CA2387391A1 - Hu antigen-derived peptides and uses thereof - Google Patents

Abstract

The present invention relates to Hu antigen-derived peptides and to their use, and more particularly to their use in the diagnostic, in the prevention and in the treatment of certain types of cancer and neuronal damage. The immunogenic peptides of the invention are capable of generating cytotoxic CD8 T-lymphocytes (CTLs) which may eliminate undesirable cells such as SCLC cancerous cell, without reacting against non-cancerous such as neural cells. The invention also provides nucleotides coding these immunogenic peptides and antibodies binding thereto.

Description

'~ I I''' ~'.~.,L. III ~ ~~

t HU ANTIGEN-DERIVED PEPTIDES AND USES THEREOF
BACKGROUND OF THE INVENTION
AAA Field of the invention The present invention relates to Hu antigen-derived peptides and to their use, and more particularly to their use in the diagnostic, in the prevention and in the treatment of certain types of cancer and neuronal damage.
B) Brief description of the prior art The term Hu antigen refers to a family of predominantly nuclear proteins family (35-40 kDa) normally expressed in all neurons of the central and peripheral nervous system, but not in other cell types, with the possible exception of the testes (Posner and Dalmau, 1997).
Hu proteins are also expressed in a number of tumors including al) small-cell lung cancers and about 70% of neuroblastomas, in addition to occasional other tumors, including sarcoma and prostate carcinoma (Dalmau et al, 1992).
The exact function of Hu proteins in neurons and their role in the cancers in which they are expressed is unknown.
Anti-Hu syndrome is associated with CD8 T-cell infiltrates, in both lung cancer and the nervous tissues. The nucleoprotein HuD, expressed in both tumor cells and neurons, potentially constitutes a target for auto-reactive T-cells.
There is therefore a need for Hu antigen-derived peptides that could be used for the diagnostic of a cancer in a mammal, particularly in humans, and also for inducing a immune response against cancerous cells. More particularly, there is a need for cytotoxic CD8 T-lymphocytes (CTLs) capable of targeting the cancerous cell of a mammal without inducing an immune response against non-cancerous cells of the mammal.
The present invention fulfils these needs and also other needs which will be apparent to those skilled in the art upon reading the following specification.

!i i I; ,I ,i~ t AI ~ i i t ' SUMMARY OF THE INVENTION
The present invention relates to Hu antigen-derived peptides.
More particularly, the invention provides immunogenic peptides capable of generating cytotoxic CD8 T-lymphocytes (CTLs) so that these cells eliminate undesirable cells such as SCLC cancerous cell, without reacting against non-cancerous such as neural cells.
The invention also provides nucleotides coding the immunogenic peptides and antibodies binding specifically thereto.
The invention further relates to pharmaceutical compositions and to methods for inducing/stimulating of an immune response into a mammal.
The invention also provides methods for purifying anti-Hu CTL cells and methods for treating a mammal suffering of paraneoplastic neuropathy using these cells.
The invention is also concerned with methods for selecting therapeutic molecules capable of inducing an immune response in vivo .
An advantage of the present invention is that it allows to generate CTLs directed against HuD peptides, in vivo and in vitro. This is very interesting since CTLs that are potentially harmful to self are usually eliminated or tolerated.
Other objects and advantages of the present invention will be apparent upon reading the following non-restrictive detailed description, made with reference to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A, 1B and 1C are graphs showing the induction of CTL against HuD
and control FLU peptide in PBMC from normal human blood donors. CD8 T cells from HLA A*0201 individuals were stimulated by autologous mDC pulsed with HuD-derived synthetic peptides as detailed in materials and methods. Fig. 1A:
Results refer to effector cells from one donor immunized in vitro against p86.
Fig. 1 B: Results refer to effector cells from one donor immunized in vitro against p248. Fig. 1C: Results refer to effector cells from one donor immunized in vitro against FLU peptide. X axis refers to Effector to Target ratio on an individual l~ J~ JI ~J Vi I , II , t ~
S

basis, Y axis to percentage of 5'Cr release calculated as specified in materials and methods.
Figure 2: Shows the reading frame of the nucleotide sequence of HuD (SEQ ID
N0:1; M62843) and the corresponding deduced amino acid sequence HuD (SEQ
ID N0:2) from which Htr4 A2.1 peptides are obtained.
Figure 3: Shows the amino acid sequence of the HuD peptides (SEQ ID NOs:3 15) and, for each of these peptides, one of the many possible nucleotide sequences for encoding these peptides (SEQ ID NOs:19-31).
DETAILED DESCRIPTION OF THE INVENTION
A1 Definitions In order to provide an even clearer and more consistent understanding of the specification and the claims, including the scope given herein to such terms, the following definitions are provided:
The term "analog" as is generally understood and used herein, refers to a peptide that is substantially similar in function to the peptides of the invention.
Antibody : refers to a glycoprotein produced by lymphoid cells in response to a stimulation with an immunogen. Antibodies possess the ability to react in vifro and in vivo specifically and selectively with an antigenic determinant or epitope eliciting their production or with an antigenic determinant closely related to the homologous antigen As used herein, a protein/peptide is said to be a "chemical derivative" of another protein/peptide when it contains additional chemical moieties not normally part of the protein/peptide, said moieties being added by using techniques well known in the art. Such moieties may improve the proteinlpeptide solubility, absorption, bioavailability, biological half life, and the like.
Any undesirable toxicity and side-effects of the proteinlpeptide may be attenuated and even eliminated by using such moieties. For example, proteins/peptides can be covalently coupled to biocompatible polymers (polyvinyl-alcohol, polyethylene-glycol, etc) in order to improve stability or to decrease/increase their antigenicity.

. p; ~,~,1 ,i~ . ~I

r Derived: A protein/peptide is said to "derive" from a protein/peptide or from a fragment thereof when such protein/peptide comprises at least one portion, substantially similar in its sequence, to the native protein/peptide or to a fragment thereof.
EL4S3 Rob mouse: Refers to mouse deposited at the CNCM under number I-258 (December 1,2000) which characteristics have been described in the J. Exp. Med, vol. 185, number 12, June 16, 1997,pp 2043-2051.
Fragment: refers to a section of a molecule, such as protein/peptide or nucleic acid, and is meant to refer to any portion of the amino acid or nucleotide sequence.
A "functional derivative", as is generally understood and used herein, refers to a protein/peptide sequence that possesses a functional biological activity that is substantially similar to the biological activity of the whole protein/peptide sequence. A functional derivative of a proteinlpeptide may or may not contain post-translational modifications such as covalently linked carbohydrate, if such modification is not necessary for the performance of a specific function. The term "functional derivative" is intended to the "fragments", "segments", "variants", "analogs" or "chemical derivatives" of a proteinlpeptide.
Fusion protein: A protein formed by the expression of a hybrid gene made by combining two gene sequences. Typically, this is accomplished by cloning a cDNA into an expression vector in frame with an existing gene.
HHD mouse: Refers to a transgenic mouse deposited which characteristics have been described in the European Journal of Immunology (1999), 29:3112-3121.
Immunogenic: Refers to the property of a molecule or compound, such as a protein/peptide to induce in vivo or in vitro a cellular or humoral immune response.
Immune response: Refers to an in vivo or in vifro reaction in response to a challenge by an immunogen. An immune response is generally expressed by an antibody production and/or a cell-mediated immunity or immunologic tolerance.

