CA2387044A1 - Oleoyl-acyl-carrier-protein thioesterases in plants - Google Patents

Abstract

This invention relates to an isolated nucleic acid fragment encoding an oleolyl-ACP thioesterase. The invention also relates to the construction of a chimeric gene encoding all or a portion of the oleolyl-ACP thioesterase, in sense or antisense orientation, wherein expression of the chimeric gene results in production of altered levels of the oleolyl-ACP thioesterase in a transformed host cell.

Description

TITLE
OLEOYL-ACYL-CARRIER-PROTEIN THIOESTERASES IN PLANTS
This application claims the benefit of U.S. Provisional Application No.
60/167510, filed November 24, 1999.
FIELD OF THE INVENTION
This invention is in the field of plant molecular biology. More specifically, this invention pertains to nucleic acid fragments encoding oleoyl-ACP thioesterase in plants and seeds.
BACKGROUND OF THE INVENTION
The composition of plant lipids largely determines membrane function and climatic adaptation of the species. As a result, many naturally occurnng plant oils exist that display a wide variety of properties and compositions. This has led to the selection of different plant oils to perform specific industrial and nutritional functions. Lipid composition is determined by the synthesis of the fatty acids on an acyl carrier protein (ACP), and their removal from ACP by thioesterases. Fatty acid chains removed from ACP are no longer substrates for elongation or desaturation and are free to be coupled to the head groups to form the higher order triacyl compounds that are the major component of oils.
Plant lipids find their major use as edible oils in the form of triacylglycerols. The specific performance and health attributes of edible oils are determined largely by their fatty acid composition. Most vegetable oils derived from commercial plant varieties are composed primarily ofpalmitic (16:0), stearic (18:0), oleic (18:1), linoleic (18:2) and linolenic (18:3) acids. Palmitic and stearic acids are, respectively, 16- and 18-carbon-long, saturated fatty acids. Oleic, linoleic, and linolenic acids are 18-carbon-long, unsaturated fatty acids containing one, two, and three double bonds, respectively. Oleic acid is referred to as a mono-unsaturated fatty acid, while linoleic and linolenic acids are referred to as poly-unsaturated fatty acids.
Oil biosynthesis in plants has been well-studied [see Harwood (1989) in Critical Reviews in Plant Sciences, Vol. 8 (1 ):1-43]. The biosynthesis of palmitic, stearic and oleic acids occur in the plastids by the interplay of three key enzymes of the "ACP
track":
palmitoyl-ACP elongase, stearoyl-ACP desaturase and the acyl-ACP
thioesterases. Of these three enzyme types, the acyl-ACP thioesterases function to remove the acyl chain from the carrier protein (ACP) and thus from the metabolic pathway. The oleoyl-ACP
thioesterase catalyzes the hydrolysis of oleoyl-ACP thioesters at high rates and at much lower rates the hydrolysis of palmitoyl-ACP and stearoyl-ACP. Other acyl-ACP thioesterases have been identified which do not exhibit this substrate specificity. Competition between all forms of acyl-ACP thioesterases, palmitoyl-ACP elongase, and stearoyl-ACP desaturase working on the same pool of ACP-bound substrates, ultimately determines the ratios of palmitic, stearic, and polyunsaturated acids found in the triacylglyceride of vegetable oils.
Recent research efforts have examined the role that monounsaturated fatty acid plays in reducing the risk of coronary heart disease. In the past, it was believed that monounsaturates, in contrast to saturates and polyunsaturates, had no effect on serum cholesterol and coronary heart disease risk. Several recent human clinical studies suggest that diets high in monounsaturated fat may reduce the "bad" (low-density lipoprotein) cholesterol while maintaining the "good" (high-density lipoprotein) cholesterol. (See Mattson, et al., Journal of Lipid Research (1985) 26:194-202). The significance of monounsaturated fat in the diet was confirmed by international researchers from seven countries at the Second Colloquium on Monounsaturated Fats sponsored by the National Heart, Lung and Blood Institutes in 1987. Therefore, high levels of an oleoyl-ACP
thioesterase activity may be advantageous in increasing the concentration of monounsaturated oleate in plant oils.
The class I thioesterases, found in plants and bacteria, are monofunctional proteins that catalyze the hydrolysis of acyl-ACP thioesters. Class II thioesterase activities are usually found as components of multifunctional polypeptides and are exemplified by the enzymes from birds (Rogers and Kolattukudy (1984) Anal. Biochem 137:444-448) and rat (Naggert et al. (1988) J. Biol. Chem. 263:1146-1150).
U.S. Patent No. 5,147,792, issued to Perchorowicz et al., describes a method of shifting the fatty acid distribution in plastids towards shorter-chained species by using thioesterase II and acyl carrier protein. While Perchorowicz et al. teach a method for altering the fatty acid distribution in isolated plastids, they do not teach a method of producing such altered fatty acid profiles in whole plant cells. They further do not teach a method of producing sexually reproducing plants producing altered fatty acid profiles. The methods therefore do not provide a means for the large scale production of usable vegetable oils with new fatty acid compositions.
U.S. Patent No. 5,298,421, issued to Davies et al., describes plant medium-chain preferring acyl-ACP thioesterases and related methods. The methods taught by Davies et al.
produce plants with seed oil compositions with substantial amounts of fatty acids of less than 16 carbon atoms in length. These oils are different from the seed oils produced by normal, temperate oilseeds in this characteristic. The seed oil fatty acid compositions taught in the instant invention are not elevated in comparison to normal oils in the shorter (less than 16 carbon atom) fatty acids. The fatty acid profiles produced in the instant invention are different from common temperate oilseeds and from the invention of Davies et al. in that they contain elevated levels of fully saturated fatty acids of 16 and 18 carbon atoms in length.

U.S. Patent No. 5,530,186, issued to Hitz et al. on June 25, 1996, describes the use of isolated nucleic acid fragments encoding acyl-ACP and palmitoyl-ACP
thioesterases (respectively) in transgenic plants that have altered fatty acid compositions.
The acyl-ACP
thioesterase encodes a medium-chain prefernng enzyme similar to that described by Davies.
The palmitoyl-ACP thioesterase exhibits specificity for the 16 carbon unsaturated palmitate.
The evidence for three full-length cDNAs, and three partial cDNAs, encoding oleoyl-ACP
thioesterases from six different plant species is presented herein.
SUMMARY OF THE INVENTION
The present invention concerns an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting o~ (a) a first nucleotide sequence encoding a polypeptide of at least 166 amino acids having at least 90% identity based on the Clustal method of alignment when compared to a polypeptide selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, and 16, or a second nucleotide sequence encoding a polypeptide of at least 363 amino acids having at least 92% identity based on the Clustal method of alignment when compared to a polypeptide from SEQ ID N0:14, and (b) a third nucleotide sequence comprising the complement of the first or second nucleotide sequence.
In a second embodiment, it is preferred that the isolated polynucleotide of the invention comprises a first nucleotide sequence which comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs:I, 3, 5, 7, 9, 11, 13, and 15 that codes for the polypeptide selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, and 16.
In a third embodiment, this invention concerns an isolated polynucleotide comprising a nucleotide sequence of at least one of 60 (preferably at least one of 40, most preferably at least one of 30) contiguous nucleotides derived from a nucleotide sequence selected from the group consisting of SEQ ID NOs:I, 3, 5, 7, 9, 11, 13, and 15 and the complement of such nucleotide sequences.
In a fourth embodiment, this invention relates to a chimeric gene comprising an isolated polynucleotide of the present invention operably linked to at least one suitable regulatory sequence.
In a fifth embodiment, the present invention concerns an isolated host cell comprising a chimeric gene of the present invention or an isolated polynucleotide of the present invention. The host cell may be eukaryotic, such as a yeast or a plant cell, or prokaryotic, such as a bacterial cell. The present invention also relates to a virus, preferably a baculovirus, comprising an isolated polynucleotide of the present invention or a chimeric gene of the present invention.
In a sixth embodiment, the invention also relates to a process for producing an isolated host cell comprising a chimeric gene of the present invention or an isolated polynucleotide of the present invention, the process comprising either transforming or transfecting an isolated suitable host cell with a chimeric gene or isolated polynucleotide of the present invention.
In a seventh embodiment, the invention concerns an oleolyl-ACP thioesterase polypeptide of at least 166 amino acids comprising at least 90% identity based on the Clustal method of alignment compared to a polypeptide selected from the group consisting of SEQ
ID NOs:2, 4, 6, 8, 10, 12, and 16, or polypeptide of at least 363 amino acids comprising at least 92% identity based on the Clustal method of alignment compared to a polypeptide from SEQ ID N0:14.
In an eighth embodiment, the invention relates to a method of selecting an isolated polynucleotide that affects the level of expression of an oleolyl-ACP
thioesterase polypeptide or enzyme activity in a host cell, preferably a plant cell, the method comprising the steps of: (a) constructing an isolated polynucleotide of the present invention or an isolated chimeric gene of the present invention; (b) introducing the isolated polynucleotide or the isolated chimeric gene into a host cell; (c) measuring the level of the oleolyl-ACP
thioesterase polypeptide or enzyme activity in the host cell containing the isolated polynucleotide; and (d) comparing the level of the oleolyl-ACP thioesterase polypeptide or enzyme activity in the host cell containing the isolated polynucleotide with the level of the oleolyl-ACP thioesterase polypeptide or enzyme activity in the host cell that does not contain the isolated polynucleotide.
In a ninth embodiment, the invention concerns a method of obtaining a nucleic acid fragment encoding a substantial portion of an oleolyl-ACP thioesterase polypeptide, preferably a plant oleolyl-ACP thioesterase polypeptide, comprising the steps of:
synthesizing an oligonucleotide primer comprising a nucleotide sequence of at least one of 30 (preferably at least one of 40, most preferably at least one of 60) contiguous nucleotides derived from a nucleotide sequence selected from the group consisting of SEQ
ID NOs:I, 3, 5, 7, 9, 11, 13, and 15, and the complement of such nucleotide sequences; and amplifying a nucleic acid fragment (preferably a cDNA inserted in a cloning vector) using the oligonucleotide primer. The amplified nucleic acid fragment preferably will encode a substantial portion of an oleolyl-ACP thioesterase amino acid sequence.
In a tenth embodiment, this invention relates to a method of obtaining a nucleic acid fragment encoding all or a substantial portion of the amino acid sequence encoding an oleolyl-ACP thioesterase polypeptide comprising the steps of: probing a cDNA
or genomic library with an isolated polynucleotide of the present invention; identifying a DNA clone that hybridizes with an isolated polynucleotide of the present invention;
isolating the identified DNA clone; and sequencing the cDNA or genomic fragment that comprises the isolated DNA clone.

In an eleventh embodiment, this invention concerns a composition, such as a hybridization mixture, comprising an isolated polynucleotide of the present invention.
In a twelfth embodiment, this invention concerns a method for positive selection of a transformed cell comprising: (a) transforming a host cell with the chimeric gene of the present invention or an expression cassette of the present invention; and (b) growing the transformed host cell, preferably a plant cell, such as a monocot or a dicot, under conditions which allow expression of the oleolyl-ACP thioesterase polynucleotide in an amount sufficient to complement a null mutant to provide a positive selection means.
In a thirteenth embodiment, this invention relates to a method of altering the level of expression of a oleoyl-ACP thioesterase in a host cell comprising: (a) transforming a host cell with a chimeric gene of the present invention; and (b) growing the transformed host cell under conditions that are suitable for expression of the chimeric gene wherein expression of the chimeric gene results in production of altered levels of the oleoyl-ACP
thioesterase in the transformed host cell.
BRIEF DESCRIPTION OF THE
DRAWINGS AND SEQUENCE LISTINGS
The invention can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing which form a part of this application.
Figure 1 shows a comparison of the amino acid sequences of oleoyl-ACP
thioesterase from African daisy (Dimorphotheca sinuata, SEQ ID N0:2 denoted as [SIN2]), corn (Zea mays, SEQ ID N0:6 denoted as [SIN6]), rice (Oryza sativa, SEQ ID N0:8 denoted as [SIN8]), safflower (Carthamus tinctorius, SEQ ID N0:17, NCBI Accession No: gi 404028), gopher apple (Licania michauxii, SEQ ID N0:4 denoted as [SIN4]), mangosteen (Garcinia mangostana, SEQ ID N0:18, NCBI Accession No: gi 1930077), Vernonia (I~ernonia mespilifolia, SEQ ID NO:10 denoted as [SIN10]), safflower (Carthamus tinctorius, SEQ ID
N0:19, NCBI Accession No: gi 404026), wheat (Triticum aestivum, SEQ ID N0:12 denoted as [SIN 12]), African palm oil (Elaeis guineensis, SEQ ID N0:20, NCBI
Accession No: gi 4704640), corn (Zea mays, SEQ ID N0:14 denoted as [SIN14]), wheat (Triticum aestivum, SEQ ID N0:16 denoted as [SIN16]), and two Arabidopsis proteins (Arabidopsis thaliana, SEQ ID N0:21 and 22, NCBI Accession No: gi 7487983 and gi 1076361, respectively).
Table 1 lists the polypeptides that are described herein, the designation of the cDNA
clones that comprise the nucleic acid fragments encoding polypeptides representing all or a substantial portion of these polypeptides, and the corresponding identifier (SEQ ID NO:) as used in the attached Sequence Listing. The sequence descriptions and Sequence Listing attached hereto comply with the rules governing nucleotide and/or amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. ~1.821-1.825.

