aci ci ( D ) '"~JPOLOGY : l ine~a:r (ii) MOLECJLE TYPE: protein (xi) SEQUEiVCE DESCRIPTION: SEQ ID N0;2:
Met Ser Thr Arg Ile Asn Le:u Trp Arg Ala Leu Phe Gly G:Lu Lys Pro Arg Ile Leu Leu Glu Asn Sex Asp Phe Thr Val Thr Ser Phe Arg Tyr Asp Se:r Gly Val. GLu Gly Leu Lys Ile A.la Asn Ser Arg Gly His Leu Ile Ile Leu P:ro 'Prp Met Gly Gln Met. Ile Trp Asp Ala Gln Phe Asp Gly His GLy Leu Thr Met Cys Asn Met Phe Arg 65 70 '75 Gln Pro Lys Pro Ala 'rhr GLu 'dal Ile Glu Thr Tyz Gly Cys I'he Ala Phe His Sexy Gly Leu L~.u Al.a Asn Gly C;ys Pra Ser A).a Glu Asp Thr His Leu Leu His G.y "1.u Met ALa Cys Ala Ala Met Asp Glu Ala Trp Leu Glu Leu Asp c~l.y Asp Met Leu Arg Leu Asn Arg Arg Tyr Glu Ty° Val Met G:Ly L?he ~~:Ly His His Tyz :Leu Ala Gln Pro Thr Val Va.Leu His Ly:per Ser Thr lieu Phe Asp Ile Lys Met Ala Val Thz: Asn Leu A'a :ver Val Asp Met Pro Leu Gln Tyr 170 1'75 180 Met Cys His Met Asn Tyr A:_a 'tyr Ile Pro t~sn Ala Thr Phe Ser Gln Asn Ile Pro Asp Glu Ia_e Leu Arg Leu Arg Glu Ser Val Pro Ser His Val Asn Pro Thr A1_a Gln Trp Leu Ala Phe Asn Gln Arg Ile Met Gln Gly Glu Ala Seer Leu Ser Thr Leu Ser Gln Pro Glu 230 23ti 2.40 Phe Tyr Asp Pro Glu Ile Val Phe Phe Ala Asp Lys Leu Asp Ala Tyr Thr Asp Gln Pro Glu Phe Arg Met Ile Ser Pro Asp Gly Thr Pan°