Isolated or Purified: Means altered "by the hand of man" from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide naturally present in a living organism is not "isolated", the same polynucleotide separated from the coexisting 5 materials of its natural state, obtained by cloning, amplification and/or chemical synthesis is "isolated" as the term is employed herein. Moreover, a polynucleotide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated" even if it is still present in said organism.
Oligonucleotides means nucleic acid, either desoxyribonucleic acid (DNA), or ribonucleic acid (RNA), in single-stranded or double-stranded form and any chemical modifications thereof. Such modifications include, but are not limited to providing other chemical groups that incorporate additional charge, polariZability, hydrogen bonding or electrostatic interaction to one or more of nucleic acid bases of the oligonucleotide. Examples of modifications are, but are not limited to, modifying the bases such as substitution of 5-bromouracil, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, 2'-position sugar modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine, backbone modifications, 3' and 5' modifications such as capping, and the like.
Are also compatible with the current invention, modifications that occur after each round of amplification in a reversible or irreversible manner.
The term "peptide" herein includes any natural or synthetic compounds containing two or more amino acids. Therefore, it comprises proteins, glycoproteins, and protein fragments derived from pathogenic organisms such as viruses, bacteria, parasites and the like, or proteins isolated from normal or pathogenic tissues, such as cancerous cells. It also includes proteins and fragments thereof produced through recombinant means that has been associated or not with other peptides coding for tumoral, viral, bacterial or fungic epitopes for forming a fusion protein. As used herein, the term "polypeptide"
refers to a more complex peptide, i.e. a peptide with an amino acid sequence including two or more peptides or a peptide comprising two or more peptides fused together.
Polynucleotide: Any DNA, RNA sequence or molecule having one nucleotide or more, including nucleotide sequences encoding a complete gene.
The term is intended to encompass all nucleic acids whether occurring naturally or non-naturally in a particular cell, tissue or organism. This includes DNA
and fragments thereof, RNA and fragments thereof, cDNAs and fragments thereof, expressed sequence tags, artificial sequences including randomized artificial sequences.
The term "variant" as is generally understood and used herein, refers to a protein that is substantially similar in structure and biological activity to either the protein or fragment thereof. Thus two proteins are considered variants if they possess a common activity and may substitute each other, even if the amino acid sequence, the secondary, tertiary, or quaternary structure of one of the proteins is 7 5 not identical to that found in the other.
Vector: A self-replicating RNA or DNA molecule which can be used to transfer an RNA or DNA segment from one organism to another. Vectors are particularly useful for manipulating genetic constructs and different vectors may have properties particularly appropriate to express proteins) in a recipient during cloning procedures and may comprise different selectable markers. Bacterial plasmids are commonly used vectors.
B1 General overview of the invention The present invention relates to Hu antigen-derived peptides. The peptides of the invention are useful for the prevention and treatment of certain types of cancers, and more particularly for the elimination of cancerous cells in vertebrates by inducing specific cytotoxic CD8 T-lymphocytes (CTLs).
Advantageously, the induced specific CTLs according to the invention are capable of eliminating, from a mammal, specific cells such as SCLC cancerous cells, without reacting against non-cancerous cells such as neural cells.
The peptides of the invention are also useful for the treatment or the prevention of nervous system damage diseases.

The peptides of the invention may also be used for detecting an early CTL
response against SCLC, for detecting an early CTL response against neuronal cells or for detecting neuronal damage in a mammal.
The peptides of the present invention may be used in all members of the class Vertebrates. Preferably, the vertebrate is a mammal including, but not limited to human and non-human primates, farm animals, domestic animals, and laboratory animals. According to most aspects of the present invention, the mammal is more preferably a human.
C~ Immuno~tenic Peptides and corresponding Nucleotides In one aspect, the invention is directed to immunogenic peptides that derive from the Hu antigen. Advantageously, the peptides of the invention are capable of inducing an immune response against a cancerous cell of a mammal without inducing an immune response against non-cancerous cells of the mammal.
More particularly, the immunogenic peptides according to the invention can induce in vitro, ex vivo andlor in vivo specific cytotoxic CD8 T-lymphocytes (CTLs) capable of eliminating specifically small-cell lung cancers, neuroblastomas, sarcoma and prostate carcinoma. Preferably, the immunogenic peptides are nonameric or docameric peptides and more preferably, they are selected from SEQ ID NOs:3 to 15 (see Figure 3).
The peptides of the present invention may be prepared by any suitable process. Preferably, they are obtained by chemical synthesis, but they may also be obtained using biological processes using expression vectors comprising a polynucleotide sequence encoding for the peptide of interest. They may also be incorporated in polypeptides having a length varying from about 10 to about 50 amino acids, preferably 15 amino acids. According to a preferred embodiment, the peptides are incorporated in a tetrameric complex of HLA-A2.2 comprising a plurality of identical or different peptides/polypeptides according to the invention.
According to another preferred embodiment, the peptides of the invention are incorporated into a support comprising at least two peptide molecules.
Examples of suitable support include polymers, lipidic vesicles, microsphere, latex beads, polystyrene beads, proteins and the like.
The reading frame of the nucleotide sequence of HuD is known (GENBANKT"" No. M62843, see SEQ ID N0:1 and Fig. 2), as well as the corresponding deduced amino acid sequence HuD (see SEQ ID N0:2 and Fig. 2). Figure 3 shows the amino acid sequence of the HuD peptides of the invention (SEQ ID NOs:3-15) and, for each of these peptides, the corresponding nucleotide sequence encoding these peptides (SEQ ID NOs:19-31). However, since the genetic code is degenerated, it is clear that the nucleotide sequences given in Figure 3 are, for each of these peptides, one specific example of the many possible examples of sequence for coding these peptides. A person skilled in the art will easily be capable of determining other nucleotide sequences coding for the peptides of the present invention.
In another aspect, the invention is directed to a method for producing, in vitro, an immunogenic peptide, comprising: culturing in vitro, in a suitable culture medium, a cell incorporating an expression vector as described previously; and collecting in the culture medium immunogenic peptides produced by these cells.
Therefore, the invention is also concerned with cells transformed for expressing the peptides of the invention. Methods for producing such cells and methods for using these cells in the production of proteinslpeptides are well known in the art and wiH no be described in detail herein.
The peptides, polypeptides and polynucleotides of the invention may also be used for producing pvlyclonal or monoclonal antibodies capable of recognizing and binding the same. Methods for producing such antibodies are well known in the art. These antibodies may be used for the preparation of a medicine for the treatment of human SCLC or for the treatment of nervous system damages caused by anti-Hu.
D) Pharmaceutical Comaositions The peptides/polypeptides of the present invention, the polynucleotides coding the same, and polyclonal or monoclonal antibodies produced according to the invention, may be used in many ways as antitumora! agents, for the preparation of pharmaceutical compositions, for the preparation of an antitumoral vaccine, for the treatment or the prevention of HLA-A2.1 human SCLC and/or for the treatment or the prevention of nervous system damage diseases.
Therefore, in another aspect, the invention is directed to pharmaceutical compositions comprising:
a) at least one component selected from the group consisting of:
- an immunogenic peptide/polypeptide and/or a polynucleotide and/or a fragment thereof and/or an antibody as defined previously; and Hu specific CD8 T-cells primed against an immunogenic peptide/polypeptide andlor a fragment thereof;
and b) a pharmaceutically acceptable vehicle or carrier.
The compositions of the invention may be in a solid or liquid form or in any suitable form for a therapeutic use. They may be formulated for a rapid or slow release of its components and may further comprise compounds for stimulatinglinhibiting the immune system. The compositions of the invention may be prepared according to conventional methods known in the art.
E) Stimulation of a Immune Resaonse In another aspect, the invention is directed to a method for priming in vitro immune cells of a mammal, comprising the steps of:
a) isolating HLA-A2.1 lymphoid or myeloid cells from the mammal; and b) priming in vitro the cells isolated at step a) with at least one immunogenic peptide/polypeptide andlor polynucleotide as defined previously.
According to a preferred embodiment, the method further comprises the steps of:
c) isolating CD8+ T-cells from the mammal; and d) using the cells primed at step b) for priming in vitro the CD8+ T-cells isolated at step c).
In a further aspect, the invention is directed to a method for stimulating a mammal's immune response comprising:

- administering into a compatible mammal HLA-A2.1 lymphoid or myeloid cells primed in vitro using the method defined hereinabove; andlor - administering into a compatible mammal CD8+ T-cells primed according to the method using the method defined hereinabove.
5 The invention also provides an ex vivo stimulation process of the human immune response. This method comprises the steps of: separating the autologous lymphoid or myeloid cells, then incubating in vitro of the separated cells with an immunogenic peptide/polypeptide and or a polynucleotide as defined previously, these cells allowing the induction of a cytotoxic response in vitro.