Oleoyl-ACP Thioesterase SEQ ID NO:

Oleoyl-ACP Thioesterase Clone Designation(Nucleotide) (Amino Acid) African daisy [Dimorphothecadms2c.pk001.m14:fis1 2 sinuata]

Gopher apple [Licania elslc.pk001.k6:fis3 4 michauxii]

Corn [Zea mays] crln.pk0147.g3:fis5 6 Rice [Oryza saliva] rl0n.pk101.123:fis7 8 r1r48.pk001 O.fS

Vernonia [Vernonia mespilifolia]vsln.pk0010.g10:fis9 10 Wheat [Triticum aestivum]wrl.pk0026.b7 11 12 Corn [Zea mays] cpjlc.pk002.g7:fis13 14 Wheat [Triticum aestivum]wrl.pk0026.b7:fis15 16 The Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the IUPAC-IUBMB
standards described in Nucleic Acids Res. 13:3021-3030 (1985) and in the Biochemical J.
219 (No. 2):345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the requirements of 37 C.F.R. ~ 1.822.
DETAILED DESCRIPTION OF THE INVENTION
In the context of this disclosure, a number of terms shall be utilized. The terms "polynucleotide," "polynucleotide sequence," "nucleic acid sequence," and "nucleic acid fragment"/"isolated nucleic acid fragment" are used interchangeably. These terms encompass nucleotide sequences and the like. A polynucleotide may be an RNA or DNA
that is single- or double-stranded, that optionally contains synthetic, non-natural or altered nucleotide bases. A polynucleotide in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
An isolated polynucleotide of the present invention may include at least one of 1200 contiguous nucleotides, preferably at least one of 800 contiguous nucleotides, most preferably one of at least 400 contiguous nucleotides derived from SEQ ID NOs:I, 3, 5, 7, 9, 1 l, 13, and 15, or the complement of such sequences.
The term "isolated" polynucleotide refers to a polynucleotide that is substantially free from other nucleic acid sequences, such as and not limited to other chromosomal and extrachromosomal DNA and RNA, that normally accompany or interact with it as found in its naturally occurring environment. Isolated polynucleotides may be purified from a host cell in which they naturally occur. Conventional nucleic acid purification methods known to skilled artisans may be used to obtain isolated polynucleotides. The term also embraces recombinant polynucleotides and chemically synthesized polynucleotides.
The term "recombinant" means, for example, that a nucleic acid sequence is made by an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated nucleic acids by genetic engineering techniques.
As used herein, "contig" refers to a nucleotide sequence that is assembled from two or more constituent nucleotide sequences that share common or overlapping. For example, the nucleotide sequences of two or more nucleic acid fragments can be compared and aligned in order to identify common or overlapping sequences. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences (and thus their corresponding nucleic acid fragments) can be assembled into a single contiguous nucleotide sequence, to form a "contig".
As used herein, "substantially similar," in the case of nucleic acid fragments, refers changes in one or more nucleotide bases that result in substitution of one or more amino acids, but do not affect the functional properties of the polypeptide encoded by the nucleotide sequence. "Substantially similar" also refers to nucleic acid fragments wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid fragment to alter gene expression patterns by gene silencing through for example antisense or co-suppression technology. "Substantially similar" also refers to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotides that do not substantially affect the functional properties of the resulting transcript vis-a-vis the ability to mediate gene silencing or alteration of the functional properties of the resulting protein molecule. It is therefore understood that the invention encompasses more than the specific exemplary nucleotide or amino acid sequences and includes functional equivalents thereof. The terms "substantially similar" and "corresponding substantially" are used interchangeably herein.
In one embodiment, substantially similar nucleic acid fragments may be obtained by screening nucleic acid fragments representing subfragments or modifications of the nucleic acid fragments of the instant invention, wherein one or more nucleotides are substituted, deleted and/or inserted, for their ability to affect the level of the polypeptide encoded by the unmodified nucleic acid fragment in a plant or plant cell. For example, a substantially similar nucleic acid fragment representing at least one of 400 contiguous nucleotides derived from the instant nucleic acid fragment can be constructed and introduced into a plant or plant cell. The level of the polypeptide encoded by the unmodified nucleic acid fragment present in a plant or plant cell exposed to the substantially similar nucleic fragment can then be compared to the level of the polypeptide in a plant or plant cell that is not exposed to the substantially similar nucleic acid fragment.

For example, it is well known in the art that antisense suppression and co-suppression of gene expression may be accomplished using nucleic acid fragments representing less than the entire coding region of a gene, and by using nucleic acid fragments that do not share 100% sequence identity with the gene to be suppressed. Moreover, alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not effect the functional properties of the encoded polypeptide, are well known in the art. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products. Consequently, an isolated polynucleotide comprising a nucleotide sequence of at least one of 60 (preferably at least one of 40, most preferably at least one of 30) contiguous nucleotides derived from a nucleotide sequence selected from the group consisting of SEQ ID NOs:I, 3, S, 7, 9, 11, 13, and 15, and the complement of such nucleotide sequences may be used in methods of selecting an isolated polynucleotide that affects the expression of an oleolyl-ACP thioesterase polypeptide in a host cell. A method of selecting an isolated polynucleotide that affects the level of expression of a polypeptide in a virus or in a host cell (eukaryotic, such as a plant cell, or a yeast cell, or prokaryotic such as a bacterial cell) may comprise the steps of constructing an isolated polynucleotide of the present invention or an isolated chimeric gene of the present invention; introducing the isolated polynucleotide or the isolated chimeric gene into a host cell; measuring the level of a polypeptide or enzyme activity in the host cell containing the isolated polynucleotide; and comparing the level of a polypeptide or enzyme activity in the host cell containing the isolated polynucleotide with the level of a polypeptide or enzyme activity in a host cell that does not contain the isolated polynucleotide.
Moreover, substantially similar nucleic acid fragments may also be characterized by their ability to hybridize. Estimates of such homology are provided by either DNA-DNA or DNA-RNA hybridization under conditions of stringency as is well understood by those skilled in the art (Hames and Higgins, Eds. (1985) Nucleic Acid Hybridisation, IRL Press, Oxford, U.K.). Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms.

Post-hybridization washes determine stringency conditions. One set of preferred conditions uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2X SSC, 0.5% SDS at 45°C for 30 min, and then repeated twice with 0.2X SSC, 0.5% SDS at 50°C for 30 min. A more preferred set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2X SSC, 0.5% SDS was increased to 60°C.
Another preferred set of highly stringent conditions uses two final washes in O.1X SSC, 0.1% SDS at 65°C.
Substantially similar nucleic acid fragments of the instant invention may also be characterized by the percent identity of the amino acid sequences that they encode to the amino acid sequences disclosed herein, as determined by algorithms commonly employed by those skilled in this art.
Suitable nucleic acid fragments (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% identical, preferably at least about 80%, more preferably at least about 85%, still more preferably at least about 90%, and most preferably at least about 95% identical to the amino acid sequences reported herein.
Preferred nucleic acid fragments encode amino acid sequences that are about 92% identical to the amino acid sequences reported herein. More preferred nucleic acid fragments encode amino acid sequences that are at least about 93% identical to the amino acid sequences reported herein. Most preferred are nucleic acid fragments that encode amino acid sequences that are at least about 96% identical to the amino acid sequences reported herein.
Suitable nucleic acid fragments not only have the above identities but typically encode a polypeptide having at least 10, preferably 20, more preferably 30, still more preferablly 50, more preferably at least 100, more preferably at least 150 amino acids, preferably at least 166 amino acids, more preferably at least 200 amino acids, still more preferably at least 250 amino acids, and most preferably at least 300 amino acids. Sequence alignments and percent identity calculations were performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, WI).
Multiple alignment of the sequences was performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS 5:151-153) with the default parameters (GAP
PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
A "substantial portion" of an amino acid or nucleotide sequence comprises an amino acid or a nucleotide sequence that is sufficient to afford putative identification of the protein or gene that the amino acid or nucleotide sequence comprises. Amino acid and nucleotide sequences can be evaluated either manually by one skilled in the art, or by using computer-based sequence comparison and identification tools that employ algorithms such as BLAST
(Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol.
215:403-410; see also www.ncbi.nlm.nih.govBLAST~. In general, a sequence of ten or more contiguous amino acids or thirty or more contiguous nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene.
Moreover, with respect to nucleotide sequences, gene-specific oligonucleotide probes comprising 30 or more contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12 or more nucleotides may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a "substantial portion" of a nucleotide sequence comprises a nucleotide sequence that will afford specific identification and/or isolation of a nucleic acid fragment comprising the sequence. The instant specification teaches amino acid and nucleotide sequences encoding polypeptides that comprise one or more particular plant proteins. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above.
"Codon degeneracy" refers to divergence in the genetic code permitting variation of the nucleotide sequence without effecting the amino acid sequence of an encoded polypeptide. Accordingly, the instant invention relates to any nucleic acid fragment comprising a nucleotide sequence that encodes all or a substantial portion of the amino acid sequences set forth herein. The skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid.
Therefore, when synthesizing a nucleic acid fragment for improved expression in a host cell, it is desirable to design the nucleic acid fragment such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
"Synthetic nucleic acid fragments" can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art.
These building blocks are ligated and annealed to form larger nucleic acid fragments which may then be enzymatically assembled to construct the entire desired nucleic acid fragment.
"Chemically synthesized", as related to a nucleic acid fragment, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of nucleic acid fragments may be accomplished using well established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines.
Accordingly, the nucleic acid fragments can be tailored for optimal gene expression based on optimization of the nucleotide sequence to reflect the codon bias of the host cell. The skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available.
"Gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (S' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature with its own regulatory sequences. "Chimeric gene" refers any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature.
Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
"Endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign-gene" refers to a gene not normally found in the host organism, but 1 S that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A
"transgene" is a gene that has been introduced into the genome by a transformation procedure.
"Coding sequence" refers to a nucleotide sequence that codes for a specific amino acid sequence. "Regulatory sequences" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
"Promoter" refers to a nucleotide sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' to a promoter sequence. The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "enhancer" is a nucleotide sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or may be composed of different elements derived from different promoters found in nature, or may even comprise synthetic nucleotide segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions.
Promoters which cause a nucleic acid fragment to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro and Goldberg (1989) Biochemistry ofPlants 15:1-82.
It is fiwther recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, nucleic acid fragments of different lengths may have identical promoter activity.
"Translation leader sequence" refers to a nucleotide sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner and Foster (1995) Mol. Biotechnol. 3:225-236).
"3' non-coding sequences" refer to nucleotide sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor. The use of different 3' non-coding sequences is exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
"RNA transcript" refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA
sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA. "Messenger RNA (mRNA)" refers to the RNA that is without introns and that can be translated into polypeptides by the cell.
"cDNA" refers to DNA that is complementary to and derived from an mRNA template. The cDNA can be single-stranded or converted to double stranded form using, for example, the Klenow fragment of DNA polymerase I. "Sense-RNA" refers to an RNA transcript that includes the mRNA and so can be translated into a polypeptide by the cell. "Antisense RNA"
refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (see U.S. Patent No.
5,107,065, incorporated herein by reference). The complementarity of an antisense RNA may be with any part of the specific nucleotide sequence, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence. "Functional RNA" refers to sense RNA, antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.
The term "operably linked" refers to the association of two or more nucleic acid fragments on a single polynucleotide so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
The term "expression", as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
"Antisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein. "Overexpression" refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal or non-transformed organisms. "Co-suppression" refers to the production of sense RNA
transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Patent No. 5,231,020, incorporated herein by reference).
A "protein" or "polypeptide" is a chain of amino acids arranged in a specific order determined by the coding sequence in a polynucleotide encoding the polypeptide. Each protein or polypeptide has a unique function.
"Altered levels" or "altered expression" refers to the production of gene products) in transgenic organisms in amounts or proportions that differ from that of normal or non-transformed organisms.
"Null mutant" refers here to a host cell which either lacks the expression of a certain polypeptide or expresses a polypeptide which is inactive or does not have any detectable expected enzymatic function.
"Mature protein" or the term "mature" when used in describing a protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or propeptides present in the primary translation product have been removed. "Precursor protein" or the term "precursor" when used in describing a protein refers to the primary product of translation of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to intracellular localization signals.
A "chloroplast transit peptide" is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the chloroplast or other plastid types present in the cell in which the protein is made. "Chloroplast transit sequence" refers to a nucleotide sequence that encodes a chloroplast transit peptide. A "signal peptide" is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the secretory system (Chrispeels (1991) Ann. Rev. Plant Phys. Plant Mol.
Biol. 42:21-53).
If the protein is to be directed to a vacuole, a vacuolar targeting signal (supra) can further be added, or if to the endoplasmic reticulum, an endoplasmic reticulum retention signal (supra) may be added. If the protein is to be directed to the nucleus; any signal peptide present should be removed and instead a nuclear localization signal included (Raikhel (1992) Plant Phys. 100:1627-1632).

"Transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" organisms.
Examples of methods of plant transformation include Agrobacterium-mediated transformation (De Blaere et al. (1987) Meth. Enrymol. 143:277) and particle-accelerated or "gene gun"
transformation technology (Klein et al. (1987) Nature (London) 327:70-73; U.S. Patent No.
4,945,050, incorporated herein by reference). Thus, isolated polynucleotides of the present invention can be incorporated into recombinant constructs, typically DNA constructs, capable of introduction into and replication in a host cell. Such a construct can be a vector that includes a replication system and sequences that are capable of transcription and translation of a polypeptide-encoding sequence in a given host cell. A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp.
1987;
Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989;
1 S and Flevin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990.
Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook et al. Molecular Cloning: A
Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, (hereinafter "Maniatis").
"PCR" or "polymerase chain reaction" is well known by those skilled in the art as a technique used for the amplification of specific DNA segments (U.S. Patent Nos. 4,683,195 and 4,800,159).
The present invention concerns an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) first nucleotide sequence encoding a polypeptide of at least 166 amino acids having at least 90% identity based on the Clustal method of alignment when compared to a polypeptide selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, and 16, or a second nucleotide sequence encoding a polypeptide of at least 363 amino acids having at least 92% identity based on the Clustal method of alignment when compared to a polypeptide from SEQ ID N0:14, or (b) a third nucleotide sequence comprising the complement of the first or second nucleotide sequence.

