CA2387146A1 - Gene transfer vectors for treating autoimmune diseases and diseases with immunopathogenesis by therapy - Google Patents

Abstract

The invention relates to a gene transfer vector, comprising at least one nucleic acid molecule comprising a first nucleic acid sequence which codes for one or more ligands that trigger apoptosis, a second nucleic acid sequence which codes for one or more antigens, optionally, a third nucleic acid sequence which codes for one or more anti-apoptosis molecules, and optionally, a fourth nucleic acid sequence which codes for one or more suicide enzymes.

Description

PCT/DE 00/03608 (WO 01/27254) Gene transfer vectors for the therapy of autoimmune diseases and diseases involving immunopathogenesis The invention relates to a gene transfer vector which comprises at least one nucleic acid molecule which comprises a first nucleic acid sequence, encoding one or more apoptosis-inducing ligand(s), a second nucleic acid sequence, encoding one or more antigen(s), and, where appropriate, a third nucleic acid sequence, encoding one or more antiapoptosis molecule(s), and, where appropriate, a fourth nucleic acid sequence, encoding one or more suicide enzyme ( s ) .
The development of autoimmune diseases, such as multiple sclerosis (MS) or diabetes (type 1), is due to an uncontrolled activation of immune cells, which attack the healthy cells in the body and destroy them. T lymphocytes, which recognize fragments of endogenous proteins in connection with endogenous MHC (major histocompatibility complex) molecules, are crucially involved in the pathogenesis of autoimmune diseases. T helper cells (CD4+/CD8-) , which recognize a combination of peptide and MHC
Class II, have a key function in immunopathogenesis since they stimulate the induction of autoreactive antibodies and immune cells by secreting a variety of cytokines. Proteins which are of cellular or viral origin, and which are synthesized in cells, are degraded intracellularly in proteasomes and presented on the cell surface, together with MHC Class I molecules, to the T lymphocytes. These cells are specifically recognized by cytolytic T cells (CD4-/CD8+) and eliminated.
Normally, T cells which recognize endogenous proteins are either eliminated (clonal deletion) or inactivated (anergy).
The consequence is tolerance to cells and structures which are intrinsic to the body. In autoimmune diseases, this tolerance is disturbed or inadequate. Autoimmune diseases are possibly induced by viral or bacterial infections. It is assumed that, because of similarities between pathogen-specific and cell-type-specific proteins, uninfected cells are also attacked by pathogen-specific antibodies or T cells.
In connection with chronically persisting viral infections, inflammatory processes, some of which affect essential organs such as the liver (hepatitis), also occur, even though the immune response is primarily directed against pathogen-specific structures. Such cases are said to involve immuno-pathogenesis, since the damage and symptoms are primarily caused by the body's own immune system and not by the pathogen. A comparable situation is seen when transplanted organs are rejected. In this case, a combination of the donor's foreign MHC molecules and cellular proteins, with which the molecules are complexed, is recognized by the recipient's T cells as being foreign.
In accordance with present day knowledge, autoimmune diseases and other diseases involving immunopathogenesis are treated by a powerful immunosuppression and/or by administering cytokines which have a regulatory effect, such as interferon A large number of different preparations, provided by a variety of manufacturers, are available for classical chemotherapy using immunosuppressive agents, with these preparations differing importantly in their areas of application and their modes of action. A particularly serious disadvantage of these substances is the occurrence of many and various, and in some cases life-threatening, side-effects (inter alia kidney damage, liver damage, inflammation of the pancreas, anemia and fever), with these side-effects being observed in a large number of patients. Such a nonspecific inhibition of the immune system (e.g. with cyclosporin or FK506) not only leads to a greatly attenuated immune defense, and consequently to increased susceptibility to infectious diseases, but also favors the development of tumors. For example, the risk of being affected by Epstein Barr virus-associated tumors is increased many times following organ transplantations, where life-long immunosuppression is required. The use of immunotherapeutic agents (e. g.

interferons) represents a marked improvement on classical chemotherapy since it leads to fewer side-effects. However, it is not possible to cure autoimmune diseases even with these novel immunotherapeutic agents, since they do not act specifically.
Antigen-presenting cells (APCs) play an important role both in eliciting a T cell response and in inducing T cell tolerance. The induction of an extensive activation and multiplication of T cells is dependent on two signals which the T cell has to receive. The first signal is conducted into the T cell by the T cell receptor which recognizes an antigen in connection with MHC on the surface of APCs. In the absence of the second signal, i.e. what is termed the costimulatory signal, the T cell becomes anergic. Anergy describes a state in which the T cells are not reactive and do not multiply.
APCs are additionally able to influence the function of T
helper cells and to steer their properties either in the direction of the Th(T helper cell)1 phenotype or in the direction of the Th2 phenotype and thereby, for example, promote the development of autoimmune diseases. The combination of the different functions of the antigen-presenting properties of the APCs determines the profile of the T helper cell response. For this reason, APCs are able to control whether an immune response proceeds immunogenically or tolerogenically.
Fas is expressed on the surface of cells and mediates apoptosis after it has interacted with the specific ligand Fast or after it has bound an anti-Fas antibody which has an agonistic effect. What is termed the "activation-induced cell death" (AICD) of T cells, i.e. their programmed cell death after the cells have been activated, is induced by an autocrine feedback following the interaction of Fas and Fast on one and the same activated T cell, an event which underlines the importance of Fas-associated apoptosis for the maintenance of T cell tolerance.
The Fas-mediated apoptosis of APCs plays a role in the f downregulation of immune responses. Activated T cells express increased quantities of Fas ligand and in this way induce apoptosis in the APCs. On the other hand, activated macrophages also express Fas ligand and are able, for their part, to induce apoptosis in the T cells. Thus, a large quantity of Fas ligand on HIV-infected macrophages is, for example, taken to be connected with the depletion of HIV-specific CD4+ T cells.
The importance of Fas-dependent apoptosis for maintaining T
cell tolerance and avoiding autoimmune diseases has been demonstrated, inter alia, by the fact that mutations which affect the genes for Fas and the ligand of Fas, i.e. FasL, respectively, lead to the development of autoimmune diseases in 1pr/lpr and g1d/g1d mice, respectively. g1d/g1d and lpr/1pr respectively designate mice which are homozygous for inactivating mutations for Fast and Fas, respectively. Both the clonal deletion of T cells in the periphery of the body, and the maintenance of T cell tolerance to the body's own antigens (autoantigens) and superantigens are disturbed in lpr/1pr mice. Using a Fas gene which is artificially introduced into, and then expressed in, the T cells to correct the Fas-associated apoptosis defect in these cells can prevent the development of autoimmune diseases in Ipr/lpr mice.
Fas-mediated apoptosis also plays a crucial role in the maintenance of immunoprivileged sites in the body. The immunoprivileged state of the testes and the anterior chamber of the eye require Fas ligand to be strongly expressed on the corresponding parenchymal cells of these organs. In these cases, it is assumed that the expression of Fas ligand on the parenchyma) cells protects these tissues from destruction by T cells by inducing apoptosis in the T cells. A viral infection in the anterior chamber of the eye leads to systemic T cell tolerance towards the virus. It is assumed that APCs which present the Fas ligand together with privileged antigens, which are derived from the privileged cells, on their cell surfaces induce apoptosis of T cells in the peripheral areas of the body and thereby bring about systemic T cell tolerance.
In 1998, Zhang et a1. (Zhang et a1. (1998) Nat Biotechnol 16:1045-1049) demonstrated for the first time that Fas ligand (FasL)-producing antigen-presenting cells (APCs) induced antigen-specific T cell tolerance in a mouse model. It was possible to produce T cell tolerance in mice using antigen-presenting cells which, as a result of being infected with an adenoviral vector, encoded adenoviral proteins in addition to Fast. The T cell tolerance was specific for adenovirus proteins and had no effect on an infection with mouse cytomegalovirus. In a subsequent infection with an adenovirus, mice which had been treated with the APCs exhibited markedly prolonged persistence of the virus in the liver, in conformity with a suppressed T cell response against adenovirus-infected cells. Furthermore, the T cell tolerance was dependent on the function of the Fas ligand since it was not possible to induce any tolerance in Fas-negative mice. A year later, the same research group published experiments, which were likewise carried out in a mouse model, on the induction of T cell tolerance toward alloantigens (Zhang et a1. (1999) J Immunol 162: 1423-1430).
A further year later, the research group published experiments which demonstrated that it was possible to use Fast-expressing, antigen-presenting cells to prevent or treat chronically inflammatory diseases as occur, for example, following an infection of Fas-deficient mice with mouse cytomegalovirus (Zhang et a1. (2000) J Clin Invest 105: 813-821). In this experimental approach as well, the therapy was based on inducing an antigen-specific, in this case mouse cytomegalovirus-specific, T cell tolerance. For the above described experiments, Zhang et a1. used adenoviral vectors, which have the advantage of a high infection rate and ensure satisfactory gene expression.
However, adenoviral vectors suffer from crucial disadvantages precisely for use in humans; the foremost of these is the expression of antigenic viral proteins, which has so far thwarted gene therapy approaches using adenoviral vectors.
Since adenoviral vectors express regulatory and structural proteins, the transduced cells are recognized by the immune system, independently of the deliberately expressed antigens, and eliminated. In order to avoid this reaction, the mice described in the experiment had previously been made tolerant to adenoviral proteins using appropriate Fast-positive APCs which were expressing adenoviral proteins. A corresponding approach to making the immune system tolerant toward a potential viral pathogen is not suitable for humans.
The problem of the autocrine induction of apoptosis by interaction of the artificially expressed Fast molecules with the corresponding apoptosis receptors on the surface of the APCs was ignored in the above-described experiments. In the experiments of Zhang et al. (Zhang et a1. (1998) Nat Biotechnol 16: 1045-1049; Zhang et a1. (1999) J Immunol 162:
1423-1430; Zhang et a1. (2000) J Clin Invest 105: 813-821), Fas-deficient APCs were infected with vectors expressing the Fas ligand. For an efficient therapeutic application, it is imperative to protect the altered, antigen-presenting cells from an autocrine stimulation of apoptosis and, at the same time, to be able to avoid an uncontrollable immortalization or even a transformation of the cells in the direction of a tumor cell.
Furthermore, all the previous experiments have ignored the problem of an unintentional stimulation of the immune system resulting from expression of the antigen, for which T cell tolerance is to be induced, without any simultaneous expression of apoptosis-inducing ligands.
An object of the present invention is therefore the provision of means for preventing or treating autoimmune diseases and diseases involving immunopathogenesis.
The object is achieved by the subject matter defined in the patent claims.

- 7 _ The invention is explained by the following figures.
Figure 1 shows, in diagrammatic form, the results of an infection of mouse macrophages with an adenovirus which is expressing Fast. Macrophages from CD95-deficient B6 mice were purified and infected with adenoviruses which were expressing either LacZ (AdLacZ, Ad/CV; Fast control) or Fast (AdFasL, Ad/FL). (A) FACS was used to investigate the expression of Fast on AdFasL-infected and uninfected macrophages. The histogram shows the number of infected cells and the strength of the Fast expression (Y axis, number of fluorescent cells;
X axis, strength of the fluorescence, determined using a fluorescence-coupled anti-Fast antibody). (B) SlCr release test for determining the ability of the infected, FasL-expressing cells to induce apoptosis in target cells. The macrophages which were infected with the two different adenoviruses, and/or uninfected control macrophages, were incubated with Slchromium- labeled, Fas+ target cells (A20 cells) and the lysis of the target cells was quantified by the release of Slchromium into the culture supernatant.
Counts: number of Fast-expressing cells; FL2-H/PE: strength of Fast expression; specific lysis (~): release of Slchromium as related to a positive control in which maximum Slchromium release was achieved by lyzing cells with SDS; E/T ratio:
ratio of effector cells (infected macrophages) to target cells (A20 cells); M~-Ad/CV: macrophages infected with AdLacZ (adenovirus which is expressing LacZ); MPG-Ad/FL:
macrophages infected with Ad-Fast (adenovirus which is expressing FasL); M~-FL: macrophages transfected with a Fast-expressing plasmid;
Figure 2 shows, in diagrammatic form, the result of inhibiting the allogenic stimulation of T cells by FasL-expressing antigen-presenting cells. Macrophages were isolated from B6 1pr/Zpr mice and infected with adenoviruses which were expressing either LacZ (AdLacZ) or Fast (AdFasL).
The infected macrophages were cocultured with T cells from either (A) Fas-expressing B6 +/+ mice or (8) Fas-deficient B6 lpr/lpr mice and the stimulation of the T cells was measured s.

_g_ by incorporating 3H-thymidine (mixed Lymphocyte reaction, MLR). M~-CV: macrophages which are infected with AdLacZ
(adenovirus which is expressing LacZ); MQ~-FL: macrophages which are infected with Ad-Fast (adenovirus which is expressing FasL).
Figure 3 shows, in diagrammatic form, the result of quantitatively analyzing the inflammation reaction in the lung, the kidney and the liver. B6+~+ and B6 g1d/g1d mice were infected intraperitoneally with mouse cytomegalovirus (1 x 105 pfu) and the degree of inflammation and of tissue damage in the lung (upper panel), the kidney (middle panel) and the liver (lower panel) was then assessed in accordance with a relative scale of from 0 (no inflammation and/or damage) to 4 (strongest inflammation and/or damage). The thick lines in the display represent the mean value ~ standard deviation of the results from at least 5 mice at each investigation time.
Figure 4 shows, in diagrammatic form, the result of decreasing the inflammations in the lung, the kidney and the liver in mouse cytomegalovirus-infected mice which had been treated, prior to the infection, with AdFasL-infected antigen-presenting cells (APCs). B6 gId/g1d mice and B6 lpr/1pr mice were infected with mouse cytomegalovirus and, at 28 days after infection, treated with APCs which had either been infected with Ad-CMVLacZ (Fast negative control), with mouse cytomegalovirus (APC + MCMV), with AdFasL (Fast positive control) or with mouse cytomegalovirus and AdFasL
(MCMV + AdFasL). The mice were treated four times with the APCs at intervals of three days and examined four weeks after the APC therapy had commenced. Lung, kidney and liver were stained with hematoxylin and eosin and assessed by three independent individuals. The thick lines in the display represent the mean value ~ standard deviation of the inflammation reaction in the different organs in the variously treated mice. Lung gld and lung lpr: lung from B6 gId/g1d mice and B6 Ipr/1pr mice, respectively; liver gld and liver lpr: liver from B6 g1d/g1d mice and B6 1pr/lpr mice, respectively; kidney gld and kidney lpr: kidney from B6 _g-gld/g1d mice and B6 1pr/1pr mice, respectively; APC-AdLacZ:
antigen-presenting cells infected with an adenovirus which is expressing LacZ; APC+MCMV: antigen-presenting cells which are infected with mouse cytomegalovirus; APC-AdFasL: antigen-s presenting cells which are infected with an adenovirus which is expressing Fast; APC-AdFasL+MCMV: antigen-presenting cells which are infected with mouse cytomegalovirus and with an adenovirus which is expressing Fast: * designates mean values which differ significantly from the control group based on a confidence interval of 95~ (P < 0.05).
Figure 5 shows, in diagrammatic form, the result of an experiment for ascertaining the quantity of reactive T cells which are specific for mouse cytomegalovirus from cytomegalovirus (MCMV)-infected mice which, prior to the infection, had been treated with AdFasL-infected antigen-presenting cells (APCs). B6 1pr/1pr mice were infected with mouse cytomegalovirus and treated with different APCs as described in figure 4. Spleen cells were isolated from the MCMV-infected mice 4 weeks after the APC therapy. The T cells were stimulated in vitro with MCMV-infected APCs and the IL-2-containing supernatant was isolated after 48 hours. APC-AdLacZ: antigen-presenting cells which are infected with an adenovirus which is expressing LacZ; APC-AdFasL: antigen-presenting cells which are infected with an adenovirus which is expressing Fast; APC-AdFasL+MCMV: antigen-presenting cells which are infected with mouse cytomegalovirus and with an adenovirus which is expressing Fast; * denotes mean values which differ significantly from the control group based on a confidence interval of 950 (P < 0.05).
Figure 6 shows, in diagrammatic form, the result of a decreased production of autoantibodies in cytomegalovirus (MCMV)-infected mice which, prior to infection, had been treated with AdFasL-infected antigen-presenting cells (APC).
B6 g1d/g1d mice were infected with mouse cytomegalovirus and treated with different APCs as described in figure 4. Sera were isolated from the MCMV-infected mice 4 weeks after the APC therapy. RF IgGl: rheumatoid factor; dsDNA IgGl:

autoantibodies directed against double-stranded DNA; APC-AdLacZ: antigen-presenting cells which are infected with an adenovirus which is expressing LacZ; APC-AdFasL: antigen-presenting cells which are infected with an adenovirus which is expressing Fast; APC-AdFasL+MCMV: antigen-presenting cells which are infected with mouse cytomegalovirus and with an adenovirus which is expressing Fast; * denotes mean values which differ significantly from the control group based on a confidence interval of 95~ (P c 0.05).
Figure 7 shows human macrophages which have been infected with an adenovirus which is expressing LacZ. The virus infected macrophages were identified using an X-Gal stain, which detects (3-galactosidase (LacZ) in the infected cells by means of its catalytic properties.
Figure 8 shows, in diagrammatic form, the results of an experiment for demonstrating the modulating influence of IL-10 .and tumor necrosis factor (TNF) on the function of dendritic cells (DC) as antigen-presenting cells. Dendritic cells were generated from peripheral blood mononuclear cells in vitro by treating them with IL-4 and GM-CFS. The DCs were treated either with TNF or IL-10 and subsequently incubated with allogenic T cells; the stimulation and multiplication of the T cells were then measured by incorporating 3H-labeled thymidine. APC: antigen-presenting cells; DC (TNF): dendritic cells which have been stimulated with tumor necrosis factor (TNF); DC (IL-10): dendritic cells which have been stimulated with interleukin-10 (IL-10); alto T cells: T cells from a donor possessing an allogenic MHC pattern, i.e. an MHC
pattern which differs from that of the DCs. The X axis shows the quantity of APCs which were used in the reaction. The Y
axis shows the radioactive disintegrations per minute (CPM) as a measure of the incorporation of the radioactively labeled nucleotide or as a measure of the stimulation of the T cells.
Figure 9 shows, in diagrammatic form, the results of an experiment for demonstrating an allogen-specific suppression by tolerizing antigen-presenting cells (APCs). Dendritic cells were generated from peripheral blood mononuclear cells in vitro by treating them with IL-4 and GM-CFS. The DCs were treated with either TNF or IL-10 and subsequently incubated with allogenic T cells. Five days later, the T cells from this reaction were incubated with antigen-presenting cells from a third allogenic donor and the stimulation and multiplication of the T cells were measured by the incorporation of 3H-labeled thymidine. A, B and C denote donors possessing different (allogenic) MHC patterns; MLR:
mixed lymphocyte reaction. The Y axis shows the radioactive disintegrations per minute (CPM) as a measure of the incorporation of the radioactively labeled nucleotide or as a measure of the stimulation of the T cells. The compositions of the first stimulation reaction (1st MLR) and the second reaction (2nd MLR) are given under the individual bars.
Figure 10 shows, in diagrammatic form, the construction of the vectors according to the invention, i.e. (A) pcDNA3-TK-IRES-crmA and (B) pcDNA3-Fast-IRES-PLP. Coding reading frames, such as the nucleic acid sequence for the Fas ligand (FasL), the proteolipid protein (PLP), the thymidine kinase (TK) and crmA, and for resistance proteins such as neomycin and ampicillin, are marked with light arrows. Eukaryotic promoter elements which have regulatory activity, such as the CMV promoter and the SV40 promoter, are depicted by dark arrows, while prokaryotic promoters, such as the SP6 promoter and the T7 promoter, are depicted by thin bent arrows.
Cleavage sites for selected restriction endonucleases, such as BamHI, EcoRI, XhoI and HindIII, are identified with the name of the nuclease. Regulatory nucleic acid sequences, such as the SV40 virus polyadenylation sequence (SV40polyA) and the IRES, i.e. the internal ribosome binding site, are marked by thin bars.
The expressions "vector" or "gene transfer vector" which are used here denote naturally occurring or artificially created organisms and constructs for the uptake, replication, expression or transfer of nucleic acids in cells. Viruses, such as retroviruses, adenoviruses, adeno-associated viruses, poxviruses, alphaviruses or herpesviruses are examples of vectors. Bacteria, such as listerias, shigellas or salmonellas, are also examples of vectors. Liposomes or naked DNA, such as bacterial plasmids, virus-derived plasmids, phagemids, cosmids, bacteriophages or artificially prepared nucleic acids, such as artificial chromosomes, are further examples of viruses.
The expression "apoptosis receptor" which is used here denotes polypeptides which are located in the cytoplasmic membrane of cells and which initiate apoptosis in the cell following interaction with, and activation by, a specific ligand. Examples of apoptosis receptors are polypeptides which belong to the subfamily of tumor necrosis factor receptors which are characterized by cytoplasmic death domains, for example CD95/Fas/Apol, TRAIL-R1, TRAIL-R2 and Apo3.
The expressions "ligand" or "apoptosis-inducing ligand" or "apoptosis ligand" which are used here denote a membrane-located polypeptide which can interact with apoptosis receptors. The binding of the ligands to the apoptosis receptors activates the receptors and induces apoptosis in the cells which are carrying the receptors. Examples of apoptosis ligands are CD95L/FasL/ApolL, TRAIL and Apo3L.
The expression "antiapoptosis molecules" which is used here denotes polypeptides which inhibit apoptosis in the cell.
These polypeptides may be of cellular or viral origin.
Antiapoptosis molecules furthermore denote nucleic acid molecules, including nucleic acids which are complementary to nucleic acids, which encode apoptosis-inducing polypeptides.
The expression "antigen" which is used here denotes polypeptides which comprise either a complete protein or parts of a protein which include single or several T cell epitopes and, after proteolytic processing by the cell, are presented by MHC molecules and bound by T cell receptors.

The expression "suicide enzyme" which is used here denotes polypeptides which convert substances, which are only slightly toxic or are not toxic, into toxic substances or alter them in such a way that they can be used or converted by enzymes in the cell.
The expression "IRES" which is used here denotes viral nucleic acid sequences which enable binding of functionally active ribosomes to take place, independently of the cellular regulatory sequences, such as the 5'-Cap structure. IRES
sequences are characterized by a strong secondary structure.
IRES sequences have been described, for example in picorna-viruses.
An object of the present invention is to enable a selective, antigen-specific immunotherapy to be achieved in cases of autoimmune diseases and diseases involving immunopathogenesis. Individual T cell clones possessing defined specificity for cellular or pathogen-specific proteins are to be eliminated and immulological tolerance toward an antigen thereby generated or restored.
The invention relates to a gene transfer vector which comprises at least one nucleic acid molecule which comprises a first nucleic acid sequence, which encodes one or more apoptosis-inducing ligand(s), a second nucleic acid sequence, which encodes one or more antigen(s), and, where appropriate, a third nucleic acid sequence, which encodes one or more antiapoptosis molecule(s), and, where appropriate a fourth nucleic acid sequence, which encodes one or more suicide enzyme(s). Preference is given to a gene transfer vector which comprises a nucleic acid molecule which comprises the first three, or all four, or the first two and the fourth, nucleic acid sequences. Preference is furthermore given to a gene transfer vector which comprises two nucleic acid molecules, with the first and second nucleic acid sequences being present on a first nucleic acid molecule and the third and fourth. nucleic acid sequences being present on a second nucleic acid molecule. Particular preference is given to a gene transfer vector, with the first and second nucleic acid sequences being functionally linked to each other such that the expression of the second nucleic acid sequence is dependent on the expression of the first nucleic acid sequence and/or the third and fourth nucleic acid sequences being functionally linked to each other such that the expression of the fourth nucleic acid sequence is dependent on the expression of the third nucleic acid sequence.
The gene transfer vectors according to the invention can be used for treating autoimmune diseases and other diseases which are due to immunopathogenesis. Immunopathogenesis denotes damage to cells, tissues or organs which is caused by cellular or humoral immune mechanisms, i.e. by lymphocytes or antibodies or complement-mediated mechanisms. The vectors according to the invention can be used to recombinantly alter cells of the body ex vivo. By means of these gene therapy vectors, the cells which are to be modified obtain a number of new properties which make them suitable for treating autoimmune diseases and other diseases which are due to immunopathogenesis. Within the meaning of this invention, suitable denotes that the modified cells are able to attract the immune cells which are involved in the pathogenesis, to recognize these cells specifically and to destroy them by inducing apoptosis.
The vectors according to the invention can be based on a large number of vector systems which are nowadays available and which are able to carry a number of different genes or functional regions and express the corresponding gene products in eukaryotic cells. In the case of vectors which are based on viral systems, nucleic acid sequences are packaged into these vectors using packaging cell lines or other in vitro systems. The vectors can then either penetrate into the cells actively or be taken up by these cells.
Nonviral vectors are introduced into the target cells by way of a variety of transfer processes which are based on physical and biological mechanisms. An important property of the vectors according to the invention is that no viral proteins, or other proteins which are connected with the vector system, which might interfere with the function of the cells modified by the vector systems are synthesized in the modified cells. Within the meaning of the invention, an expression of viral or other proteins would be harmful if the modified cells, which produce these proteins, are recognized and destroyed by immune cells. Within the meaning of this invention, this recognition would be harmful if it thereby impairs the natural function of the immune system in recognizing and destroying viral or bacterial pathogens, degenerate cells or other cells or pathogens which are normally recognized by the immune system. It is also harmful if it thereby restricts the efficiency of the cells in destroying the immunopathogenic immune cells.
The cells which have been modified by means of the vectors according to the invention, which vectors comprise the combination according to the invention of nucleic acid sequences, express antigens which are recognized by immunopathogenic immune cells. These immunopathogenic cells play a particular role for the pathogenesis of a defined disease since they specifically recognize (endogenous) antigens and coordinate an immune reaction against these antigens and the antigen-expressing cells. The antigens which are introduced into the cells together with the vectors according to the invention can be specific for particular diseases or specific for the affected organ or tissue or the affected cell type. The vectors according to the invention additionally encode apoptosis-inducing ligands. These apoptosis-inducing ligands induce natural cell death in the immunopathogenic immune cells which recognize the antigens.
The vectors according to the invention may encode one or more different apoptosis-inducing ligands. The modified cells only recognize and destroy those immune cells which recognize the artificially synthesized antigenic epitope and therefore physically come into contact with the modified cells.
The nucleic acid sequences which are responsible for inducing the apoptosis (apoptosis-inducing ligands) and the nucleic acid sequences which encode the antigenic polypeptides (antigens) can be functionally coupled or linked to each other at the transcriptional level such that it is not possible for the antigens to be expressed without the apoptosis-inducing ligands being expressed. This greatly increases the safety of the vectors according to the invention since this thereby prevents it from being possible for the disease-causing immune cells to recognize the altered cells, and for the immune cells to be thereby stimulated, without apoptosis being simultaneously induced in these latter cells.
The nucleic acid sequences in the vectors according to the invention can additionally carry genes or functional regions which prevent the cells which have been altered by the vector according to the invention from themselves initiating apoptosis, by way of autocrine mechanisms, and in this way destroying themselves (antiapoptosis molecules). This greatly increases the efficiency of the vectors and of the altered cells. The genes or functional regions either encode regulators of the activity of apoptosis-inducing factors or prevent them being expressed.
Where appropriate, the vectors according to the invention can additionally comprise nucleic acid sequences (suicide genes) which encode polypeptides which make it possible, if desired, to eliminate the recombinantly modified cells after they have been reinfused into the body. A functional coupling which is comparable to the functional coupling of the nucleic acid sequences which encode the antigen and the apoptosis-inducing ligands can be present in the case of the nucleic acid sequences which encode the antiapoptosis molecules and the suicide enzymes. This coupling ensures that cells which can no longer be eliminated from the body on account of the antiapoptosis molecules can be removed by the function of the suicide enzymes.
The nucleic acid sequences for the antiapoptosis molecules and the suicide enzymes can be located on the same nucleic acid molecule on which the nucleic acid sequences for the apoptosis-inducing ligands and the antigens are located, or they can be located on a different nucleic acid molecule.
The invention furthermore relates to a gene transfer vector as a therapeutic agent. The invention furthermore relates to the use of the gene transfer vectors for producing a therapeutic composition for preventing or treating autoimmune diseases, e.g. rheumatoid arthritis, systemic lupus erythematodes, Sjogren's syndrome, polymyositis, dermatomyositis, polymyalgia rheumatica, temporal arteritis, spondylarthropathies, such as Bechterew's disease, Crohn's disease, ulcerative colitis, celiac disease, autoimmune hepatitis, type I diabetes mellitus, adrenal insufficiency, thyroiditis, psoriasis, dermatitis, herpetiformis, pemphigus vulgaris, alopecia, multiple sclerosis and myasthenia gravis, or for preventing or treating chronically inflammatory processes which are due to immunopathogenesis, for example chronic inflammations following viral or bacteria l infections, such as chronic hepatitis in the case of hepatitis B virus or hepatitis C virus infections, or encephalitis following infection with the measles virus, and for preventing or treating transplant rejections.
The invention furthermore relates to the use of gene transfer vectors for the ex vivo modification of eukaryotic cells, in particular animal or mammalian cells, in particular human cells.
Retroviral vectors Preference is given to the gene transfer vectors being retroviral vectors and, in particular, vectors which are based on lentiviruses. These constitute a suitable platform for developing efficient vectors for transferring nucleic acids into cells. The insertion of a desired foreign gene into a suitable vector, and the packaging into retroviral particles, can be carried out using methods which have already been described in detail, and are state of the art.
The recombinant viruses which are produced are subsequently isolated and incubated in vivo or ex vivo with the desired target cells. A large number of different retroviral systems have thus far being described, with these systems being suitable for transferring the combinations of nucleic acids according to the invention. Preference is therefore given to using retroviral, and, in particular, lentiviral, gene transfer vectors for transferring the combinations of nucleic acid sequences according to the invention into eukaryotic cells.
Retroviral gene transfer vectors according to the invention can be based on a variety of retroviruses such as type B, C
or D retroviruses and also spumaviruses and lentiviruses.
Examples of representatives of suitable retrovirus families are those which are described on pages 2-7 in "RNA Tumor Viruses" and also a large number of xenotrophic retroviruses, such as NZB-X1, NZB-X2 and NZB9-1, and polytrophic retroviruses, such as MCF and MCF-MLV. These retroviruses can be obtained from stocks or collections, such as the American Type Culture Collection ("ATCC", Manassas, Va.), or can be isolated from biological material using current and published molecular biological techniques.
Retroviruses which are particularly suitable for preparing retroviral gene transfer vectors comprise representatives from the group of avian leukemia viruses, bovine leukemia viruses, mouse leukemia viruses, mink cell focus-inducing viruses, mouse sarcoma viruses, gibbon leukemia viruses, cat leukemia viruses, reticuloendothelial viruses and Rous sarcoma viruses. Mouse leukemia viruses such as the representatives 4070A and 1504A, Abelson (ATCC No. VR-999), Friend (ATCC No. VR-245), Graffi, Gross (ATCC No. 590), Kirsten, Harvey sarcoma virus and Rauscher (ATCC No. VR-998), and also the Moloney mouse leukemia virus (ATCC No. VR-190), are particularly suitable. The Rous sarcoma virus, including Bratislava, Bryan high titer (e. g. ATCC Nos. VR-334, VR-657, VR-726, VR-659 and VR-728), Bryan Standard, Carr-Zilber, Engelbreth-Holm, Harris, Prague (e.g. ATCC Nos. VR-772 and 45033) and Schmidt-Ruppin (e.g. ATCC Nos. VR-724, VR-725 and VR-354), are also particularly suitable.
In the case of special applications, which are described in the invention, components of the nucleic acid molecules in the retroviral gene transfer vectors can also be derived from other retroviruses than those which are listed. For example, retroviral vector long terminal repeat (LTR) regions can be derived from the mouse sarcoma virus while the tRNA binding site can be derived from the Rous sarcoma virus, the packaging signal from the mouse leukemia virus and the origin for the second strand DNA synthesis from the avian leukemia virus.
It is furthermore possible to use nucleic acid molecules for retroviral vectors which contain a 5' LTR, a tRNA binding site, a packaging signal, one or more heterologous sequences, an origin of second strand DNA synthesis, and a 3' LTR, with the nucleic acid molecule not containing any sequences encoding Gag/Pol or Env. LTRs contain three elements, i.e.
the U5, R and U3 regions. These elements contain a large number of signals which are of importance for the biological activity of retroviruses, for example promoters and enhancer elements which are located in the U3 region. LTRs within a provirus can be characterized unambiguously with the aid of the characteristic sequence duplications at the ends of the genome. The 5' LTRs which are preferably used in the present invention contain a 5' promoter element and a minimal LTR
sequence which enables the vector nucleic acid to be reverse-transcribed and integrated into the genome of the target cell. The 3' LTR region contains a polyadenylation signal and LTR sequences which are required for the reverse transcription and integration of the vector nucleic acid into the genome of the target cell.
The tRNA binding site and the origin of the second strand DNA
synthesis are required for biological activity, and the identification of these components is state of the art. For example, retroviral tRNAs bind, by means of Watson-Crick base pairing, to a tRNA binding site and are packaged into the virus particles together with the retroviral genome. The tRNA
is then used by the reverse transcriptase as a primer for the DNA synthesis. The tRNA binding sequence is located immediately downstream of the 5' LTR and can be readily identified by its location. In the same way, the origin of the second strand DNA synthesis is of great importance for retroviral second strand DNA synthesis. This region, which is termed a polyuridine tract, is located directly upstream of the 3' LTR.
In addition to the 5' and 3' LTRs, the tRNA binding sequence and the origin of second strand DNA synthesis, the nucleic acid sequences in retroviral gene transfer vectors can contain a packaging signal and, in addition to this, one or more heterologous sequences which are described in detail below.
For example, use is made of retroviral gene transfer vectors which do not possess nucleic acid sequences encoding Gag/Pol or Env. For example, retroviral gene transfer vectors which do not possess any sequences encoding Gag/Pol or Env can be produced by preparing vector constructs which possess an extended packaging signal. The term "extended packaging signal" defines a nucleotide sequence which exceeds the minimal sequence which is required for specifically packaging nucleic acids. Use of the extended packaging sequence makes it possible to prepare virus stocks which have a higher titer, with this being due to an increased quantity of RNA
being packaged. For example, the minimal packaging signal of the Moloney mouse leukemia virus (Mo-MLV) is encoded by a sequence which begins at the end of the 5' LTR and contains the Pst I cleavage site. The extended packaging signal of Mo-MLV contains sequences beyond nucleotide 567, including the start of the Gag/Pol gene (nucleotide 621), and ends beyond nucleotide 1560. Therefore, a retroviral gene transfer vector which does not possess any extended packaging signal can be prepared from Mo-MLV by deleting the sequence extending beyond nucleotide 567.
It is furthermore possible to use nucleic acid sequences, for retroviral gene transfer vectors, in which the packaging signal partially or entirely overlaps the retroviral Gag/Pol sequence but has nevertheless been completely deleted or truncated upstream of the start codon of the Gag/Pol gene. It is furthermore possible to use nucleic acid sequences, for retroviral gene transfer vectors, which contain a packaging signal which is extended in the 5' region upstream of the start of the Gag/Pol gene. If these retroviral vectors are used, preference should be given to using packaging cell lines, for producing the recombinant virus particles, in which the 5' terminal end of the Gag/Pol gene in a Gag/Pol expression cassette is modified such that it exhibits a codon usage in the Gag gene which is modified and which differs from the wild-type HIV-1 Gag sequence.
It is furthermore possible to use nucleic acid sequences, for retroviral gene transfer vectors, which possess a 5' LTR, a tRNA binding site, a packaging signal, an origin of second strand DNA synthesis and a 3' LTR region, with the nucleic acid sequence not possessing any retroviral nucleic acid sequence upstream of the 5' LTR. These vectors do not possess any Env-encoding sequence upstream of the 5' LTR. It is furthermore possible to use nucleic acid sequences, for retroviral gene transfer vectors, which contain a 5' LTR, a tRNA binding sequence, a packaging signal, an origin of second strand DNA synthesis and a 3' LTR but which do not contain any retroviral packaging signal sequence downstream of the 3' LTR. The term "packaging signal sequence", which is used here, defines a sequence which is required for packaging an RNA genome.
Suitable packaging cell lines for establishing the abovementioned retroviral gene transfer vectors are already available and have been used many times for preparing cell lines (also termed vector cell lines) for producing recombinant vector particles.