10 In another aspect, the invention is directed to a method for detecting an early CTL response against SCLC, to a method for detecting an early CTL
response against neuronal cells and to a method for detecting neuronal damage in a mammal, comprising:
- providing a tetrameric complex of HLA-A2.2 as defined previously;
- incubating this complex with peripheral blood lymphocytes of a mammal; and - determining the presence of Hu specific CTL.
More specifically, for detecting an early CTL response against SCLC, the presence of SCLC Hu specific CTLs is determined, whereas for detecting an early CTL response against neuronal cells, the presence of neuronal Hu specific CTLs is determined. The presence of Hu specific CTLs may be determined by comparing cells from the mammal with normal cells in culture using any suitable method such as FACS.
In another aspect, the invention is directed to a method for stimulating a human immune response against SCLC, comprising:
- isolating from a human SCLC Hu specific CTLs;
- amplifying ex vivo the isolated SCLC Hu specific CTLs; and - injecting in a compatible human suffering of SCLC, the SCLC Hu specific CTLs.
F) Purification of anti-Hu CTL cells and Use thereof In another aspect, the invention is directed to a method for purifying anti-Hu CTLs from blood of a mammal, comprising the steps of:

fixing on a column a tetrameric complex of HLA-A2.2 comprising at least one immunogenic peptide as defined previously;
- passing blood lymphocytes from the mammal into the column ; and - recovering anti-Hu CTLs retained by the column.
Such anti-Hu CTLs may be used for treating a mammal suffering from paraneoplastic neuropathy by injecting thereto the purified anti-Hu CTLs.
G1 Selection of Therapeutic molecules In a further aspect, the invention provides a method for selecting therapeutic molecules capable of inducing an immune response in vivo against at least one of the peptides/polypeptides defined previously. The method comprises the steps of:
a) adrninistering EL4S3-Rob tumoral cells as defined previously to a first animal model having a genotype compatible with the tumoral cells and having beforehand been immunized with the therapeutic molecules to be selected;
and b) comparing the immune response of the first animal model with the immune response of a second animal model having beforehand been immunized with the therapeutic molecules to be selected.
By comparing the immune response between the two animal models, it is possible to select therapeutic molecules capable of inducing an immune response in vivo against at least one of the peptides/polypeptides defined previously. For instance, this method may help in evaluating peptidic sequence or nucleotide sequence capable of inducing an in vivo response against non modified tumoral epitopes, viral epitopes, bacterial epitopes, or fungic epitopes.
The present invention will be more readily understood by referring to the following example: This example is illustrative of the wide range of applicability of the present invention and is not intended to limit its scope. Modifications and variations can be made therein without departing from the spirit and scope of the invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred methods and materials are described.

EXAMPLE 1:
Gytotoxic T lymphocytes can be generated against Hu antigen-derived peptides: a new step in deciphering pathogenesis of anti-Hu syndrome.
A) Introduction Paraneoplastic sensory neuronopathies, often associated with encephalomyelitis (PEM/SN), are commonly associated with circulating anti-Hu antibodies. More than 80% of patients with "anti-Hu syndrome" have a small-cell lung cancer (SCLC), which has limited extension in this particular setting (Dalmau, Medicine, 1992). Anti-Hu antibodies specifically react with a set of protein antigens, expressed by both neurons and SCLC cells (Dalmau, Am J
Path, 1992). It is currently believed that expression of HuD protein by the tumor triggers an immune response misdirected against homologous proteins expressed in the nervous system (Darnell, PNAS, 1996[rev]). It now seems clear, however, that anti-Hu antibodies do not cause neuronal damage by themselves (Hormigo, J Neuro immunol, 1994). In contrast, there are arguments suggesting a T-cell mediated autoimmune process, including : (i) the finding of T-cells in DRGs (Vllanschitz, Graus 1990, Walter 1994, Panegyres 1993), where CD8+ T-cells may be seen indented in neurons (Wanschitz) ; (ii) repertoire analysis showing similar oligoclonal T-cell populations, mainly CD'8+, in inflamed nervous tissue and tumor (Voltz, 1998).
HuD is encoded in the genome and is in all respects a self-antigen (Szabo, Cell, 1991 and Dalmau, Am J Pathol, 1992). Consequently, CD8+ T-cells with a receptor for MHC/HuD peptide complexes are expected to be eliminated during thymic negative selection, reducing the potential precursor T-cell repertoire and imposing limitations on their expansions on encounter with tumor cells in adult life. Additionally, stimulation by antigen in the absence of a second signal induces clonal anergy (Schwartz, Science, 1990), further hampering the potential repertoire of T-cells directed against systemic self antigens. However, clonal anergy may be irrelevant in CNS, due to absence of HLA class 1 expression in functional neurons. Eventually, the extent to which these events affect the normal adult repertoire is not known. Answering these questions is relevant to future strategies of immune intervention targeted at tumor antigens, which are also self antigens, that should be designed to avoid triggering auto-immune destructive processes.
We addressed this question using two systems : first, we evaluated the immunogenic potential of the HuD peptides in H-2 class 1 knockout, HLA-A*0201transgenic mice (HHD mice) (Pascolo, J exp Med, 1997). Expected results are entirely relevant in a murine model because potentially immunogenic HuD peptides are identical in both murine and human HuD protein. Second, we analyzed the ability of normal individuals to mount a CTL response in vitro against HuD peptides restricted by the HLA-A2 allele.
In that respect, we decided to test the prevalent hypothesis of HuD as immune target : (i) - in HHD mice by peptidic vaccination to obtain cytotoxic T-cell clones directed at HuD peptides (ii) - by artificially generating human cytotoxic T
cells directed against peptides derived from HuD sequence.
B) Materials and Methods S~nfhetic peptides.
HuD synthetic peptides included 8 nonamers : p163 ('631LVDQVTGV"';
SEQ ID N0:8), p362 (362RLGDRVLQV3~°; SEQ ID N0:15), p248 (248NLLNMAYGVz56; SEQ ID N0:9), p111 ("'RLQTKTIKV"s; SEQ ID N0:5), p315 (3'5QLFGPFGAV32s; SEQ ID N0:14), p314 (3'4WQLFGPFGA322; SEQ ID
N0:13), p251 (25'NMAYGVKRL25s; SEQ ID N0:10), p64 (~SLFGSIGE1~2; SEQ ID
N0:3); 5 decamers : p86 (86SLGYGFVNY~sS; SEQ ID N0:4), p162 ('62RILVDQVTGV"'; SEQ ID N0:7), p133 ('33NLYVSGLPKT'42; SEQ ID N0:6), p303 (3°3NLSPDSDESV3'2; SEQ ID N0:12), p314 (3'4WQLFGPFGAV323; SEQ ID
N0:13) and p280 (2$°GMTSLVGMN128s; SEQ ID N0:11). These peptides were purchased from Syntem (Nimes, France), as well as control peptide for MHC
binding and stabilization assay, HIV-1 pol p589 (58sIVGAETFYVSS'; SEQ ID
N0:16).
Peptide '28TPPAYRPPNAPIL'4° (SEQ ID N0:17) of the hepatitis B core antigen, peptide 5"YLSGANLNL5~9 (SEQ ID N0:18) of carcinoembryonic antigen, TcyP9 of Trypanozoma cruzi and Peptide FLU were also purchased, but from a different source.
Peptides were dissolved in DMSO (5~,IImg peptide) and subsequently diluted in PBS or dH20. HuD peptides were diluted at 4mg/ml, other peptides were diluted at 2mg/ml.
Cell lines and antibodies Cell lines H69 (HTB-119) is a A2.1 small cell lung cancer cell line obtained from the American Type Culture Collection.
Antibodies Human anti-Hu serum was obtained from patients with anti-Hu syndrome from different hospitals.
Human blood cells Peripheral Blood Mononuclear Cells (PBMC) were obtained from leukapheresis from 2 donors of HLA-A*0201 group. Autologous immature dendritic cells (iDC) were obtained from monocytes as follows : PBMC were incubated at 10~cells/mm3 in 6-well plaques for 2 hours. Non adherent cells were removed by successive washes in RPMI. Adherent cells were subsequently induced to differentiate into iDC in RPMI with 2% SAB, GM-CSF and IL-4 for 6 days (Sallusto, 1994). iDC were frozen in DMSO until use. At the time of induction, iDC were thawed and allowed to differentiate in mature dendritic cells (mDC) by a 48-hours-long incubation with TNF-a, IFN-y, and PGE-2.
CD8+ T-cells, obtained from frozen PBMC, were purified with immuno-magnetic beads, eliminating CD4+ T cells, B cells, CD56+ cells and monocytes (Milteny et al.) and TCR yi5 T-cells (Milteny et al.).
NLA A2.1 BindinQlStabilization Assay Binding assay : T2 (TAP-, HLA-A2.1 ) cells were incubated overnight at 37°C
(3x105/ml) in FCS-free RPMI medium supplemented with 100 ng/ml human ~i2microglobulin (Sigma, St Louis, MO) in the absence (negative control) or presence of either reference HIV-1 pol 589-597 or tested HuD peptides at various final concentrations (100, 10, 1 and 0.1 p,M). T2 cells were subsequently labeled for 30mn at 4°C with a saturating concentration of anti-HLA-A2.1 BB7.2 antibody, 5 then washed three times in PBS. The cells were then incubated for 30 min at 4°C
with a saturating concentration of FITC-conjugated goat anti-mouse IgG (H+L) (Caltag, South San Fransisco), washed three times and fixed in PBS/1 paraformaldehyde and analyzed using a COULTER XLT"" cytofluorometer (Beckman-Coulter, Nyon, Switzerland). The mean intensity of fluorescence (MiF) 10 observed for each peptide concentration (after subtraction of the MIF
observed without peptide) was used as an estimate of peptide binding. For each peptide, the concentration needed to reach 20% of the maximal binding (as defined with 100 mg/ml of HIV pol 589 peptide) was calculated. RA is the ratio of the concentrations of tested and HIV pol 589 reference peptides needed to reach this 15 value. The lower the RA, the stronger the binding.
Stabilization assay : Stabilization assays were performed similarly. Following initial overnight incubation with 50 N1/2 ml well of peptide at 100 NM, cells were washed in RPMI complete medium to remove free peptides and incubated in the continuous presence of 10 Ng/ml brefeldine A for 2, 4, and 6 h. The amount of stable peptide-HLA-A2.1 complexes was estimated as described above by indirect immunofluorescence analysis at t0, t2, t4 and t6. The half-life of complexes is the time required for a 50% reduction of the t0 MIF value.
Mice HHD mice express a transgenic monochain histocompatibility class 1 molecule in which the C terminus of the human ~i2microglobulin is covalently linked to the N terminus of a chimeric heavy chain (HLA-A2.1 a1-a2, H-2Db a3 transmembrane and intracytoplasmic domains; Pascolo, J exp Med 1997). The H-2Db and mouse (i2microglobulin genes of these mice have been disrupted by homologous recombination resulting in complete lack of serologically detectable cell surface expression of mouse histocompatibility class 1 molecules.