Preferably, the first nucleotide sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: l, 3, 5, 7, 9, 11, 13, and 15, that codes for the polypeptide selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, and 16.
Nucleic acid fragments encoding at least a portion of several oleolyl-ACP
thioesterase have been isolated and identified by comparison of random plant cDNA
sequences to public databases containing nucleotide and protein sequences using the BLAST
algorithms well known to those skilled in the art. The nucleic acid fragments of the instant invention may be used to isolate cDNAs and genes encoding homologous proteins from the same or other plant species. Isolation of homologous genes using sequence-dependent protocols is well known in the art. Examples of sequence-dependent protocols include, but are not limited to, methods of nucleic acid hybridization, and methods of DNA
and RNA
amplification as exemplified by various uses of nucleic acid amplification technologies (e.g., polymerase chain reaction, ligase chain reaction).
For example, genes encoding other oleolyl-ACP thioesterase, either as cDNAs or genomic DNAs, could be isolated directly by using all or a portion of the instant nucleic acid fragments as DNA hybridization probes to screen libraries from any desired plant employing methodology well known to those skilled in the art. Specific oligonucleotide probes based upon the instant nucleic acid sequences can be designed and synthesized by methods known in the art (Maniatis). Moreover, an entire sequence can be used directly to synthesize DNA
probes by methods known to the skilled artisan such as random primer DNA
labeling, nick translation, end-labeling techniques, or RNA probes using available in vitro transcription systems. In addition, specific primers can be designed and used to amplify a part or all of the instant sequences. The resulting amplification products can be labeled directly during amplification reactions or labeled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency.
In addition, two short segments of the instant nucleic acid fragments may be used in polymerase chain reaction protocols to amplify longer nucleic acid fragments encoding homologous genes from DNA or RNA. The polymerase chain reaction may also be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the instant nucleic acid fragments, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3' end of the mRNA
precursor encoding plant genes. Alternatively, the second primer sequence may be based upon sequences derived from the cloning vector. For example, the skilled artisan can follow the RACE protocol (Frohman et al. (1988) Proc. Natl. Acad. Sci. USA 85:8998-9002) to generate cDNAs by using PCR to amplify copies of the region between a single point in the transcript and the 3' or 5' end. Primers oriented in the 3' and 5' directions can be designed from the instant sequences. Using commercially available 3' RACE or 5' RACE
systems (BRL), specific 3' or 5' cDNA fragments can be isolated (Ohara et al. (1989) Proc. Natl.
Acad Sci. USA 86:5673-5677; Loh et al. (1989) Science 243:217-220). Products generated by the 3' and 5' RACE procedures can be combined to generate full-length cDNAs (Frohman and Martin (1989) Techniques 1:165). Consequently, a polynucleotide comprising a nucleotide sequence of at least one of 60 (preferably one of at least 40, most preferably one of at least 30) contiguous nucleotides derived from a nucleotide sequence selected from the group consisting of SEQ ID NOs:I, 3, 5, 7, 9, 11, 13, and 15 and the complement of such nucleotide sequences may be used in such methods to obtain a nucleic acid fragment encoding a substantial portion of an amino acid sequence of a polypeptide.
The present invention relates to a method of obtaining a nucleic acid fragment encoding a substantial portion of an oleolyl-ACP thioesterase polypeptide, preferably a substantial portion of a plant oleolyl-ACP thioesterase polypeptide, comprising the steps of synthesizing an oligonucleotide primer comprising a nucleotide sequence of at least one of 60 (preferably at least one of 40, most preferably at least one of 30) contiguous nucleotides derived from a nucleotide sequence selected from the group consisting of SEQ
ID NOs:I, 3, 5, 7, 9, 11, 13, and 15, and the complement of such nucleotide sequences; and amplifying a nucleic acid fragment (preferably a cDNA inserted in a cloning vector) using the oligonucleotide primer. The amplified nucleic acid fragment preferably will encode a portion of an oleolyl-ACP thioesterase polypeptide.
Availability of the instant nucleotide and deduced amino acid sequences facilitates immunological screening of cDNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides can be used to immunize animals to produce polyclonal or monoclonal antibodies with specificity for peptides or proteins comprising the amino acid sequences. These antibodies can be then be used to screen cDNA expression libraries to isolate full-length cDNA clones of interest (Lerner (1984) Adv. Immunol. 36:1-34; Maniatis).
In another embodiment, this invention concerns viruses and host cells comprising either the chimeric genes of the invention as described herein or an isolated polynucleotide of the invention as described herein. Examples of host cells which can be used to practice the invention include, but are not limited to, a yeast cell, a bacterial cell, and a plant cell.
The nucleic acid fragments of the instant invention may be used to create transgenic plants in which the disclosed polypeptides are overexpressed or their expression suppressed.
or in cell types or developmental stages in which they are not normally found.
This would have the effect of altering the level of fatty acids in those cells.
Thioesterases remove their substrates from the oil biosynthesis pathway. Therefore, inhibiting the activity of oleoyl-ACP thioesterase would result in a lowering of 18:1 acyl chains released. This would result in a net increase in the longer chain polyunsaturated (18 and 20 carbon) fatty acids.

Overexpressing palmitoyl-acyl-ACP thioesterase would increase the release of 18:1 fatty acids, as well as the 16:0 and 18:0 unsaturated chains in the oil, at the expense of the longer and polyunsaturated fatty acids. It is believed that altering the oil composition in plants may lead to changes in growth and development, and the health effects on humans from the consumption of that oil will also be impacted.
Overexpression of the proteins of the instant invention may be accomplished by first constructing a chimeric gene in which the coding region is operably linked to a promoter capable of directing expression of a gene in the desired tissues at the desired stage of development. The chimeric gene may comprise promoter sequences and translation leader sequences derived from the same genes. 3' Non-coding sequences encoding transcription termination signals may also be provided. The instant chimeric gene may also comprise one or more introns in order to facilitate gene expression.
Plasmid vectors comprising the instant isolated polynucleotide (or chimeric gene) may be constructed. . The skilled artisan readily recognizes that the choice of plasmid vector is dependent upon many factors, such as whether the vector is for protein expression, gene over-expression or suppression, and in what type of host cell the vectors are propagated. The choice of plasmid vector is also dependent upon the method that will be used to transform host plants. The skilled artisan is well aware of the genetic elements that must be present on the plasmid vector in order to successfully transform, select and propagate host cells containing the chimeric gene. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al. (1985) EMBO J. 4:2411-2418; De Almeida et al. (1989) Mol. Gen.
Genetics 218:78-86), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression, Western analysis of protein expression, or phenotypic analysis.
For some applications it may be useful to direct the instant polypeptides to different cellular compartments, or to facilitate its secretion from the cell. It is thus envisioned that the chimeric gene described above may be further supplemented by directing the coding sequence to encode the instant polypeptides with appropriate intracellular targeting sequences such as transit sequences (Keegstra (1989) Cell 56:247-253), signal sequences or sequences encoding endoplasmic reticulum localization (Chrispeels (1991) Ann.
Rev. Plant Phys. Plant Mol. Biol. 42:21-53), or nuclear localization signals (Raikhel (1992) Plant Phys.100:1627-1632) with or without removing targeting sequences that are already present.
While the references cited give examples of each of these, the list is not exhaustive and more targeting signals of use may be discovered in the future.

It may also be desirable to reduce or eliminate expression of genes encoding the instant polypeptides in plants for some applications. In order to accomplish this, a chimeric gene designed for co-suppression of the instant polypeptide can be constructed by linking a gene or gene fragment encoding that polypeptide to plant promoter sequences.
Alternatively, a chimeric gene designed to express antisense RNA for all or part of the instant nucleic acid fragment can be constructed by linking the gene or gene fragment in reverse orientation to plant promoter sequences. Either the co-suppression or antisense chimeric genes could be introduced into plants via transformation wherein expression of the corresponding endogenous genes are reduced or eliminated.
Molecular genetic solutions to the generation of plants with altered gene expression have a decided advantage over more traditional plant breeding approaches.
Changes in plant phenotypes can be produced by specifically inhibiting expression of one or more genes by antisense inhibition or cosuppression (U.S. Patent Nos. 5,190,931, 5,107,065 and 5,283,323). An antisense or cosuppression construct would act as a dominant negative regulator of gene activity. While conventional mutations can yield negative regulation of gene activity these effects are most likely recessive. The dominant negative regulation available with a transgenic approach may be advantageous from a breeding perspective. In addition, the ability to restrict the expression of a specific phenotype to the reproductive tissues of the plant by the use of tissue specific promoters may confer agronomic advantages relative to conventional mutations which may have an effect in all tissues in which a mutant gene is ordinarily expressed.
The person skilled in the art will know that special considerations are associated with the use of antisense or cosuppression technologies in order to reduce expression of particular genes. For example, the proper level of expression of sense or antisense genes may require the use of different chimeric genes utilizing different regulatory elements known to the skilled artisan. Once transgenic plants are obtained by one of the methods described above, it will be necessary to screen individual transgenics for those that most effectively display the desired phenotype. Accordingly, the skilled artisan will develop methods for screening large numbers of transformants. The nature of these screens will generally be chosen on practical grounds. For example, one can screen by looking for changes in gene expression by using antibodies specific for the protein encoded by the gene being suppressed, or one could establish assays that specifically measure enzyme activity. A preferred method will be one which allows large numbers of samples to be processed rapidly, since it will be expected that a large number of transformants will be negative for the desired phenotype.
In another embodiment, the present invention concerns a polypeptide of at least 166 amino acids that has at least 90% identity based on the Clustal method of alignment when compared to a polypeptide selected from the group consisting of SEQ ID
NOs:2, 4, 6, 8, 10, 12, 14, and 16.
The instant polypeptides (or portions thereof) may be produced in heterologous host cells, particularly in the cells of microbial hosts, and can be used to prepare antibodies to these proteins by methods well known to those skilled in the art. The antibodies are useful for detecting the polypeptides of the instant invention in situ in cells or in vitro in cell extracts. Preferred heterologous host cells for production of the instant polypeptides are microbial hosts. Microbial expression systems and expression vectors containing regulatory sequences that direct high level expression of foreign proteins are well known to those skilled in the art. Any of these could be used to construct a chimeric gene for production of the instant polypeptides. This chimeric gene could then be introduced into appropriate microorganisms via transformation to provide high level expression of the encoded oleolyl-ACP thioesterase. An example of a vector for high level expression of the instant polypeptides in a bacterial host is provided (Example 6).
All or a substantial portion of the polynucleotides of the instant invention may also be used as probes for genetically and physically mapping the genes that they are a part of, and used as markers for traits linked to those genes. Such information may be useful in plant breeding in order to develop lines with desired phenotypes. For example, the instant nucleic acid fragments may be used as restriction fragment length polymorphism (RFLP) markers. Southern blots (Maniatis) of restriction-digested plant genomic DNA
may be probed with the nucleic acid fragments of the instant invention. The resulting banding patterns may then be subjected to genetic analyses using computer programs such as MapMaker (Larder et al. ( 1987) Genomics 1:174-181 ) in order to construct a genetic map.
In addition, the nucleic acid fragments of the instant invention may be used to probe Southern blots containing restriction endonuclease-treated genomic DNAs of a set of individuals representing parent and progeny of a defined genetic cross.
Segregation of the DNA polymorphisms is noted and used to calculate the position of the instant nucleic acid sequence in the genetic map previously obtained using this population (Botstein et al. (1980) Am. J. Hum. Genet. 32:314-331).
The production and use of plant gene-derived probes for use in genetic mapping is described in Bernatzky and Tanksley (1986) Plant Mol. Biol. Reporter 4:37-41.
Numerous publications describe genetic mapping of specific cDNA clones using the methodology outlined above or variations thereof. For example, F2 intercross populations, backcross populations, randomly mated populations, near isogenic lines, and other sets of individuals may be used for mapping. Such methodologies are well known to those skilled in the art.
Nucleic acid probes derived from the instant nucleic acid sequences may also be used for physical mapping (i.e., placement of sequences on physical maps; see Hoheisel et al. In:

Nonmammalian Genomic Analysis: A Practical Guide, Academic press 1996, pp. 319-346, and references cited therein).
In another embodiment, nucleic acid probes derived from the instant nucleic acid sequences may be used in direct fluorescence in situ hybridization (FISH) mapping (Track (1991) Trends Genet. 7:149-154). Although current methods of FISH mapping favor use of large clones (several to several hundred KB; see Laan et al. (1995) Genome Res. 5:13-20), improvements in sensitivity may allow performance of FISH mapping using shorter probes.
A variety of nucleic acid amplification-based methods of genetic and physical mapping may be carried out using the instant nucleic acid sequences. Examples include allele-specific amplification (Kazazian (1989) J. Lab. Clin. Med. 11:95-96), polymorphism of PCR-amplified fragments (CAPS; Sheffield et al. (1993) Genomics 16:325-332), allele-specific ligation (Landegren et al. (1988) Science 241:1077-1080), nucleotide extension reactions (Sokolov (1990) Nucleic Acid Res. 18:3671), Radiation Hybrid Mapping (Walter et al. (1997) Nat. Genet. 7:22-28) and Happy Mapping (Dear and Cook (1989) Nucleic Acid Res. 17:6795-6807). For these methods, the sequence of a nucleic acid fragment is used to design and produce primer pairs for use in the amplification reaction or in primer extension reactions. The design of such primers is well known to those skilled in the art. In methods employing PCR-based genetic mapping, it may be necessary to identify DNA
sequence differences between the parents of the mapping cross in the region corresponding to the instant nucleic acid sequence. This, however, is generally not necessary for mapping methods.
Loss of function mutant phenotypes may be identified for the instant cDNA
clones either by targeted gene disruption protocols or by identifying specific mutants for these genes contained in a maize population carrying mutations in all possible genes (Ballinger and Benzer (1989) Proc. Natl. Acad. Sci USA 86:9402-9406; Koes et al. (1995) Proc. Natl.
Acad. Sci USA 92:8149-8153; Bensen et al. (1995) Plant Cell 7:75-84). The latter approach may be accomplished in two ways. First, short segments of the instant nucleic acid fragments may be used in polymerase chain reaction protocols in conjunction with a mutation tag sequence primer on DNAs prepared from a population of plants in which Mutator transposons or some other mutation-causing DNA element has been introduced (see Bensen, supra). The amplification of a specific DNA fragment with these primers indicates the insertion of the mutation tag element in or near the plant gene encoding the instant polypeptides. Alternatively, the instant nucleic acid fragment may be used as a hybridization probe against PCR amplification products generated from the mutation population using the mutation tag sequence primer in conjunction with an arbitrary genomic site primer, such as that for a restriction enzyme site-anchored synthetic adaptor. With either method, a plant containing a mutation in the endogenous gene encoding the instant polypeptides can be identified and obtained. This mutant plant can then be used to determine or confirm the natural function of the instant polypeptides disclosed herein.
EXAMPLES
The present invention is further defined in the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.
The disclosure of each reference set forth herein is incorporated herein by reference in its entirety.