Among the retroviral vectors, lentiviral vectors are particularly suitable for transferring the combinations, according to the invention, of nucleic acid sequences since they are able to insert nucleic acid sequences into a large number of resting and postmitotic cells, such as neuronal cells, liver cells, muscle cells and hematopoietic stem cells, and to cause the sequences to be expressed. The lentiviral vector particles can be produced by the triple infection of mammalian cells with (i) a Gag/Pol expression vector, (ii) a transfer construct which contains the packaging signal, the foreign nucleic acid sequences) and the flanking LTRs, and (iii) an expression vector for a coat protein. In this connection, it is possible to use coat proteins from various amphotrophic or xenotrophic retroviruses and also other viruses, such as the coat proteins of the Moloney mouse leukemia virus (Mo-MLV) and the MLV isolate 4070A, and also the vesicular stomatitis virus (VSV) G glycoprotein or the rabies G glycoprotein. Lentiviral vectors which have been prepared in this way are able to stably transfect a large number of different cells.
Lentiviral vectors which contain the central polyuridine tract and the terminator sequence of the HIV Pol gene exhibit an increased transduction efficiency, with this increased efficiency being due to an improved nuclear translocation of the vector.
In order to improve the safety of lentiviral gene therapy vectors, it is possible to prepare different functional packaging constructions containing deletions in the accessory HIV-1 and/or SIV-1 genes Vif, Vpr, Vpu and Nef. It is furthermore possible to develop functional lentiviral vectors which no longer require the viral transactivator protein Tat.
Furthermore, in order to minimize the appearance of replication-competent recombinants, it is possible to develop self-inactivating vector systems in which, for example, an extensive segment of the U3 region in the 5' and/or 3' LTR, including the TATA box and the sites for binding the transcription factors SP1 and NF-KB, is deleted within the vector. These modifications remove a large part of the viral transcription elements. Furthermore, deleting the U3 region prevents a possible interference between the promoter located in the LTR and internal promoters and drastically reduces the danger of activating neighboring cellular genes at the site of integration of the lentiviral vector. Synthetically prepared, codon-adapted HIV and/or SIV Gag/Pol and Env genes are used, for example, to circumvent the Rev dependence of the lentiviral Gag/Pol and Env genes. Alternatively, it is possible to use constitutive transport elements (CTE) from other viruses, such as, for example, the Mason-Pfitzer monkey virus CTE or the monkey retrovirus type 1 (SRV-1) CTE, and also the hepatitis B virus post-transcriptional regulatory element (PRE) and the Rous sarcoma virus post-transcriptional direct repeat (DR) element, in order to enable the HIV/SIV
Gag, Gag/Pol and Env gene transcripts to be exported in a Rev-independent manner. These methods enable the transactive Rev protein to be excluded from the lentiviral vectors, thereby contributing to an increase in the safety of this vector type. A compilation of the lentiviral vector systems which are currently in use is given, for example, in the review by Buchschacher and Wong Staal (Buchschacher et al.
(2000) Blood 95: 2499-2504).
In addition to retroviral and lentiviral vectors, it is also possible to use a large number of other viral and nonviral gene transfer vectors which can likewise be employed for transferring the nucleic acid sequence combinations according to the invention. Since these vector systems are to be employed for generating therapeutically utilizable, recombinantly modified cell lines, the viral vector systems are modified, for safety reasons, such that they are no longer able to replicate lytically. Preference is given to the gene transfer vectors being vectors which are based on adenoviruses, adenoassociated viruses, poxviruses, alphaviruses or herpesviruses.
Adeaoviral vectors The preparation of recombinant adenoviral vectors (Ad vectors), including the E1/E3, E1/E4 and gutless vectors, is state of the art and can be carried out in accordance with published protocols. For example, (1) the desired nucleotide sequence can be inserted into a pBHGl1 plasmid in order to produce recombinant E1/E3-deleted Ad vectors following the transfection of 293 cells and subsequent intracellular recombination; (2) the desired nucleotide sequence can first of all be integrated into the E1 region of one of a large number of E1-deleted Ad vectors, and cotransfected with a ClaI-digested H5d11014 vector, and the recombinant, El/E4-deleted Ad vectors can be isolated following the transfection of 293 E4 cells and subsequent intracellular homologous recombination, and (3) the desired nucleotide sequence can first of all be inserted, together with an appropriate quantity of a stuffer sequence, e.g. which is derived, for example, from bacteriophage lambda DNA, into the ArAd plasmid in order, subsequently, to ensure efficient packaging of the recombinant gutless adenovirus vector genomes following transfection into 293 cells and infection with an HS.CBALP
helper virus. Equilibrium sedimentation in a cesium chloride gradient can be used, for example, to free the recombinant gutless adenovirus vector particles from contaminating helper viruses due to the vector particles having a lower density than the helper virus.
Adenoassociated viruses It is furthermore possible to use a variety of adeno-associated virus (AAV) vector systems, which have already been developed, for the gene transfer. A detailed description of the construction of AAV vectors has been published and is state of the art.
In recombinant AAV vectors, all the coding sequences are usually replaced with the desired heterologous nucleic acid sequences. The recombinant AAVs are prepared by cotransfecting an AAV vector, which carries the desired gene, and a helper AAV plasmid, which possesses all the essential AAV genes, into adenovirus-infected cells, which provide all the helper functions which are required for AAV replication and the production of vector particles. However, disadvantages of this vector system for use in gene therapy are the low titers of recombinant vectors and possible contaminations of the vectors with wild-type AAV and infectious helper viruses. Furthermore, the size of the foreign sequences to be integrated into AAV vectors is limited to 5 kb.
Poxviruses Alternative viral vector systems for transferring nucleic acids which encode a desired foreign gene are based on representatives of the poxvirus family, including the vaccinia viruses and avian poxviruses. Vector systems of this nature are prepared as will now be described using the example of recombinant vaccinia viruses. The DNA encoding the desired gene is first of all integrated into a suitable vector such that it is located in the vicinity of a vaccinia promoter and a flanking vaccinia DNA sequence such as the sequence encoding thymidine kinase (TK). This vector is then transfected into cells, with these latter simultaneously being infected with vaccinia viruses. By means of an homologous recombination, the insert containing the foreign gene is then recombined into the viral genome. The resulting TK-positive recombinants can be established by culturing the viruses on cells in the presence of 5-bromodeoxyuridine and subsequently isolating plaques.
Alternatively, it is possible to use other avian poxviruses for the gene transfer, such as fowlpox and canarypox viruses.
Recombinant avian poxviruses which are expressing immunogens derived from organisms which are pathogenic to humans can induce a protective immune response after having been administered to mammals. The use of avian poxviruses is particularly advantageous for an application in humans and other mammals since representatives of the avian pox genus only replicate productively in receptive avian species and not in mammalian cells. Methods for preparing recombinant avian poxviruses are state of the art and are based on genetic recombination mechanisms which are comparable with those which have previously been described for producing recombinant vaccinia viruses.
Alphaviruses Vectors derived from representatives of the alphavirus genus, such as Sindbis and Semliki forest viruses, can also be used for transferring the nucleotide sequences of selected genes.
The preparation and use of vectors based on Sindbis virus are state of the art and have been published many times.
Bacteria Preference is furthermore given to the gene transfer vectors being bacteria, in particular Listeria monocytogenes (Ompl, DactA, ~plcB), Shigella flexneri (~aroA, OvirG) and Salmonella typhimurium. A very promising DNA delivery system for recruiting and activating antigen-specific cells makes use of bacterial suicide vectors which are based, for example, on attenuated Listeria monocytogenes (~mpl, DaCtA, ~plcB), Shigella flexneri (DarOA, wire) and Salmonella typhimurium isolates. The preparation and use of such bacterial gene transfer systems have been published in detail and are state of the art. Thus, "suicide" strains of L.
monocytogenes are able, for example, to infect professional antigen-presenting cells selectively. After the bacteria have been taken up into the cytoplasm of the target cell, they are destroyed by means of a Listeria-specific phage lysin, resulting in the release of the plasmid DNA transported by the bacteria, with this DNA subsequently penetrating into the cell nucleus. Important advantages of this bacterial system lie in the oral administration of the bacteria and the selective introduction of plasmids into APCs, which assume a central role in inducing a cellular immune response. The suicide strains of the invasive bacteria Shigella flexneri and Salmonella typhimurium have been attenuated by deleting genes which are essential for producing metabolites involved in cell wall synthesis. After infecting mammalian cells, f these bacterial strains lyse due to the lack of these metabolites.
PZasmid DNA
Preference is furthermore given to the gene transfer vectors being plasmids. Naked plasmid DNA is suitable as a vector for the nucleic acid sequence combinations according to the invention. These expression vectors contain, by way of example, the following essential elements: one or more strong constitutive and/or inducible promoters, a transcription terminator, such as that of bovine growth hormone, an antibiotic resistance or another marker for selecting the transformed organism, the first, second and/or third and/or fourth nucleic acid sequence according to the invention, and an origin of replication which enables the plasmid to be produced in a suitable host organism. A second generation of linear DNA plasmids, i.e. what are termed the MIDGE
transfection vectors, are particularly suitable for efficiently transferring the nucleic acid sequences according to the invention. MIDGE vectors are composed of the two strands of a DNA polymer which contains an arbitrary number of the desired coding sequences and the promoter and terminator sequences which are required for expressing foreign genes, with the strands being linked, at both ends, with loops of single-stranded deoxyribonucleotides such that a covalently closed molecule is formed. Apart from the foreign genes which are desired for the medical application, together with the regulatory units which are required for an efficient expression, MIDGES do not contain any further coding sequences as are required, for example, for amplifying and selecting customary DNA transfer vectors. Thus, these vectors do not, for example, possess any Ori sequences, which contain potential integration sites, or any sequences encoding antibiotics as selection markers, which latter sequences are under the control of promoters which frequently cannot be completely shut down in mammalian cells.
The efficiency of this system for transferring genes and for achieving an improved expression of foreign genes in mammalian and human cells can be increased, in particular, by attaching a heterologous class of peptides, i.e. what are termed nuclear localization signals (NLS, nuclear localization sequences). For example, use of the NLS derived from the SV-T antigen can improve the importation into the nucleus of MIDGE-like constructs and increase the expression of foreign genes. Furthermore, specific targeting can be achieved by coupling the MIDGES to tissue-specific ligands.
Furthermore, in analogy with naked DNA, the MIDGES can be coupled to a large number of nonviral gene transfer systems in order to ensure more efficient uptake into the target cell.
Furthermore, it is possible to use gene transfer vectors which contain components of eukaryotic DNA transposons.
Transposons are naturally occurring genetic elements which are able to move from one position to the next within a chromosome. For example, representatives of the Tc1/mariner family, such as the sleeping beauty transposon, can be used for preparing suitable vectors for employment in mammalian cells. An advantage of these vectors is that it is possible to integrate multiple regulatory sequences into the vectors.
These vectors integrate into the host cell genome and enable the desired foreign sequences to be expressed continuously over a long period.
Systems for transferring nucleic acids into eukaryotic cells In addition, a large number of methods have been described for transferring genes into mammalian cells on the basis of nonviral systems. The nonviral vectors are frequently employed in combination with particle-mediated gene transfer or with viral vector systems.
In brief, the nucleic acid sequence combination according to the invention can be integrated into a conventional gene transfer vector, or a combination of several conventional gene transfer vectors, which possesses) suitable control elements for enabling the desired foreign genes) to be expressed efficiently with high yields. The vectors according to the invention can then be coupled to synthetic gene transfer molecules, for example polymeric DNA-binding rations, such as polylysine, protamine and albumin, or bound to ligands which mediate specific cell targeting, such as asialoorosomucoid, insulin, galactose, lactose or transferrin.
Furthermore, the efficiency of the uptake of naked DNA can be increased by using biologically degradable latex beads. Due to the endocytosis which is mediated by the latex beads, DNA-loaded latex beads are taken up into the target cells with an increased efficiency. The efficiency of this method can be increased by an increase in the hydrophobicity, and an improved disaggregation which accompanies this, of the beads in the endosome, resulting in the DNA being more efficiently released in the cytoplasm.
Furthermore, various liposome compositions and also immunostimulatory reconstituted influenza virosomes (IRIV, immunopotentiating reconstituted influenza virosomes) are also suitable for use as vehicles for transferring the vectors according to the invention into mammalian and human cells (US Pat. No. 5,879,685). Furthermore, foreign nucleic acid sequences can be integrated into a vector containing suitable control sequences, bound to synthetic gene transfer molecules, such as polymeric DNA-binding rations (e. g.
polylysine, protamine and albumin), and coupled to cell targeting ligands, such as asialoorosornucoid, insulin, galactose, lactose or transferrin. Another administration system is based on the packaging of sequences, which contain the desired genes under the control of different tissue-specific and/or constitutive promoters, into liposomes. In addition, the transfer of the previously described nucleic acids can be increased by combination with a photopolymerized hydrogel material. Another customary method for transferring nucleic acids is their administration using a portable particle gun, and also the use of ionizing radiation for activating the gene transfer.
Other methods for optimizing the efficiency of viral vector transduction comprise varying the multiplicity of infection (M.O.I), depleting ions, such as phosphate ions, adding polycationic substances, such as protamine sulfate, varying the contact time, the temperature and the pH, and centrifuging cells and virus or vector stocks together with each other.
The above-described gene transfer systems can be used for genetically manipulating isolated human or mammalian cells, in particular antigen-presenting cells (monocytes, macrophages, dendritic cells and B cells). If retroviral gene transfer vectors are used, the cells can be converted by stimulation into the S phase in order to make it possible to infect these cells . Cells which are in the first quarter to half of the S phase have been found to be particularly susceptible to being transfected with retroviruses.
Polypeptides possessing antigenic epitopes The vectors according to the invention are characterized by the fact that they comprise nucleic acid sequences which encode proteins, or parts of proteins or polypeptides, which are recognized by immune cells (antigens). Within the meaning of the invention, immune cells are lymphocytes which possess regulatory or cytolytic properties, such as CD8+/CD4- T cells or CD8-/DC4+ T cells or CD8-/CD4-/CD56+ killer cells (NK
cells). Within the meaning of this invention, proteins or polypeptides are proteins derived from human or animal cells.
These proteins or polypeptides are located either on the surface of the cells which are attacked, e.g. glycoproteins on cell membranes as a result of their function, or are located in the interior of the cells, e.g. regulatory proteins. These proteins or polypeptides are processed in the cell and presented to the immune cells of the body in the context of Class 1 or Class 2 MHC molecules. The proteins or polypeptides within the meaning of this invention are recognized by the endogenous immune cells and lead to a stimulation of these cells, i.e. to a multiplication of the cells, which multiplication can be measured by the release of messenger substances (IFN-y, IL2, TNF, inter alia) or by the cytolytic activity of the immune cells.
The vectors according to the invention are characterized by the fact that they comprise nucleic acid sequences which encode polypeptides which possess one or more linear or structural epitopes. These epitopes can be recognized by immunopathogenic T cells after they have been presented by way of MHC molecules. These peptide regions and epitopes can also be encoded and expressed in the context of other, immunogenic or nonimmunogenic, polypeptides, for example as fusion proteins or in the form of exchangeable cassettes in proteins, with the cassettes encoding regions or epitopes or combinations of epitopes of the proteins. Within the meaning of this invention, epitopes of the proteins are those regions of tyke proteins, or those amino acid sequences, which are recognized by immune cells such as T cells or NK cells. These epitopes can be recognized both by immune cells derived from healthy individuals and by immune cells derived from individuals suffering from autoimmune diseases.
The vectors according to the invention can be used, for example, for treating autoimmune diseases, chronically inflammatory processes which are due to immunopathogenesis, and tissue and organ rejection reactions. For example, autoreactive T cells, which recognize endogenous proteins and structures, are known to be involved in many autoimmune diseases. The vectors according to the invention can comprise nucleic acid sequences which encode and express these endogenous proteins and structures. A11 diseases where T
cells are involved in the pathogenesis and where the proteins and structures attacked by the T cells have been identified are suitable for treatment.
Rheumatologic diseases are one group of autoimmune diseases .
In rheumatoid arthritis, for example, the joints are attacked and clinical complications are joint destruction, kidney damage and amyloidosis. Systemic lupus erythematodes affects and damages various organs and tissues, such as the central nervous system and the kidneys. The Sjogren's syndrome affects exocrine glands such as salivary glands. Polymyositis and dermatomyositis are autoimmune diseases of the musculature and the skin and lead to myasthenia and paralysis. Polymyalgia rheumatica and temporal arteritis are inflammatory diseases of the blood vessels and cause myasthenia and loss of sight. Spondylarthropathies, such as Bechterew's disease, once again affect the joints and lead to rigidity.
A number of gastrointestinal diseases constitute a further group of autoimmune diseases. Crohn's disease affects the entire intestinal tract and leads to bleeding, stenoses and fistulae, and not infrequently results in the development of tumor diseases. Ulcerative colitis is an inflammatory disease of the large intestine and leads to perforation and bleeding.
Celiac disease affects both the small intestine and the large intestine and results in weight loss. Autoimmune hepatitis is an inflammatory disease of the liver with liver cirrhosis and liver transplantation as a consequence.
Endocrinological diseases can likewise be attributed to autoimmune reactions. Type I diabetes mellitus is an inflammatory disease of the pancreas and leads to diabetes and damage to the blood vessels, for example with impairment of the kidneys, of the peripheral nervous system and the eyes, and may subsequently require kidney and pancreas transplants. Adrenal insufficiency and thyroiditis are also autoimmune diseases involving T cell pathogenesis.
Furthermore, a number of skin diseases are classed as belonging to the autoimmune disease group. Some examples are psoriasis, dermatitis herpetiformis and pemphigus vulgaris:
in the case of these diseases, infections can induce complications. Alopecia leads to hair loss. Finally, there are also neurologic diseases which have to be attributed to autoimmune reactions. For example, multiple sclerosis affects the central and peripheral nervous system while myasthenia gravis affects the musculature. Paralyses can arise as complications in association with both these neurologic autoimmune diseases.
The vectors according to the invention can also be used for treating chronically inflammatory processes which are due to immunopathogenesis, for example chronic inflammations following viral or bacterial infections, such as chronic hepatitis in the case of hepatitis B virus infections or hepatitis C virus infections, or encephalitis following infection with the measles virus.
In addition, the vectors according to the invention can be used for treating tissue and organ rejection reactions. As a rule, the immune response against foreign structures on the surfaces of the cells of the organ to be transplanted, which structures are essentially formed by the MHC (major histocompatibility complex) molecules which are present on all cells, excludes the transplantation of tissues and organs when the donor and recipient are not compatible with each other or when the immune response of the donor is not suppressed. In the sense of organ transplants, compatible means that the different alleles for Class I and Class II MHC
in the donor and the recipient match to such a substantial extent that no inflammatory reaction occurs.
Normally, T cells recognize, by means of their T cell receptors, fragments of nonendogenous proteins associated with endogenous MHC. T cells which recognize endogenous fragments of proteins together with endogenous MHC are either inactivated by a variety of pathways or are not activated. In the case of an immune response against an organ which is to be transplanted, the T cells of the recipient recognize the combination of antigen and foreign MHC even if the same antigen is not recognized in combination with endogenous MHC.
The vectors according to the invention, which are employed, in connection with a transplantation, for the purpose of inducing tolerance toward the organ which is to be transplanted or which has already been transplanted, encode and express proteins and structures of the organ types which are to be transplanted or which have already been transplanted. The vectors which are employed, for example, in connection with a pancreas transplantation, encode characteristic proteins derived from the pancreas. Vectors which are employed in association with kidney or liver transplantations encode characteristic proteins derived from liver or kidney cells. The encoded proteins also include those proteins which are not organ-specific, such as endothelial cells, but which are present in the transplanted organ and constitute a target of the inflammatory reaction in the case of organ rejection.
In that which follows, the choice of possible antigenic proteins which can be encoded and expressed by the vectors according to the invention is described in more detail, by way of example, for three autoimmune diseases, i.e. multiple sclerosis, myasthenia gravis, rheumatoid arthritis, and Type I diabetes mellitus.
Multiple sclerosis Multiple sclerosis (MS), which is a disease of the human central nervous system, is characterized by perivascular inflammations and by demyelination. The collections of activated T cells in the early MS lesions, and in the surrounding, still unaffected regions, of the white medullary body, underline the role of cell-mediated immunity (T cells) in the development of multiple sclerosis. The investigations carried out on a generally accepted animal model, i.e.
experimental autoimmune encephalomyelitis (EAE), which can be induced by immunizing with myelin components, have demonstrated that EAE can be transferred from one animal to another by activated, myelin-specific T cells. As a rule, immune cells directed against different components of the myelin, components of astrocytes and proteins which are not derived from cells of the central nervous system can be detected in a patient suffering from multiple sclerosis. In addition, different immune cells recognize various regions of a component (epitopes), with an increase in the number of recognized epitopes correlating with aggravation of the disease.
Myelin basic protein (MBP) is a constituent of myelin which can be separated off and relatively easily purified. About 300 of the myelin in the central nervous system (CNS) consists of MPB. MBP was the first protein constituent of myelin which was demonstrated to have inflammation-inducing properties. By way of example, the vectors according to the invention encode and express the following epitopes, singly or in combination: AA 1-20, AA 7-26, AA 16-38, AA 38-55, AA 50-68, AA 61-82, AA 71-89, AA 83-102, AA 94-117, AA 108-131, AA 124-141, AA 131-145, AA 139-153, AA 148-162, AA 153-170, AA 80-102, AA 81-99, AA 82-100, AA 83-99, AA 85-99, AA
86-99 and AA 159-169.
With a content of more than 50$, myelin.proteolipid protein (PLP) is the largest constituent of myelin in the central nervous system. PLP is a membrane protein having strongly hydrophobic properties. It is mainly CD4+, PLP-specific T
cells which have been identified by proliferation experiments in the blood of individuals suffering from multiple sclerosis. By way of example, the vectors according to the invention encode and express the following epitopes, individually or in combination: AA 40-60, AA 89-106, AA 103 120, AA 125-143, AA 139-154, AA 1-275, AA 95-117, AA 139-151 and AA 185-206.
Myelin oligodendrocyte protein (MOG) is a relatively small constituent (0.01-0.05$) of myelin. MOG has a molecular weight of 26-28 kDa and is composed of an immunoglobulin-like variable domain and two hydrophobic (potential) transmembrane domains. Investigations carried out on animal models, in which MOG induces both a T cell-mediated inflammatory reaction and demyelinating antibodies, and investigations carried out in association with multiple sclerosis, have identified the glycoprotein as being an important antigen in demyelinating autoimmune diseases of the central nervous system. By way of example, the vectors according to the invention encode and express the following epitopes of MOG, individually or in combination: AA 1-22, AA 35-55, AA 36-45, AA 34-56, AA 43-57, AA 64-96, AA 92-106, AA 134-148, AA 1-26, AA 14-39, AA 27-50, AA 38-60, AA 50-74, AA 63-87, AA 76-100, AA 89-113, AA 101-125, AA 162-178, AA 168-182 and AA 14-36.
The myelin-associated basic protein on oligodendrocytes (myelin-associated oligodendrocytic basic protein, MOBP) is one of the main constituents of myelin. Patients suffering from multiple sclerosis which proceeds in phases exhibit a cellular immune reaction against MOBP. By way of example, the vectors according to the invention encode and express the following epitopes, individually or in combination: AA 1-19, AA 11-29, AA 21-39, AA 31-49, AA 37-60, AA 41-59, AA 51-69, AA 83-99, AA 1-60 and AA 27-50.
The oligodendrocyte-specific protein (OSP) represents about 7% of total myelin. OSP is a transmembrane protein having a length of 207 amino acids. A comparison of the tertiary structure of OSP showed homology with peripheral myelin protein 22 in the CNS. It has been possible to detect antibodies against OSP in the spinal fluid of individuals who have contracted multiple sclerosis which proceeds in phases.
T cells having a specificity for OSP have been demonstrated to be present in humans. By way of example, the vectors according to the invention encode and express the following epitopes, individually or in combination: AA 52-71, AA 72-91, AA 82-101, AA 102-121, AA 131-151, AA 142-161, AA 182-201 and AA 192-207.
Myelin-associated glycoprotein (MAG) is a constituent of myelin in the central and peripheral nervous system. MAG is a membrane protein having a molecular weight of 100 kDa and is composed of five extracellular immunoglobulin-like domains, a single transmembrane domain and a cytoplasmic domain. Two isoforms (L and S forms), which are formed by alternative splicing, have been described, with these forms being detected at different times during myelin formation. MAG is located in the periaxonal membranes of the myelin-forming Schwann cells and oligodendrocytes and is thought to be connected with glia-axon interactions. By way of example, the vectors according to the invention encode and express the following epitopes, individually or in combination: AA 20-34, AA 124-137, AA 354-377 and AA 570-582.
The proteins which will now be described constitute other targets for pathogenic immune cells. Glycoprotein P0, as a constituent of the peripheral nervous system and the Schwann cells. PO has a molecular weight of 30 kDa and constitutes more than 50~ of the mass of the compact myelin in the peripheral nervous system. Peripheral myelin protein 22 (PMP-22/PAS-II) has a molecular weight of 22 kDa. PMP-22 is not specific for Schwann cells but is also expressed in other tissues such as the lung, the stomach and the heart.
p170k/SAG (Schwann cell membrane glycoprotein) is a glycoprotein which has a molecular weight of 170 kDa. SAG is produced by myelinating and nonmyelinating Schwann cells.
Oligodendrocyte myelin glycoprotein (OMgp) is a glycoprotein having homology with MPB which is expressed exclusively in the central nervous system. Schwann cell myelin protein (SMP) is another glycoprotein which is formed by Schwann cells and was discovered in chickens. The glycoprotein exhibits 44~
homology with MAG. Other polypeptides which have been identified as targets for autoimmunoreactive cells are transaldolase, 5100, alpha B crystallin, 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNP) and GFAP. By way of example, the vectors according to the invention furthermore encode these proteins, or fragments thereof, in particular regions, or combinations of regions, which carry T cell epitopes.
Myasthenia gravis Myasthenia gravis, an autoimmune disease which leads to progressive muscle weakness, is caused by autoantibodies directed against the acetylcholine receptor on muscle cells.
Production of the autoantibodies is dependent on specific T
helper cells. 10~ of patients with myasthenia gravis suffer from epithelial tumors of the thymus. The tumor cells synthesize mRNAs which encode the a and E subunits of the acetylcholine receptor and may possibly, in this way, mistakenly sensitize T cells in the thymus, or circulating T
cells, against epitopes of the acetylcholine receptor.
However, the mechanism of tolerance induction is also possibly disturbed in the maturing thymocytes. Regions in the subunits of the acetylcholine receptor which constitute epitopes for B and T cells have been described on many occasions. By way of example, the vectors according to the invention encode and express subunits of the acetylcholine receptor, or fragments of these subunits, in particular the following regions, individually or in combination: AA a1-437, AA a3-181, AA a37-114, AA a37-181, AA a62-90, AA a73-90, AA
a75-90, AA a75-115, AA a130-178, AA a138-167, AA a144-156, AA
a149-158, AA a149-163, AA a146-160 and AA x201-219.
Rheumatoid arthritis Rheumatoid arthritis was one of the first systemic diseases to be attributed to autoimmune mechanisms. Essentially two aspects of rheumatoid arthritis suggest that a fundamental disturbance of the immune system is the cause of the disease.
The first of these is the frequently very massive infiltration of lymphocytes, including CD4+ T cells, in the inflamed hypertrophic synovial tissue, and the second is the production of large quantities of rheumatoid factor by B
cells and plasma cells in the synovium. Rheumatoid factors are antibodies which are directed against structure-imparting regions of the heavy chain of IgG. The specific tissue damage in the joints and in extraarticular structures is attributed to the inflammatory panni and to accretions of granular cells, which are termed rheumatoid nodes. The most important argument in support of T cells participating in the development of rheumatoid arthritis is the strong association of the disease with particular MHC Class II haplotypes and ' the observation that, in the mouse model, the disease can be adaptively transferred by isolated T cells. A very wide variety of antigens have been described as being possible targets of the autoreactive immune cells, including structures in the connective tissue, such as collagen, proteoglycans and antigens on chondrocytes, heat shock proteins and exogenous viral or bacterial antigens. By way of example, the vectors according to the invention encode these proteins or fragments thereof, in particular regions or combinations of regions, which carry T cell epitopes, for example Type II collagen (CII).
Type 1 diabetes mellitus Type I diabetes mellitus is an autoimmune disease with multifactorial causes which include genetic predisposition.
The destruction of the insulin-producing (3 cells is caused by T lymphocytes. Both CD4+ and CD8+ T cells are involved in the pathogenesis and both subtypes are required equally for the development of the inflammatory reaction. Experiments with NOD mice, which constitute an animal model for diabetes, have identified CD8+ T cells as being the functional effector cells. It was possible to transmit the disease by transferring CD8+ T cells from prediabetic NOD mice to SCID
NOD mice, which, while exhibiting the genetic predisposition, do not possess any immune cells.
A number of possible autoantigens have already been identified in diabetes. Antibodies directed against various autoantigens have been detected in prediabetic patients and in patients in whom diabetes has recently been diagnosed. In addition, CD4+ and CD8+ T cells have been detected whose specificity differs to some degree. Within the context of the invention which is described here, the gene therapy vectors carry functional regions or genes which encode and express antigenic proteins, protein fragments, or epitopes and combinations of epitopes, which constitute targets for CD4+
and/or CD8+ T cells. Within the meaning of this invention, antigenic proteins are those proteins which are recognized, in conjunction with MHC Class I or MHC Class II, on syngenic cells by T cells from individuals suffering from diabetes.
One target of the autoimmune mechanisms in Type I diabetes is the tyrosine phosphatase IA-2. Autoantibodies against the protein, which autoantibodies are almost always directed against the intracellular domain of the protein, can be detected in patients suffering from diabetes. In individuals with a genetic predisposition to diabetes, autoantibodies against IA-2 are a clear marker of a rapid aggravation of the disease. As an antigenic target for T cells in diabetes, the vectors can encode and express the entire IA-2 protein, or protein fragments thereof. By way of example, the vectors according to the invention encode and express the following regions, individually or in combination, which regions have been identified as being epitope-carrying regions in conjunction with MHC-DR4: AA 654-674, AA 709-732, AA 753-771, AA 797-817, AA 854-872 and AA 955-975.
Among the possible autoantigens in Type I diabetes, insulin and its precursor, i.e. proinsulin, are the only proteins which are exclusively synthesized in the beta cells.
Autoantibodies directed against proinsulin can be detected in prediabetic and diabetic patients. Diabetes can be produced in NOD mice by transferring proinsulin-specific T cells, an observation which demonstrates the importance of proinsulin as a target of the cellular immune response. As an antigenic target for T cells in diabetes, the vectors can encode and express the entire alpha chain, the entire beta chain, the linking peptide, the entire proinsulin protein or protein fragments, individually or in combination. By way of example, the vectors according to the invention encode and express the following regions, which have been identified as being epitope-carrying regions: AA 1-15 (p1-15) and AA 35-50 (p35-50), from the region of the linking peptide between the alpha and beta chains; AA 6-80 (a6-80) from the region of the alpha chain; AA 9-23 and AA 10-25 (b10-25), from the region of the beta chain.
Glutamic acid decarboxylase 65 (GAD65) is one of the target structures for autoimmune reactions in patients suffering from Type I diabetes. Mononuclear cells in the blood of patients react with cell division to the protein, and, furthermore, more than 70~ of patients possess antibodies directed against GAD65. A combination of antibodies directed against GAD65 and IA-2 in individuals who, because of their MHC type, exhibit a genetic predisposition for diabetes is a strong indication that a Type I diabetes is developing. As an antigenic target for T cells in diabetes, the vectors can encode and express the entire GAD65 protein or protein fragments thereof. By way of example, the vectors according to the invention encode and express the following regions, individually or in combination, which regions have been identified as being epitope-carrying regions in conjunction with MHC-DQ8: AA 1-60, AA 51-120, AA 101-115, AA 111-180, AA
171-240, AA 206-220, AA 231-300, AA 291-360, AA 351-420, AA 411-480, AA 431-445, AA 461-475, AA 471-530, AA 521-585, AA 536-550, AA 121-140, AA 201-220, AA 231-250 and AA 471-490. GAD65 is also a target of CD8+ T cells. Vectors can therefore also encode and express the region AA 15-23. Other possible regions are AA 505-519 and AA 521-535.
The heat shock protein Hsp60 constitutes another target for activated immune cells in Type I diabetes. The vectors encode and express, for example, the AA 437-460 region (peptide 277?, which has been identified as being a T cell epitope in NOD mice. A number of epitopes or regions in the Hsp60 protein which contain T cell epitopes have been identified in individuals suffering from diabetes and in healthy control individuals. By way of example, the vectors according to the invention encode the entire Hsp60 protein or fragments thereof, in particular the following regions, or combinations of regions, which carry T cell epitopes: AA 1-20, AA 16-35., AA 31-50, AA 46-65, AA 61-80, AA 106-125, AA 121-140, AA 136-155, AA 151-170, AA 166-185, AA 195-214, AA 240-259, AA 255-275, AA 271-290, AA 286-305, AA 301-320, AA 346-365, AA 421-440, AA 436-455, AA 466-485 and AA 511-530.
Other targets of the autoimmune reaction in Type I diabetes are constituted by proteins, which have not yet been ' characterized, in the cell membrane of the beta cells. The islet cell protein ICA69 and a protein with a molecular weight of 38 kDa in the secretory granules (Roep et a1.
(1991) .Lancet 337: 1439-1441) have been identified as being further antigens. By way of example, the vectors according to the invention encode these proteins, or fragments thereof, in particular regions, or combinations of regions, which carry T
cell epitopes.
Expression of apoptosis-inducing ligands The vectors according to the invention are characterized by the fact that they comprise nucleic acid sequences which encode one or more apoptosis-inducing ligands. Apoptosis is a process which is controlled at the level of the genes and which is involved in the regulation of homeostasis, the development of tissues and organs and the removal of cells of the immune system which are no longer required. Apoptosis is also involved in the elimination of cells which have undergone changes due to damage to their chromosomes or due to an infection with viral pathogens. Normal cells are protected from apoptosis by what are termed "survival signals". However, proapoptotic signals, which are elicited by damage or infection, initiate a sequence of events which end with the death of the cells . Cell death by apoptosis is characterized by a thickening of the chromatin, a fragmentation of the chromosomal DNA, a type of blistering of the membrane, a shrinking of the cell and, finally, decomposition of the dead cell in a membrane-enclosed vesicle (apoptotic bodies).
Essentially two signal pathways leading to the elicitation of apoptosis exist in the cell. The two pathways react to different inducers. The pathway which is relevant to the present invention leads, by way of the stimulation of apoptosis receptors on the surface of the cells, such as CD95/Fas/Apol, TRAIL or Apo3, and mediation by adapter molecules, such as FADD and TRADD, to the activation of caspase 8 (FLICE, initiator ca spa se) , which has a regulatory action, and subsequent caspases, such as caspase 3 (effector caspase), which induce the apoptosis. By contrast, other signals, such as DNA damage, the lack of growth factors, defective cell adherence or activated oncogenes, lead to the induction of a signal cascade in which factors from mitochondria, such as cytochrome C and APAF1, and factors of the Bcl family, are involved. This cascade leads to the activation of caspase 9 (initiator caspase) and, subsequently, to the activation of caspase 3.
The apoptosis receptors belong to a subfamily of what are termed "death receptors", which form a part of the tumor necrosis factor (TNF) receptor superfamily. The members of this family are characterized by from two to four copies of cysteine-rich extracellular domains. The apoptosis receptors in turn possess intracellular "death domains" (DD) which are indispensable for the further transmission of the apoptosis signal. By means of adapter proteins, the apoptosis signal is communicated to the caspases, which finally initiate apoptosis by way of a number of steps.
The apoptosis-inducing ligands are membrane-located or soluble proteins, for example CD95L/FasL/ApolL, Apo2L/TRAIL
or Apo3L, which interact with specific receptor molecules, such as CD95/Fas/Apol, TRAIL or Apo3, on other cells, or on the same cell, and thereby induce apoptosis in the receptor-carrying cells. The apoptosis-inducing ligands belong, for example, to the tumor necrosis factor (TNF) superfamily.
Members of the TNF family are characterized by structural and biochemical properties. The members are Type II transmembrane proteins, with the exception of Lyrnphotoxin (LT) a, and (3, which can also be converted by proteolytic cleavage into soluble ligands. The ligands occur as trimers having three identical subunits which, by interaction with their specific apoptosis receptors, cause these receptors to become trimerized.
Caspases are a group of cysteine proteases . 14 caspases have so far been identified in mammals (including humans).