2003-07-08 L:istage pour 1e BdB corric~e.txt Thr Phe Val Thr Arg Phe Tyr Ser Ala G1u Leu Asn Tyr Val Thr Arg Trp Ile Leu Tyr Asn G~y Gl~_z Gln Gln 'Tal Ala A1a Phe Ala Leu Pro Ala Thr_ Cys Arg Pi:o ~;,1u Gly Tyr :~~eu Ala Ala G:Ln Arg Asn Gly Thr Lea Ile Gln V~s.l. A.L~a Pro G~n Gln 'z: hr Arg Thr Phe Thr Va1 Thr Thr G:Ly Ile Gl a ( 2 ) INFORMATION FOR SEQ I U L~,TO : 3 :
(i) SEQUENCE CHARACT~:RISTICS:
(A) .'..:~_'.NGTI-1: 43 . a:ni.no acids>
(B) '1'~'PE: amino acid (D) 'TOPOLOGY: l.im~ar (ii) MOLECC1:~E TYPE: peotr~-~n.
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Met Asn Asp Ly:> Asn I1e IIe Gl.n Met Pro Asp (:,1y Tyr Leu Asn 1 C? 7. 5 Lys Thr Pro Let:c Phe Gln Phe Ile heu Leu Ser Cys Leu Phe Pro Leu Trp Gly Cys Ala Ala A.la L~eu Asn Asp IIe l,eu Ile Thr Gl.n Phe Lys Ser Val Phe Ser Le>u Ser Asn Phe Ala Ser Ala Leu Val Gln Ser Ala Phe Tyr Gly GLy 'Cyr Phe Leu :Ile Ala Ile Pro Ala Ser Leu Val IlELys Lys Thr Ser Ty.r Lys Val A_La Ile Leu Ile Gly Leu Thr Leu Tyr Ile G.~y ~::~l.y Cys Thr L~eu Phe Phe Pro A:La 95 100 7.05 Ser His Met Ala Thr Tyr Thr Met Phe Leu .Ala A'__a :Ile Phe A1a 110 17.5 120 Ile Ala Ile Gly Leu Ser Phe L.eu Glu 'I'hr Ala Ala Asn 'Phr Tyr Ser Ser Met Ile Gly Pro Lys Ala Tyr Ala Thr I,eu Arg heu Asn Ile Ser Gln Thr Phe 'ryr Pro Ile G'__y Ala ;Ill.a Sc~~r c;ly Ile Leu Leu Gly Lys Tyr Leu Val Phe :3er t~Lu Gly ~.:;la Ser heu Glu hys 2003-07-08 Listage pour 1e HdI3 corrig~.txt Gln Met Ser Gly Met Asn A;~a Glu Gln Ile His Asn Phe Lys Val 185 190 1.95 Leu Met Leu Glu Asn Thr I:eu Gl~.i Pro 'Pyr Lys Tyr Met Ile Met Ile Leu Val Va:L Val Met Va.l. Leu Phe Leu Leu Th~~ Ar.g Phe Pro Thr Cys Lys Val Ala Gln Thr Ser Hips Tyr Lys Ar<I Pro Ser Ala Met Asp Thr Leu Arg Tyr Leu A:La Arg Asn Pro Arg Phe Arg Arg 245 250 2.55 Gly Ile Val Ala Gln Phe Leu Tyr Val Gly Met Gln Val Ala Val Trp Ser Phe Th.r Ile Arg L~~u .Ala Leu G _u Leu G.Ly Asp I:Le Asn 275 280 <'?85 Glu Arg Asp Al,a Ser Asn P~~e Met: Va1 Tyr Ser .P.he Ala Cys Phe Phe Ile Gly Ly;_: Phe Ile Al.a .Elsru Ile Leu Met T:hr Arg Phe Asn Pro Glu Lys Va.L Leu Ile L,~_~u 'I'yr Ser Va 1 1~ 1e G.Ly Ala Leu I'he Leu Ala Tyr Va:1 Ala Leu Ala Prc; Ser Phe Ser A.1G Val Tyr Val Ala Val Leu Va:l. Ser Val Lf~~u ahe Gly Pro Cys Trp Al.a Thr ILe Tyr Ala Gly Th:~: Leu As.p T!,.r 'Jal. Asp Asn C~lu ,H:i~. Thr G~.u Met A1a Gly Ala Va:L Ile Val Mrt Ala .I: 1e Va 1. Gi y .A:1 G Ala Val Val Pro Ala Ile Gln Gly Tyr I:Le AI_a Asp M~:et E?he Eli. Ser Le~u G1n Leu Ser Phe Leu Val Ser Met Leu Cys Phe Va1 Tyr Val G1y Val Tyr Phe Trp Arg Glu Ser Lays Val. Arg Thr Ala Leu Ala Glu Val 425 4?~0 935 Thr Ala Ser (2) INFORMATION FOR SEQ ID t4(:): 4:
( i ) SEQUEPdC:E CHARACTE~~R:I,:p'I'IC::>
(A) LENGTH : 30Ei <~~rli rio acids (B) T"pE: ami.no a<:;.d (D) TOPOLC%GY: l_rn~ar 2003-07-C)8 Listage pour ie BdB corrige.txt (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIP'.I'ION: SEQ ID N(7:4:
Met Asp Ile Ala Val Ile G__y Ser Asn Met Val Asp Leu Ile Thr 1 Ci 15 Tyr Thr Asn Gln Met Pro Lys Giu Gly Glu Thr Leu Glu Ala Pro 20 2'e 30 Ala Phe Lys Ile Gly Cys Gly G:ly Lys Gly Ala Asru Gln Ala Val Al.a Ala Ala Lys Leu Asn Seer hys Val Leu Met Ge~.x Thr Lys Val Gly Asp Asp Ile Phe Ala Asp Asn '('hr Ile Arg Asn Leu G.Lu Ser Trp Gly Ile As.n Thr Thr 7'yr Val. Glu Lys Val Pro Cys Thr Ser Ser Gly Val Al~a Pro Tle Prze V<31 Asn Ala Asn Ser Ser Asn Ser Ile Leu Ile Ile Lys Gly Ala .?~sn l.ys Phe Leu Ser Pro Glu Asp 110 1:15 120 Ile Asp Arg Al,a Ala Glu A=;p Leu Lys Lys C:ys Lya Leu Tle Val 125 130 7.35 Leu Gln Leu Glm Val Gln L~=~u. Glu Thr V<~1 Tyr HL> Ala I~.e Glu 140 145 7.50 Phe Gly Lys Lys Asn Gly Ile ~:~l.u Val Leu Leu Asn Pro Al.a Pro 155 160 1.65 Ala Leu Arg Glu Leu Asp M~_~t Ser Tyr Aia Cys Lys Cys Asp Phe 170 1'75 1.80 Phe Ile Pro Asn Glu 'Phr G:Lu Leu Glu Ile Leu Thr Gly Met Ser Val Asp Thr Tyr Asp His I:Le Arg Leu Ala Ala Arg Ser Leu Val 200 205 2:10 Asp Lys Gly Lets Asn Asn I:le Ile Val Thr Met Ser Glu Lys Gly Ala Leu Trp Met Thr Arg Asp Gln Glu Va1 His Val Pro Ala Phe 230 23'p 240 Lys Val Asn Ala Val Asp Thr Ser Gly Ala Gly A.>p Ala Pr:e Ile Gly Cys Phe Sei: His Tyr Tyr_ ~~al Gln Ser G1y Asp Va1 Gl.u A1a Ala Leu Lys Ly: Ala Ala LEe;a !?7e Ala A.la E'he S~e.r 'Ja1 Thr G1y Lys Gly Thr Glr~ Ser Ser Tsr~:~ -?ro rer I.le :'~lu C: n P:ze .As;n C~Lu Paqo 2073-07-f78 I,istace pour 1.e Bd3 corrige.txt Phe Leu Thr Leu Asn G1u (2) INFORMAT2CN FOR SEA TI:) LSO:
(i) SEQUENCE CHARACT1~RIST:fC~:
(A) LENGTH: 261) amino acids (B) 'TYPE: amino amid (D) TOPOLOGY: .. inear (ii) MOLECCJLE 'T'IPE: Li:°<,tvei.n (xi) SEQUENCE D:F~SCRIP'f'ION: SEQ ID N0:5:
Met Glu Thr Lys Gln Lys lxlu Arg Ile Arg Arg Leu Met Glu Leu Leu Lys Lys Thr Asp Arg Ile His I,eu Lys Asp Ala Ala Arg Met Leu Glu Val Ser Va:1 Met Ttrr Tle Arg Arg Asp Leu His Gln Glu Asp Glu Pro Leu Pro Leu Thr heu Leu G1y Gly Tyr_ Ile Val Met Val Asn Lys Pro Ala Pro SEea: Met: Pro Val :Lle His Asp Val Pro Lys Asn His Arg Asp Asp L~eu Pro Ile Ala Ile Leu Ala A.La Gly Met Val Asn Glu Asn Asp Leu Ile Phe Phe Asp Asr:~. Gly G.Ln G1u Ile Pro Leu Va1 Ile Ser Met I1e Pro Asp Ala Ile: 'Thr Phe Thr Gly Ile Cys Tyr Ser His Arg Val Phe Val Al.a Leu Asn Glu Lys Pro Asn Val Thr Ala Ile L~~~~u Cys Gly Gly Thr Tyr Arg Al.a Arg 140 195 x.50 Ser Asp Ala Phe Tyr Asp Ala Ser Asn Ser Ser Prc? Leu Asp Ser 155 160 7.65 Leu Asn Pro Arg Lys Ile Phe Ile Ser Ala Ser Gly Val His Asn His Phe Gly Val Ser Trp Ph.e Asn Pro Gl.u Asp Leu Ala Thr Lys Arg Lys Ala Met Asn Arg G:ly ~eu Arg Lys Ile Leu Leu Ala Arg His A1a Leu Phe Asp Glu Va1 A1a Ser Ala Ser Leu Ala Pro Ile Ser Ala Phe Asl:~ Val heu I 1e :per Asp Arg Pro I,eu Pro Al,a Asp Page 2003-07-()8 Listage pc:ur 1e BdB corrige.txt 230 2.35 240 Tyr Val Thr His Cys Gln P.:~ru Gly Se:r Val Lys Ile Ile Thr Pro Asp Ser Glu Asp Glu (2) INFORMATION FOR SEQ ID NG: 6:
(i) SEQUENCE CHARACT3R.TSTICS:
(A) :LENGTIV: 4486 nucleotides (B) TYPE: nucl~:i c acs d (ii) MOLECULE TYPE: D2dA.
(vi) ORIGINAL Sc7URCE:
(A) ORGANISM: f;;c~erichia coi:i (B) STRAIN: AL8Cs2 (xi) SEQUENCE D°SCRIEe'''1:0N: SEQ IC N0:6:
ggacgataatgtgatcgtcaataagggca:cacgctatc:atagtc~ttgtc:ctggcgggtaaa60 aaaacgcgcttaccttaaa:gataa:gcgcgccgctgttcaggccttgagtggttattcaat120 tcctgtggtgactgtaaa~.gtgcgcgt ctgcc;gt.gcaacctgaatcagcgtgccatt180 tt:c~