Composition of cDNA Libraries; Isolation and Seguencin~ of cDNA Clones cDNA libraries representing mRNAs from various African daisy (Dimorphotheca sinuata), gopher apple (Licania michauxii), corn (Zea mays), rice (Oryza sativa), Yernonia (Yernonia mespilifolia), and wheat (Triticum aestivum) tissues were prepared.
The characteristics of the libraries are described below.

cDNA Libraries from African Daisy, Gopher Apple, Corn, Rice, Vernonia, and Wheat Library Tissue Clone dms2c African daisy (Dimorphotheca sinuata) developing seeds dms2c.pk001.ml4:fis elslc Gopher apple (Licania michauxii) developing seeds elslc.pk001.k6:fis crln Corn Root From 7 Day Old Seedlings* crln.pk0147.g3:fis cpj 1 c Corn (Zea mays L.) pooled BMS treated with chemicals cpj 1 c.pk002.g7:fis related to membrane ionic force rl0n Rice 15 Day Old Leaf* rl0n.pk101.123:fis r1r48 Rice Leaf 15 Days After Germination, r1r48.pk0010.f5 48 Hrs After Infection of Strain Magaporthe grisea 4360-R-62 (AVR2-YAMO); Resistant vsln Yernonia Seed Stage 1* vsln.pk0010.g10:fis wrl Wheat Root From 7 Day Old Seedling wrl.pk0026.b7 *These libraries were normalized essentially as described in U.S. Patent No. 5,482,845, incorporated herein by reference.

cDNA libraries may be prepared by any one of many methods available. For example, the cDNAs may be introduced into plasmid vectors by first preparing the cDNA
libraries in Uni-ZAPTM XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, CA). The Uni-ZAPTM XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into precut Bluescript II SK(+) vectors (Stratagene) using ligase (New England Biolabs), followed by transfection into DH10B cells according to the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant pBluescript plasmids, or the insert cDNA sequences are amplified via polymerise chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-primer sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"; see Adams et al., (1991) Science 252:1651-1656). The resulting ESTs are analyzed using a Perkin Elmer Model 377 fluorescent sequencer.
Full-insert sequence (FIS) data is generated utilizing a modified transposition protocol. Clones identified for FIS are recovered from archived glycerol stocks as single colonies, and plasmid DNAs are isolated via alkaline lysis. Isolated DNA
templates are reacted with vector primed M13 forward and reverse oligonucleotides in a PCR-based sequencing reaction and loaded onto automated sequencers. Confirmation of clone identification is performed by sequence alignment to the original EST sequence from which the FIS request is made.
Confirmed templates are transposed via the Primer Island transposition kit (PE
Applied Biosystems, Foster City, CA) which is based upon the Saccharomyces cerevisiae Tyl transposable element (Devine and Boeke (1994) Nucleic Acids Res. 22:3765-3772).
The in vitro transposition system places unique binding sites randomly throughout a population of large DNA molecules. The transposed DNA is then used to transform DH10B
electro-competent cells (Gibco BRL/Life Technologies, Rockville, MD) via electroporation.
The transposable element contains an additional selectable marker (named DHFR;
Fling and Richards (1983) Nucleic Acids Res. 11:5147-5158), allowing for dual selection on agar plates of only those subclones containing the integrated transposon. Multiple subclones are randomly selected from each transposition reaction, plasmid DNAs are prepared via alkaline lysis, and templates are sequenced (ABI Prism dye-terminator ReadyReaction mix) outward from the transposition event site, utilizing unique primers specific to the binding sites within the transposon.

Sequence data is collected (ABI Prism Collections) and assembled using Phred/Phrap (P. Green, University of Washington, Seattle). Phrep/Phrap is a public domain software program which re-reads the ABI sequence data, re-calls the bases, assigns quality values, and writes the base calls and quality values into editable output files. The Phrap sequence assembly program uses these quality values to increase the accuracy of the assembled sequence contigs. Assemblies are viewed by the Consed sequence editor (D.
Gordon, University of Washington, Seattle).

Identification of cDNA Clones cDNA clones encoding oleolyl-ACP thioesterase were identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol.
215:403-410; see also www.ncbi.nlm.nih.govBLAST~ searches for similarity to sequences contained in the BLAST "nr" database (comprising all non-redundant GenBank CDS
translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL, and DDBJ databases). The cDNA sequences obtained in Example 1 were analyzed for similarity to all publicly available DNA sequences contained in the "nr" database using the BLASTN
algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the "nr" database using the BLASTX
algorithm (Gish and States (1993) Nat. Genet. 3:266-272) provided by the NCBI.
For convenience, the P-value (probability) of observing a match of a cDNA sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST are reported herein as "pLog" values, which represent the negative of the logarithm of the reported P-value. Accordingly, the greater the pLog value, the greater the likelihood that the cDNA sequence and the BLAST "hit" represent homologous proteins.
ESTs submitted for analysis are compared to the genbank database as described above. ESTs that contain sequences more 5- or 3-prime can be found by using the BLASTn algorithm (Altschul et al (1997) Nucleic Acids Res. 25:3389-3402.) against the DuPont proprietary database comparing nucleotide sequences that share common or overlapping regions of sequence homology. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences can be assembled into a single contiguous nucleotide sequence, thus extending the original fragment in either the 5 or 3 prime direction. Once the most 5-prime EST is identified, its complete sequence can be determined by Full Insert Sequencing as described in Example 1. Homologous genes belonging to different species can be found by comparing the amino acid sequence of a known gene (from either a proprietary source or a public database) against an EST database using the tBLASTn algorithm. The tBLASTn algorithm searches an amino acid query against a nucleotide database that is translated in all 6 reading frames. This search allows for differences in nucleotide codon usage between different species, and for codon degeneracy.

Characterization of cDNA Clones EncodinJ-~yl-ACP Thioesterase The BLASTX search using the EST sequences from clones listed in Table 3 revealed similarity of the polypeptides encoded by the cDNAs to oleoyl-ACP thioesterase from safflower (Carthamus tinctorius, SEQ ID N0:13, NCBI Accession No: gi 404028), mangosteen (Garcinia mangostana, SEQ ID N0:14, NCBI Accession No: gi 1930077), safflower (Carthamus tinctorius, SEQ ID NO:1 S, NCBI Accession No: gi 404026), and African palm oil (Elaeis guineensis, SEQ ID N0:16, NCBI Accession No: gi 4704640).
Shown in Table 3 are the BLAST results for individual ESTs ("EST"), the sequences of the entire cDNA inserts comprising the indicated cDNA clones ("FIS"), the sequences of contigs assembled from two or more ESTs ("Contig"), sequences of contigs assembled from an FIS and one or more ESTs ("Contig*"), or sequences encoding an entire protein derived from an FIS, a contig, or an FIS and PCR ("CGS"):

BLAST Results for Sequences Encoding Polypeptides Homologous to Oleoyl-ACP Thioesterase BLAST pLog Score Clone SEQ ID NO: Status 404028 dms2c.pk001.m14 2 FIS 177.00 crln.pk0147.g3 4 FIS 133.00 rl0n.pk101.123 8 Contig 155.00 r1r48.pk001 O.fS
BLAST pLog Score Clone Status 1930077 elslc.pk001.k6 6 FIS 129.00 BLAST pLog Score Clone Status 404026 vsln.pk0010.g10 10 FIS 171.00 BLAST pLog Score Clone Status 4704640 wrl.pk0026.b7 12 FIS 80.70 The sequence of the entire cDNA insert in the clones listed in Table 3 was determined. Further sequencing and searching of the DuPont proprietary database allowed the identification of other corn and wheat clones encoding oleolyl-ACP
thioesterase. The BLASTX search using the EST sequences from clones listed in Table 4 revealed similarity of the polypeptides encoded by the cDNAs to oleolyl-ACP thioesterase from Arabidopsis thaliana (NCBI General Identifier No. gi 1076361 and gi 7487983). Shown in Table 4 are the BLAST results for individual ESTs ("EST"), the sequences of the entire cDNA inserts comprising the indicated cDNA clones ("FIS"), sequences of contigs assembled from two or more ESTs ("Contig"), sequences of contigs assembled from an FIS and one or more ESTs ("Contig*"), or sequences encoding the entire protein derived from an FIS, a contig, or an FIS and PCR ("CGS"):

BLAST Results for Sequences Encoding Polypeptides Homologous to Oleolyl-ACP Thioesterase BLAST pLog Score Clone SEQ ID NO: Status 1076361 cpjlc.pk002.g7:fis 14 FIS 180.00 BLAST pLog Score Clone Status 7487983 wrl.pk0026.b7:fis 16 FIS 77.20 Figure 1 shows a comparison of the amino acid sequences of oleoyl-ACP
thioesterase from African daisy (Dimorphotheca sinuata, SEQ ID N0:2 denoted as [SIN2]), corn (Zea mays, SEQ ID N0:6 denoted as [SIN6]), rice (Oryza sativa, SEQ ID N0:8 denoted as [SIN8]), safflower (Carthamus tinctorius, SEQ ID N0:17, NCBI Accession No: gi 404028), gopher apple (Licania michauxii, SEQ ID N0:4 denoted as [SIN4]), mangosteen (Garcinia mangostana, SEQ ID N0:18, NCBI Accession No: gi 1930077), Vernonia (Vernonia mespilif'olia, SEQ ID NO:10 denoted as [SIN10]), safflower (Carthamus.
tinctorius, SEQ ID
N0:19, NCBI Accession No: gi 404026), wheat (Triticum aestivum, SEQ ID N0:12 denoted as [SIN12]), African palm oil (Elaeis guineensis, SEQ ID N0:20, NCBI Accession No: gi 4704640), corn (Zea mays, SEQ ID N0:14 denoted as [SIN14]), wheat (Triticum aestivum, SEQ ID N0:16 denoted as [SIN16]), and two Arabidopsis proteins (Arabidopsis thaliana, SEQ ID N0:21 and 22, NCBI Accession No: gi 7487983 and gi 1076361, respectively).

Percent Identity of Amino Acid Sequences Deduced From the Nucleotide Sequences of cDNA Clones Encoding Polypeptides Homologous to Oleoyl-ACP Thioesterase Percent Identity to SEQ ID NO. 404028 2 78.2%
6 63.1%
8 66.0%
Percent Identity to SEQ ID NO. 1930077 4 84.2%
Percent Identity to SEQ ID NO. 404026 89.3 Percent Identity to SEQ ID NO. 4704640 12 72.3%
Percent Identity to SEQ ID NO. 1076361 14 65.5% ' Percent Identity to SEQ ID NO. 7487983 16 72.3%

Sequence alignments and percent identity calculations were performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR
Inc., Madison, WI). Multiple alignment of the sequences was performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default 10 parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. Sequence alignments and BLAST scores and probabilities indicate that the nucleic acid fragments comprising the instant cDNA clones encode a substantial portion of a oleolyl-ACP thioesterase. These sequences represent the first Dimorphotheca, Licania, and vernonia sequences encoding oleoyl-ACP
thioesterase known to Applicant.

Expression of Chimeric Genes in Monocot Cells A chimeric gene comprising a cDNA encoding the instant polypeptides in sense orientation with respect to the maize 27 kD zero promoter that is located 5' to the cDNA

fragment, and the 10 kD zero 3' end that is located 3' to the cDNA fragment, can be constructed. The cDNA fragment of this gene may be generated by polymerase chain reaction (PCR) of the cDNA clone using appropriate oligonucleotide primers.
Cloning sites (NcoI or SmaI) can be incorporated into the oligonucleotides to provide proper orientation of the DNA fragment when inserted into the digested vector pML103 as described below.
Amplification is then performed in a standard PCR. The amplified DNA is then digested with restriction enzymes NcoI and SmaI and fractionated on an agarose gel. The appropriate band can be isolated from the gel and combined with a 4.9 kb NcoI-SmaI
fragment of the plasmid pML 103. Plasmid pML 103 has been deposited under the terms of the Budapest Treaty at ATCC (American Type Culture Collection, 10801 University Blvd., Manassas, VA 20110-2209), and bears accession number ATCC 97366. The DNA segment from pML103 contains a 1.05 kb SaII-NcoI promoter fragment of the maize 27 kD zero gene and a 0.96 kb SmaI-SaII fragment from the 3' end of the maize 10 kD zero gene in the vector pGem9Zf(+) (Promega). Vector and insert DNA can be ligated at 15°C
overnight, essentially as described (Maniatis). The ligated DNA may then be used to transform E. coli XL1-Blue (Epicurian Coli XL-1 Bluer""; Stratagene). Bacterial transformants can be screened by restriction enzyme digestion of plasmid DNA and limited nucleotide sequence analysis using the dideoxy chain termination method (SequenaseT"" DNA
Sequencing Kit;
U.S. Biochemical). The resulting plasmid construct would comprise a chimeric gene encoding, in the 5' to 3' direction, the maize 27 kD zein promoter, a cDNA
fragment encoding the instant polypeptides, and the 10 kD zero 3' region.
The chimeric gene described above can then be introduced into corn cells by the following procedure. Immature corn embryos can be dissected from developing caryopses derived from crosses of the inbred corn lines H99 and LH132. The embryos are isolated 10 to 11 days after pollination when they are 1.0 to 1.5 mm long. The embryos are then placed with the axis-side facing down and in contact with agarose-solidified N6 medium (Chu et al.
(1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the dark at 27°C. Friable embryogenic callus consisting of undifferentiated masses of cells with somatic proembryoids and embryoids borne on suspensor structures proliferates from the scutellum of these immature embryos. The embryogenic callus isolated from the primary explant can be cultured on N6 medium and sub-cultured on this medium every 2 to 3 weeks.
The plasmid, p35S/Ac (obtained from Dr. Peter Eckes, Hoechst Ag, Frankfurt, Germany) may be used in transformation experiments in order to provide for a selectable marker. This plasmid contains the Pat gene (see European Patent Publication 0 242 236) which encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT
confers resistance to herbicidal glutamine synthetase inhibitors such as phosphinothricin. The pat gene in p35S/Ac is under the control of the 35S promoter from Cauliflower Mosaic Virus (Odell et al. ( 1985) Nature 313:810-812) and the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens.
The particle bombardment method (Klein et al. (1987) Nature 327:70-73) may be used to transfer genes to the callus culture cells. According to this method, gold particles (1 m in diameter) are coated with DNA using the following technique. Ten p,g of plasmid DNAs are added to 50 ~,L of a suspension of gold particles (60 mg per mL).
Calcium chloride (50 p.L of a 2.5 M solution) and spermidine free base (20 ~L of a 1.0 M solution) are added to the particles. The suspension is vortexed during the addition of these solutions.
After 10 minutes, the tubes are briefly centrifuged (5 sec at 15,000 rpm) and the supernatant removed. The particles are resuspended in 200 p,L of absolute ethanol, centrifuged again and the supernatant removed. The ethanol rinse is performed again and the particles resuspended in a final volume of 30 ~L of ethanol. An aliquot (5 ~L) of the DNA-coated gold particles can be placed in the center of a KaptonT"" flying disc (Bio-Rad Labs). The particles are then accelerated into the corn tissue with a BiolisticT"" PDS-1000/He (Bio-Rad Instruments, Hercules CA), using a helium pressure of 1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0 cm.
For bombardment, the embryogenic tissue is placed on filter paper over agarose-solidified N6 medium. The tissue is arranged as a thin lawn and covered a circular area of about 5 cm in diameter. The petri dish containing the tissue can be placed in the chamber of the PDS-1000/He approximately 8 cm from the stopping screen. The air in the chamber is then evacuated to a vacuum of 28 inches of Hg. The macrocarrier is accelerated with a helium shock wave using a rupture membrane that bursts when the He pressure in the shock tube reaches 1000 psi.
Seven days after bombardment the tissue can be transferred to N6 medium that contains gluphosinate (2 mg per liter) and lacks casein or proline. The tissue continues to grow slowly on this medium. After an additional 2 weeks the tissue can be transferred to fresh N6 medium containing gluphosinate. After 6 weeks, areas of about 1 cm in diameter of actively growing callus can be identified on some of the plates containing the glufosinate-supplemented medium. These calli may continue to grow when sub-cultured on the selective medium.
Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al. (1990) BiolTechnology 8:833-839).