In vivo immunization, generation of CTL, and cytotoxic assay Each mouse was injected s.c. at the base of the tail with 100 ~,g of individual HuD peptide, and 50 p,g of helper peptide '28TPPAYRPPNAPIL'4° of the hepatitis B core antigen, emulsified in incomplete Freunds' adjuvant.
After 2 weeks, half of the mice were restimulated, 2.5x10' RBC-depleted splenocytes were restimulated in vitro in complete RPMI 1640 medium (10%FCS, 2mM
L-glutamine, 5x10-5 ~i-mercaptoethanol, 50 Ulmi penicillin, 50 ~glml streptomycin, and 10% TCGF) and 40 ~,g of corresponding HuD peptide.
After 5 days, responder mice were individually tested in a standard cytolytic 4-h 5'Cr-release assay. Briefly, Target HHD-transfected TAP' RMA-S
cells were loaded with relevant or negative control peptide 5"YLSGANLNL5's of carcinoembryonic antigen (10~g/ml, 5 x 106 ceils/ml, in FCS-free RPMi medium, 2 hr at room temperature. Specific lysis was calculated as follows :
(experimental release - spontaneous reiease)/(total release-spontaneous release) x 100.
Generation of cytotoxic T cell clones Spleen cells from primed mice were restimulated weekly using irradiated (5000 rads) peptide-loaded (10 ~,g/ml, 5x106 cells/ml, in FCS-free RPMI
medium, 2 hr at room temperature) HHD splenocytes, and grew in complete RPMI medium supplemented with 10%FCS, 2 mM L-glutamine, 5x10-6 ~i-mercaptoethanol, 50 U/ml penicillin, 50 p,g/ml streptomycin, and 10% TCGF.
After 3 to 5 restimulations, the cytotoxic T cell lines were cloned in limiting dilution cultures at 1, 10 and 20 cells per well in the presence of irradiated, peptide-pulsed HHD splenocytes. After two weeks, the isolated clones were assayed for cytolytic activity against peptide-pulsed HHD transfected RMA-S
cells. Cytotoxic clones were amplified and restimulated every week.
Adoptive transfer Between 8 and 17x106 HuD or TCyP1 clones were purified from feeder cells by FYCOLLT"" gradient separation, washed three times in PBS, and injected i.v. (retroorbital veins) in HHD mice. In some instances, mice had received 24h before 5x104 U/ml of murine recombinant ~y-IFN administered i.v.
In vitro immunization of human precursor T cells, Generation of CTL. and cytofoxic assay Sorted CD8 T-cells were plated in 96-well plates at 106 cells/ml in RPMI
medium supplemented with 10% human AB~ serum, L-glutamine, sodium pyruvate and antibiotics. mDC were pulsed for two hours at 37°C with saturating concentrations of peptides (10 ~,glml), irradiated at 30 Gy, washed once, and added to CD8 T-cells at a responder to stimulator ratio (R :S) of 5 :1. IL-6 (10 ng/ml) and IL-12 (1 ng/ml) were added. After 3 days, IL-2 (25 U/mI) was added to the medium. Lymphocytes were restimulated weekly with peptide-pulsed irradiated autologous PBMC. IL-2 and IL-7 (10 ng/ml) were added to the cultures the same day, and IL-2 alone after 3 days. Two rounds of restimulation were performed before the cytotoxicity assays.
The induction of CTL in human PBMC was monitored in a conventional siCr-labeling release assay. Briefly, peptide-pulsed TAP-/HLA-A*0201 human T2 cells were incubated, with 10 p,g/ml of HuD peptide or Flu control peptide for 120 min at 37°C followed by incubation with 5~Cr for 60 min. After washing, the target cells were added to serially diluted effectors in 96-well microplates.
After a 4-h incubation at 37°C, supernatants were harvested and counted in a gamma counter. Results are expressed as the percentage of specific lysis and determined as follows : [(experimental cpm-spontaneous cpm)/(maximum cpm -spontaneous cpm)] x 100.
C) Results Identification and Ana~sis of HLA - A*0201- restricted HuD Peptides.
The amino acid sequence of HuD (Szabo Cell, 1991) was analyzed for 9-and 10mer peptides sequences containing known binding motifs for the HLA-A*0201 molecule (Ruppert, Sette, Cell 1993), a subtype encompassing 95% of the HLA A2 allele which is expressed in about 50% of the Caucasian population (Lee, 1990, Fernandez, 1992, Krausa,1995). Peptides were identified by reverse genetics based on canonical anchor residues for HLA - A*0201 (Krausa, 1995), and by using the software of the Bioinformatics and Molecular Analysis Section (National Institute of Health, Washington, DC) available at http:Ilbimas.dcrt.nih.pov/molbio/hla bind/index.html which ranks 9- or 10-mer peptides on a predicted half-time dissociation coefficient from HLA class I
molecules (Parker, JI, 1994). From an initial panel of thirty 9-mer and thirty 14-mer peptides, we retained 14 sequences, eight 9-mer and six 10-mer peptides (Table 1 ).
Because the immunogenicity of MHC class-I-restricted peptides reflects to some degree their binding and stabilizing capacity for MHC class-I molecules (Vitiello, J exp Med 1991, Sette JI, 1994, van der Burg, JI 1996), we sought direct proof of the strength of interaction between the 14 HuD peptides and the HLA-A*0201 molecule in a binding/stabilization assay that uses the antigen-transporting deficient (TAP-) HLA-A*0201 human T2 cells. The RA was calculated in reference to HIV-1 pol p589 peptide. Four to five tests were performed for each peptide. Mean values are indicated in Table 1. Stability of each peptide bound to HL.A-A*0201 was measured as the half-life of the complex.
Mean values of the 3 to 4 tests performed for each peptide are indicated in Table 1.