acgttgcgcggcaagatac:ccoca ggcc_:gacagqtt.gc:aggl::aatgraaaggcggctac240 ctgttgctctccgttata ggat:cc:vagc:gtgtc<~ca.taa.t~t:tagttcac~::actgtagaa300 ~a acgagtaacaaacgtagtgccats:~gygagagatcatgcgaaactctggctgatctgtata360 agcgtccagtttgtctgc~aagaagacaatttctggatcataaaattccggttgactcag420 cgtcgacagagaggcttct;ccctctc:~:taatccgtt.gattaa:~<:gccagcc:actgagcggt480 gggattaacatgcclaaggc:actc~~~tt:cargcaatctt<zatatt.tcgt<:cc~ggatattct=g540 gctgaatgtagcai:ttggtat:at~3t:c:~ca:ataat.tcatc~i:ggc:.ac~at:ataqtagtggc<~t600 t~:

atctacagaagccagatt~gtaacggcc:atcttaatatcgaacagtgtagaggatttgtg660 aaggaccactgttggctgagccactat.aat:gatgacccaaacccattacatactcgtaacg720 cccgttaaggcgtaacatatctcc~qtctaattccagccatgctetcatc::c:r'.:cgcggcaca'780 ggccatttcaccgi:gtagcagat,tac7tt;~tr.t:t.cr_:acac~at.dr,Iqcagccat:~~<~gccagcaa84 acctgaatgaaaagcaaaacagcc:ataggtctctatc:acct~ct:gtcgccdgtataggctg900 gcgaaacatattgcacat<rgtgaagc:cgt.gtccatcaaattgcgcatcccaaatcatctg960 ccccatccagggaagaat:,iat:ca-a:ct:gt.c:c:acgac:U:a;tt:tgc<:at:tttaactcccctcgac1020 accgctgtcatat c;gaaaaagacgt:ctac<igt:aaaatcactattttccagc<3<3gatacgagg1080 tttctcgccaaaaa:~cgr_c,cgcc_cc:~.iaat:vtaatacgc~<Ltactcvataac:gat.-.tctcctcag1140 gacgctgtgacttcagccaagtgc~3gtacgtactttgctttcac:gccaga<3gtagactccg1200 acatagacaaagcagagcataga_caccaggaatgaaagctgtagtgagtggaacatatct1260 gcaatatatccct:Iaat~t.ccggnac:cs~ccgc:ggc:acc;gac.aatagcc:at:aacaatga<:t1320 c gctcctgccattt::tgtat:gttc~;t.t:aitc:aacagtatccar~tc;ttcctgc:at:agatcgtc1:380 gcccagcaagggc~.aaac<3aaac._,ct aggacggcgacat agaccgc:g<agaaactt1440 t<icc:

ggagccagtgcaac.atatgccag~~~aac:agcgcccctataacgcfaatagagaatcaatact1500 ttttccggattaa<iacgccftcat cac~gat~att.ggctat:aaac.t:tgccaai:aaagaagcag1560 gcaaagctataga::::atg~:3agtt tgaagcatcacctttcctttgatatcgcccaactccagc1620 gccagacggatggt:aaatc,tac:catactgc~gac:ctgcat:acc;:acataaaddaactgcgc:c1680 acaataccgcgacg:aaag<:gcggatttctagccagatagcgc<3gcgtatc~cattgctgac1740 gggcgtttatggtg:acttcJtctgt:gccactttacaggttgggaagcgggt:t:aaaaggaac1800 aacaccatgacca~;..aacca~gaat~:at;:,aatcatata<:ttat<~cctgttcaaciggtgttctct1860 aacatcagcaccttaaagi:tgtg:uat,ttgct:cggcgtt:cattc:ctgac:ai:ct:gcttttca1920 aggctttccccctcggagaaaac~~:agatat:ttgcccaataa~~~aaccag<icgcagcacca1980 atcggataaaaggt~~tggc.:tgatatt:gagecgcaatgtgge~ataggctti:tggaccgatc2040 attgaactgtatgt~~ttrc:xct..gc:e.gtaggaaact:caclgccaatcgc:aatcgcaaaa2100 t.i~ca atagctgcaagga,_~~ata<tt<ttaa~=~c3l::t,c~c:.catatgcgaggcactggaaaaa~<tagtgtacaa21 ccaccaatatacag~~gtcaggcc~:attaaaattgcca<:cttat:aactggt:cattttaat:c2220 acaagggatgctggtatt<3caatta.aaaaataacctccataaaatgcgct:ctgcaccaat2280 gctgaagcaaagttacttagcga,~aatacacttttgaattgagtgattaatatgtcattt2390 Paste 8 2003-07-C~E3 BdB corr:ige.txt f.~istage pour :1e aatgcagctgcgcat:ccccatagcg<~gaataaacacgataacaaaataaactggaacaag 2400 ggagtcttattcaciataccr_atcaggcatctgaatgat.gtttttatcgtt;catagtgcta 2460 cctttaactgtgcac~gatgattat:tc~gtataaggttaaaaattc:attaaat:tgttcaat.a2520 ctcggataagatgatagcgtaces=ti:c_cctgtgacgc2:gaaagcggcaaagagagcggct 2580 tttttcaaagcggcatcaacatcacc~c~ctttgaacataataatgggaaaagcaaccaata 2640 aatgcgtcaccagcc~ccac;tagt,:3t:s.~<~aragcatttar;tttgaatgcagctaacatggac,t2700 tcctgatcgcgggt:catcc:ataat:cacc:Lcc:tttttcgct.catggtaacaat;aatattgttc 2760 agccctttatcaar_i~aacgaacgtgcggccaaacgaat.atgatcataagtatcaaccgac 2820 ataccggttaatat.t~tccagttct:cyt~:t:cattcgggataaac~naatcacatt.tgcaggca2880 taagacatatctaactcac:gc:aatc3~~c~qgagccggatttaataacacttc:aataccattt 2990 ttcttaccaaactc~<~atc<~cgtgtt~3aactgtttc~cagttgaact.t:cc:agttgtaaaacg 3000 atcaatttgcatti:.i~ttcagatctt:~rtgcagctcgatcgatat.cttccg<iggaaagaaat 3060 ttattcgctccctt:<~attattaavatact.attgctcgagtt~3gcattaac:aaagatcggt 3120 gcaacaccactgc!::c~gtac::aggg~,~a;attctcaacataagt:ggtattaat:.t:ccccatgat3180 tcgagattacgaatagtattatc_:gcaaaaatatcatcacctactttagti_agcatcagg3290 acttttgaattcaavttac7ccgc~~:g~car_cgcttgattagcacctttccc:accacatccg 3300 attttgaaggcaggtgctt:.ccag,ugt:ttct:ccttc~ttt:aggr,atctgatt:agtgtaagta 3;360 atgagatccacca~t,3ttg<~aacc~uat;aactgcaatgtccattt cactacc:t_cttataaac3420 tttcgcataacaatggtatataaataacattagcatgttacttttgcatcatttgtgact 3480 gagatcgcgatta~;i;:acat:caac~:cgai~gttt.atttaatagac-ttccagtcttatcactc 3540 aggccaacactat::taatc:ataactcaac;ctaacaggat:t:aataccgaaaat~t:cagcagtc3600 tatacccttttcatttcaaagggt:cggtcgtatagtat~ggt.-3ar_taaaac:aatgtttact 3660 aatgccataatgtt.atttttataacattttacggagagagttgatggaaacgaagcaaaa 3720 agagcgtatccgacgtttgat:tg_uaatact.taagaaaaccgac:agaatccatttgaaaga 3780 cgcggcacgaatg,ctgga<igt:tr_c.t:cttaat:gactatt.<:gtagc:vgatct:cc~at=caggaaga3840 tgaacctctgccactgaccctact:gggtggctatattgt:aatggtgcataaacccgcacc 3900 atccatgccagtaatccaggacgt:tccgagaaatcatc:gtgatgactt.acctattgcaat 3960 tctggccgccggaatggttaatgaaaatgat:ctgatca:t:cttt.gataaat~:~gccaggagat 4020 accgctcgttataagcatgatccc:ggatycaatcacc:ttcactggr_atc=gttactcaca 4080 tcgtgtcttt gttgcgttgaatgaaaaacc:taatgtgar_agcaatactttgtggtggtac 4140 gtatcgtgccagaagtgatgc.~tt.i.t:t:.acc:tatgccagt:aact<a.tcgccatt:agactctct4200 caatccgcgaaaaatattt:atttc.ccaccagc;ggtgta~c~atgat:cactttggcgtcagctg 4260 gtttaatcccgaagatcttgccactaagcgtaaagcgatggcccgtggactaaggaaaat 4320 tttgctcgcccgcc:acgc~:atgt.tcgatgaagtagcctctgc<aagcct:cgc~accgctctc4380 tgcatttgat gttctgattagcgagc.gtccgt:t:accctgcagat;.tatgttacgcactgccg 4440 gaatgcttcgtaaagat~,at t. t:cactaaagacgautga 4486 ttacvacctga (2) INFORMATION FOR SEQ II:7 N0: 7:
(i) SEQUENCE CHARAC'!'i;R.IST.ICS:
(A) LENGTH: 3~'~' domino acic>
(B) TYPE: amine ac:,id (D) TOPOLOGY: :spear (ii) MOLECULE TYPE: p:co.ein (xi) SEQUENCE DESCRIF'iT~~N: SEQ ID NO:7:
Met Ser Thr Arg Ile Asn i_.n_u:: Trp Arg F,~' a f.~eu Fnee G1y Glu L~ys I. ~ ~. 5 Pro Arg Ile Leu Leu Glu F.:=,n. Ser P.sp P:.e Thr ua!. ~'hr Ser Phe 20 <:~~ 30 Arg Tyr Asp Ser Gly Val ~:l.m Gl~Y~ heu hys I1_e P.la Asn Ser Arg 35 =?(i e5 Gly His Leu Ile Ile Leu Pro Trp Met G~.y Gln Mev Ile Trp Asp 50 5!-i 60 Ala Gln Phe Asp Gly His G..y Leu Thr Met Cys Asn Met Phe Arg Pave 9 2003-07-O8 histage poeir1e BdEcorrige.txt GlnProLys PrrrAlaThr G ';!alI GJ.Thr'TyxGly CysPhe 1.,a 1e a 80 8'~ 90 AlaPheHis Se:rGlyLeu h_~uAlaAsn G:LyCysPrc:~Ser ValGlu 95 100 ~05 AspThrHis Le~_iLeuHis Gl.yG1L.Met.Ala(:ysAlaAI_aMetAsp GluAlaTrp Le,zGluLeu A.>p.,1yAsp MetLeuAr_c)Leu AsnGly ArgTyrGlu TyrValMet.Gl_yPheGly HisHi_sTyr:-Leu AlaGln ProThrVa1 Va:LLeuHis hysSerSer Thr7_~euPheAsp ILeLys 155 160 1.65 MetAlaVal ThrAsnLeu A=_aSerVal AspMetPrc-.Leu GLnTyr 170 175 1.80 MetCysHis MetAsnTyr A:LaTyrIle ProAsnAlaThr PheSer GlnAsnIle ProAspGlu I:LeL,euArg LeuArgGlmSer ValPro SerHisVal AsnProThr RiaGl_nTrp LeuA:LaPheAsn GLnArg IleMetGln GlyGluAla :>c~rLeiaSer ThrLeuSerGln ProGlu PheTyrAsp ProGluIle Val.PhePhe ALaAspLysLeu AspAla 295 2~,0 255 TyrThrAsp GlnProGlu PlueArgMet IieSerPrc~Asp GlyThr 260 2E>5 270 ThrPheVal ThrArgPhe TyxSerA:laGl.uLeuFsnTyr Va1Thr ArgTrpIle LeuTyrAsn C:lyG1~~Gl.nGLnValAl..:xA1a PheAla LeuProAla ThrCysArg k'rc>GluG_y TyrLeuAlaAla G.lnArg 305 31.0 315 AsnGlyThr LeL.IleGln V,a:l.AlaPro GLnGlnThr_Arg ThrPhe 320 325 ;330 ThrValThr Tl-~rGlyIle Ca:Ll.i ( 2 ) INFORMATIOI~I FOR. SEQ I 1) I'!0 : 8 :
(i) SEQUE;DICE CHARAC'1'E; I:STICS:
(A) hENGTH: 4 ,t3 amino acids (B) TYPE: aminas a-3cv.i.d (D) TOPOLOGY: ' ira<ear Page '.0 2003-07-08 L~istage pour1e BdBcorrige.txt (ii)MOL ECULE protein TYPE:

(xi)SEQUEN(:E P':CIOt~T; :8:
DESCRI SEQ
ID

MetAsnAsp LysAsnIle I:Le;7 MetP:r Faspu.LyTyr LE.~uAsn n o 5 7.0 7.5 LysThrPro LeuPheGln PheI1_eheuLeu L~er.~.~JSLeu PheI~'ro LeuTrpGly Cy::~AlaAla Ala?~euAsnAsp Il.eLei:Ile TtArGin 35 4~ 45 PheLysSer Va:LPheSer IaE_;a:3erAsnP'~eA1aSerAla LeuVal 50 5.'> 60 GlnSerAla Ph<~TyrGly G 'ryrP:heLeu 7: i~ I ProAla l 1e La 1e y 65 70 'S

SerLeuVal IleLysLys T!-~r,:perTyrLys ValAlaI1_eLeu7:1e GlyLeuThr Le~.rTyrI1e Gl.y~:~'.yCysThr LeuP:ze.~Phe PwoAla SerHisMet A1.3ThrTyr Tr:r!hetPheLeu AlaA1<~ile PheAla 110 1'15 120 IleAlaIle GlyLeuSer F:hc~_LeuGluThr F~7.aAlaA.snThrTyr 125 1:~0 '_35 SerSerMet IleGlyPro hysAiaTyrAia ThrL~uArg LceuAsn 140 145 ~~50 IleSerGln ThrPheTyr ProI:LGlyAla A7.aS2rGly I:l_eI~eu e:.

155 1E~0 165 LeuGlyLys Tyr_LeuVa:LFheSerGluG1y GluSerLeu GluLys 1'70 175 180 GlnMetSer GlyMetAsn A7 G:LiaGlnI HisAsrzPhe LysVal a 1e LeuMetLeu GluAsnThr.LeuGluProTyr I~ysTyrMet I:LeMet IleLeuVal Va:LValMet.Va7.LeuPheLeu LeuThr-Arg PhePro 215 220 'Z25 ThrCysLys Va:LAlaGln ThrSerHisHis -LysArgPro SerAla MetAspThr LeuArgTyr L,euA.laArgAsn ProAr<(Phe ArgArg GlyIleVal AlaGlnPhe L,~~uT ValGly MetGlnVal AlaVal yr TrpSerPhe Th.rIleArg I,euAlaLeuGlu :LeuGlvrAsp I1eAsn GluArgAsp A1;~SerAsn PheMetVa1Tyr SerPheAla CysPhe 2003-07-(:~E3 L~istage pour1e BdBc:orrige.
txt PheIleGly LysPheIle A_aAsnIleLeu MetThrArg PheAsn ProGluLys Va~_LeuIle Lea.x'CyrSerV<i:LLleG:LyAla LeuPhe LeuAlaTyr VaI.Al.aLeu A:LaProSerPhe SerAlaVal TyrVal AlaValLeu ValSerVal L<:uPheGlyPro CysTrpAla ThrIle TyrA1aGly ThwLeuAsp Th.r',7a1AspAsn GluIsisThr GluMet AlaGlyAla Vaa.Il.eVal McaA.laIl.eVal GlyALaAla ValVal ProAlaIle GlnGlyTyr IleAlaAspMet PheH.isSex LeuGln LeuSerPhe LeuValSer M._aLeuC:ysPhe ValT Val G7_yVal yr TyrPheTrp ArgGluSer LysValArgThr AlaLeuAla GluVal Thr Ala Ser (2) INFORMATIOiV FOR SEQ_ IC~ NO: 9:
( i ) SEQUENCE C'?ARACTE:,R1 S'_"I CS
{A) IaGNGTII: 3UFi amino acida {B) :CYPE: amine ;7cid (D) TOPOLOGY: lp_r_ear (ii) MOLECULE T'~PE: pi:r.:tr:in (xi) SEQUENCE DhSCRIP~"I:C?N: SEQ ID NO:.°.:
Met Asp Ile Ala Val Ile G:y Ser Asn Met 'JaJ. Asp heu Ile Thr 10 :15 Tyr Thr Asn Gln Met Pro L~js Glu Gly Glu 'rrr Leu Glu Aia Pro Ala Phe Lys Ile Gly Cys C:,:Ly G1y hys Gl.y Al.a As~a Gln ALa 'Jal Ala Ala Ala Lys Leu Asn Scar Lys Va1 Leu Met Leu Thr Lys Val 50 5'60 Gly Asp Asp Ile Phe Ala A:~L:~ Asn Thr T:ie Arg Asu heu Glu Ser Trp Gly Ile Asn Thr Thr '1'yr Val Glu Lys Val Pro Cys Thr Ser Ser Gly Val Ala Pro Ile Phe Val Asn Ala Asn Ser Ser Asn Ser 95 1. C)0 1.05 2003-07 -08I~ist~age pourle BdBcorr:ige.txt IleLeuIle IleLysGly ALaAsnLysPhe heuSerProGlu Asp IleAspArg AlaAlaGlu Asp!:.~euhysLys O:yshya,LeuI7_eVal 125 130 1.35 LeuGlnLeu GluVal.Gin LeuGluThrVal 'I'yrH:LsAl.aIl.eGlu 140 195 1.50 PheGlyLys LysAsnGly ILeGluValLeu L~euAsnProAl.aPro 155 160 I_65 AlaLeuArg GlnzLeuAsp Met:SerTyrA:laCysLysCysAsp Phe 1'70 115 180 PheIlePro AsnGlu'rhrGLuLeuGluIle LeuThxGlyMet Ser ValAspThr Ty:c:AspHis I .?ergLeuAla AlaArc)SerLeu Val Le AspLysGly LeuAsnAsn Il.e:L:LeVal.'rhrMetS~~rG1_uLys Gly 215 220 2.25 AlaLeuTrp Met.ThrArg A~;p~:LnGluVal HisVaif'roAl.aPhe LysValAsn Al._iValAsp ThrSerGlyAl.aGlyAspAlaPhe Ile GlyCysPhe Ser_HisTyr Ty:rValGlnSer GlyAsiaValG_LuAla AlaLeuLys LysAlaAla LeuPheAl.aAla hheSerValThr Gly LysGlyThr GlnSerSer TyrProSerIle GluG1nPheA.snGlu PheLeuThr LeuAsnGlu (2) INFORMATION FOR SEQ LD N0: 10:
(i) SEQUENCE CIiARACThRIS'PICS:
(A) LENGTH: 30E: amino acids (B) 'TYPE: amino avid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE C)L,SCRIPT~GN: SEQ ID NC3:10:
Met Asp Ile Ala Val Ile G':y Sez Asn Mc~t Jai Ast~ Leu I1e Thr 1C' 15 Tyr Thr Asn Gl~z Met Pro I~ys G1u GI_y Glu Thr L,e G.I_u A1a Pro Ala Phe Lys Ile Gly Cys GL.y Gly Lvs G?~y .~lla Pan Ciln Ala Val 35 4C) 95 2003-07-C3 '~~is"_:age po~:_ir.1e I3clBcorrige.txt AlaAlaAla Lye;LeuAsn Ser,ysVa.LLeu MetLeu'l LysVal hr G1yAspAsp Ile:PheA1 A:>palsnTh.rI7_e~,rgAsnLeu Gl.uSer a 65 70 7~