Caspases recognize motifs consisting of 4 amino acids, which they cut on the carboxyl side of the amino acid aspartate.
Caspases are synthesized as zymogens, i.e. precursor proteins with a very low activity, with these zymogens being activated by proteolytic cleavage: The activated enzymes are hetero-tetramers, comprising in each case two identical cleaved subunits. A number of caspases are activated by autoproteolytic cleavage while others are activated by further caspases. What are termed the initiator caspases (caspase 8 and caspase 9) start the avalanche of self-augmenting caspase activity by activating what are termed effector caspases (caspase 3) by means of proteolytic cleavage.
Adapter proteins constitute a link between the effectors (caspases) and the regulators (Bcl-2 family receptors) of apoptosis. The adapters interact physically, by means of homotypic interactions, with the three groups of factors by way of what are termed death domains (DD), death effector domains (DED) and caspase recruitment domains (CARD).
The vectors according to the invention comprise nucleic acid sequences which encode apoptosis-inducing ligands. For example, the vectors encode the ligand CD95L, which binds to the receptor molecule CD95/Fas/Apo-1. CD95 is a glycosylated membrane protein (Type I) having a molecular weight of about 45-52 kDa (335 amino acids). Several soluble forms of the protein also arise as a result of differential splicing of the messenger RNA. Expression of the CD95 molecule is stimulated by interferon-y (IFN-y), by TNF and by the activation of T cells. Under natural conditions, CD95-mediated apoptosis is induced by CD95 binding with the natural ligand CD95L (Fast, Apo-1-L). CD95L is a TNF-related membrane protein (Type II) which likewise occurs in soluble form, as a result of proteolytic cleavage, and can bind to CD95. The interaction of CD95L with CD95 leads to a Ca2+-independent (i.e. different from the induction due to perforin/granzyme) apoptosis of the CD95-carrying cells.