Expression of Chimeric Genes in Dicot Cells A seed-specific expression cassette composed of the promoter and transcription terminator from the gene encoding the (3 subunit of the seed storage protein phaseolin from the bean Phaseolus vulgaris (Doyle et al. (1986) J. Biol. Chem. 261:9228-9238) can be used for expression of the instant polypeptides in transformed soybean. The phaseolin cassette includes about 500 nucleotides upstream (5') from the translation initiation codon and about 1650 nucleotides downstream (3') from the translation stop codon of phaseolin.
Between the S' and 3' regions are the unique restriction endonuclease sites Nco I (which includes the ATG
translation initiation codon), Sma I, Kpn I and Xba I. The entire cassette is flanked by Hind III sites.
The cDNA fragment of this gene may be generated by polymerase chain reaction (PCR) of the cDNA clone using appropriate oligonucleotide primers. Cloning sites can be incorporated into the oligonucleotides to provide proper orientation of the DNA fragment when inserted into the expression vector. Amplification is then performed as described above, and the isolated fragment is inserted into a pUC 18 vector carrying the seed expression cassette.
Soybean embryos may then be transformed with the expression vector comprising sequences encoding the instant polypeptides. To induce somatic embryos, cotyledons, 3-S mm in length dissected from surface sterilized, immature seeds of the soybean cultivar A2872, can be cultured in the light or dark at 26°C on an appropriate agar medium for 6-10 weeks. Somatic embryos which produce secondary embryos are then excised and placed into a suitable liquid medium. After repeated selection for clusters of somatic embryos which multiplied as early, globular staged embryos, the suspensions are maintained as described below.
Soybean embryogenic suspension cultures can be maintained in 35 mL liquid media on a rotary shaker, 150 rpm, at 26°C with florescent lights on a 16:8 hour day/night schedule. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 mL of liquid medium.
Soybean embryogenic suspension cultures may then be transformed by the method of particle gun bombardment (Klein et al. (1987) Nature (London) 327:70-73, U.S.
Patent No. 4,945,050). A DuPont BiolisticT"" PDS 1000/HE instrument (helium retrofit) can be used for these transformations.
A selectable marker gene which can be used to facilitate soybean transformation is a chimeric gene composed of the 35S promoter from Cauliflower Mosaic Virus (Odell et al.
(1985) Nature 313:810-812), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz et a1.(1983) Gene 25:179-188) and the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens. The seed expression cassette comprising the phaseolin 5' region, the fragment encoding the instant polypeptides and the phaseolin 3' region can be isolated as a restriction fragment. This fragment can then be inserted into a unique restriction site of the vector carrying the marker gene.
To 50 uL of a 60 mg/mL 1 p.m gold particle suspension is added (in order): 5 ~L
DNA (1 ~g/p,L), 20 ~L spermidine (0.1 M), and 50 ~L CaCl2 (2.5 M). The particle preparation is then agitated for three minutes, spun in a microfuge for 10 seconds and the supernatant removed. The DNA-coated particles are then washed once in 400 ~L
70%
ethanol and resuspended in 40 uL of anhydrous ethanol. The DNA/particle suspension can be sonicated three times for one second each. Five ~L of the DNA-coated gold particles are then loaded on each macro carrier disk.
Approximately 300-400 mg of a two-week-old suspension culture is placed in an empty 60x15 mm petri dish and the residual liquid removed from the tissue with a pipette.
For each transformation experiment, approximately 5-10 plates of tissue are normally bombarded. Membrane rupture pressure is set at 1100 psi and the chamber is evacuated to a vacuum of 28 inches mercury. The tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue can be divided in half and placed back into liquid and cultured as described above.
Five to seven days post bombardment, the liquid media may be exchanged with fresh media, and eleven to twelve days post bombardment with fresh media containing 50 mg/mL
hygromycin. This selective media can be refreshed weekly. Seven to eight weeks post bombardment, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue is removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each new line may be treated as an independent transformation event.
These suspensions can then be subcultured and maintained as clusters of immature embryos or regenerated into whole plants by maturation and germination of individual somatic embryos.

Expression of Chimeric Genes in Microbial Cells The cDNAs encoding the instant polypeptides can be inserted into the T7 E.
coli expression vector pBT430. This vector is a derivative of pET-3a (Rosenberg et al. (1987) Gene 56:125-135) which employs the bacteriophage T7 RNA polymerase/T7 promoter system. Plasmid pBT430 was constructed by first destroying the EcoR I and Hind III sites in pET-3a at their original positions. An oligonucleotide adaptor containing EcoR
I and Hind III sites was inserted at the BamH I site of pET-3a. This created pET-3aM
with additional unique cloning sites for insertion of genes into the expression vector. Then, the Nde I site at the position of translation initiation was converted to an Nco I
site using oligonucleotide-directed mutagenesis. The DNA sequence of pET-3aM in this region, 5'-CATATGG, was converted to 5'-CCCATGG in pBT430.
Plasmid DNA containing a cDNA may be appropriately digested to release a nucleic acid fragment encoding the protein. This fragment may then be purified on a 1 % low melting agarose gel. Buffer and agarose contain 10 p,g/ml ethidium bromide for visualization of the DNA fragment. The fragment can then be purified from the agarose gel by digestion with GELaseT"" (Epicentre Technologies, Madison, WI) according to the manufacturer's instructions, ethanol precipitated, dried and resuspended in 20 p,L of water.
Appropriate oligonucleotide adapters may be ligated to the fragment using T4 DNA ligase (New England Biolabs (NEB), Beverly, MA). The fragment containing the ligated adapters can be purified from the excess adapters using low melting agarose as described above. The vector pBT430 is digested, dephosphorylated with alkaline phosphatase (NEB) and deproteinized with phenol/chloroform as described above. The prepared vector pBT430 and fragment can then be ligated at 16°C for 15 hours followed by transformation into DHS
electrocompetent cells (GIBCO BRL). Transformants can be selected on agar plates containing LB media and 100 pg/mL ampicillin. Transformants containing the gene encoding the instant polypeptides are then screened for the correct orientation with respect to the T7 promoter by restriction enzyme analysis.
For high level expression, a plasmid clone with the cDNA insert in the correct orientation relative to the T7 promoter can be transformed into E. coli strain BL21(DE3) (Studier et al. (1986) J. Mol. Biol. 189:113-130). Cultures are grown in LB
medium containing ampicillin (100 mg/L) at 25°C. At an optical density at 600 nm of approximately l, IPTG (isopropylthio-(3-galactoside, the inducer) can be added to a final concentration of 0.4 mM and incubation can be continued for 3 h at 25°. Cells are then harvested by centrifugation and re-suspended in 50 pL of 50 mM Tris-HCl at pH 8.0 containing 0.1 mM
DTT and 0.2 mM phenyl methylsulfonyl fluoride. A small amount of 1 mm glass beads can be added and the mixture sonicated 3 times for about 5 seconds each time with a microprobe sonicator. The mixture is centrifuged and the protein concentration of the supernatant determined. One pg of protein from the soluble fraction of the culture can be separated by SDS-polyacrylamide gel electrophoresis. Gels can be observed for protein bands migrating at the expected molecular weight.