TrpGlyIle Asr:ThrThr Tsrr'1<a1.C~:l.uLy,>N'alPrc~:ysThrSer SerGlyVal AlaProIle PheValAsnAia AsnSerSer AsnSer 95 i~:?~ 105 IleLeuIle I1<;LysGly A:laAsnLysPhe LeuSerPro GluAsp IleAspArg AlmAlaGlu A:~p:L,euLysLys C'.ysLysLeu I~.eVal LeuGlnLeu GlozValGln L. GluThrVal TyrH A7_aI:LeGlu ~u L:;

PheGlyLys LysAsnGly Il.eGluVal.Leu LeuAsr;Pro A1aPro 155 1.60 165 AlaLeuArg GluLeuAsp MeatSerTyrAla CysLysCys AspPhe PheIlePro AsnGluThr Gl.uLeuGluIle L,eu'rhrGly MetSer ValAspThr TyrAspHis IleArgL,euAla AlaArc;Sex LeuVal AspLysGly LeuAsnAsn I'_eIleValThr MetSerGlu LysGly AlaLeuTrp MetThrArg AspGLnGl.uVal HisValPro AlaPhe LysValAsn AlaValAsp 7'h~:SerGl.yA:laGlyAspAla P:helle GlyCysPhe Se:rHisTyr TyrValGl.nSer Gl.yAspVal GluAla AlaLeuLys LysAlaAla I:E=u.PheAlaAla PheSerVal ThrGly 2.75 280 285 LysGlyThr GlnSerSer TyrPr<>SerI GluGl.nPhe AsnGlu ~e 290 2.95 300 PheLeuThr LeuAsnGlu ( 2 ) INFORMATI01\! FOR SEQ I D NC): 11 (i) SEQUEI~ICE CHARACTERISTICS:
(A) LENGTH: 8'~4 nucLeot~.ide,>
(B) TYPE: nucle~:i.c: acid ( i i ) MOLEC'.LILE TYPE : C>NA

2003-07-C'_'s histage poszr 1e BdB c:orrige.txt (vi) ORIGINF~L SOURCE: lsc:herichia coli ( xi ) SEQUENCE DESCRI P'l.' LC)N : S EQ I D N0 : 1 1 caatactcggataactatgattgccttacctttccctgtgacgcagaaagcggcaaagagag 60 cggcttttttcaaagcggcttca<ccat:caccgctttgaacat aataatgggaaaagcaac 120 caataaatgcgtc<~c:cagcgccar:t<~cJt:atcaacagcatttactttgaat:gcaggaacat 180 ggacttcctgatc<Jc:gggt:catcc:ai:~~atg<:gcctttttcgctcatggtaacaataatat 2.40 tgttcagccctttat:caact=aaccJaac;gtgcggcc:aaacgaatatgatcat:aagtatca.a300 ccgacataccggttt~atat:ttcc~igi:t_<agt:ttcattcgggataaagaaat: cacatttgc360 aggcataagacatat:ctaactca<:gc:.aatgccggagccggat:ttaataac:acttcaatac 420 catttttcttacca.aactcaatcgcgtggtaaactgt?-tccagttgaactt:ccagttgta480 aaacgatcaattt<Jcattt:tttcrigat:ctr.ctgcagctcgatcgatatctt:ccggggaaa540 gaaatttattcgct:cccttaattati_aatatacta"~tgct,,:,~t:gttggc~c't:taacaaaga600 tcggtgcaacaccacagctggtac,~gc~ggactttctcaacata.agtggtat:taattcccc660 atgattcgagattac:gaatgta':t,~;:~cgcaaaa;~tatca'~c a:~ctact,t:t.agttagc;a720 a tcaggacttttgaai:tcaactttacJcc:~c:cgc<:ac~~gct..t:gat:tac~cacctt:t:.cccaccac780 atccgattttgaacxgcaggtgctt~:~c~agagtttc;:cctt:ct'Ytaggcatc:t:gat 8:34 ( 2 ) INFORMATIOt~I FOR SEQ IC~ 1v0: 12 ( i ) SEQUEtVC:E CHARACTL,ft . STI CS
{A) LENGTH: 81~= !m.ic7_e~otides {B) '1"fPE: nucleic acid ( i i ) MOLECiJ::~E TYPE : Dl>IA
(vi) ORIGIN~~L SOURCE: I_,scher.ichia ca7.i.
{xi) SEQUE19CE DESCRIP'I'I~DiV: SEQ ID N0:7.2:
ggacgataatgtg,_~rcgtc::tata,~q;Jgcaacgctatcatagtcatgtcct:ggcgggtaaa 60 aaaacgcgcttaccttaa<:gata~~~g.~.gcgccgctgttc:aggccttgagt.<~gttattcaat 120 tcctgtggtgact~ataaaagtgc~:~cqtttgctgcggtcJcaa :cvtgaatcac~cgtgccat:t180 acgttgcgcggcaagatac:cc:ct~::ag:~<:cgacaggttgc:aggt:aatgcaaaggcggctac 240 ctgttgctctccgt:tata~~aggatccagcqtgtcacat:aa-tt agttcagc~actgtagaa300 acgagtaacaaac:Jtagtgccat.:gcx:~agagatcatgcgaasc:t~ctggctgatctgtata 360 agcgtccagtttgt~tgct3aagaagac ttct:ggat:c:a!:aar.aattcccJgttgactcag 420 aat cgtcgacagagag;Jcttct:ccct.~fc:ataatccgttgattaaacgccagcc::actgagcggt 480 gggattaacatgc;fiaagg~actg=u.t caatctt<iatatt:tcgtccgcJgatattctg540 c<~cg gctgaatgtagcat:ttggn:atat:~stgcat:.aat.tcatgt:ggcac:atatat?:dt:agtggcat600 atctacagaagccagatt<;gttac:ggccatct.taatat=cgaac:agtgtac4aggatttgtg 660 aaggaccactgttc~gctg<igccac~~ataatgat:gaccgaaaccc:attaca'_actcgtaacg '720 cccgttaaggcgtaacata-itctccgtctaattccagrcatgcttcatcc~itcgcggcaca 780 ggccatttcaccgi:gtagc:agat_c~~agtatc:ttc:cac 816 PacJee 1. S