In addition, the vectors according to the invention can comprise nucleic acid sequences which encode the protein TRAIL (APO-2L), which binds to the specific receptor molecules TRAIL-R1 (DR4), TRAIL-R2 (KILLER, DR5, TRICK2), TRAIL-R3 (LIT, DcR1) and TRAIL-R4 (TRUNDD, DcR2). TRAIL has been demonstrated to be naturally present on a number of cells, such as Type II interferon-stimulated monocytes, cytomegalovirus-infected fibroblasts, and Type I interferon-stimulated and antigen-stimulated T cells or NK cells. TRAIL
induces apoptosis in a number of transformed tumor cell lines and activated T cells. It has been possible to detect the mRNA which encodes the TRAIL-R2 receptor in a very wide variety of tissues, such as spleen, thymus and lymphocytes in the peripheral blood. Cells and tissues which express mRNA
for TRAIL-R2 are susceptible to TRAIL-mediated apoptosis.
In addition, the vectors according to the invention can comprise nucleic acid sequences which encode the APO-3 ligand (Apo3L/TWEAK). Apo3L is a Type II transmembrane protein having a length of 149 amino acids. The extracellular region of ApoL3 exhibits a high degree of homology with TNF. Apo3L
mRNA has been detected in a very wide variety of lymphoid and nonlymphoid tissues. ApoL3 binds to the receptor molecule Apo3 (DR3, WSL-1, TRAMP, LARD) and induces apoptosis in the receptor-carrying cells. The receptor for Apo3L is principally expressed on the cell surface of lymphocytes for example on unstimulated resting lymphocytes in the peripheral blood (PBL), phytohemagglutinin (PHA)-treated PBL, CD4+ T
cells, CD8+ T cells and B cells. The induction of apoptosis by way of Apo3L is mediated by FADD/MORT1. ApoL3-mediated apoptosis is blocked by the viral caspase inhibitors CrmA, obtained from cowpox virus, and by the baculovirus p35 protein.
Inhibition of apoptosis in the recombinantly modified cells The vectors according to the invention are characterized by the fact that they comprise, where appropriate, nucleic acid sequences which encode one or more antiapoptosis molecules.

An interaction of CD95, TRAIL, TRAMP, TNF or lymphotoxin with their specific receptors can take place not only between different cells but also on one and the same cell and thereby lead, in an autocrine manner, to the induction of apoptosis.
An example of this is the apoptosis of activated immune cells, i.e. what is termed activation-induced cell death, which leads to the removal of immune cells which are no longer required. T cells which have been stimulated, by way of their T cell receptor, to multiply express CD95 on their cell surface, with this CD95 interacting with CD95L on the membrane.
In order to prevent such an autocrine induction, or a paracrine induction, by other cells, for example in cell culture when the starting cells are being modified, in the cells which have been modified with the vectors according to the invention, the vectors can comprise nucleic acid sequences which encode intracellular inhibitors of apoptosis (antiapoptosis molecules). These inhibitors interact either with the different receptor molecules in the cell membrane, with the adapter molecules which transmit the death signal between the receptors and the caspases, or with the caspases themselves. These inhibitors are derived either from the cells themselves, and are involved in the regulation of apoptosis, or they are viral proteins which prevent apoptosis occurring in virus-infected cells until sufficient viral progeny have been produced and released.
The induction of apoptosis can be inhibited at the various stages of the cascade comprising receptors, adapters and caspases. In particular viruses have invented a large number of strategies for protecting themselves against apoptosis as an immune mechanism. The present invention uses these viral and cellular mechanisms in order to protect the cells, which have been altered by the vectors, from autocrine induction of apoptosis.
The vectors according to the invention can, for example, comprise nucleic acid sequences which encode adenoviral proteins from the E3 region of the virus. These proteins inhibit membrane-bound biochemical processes which are induced when the TNFR is activated. The protein E3-14.7K
inhibits the release of arachidonic acid by phospholipase A2 (PLAZ) as a consequence of stimulation by way of the TNF
receptor. The adenoviral proteins E3-14.5K and E3-10.4K form the complex RID, which prevents translocation of PLAZ from the cytoplasm to the cell membrane following stimulation of the TNFR. In addition, RID causes a rapid internalization, and lysosomal degradation, of membrane-bound CD95.
In addition, the vectors according to the invention can comprise nucleic acid sequences which encode proteins which exhibit a high degree of homology with the DED domains. These proteins are termed FLIPS, while the viral proteins are termed vFLIPs. The signal cascade between receptors and FADD, on the one hand, and caspase 8 (FLICE), on the other hand, is blocked, and apoptosis thereby prevented, by means of a homotypic interaction of the FLIPs/vFLIPs with the adapter protein FADD by way of the DED domains.
In addition, the vectors according to the invention can comprise nucleic acid sequences which encode the proteins which will now be described. The proteins MC159 (Bertin et aI. (1997) Proc Nat1 Acad Sci U S A 94: 1172-1176) and MC160 from the Molluscum contagiosum virus bind to FADD and thereby prevent caspase 8 and FADD from being recruited. The proteins BORFE2 (E1.1) from herpesvirus BHV-4 and E8 from the equine herpesvirus EHV-2 (Bertin et a1. (1997) Proc Nat1 Acad Sci U
S A 94: 1172-1176) bind inactive procaspase 8 and in this way prevent an interaction with FADD and consequently activation.
The proteins K13 from HHV-8 and ORF71 from herpesvirus saimiri also possess DE.D domains and function in the same way. Furthermore, viral proteins can be encoded which bind, and thereby inactivate, signal factors (FADD, TRADD, TRAF) in the apoptosis cascade. The adenovirus protein E1B-19K, which exhibits homology with the cellular protein Bcl-2, interacts with FADD and thereby blocks signal transfer from TNFR and CD95. In addition, E1B-19K is furthermore able to replace Bcl-2 functionally and to prevent activation by way of the mitochondria (via caspase 9). The Epstein Barr virus LMP-1 protein interacts with various TRAF molecules (TNFR-associated factors) and thereby blocks signal transfer from TNFR. In addition, LMP-1 also binds TRADD. However, the apoptosis signal cascade is not induced, presumably due to the binding site for TRADD being modified. LMP-1 additionally induces expression of the antiapoptotic proteins A20, Bcl-2 and Mcl-1. The vectors according to the invention furthermore express, for example, the SV40 LT protein, which mediates resistance to Fas-induced apoptosis by way of a protein kinase C-mediated pathway. For example, the vectors according to the invention encode the polyoma proteins ST and MT, both of which mediate resistance to CD95-mediated and/or TNFR-mediated apoptosis. The ST protein achieves this by binding and inhibiting the protein PP2A. The MT protein directly activates signal pathways which promote survival of the cell.
These pathways include the PI3 kinase, which subsequently phosphorylates, and thereby inactivates, the protein Bad, which has a proapoptotic action.
The vectors according to the invention can likewise encode caspase inhibitors in order to prevent autocrine induction of apoptosis in the modified cells. The p35 protein from the baculoviruses Autographica californica nuclear polyhedrosis virus (AcNPV) and Bombyx mori NHV (BmNPV) is synthesized in the early phase of virus replication and prevents apoptosis by a number of very different stimuli. p35 blocks the induction of apoptosis by ligands of TNF and CD95. p35 is cleaved by a number of caspases (caspases 1, 3, 6, 7, 8 and 10). However, the cleavage products are not released but remain bound and form, together with the caspases, a stable inhibitory complex. p35 can, for example, be encoded by the vectors according to the invention. The vectors according to the invention can also encode viral proteins which exhibit homology with cellular serpins. Serpins are chymotrypsin-like serine proteases and inhibit a number of different caspases.
CrmA from the cowpox virus inhibits CD95L-induced and TNFR-induced apoptosis by blocking caspases 1 and 8. The SPI-1 and SPI-2 proteins from the harepox virus, and the protein B13R
from the vaccinia virus, exhibit a high degree of homology with CrmA and likewise inhibit apoptosis due to CD95L and TNF. The Serp-1 and Serp-2 proteins of the myxoma virus and the SPI-4 protein of the harepox virus possess corresponding antiapoptotic properties. Furthermore, it is possible to encode proteins which are homologous with cellular cIAPs, such as vIAPs, or cellular proteins, such as FLAME-1 or I-FLICE.
Cydia pompnella granulosis virus (CpGP), Orgyiapse audotsugata polyhedro$is virus (OpMNPV) and AcNPV encode viral IAPs (vIAPs) which act in the signal cascade above p35.
While vIAPs bind and inhibit inactive procaspases and caspase 8, they are unable to inhibit already activated caspases, as p35 can. While cIAPs interact with TRAF molecules, they can also inhibit apoptosis due to non-TNFR-associated processes.
A conserved RING Finger motif and at least one so-called BIR
motif (baculovirus IAP repeat) are required for antiapoptotic activity. FLAME-1 is a cellular protein which inhibits apoptosis due to CD95/TNF receptor (Srinivasula et a.I. (1997) J Bio1 Chem 272: 18542-18545). FLAME-1 exhibits a high degree of homology to caspase 10 and caspase 8 (FLICE). Two adjacent regions are located in the amino terminal region and exhibit homology with the DED domains of FADD which make homotypic interactions with other DED proteins possible. A third adjacent region exhibits homology with the functional caspase domain of caspases 8 and 10. While FLAME-1 interacts directly with FADD, caspase 8 and caspase 9, it does not possess any caspase activity. FLAME-1 therefore acts as a dominant negative repressor of apoptosis by means of CD95/TNF
receptor. The inhibitory effect ensues as a result of the functionally inactive FLAME-1 protein blocking the receptor complex composed of CD95/TNR receptor/FADD. I-FLICE is another cellular inhibitor (Hu et al. (1997) J Bio1 Chem 272:
17255-17257) which can be encoded and expressed by the vectors according to the invention in order to prevent apoptosis in the recombinantly modified cells. I-FLICE
exhibits structural homologies with FLICE/caspase 8 and caspase 10. In the amino terminal region, there are two adjacent domains having homology with FADD DED domains. In the carboxy terminal region, a domain exists which exhibits homology with the caspase domain. However, I-FLICE does not exhibit any caspase activity and acts as a dominant negative inhibitor of apoptosis by means of CD95/TNF receptors. In contrast to FLAME-1, I-FLICE only binds to FLICE/caspase 8 and caspase 10 and not to FADD. I-FLAME is therefore not recruited by the binding of CD95L/TNF to the receptor complex consisting of CD95/TNR receptor/FADD. The inhibitory effect is brought about by complexing, and thereby inactivating, caspases 8 and 10.
An inhibition of apoptosis in the cells modified by the vectors according to the invention can also be produced by inhibiting, e.g. by means of an antisense approach, expression of the proteins (apoptosis receptors, adapters and caspases) which are involved in the induction.
The antisense RNAs which are encoded and synthesized by the vectors according to the invention may, on the one hand, be directed exclusively against a protein in the apoptosis signal chain and inhibit apoptosis by way of a particular pathway, for example by way of membrane-associated receptors ,or by way of a mitochondria-mediated pathway. On the other hand, the antisense RNA may include various regions which are specific for different targets in the signal cascade for inducing apoptosis. These different regions in the antisense RNA are specific for receptor proteins, adapter proteins and/or caspases. The vectors according to the invention either synthesize a single antisense RNA or a combination of different antisense RNAs which are specifically directed, for example, against individual apoptosis receptors, caspases or adapter molecules. Alternatively, the vectors express a single antisense RNA which contains several regions which are in each case specific for individual apoptosis receptors, caspases or adapter molecules and, in combination, prevent the expression of several proteins which are involved in apoptosis.

s In connection with this invention, the vectors carry, for example, functional regions which synthesize the antisense RNA for apoptosis receptors in eukaryotic cells. Blocking the expression of receptor molecules which start signal cascades which have a proapoptotic action blocks autocrine stimulation of apoptosis in the gene therapy vector-modified cell at the earliest possible stage.
The vectors according to the invention can, for example, encode CD95-specific antisense RNAs and block expression of CD95/Fas. Blocking CD95 prevents induction of apoptosis by way of CD95L/FasL. For example, the gene therapy vectors encode and express TNFR-specific antisense RNAs which block expression of TNFR and protect the cell from TNF-mediated apoptosis. Alternatively, the vectors encode and express, for example, TRAIL-R1-specific and/or TRAIL-R2-specific antisense RNAs which prevent the expression of the TRAIL-R1 and/or TRAIL-R2 receptors, respectively. This makes the cells resistant to TRAIL-mediated apoptosis. Alternatively, the gene therapy vectors encode and express TRAMP receptor-specific antisense RNAs, which prevent expression of TRAMP
receptors in the altered cells. This makes the cells resistance to TRAMP-mediated apoptosis.
The vectors according to the invention can furthermore comprise nucleic acid sequences which encode, for example, antisense RNA for adapter proteins in eukaryotic cells. Since these adapter molecules function one level below the apoptosis receptors and one adapter molecule is used by several apoptosis receptors, more than only one apoptosis signal pathway can be blocked by blocking the expression of a single adapter protein. Resistance to different apoptosis-inducing ligands can be achieved by blocking a single adapter molecule. The vectors according to the invention synthesize either a single antisense RNA or a combination of different antisense RNAs which are specifically directed against individual adapter proteins. Alternatively, the vectors express an antisense RNA which contains individual regions which are in each case specific for an adapter protein and, in combination, prevent the expression of several adapter proteins.
In connection with this invention, the gene therapy vectors can, for example, encode FADD-specific antisense RNAs which prevent expression of FADD. Inhibiting FADD expression blocks signal transfer by the apoptosis receptors CD95, TNFR, TRAIL-R1, TRAIL-R2 and TRAMP. The cells are thereby resistant to an induction of apoptosis by way of CD95L, TNF, TRAIL and CD3.
Furthermore, the vectors can, for example, encode TRADD-specific antisense RNAs which prevent expression of TRADD.
TRADD is specifically involved in the induction of apoptosis by means of TNF/TNFR. Inhibiting the expression of TRADD
thereby specifically blocks the induction of apoptosis by means of TNF/TNFR. In addition, the vectors can encode APAFl-specific antisense RNAs. APAF1 is an adapter protein which plays a central role in the induction of apoptosis by way of the mitochondria-associated pathway. APAF1 is released from the mitochondria, together with cytochrome C, and associates, in the cytoplasm of the cell, with dATP to form a trimeric complex which activates caspase 9. Inhibition of the synthesis of APAF1 leads to a blockade of apoptosis by way of the mitochondria-associated pathway.
In connection with this invention, the gene therapy vectors can furthermore encode antisense RNA against caspases, e.g.
caspase 1, 3, 8 or 9, in eukaryotic cells. The vectors according to the invention synthesize either a single antisense RNA or a combination consisting of different antisense RNAs which are specific directed against individual caspases. Alternatively, the vectors express an antisense RNA
which contains individual regions which are in each case specific for a caspase and, in combination, inhibit the expression of several caspases.
Suicide enzymes The vectors according to the invention are characterized by a, the fact that they comprise, where appropriate, nucleic acid sequences which encode suicide enzymes by which the recombinantly modified cells can, at any time, for example in vivo, be eliminated. For example, the suicide genes encode and express enzymes which convert biological substrates (prodrugs), which are supplied to the body from the exterior, into toxic substances and/or modify the substances in such a way that these substances are used as substrates by the enzymes of the cell. Alternatively, suicide enzymes encode substances which are themselves toxic, but the expression of these genes is strictly controlled in the recombinantly modified cell. In connection with this invention, the genes encoding substances which are themselves toxic are strongly suppressed in the cell and are not synthesized. By adding biological or chemical substances, the genes which encode the toxic proteins are activated and the cells will then die. The vectors which are described in connection with this invention preferably encode suicide genes which convert prodrugs, which are not toxic or are only slightly toxic, into toxic substances.
The prodrugs which are used must exhibit a markedly lower toxicity than the activated substances and must constitute good substrates for the activating enzymes. In addition, these substances must be sufficiently chemically stable under physiological conditions and possess good pharmacological and pharmacokinetic properties. Depending on the type, some prodrugs are taken up into the cells and converted intracellularly into the toxic substance. Other prodrugs are activated extracellularly. Accordingly, the prodrugs or the activated toxic substances must be readily taken up by the cells.
For example, the vectors according to the invention encode and express herpes simplex virus (HSV) thymidine kinase (TK).
HSV TK phosphorylates acyclovir to acyclovir diphosphate, which is further phosphorylated by cellular kinases. Because of its substrate specificity, the eukaryotic cell thymidine kinase cannot phosphorylate acyclovir, for which reason uninfected cells or HSV TK-negative cells are resistant to guanosine analogs. The HSV-infected and/or thymidine kinase-positive cells, which have, for example, been modified with the therapy vectors of this invention, can be selectively eliminated by systemically administering acyclovir or gancyclovir.
Furthermore, the vectors according to the invention can encode varicella zoster virus (VZV) thymidine kinase. The action of VZV TK is comparable with that of HSV TK, with the difference that VZV TK uses 6-methoxypurine arabinonucleoside.
In addition, the vectors which are mentioned in this invention can encode enzymes which activate the following prodrug/enzyme systems: carboxylesterase (CA) activates irinotecan; cytosine deaminase (CD) activates 5-fluorocytosine (5-FC); carboxypeptidase G2 (CPG2) activates 2-chloroethyl-2-mesyloxyethylaminobenzoyl-L-glutamic acid (CMDA) and CJS278H and also the self-activating prodrugs doxorubicin and daunorubicin; cytochrome P450 (Cyt 450) activates cyclophosphamide (CP), ifosfamide (IF), ipomeanol and 2-aminoanthracene (2-AA); deoxycytidine kinase (dCK) activates cytosine arabinose (ara-C); nitroreductase (NR) activates CB1954 (5-aziridinyl-2,4-dinitrobenzamide); purine nucleoside phosphorylase (PNP) activates 6-methylpurine-2'-deoxyribonucleoside (6-MePdR); thymidine phosphorylase (TP) activates 5'-deoxy-5-fluorouridine (5'-DFUR); xanthine guanine phosphoribosyl transferase (XGPRT)activates 6-thioxanthine (6-TX) and 6-thioguanine (6-TG). In addition, the vectors according to the invention can encode bacterial uracil phosphoribosyl transferase, which activates 5-fluorouracil, or encode a fusion protein consisting of cytosine deaminase (FCY1) and Saccharomyces cerevisiae uracil phosphoribosyl transferase (FUR1), which activates fluorocytosine (5-FC).