Table 1. MHC bindin~t and stabilization of HuD peptides on HLA A*0201.
Sequence Predicted score"RAa T~12 ~'ILVDavTGVi' 1115 0.2o s sszRLGDRVLQV3' 656 1.08 6 z~NLLNMAYGVzSS 25$ O.fi2 6 "' RLQTKTI KV"9 70 1.60 4 3'Sf~LFGPFGAV3z3 64 0.49 2 3'aWQLFGPFGA3zz 50 0.34-0.4-0.63-2.32 *

z5' NMAYGVKRLzss 35 */*/* nd saSLFGSIGEI'z 12 2.2 6 86SLGYGFVNYI9$ 520 0.88 6 Ts2RlLVDQVTGV"' $1 0.53 8 '33NLYVSGLPKT'4z 50 * I*I* nd sosNLSPDSDESV3'z 35 *I*I* nd 3'4WQLFGPFGAV3z3 29 0.62 4 zsoGMTSLVGMNIzss 11 5.7-11.7-* * nd '-~ : as defined by Parker et al (-). ' : RA is the ratio of the concentrations of tested and HIV po1589 reference peptides needed to reach this value. The lower the RA, the stronger the binding. Each value corresponds to the average result of 4 or 5 MHC binding assays. ~ : half-life of peptide-HLA-A2.1 complexe : time required for a 50% reduction of the t0 MIF value. 8 hours is the highest time tested. Each value corresponds to the average of 3 or 4 tests.
CTL r~esaonse against HuD in HHD mice.
Whether peptides can serve as immunogens in vivo and elicit a CTL
response depends on a variety of factors such as the mode of immunization, suitable activation of antigen presenting cells, the frequency of precursor cells, and binding and stabilization of MHC class I molecules by peptide. Also, whereas the sole immunization with class I-restricted synthetic peptides of optimal size is sufficient for the induction of CTL responses in some cases (Vasilakos, JI
1993), the need for help has been documented in other circumstances (Ossendorp, J
exp Med 1998). Therefore, the CTL responses of HHD mice which express H-2b class II molecules were tested by co-injecting HuD peptides and the IAb-restricted HBVc.128 peptide (Milich, PNAS, 1988). In these mice, the peripheral CD8 T-cell repertoire is essentially educated on the transgenic human rnolecuie.
Therefore, HHD mice are an excellent tool to assess at the pre-clinical level the ability of individual peptides to induce HLA-A*0201-restricted CTL responses in vivo (Firat, Eur J I, 1999). 10/14 peptides were satisfying with regard to MHC binding status and were therefore injected into HHD mice (Table 2). 7/10 peptides elicited CTL

responses in a proportion of injected mice. CTL lines were derived and then cloned by limit dilution method. Cytotoxic clones were obtained for p248(2aaNLLNMAYGVz5s), p86 (BSSLGYGFVNY~95), p111 ("'RLQTKTIKV"9), p314 (3'4WQLFGPFGAV3zs), Although overall correlation between the results of 5 binding/stabilization of the HLA A*0201 molecule is expected (Firat), in this study, p1fi3('s3ILVDQVTGV"') and p362 (3szRLGDRVLQV3'°) were the most efficiently binding and stabilizing peptides, and yet elicited only 1/6 and 0/6 responses respectively.
10 Table 2. Induction of CTL against HuD in HLA-A2.1 transgenic mice.
HuD peptide Nr. of responders Percent Ivs ''ILVDQVTGV"' 1/6 62 sszRLGDRVLQV3' 0/6 z4aNLLNMAYGVzss 3/6 44 "'RLQTKTIKV"s 1/5 55 3'SQLFGPFGAV323 0/5 3'4WQLFGPFGA3zz 0/5 s4SLFGSIGEI'z 2/5 60 saSLGYGFVNYl9a 2/6 15 iszRILVDQVTGV"' 3/6 16 3'WQLFGPFGAVazs 1/5 57 ~ : Values of cytotoxicity refer to cytotoxicity of highest responder at an effector-to-target ratio of 60 :1.
15 CTL response against HuD in normal human individuals.
The presence of precursor T cells was tested for 8/10 HuD peptides, which gave results in HHD mice, plus p362, which bound and stabilized HLA-A*0201 very efficiently and yet elicited no response in HHD mice. Expansion on antigen stimulation was tested by using PBMC and autologous monocyte-derived 20 dendritic cells of 2 HLA-A*0201 normal blood donors in an in vitro assay. T
cells that lysed peptide-pulsed T2 cells as targets starting from the third round of peptide stimulation were generated in response to 2 peptides, p248 (zasNLLNMAYGVzss) and p86 (BSSLGYGFVNY~95). The same procedure was applied to generate CTL against FLU peptide to serve as irrelevant CTL against H69. Maximal specific lysis at E:S ratio 50:7 was 75% for p248 (Fig 1A), maximal specific lysis at E:S ratio 25:1 was 57% (Fig 1 B). For one peptide, p111 ("'RLQTKTIKV"9 ), there was a measurable nonspecific lysis (20% at E:S ratio 50:1), although the expanded population consisted of 90% of CD8 T cells (data not shown).
CTL resaonse a4ainst H69 in normal human individuals.
Human CTL generated against p248 and p86, as well as control CTL
generated against FLU peptide were tested against H69 HLA A*0201 SCLC cell line. H69 was incubated with 100U/ml of recombinant IFN-g for 48h before the 5'Cr-labeling release assay to upregulate HLA class I expression (Doyle, J Exp Med 1985 and Traversari, J I Ther, 1997). No lysis was obtained against H69 (Fig. 1), although H69 pulsed according to the same protocol as T2 cells could be lysed by CTL against p86 (Fig 1A).
E) R~ferences Throughout this application, reference is made to a number of articles of scientific literature that are listed below:
Albert ML, Darnell JC, Bender A, Francisco LM, Bhardwaj N, Darnell RB. Tumor-specific killer cells in paraneoplastic cerebral degeneration. Nat Med 1998 ;
4 : 1321-1324.
Carcassi C, Krausa P, Bodmer J, Contu L, Browning M. Characterization of HLA-A*02 subtypes in the Sardinian population. Tissue Antigens. 1995 Nov;46(5):391-3.
Carpentier AF, Rosenfeld MR, De(attre JY, Whalen RG, Posner JB, Dalmau J
DNA vaccination with Hu-D inhibits growth of neuroblastoma in mice. Clin Cancer Res, 1998, 4, 2819-2824.
Dalmau J, Furneaux HJ, Gralla RJ, Kris MG, Posner JB. Detection of the anti-Hu antibody in the serum of patients with small cell lung cancer. A quantitative Western blot analysis. Ann Neurol, 1990, 27 : 544-552.
Dalmau J, Furneaux HM, Cordon-cardo C, Posner JB. The expression of the Hu (paraneop1astic encephalomyelitis/sensory neuropathy) antigen in human normal and tumor tissues. Am J Pathol, 1992, 141 : 881-886.

Dalmau J, Graus F, Cheung NKV, Rosenblum MK, Ho A, Canete A, Delattre JY, Thompson SJ, Posner JB. Major histocompatibility proteins, anti-Hu antibodies, and paraneoplastic encephalomyelitis in neuroblastoma and small cell lung cancer. Cancer, 1995, 75 : 99-109.
Dalmau J, Graus F, Rosenblum MK, Posner JB. Anti-Hu-associated paraneoplastic encephalomyelitis/sensory neuropathy. A clinical study of 71 patients. Medicine. 1992, 71 : 59-72.
Darnell RB. Onconeural antigens and the paraneoplastic neurologic disorders.
at the intersection of cancer, immunity, and the brain. Proc Natl Acad Sci U S
A. 1996 May 14;93(10):4529-36.
Doyle A, Martin WJ, Funa K, Gazdar A, Carney D, Martin SE, Linnoila I, Cuttitta F, Mulshine J, Bunn P, and Minna J. Markedly decreased expression of class I histocompatibility antigens, protein, and mRNA in human small-cell lung cancer. J Exp Med. 1985 May 1;161 (5):1135-51.
Fernandez-Vina MA, Falco M, Sun Y, Stastny P. DNA typing for HLA class I
alleles: I. Subsets of HLA-A2 and of -A28. Hum Immunol 1992 Mar;33(3):163-73.
Firat H, Garcia-Pons F, Tourdot S, Pascolo S, Scardino A, Garcia Z, Michel ML, Jack RW, Jung G, Kosmatopoulos K, Mateo L, Suhrbier A, Lemonnier FA, Langlade-Demoyen P. H-2 class I knockout, HLA-A2.1-transgenic mice: a versatile animal model for preclinical evaluation of antitumor immunotherapeutic strategies. Eur J Immunol 1999 Oct;29(10):3112-21.
Firat H, Garcia-Pons F, Tourdot S, Pascolo S, Scardino A, Garcia Z, Michel ML, Jack RW, Jung G, Kosmatopoulos K, Mateo L, Suhrbier A, Lemonnier FA, Langlade-Demoyen P. H-2 class I knockout, HLA-A2.1-transgenic mice: a versatile animal model for preclinical evaluation of antitumor immunotherapeutic strategies. Eur J Immunol. 1999 Oct;29(10):3112-21.
Graus F, Ribalta T, Campo E, Monforte R, Urbano A, Rozman C.
Immunohistochemical analysis of the immune reaction in the nervous system in paraneoplastic encephalomyelitis. Neurology, 1990, 40 : 219-222.