Claims (39)

1. A method for evaluating pathogenicity of a strain of E. coli, comprising the step of assaying a metabolic activity of said strain.
2. The method of claim 1, wherein said metabolic activity consists of metabolization of 2-Deoxy-D-ribose.
3. The method of claim 1 or 2, wherein said assessment comprises growing said strain on a minimal medium comprising 2-Deoxy-D-ribose as a sole source of carbon.
4. A method for determining likelihood of pathogenicity of a strain of E.
coli, comprising:
- assaying deoxyribokinase enzymatic activity of said strain; and/or - assaying said strain for the presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose;
wherein ability of said strain to metabolize 2-Deoxy-D-ribose and/or presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose is indicative of a higher likelihood that said strain of E. coli is pathogenic as compared to a commensal strain.
5. A method for identifying a pathogenic strain of E. coli, comprising:
- assaying deoxyribokinase enzymatic activity of said strain; and/or - assaying said strain for the presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose (autres deoxyribose??);
wherein ability of said strain to metabolize 2-Deoxy-D-ribose and/or presence of genes or proteins involved in metabolization of 2-Deoxy-D-ribose is indicative that said strain of E. coli is pathogenic.
6. The method of claim 4 or 5, wherein said genes or proteins consists of genes or proteins from operon deoK.

34.
7. The method of any one of claims 4 to 6, comprising assaying said strain for the presence of a nucleic acid sequence selected from the group consisting of:
a) sequences provided in part or all of SEQ ID NO: 1 or 6;
b) complements of the sequences provided in part or all of SEQ ID NO: 1 or 6;
c) sequences consisting of at least 20 contiguous residues of a sequence provided in SEQ ID NO: 1 or 6;
d) sequences that hybridize to part or all of nucleic acids of SEQ ID NO: 1 or 6, under moderately, preferably high, stringent conditions;
e) sequences having at least 80% identity to part or all of SEQ ID NO: 1 or 6;
f) degenerate variants of a sequence provided in part or all of SEQ ID NO: 1 or 6;
and g) sequences encoding part or all of polypeptides provided in SEQ ID NO: 2-5 and 7-10.
8. The method of claim 7, wherein said nucleic acid sequence is selected from the group consisting of:
a) a nucleotide sequence having at least 80% nucleotide sequence identity with part or all of SEQ ID NO: 1 or 6; and b) a nucleotide sequence having at least 80% nucleotide sequence identity with a nucleic acid encoding any of SEQ ID N0:2-5 and 7-10.
9. The method of claim 8, wherein said nucleic acid sequence is selected from the group consisting of:
a) a sequence substantially the same to part or all of SEQ ID NO: 1 or 6; and b) a sequence substantially the same to a nucleic acid encoding part or all of any of SEQ ID NO:2-5 and 7-10.
10. The method of claim 9, wherein it comprises a sequence selected from the group consisting of:
a) a sequence having 100% identity with SEQ ID NO: 1 or 6;

b) a sequence having 100% identity with a nucleic acid encoding any of SEQ ID
NO:2-5 and 7-10.
11. The method of any one of claims 4 to 6, comprising assaying said strain for the presence of a polypeptide comprising an amino acid sequence selected from the group consisting of:
a) sequences encoded by a nucleic acid as defined in claim 7;
b) sequences having at least 80% identity to part or all of any of SEQ ID NO:2-and 7-10;
c) sequences having at least 85% homology to part or all of any of SEQ ID NO:2-and 7-10; and d) sequence provided in part or all of any of SEQ ID NO:2-5 and 7-10.
12. The method of claim 11, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of sequences substantially the same as any of SEQ ID NO:2-5 and 7-10.
13. The method of claim 12, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of sequences 100% identical to any of SEQ ID NO:2-5 and 7-10.
14. The method of any one of claims 4 to 6, comprising assaying, under suitable culture conditions, capabilities of said strain to metabolize 2-Deoxy-D-ribose.
15. The method of claim 14, comprising growing said strain on a minimal medium comprising 2-Deoxy-D-ribose as a sole source of carbon.
16. The method of claim 15, wherein said minimal medium comprises about 0.1 % 2-Deoxy-D-ribose.
17. The method of claim 15 or 16, wherein said strain is cultured in said minimal medium for about 24h to about 48h.
18. An isolated or purified nucleic acid molecule comprising a sequence selected from the group consisting of a) sequences provided in part or all of SEQ ID NO: 1 or 6;
b) complements of the sequences provided in part or all of SEQ ID NO: 1 or 6;
c) sequences consisting of at least 20 contiguous residues of a sequence provided in SEQ ID NO: 1 or 6;
d) sequences that hybridize to part or all of nucleic acids of SEQ ID NO: 1 or 6, under moderately, preferably high, stringent conditions;
e) sequences having at least 80% identity to part or all of SEQ ID NO: 1 or 6;
f) degenerate variants of a sequence provided in part or all of SEQ ID NO: 1 or 6;
and g) sequences encoding part or all of polypeptides provided in SEQ ID NO: 2-5 and 7-10.
19. The nucleic acid of claim 18, wherein it comprises a sequence selected from the group consisting of:
a) a nucleotide sequence having at least 80% nucleotide sequence identity with part or all of SEQ ID NO: 1 or 6; and b) a nucleotide sequence having at least 80% nucleotide sequence identity with a nucleic acid encoding a polypeptide provided in SEQ ID NO: 2-5 and 7-10.
20. The nucleic acid of claim 19, wherein it comprises a sequence is selected from the group consisting of:
a) a sequence substantially the same to part or all of SEQ ID NO: 1 or 6; and b) a sequence substantially the same to a nucleic acid encoding part or all of any of SEQ ID NO: 2-5 and 7-10.
21. The nucleic acid of claim 20, wherein it comprises a sequence selected from the group consisting of:

a) a sequence having 100% identity with SEQ ID NO: 1 or 6;
b) a sequence having 100% identity with a nucleic acid encoding any of SEQ ID
NO:2-5 and 7-10.
22. An isolated or purified nucleic acid molecule comprising a sequence encoding a E. Coli polypeptide involved in metabolization of 2-Deoxy-D-ribose, or degenerate variants thereof, wherein said E. coli polypeptide or degenerate variant comprises part or all of SEQ ID NO:2-5 and 7-10.
23. An isolated or purified protein comprising an amino acid sequence selected from the group consisting of:
a) sequences encoded by a nucleic acid as defined in claim 7;
b) sequences having at least 80% identity to part or all of any of SEQ ID NO:2-and 7-10;
c) sequences having at least 85% homology to part or all of any of SEQ ID NO:2-and 7-10; and d) sequence provided in part or all of any of SEQ ID NO:2-5 and 7-10.
24. The protein of claim 23, wherein it comprises an amino acid sequence selected from the group consisting of sequences substantially the same as any of SEQ ID NO:2-5 and 7-10.
25. The protein of claim 24, wherein it comprises an amino acid sequence selected from the group consisting of sequences 100% identical to any of SEQ
ID
NO:2-5 and 7-10.
26. An isolated or purified protein involved in E. Coli metabolization of 2-Deoxy-D-ribose, or degenerate variants thereof, wherein said protein or degenerate variant comprises part or all of any of SEQ ID NO:2-5 and 7-10.
27. An isolated or purified antibody that specifically binds to a protein as defined in any one of claims 23 to 26.
28. The antibody of claim 27, wherein said antibody consists of a monoclonal or of a polyclonal antibody.
29. A cloning or expression vector comprising the nucleic acid of any one of claims 18 to 22.
30. The vector of claim 29, wherein said vector is capable of directing expression of the peptide encoded by said nucleic acid in a vector-containing cell.
31. A transformed or transfected cell that contains the nucleic acid any one of claims 18 to 22.
32. The cell of claim 31, wherein said cell consists of a Escherichia coli bacterium.
33. The cell of claim 31, wherein the Escherichia coli bacterium is selected from the group consisting of Escherichia coli bacteria filed at the CNCM under accession numbers I-2867 and I-2867 on May 14, 2002.
34. A nucleotide probe comprising a sequence of at least 15 sequential nucleotides of SEQ ID NO: 1 or 6, or of a sequence complementary to SEQ ID
NO: 1 or 6.
35. The probe of claim 30, wherein it consists of SEQ ID NO: 11 or 12.
36. A kit for identifying a pathogenic strain of E. coli, comprising the antibody of claim 27 or 28; or the probe according to claim 34 or 35; and at least one element selected from the group consisting of instructions for using said kit, reaction buffer(s), and enzyme(s).
37. A kit for identifying a pathogenic strain of E. coli, comprising means for assaying capabilities of said strain to metabolize 2-Deoxy-D-ribose.
38. The kit of claim 37, wherein said kit comprises a minimal culture medium with 2-Deoxy-D-ribose as a sole source of carbon.
39. A method for producing a polypeptide involved in E. coli metabolization of Deoxy-D-ribose, comprising:

- providing a cell transformed with a nucleic acid sequence encoding said polypeptide positioned for expression in said cell;

- culturing said transformed cell under conditions suitable for expressing said nucleic acid; and - producing said human polypeptide.
CA002388445A 2002-05-31 2002-05-31 Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of e. coli Abandoned CA2388445A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CA002388445A CA2388445A1 (en) 2002-05-31 2002-05-31 Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of e. coli

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CA002388445A CA2388445A1 (en) 2002-05-31 2002-05-31 Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of e. coli

Publications (1)

Publication Number Publication Date
CA2388445A1 true CA2388445A1 (en) 2003-11-30

Family

ID=29783844

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002388445A Abandoned CA2388445A1 (en) 2002-05-31 2002-05-31 Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of e. coli

Country Status (1)

Country Link
CA (1) CA2388445A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105886595A (en) * 2016-04-28 2016-08-24 夏云 Method for rapidly detecting proteolysis bacteria in human excrement

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105886595A (en) * 2016-04-28 2016-08-24 夏云 Method for rapidly detecting proteolysis bacteria in human excrement

Similar Documents

Publication Publication Date Title
AU735444B2 (en) (Enterococcus faecalis) polynucleotides and polypeptides
Sokurenko et al. Quantitative differences in adhesiveness of type 1 fimbriated Escherichia coli due to structural differences in fimH genes
JP3368268B2 (en) Universal eubacterial nucleic acid probe and method
Gough et al. hrp genes of Pseudomonas solanacearum are homologous to pathogenicity determinants of animal pathogenic bacteria and are conserved among plant pathogenic bacteria
AU700752B2 (en) Nucleic acid probes for detecting E. coli 0157:H7
US8354500B2 (en) Cytolethal distending toxins and detection of campylobacter bacteria using the same as a target
CN111020041B (en) 16 different serotype salmonella specific new molecular targets and rapid detection method thereof
Chang et al. Cloning and sequence analysis of a novel hemolysin gene (vllY) from Vibrio vulnificus
Kageyama et al. Emendation of genus Collinsella and proposal of Collinsella stercoris sp. nov. and Collinsella intestinalis sp. nov.
EP0821735A1 (en) Helicobacter pylori cagi region
JPH05504672A (en) Polynucleotide probes, methods and kits for the identification and detection of Gram-negative bacteria
US7601822B2 (en) Molecular identification of bacteria of genus Streptococcus and related genera
JPH03505974A (en) Nucleotide sequences of the order Actinobacteria, application to the synthesis or detection of nucleic acids, expression products of such sequences and application as immunological compositions
CA2388445A1 (en) Genetic markers, metabolic markers, and methods for evaluating pathogenicity of strains of e. coli
JPH08503609A (en) Pathogenic-specific bacterial DNA sequences
EP1878439A2 (en) Actinobacillus pleuropneumoniae virulence genes
KR20110007539A (en) Primer and probe for detection of streptococcus oralis and method for detecting streptococcus oralis using thereof
Momynaliev et al. Characterization of the Mycoplasma hominis ftsZ gene and its sequence variability in mycoplasma clinical isolates
AU770915B2 (en) Enterococcus faecalis polynucleotides and polypeptides
EP2324052B1 (en) Marker of streptococcus anginosus / streptococcus constellatus (moac) and uses thereof
WO1997001647A2 (en) Dna sequences for identifying highly transmissible lineages of pseudomonas (burkholderia) cepacia
CN113583991A (en) Amylosucrase SaAS and coding gene and application thereof
AU760154B2 (en) Antigens and their detection
De Smidt et al. Genetic organisation of the capsule transport gene region from Haemophilus paragallinarum
Wren et al. DNA Probes and PCR Analysis in the Detection of Clostridium difficile and Helicobacter pylori

Legal Events

Date Code Title Description
FZDE Dead