Vectors according to the invention for gene therapy The invention relates to a gene transfer vector which comprises at least one nucleic acid molecule which comprises a first nucleic acid sequence, encoding one or more apoptosis-inducing ligand(s), a second nucleic acid sequence, encoding one or more antigen(s), and, where appropriate, a third nucleic acid sequence, encoding one or more antiapoptosis molecule(s), and, where appropriate, a fourth nucleic acid sequence, encoding one or more suicide enzyme ( s ) .
Particular preference is given to a gene transfer vector in which the first and second nucleic acid sequences are linked to each other functionally such that expression of the second nucleic acid sequence is dependent on expression of the first nucleic acid sequence, i.e. expression of the antigens is physically coupled to expression of the apoptosis-inducing ligands and is dependent on the latter. Particular preference is furthermore given to a gene transfer vector in which the third and fourth nucleic acid sequences are functionally linked to each other such that expression of the third nucleic acid sequence is dependent on expression of the fourth nucleic acid sequence, i.e. expression of the antiapoptosis molecules is always coupled to expression of the suicide enzymes and is dependent on this expression.
For treating diseases such as autoimmune diseases, or diseases which are due to an immunopathogenesis or diseases which are based on the rejection of transplanted tissues or organs, antigen-presenting cells (APCs) can be treated with one of the vectors according to the invention. APCs can be treated, for example, with a gene transfer vector which comprises nucleic acid sequences which encode antigens, apoptosis-inducing ligands, antiapoptosis molecules and suicide enzymes. Furthermore, the APCs can be treated with any type of combination of vectors, for example with several of the vectors according to the invention, which vectors encode different antigens. The APCs can, for example, also be treated with a combination of vectors according to the invention which encode antigens and vectors according to the invention which encode antiapoptosis molecules. Combinations of vectors are of value when, for example, the individual nucleic acid regions in the vectors are so large that they, for example, exert a negative influence on the preparation or use of the vector or when APCs are to be treated with vectors which encode different antigens, apoptosis ligands, antiapoptosis molecules or suicide enzymes.
Control elements for expressing gene information The gene transfer vectors according to the invention comprise nucleic acids which, apart from the first to fourth above-described nucleic acid sequences, can contain additional sequences and functional regions, e.g. for controlling and regulating the expression of genes in mammalian cells, for example.
These sequences and functional regions can be promoters and/or promoter elements, preferably viral promoter sequences for expressing gene sequences in mammalian cells. Some examples of viral promoter sequences are the early SV40 promoters, the mouse mammary tumor virus (MMTV) LTR promoter, the Type I human immunodeficiency virus (HIV-1) LTR promoter, the adenovirus major late promoter (Ad MLP) and the herpes simplex virus (HSV) promoter. Furthermore, promoters of nonviral genes, for example promoters of murine 3-phosphoglycerate kinase, of human ubiquitin C and of the murine metallotheionein gene, are also suitable for efficiently expressing gene sequences in mammals. In this connection, expression can be effected using a constitutive promoter or a regulatable (inducible) promoter. Thus, a glucocorticoid-inducible promoter can, by way of example, be used in certain cell types, such as hormone-stimulatable cells.
The expression rates can normally be increased by combining the abovementioned promoter elements with what are termed enhancer elements. In this connection, viral enhancer elements are frequently particularly efficient since they normally have a broader host spectrum than do enhancers derived from mammalian cells. Very efficient representatives of viral enhancers include the SV40 early gene enhancer and the promoter/enhancer combinations from the Rous sarcoma virus LTR and human cytomegalovirus. Furthermore, it is also possible to use regulatable enhancer elements which are only active, for example, in the presence of inducers, such as hormones or metal ions.
These sequences and functional regions can furthermore be leader sequences and/or processing sequences, e.g. a protease cleavage site, preferably the adenoviral three-part leader sequence and a large number of leader sequences of mammalian proteins such as the leader of the erythropoietin gene and the tPA leader, in order to mediate efficient secretion of foreign proteins from mammalian cells.
In addition, these sequences and functional regions can be transcription termination sequences and polyadenylation sequences. Some very efficient poly A signals for use in mammalian expression vectors are derived, for example, from bovine growth hormone, from mouse (3-globin, from the early SV40 transcription unit and from the herpes simplex thymidine kinase gene. Prokaryotic transcription terminators have been described in detail and incorporating them has a large number of positive effects on gene expression. In eukaryotes, a consensus sequence having the nucleotide sequence ATC AAA
(A7T) TAG GAA GA has been identified in the termination region of 9 genes.
In addition, these sequences and functional regions can be translation control elements. Thus, an optimal Kozak sequence (CC(A/G)CcaugG) promotes the initiation of the translation of eukaryotic mRNAs. In this connection, particular significance for optimal translation initiation must be attached to the purines A or G in position -3 and the G directly upstream of the start codon.

In addition, the efficiency with which cDNA gene sequences, which do not contain any introns, are expressed can in some cases be significantly increased 10-20 fold by fusing an intron in the 5' region of the ORF. In this connection, a synthetic intron SIS, which was been produced by fusing an adenovirus splice donor to an immunoglobulin gene splice acceptor, or an SV40 19S late mRNA intron, by way of example for a large number of different introns, possesses particular efficacy in a variety of cells.
In addition, translation initiation at the correct start codon can be severely impaired by the presence of additional AUG codons in the 5'-untranslated region. Such an inhibition can be minimized by the presence of a translation termination codon which is in frame with the upstream AUG. Furthermore, translation is frequently impaired by the tendency of defined sequences in the 5'-untranslated region (UTR) to form secondary structures. Furthermore, destabilizing motifs within foreign gene sequences can have a negative effect on expression rates. Representative sequences of this nature are, by way of example, AU-rich sequences in the 3' UTR
region of many unstable mammalian mRNAs. UUAUUUAUU and UUAUUUA(U/A)(U(/A) are very efficient destabilizing sequence motifs. These sequence motifs should be removed or inactivated in order to increase expression of the desired foreign genes.
In addition, the efficiency with which the desired nucleic acid sequence is expressed can be increased by selecting and using suitable, host-specific codons (codon usage).
An expression vector normally contains a combination of a promoter, a polyadenylation signal and a transcription termination sequence. Furthermore, enhancers, introns having functional splice donor and acceptor sites, and also leader sequences, can, if required, be incorporated in a modular manner into the constructs. Expression constructs are frequently contained in a replicon, for example in extra-chromosomal elements (e.g. plasmids) which are able to survive stably in a host, such as a mammalian cell. Mammalian replication systems contain those which are derived from animal viruses and require transactive factors for replication: For example, plasmids which contain the replication systems of papova viruses, such as SV40 or polyoma viruses, replicate in extremely high copy number in the presence of the appurtenant viral T antigen. Other examples of mammalian replicons include those which are derived from the bovine papilloma virus and from the Epstein Barr virus. Furthermore, a replicon can contain two replication systems which ensure survival in the host, e.g. a replication system for gene expression in mammals and a system for amplifying the vector in bacteria. The plasmid pMT2 is an example of such a mammalian/bacterial shuttle vector.
Regulating the expression of the apoptosis-inducing ligands The nucleic acid sequences which encode apoptosis-inducing ligands can be regulated such that the expression of the ligands can be switched on and switched off. Expression of the apoptosis-inducing ligands can be completely switched off in transduced cells. This is of particular importance for preparing stable, vector-producing cell lines or for generating the bait cells. Since most cells carry apoptosis receptors constitutively on their surfaces, including also the packaging cell lines which can be used for preparing viral gene transfer vectors and the antigen-presenting cells which are to be transduced, transduction of these cells with the gene for an apoptosis-inducing ligand would lead to paracrine and autocrine induction of apoptosis. Switching off the expression of the ligand in the packaging lines and/or in the transduced cells in culture prevents nonspecific interaction between these cells and makes it possible to culture them.
Expression of the ligands is preferably switched off using the methods which will now be described. 1. By means of using the RevTet system supplied by ClonTech, USA. 2. Another -6~-possibility, which is based on the principle of double infection with an expression vector and a regulatory vector, is based on using bacterial regulatory systems in eukaryotes.
The gene for the apoptosis-inducing ligand is under the control of the strong prokaryotic T7 promoter. Since T7 polymerase is not present either in the packaging line or in the cells which are to be transduced subsequently, the ligand is not expressed. It is only when a second regulatory vector is used to cotransduce the gene for T7 polymerase that the ligand is then expressed in the doubly transduced cells.
3. Another suitable system is the Cre-loxP system from bacteriophage P1.
Coexpressing antigens and apoptosis-inducing ligands or antiapoptosis molecules and suicide enzymes Preference is given to the vectors according to the invention only expressing the antigens, or constituents of antigens, which are recognized by immune cells in conjunction with the ligands which have an apoptotic effect. This coexpression is achieved by coupling the nucleic acid sequences on a joint transcript. This prevents the transduced cells from stimulating specific T cells in vivo, by presenting constituents of the antigen, without destroying the T cells.
An internal ribosomal entry site (IRES) can be used to express two or more genes under the transcriptional control of a constitutive or regulatable promoter. For example, the IRESs from picorna viruses, from hepatitis C virus or from BiP (immunoglobulin heavy chain binding protein), or retroviral IRES sequences, are used.
Another possibility for expressing two or more genes under the transcriptional control of a strong promoter consists in using sequences which require a shift in the ribosomal reading frame during translation, as a result of which a stop codon is overlooked. Normally, these frame-shift signals at the RNA level require the ribosomes to be displaced, at a specific site, into the -1 reading frame (in the 5' orientation) and to continue the translation in the new reading frame. Such -1 frame-shift signals have been described in a large number of different virus families, such as retroviruses, coronaviruses, astroviruses, totiviruses, podoviruses, siphoviruses, luteoviruses and dianthoviruses.
By way of example, the frame-shift sequence in the Rous sarcoma virus (RSV) consists of 2 essential components: a homopolymeric slippery sequence, consisting of the sequence (AAAUUUA) and an RNA secondary structure which is located a few nucleotides downstream. The following slippery consensus sequence has been constructed by comparing the slippery sequences in different viruses: it consists of a sequence which comprises 7 nucleotides and which contains 2 homopolymeric triplets (X-XXY-YYZ) (Brierley (1995) J Gen Viro1 76 (Pt 8): 1885-1892).
In addition to vector-specific nucleic acid sequences, which, for example, enable the vectors to replicate in bacteria or eukaryotic cells, or regulatory nucleic acid sequences, which enable the coding regions to be expressed, or nucleic acid sequences which enable the vector to be packaged or the nucleic acid to be packaged into a vector, vectors according to the invention also comprise, for example, nucleic acids, as well, which encode one or more suicide enzymes and one or more antiapoptosis molecules. The expression of the antiapoptosis molecules is always coupled to the expression of the suicide enzymes and is dependent on this latter expression.
Target cells for treatment with therapeutically active nucleic acids Antigen-presenting cells (APCs) For the therapy of autoimmune diseases or diseases involving immunopathogenesis, syngenic antigen-presenting cells from the individuals who are to be treated are used for preparing the bait cells. The MHC pattern of the antigen-presenting cells and the reactive cells is consequently identical and it is only those T cells which react autoaggressively, or recognize the foreign antigens in conjunction with endogenous MHC, which are attracted and eliminated. When transplant rejections are being treated or prevented, antigen-presenting cells are purified from the organ donor. These cells are allogenic (different MHC pattern) in relation to the recipient. In this case it is necessary to recognize and eliminate the T cells which recognize cellular antigens together with foreign MHC from the donor.
Lymphocytes, accessory cells and effector cells constitute the most prominent representatives of the acquired immune system. Lymphocytes are able to recognize foreign antigens specifically and to stimulate a specific humoral and cell-mediated immune response. Different subpopulations of lymphocytes are known to differ in the nature of their antigen recognition and their specific effector functions.
B lymphocytes are the producers of antibodies. They recognize extracellular antigens and and antigens which are presented on the surfaces of cells and differentiate into antibody-secreting plasma cells following contact with an antigen.
T lymphocytes, which are the mediators of the cell-mediated immune response, can be subdivided into several subtypes of which the CD4+ T helper cells and CD8+ cytotoxic T cells are the most important. Helper and cytotoxic T cells exhibit a restricted specificity for antigens. They only recognize peptide antigens which are presented on the surface of an endogenous cell together with MHC class II or MHC class I, respectively. Following the specific recognition of a specific MHC class II/peptide complex, T helper cells secrete cytokines which stimulate T cells and other immune cells, such as B cells and macrophages, to proliferate and differentiate. Cytotoxic T cells (CTL) lyse cells which are presenting peptides from nonendogenous proteins together with MHC class I proteins on their surfaces. On the other hand, what are termed the suppressor T cells are a subtype of T
helper cells which produce cytokines which suppress particular immune functions. A third class of lymphocytes, i.e. the natural killer (NK) cells, are a component of the innate immune response for combating viruses and intracellular pathogens.
Antigen-presenting cells (APCs) are of very great importance for regulating the immune system. These cells take up foreign antigens, process them into small peptides and present them, together with MHC proteins, on their surfaces. Two classes of APCs are distinguished. Professional APCs present the generated peptides on MHC class I and class II proteins and, in addition, express costimulatory proteins such as B7.1 and B7.2. The most important representatives of these APCs are dendritic cells and macrophages, and also B cells. These cells stimulate T helper cells and cytotoxic T cells which, by means of their T cell receptor, recognize peptides which are complexed with MHC class II and MHC class I, respectively. On the other hand, nonprofessional APCs, which present MHC/peptide complexes but do not present any costimulatory proteins, are only recognized by T cells which have already been activated. The professional APCs are the main target cells into which the vectors according to the invention are to be preferentially inserted ex vivo.
The purification of different populations of blood lymphocytes has been described in a large number of publications and is state of the art. Mononuclear cells can be purified, for example, from the peripheral blood by means of Ficoll-Hypaque density gradient centrifugation.
Furthermore, other methods based on the antibody-mediated recognition of immune cells can be used for positively and negatively selecting cell populations. By way of example, such methods are immunomagnetic selection, "panning" on immobilized monoclonal antibodies, antibodies/complement-mediated cell lysis and the cell sorting of fluorescence-labeled cells. CD3 is a suitable surface marker for selecting T cells. Specific T helper cells are selected with the aid of the CD4 marker and cytotoxic T cells are selected with the aid of the CD8 marker. Other T cell subpopulations can be (pre)selected with the aid of the markers CD30, CD45RA (naive T cells) and CD45R0 (activated T cells and memory T cells).
Activated T cells can be separated with the aid of the CD69 marker protein. Monocytes can be purified using specific antibodies (AB) directed against the surface markers CD14 and CDllb, while natural killer cells can be purified using anti-CD16 ABs and B cells can be purified using markers CD19 and CD22. APCs can be purified using specific antibodies directed against HLA-DR.
Suitable methods for separating T cells from mononuclear cell populations are based, for example, on rosetting T cells using sheep red blood cells (SRBC). In addition this method makes it possible to isolate nonrosetting cell populations (B lymphocytes, monocytes and macrophages). In this connection, preference is given to using SRBCs which have been treated with neuraminidase or 2-aminoethylisothiouronium bromide (AET), since these treated SRBCs exhibit an increased binding of T cells. The different T cell populations can be positively identified or separated using the previously described methods based on using antibodies to recognize specific surface markers.
B cells can, by way of example, be very efficiently purified, in accordance with the already described methods, using CD19-specific antibodies. The methods of cell sorting by means of FACS and the use of immunomagnetic beads are particularly suitable. By way of example, monocytes can be isolated by adherence to L-leucine methyl ester matrices, for example, gradient sedimentation through colloidal silica particles and flow cytometry. However, the former methods activate monocytes. Another very suitable method for purifying large quantities of nonactivated monocytes is counterflow centrifugation using an elutriator (counterflow centrifugal elutriation, CCE).
By way of example, natural killer cells can be isolated from Ficoll-Hypaque gradients-purified lymphocyte populations by means of negative selection using anti-CD3, anti-CDS, anti-CD19, anti-CD14 and anti-erythrocyte antibodies.
Immune cells can also be generated from other cell ~ -65-~ populations by means of cytokine stimulation. For example, white blood cells and differentiating precursor cells and stem cells can be stimulated by a large number of growth factors. In particular, the cytokines IL-3, IL-4, IL-5, IL-6, IL-9, CM-CSF, M-CSF and G-CSF, which are produced by activated T helper cells and activated macrophages, stimulate myeloid stem cells, which then differentiate into pluripotent stem cells, granulocyte-monocyte precursor cells, eosino-philic precursor cells, basophilic precursor cells, megakaryocytes and erythroid precursor cells. The differentiation is modulated by growth factors such as GM-CSF, IL-3, IL-6, IL-11 and erythropoietin (EPO).
Pluripotent stem cells then differentiate into lmyphoid stem cells, bone marrow stroma cells, precursor T cells, precursor B cells, thymocytes, T helper cells, cytotoxic T cells and B
cells. This differentiation is modulated by growth factors such as IL-3, IL-4, IL-6, IL-7, GM-CSF, M-CSF, G-CSF, IL-2 and IL-5. Granulocyte-monocyte precursors differentiate into monocytes, macrophages and neutrophils. This differentiation is modulated by the growth factors GM-CSF, M-CSF and IL-8.
Eosinophilic precursors differentiate into eosinophils. This process is modulated by GM-CSF and IL-5. The differentiation of basophilic precursors into mast cells and basophils is stimulated by GM-CSF, IL-4 and IL-9. Following stimulation with GM-CSF, EPO and IL-6, megakaryocytes produce blood platelets. Stimulated by EPO, erythroid precursor cells differentiate into red blood cells. The purity of the isolated cell populations is monitored by FRCS analysis using specific antibodies.
The proportion of the dendritic cells in the blood is less than 0.2%. For this reason, it is not necessary to directly purify this cell population. However, by way of example, cytokines can be used to generate relatively large quantities of dendritic cells from CD14-positive blood rnonocytes. The cytokines TNF-a, GM-CSF and IL4 are used, in suitable concentrations, for differentiating dendritic cells from monocytes. This method has been published on a number of occasions and is state of the art.