Jean WC, Dalmau J, Ho A, Posner JB. Analysis of the IgG subclass distribution and inflammatory infiltrates in patients with anti-Hu-associated paraneoplastic encephalmyelitis. Neurology, 1994, 44 : 140-147.
Lee TD. In the HLA system, ed. Lee J (Springer, New York), 1990, 141-178.
Milich DR, Hughes JL, McLachlan A, Thornton GB, Moriarty A. Hepatitis B
synthetic immunogen comprised of nucleocapsid T-cell sites and an envelope B-cell epitope. Proc Natl Acad Sci U S A. 1988 Mar;85(5):1610-4.
Minev B, Hipp J, Firat H, Schmidt JD, Langlade-Demoyen P, Zanetti M. Cytotoxic T cell immunity against telomerase reverse transcriptase in humans. Proc Natl Acad Sci U S A. 2000 Apr 25;97(9):4796-801.
Neumann H, Cavali~ A, Jenne DE, Wekerle H. Induction of MHC class I genes in neurons. Science, 1995, 269 : 549-552.
Ossendorp F, Mengede E, Camps M, Filius R, Melief CJ. Specific T helper cell requirement for optimal induction of cytotoxic T lymphocytes against major histocompatibility complex class Ii negative tumors. J Exp Med. 1998 Mar 2;187(5):693-702.
Panegyres PK, Reading MC, Esiri MM. The inflammatory reaction of paraneoplastic ganglionitis and encaphalitis: an immunohistochemical study. J Neuroi, 1993, 240 : 93-97.
Parker KC, Bednarek MA, Coligan JE. Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side-chains. J Immunoi, 1994, 152 : 163-175.
Pascolo S, Bervas N, Ure JM, Smith AG, Lemonnier FA, Perarnau B. HLA-A2.1 restricted education and cytolytic activity of CD8(+) T lymphocytes from beta2 microglobulin (beta2m) HLA-A2.1 monochain-transgenic H-2Db beta2m double knockout mice. J Exp Med 1997 Jun 16;185(12):2043-51.
Posner JB, Dalmau J. Paraneoplastic syndromes. Curr Opin Immun 1997, 9:723-29.
Ruppert J, Sidney J, Cells E, Kubo RT, Grey HM, Sette A: Prominent role of secondary anchor residues in peptide binding to HLA- A2.1 molecules. Cell 74(5): 929-37, 1993.
Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med. 1994 Apr 1;179(4):1109-18.
Schwartz RH. A cell culture model for T lymphocyte clonal anergy. Science 1990 Jun 15;248(4961 ):1349-56.
Sette A, Vitiello A, Reherman B, Fowler P, Nayersina R, Kast WM, Melief CJ, Oseroff C, Yuan L, Ruppert J, et al. The relationship between class I binding affinity and immunogenicity of potential cytotoxic T cell epitopes. J Immunol.
1994 Dec 15;153( 12):5586-92.
Szabo A, Dalmau J, Manley G, Rosenfeld M, Wong E, Henson J, Posner JB, Furneaux HM. Hu-D, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is homologous to Elav and sex-lethal. Cell, 1991, 67 : 325-333.
Traversari C, Meazza R, Coppolecchia M, Basso S, Verrecchia A, van der Bruggen P, Ardizzoni A, Gaggero A, Ferrini S. IFN-gamma gene transfer restores HLA-class I expression and MAGE-3 antigen presentation to CTL
in HLA-deficient small cell lung cancer. Gene Ther. 1997 Oct;4(10):1029-35.
Tsai V, Southwood S, Sidney J, Sakaguchi K, Kawakami Y, Appella E, Sette A, Celis E: Identification of subdominant CTL epitopes of the GP100 melanoma- associated tumor antigen by primary in vitro immunization with peptide- pulsed dendritic cells. J Immunol 158(4): 1796-802, 1997.
Van der Burg SH, Visseren MJ, Brandt RM, Kast WM, Melief CJ. Immunogenicity of peptides bound to MHC class I molecules depends on the MHG-peptide complex stability. J Immunol 1996 May 1;156(9):3308-14.
Vasilakos JP, Michael JG. Herpes simplex virus class I-restricted peptide induces cytotoxic T lymphocytes in vivo independent of CD4+ T cells. J Immunol.
1993 Mar 15;150(6):2346-55.
Vitiello A, Marchesini D, Furze J, Sherman LA, Chesnut RW. Analysis of the HLA-restricted influenza-specific cytotoxic T lymphocyte response in transgenic mice carrying a chimeric human-mouse class I major histocompatibility complex. J Exp Med. 1991 Apr 1;173(4):1007-15.

Wanschitz J, Hainfellner JA, Kristoferitsch W, Drlicek M, Budka H.
Ganglionitis in paraneoplastic subacute sensory neuropathy : a morphologic study.
Neurology, 1997, 49 : 11565-1159.
5 While several embodiments of the invention have been described, it will be understood that the present invention is capable of further modifications, and this application is intended to cover any variations, uses, or adaptations of the invention, following in general the principles of the invention and including such departures from the present disclosure as to come within knowledge or 10 customary practice in the art to which the invention pertains, and as may be applied to the essential features hereinbefore set forth and falling within the scope of the invention or the limits of the appended claims.

SEQUENCE LISTING
<110> Institut Pasteur INSERM
Assistance Publique-Hopitaux de Paris <120> HU ANTIGEN-DERIVED PEPTIDES AND USES THEREOF
<130> 000966-0005 <150> CA 2,344,768 <151> 2001-05-08 <160> 31 <170> Patentln version 3.1 <210> 1 <211> 1441 <212> DNA
<213> Homo sapiens <220>
<221> CDS
<222> (95)..(1237) <223>
<300>

<308> 43 <309> 1994-12-31 <313> (1)..(1441) <400> 1 ccaatagtagtcattttaaa gaaatctttg caaattttaa cagaagagtc tatatattct gaagctctgc gagacccaat aaga tt 115 atttgccaat atg agc gtt acc atg ata a Met 1e Va1 Ser Met Thr Ile I