SEQUENCE LISTING
<110> E.I. du Pont de Nemours <120> OLEOYL-ACYL-CARRIER-PROTEIN THIOESTERASES IN PLANTS
<130> BB1348 PCT
<140>
<141>
<150> 60/167,510 <151> 1999-11-24 <160> 22 <170> Microsoft Office 97 <210> 1 <211> 1507 <212> DNA
<213> Dimorphotheca sinuata <400> 1 gcacgaggct ccggccacca cgccgccaat tccgtcacca atcatgctct cacgtctcat 60 tccaaccgcc gccgccgcgg caacggcaac cgcaacaaca accacaaaca ccgcggcatt 120 caccggcaac aaccgcaccg taactaactt ccgatccggt gattccgtct caatccggcg 180 acaaaacagc ggttatttat gtaattcagc tcgccggagg ataactccgg taatggcggt 240 gaagaccggt gagcaaccga acagcgttgc tgctgcttct gacgtcagct tgaaggagaa 300 gagcttggcg gatcggctcc ggttaggtag cttgacggac ggtggattat cgtatacgga 360 gaggttcatt attaggtgtt atgaagtcgg aatcaataaa actgctactg ttgaaacaat 420 tgctaatctg ttgcaggagg ttggaggtaa tcatgctcaa agtgttggat tttcgacaga 480 tggatttgcc accactacaa ctatgagaaa attgcatctc atatgggtga cttcacgaat 540 gcatattgaa atttacagat atcctgcatg gagtgatgtg gttgagattg agacttggtg 600 tcaaagtgaa ggaagaattg gtactagacg tgattggatt attaaagact cttccaatgg 660 tgaggtcatt ggaagagcta caagcaagtg ggtgatgatg aactcggata ctagaagact 720 ccagaaagtc aatgatgata tccgagatga atatttgatt ttttgtccta aggaaccgag 780 attatcattt cccgaagaga acaataagag tctgaagaaa attaaaaagt tggaagatcc 840 agctgaattt tcaacattag gacttgtgcc aagaagagca gatttggata tgaacaaaca 900 tgttaacaat gttacctaca ttggatgggt tctcgagagc atcccacaag aagtaatcga 960 cactcatgaa ctacaaacaa ttacgttaga ctacagacgt gaatgccagc atgatgatgt 1020 agtcgattct ctcacaagtt cagaatcact cgtctcaaaa cttgaaggaa ccaacggttc 1080 tgcttcttcc aaaaacgacg aacaagattt aagccaattt ttgcatttat taagatcatc 1140 tggtgatggt cttgaactca acaggggtcg taccgaatgg agaaaaaaac aagataaacg 1200 ataaacatat gttttcgttg gtttatttta ggccccccat cattctatta taatacccct 1260 tctgtattct tgttttttgt atgttttgtt gcggtttcgt attttacctt tttcgttatt 1320 ttgcgtattt gtgtatctcc gtagatggac tagattttcg gattcttaaa cccgaaaaac 1380 tgtttttttt tcttttttta aagttttctt gtggtttgca tgaagaactt tatgaatcat 1440 ttatctatga agtatttaag tattgaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1500 aaaaaaa 1507 <210> 2 <211> 386 <212> PRT
<213> Dimorphotheca sinuata <400> 2 Met Leu Ser Arg Leu Ile Pro Thr Ala Ala Ala Ala Ala Thr Ala Thr Ala Thr Thr Thr Thr Asn Thr Ala Ala Phe Thr Gly Asn Asn Arg Thr Val Thr Asn Phe Arg Ser Gly Asp Ser Val Ser Ile Arg Arg Gln Asn Ser Gly Tyr Leu Cys Asn Ser Ala Arg Arg Arg Ile Thr Pro Val Met Ala Val Lys Thr Gly Glu Gln Pro Asn Ser Val Ala Ala Ala Ser Asp Val Ser Leu Lys Glu Lys Ser Leu Ala Asp Arg Leu Arg Leu Gly Ser Leu Thr Asp Gly Gly Leu Ser Tyr Thr Glu Arg Phe Ile Ile Arg Cys Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Val Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Gly Asn His Ala Gln Ser Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Thr Thr Met Arg Lys Leu His Leu Ile Trp Val Thr Ser Arg Met His Ile Glu Ile Tyr Arg Tyr Pro Ala Trp Ser Asp Val Val Glu Ile Glu Thr Trp Cys Gln Ser Glu Gly Arg Ile Gly Thr Arg Arg Asp Trp Ile Ile Lys Asp Ser Ser Asn Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Ser Asp Thr Arg Arg Leu Gln Lys Val Asn Asp Asp Ile Arg Asp Glu Tyr Leu Ile Phe Cys Pro Lys Glu Pro Arg Leu Ser Phe Pro Glu Glu Asn Asn Lys Ser Leu Lys Lys Ile Lys Lys Leu Glu Asp Pro Ala Glu Phe Ser Thr Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Lys His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Glu Val Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asp Asp Val Val Asp Ser Leu Thr Ser Ser Glu Ser Leu Val Ser Lys Leu Glu Gly Thr Asn Gly Ser Ala Ser Ser Lys Asn Asp Glu Gln Asp Leu Ser Gln Phe Leu His Leu Leu Arg Ser Ser Gly Asp Gly Leu Glu Leu Asn Arg Gly Arg Thr Glu Trp Arg Lys Lys Gln Asp Lys Arg <210> 3 <211> 1214 <212> DNA
<213> Licania michauxii <900> 3 tttttctgca actggtcatt gcaaggagca attgcatgat ggggacagag aagacttcgt 60 cctcaaatgt tatgcaattg tttgaaaaaa aaaaaaaaca aaaagtgaca ttcacggagg 120 ttggttgtaa tcatgctcaa agtgttggat tctcaacaga tgggtttgca acaaccctga 180 caatgaggaa attgcatctc atttgggtaa ccgctcgtat gcacattgaa atttacaaat 240 acccggcttg gggtgatgta gtagaaatag agacttggtg ccaaggtgaa ggaagaattg 300 gaaccagacg cgattggatt ctgaaggact atgccactgg tgaagttatt gggagagcta 360 ctagtaagtg ggtgatgatg aaccaagata ctaggcgcct acaaaaagtg actgatgatg 420 tccgggatga atatttagtt ttctgtccac gtgaacttag attggcattc cctgaggaga 480 ataatcgcag cttgaggaag attgcaaagc tagaggatcc tgctgaacat tccaagctgg 540 gacttgtgcc cagaagagca gatctggaca tgaatcaaca tgttaataac gtcacctaca 600 ttggatgggt tttggagagc ctgccccaag aagtcattga aacccatgag ctgcaaacta 660 ttaccttaga ttacagaagg gaatgtcaac atgatgatgt agttgattcc ctcacaagtc 720 ctgaacccga tgagcaattt gaaggagttt cagagcttcg agggacaaat ggctctgcca 780 caccaactgc tgacaaccaa gactgcctga acttcttgca tctactgaga ctatcaggtg 840 aagggcttga gattaaccgc ggccgcactg agtggagaaa gaaacctgca agatgagggg 900 aatagtgtag agtcttgtac ttcttaatgc tttagccagt cttaagagtc catttctctg 960 tggcttcctt ctctttacct ctttgcttct ctattttggc ttttcttggc tcccagagga 1020 tcttgatctg attttgccgt cgttagctaa tatgttgtca ttggttgtac ggaatgagag 1080 gaaactgtac tgtactaaat gttgatactt gccaaaccca tcgtgcaaaa cttcgtgaat 1140 gaaatgttgt actgtgcttt tcttgaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1200 aaaaaaaaaa aaaa 1214 <210> 4 <211> 259 <212> PRT
<213> Licania michauxii <400> 4 Glu Val Gly Cys Asn His Ala Gln Ser Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Leu Thr Met Arg Lys Leu His Leu Ile Trp Val Thr Ala Arg Met His Ile Glu Ile Tyr Lys Tyr Pro Ala Trp Gly Asp Val Val Glu Ile Glu Thr Trp Cys Gln Gly Glu Gly Arg Ile Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Tyr Ala Thr Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asp Thr Arg Arg Leu Gln Lys Val Thr Asp Asp Val Arg Asp Glu Tyr Leu Val Phe Cys Pro Arg Glu Leu Arg Leu Ala Phe Pro Glu Glu Asn Asn Arg Ser Leu Arg Lys Ile Ala Lys Leu Glu Asp Pro Ala Glu His Ser Lys Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Leu Pro Gln Glu Val Ile Glu Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asp Asp Val Val Asp Ser Leu Thr Ser Pro Glu Pro Asp Glu Gln Phe Glu Gly Val Ser Glu Leu Arg Gly Thr Asn Gly Ser Ala Thr Pro Thr Ala Asp Asn Gln Asp Cys Leu Asn Phe Leu His Leu Leu Arg Leu Ser Gly Glu Gly Leu Glu Ile Asn Arg Gly Arg Thr Glu Trp Arg Lys Lys Pro Ala Arg <210> 5 <211> 1440 <212> DNA
<213> Zea mays <400> 5 gcacgagccg ctccgcccgt gtaaaccaaa ccccgcttcg gcggcggcgg cgactggccc 60 acgagccttc tcgaaccgac gcatccgcca cccatgctgc gctgccacac gccaccgcaa 120 tgcgcccgcg cgccgctccg ccaccacgga aggtgggagt cgcctccggc ggcggcgccc 180 gcggtggtag tgcggtgcgc gcggggtgcg ccgcaggtgt ccgggatcga ggcggcttcg 240 ccgggccacg cggctgtcac ggcggcgtta gctaaggcgg aagggggtga cgcgcggccc 300 agcctggccg agcggctgcg gttggggaac ctcctggagg acgggctatc gtacaaggag 360 agtttcatcg tgcgctgcta cgaggtgggg atcaacaaga cggccaccgt tgagaccatc 420 gccaatctcc tccaggaggt aggatgtaac catgcacaaa gtgttgggtt ctccactgat 480 ggcttcgcca cgaccactac aatgagaaaa cttggactta tttgggtgac gaacagaatg 540 cacattgaga tctacaagta cccagcttgg ggtgatgttg ttgagatcga aacatggtgc 600 caagaagatg gaagaattgg tacccgtcgt gattggatcc tcaaggacct agctaatggt 660 gaagttattg gcagagctac cagcaagtgg gtcatgatga acca.aaatac acggagactt 720 cagcgggtca gtgatgacgt gagggatgag gtgtttatgc actgtccaaa ggctccaaga 780 ttagcattcc cagaggaaaa taatggcagt ttgaagaaga ttccgaatct ttcagaccct 840 gcagaatatt caagacttgg actagtgcca agaagagctg acctggacat gaaccaacat 900 gtcaataatg ttacttacat aggttgggtc ctcgaaagta tacctcaaga tataattgat 960 acacacgagt tacaaacaat cactctcgac tacagaaggg agtgtcaaca ggatgatata 1020 gttgattctc gaggagaaaa gcatgaacgg 1080 ttacttgcat ctctgcttct agaggaagga gcagcagcgc a agcggcag cagttcctgc attgcttgag 1140 ctcacaaag ag atttgcagcc aacggacacg g gccgtacc gtgtggagga agctagctag 1200 agatcaacc tg ataaaagtgt tctttcgtca gatct tccatttc tctgctcacg gctggcggcc 1260 taaat cc cttgtaccac aattttgtga g ctttggaa tgtactcagc catgtatcgg 1320 tgtattgtt cc tgccgatttg tgacatttct a tgtctgtc cgttttgtac cagtggacaa 1380 tggagctgt gc tgtttgtgac atgcaataaa aaaaaaaaaa aaaaaaaaaa 1440 ctgcgtttct aaaaaaaaaa ccggcaaaaa <210> 6 <211> 366 <212> PRT

<213> Zea mays <900> 6 Met Leu CysHisThr ProProGlnCysAlaArg AlaProLeuArg Arg His His ArgTrpGlu SerProProAlaAlaAla ProAlaValVal Gly Val Arg AlaArgGly AlaProGlnValSerGly IleGluAlaAla Cys Ser Pro HisAlaAla ValThrAlaAlaLeuAla LysAlaGluGly Gly Gly Asp ArgProSer LeuAlaGluArgLeuArg LeuGlyAsnLeu Ala Leu Glu GlyLeuSer TyrLysG1uSerPheIle ValArgCysTyr Asp Glu Val IleAsnLys ThrAlaThrValGluThr IleAlaAsnLeu Gly Leu Gln ValGlyCys AsnHisAlaGlnSerVal GlyPheSerThr Glu Asp Gly AlaThrThr ThrThrMetArgLysLeu GlyLeuIleTrp Phe Val Thr ArgMetHis IleGluIleTyrLysTyr ProAlaTrpGly Asn Asp Val GluIleGlu ThrTrpCysGlnGluAsp GlyArgIleGly Val Thr Arg AspTrpIle LeuLysAspLeuAlaAsn GlyGluValIle Arg Gly Arg ThrSerLys TrpValMetMetAsnGln AsnThrArgArg Ala Leu Gln ValSerAsp AspValArgAspGluVal PheMetHisCys Arg Pro Lys ProArgLeu AlaPheProGluGluAsn AsnGlySerLeu Ala Lys Lys Ile Pro Asn Leu Ser Asp Pro Ala Glu Tyr Ser Arg Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Asp Ile Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln Gln Asp Asp Ile Val Asp Ser Leu Thr Cys Ile Glu Glu Gly Glu Glu Lys Ser Met Asn Gly Ser Ala Ser Ala Ala Ala Pro His Lys Glu Glu Arg Gln Gln Phe Leu His Cys Leu Arg Phe Ala Ala Asn Gly His Glu Ile Asn Arg Gly Arg Thr Val Trp Arg Lys Leu Ala Arg <210> 7 <211> 1510 <212> DNA
<213> Oryza sativa <400> 7 gcacgagtgg tacctcctcc ctataaaccc ccccgcgccc ccagctgctc gggcggcggc 60 ggcggcggcg cgaactcgaa tctcttctgt ccccttccac caccgtcccc ccacaggaga 120 tgctgcgctg ccacacgccg ccgcaatgcc gcctcggcgc gggcggcgcg ggcgcggggg 180 tgctgctgag gcagcggagc gaggtggcgg tgcggtgccg cgcgcagcag gtgtccgggg 240 tcgaggcggc ggcggggaca ccggcggcgc gggcggcggt ggagggtggg gagaggacga 300 gcctggcgga gcggctgcgg ctggggagcc tgctggagga cgggctgtcg tacaaggaga 360 gcttcatcgt gcggtgctac gaggtgggca tcaacaagac ggccaccgtc gagaccatcg 420 ccaacctcct ccaggaggta gggtgtaacc atgcacaaag tgttgggttc tccactgatg 480 gttttgccac aactaccaca atgagaaaac ttggtctaat ttgggtgacc aaccgaatgc 540 acattgagat ctacaagtac ccagcatggg gtgatgttgt ggagattgaa acttggtgcc 600 aagaagatgg aaagatcggt actcgtcgtg attggatcct taaggatctg gctaatggtg 660 aagttatcgg cagagctacc agcaagtggg tcatgatgaa ccaaaataca cgcagacttc 720 aaagagtgag tgatgacgtg agggatgagg tttttgtaca ctgtccaaag actccaagat 780 tagcattccc cgaggaaaat aatggcagtt tgaaaaagat tccagttctt actgatcctg 840 cacagcactc aagactaggc ctagtgccaa gaagagctga tctggacatg aaccaacatg 900 tcaataatgt cacttacatt ggttgggtac ttgaaagtat acctcaagat attattgata 960 cacatgagtt acaaacaatc actcttgact acagaagaga gtgccaacat gatgacatag 1020 tagattcact tacttatatc gaggaaggag aggagaagag ttccaatgga tccgcatttg 1080 ctgcaccgca cccagaagag cagcgacagt tcttgcactg cttaagattt gctgggaacg 1140 ggaacgagat caaccgtggg cgcaccgtgt ggaggaagct agctagatga attccctagt 1200 tttgatcata cagtcatatg tattctgatc cttccatttg ttccatcatt ttgctcttgg 1260 tgtctggcat agccctttca gagaatcggt tgtaccccaa attttgtgtt aatttgttac 1320 ctttgtaatg taccgtggta acaattacag tttgtgacat tcgtcttacc tgaagttgtg 1380 cgttgctgta tactttgtac tagtagaatc agtgtttatg aatcttcaaa taattctatc 1440 ggcaacagat agcaatggca tgccaagttt ggttaaaaaa aaaaaaaaaa aaaaaaaaaa 1500 aaaaaaaaaa 1510 <210> 8 <211> 356 <212> PRT
<213> Oryza sativa <400> 8 Met Leu Arg Cys His Thr Pro Pro Gln Cys Arg Leu Gly Ala Gly Gly Ala Gly Ala Gly Val Leu Leu Arg Gln Arg Ser Glu Val Ala Val Arg Cys Arg Ala Gln Gln Val Ser Gly Val Glu Ala Ala Ala Gly Thr Pro Ala Ala Arg Ala Ala Val Glu Gly Gly Glu Arg Thr Ser Leu Ala Glu Arg Leu Arg Leu Gly Ser Leu Leu Glu Asp Gly Leu Ser Tyr Lys Glu Ser Phe Ile Val Arg Cys Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Val Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Cys Asn His Ala Gln Ser Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Thr Thr Met - ~ 115 120 125 Arg Lys Leu Gly Leu Ile Trp Val Thr Asn Arg Met His Ile Glu Ile Tyr Lys Tyr Pro Ala Trp Gly Asp Val Val Glu Ile Glu Thr Trp Cys Gln Glu Asp Gly Lys Ile Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Leu Ala Asn Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asn Thr Arg Arg Leu Gln Arg Val Ser Asp Asp Val Arg Asp Glu Val Phe Val His Cys Pro Lys Thr Pro Arg Leu Ala Phe Pro Glu Glu Asn Asn Gly Ser Leu Lys Lys Ile Pro Val Leu Thr Asp Pro Ala Gln His Ser Arg Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Asp Ile Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asp Asp Ile Val Asp Ser Leu Thr Tyr Ile Glu Glu Gly Glu Glu Lys Ser Ser Asn Gly Ser Ala Phe Ala Ala Pro His Pro Glu Glu Gln Arg Gln Phe Leu His Cys Leu Arg Phe Ala Gly Asn Gly Asn Glu Ile Asn Arg Gly Arg Thr Val Trp Arg Lys Leu Ala Arg <210> 9 <211> 1101 <212> DNA
<213> Vernonia mespilifolia <400> 9 gcacgaggag agtttctccg ttactggcgg tgacgaccgg agagcagtcg agtagcgttg 60 gtagcttaca tgaggcggaa aaggaaaaaa gcctggggaa caggctccga ctggggagct 120 tgacggagga tggattatcg tataaggaga aatttgttat aaggtgttat gaggttggca 180 tcaacaaaac tgccactatt gaaacgattg ccaatctttt gcaggaggtt ggaggtaatc 240 atgctcagag tgttggattt tctactgatg ggtttgccac tacgaccact atgaggaaat 300 tgcatctcat atgggttact gcacgaatgc atatcgaagt atacagatac cctgcttgga 360 gtgatgtgat tgaaatcgag acttgggttc aaggtgaagg aagggttggg accagacgtg 420 attggattct caaagactat gccaatgacg aggtcattgg aagggctacg agcaaatggg 480 tgatgatgaa tgaggatact agaagattgc agaaagtcgg tgatgatgtc agagaagaat 540 atttagtgtt ttgccccagg acattgagat tggcatttcc tgaagagaac aataacagcc 600 tgaagaaaat agcaaaactc gaagacccgg ctgaatattc caggctaaga ctcgtgccga 660 ggagatcgga tctggatatg aacaaacatg taaataatgt tacctacatt ggatgggctc 720 tggagagcat cccaccagat atcatcgaca cccatgaact gcaagcaatt accctagact 780 atagacgtga atgccagcag gatgacatag ttgattcact caccagtcgg gaaccactcg 840 ttgatgctgc caatttagaa cttacagaaa gcaatgacag agaagatttg agccgatttt 900 tgcatctact aagatcggct gctaatggtc ttgagataaa tcggtgtcgc actgaatgga 960 gaaagaaacc agcaaaaata tagtacaccc acacacaatc tgttgatcct tctccttctc 1020 ctgtacctgt ttaccgtatt tacccttctc gtttgtgttc aaagtgtagt ttttcttttt 1080 ataaaaaaaa aaaaaaaaaa a 1101 <210> 10 <211> 326 <212> PRT
<213> Vernonia mespilifolia <400> 10 Thr Arg Arg Val Ser Pro Leu Leu Ala Val Thr Thr Gly Glu Gln Ser Ser Ser Val Gly Ser Leu His Glu Ala Glu Lys Glu Lys Ser Leu Gly Asn Arg Leu Arg Leu Gly Ser Leu Thr Glu Asp Gly Leu Ser Tyr Lys Glu Lys Phe Val Ile Arg Cys Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Ile Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Gly Asn His Ala Gln Ser Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Thr Thr Met Arg Lys Leu His Leu Ile Trp Val Thr Ala Arg Met His Ile Glu Val Tyr Arg Tyr Pro Ala Trp Ser Asp Val Ile Glu Ile Glu Thr Trp Val Gln Gly Glu Gly Arg Val Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Tyr Ala Asn Asp Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Glu Asp Thr Arg Arg Leu Gln Lys Val Gly Asp Asp Val Arg Glu Glu Tyr Leu Val Phe Cys Pro Arg Thr Leu Arg Leu Ala Phe Pro Glu Glu Asn Asn Asn Ser Leu Lys Lys Ile Ala Lys Leu Glu Asp Pro Ala Glu Tyr Ser Arg Leu Arg Leu Val Pro Arg Arg Ser Asp Leu Asp Met Asn Lys His Val Asn Asn Val Thr Tyr Ile Gly Trp Ala Leu Glu Ser Ile Pro Pro Asp Ile Ile Asp Thr His Glu Leu Gln Ala Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln Gln Asp Asp Ile Val Asp Ser Leu Thr Ser Arg Glu Pro Leu Val Asp Ala Ala Asn Leu Glu Leu Thr Glu Ser Asn Asp Arg Glu Asp Leu Ser Arg Phe Leu His Leu Leu Arg Ser Ala Ala Asn Gly Leu Glu Ile Asn Arg Cys Arg Thr Glu Trp Arg Lys Lys Pro Ala Lys Ile <210> 11 <211> 522 <212> DNA
<213> Triticum aestivum <220>
<221> unsure <222> (134) <400> 11 gaaagatcgg tactcggcgt gattggatcc ttaaggattt agctaatggt gaagttattg 60 gaagagctac cagcaagtgg gtcatgatga accaaaatac acgcagactt caaagagtca 120 gtgacgaagc aggngatgag gtgtttatcc actgtccgaa gagtccaaga ttagcattcc 180 ctgaggaaaa taatggcagt ctgaagaaga ttcctgttct aacagatcct gcacagcact 240 cgaggctcgg tctagtgcct agaagagctg atctggacat gaaccaacat gtcaataatg 300 tcacttacat tggttgggtc ctcgaaagca tacctcaaga tattattgat acccatgagt 360 tgcaaacaat cactcttgac tacagaagag agtgccagca tgatgacata gtcgattctc 420 tcacctatat agaggaaggg gaggagataa attctaatgg atctctgttt tcagcgccgc 480 acccagaaga gcagcgtcag ttcttgcact gcttgagatt tg 522 <210> 12 <211> 166 <212> PRT
<213> Triticum aestivum <400> 12 Lys Ile Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Leu Ala Asn Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asn Thr Arg Arg Leu Gln Arg Val Ser Asp Glu Ala Gly Asp Glu Val Phe Ile His Cys Pro Lys Ser Pro Arg Leu Ala Phe Pro Glu Glu Asn Asn Gly Ser Leu Lys Lys Ile Pro Val Leu Thr Asp Pro Ala Gln His Ser Arg Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Asp Ile Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asp Asp Ile Val Asp Ser Leu Thr Tyr Ile Glu Glu Gly Glu Glu Ile Asn Ser Asn Gly Ser Leu Phe Ser Ala Pro His Pro Glu Glu Gln Arg Gln <210> 13 <211> 1454 <212> DNA
<213> Zea mays <400> 13 gcacgagaac cccagtccgc tccgcccgtg taaaactcca accgcgcatc gtcgtcgtcg 60 tcggctgcgg cggcggccgg gcaacgagcc tcctcgaaac gacgcgcccg ctctcccaca 120 tgctgcgctg tcacgcgcca ccgcaatgcg gccgcgcgcc gctccgccac cacggaaggt 180 gggagtcgtc tcccgcaccc ggggtggtgg tgcggtgcac gcggggtgcg ccgcaggtat 240 ccgggatcga ggcggcgtcg ccggaccacg cagctgccac ggcggtggcg gctaaggcgg 300 aagggggtga cgcgcggccc agcctggccg agcggctgcg actggggagc ctcctggagg 360 acgggctctc ttacaaggag agtttcatcg tgcgctgcta cgaggtgggt atcaacaaga 420 1~