It is possible to take up all the mononuclear cells in cell culture medium and to stimulate them nonspecifically. For example, the B cells are stimulated to proliferate using crosslinking antibodies directed against the B cell receptor or using lectins (pokeweed mitogen) or IL-4. For example, T
lymphocytes can be stimulated preferentially by incubating with a CD3-binding agent, such as the monoclonal antibody OCT-3. A CD3-binding agent is a ligand which binds CD3 molecules on the surfaces of cells. The ligand can be an antibody, such as OCT-3, which is able to crosslink two or more CD3 molecules. This crosslinking induce s the proliferation and activation of CD3+ cells, such as T lymphocytes. Furthermore, the activation of T lymphocytes by CD3-binding agents can be enhanced by varying particular parameters, such as the concentration of the binding agent, the incubation time, the cell number, the incubation temperature, the binding affinity of the agent, the avidity and the efficiency of the cell activation. Furthermore, T
cells in peripheral blood monocytes can be stimulated with phytohemaglutinin (PHA). By way of example, other lymphocyte stimulators are tetanus toxoid, concanavalin A (Con A), ionomycin and PMA.
Furthermore, nucleic acids which contain unmethylated CpG
motif sequences together with the sequence motif Pur-Pur-CG-Pyr-Pyr are particularly suitable for activating the mammalian B cells, monocytes, macrophages and dendritic cells. In this connection, CpG-containing bacterial or insect DNA, and also CpG-containing synthetic oligodeoxynucleotides (ODNs) having a minimal length of 8 nucleotides, can be suitable for stimulating the abovementioned cell populations.
An enhanced effect can be achieved by using chemically modified,. and thereby stabilized, oligonucleotides, such as phosphorothioate-linked ODNs, by way of example. Mammalian immune cells, such as B cells, monocytes, macrophages and dendritic cells, are activated directly following contact with CpG-containing nucleic acids, a fact which is expressed in the enhanced surface expression of MHC class II molecules and costimulatory molecules and in the increased transcription of defined cytokine mRNAs and the secretion of proinflammatory cytokines such as TNF-a, IFN-y, IL12 and IL6.
In particular, modulation of the immunological properties of CpG-containing ODNs can be achieved by specifically selecting or changing the sequences flanking the CpG motifs.
On the one hand, proliferation of the cells which are subsequently to be transduced is necessary in order, for example, to enable the retroviral vectors to be integrated into the cellular genome. On the other hand, the multiplication of the cells following transduction with a retroviral vector leads to an increase in the probability that these cells will be recognized by appropriate T cells.
For the therapy of autoimmune diseases or of diseases involving immunopathogenesis, syngenic antigen-presenting cells from the individuals who are to be treated are used for preparing the bait cells. The MHC pattern of the antigen-presenting cells and the reacting cells is consequently identical and only those T cells which react autoaggressively, or which recognize the foreign antigens in conjunction with endogenous MHC, are attracted and eliminated. When transplant rejections are being treated or prevented, antigen-presenting cells are purified from the peripheral blood of the organ donor. These cells are allogenic (different MHC pattern) in relation to the recipient. In this case, it is necessary to recognize and eliminate the T cells which recognize cellular antigens together with foreign MHC from the donor.
Cul turiag APCs The mammalian or human cells can be cultured in a suitable nutrient medium to which at least one defined growth factor has been added. A large number of growth factors, which promote the growth of different cell types, have been described. Typical representatives of such growth factors are cytokine mitogens, such as IL-2, IL-10, IL-12 and IL-15, which, for example, promote the growth and activation of lymphocytes. Other cell types are in particular [lacuna] by a different class of growth factors, such as hormones, including the human pregnancy hormone chorionic gonadotrophin (hCG) and human growth hormone. The selection of suitable growth factors for defined cell populations has been described in detail and is state of the art.
The following implementation examples serve to explain the invention and are not to be construed as being limiting.
Data from animal experiments Using adenoviral gene transfer to transfect murine antigen-presenting cel.Is (APCs) with the Fas ligand gene A peritoneal lavage was carried out in Fas (CD95)-deficient C57BL(B6) mice and the peritoneal macrophages were isolated.
5 x 106 macrophages per well were cultured for a period of 24 hours in complete DMEM medium in a 6-well plate and subsequently transfected with an adenoviral vector (AdFasL), which led to expression of the Fas ligand (Fast, CD95L) gene, or with a control vector (AdLac2, expression of the (3-galactosidase). After 48 hours, the transfected macrophages were tested for the expression and functionality of Fast. In the Facs analysis, it was found that almost 90°s of the AdFasL-transfected macrophages (AdFasL-APCs) were expressing the Fast gene on the cell surface whereas it was not possible to observe any relevant Fast expression on the macrophages which had been transfected with AdLacZ (AdLacZ-APCs) (fig. 1A). In order to investigate whether the Fast expression was also functional, AdFasL-transfected macrophages were employed in a cytotoxicity test using Fas-expressing A20 target cells. A concentration-dependent cytolysis of the target cells was then observed in the cocultures with AdFaL-APCs, whereas it was not possible to detect any lysis, or only possible to detect slight spontaneous lysis, in the cocultures of AdLacZ-APCs and A20 target cells (fig. 1B).
Inhibition of the allogenic proliferation of T cells by Fas ligand-expressing APCs In order to establish whether Fast expression on the AdFasL-APCs can modulate the interaction with T cells and suppress an allogen-specific T cell response, AdFasL-APCs and AdLacZ-APCs were generated from B6-1pr/1pr mice (H-2Db) and cocultured, in a mixed lymphocyte reaction (MLR), with T
cells from Fas-deficient MRL-1pr/1pr mice (H-2Dk) or Fas-expressing MRL-+/+ control mice (H-2Dk). Allogenic T cell proliferation was determined by the incorporation of [3H]-thymidine. It was found that the allogenic proliferation of the H-2Dk T cells was significantly reduced in the cocultures with H-2Db Fast-APCs as compared with the cocultures of H-2Dk T cells with H-2Db LacZ-APCs (fig. 2A). By using the Fas-deficient T cells from MRL-lpr/lpr mice, it was furthermore possible to demonstrate that this suppression effect was due to the interaction of Fas with Fas ligand and consequently required the functional expression of both the molecules (fig. 2B) .
Therapeutic use of Fas ligand-expressing antigen-presenting cells in a mouse model of virus-induced autoimmune disease The infection of Fas ligand-deficient C57/BL6(B6) g1dlgld mice with murine cytomegalovirus (MCMV) induces a chronic autoimmune inflammatory reaction. In order to test whether an antigen-specific suppression of the T cells by AdFasL-APCs can also be achieved in vivo, AdFasL-APCs and AdLacZ-APCs were tested therapeutically in a mouse model of chronic autoimmune disease. In the mouse model employed, a chronic inflammatory reaction in various organs was induced by the intraperitoneal infection of Fas-deficient B6-lpr/lpr mice or Fast-deficient B6-g1d/g1d mice with 1 x 106 PFU of the mouse cytomegalovirus (MCMV), whereas it was not possible to detect any relevant organ changes in B6-+/+ mice after the virus-infected cells has been eliminated. The reasons for the chronic inflammation in B6-Ipr/1pr and B6-g1d/gld mice was not a delay in the elimination of virus-infected cells but, instead, a persistent activation of T cells, which were principally responsible for the inflammatory infiltrates in the organs; for this reason, this mouse model was outstandingly suitable for testing the effectiveness of the novel therapy concept. Furthermore, the chronic inflammation exhibited a marked autoimmune component since it was possible to detect an increase in autoantibodies. Fig. 3 shows the histological severity, over time, of the inflammatory reaction in the lung, kidney and liver in MCMV-infected B6-+/+ and Fast-deficient B6-gld/gld mice.
Significant improvement in the MCMV-induced chronic inflammatory reaction achieved by treating with Fas Zigand-expressing APCs 28 days after the infection with MCMV, B6-gZd/g1d and B6-Zpr/Zpr mice were treated with AdLacZ-APCs or AdFasL-APCs (1 x 106 APCs i.p. every 3rd day for a period of 12 days). In addition, some of these APCs were pulsed with MCMV in vitro prior to administration. 4 weeks after the beginning of the treatment, the organs were removed and the severity of the inflammatory reaction was determined (fig. 4) . A significant improvement in the inflammation was found in the case of the B6-g1d/gld mice treated with AdFasL-APCs, with this improvement being augmented still further by the APCs being previously pulsed with MCMV. In addition, it was possible to demonstrate that the observed therapeutic effect was Fas-mediated since it was not possible to detect any improvement in Fas-deficient B6-1pr/lpr mice.
Significant reduction in MCMV-specific T cells in the spleen following treatment with Fas ligand-expressing APCs At the same time, the spleen was also removed from the B6-gZdlgld mice and the spleen cells were cocultured with MCMV-pulsed APCs, derived from B6 mice, over a period of 48 hours in a mixed lymphocyte reaction (MLR). A significant reduction in IL-2 secretion was seen in the case of the spleen cells obtained from the animals which had been treated with AdFasL-APCs (fig. 5). This consequently demonstrated that the AdFasL-APCs had suppressed the T cells, in an antigen-specific manner, in vivo.

Decreased production of autoantibodies in MCMV-infected B6-g1d/gld mice as a result of having been treated with Fas ligand-expressing APCs Since MCMV-infected B6-g1d/g1d mice develop high con-centrations of autoantibodies, an experiment was carried out to investigate whether the autoantibody production can be influenced by administrating AdFasL-APCs. For this, the levels of rheumatoid factor IgG1 and anti-double stranded DNA
IgGl autoantibodies were determined in the serum of mice which had been treated either with AdLacZ-APCs, AdFasL-APCs or MCMV-pulsed AdFasL-APCs. A significant reduction in autoantibody production was found in the animals which were treated with AdFasL-APCs, with it being possible to augment the suppression even further by previously pulsing the AdFasL-APCs with MCMV (fig. 6).
Example using primary human cells Effective transfection of primary human macrophages with an adenoviral vector Primary monocytes, which had been isolated by leukapheresis, were differentiated in vitro, over a period of 7 days, into macrophages or, by adding IL-4 and GM-CSF to the culture medium, into dendritic cells (DCs). Subsequently, the macrophages and DCs were transfected with AdLacZ at varying concentrations. It was found that, in contrast to other cells (e. g. fibroblasts or murine macrophages), both macrophages and DCs are significantly more difficult to transfect.
However, when a high MOI (500) was used, it was possible, after 72 hours, to demonstrate successful transfection in approx. 30% of the macrophages by means of detecting the (3-galactosidase by means of an x-Gal staining (fig. 7). It was possible to increase the transfection rate markedly by using a variety of cytokines and also lipofectamine.
Inhibiting the allogenic proliferation of T cells with tolerogenic dendritic cells A tolerogenic DC phenotype was also investigated independently of the adenoviral transfection. Other research groups have shown that a suppressive DC phenotype is generated by adding IL-10 to the DC culture on day 5, whereas the addition of TNF at the same point in time leads to a strongly activating DC phenotype, an observation which has been attributed, inter alia, to the differential expression of costimulating molecules. An investigation was therefore carried out to determine whether these two DC populations differ in their ability to induce an allogenic T cell stimulation in the MLR (fig. 8). It was found that IL-10-matured DCs induce a smaller proliferation of allogenic T cells than do TNF-treated DCs. It was possible to augment this effect still further by adding an anti-Fas antibody (clone CH-11).
Demonstrating an allogen-specific suppression brought about by tolerizing APCs In order to investigate whether the observed suppression of the T cell proliferation is allogen-specific, the T cells were isolated 5 days after beginning the MLR and then employed in a 2nd MLR against APCs derived from a third donor (third party) (fig. 9). In this connection, it was also possible to demonstrate that the IL-10-matured DCs brought about allogen-specific suppression of the T cells since the reaction of the T cells, which had initially been cocultured with IL-10-matured DCs, on the APCs obtained from the third donor proceeded in an unimpaired manner.
Construction of vectors according to the invention The vectors pcDNA3-TK-IRES-crmA (fig. 10A) and pcDNA3-FasL-IRES-PLP (fig. 10B) are taken as examples of vectors according to the invention.
pcDNA3-Fast-IRES-PLP (fig. 10A) comprises nucleic acid sequences which encode, for example, the apoptosis-inducing ligand Fast and, by way of example, the antigen proteolipid protein (PLP). The two regions are linked by an IRES sequence such that the antigen is translated from the same mRNA as is the apoptosis-inducing ligand. The vector is based on the cloning vector pcDNA3. The nucleic acid regions which encode Fast and PLP were transcribed from RNA into cDNA by means of the polymerase chain reaction (PCR). Methods for isolating the RNA from cells, and the use of PCR for transcribing specific RNA molecules into cDNA, are state of the art. The oligonucleotides which were used as primers for the PCR
comprise, at their 5' ends, cleavage sites for endonucleases which were subsequently used for cloning the cDNAs into the vector pcDNA3. The region which encodes Fast was cloned into the vector pcDNA3, as the first region, by way of the cleavage sites for HindIII and BamHI. Subsequently, the PLP-encoding fragment was inserted by way of the cleavage sites for BamHI and EcoRI. Finally, the nucleic acid fragment which encompasses the IRES was cloned in by way of the recognition sequence for BamHI, between Fast and PLP. The techniques for isolating nucleic acids, for cleaving nucleic acids and for purifying nucleic acid cleavage products, and also the ligation of individual nucleic acid fragments, and the replication of the artificially generated nucleic acids in bacteria, are state of the art.
pcDNA3-TK-IRES-crmA (fig. 10B) comprises nucleic acid sequences which encode a suicide enzyme, such as thymidine kinase, and an antiapoptosis molecule, such as crmA. The expression of crmA is coupled, by an IRES sequence, to the expression of TK such that crmA can only be expressed together with the TK. The vector is based on the clone vector pcDNA3, and the cloning strategy, and the preparation of the vector according to the invention, are comparable with those for pcDNA3-Fast-IRES-PLP. The region which encodes the thymidine kinase was cloned into the vector pcDNA3, as the first region, by way of the cleavage sites for HindIII and BamHI. Subsequently, the crmA-encoding fragment was inserted by way of the cleavage sites for BamHI and XhoI. Finally, the nucleic acid fragment comprising the IRES was cloned in, by way of the recognition sequence for BamHI, between Fast and PLP. The nucleic acid sequences of the two vectors pcDNA3-FasL-IRES-crmA and pcDNA3-TK-IRES-PLP are listed as SEQ ID