atg cctcag gtgtcaaat ggtccgaca tccaataca agcaatgga 163 gag Met ProGln ValSerAsn GlyProThr SerAsnThr SerAsnGly Glu ccc agcaac aacagaaac tgtccttct cccatgcaa acaggggca 211 tcc Pro SerAsn AsnArgAsn CysProSer ProMetGln ThrGlyAla Ser acc gatgac agcaaaacc aacctcatc gtcaactat ttaccccag 259 aca Thr AspAsp SerLysThr AsnLeuIle ValAsnTyr LeuProGln Thr aat acccaa gaagaattc aggagtctc ttcgggagc attggtgaa 307 atg Asn ThrGln GluGluPhe ArgSerLeu PheGlySer IleGlyGlu Met ata tcctgc aaacttgtg agagacaaa attacagga cagagttta 355 gaa Ile SerCys LysLeuVal ArgAspLys IleThrGly GlnSerLeu Glu ggg ggattt gttaactat attgatcca aaggatgca gagaaagcc 403 tat Gly GlyPhe ValAsnTyr IleAspPro LysAspAla GluLysAla Tyr -atcaac actttaaatgga ctcagactc cagaccaaa accataaag gtc 451 IleAsn ThrLeuAsnGly LeuArgLeu GlnThrLys ThrIleLys Val tcatat gcccgtccgagc tctgcctca atcagggat getaacctc tat 499 SerTyr AlaArgProSer SerAlaSer IleArgAsp AlaAsnLeu Tyr gttagc ggccttcccaaa accatgacc cagaaggaa ctggagcaa ctt 547 ValSer GlyLeuProLys ThrMetThr GlnLysGlu LeuGluGln Leu ttctcg caatacggccgt atcatcacc tcacgaatc ctggttgat caa 595 PheSer GlnTyrGlyArg IleIleThr SerArgIle LeuValAsp Gln gtcaca ggagtgtccaga ggggtggga ttcatccgc tttgataag agg 643 ValThr GlyValSerArg GlyValGly PheIleArg PheAspLys Arg attgag gcagaagaagcc atcaaaggg ctgaatggc cagaagccc agc 691 IleGlu AlaGluGluAla IleLysGly LeuAsnGly GlnLysPro Ser ggtget acggaaccgatt actgtgaag tttgccaac aaccccagc cag 739 GlyAla ThrGluProIle ThrValLys PheAlaAsn AsnProSer Gln aagtcc agccaggccctg ctctcccag ctctaccag tcccctaac cgg 787 LysSer SerGlnAlaLeu LeuSerGln LeuTyrGln SerProAsn Arg cgctac ccaggtccactt caccaccag getcagagg ttcaggctg gac 835 ArgTyr ProGlyProLeu HisHisGln AlaGlnArg PheArgLeu Asp aatttg cttaatatggcc tatggcgta aagagactg atgtctgga cca 883 AsnLeu LeuAsnMetAla TyrGlyVal LysArgLeu MetSerGly Pro gtcccc ccttctgettgt tcccccagg ttctcccca attaccatt gat 931 ValPro ProSerAlaCys SerProArg PheSerPro IleThrIle Asp ggaatg acaagccttgtg ggaatgaac atccctggt cacacagga act 979 GlyMet ThrSerLeuVal GlyMetAsn IleProGly HisThrGly Thr gggtgg tgcatctttgtc tacaacctg tcccccgat tccgatgag agt 1027 GlyTrp CysIlePheVal TyrAsnLeu SerProAsp SerAspGlu Ser gtcctc tggcagctcttt ggccccttt ggagcagtg aacaacgta aag 1075 ValLeu TrpGlnLeuPhe GlyProPhe GlyAlaVal AsnAsnVal Lys gtgatt cgtgacttcaac accaacaag tgcaaggga ttcggcttt gtc 1123 ValIle ArgAspPheAsn ThrAsnLys CysLysGly PheGlyPhe Val accatg accaactatgat gaggcggcc atggccatc gccagcctc aac 1171 ThrMet ThrAsnTyrAsp GluAlaAla MetAlaIle AlaSerLeu Asn gggtac cgcctgggagac agagtgttg caagtttcc tttaaaacc aac 1219 Gly Tyr Arg Leu Gly Asp Arg Val Leu Gln Val Ser Phe Lys Thr Asn aaa gcc cac aag tcc tga atttcccatt cttacttact aaaatatata 1267 Lys Ala His Lys Ser tagaaatatatacgaacaaaacacacgcgcgcacacacacacatacacgaaagagagaga1327 aacaaacttttcaaggcttatattcaaccatggactttataagccagtgttgcctaagta1387 ttaaaacattggattatcctgaggtgtaccaggaaaggattttataatgcttag 1441 <210> 2 <211> 380 <212> PRT
<213> Homo Sapiens <400> 2 Met Val Met Ile Ile Ser Thr Met Glu Pro Gln Val Ser Asn Gly Pro Thr Ser Asn Thr Ser Asn Gly Pro Ser Ser Asn Asn Arg Asn Cys Pro Ser Pro Met Gln Thr Gly Ala Thr Thr Asp Asp Ser Lys Thr Asn Leu Ile Val Asn Tyr Leu Pro Gln Asn Met Thr Gln Glu Glu Phe Arg Ser Leu Phe Gly Ser Ile Gly Glu Ile Glu 5er Cys Lys Leu Val Arg Asp Lys Ile Thr Gly Gln Ser Leu Gly Tyr Gly Phe Val Asn Tyr Ile Asp Pro Lys Asp Ala Glu Lys Ala Ile Asn Thr Leu Asn Gly Leu Arg Leu Gln Thr Lys Thr Ile Lys Val Ser Tyr Ala Arg Pro Ser Ser Ala Ser Ile Arg Asp Ala Asn Leu Tyr Val Ser Gly Leu Pro Lys Thr Met Thr Gln Lys Glu Leu Glu Gln Leu Phe Ser Gln Tyr Gly Arg Ile Ile Thr Ser Arg Ile Leu Val Asp Gln Val Thr Gly Val Ser Arg Gly Val Gly Phe Ile Arg Phe Asp Lys Arg Ile Glu Ala Glu Glu Ala Ile Lys Gly Leu Asn Gly Gln Lys Pro Ser Gly Ala Thr Glu Pro Ile Thr Val Lys Phe Ala Asn Asn Pro Ser Gln Lys Ser Ser Gln Ala Leu Leu Ser Gln Leu Tyr Gln Ser Pro Asn Arg Arg Tyr Pro Gly Pro Leu His His Gln Ala Gln Arg Phe Arg Leu Asp Asn Leu Leu Asn Met Ala Tyr Gly Val Lys Arg Leu Met Ser Gly Pro Val Pro Pro Ser Ala Cys Ser Pro Arg Phe Ser Pro Ile Thr Ile Asp Gly Met Thr Ser Leu Val Gly Met Asn 275 2$0 285 Ile Pro Gly His Thr Gly Thr Gly Trp Cys Ile Phe Val Tyr Asn Leu Ser Pro Asp Ser Asp Glu Ser Val Leu Trp Gln Leu Phe Gly Pro Phe Gly Ala Val Asn Asn Val Lys Val Ile Arg Asp Phe Asn Thr Asn Lys Cys Lys Gly Phe Gly Phe Val Thr Met Thr Asn Tyr Asp Glu Ala Ala Met Ala Ile Ala Ser Leu Asn Gly Tyr,Arg Leu Gly Asp Arg Val Leu Gln Val Ser Phe Lys Thr Asn Lys Ala His Lys Ser <210> 3 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 3 Ser Leu Phe Gly Ser Ile Gly Glu Ile <210> 4 <211> 10 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 4 Ser Leu Gly Tyr Gly Phe Val Asn Tyr Ile <210> 5 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 5 Arg Leu Gln Thr Lys Thr Ile Lys Val <210> 6 <211> 10 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 6 Asn Leu Tyr Val Ser Gly Leu Pro Lys Thr <210> 7 <211> 10 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 7 Arg Ile Leu Val Asp Gln Val Thr Gly Val <210> 8 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 8 Ile Leu Val Asp Gln Val Thr Gly Val <210> 9 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 9 Asn Leu Leu Asn Met Ala Tyr Gly Val <210> 10 <211> 9 <212> PRT
<2I3> Artificial sequence <220>
<223> sequence is completely synthesized <900> 10 Asn Met Ala Tyr Gly Val Lys Arg Leu <210> 11 <211> 8 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 11 Met Thr Ser Leu Val Gly Met Asn <210> 22 <211> 10 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 12 Asn Leu Ser Pro Asp Ser Asp Glu Ser Val <210> 13 <211> 10 <212> PRT