cggccaccgt cgagaccatc gccaatctcc tccaggaggt aggatgtaac catgcacaaa 980 gtgttgggtt ctctactgat ggcttcgcca caactactac aatgagaaaa cttggactta 540 tttgggtgac gaaccgaatg cacattgaga tctacaagta cccagcttgg ggtgatgttg 600 ttgagatcga aacatggtgc caagaagatg gaaaaattgg tactcgtcgt gattggatcc 660 tcaaggacct gtgtactggt gaagttactg gcagagctac cagcaagtgg gtcatgatga 720 accaaaatac acggagactt caacgagtca gtgatgacgt gagggatgag gtgtttatac 780 attgtccaaa gactccaaga ttagcatttc cagaggaaaa taatggcagt ttgaagaaga 840 ttccgaatct ttcagatcct gcacaatatt caagactagg actagtgcca agaagagctg 900 atctggacat gaaccaacat gtcaataatg ttacttacat tggttgggtc cttgaaagta 960 tacctcaaga tataattgat acacacgagt tacaaacaat cactctcgac tatagaagag 1020 aatgtcaaca cgatgacata gttgattctc ttacttacgt agaggaagga gaggagagaa 1080 gcatgaacgg ctctgcttcc tcagtgccgc acacagaaca gcggcggcag ttcttgcatt 1140 gcttgagatt tgcagccaat ggggatgaga tcaaccgtgg ccgtaccgcg tggaggaagc 1200 tagctagata aaaagtagtt tttggtcatc aatattctgc tccattttgc ttctcgcggt 1260 tggcggccct tgtaccacaa ttctgccatg cgtcgatggc gatttctgtc atttcttgca 1320 gttgtaaccg tctgtccgtt ttgtaccagt ggacagtgtc tgtgcgacat gcaataacct 1380 gcgtttaaac cctacgccaa cacaggcaag tcaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1440 aaaaaaaaaa aaaa 1454 <210> 14 <211> 400 <212> PRT
<213> Zea mays <400> 14 Thr Pro Val Arg Ser Ala Arg Val Lys Leu Gln Pro Arg Ile Val Val Val Val Gly Cys Gly Gly Gly Arg Ala Thr Ser Leu Leu Glu Thr Thr Arg Pro Leu Ser His Met Leu Arg Cys His Ala Pro Pro Gln Cys Gly Arg Ala Pro Leu Arg His His Gly Arg Trp Glu Ser Ser Pro Ala Pro Gly Val Val Val Arg Cys Thr Arg Gly Ala Pro Gln Val Ser Gly Ile Glu Ala Ala Ser Pro Asp His Ala Ala Ala Thr Ala Val Ala Ala Lys Ala Glu Gly Gly Asp Ala Arg Pro Ser Leu Ala Glu Arg Leu Arg Leu Gly Ser Leu Leu Glu Asp Gly Leu Ser Tyr Lys Glu Ser Phe Ile Val Arg Cys Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Val Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Cys Asn His Ala Gln Ser Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Thr Thr Met Arg Lys Leu Gly Leu Ile Val Thr Asn Arg His Ile Ile Tyr Lys Tyr Trp Met Glu Pro Ala Trp Asp Val Val Glu Glu Thr Cys Gln Glu Asp Gly Ile Trp Gly Lys Ile Thr Arg Arg Asp Ile Leu Asp Leu Cys Thr Gly Trp Lys Gly Glu Val Gly Arg Ala Thr Lys Trp Met Met Asn Gln Thr Ser Val Asn Thr Arg Leu Gln Arg Val Asp Asp Arg Asp Glu Val Arg Ser Val Phe Ile His Pro Lys Thr Pro Leu Ala Pro Glu Glu Asn Cys Arg Phe Asn Gly Ser Lys Lys Ile Pro Leu Ser Pro Ala Gln Tyr Leu Asn Asp Ser Arg Leu Leu Val Pro Arg Ala Asp Asp Met Asn Gln Gly Arg Leu His Val Asn Val Thr Tyr Ile Trp Val Glu Ser Ile Pro Asn Gly Leu Gln Asp Ile Asp Thr His Glu Gln Thr Thr Leu Asp Tyr Ile Leu Ile Arg Arg Glu Gln His Asp Asp Val Asp Leu Thr Tyr Val Cys Ile Ser Glu Glu Gly Glu Arg Ser Met Gly Ser Ser Ser Val Pro Glu Asn Ala His Thr Glu Arg Arg Gln Phe His Cys Arg Phe Ala Ala Gln Leu Leu Asn Gly Asp Ile Asn Arg Gly Thr Ala Arg Lys Leu Ala Glu Arg Trp Arg <210> 15 <211> 772 <212> DNA