SEQUENCE LISTING
<110> Schwarzmann, Fritz <120> Gene transfer vectors for the therapy of autoimmune diseases and diseases involving immunopathogenesis <130> SCW-002 PCT
<140> xx <141> 2000-10-12 <150> DE 199 48 983.1 <151> 1999-10-12 <160> 2 <170> PatentIn Ver. 2.1 2 0 <210> 1 <211> 10651 <212> DNA
<213> Artificial Sequence <220>
<223> Plasmid <400> 1 gatccatgaa tatttctaaa aaacttaaaa gttatacatt gataggtgga ttagctgtat 60 3 0 ttggagctct tggttctgca agctttggct ttaagcaatc agataagagt aacgataaca 120 cgcaattagt taatcaagca agaacgctag atgctaattc tgttagactt gcaggtcttg 180 gacaaaatgg ttcgttgttc aatacagttc ttagagatgt tgatgataac tttataacag 240 cagctaatgg aacaattatc aaattagata gttttactaa accattatat ggtttagatc 300 taagtgatga ttttgctgga tacaaagtaa aacaaatagt ttcagattac acaactagca 360 gaaatagatt tgatcaaaga caaacaagag catattatgc tctgttggtt aatgatgaag 420 ctaacgttca tttaaaaaga attaatacta actcaaatag aattggtaat agaaacaaca 480 attctaagtt tgtaattggt ggtgttgata atccagctca cgtaattaga tttactgatg 540 atgggactaa atttaatttt acaaagcaaa ctcaaggtga aattgttaat gacttcattt 600 tagatgcgcc aatcttacct aaagatttac acccagattg atataactta tacattcaaa 660 gaaagatctt accaaatgac gtaaacactg cagttgttcc ttgaccagta ggtagagtta 720 gtggaacaaa tgctgatgat gggatgtttg attttgggaa tggtcaaata actaatacag 780 atcctattgctcaaactaaaaccactactgataatcaaaatccttcaacttttaattcag840 gagcaatgcctggtgcaaacaatagatacgattctcaattgaatgtcaagcatagaatta900 aaacatctttccaattagatgaaaaatttgtttatccagaatgaactggttctgaagaga960 ataaaaatattacaagattagctactggaagtttgccaagcaacgaaagatattgaattc1020 ttgacataccagggactccacaagttactttaaaagaagattcagttaacgtattttcaa1080 gactatacttaaactcagttaattctttatcattcattggtgatagtatttatatttttg1140 gtacttctgaattaccatcattatgatactattcattcccaactagattatctgatctaa1200 ccgctttgaatcaagttaaaacagatgatattgaagcttcaagcactgataacggtacaa1260 caacaaacggaacaacgacaacaactgatacatctagtggttcaacaggtgctggaacag1320 gaaatactactaacacttctcaaacagtttctaatcctactttaaatacttatcgtagtt1380 ttggaattgatagtaaaccaacttctgcaaacaaaatagatgaaactaattgagcagatc1440 ctaatgttattgaagcaagaatatatgctgaatacagattaggtattcaaaatgaaattc1500 caataactaatgcaggaaactttatccgaaacacaattggtggtgttggttttacttcaa1560 caggttcaagagtagttttaagagcttcttataacggtgatcaacgtccaactggaaact1620 tccaacctttcttatacgtatttggttatttaggataccaacaaactagaacaggaactt1680 tctgatacggaacatataaactattaaacaacagcccttacgacgtattagatgctgcaa1740 gagtaggtactgaaaccaatcaatttagaagaacttcattaacataccctgttatgggtg1800 gatayctaactgaagaaggtgctagaagtttctctaatactccatatataagagcacaag1860 gtgacacaccagaaagccgaagcatcttccaatctggctaytctgataatacttatgagt1920 2 acattcaatcagttttaggatttgatggaattagaaataacttaaatgttggggttaaag1980 catcaagcttcttaaactcaaatagaccaaatccaaacggtctagaaatgattgctgcaa2040 caacatacttaagatcacaaattggattagctagaacatctggattaccaaaccaacaac2100 cattcggaacaactcaccaagttatttcagtatcacctggtgatcagttctcatcaatta2160 agaatattagaacaatcttccctggtaaccagttatgatacttcttattcacaaatgaaa2220 2 ataataaatctagtgtttatacattaagattagctgactcaagtaaccctgatgcgtcaa2280 gctcattcagtccaacaagtttaattgacgttaatgaaattggtgtaatcttacctttat2340 tagacaattcattctatacagtaaatgctgctggtaatgttgcattgttctcatcaaacc2400 ctggttctcctggatcatatactgctgtaaatacatttaatcagaacttatctgatattg2460 cttttgaaggttctggtgctaaatatacatctgatttctgaggaacaatccaattcaaac2520 30 ccgatgagtacttaattcaaaatgggttcactagtcaagtggctagaaacttcgttacaa2580 accaaagcttcttaaacagtttagttgacttcactcctgctaatgctggtactaactacc2640 gtgtagtggttgatcctgatggtaatttaacaaaccaaaacctacctctaaaagttcaga2700 tccaatacttagatggtaagtattatgatgctaaattaaagaacaataatttagtaacat2760 tctcttataacaactttgctgctttaccttcatgagtagtgcctacagcaattggtagta2820 35 cattaggtattcttgcaattatgatcatcttaggattagctatcggtattcctttaagag2880 ctcaaagaaaattacaagacaaagggttcaaaacaacattcaaaaaagttgataccttga2940 ctgctgctgttggttcagtttacaagaagattattacccaaactgctaacgttaagaaaa3000 aacctgctgctttaggtgctggtaaatctggtgataagaaacctgctgctgctgctaaac3060 ctgctgctccagctaaaccatctgcaccaaaagctagctcaccagctaaaccaactgcgc3120 40 ctaaatctggtgcgcctacaaaaccaactgctcctaagccagctgctccaaaaccaaccg3180 ctcccaaagaataactcgagcatgcatctagagggccctattctatagtgtcacctaaat3240 _77_ gctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgc3300 ccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataa3360 aatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtg3420 gggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtg3480 ggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcg3540 ccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctaca3600 cttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttc3660 gccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgct3720 ttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcg3780 ccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactc3840 ttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataaggg3900 attttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcg3960 aattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggca4020 ggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtcccca4080 ggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtc4140 ccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccc4200 catggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagcta4260 ttccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccggga4320 gcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgatt4380 2 gaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctat4440 gactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcag4500 gggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggac4560 gaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgac4620 gttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctc4680 ctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcgg4740 ctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgag4800 cgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcat4860 caggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgag4920 gatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgc4980 ttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcg5040 ttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtg5100 ctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgag5160 ttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccat5220 cacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttcc5280 gggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccacc5340 ccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttca5400 caaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtat5460 cttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagc5520 tgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagca5580 taaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgct5640 cactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaac5700 _78_ gcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgc5760 tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggt5820 tatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaagg5880 ccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacg5940 agcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagat6000 accaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgctta6060 ccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgct6120 gtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaacccc6180 ccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaa6240 gacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatg6300 taggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacag6360 tatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctctt6420 gatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagatta6480 cgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctc6540 agtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttca6600 cctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaa6660 cttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctat6720 ttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggct6780 taccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatt6840 2 tatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttat6900 ccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagtta6960 atagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttg7020 gtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgt7080 tgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccg7140 2 cagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccg7200 taagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgc7260 ggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaa7320 ctttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttac7380 cgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatctt7440 30 ttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagg7500 gaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaa7560 gcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaata7620 aacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtcgacggatcgg7680 gagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagtt7740 35 aagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaat7800 ttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttag7860 gcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgac7920 tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccg7980 cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccatt8040 40 gacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtca8100 atgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcc8160 _79_ aagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagta8220 catgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattac8280 catggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacgggg8340 atttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacg8400 ggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgt8460 acggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactg8520 gcttatcgaaattaatacgactcactatagggagacccaagcttatggcttcgtacccct8580 gccatcaacacgcgtctgcgttcgaccaggctgcgcgttctcgcggccatagcaaccgac8640 gtacggcgttgcgccctcgccggcagcaagaagccacggaagtccgcccggagcagaaaa8700 tgcccacgctactgcgggtttatatagacggtccccacgggatggggaaaaccaccacca8760 cgcaactgctggtggccctgggttcgcgcgacgatatcgtctacgtacccgagccgatga8820 cttactggcgggtgctgggggcttccgagacaatcgcgaacatctacaccacacaacacc8880 gcctcgaccagggtgagatatcggccggggacgcggcggtggtaatgacaagcgcccaga8944 taacaatgggcatgccttatgccgtgaccgacgccgttctggctcctcatatcggggggg9000 aggctgggagctcacatgccccgcccccggccctcaccctcatcttcgaccgccatccca9060 tcgccgccctcctgtgctacccggccgcgcgataccttatgggcagcatgaccccccagg9120 ccgtgctggcgttcgtggccctcatcccgccgaccttgcccggcacaaacatcgtgttgg9180 gggcccttccggaggacagacacatcgaccgcctggccaaacgccagcgccccggcgagc9240 ggcttgacctggctatgctggccgcgattcgccgcgtttacgggctgcttgccaatacgg9300 tgcggtatctgcagggcggcgggtcgtggcgggaggattggggacagctttcggggacgg9360 ccgtgccgccccagggtgccgagccccagagcaacgcgggcccacgaccccatatcgggg9420 acacgttatttaccctgtttcgggcccccgagttgctggcccccaacggcgacctgtata9480 acgtgtttgcctgggccttggacgtcttggccaaacgcctccgtcccatgcacgtcttta9540 tcctggattacgaccaatcgcccgccggctgccgggacgccctgctgcaacttacctccg9600 2 ggatggtccagacccacgtcaccaccccaggctccataccgacgatctgcgacctggcgc9660 gcacgtttgcccgggagatgggggaggctaactgaggatccactagtaacggccgccagt9720 gtgctggaattaattcgctgtctgcgagggccagctgttggggtgagtactccctctcaa9780 aagcgggcatgacttctgcgctaagattgtcagtttccaaaaacgaggaggatttgatat9840 tcacctggcccgcggtgatgcctttgagggtggccgcgtccatctggtcagaaaagacaa9900 tctttttgttgtcaagcttgaggtgtggcaggcttgagatctggccatacacttgagtga9960 caatgacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcaggt10020 cgatcgagcatgcatctagggcggccgcactagaggaattcgcccctctccctccccccc10080 ~ccctaacgttactggccgaagccgcttggaataaggccggtgtgtgtttgtctatatgtg10140 attttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtctt10200 cttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaa10260 tgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgac10320 cctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacg10380 tgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagt10440 tgtggaaagagtcaaatggctctcctcaagcgtagtcaacaaggggctgaaggatgccca10500 gaaggtaccccattgtatgggaatctgatctggggcctcggtgcacatgctttacatgtg10560 tttagtcgaggttaaaaaagctctaggccccccgaaccacggggacgtggttttcctttg10620 aaaaacacga tgataagctt gccacaaccc g 10651 <210> 2 <211> 8116 <212> DNA
<213> Artificial Sequence <220>
<223> Plasmid <400> 2 gatccttccagctgaacaaagtcagccacaaagcagactagccagccggctacaattgga60 gtcagagtcccaaagacatgggcttgttagagtgctgtgcaagatgtctggtaggggccc120 cctttgcttccctggtggccactggattgtgtttctttggggtggcactgttctgtggct180 gtggacatgaagccctcactggcacagaaaagctaattgagacctatttctccaaaaact240 accaagactatgagtatctcatcaatgtgatccatgccttccagtatgtcatctatggaa300 ctgcctctttcttcttcctttatggggccctcctgctggctgagggcttctacaccaccg360 gcgcagtcaggcagatctttggcgactacaagaccaccatctgcggcaagggcctgagcg420 2 caacggtaacagggggccagaaggggaggggttccagaggccaacatcaagctcattctt480 tggagcgggtgtgtcattgtttgggaaaatggctaggacatcccgacaagtttgtgggca540 tcacctatgccctgaccgttgtgtggctcctggtgtttgcctgctctgctgtgcccgtgt600 acatttacttcaacacctggaccacctgcgactctattgccttccccagcaagacctctg660 ccagtataggcagtctctgtgctgacgccagaatgtatggtgttctcccatggattgctt720 2 tccctggcaaggtttgtggctccaaccttctgtccatctgcaaaacagctgagttccaaa780 tgaccttccacctgtttattgctgcatttgtgggggctgcagctacactggtttccctgc840 tcaccttcatgattgctgccacttacaactttgccgtccttaaactcatgggccgaggca900 ccaagttctgagaattctgcagatatccatcacactggcggccgctcgagcatgcatcta960 gagggccctattctatagtgtcacctaaatgctagagctcgctgatcagcctcgactgtg1020 30 ccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaa1080 ggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagt1140 aggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaa1200 gacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaacc1260 agctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggt1320 3 gtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttc1380 gctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgg1440 ggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgat1500 tagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacg1560 ttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccct1620 4 atctcggtctattcttttgatttataagggattttggggatttcggcctattggttaaaa1680 aatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttag1740 ggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatgcatctcaat1800 tagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagc1860 atgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgccccta1920 actccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgca1980 gaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttgga2040 ggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaa2100 gagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccg2160 gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct2220 gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgac2280 ctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacg2340 acgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctg2400 ctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaa2460 gtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccca2520 ttcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtctt2580 gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc2640 aggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgc2700 ttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctg2760 ggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagctt2820 ggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcag2880 2 cgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaaa2940 .

tgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttct3000 atgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcg3060 gggatctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggtt3120 acaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattcta3180 2 gttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctcta3240 gctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctca3300 caattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgag3360 tgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgt3420 cgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggc3480 30 gctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcgg3540 tatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaa3600 agaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctgg3660 cgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcaga3720 ggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg3780 35 tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgg3840 gaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttc3900 gctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccg3960 gtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca4020 ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggt4080 40 ggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccag4140 ttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcg4200 gtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatc4260 ctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattt4320 tggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagtt4380 ttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatca4440 gtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccg4500 tcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgatac4560 cgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaaggg4620 ccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgcc4680 gggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgcta4740 caggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaac4800 gatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtc4860 ctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcac4920 tgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtact4980 caaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaa5040 tacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgtt5100 cttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaaccca5160 ctcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaa5220 aaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatac5280 tcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcg5340 2 gatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttcccc5400 gaaaagtgccacctgacgtcgacggatcgggagatctcccgatcccctatggtcgactct5460 cagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgtgtgtt5520 ggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccga5580 caattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggc5640 2 cagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtc5700 attagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcc5760 tggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagt5820 aacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgccca5880 cttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacgg5940 30 taaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggca6000 gtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaa6060 tgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaa6120 tgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgc6180 cccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctct6290 35 ctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatag6300 ggagacccaagcttatgcagcagcccttcaattacccatatccccagatctactgggtgg6360 acagcagtgccagctctccctgggcccctccaggcacagttcttccctgtccaacctctg6420 tgcccagaaggcctggtcaaaggaggccaccaccaccaccgccaccgccaccactaccac6480 ctccgccgccgccgccaccactgcctccactaccgctgccacccctgaagaagagaggga6540 4 accacagcacaggcctgtgtctccttgtgatgtttttcatggttctggttgccttggtag6600 gattgggcctggggatgtttcagctcttccacctacagaaggagctggcagaactccgag6660 agtctaccagccagatgcacacagcatcatctttggagaagcaaataggccaccccagtc6720 caccccctgaaaaaaaggagctgaggaaagtggcccatttaacaggcaagtccaactcaa6780 ggtccatgcctctggaatgggaagacacctatggaattgtcctgctttctggagtgaagt6840 ataagaagggtggccttgtgatcaatgaaactgggctgtactttgtatattccaaagtat6900 acttccggggtcaatcttgcaacaacctgcccctgagccacaaggtctacatgaggaact6960 ctaagtatccccaggatctggtgatgatggaggggaagatgatgagctactgcactactg7020 ggcagatgtgggcccgcagcagctacctgggggcagtgttcaatcttaccagtgctgatc7080 atttatatgtcaacgtatctgagctctctctggtcaattttgaggaatctcagacgtttt7140 tcggcttatataagctctaaggatccactagtaacggccgccagtgtgctggaattaatt7200 cgctgtctgcgagggccagctgttggggtgagtactccctctcaaaagcgggcatgactt7260 ctgcgctaagattgtcagtttccaaaaacgaggaggatttgatattcacctggcccgcgg7320 tgatgcctttgagggtggccgcgtccatctggtcagaaaagacaatctttttgttgtcaa7380 gcttgaggtgtggcaggcttgagatctggccatacacttgagtgacaatgacatccactt7940 tgcctttctctccacaggtgtccactcccaggtccaactgcaggtcgatcgagcatgcat7500 ctagggcggccgcactagaggaattcgcccctctccctcccccccccctaacgttactgg7560 ccgaagccgcttggaataaggccggtgtgtgtttgtctatatgtgattttccaccatatt7620 gccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcc7680 taggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagc7740 agttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcg7800 2 gaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacc7860 tgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaa7920 atggctctcctcaagcgtagtcaacaaggggctgaaggatgcccagaaggtaccccattg7980 tatgggaatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaa8040 aaaagctctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgata8100 2 agcttgccacaacccg 8116

Claims (11)

claims

1. A gene transfer vector which comprises at least one nucleic acid molecule which comprises a) a first nucleic acid sequence, encoding one or more apoptosis-inducing ligand(s), b) a second nucleic acid sequence, encoding one or more antigen(s), and, where appropriate, c) a third nucleic acid sequence, encoding one or more antiapoptosis molecule(s), and, where appropriate, d) a fourth nucleic acid sequence, encoding one or more suicide enzyme(s), characterized in that the first and second nucleic acid sequences and the third and fourth nucleic acid sequences are functionally linked with each other such that the expression of the second nucleic acid sequence is dependent on the expression of the first nucleic acid sequence and the expression of the third nucleic acid sequence is dependent on the expression of the fourth nucleic acid sequence.

2. Gene transfer vector as claimed in claim 1, characterized in that the first and second nucleic acid sequences are present on one nucleic acid molecule and the third and fourth nucleic acid sequences are present on another nucleic acid molecule.

3. A gene transfer vector as claimed in one of claims 1 to 2, characterized in that the vectors are viruses, in particular retroviruses, adenoviruses, adeno-associated viruses, pock viruses, alphaviruses or herpes viruses, or bacteria, in particular listerias, shigellas or salmonellas, or liposomes, plasmids, phagemids, cosmids, bacteriophages or artificial chromosomes.

4. A gene transfer vector as claimed in one of claims 1 to 3, characterized in that the first nucleic acid sequence encodes CD95L/FasL/Apo1L, TRAIL or Apo3L.

5. A gene transfer vector as claimed in one of claims 1 to 4, characterized in that the second nucleic acid sequence encodes one or more epitopes of myelin basic protein, myelin proteolipid protein, myelin-associated basic protein on oligodendrocytes, oligodendrocyte-specific protein, myelin-associated glycoprotein, glycoprotein P0, peripheral myelin protein 22, p170k/SAG, Schwann cell myelin protein, transaldolase, S100.beta., alpha B crystalline, 2',3'-cyclic nucleotide 3'-phosphodi-esterase (CNP), GFAP, the .alpha. or .epsilon. subunits of the acetylcholine receptor, type II
collagen, tyrosine phosphatase Ia-2, proinsulin, GAD65, Hsp60 or ICA69.

6. A gene transfer vector as claimed in one of claims 1 to 5, characterized in that the third nucleic acid sequence encodes E3-14.7K, E3-14.5K, E3-10.4K, FLIP, vFLIP, MC159, MC160, BORFE2, E8 from the equine herpes virus EHV-2, K13 from HHV-8, ORF71 from herpes virus saimiri, E1B-19K, LMP-1, LT protein from SV40, polyomaproteins ST and MT, inhibitors of caspases or antisense RNAs.

7. A gene transfer vector as claimed in one of claims 1 to 6, characterized in that the fourth nucleic acid sequence encodes thymidine kinase, carboxylesterase, cytosine deaminase, carboxypeptidase G2, cytochrome P450, deoxycytidine kinase, nitroreductase, purine nucleoside phosphorylase, thymidine phosphorylase, xanthine-guanine-phosphoribosyl transferase, bacterial uracil phosphoribosyl transferase, or a fusion protein composed of cytosine deaminase and saccharomyces cerevisiae uracil phosphoribosyl transferase.

8. A nucleic acid sequence as depicted in SEQ ID No: 1 or SEQ ID No: 2.

9. A gene transfer vector as claimed in one of claims 1 to 8 as a therapeutic agent.

10. The use of the gene transfer vector as claimed in one of claims 1 to 8 for producing a therapeutic agent for preventing or treating autoimmune diseases, in particular rheumatoid arthritis, systemic lupus erythematodes, Sjögren's syndrome, polymyositis, dermatomyositis, polymyalgia rheumatica, temporal arthritis, spondylarthropathy, Bechterew's disease, Crohn's disease, ulcerative colitis, celiac disease, autoimmune hepatitis, type I diabetes mellitus, adrenal insufficiency, thyroiditis, psoriasis, dermatitis herpetiformis, pemphigus vulgaris, alopecia, multiple sclerosis and myastenia gravis, or for preventing or treating chronically inflammatory processes which are due to immunopathogenesis, in particular chronic inflammations following viral or bacterial infections, in particular chronic hepatitis in association with hepatitis B
virus or hepatitis C virus infections, or encephalitis following infection with the measles virus, or for preventing or treating transplant rejections.

11. The use of the gene transfer vectors as claimed in one of claims 1 to 9 for modifying animal or mammalian cells, in particular human cells, ex vivo.