<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 13 Trp Gln Leu Phe Gly Pro Phe Gly Ala Val <210> 14 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 14 Gln Leu Phe Gly Pro Phe Gly Ala Val <210> 15 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 25 Arg Leu Gly Asp Arg Val Leu Gln Val <210> 16 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 16 Ile Val Gly Ala Glu Thr Phe Tyr Val <210> 17 <211> 13 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 17 Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu <210> 18 <211> 9 <212> PRT
<213> Artificial sequence <220>
<223> sequence is completely synthesized <400> 18 Tyr Leu Ser Gly Ala Asn Leu Asn Leu <210> 19 <211> 27 <212> DNA
<213> Homo sapiens <400> 19 agtctcttcg ggagcattgg tgaaata 27 <210> 20 <211> 30 <212> DNA
<213> Homo Sapiens <400> 20 agtttagggt atggatttgt taactatatt 30 <210> 21 <211> 27 <212> DNA
<213> Homo sapiens <400> 21 agactccaga ccaaaaccat aaaggtc 27 <210> 22 <211> 30 <212> DNA
<213> Homo sagiens <400> 22 aacctctatg ttagcggcct tcccaaaacc 30 <210> 23 <211> 30 <212> DNA
<213> Homo sapiens <400> 23 cgaatcctgg ttgatcaagt cacaggagtg 30 <210> 24 <211> 27 <212> DNA
<2I3> Homo Sapiens <400> 24 atcctggttg atcaagtcac aggagtg 27 <210> 25 <211> 27 <212> DNA
<213> Homo Sapiens <400> 25 aatttgctta atatggccta tggcgta 27 <210> 26 <211> 27 <212> DNA
<213> Homo Sapiens <400> 26 aatatggcct atggcgtaaa gagactg 27 <210> 27 <211> 27 <212> DNA
<213> Homo Sapiens <400> 27 ggaatgacaa gccttgtggg aatgaac 27 <210> 28 <211> 30 <212> DNA
<213> Homo Sapiens <400> 28 aacctgtccc ccgattccga tgagagtgtc 30 <210> 29 <211> 30 <212> DNA
<213> Homo Sapiens <400> 29 tggcagctct ttggcccctt tggagcagtg 30 <210> 30 <211> 27 <212> DNA
<213> Homo Sapiens <400> 30 cagctctttg gcccctttgg agcagtg 27 <210> 31 <211> 27 <212> DNA
<213> Homo Sapiens <400> 31 cgcctgggag acagagtgtt gcaagtt 27

Claims (32)

1. An isolated or purified immunogenic peptide characterized in that it derives from the Hu antigen.

2. The immunogenic peptide according to claim 1, characterized in that it is capable of inducing an immune response against a cancerous cell of a mammal without inducing an immune response against non-cancerous cells of said mammal.

3. The immunogenic peptide according to claim 2, wherein said mammal consists of a human.

4. The immunogenic peptide according to any one of claims 1 to 3, characterized in that said cancerous cells are selected from the group consisting of small-cell lung cancers, neuroblastomas, sarcoma and prostate carcinoma.

5. The immunogenic peptide according to any one of claims 1 to 4, characterized in that said immune response is an in vitro, ex vivo and/or in vivo CTL response:

6. The immunogenic peptide according to any one of claims 1 to 5, characterized in that said peptide consists of a nonamer or a decamer.

7. The immunogenic peptide according to any one of claims 1 to 6, characterized in that said Hu antigen comprises SEQ ID NO:2.

8. The immunogenic peptide according to any one of claims 1 to 7, characterized in that said peptide is selected from the group consisting of SEQ ID
NOs:3 to 15 and functional derivatives thereof.

9. The immunogenic peptide according to any one of claims 1 to 8, characterized in that administration of said peptide to an HLA-A2.1 human induces the activation of a specific CTL response against autologous or syngenic small-cell lung cancer (SCLC).

10. The immunogenic peptide according to any one of claims 1 to 9, characterized in that said peptide is incorporated into a support comprising at least two molecules of said peptide.

11. The immunogenic peptide according to claim 10, characterized in that said support is selected from the group consisting of polymers, lipidic vesicles, microsphere, latex beads, polystyrene beads, and proteins.

12. An isolated or purified polypeptide characterized in that it comprises at least two immunogenic peptides according to any one of claims 1 to 11.

13. The polypeptide of claim 12, comprising from about 10 to about 50 amino acids.

14. An isolated ore purified polyclonal or monoclonal antibody characterized in that it specifically binds to at least one immunogenic peptide according to any one of claims 1 to 11, to a polypeptide according to claim 12 or 13, or to a fragment thereof.

15. A purified polynucleotide characterized in that it codes for at least one immunogenic peptide according to any one of claims 1 to 11, or for a fragment thereof.

16. The polynucleotide of claim 15, characterized in that it is selected from the group consisting of SEQ ID NOs:1, 19 to 30, and 31.

17. An expression vector, characterized in that it comprises a polynucleotide as defined in claim 15 or 16.

18. A cell incorporating the expression vector of claim 17.

19. A method for producing in vitro an immunogenic peptide, comprising:
- culturing in vitro in a suitable culture medium a cell according to claim 18, and;
- collecting said peptide in the culture medium.

20. A pharmaceutical composition comprising:
a) at least one component selected from the group consisting of:
- an immunogenic peptide according to anyone of claims 1 to 11 or a functional derivative thereof;
- a polypeptide according to claim 12 or 13;
- an antibody according to claim 14;
- a polynucleotide according to claim 15 or 16, and - Hu specific CD8 T-cells primed against an immunogenic peptide according to any one of claims 1 to 11, against a polypeptide according to claim 12 or 13 and/or a functional derivative thereof;
and b) a pharmaceutically acceptable vehicle or carrier.

21. Use of a pharmaceutical composition according to claim 20, as an antitumoral agent, for the preparation of an antitumoral vaccine, for the treatment or the prevention of HLA-A2.1 human SCLC and/or for the treatment or the prevention of nervous system damage diseases.

22. A method for priming in vitro immune cells of a mammal, comprising the steps of:
a) isolating HLA-A2.1 lymphoid or myeloid cells from said mammal; and b) priming in vitro the cells isolated at step (a) with at least one immunogenic peptide as defined in any one of claims 1 to 11, with at least one polypeptide as defined in claim 12 or 13, and/or with at least one the polynucleotide as defined in claim 15 or 16.

23. The method of claim 22, further comprising the steps of:
c) isolating CD8+ T-cells from said mammal; and d) using the cells primed at step (b) for priming in vitro the CD8+ T-cells isolated at step (c).

24. A method for stimulating a mammal's immune response comprising:
- administering into a compatible mammal HLA-A2.1 lymphoid or myeloid cells primed according to the method of claim 22 or 23; and/or - administering into a compatible mammal CD8+ T-cells primed according to the method of claim 22 or 23.

25. A tumoral cell characterized in that it is obtained by a double transfection of a EL4 S3-Rob mouse with:
- a human gene coding for a HHD molecule; and - a human gene coding for at least one peptide according to any one of claims 1 to 11.

26. The tumoral cell of claim 25, wherein the EL4 S3-Rob mouse consist of a .beta.2-microglobulin negative mouse deposited at the CNCM under accession number I-2587.

27. A method for detecting an early CTL response against SCLC, for detecting an early CTL response against neuronal cells or for detecting neuronal damage in a mammal comprising:
- providing a tetrameric complex of HLA-A2.2 comprising at least one immunogenic peptide according to any one of claims 1 to 11;
- incubating said complex with peripheral blood lymphocytes of said mammal;
and - determining the presence of Hu specific CTLs.

28. The method of claim 27, wherein detection of an early CTL response against SCLC comprises determining the presence of SCLC Hu specific CTLs, and wherein detection of an early CTL response against neuronal cells comprises determining the presence of neuronal Hu specific CTLs.

29. A method for stimulating a human immune response against SCLC, comprising:
- isolating from a human SCLC Hu specific CTLs;
- amplifying ex vivo said isolated SCLC Hu specific CTLs; and - injecting to a compatible human suffering of SCLC, said SCLC Hu specific CTLs.

30. A method for purifying anti-Hu CTLs from blood of a mammal, comprising the steps of:
- fixing on a column a tetrameric complex of HLA-A2.2, said complex comprising at least one immunogenic peptide according to any one of claims 1 to 11;
- passing blood lymphocytes from said mammal into said column ; and - recovering anti-Hu CTLs retained by the column.

31. A method for treating a mammal suffering from paraneoplastic neuropathy comprising the steps of:
- purifying anti-Hu CTLs from blood of a mammal according to the method of claim 30; and - injecting said purified anti-Hu CTLs to said mammal suffering from paraneoplastic neuropathy.

32. A method for selecting therapeutic molecules capable of inducing an immune response in vivo against at least one of the peptides according to anyone of claims 1 to 11, the method comprising the steps of:
a) administering EL4S3-Rob tumoral cells according to claim 25 or 26 to a first animal model, said first animal model having a genotype compatible with said tumoral cells and having beforehand been immunized with the therapeutic molecules to be selected; and b) comparing the immune response of said first animal model with the immune response of a second animal model having beforehand been immunized with the therapeutic molecules to be selected.