<213> Triticum aestivum <400> 15 gcacgaggaaagatcggtac tcggcgtgattggatccttaaggatttagc taatggtgaa60 gttattggaagagctaccag caagtgggtcatgatgaaccaaaatacacg cagacttcaa120 agagtcagtgacgaagtcag ggatgaggtgtttatccactgtccgaagag tccaagatta180 gcattccctgaggaaaataa tggcagtctgaagaagattcctgttctaac agatcctgca240 cagcactcgaggctcggtct agtgcctagaagagctgatctggacatgaa ccaacatgtc300 aataatgtcacttacattgg ttgggtcctcgaaagcatacctcaagatat tattgatacc360 catgagttgcaaacaatcac tcttgactacagaagagagtgccagcatga tgacatagtc420 gattctctcacctatataga ggaaggggaggagataaattctaatggatc tctgttttca480 gcgccgcacccagaagagca gcgtcagttcttgcactgcttgagatttgc tggggctggg540 gacgagatcaaccgtggtcg caccgtgtggaggaaactagctagataaaa agtgatatgt600 atttgctcatatgtattgtg ctgttccttttgttttactgttttgctctt tgcgaccggc660 gccgcatcac gagagaatca actgtacccg gaattttgtg attacctttg tgacctgtgt 720 aacaatcaat gccaatctgt ggcaaatgtt ggaccaaaaa aaaaaaaaaa as 772 <210> 16 <211> 195 <212> PRT
<213> Triticum aestivum <400> 16 Ala Arg Gly Lys Ile Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Leu Ala Asn Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asn Thr Arg Arg Leu Gln Arg Val Ser Asp Glu Val Arg Asp Glu Val Phe Ile His Cys Pro Lys Ser Pro Arg Leu Ala Phe Pro Glu Glu Asn Asn Gly Ser Leu Lys Lys Ile Pro Val Leu Thr Asp Pro Ala Gln His Ser Arg Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Asp Ile Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asp Asp Ile Val Asp Ser Leu Thr Tyr Ile Glu Glu Gly Glu Glu Ile Asn Ser Asn Gly Ser Leu Phe Ser Ala Pro His Pro Glu Glu Gln Arg Gln Phe Leu His Cys Leu Arg Phe Ala Gly Ala Gly Asp Glu Ile Asn Arg Gly Arg Thr Val Trp Arg Lys Leu Ala Arg <210> 17 <211> 352 <212> PRT
<213> Garcinia mangostana <400> 17 Met Leu Lys Leu Ser Ser Ser Arg Ser Pro Leu Ala Arg Ile Pro Thr Arg Pro Arg Pro Asn Ser Ile Pro Pro Arg Ile Ile Val Val Ser Ser Ser Ser Ser Lys Val Asn Pro Leu Lys Thr Glu Ala Val Val Ser Ser Gly Leu Ala Asp Arg Leu Arg Leu Gly Ser Leu Thr Glu Asp Gly Leu Ser Tyr Lys Glu Lys Phe Ile Val Arg Cys Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Val Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Cys Asn His Ala Gln Ser Val Gly Tyr Ser Thr Gly Gly Phe Ser Thr Thr Pro Thr Met Arg Lys Leu Arg Leu Ile Trp Val Thr Ala Arg Met His Ile Glu Ile Tyr Lys Tyr Pro Ala Trp Ser Asp Val Val Glu Ile Glu Ser Trp Gly Gln Gly Glu Gly Lys Ile Gly Thr Arg Arg Asp Trp Ile Leu Arg Asp Tyr Ala Thr Gly Gln Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asp Thr Arg Arg Leu Gln Lys Val Asp Val Asp Val Arg Asp Glu Tyr Leu Val His Cys Pro Arg Glu Leu Arg Leu Ala Phe Pro Glu Glu Asn Asn Ser Ser Leu Lys Lys Ile Ser Lys Leu Glu Asp Pro Ser Gln Tyr Ser Lys Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Met Pro Gln Glu Ile Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asp Asp Val Val Asp Ser Leu Thr Ser Pro Glu Pro Ser Glu Asp Ala Glu Ala Val Phe Asn His Asn Gly Thr Asn Gly Ser Ala Asn Val Ser Ala Asn Asp His Gly Cys Arg Asn Phe Leu His Leu Leu Arg Leu Ser Gly Asn Gly Leu Glu Ile Asn Arg Gly Arg Thr Glu Trp Arg Lys Lys Pro Thr Arg <210> 18 <211> 389 <212> PRT
<213> Carthamus tinctorius <400> 18 Met Leu Ser Arg Pro Leu Pro Thr Thr Ala Ala Ala Ala Thr Thr Thr Thr Asn Asn Cys Asn Gly Val Asn Ser Arg Gly Ala Leu Pro His Ser Arg Ser Val Gly Phe Ala Ser Ile Arg Lys Arg Ser Thr Gly Ser Leu Cys Asn Ser Pro Pro Arg Thr Val Ala Pro Val Met Ala Val Arg Thr Gly Glu Gln Pro Thr Gly Val Ala Val Gly Leu Lys Glu Ala Glu Ala Glu Val Glu Lys Ser Leu Ala Asp Arg Leu Arg Met Gly Ser Leu Thr Glu Asp Gly Leu Ser Tyr Lys Glu Arg Phe Ile Ile Arg Cys Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Val Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Gly Asn His Ala Gln Ser Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Thr Thr Met Arg Lys Leu His Leu Ile Trp Val Thr Ser Arg Met His Ile Glu Ile Tyr Arg Tyr Pro Ala Trp Ser Asp Val Val Glu Ile Glu Thr Trp Cys Gln Ser Glu Gly Arg Ile Gly Thr Arg Arg Asp Trp Ile Met Lys Asp His Ala Ser Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Glu Asp Thr Arg Arg Leu Gln Lys Val Asn Asp Asp Val Arg Asp Glu Tyr Leu Val Phe Cys Pro Lys Thr Pro Arg Leu Ala Phe Pro Glu Lys Asn Thr Ser Ser Leu Lys Lys Ile Ala Lys Leu Glu Asp Pro Ala Glu Tyr Ser Thr Leu Gly Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Lys His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Glu Val Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asp Asp Ile Val Asp Ser Leu Thr Ser Ser Glu Ser Leu Leu Asp Asp Ala Ala Ile Ser Lys Leu Glu Gly Thr Asn Gly Ser Ser Val Pro Lys Lys Asp Glu Thr Asp Leu Ser Arg Phe Leu His Leu Leu Arg Ser Ser Gly Asp Gly Leu Glu Leu Asn Arg Gly Arg Thr Glu Trp Arg Lys Lys Pro Ala Lys Lys <210> 19 <211> 385 <212> PRT
<213> Carthamus tinctorius <400> 19 Met Leu Ser Lys Gly Ala Pro Ala Ala Pro Ala Val Ala Ala Met Tyr Asn Ala Ser Ala Lys Asp Thr Thr Phe Ala Leu Thr His Ser Arg Ser Ile Gly Ser Val Ser Ile Arg Arg Arg Tyr Asn Val Phe Leu Cys Asn Ser Ser Ser Ser Ser Arg Lys Val Ser Pro Leu Leu Ala Val Ala Thr Gly Glu Gln Pro Ser Gly Val Ala Ser Leu Arg Glu Ala Asp Lys Glu Lys Ser Leu Gly Asn Arg Leu Arg Leu Gly Ser Leu Thr Glu Asp Gly Leu Ser Tyr Lys Glu Lys Phe Val Ile Arg Cys Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Ile Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Gly Asn His Ala Gln Gly Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Thr Thr Met Arg Lys Leu His Leu Ile Trp Val Thr Ala Arg Met His Ile Glu Ile Tyr Arg Tyr Pro Ala Trp Ser Asp Val Ile Glu Ile Glu Thr Trp Val Gln Gly Glu Gly Lys Val Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Tyr Ala Asn Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Glu Asp Thr Arg Arg Leu Gln Lys Val Ser Asp Asp Val Arg Glu Glu Tyr Leu Val Phe Cys Pro Arg Thr Leu Arg Leu Ala Phe Pro Glu Glu Asn Asn Asn Ser Met Lys Lys Ile Pro Lys Leu Glu Asp Pro Ala Glu Tyr Ser Arg Leu Gly Leu Val Pro Arg Arg Ser Asp Leu Asp Met Asn Lys His Val Asn Asn Val Thr Tyr Ile Gly Trp Ala Leu Glu Ser Ile Pro Pro Glu Ile Ile Asp Thr His Glu Leu Gln Ala Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln Arg Asp Asp Ile Val Asp Ser Leu Thr Ser Arg Glu Pro Leu Gly Asn Ala Ala Gly Val Lys Phe Lys Glu Ile Asn Gly Ser Val Ser Pro Lys Lys Asp Glu Gln Asp Leu Ser Arg Phe Met His Leu Leu Arg Ser Ala Gly Ser Gly Leu Glu Ile Asn Arg Cys Arg Thr Glu Trp Arg Lys Lys Pro Ala Lys Arg <210> 20 <211> 222 <212> PRT
<213> Elaeis guineensis <400> 20 Gly Phe Ala Thr Thr Pro Thr Met Arg Lys Leu Arg Leu Ile Trp Val Thr Ser Arg Met His Ile Glu Ile Tyr Lys Tyr Pro Ala Trp Gly Asp Val Val Glu Ile Glu Thr Trp Cys Gln Gly Glu Gly Arg Ile Gly Thr Arg Arg Asp Trp Ile Ile Lys Asp Leu Ala Thr Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asp Thr Arg Lys Leu Gln Arg Val Ser Asp Glu Val Arg Glu Glu Tyr Leu Val Phe Cys Pro Arg Thr Pro Arg Leu Ala Phe Pro Glu Glu Asp Asn Gly Ser Val Lys Lys Ile Pro Lys Leu Glu Glu Pro Ala Asp Tyr Ser Arg Ser Glu Leu Val Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Met Pro Gln Glu Ile Ile Asp Thr His Glu Leu Gln Thr Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln His Asn Asp Met Val Asp Ser Leu Thr Ser Leu Glu Leu Ala Asp Asp Tyr Ser Thr Asn Gly Ser Ala Ile Gly Lys Gln His Lys Lys Glu His Pro Ser Leu Phe Ala Phe Leu Glu Ile Val Gln His Trp Thr <210> 21 <211> 367 <212> PRT
<213> Arabidopsis thaliana <400> 21 Met Leu Lys Leu Ser Cys Asn Val Thr Asp His Ile His Asn Leu Phe Ser Asn Ser Arg Arg Ile Phe Val Pro Val His Arg Gln Thr Arg Pro Ile Ser Cys Phe Gln Leu Lys Lys Glu Pro Leu Arg Ala Ile Leu Ser Ala Asp His Gly Asn Ser Ser Val Arg Val Ala Asp Thr Val Ser Gly Thr Ser Pro Ala Asp Arg Leu Arg Phe Gly Arg Leu Met Glu Asp Gly Phe Ser Tyr Lys Glu Lys Phe Ile Val Arg Ser Tyr Glu Val Gly Ile Asn Lys Thr Ala Thr Ile Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Ala Cys Asn His Val Gln Asn Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Leu Thr Met Arg Lys Leu His Leu Ile Trp Val Thr Ala Arg Met His Ile Glu Ile Tyr Lys Tyr Pro Ala Trp Ser Asp Val Val Glu 145 15.0 155 160 Ile Glu Thr Trp Cys Gln Ser Glu Gly Arg Ile Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Cys Ala Thr Gly Glu Val Ile Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asp Thr Arg Arg Leu Gln Arg Val Thr Asp Glu Val Arg Asp Glu Tyr Leu Val Phe Cys Pro Pro Glu Pro Arg Leu Ala Phe Pro Glu Glu Asn Asn Ser Ser Leu Lys Lys Ile Pro Lys Leu Glu Asp Pro Ala Gln Tyr Ser Met Leu Gly Leu Lys Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Glu Ile Ile Asp Thr His Glu Leu Lys Val Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln Gln Asp Asp Ile Val Asp Ser Leu Thr Thr Ser Glu Thr Pro Asn Glu Val Val Ser Lys Leu Thr Gly Thr Asn Gly Ser Thr Thr Ser Ser Lys Arg Glu His Asn Glu Ser His Phe Leu His Ile Leu Arg Leu Ser Glu Asn Gly Gln Glu Ile Asn Arg Gly Arg Thr Gln Trp Arg Lys Lys Ser Ser Arg <210> 22 <211> 362 <212> PRT
<213> Arabidopsis thaliana <400> 22 Met Leu Lys Leu Ser Cys Asn Val Thr Asp Ser Lys Leu Gln Arg Ser Leu Leu Phe Phe Ser His Ser Tyr Arg Ser Asp Pro Val Asn Phe Ile Arg Arg Arg Ile Val Ser Cys Ser Gln Thr Lys Lys Thr Gly Leu Val Pro Leu Arg Ala Val Val Ser Ala Asp Gln Gly Ser Val Val Gln Gly Leu Ala Thr Leu Ala Asp Gln Leu Arg Leu Gly Ser Leu Thr Glu Asp 65 70. 75 80 Gly Leu Ser Tyr Lys Glu Lys Phe Val Val Arg Ser Tyr Glu Val Gly Ser Asn Lys Thr Ala Thr Val Glu Thr Ile Ala Asn Leu Leu Gln Glu Val Gly Cys Asn His Ala Gln Ser Val Gly Phe Ser Thr Asp Gly Phe Ala Thr Thr Thr Thr Met Arg Lys Leu His Leu Ile Trp Val Thr Ala Arg Met His Ile Glu Ile Tyr Lys Tyr Pro Ala Trp Gly Asp Val Val Glu Ile Glu Thr Trp Cys Gln Ser Glu Gly Arg Ile Gly Thr Arg Arg Asp Trp Ile Leu Lys Asp Ser Val Thr Gly Glu Val Thr Gly Arg Ala Thr Ser Lys Trp Val Met Met Asn Gln Asp Thr Arg Arg Leu Gln Lys Val Ser Asp Asp Val Arg Asp Glu Tyr Leu Val Phe Cys Pro Gln Glu Pro Arg Leu Ala Phe Pro Glu Glu Asn Asn Arg Ser Leu Lys Lys Ile Pro Lys Leu Glu Asp Pro Ala Gln Tyr Ser Met Ile Gly Leu Lys Pro Arg Arg Ala Asp Leu Asp Met Asn Gln His Val Asn Asn Val Thr Tyr Ile Gly Trp Val Leu Glu Ser Ile Pro Gln Glu Ile Val Asp Thr His Glu Leu Gln Val Ile Thr Leu Asp Tyr Arg Arg Glu Cys Gln Gln Asp Asp Val Val Asp Ser Leu Thr Thr Thr Thr Ser Glu Ile Gly Gly Thr Asn Gly Ser Ala Thr Ser Gly Thr Gln Gly His Asn Asp Ser Gln Phe Leu His Leu Leu Arg Leu Ser Gly Asp Gly Gln Glu Ile Asn Arg Gly Thr Thr Leu Trp Arg Lys Lys Pro Ser Ser

Claims (24)

What is claimed is:

1. An isolated polynucleotide that encodes a first polypeptide of at least 166 amino acids, the polypeptide having a sequence identity of at least 90% based on the Clustal method of alignment when compared to a second polypeptide selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, and 16, or preferably a third polypeptide of at least 363 amino acids, the polypeptide having a sequence identity of at least 92% identity based on the Clustal method of alignment when compared to a fourth polypeptide selected from SEQ ID NO:14.

2. A polynucleotide sequence of Claim 1, wherein the sequence identity is at least 93%.

3. A polynucleotide sequence of Claim 1, wherein the sequence identity is at least 96%.

4. The polynucleotide of Claim 1 wherein the first polypeptide is selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, and 16.

5. The polynucleotide of Claim 1, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:1, 3, 5, 7, 9, 11, 13, and 15.

6. The polynucleotide of Claim 1, wherein the first polypeptide is an oleoyl-ACP
thioesterase.

7. An isolated complement of the polynucleotide of Claim 1, wherein (a) the complement and the polynucleotide consist of the same number of nucleotides, and (b) the nucleotide sequences of the complement and the polynucleotide have 100%
complementarity.

8. An isolated complement of the polynucleotide of Claim 5, wherein (a) the complement and the polynucleotide consist of the same number of nucleotides, and (b) the nucleotide sequences of the complement and the polynucleotide have 100%
complementarity.

9. An isolated nucleic acid molecule that (1) comprises at least 400 nucleotides and (2) remain hybridized with the isolated polynucleotide of Claim 1 under a wash condition of 0.1X SSC, 0.1% SDS, and 65°C.

10. An isolated nucleic acid molecule that (1) comprises at least 400 nucleotides and (2) remain hybridized with the isolated polynucleotide of Claim 5 under a wash condition of 0.1X SSC, 0.1% SDS, and 65°C.

11. A cell comprising the polynucleotide of Claim 1.

12. The cell of Claim 11, wherein the cell is selected from the group consisting of a yeast cell, a bacterial cell and a plant cell.

13. A transgenic plant comprising the polynucleotide of Claim 1.

14. A method for transforming a cell comprising introducing into a cell the polynucleotide of Claim 1.

15. A method for producing a transgenic plant comprising (a) transforming a plant cell with the polynucleotide of Claim 1, and (b) regenerating a plant from the transformed plant cell.

16. A method for producing a polynucleotide fragment comprising (a) selecting a nucleotide sequence comprised by the polynucleotide of Claim 1, and (b) synthesizing a polynucleotide fragment containing the nucleotide sequence.

17. The method of Claim 16, wherein the fragment is produced in vivo.

18. An isolated polypeptide comprising (a) at least 166 amino acids, and (b) has a sequence identity of at least 90% based on the Clustal method compared to an amino acid sequence selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, and 16, or preferably (c) at least 363 amino acids, and (d) has a sequence identity of at least 92% based on the Clustal method compared to an amino acid sequence selected from the group consisting of SEQ ID NO:14.

19. The polypeptide of Claim 18, wherein the sequence identity is at least 93%.

20. The polypeptide of Claim 18, wherein the sequence identity is at least 96%.

21. The polypeptide of Claim 18 wherein the polypeptide has a sequence selected from the group consisting of SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, and 16.

22. The polypeptide of Claim 18, wherein the polypeptide is an oleoyl-ACP
thioesterase.

23. A chimeric gene comprising the polynucleotide of Claim 1 operably linked to at least one suitable regulatory sequence.

24. A method for altering the level of oleoyl-ACP thioesterase expression in a host cell, the method comprising:
(a) Transforming a host cell with the chimeric gene of Claim 23; and (b) Growing the transformed cell in step (a) under conditions suitable for the expression of the chimeric gene.