CA2384123A1 - Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase 2 promoter and terminator - Google Patents

Abstract

Transcription promoter and terminator sequences from the Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase 2 gene (GAP2 gene) are disclosed. The sequences are useful within DNA constructs for the production of proteins of interest in cultures P. methanolica cells. Within the expression vectors, a GAP2 promoter and/or a GAP2 terminator is operably linked to a DNA segment encoding the protein of interest.

Description

Description BACKGROUND OF THE INVENTION
Methylotrophic yeasts are those yeasts that are able to utilize methanol as a sole source of carbon and energy. Species of yeasts that have the biochemical pathways necessary for methanol utilization are classified in four genera, Hansenula, Pichia, Candida, and Torulopsis. These genera are somewhat artificial, having been based on cell morphology and growth characteristics, and do not reflect close genetic relationships (Billon-Grand, Mycotaxon 35:201-204, 1989; Kurtzman, Mycolo~ia 84:72-76, 1992). Furthermore, not all species within these genera are capable of utilizing methanol as a source of carbon and energy. As a consequence of this classification, there are great differences in physiology and metabolism between individual species of a genus.
Methylotrophic yeasts are attractive candidates for use in recombinant 2 0 protein production systems for several reasons. First, some methylotrophic yeasts have been shown to grow rapidly to high biomass on minimal defined media. Second, recombinant expression cassettes are genomically integrated and therefore mitotically stable. Third, these yeasts are capable of secreting large amounts of recombinant proteins. See, for example, Faber et al., Yeast 11:1331, 1995; Romanos et al., Yeast 8:423, 1992; Cregg et al., Bio/Technology 11:905, 1993; U.S. Patent No.
4,855,242;
U.S. Patent No. 4,857,467; U.S. Patent No. 4,879,231; and U.S. Patent No.
4,929,555;
and Raymond, U.S. Patents Nos. 5,716,808, 5,736,383, 5,854,039, and 5,888,768.
Previously described expression systems for methylotrophic yeasts rely largely on the use of methanol-inducible transcription promoters. The use of methanol 3 0 induced promoters is, however, problematic as production is scaled up to commercial levels. The overall volume of methanol used during the fermentation process can be as much as 40% of the final fermentation volue, and at 1000-liter fermentation scale and above the volumes of methanol required for induction necessitate complex and potentially expensive considerations.
3 5 There remains a need in the art for additional materials and methods to enable the use of methylotrophic yeasts for production of polypeptides of economic importance, including industrial enzymes and pharmaceutical proteins. The present invention provides such materials and methods as well as other, related advantages.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide transcription promoter and terminator sequences for use in Pichia methanolica. It is a further object of the invention to provide materials and methods for obtaining constitutive expression of heterologous DNA in P. methanolica. It is also an object of the invention to provide methods for production of polypeptides in P. methanolica, which methods can be readily scaled up to industrial levels, and to provide materials that can be used within these methods. It is another object of the invention to provide materials and methods for obtaining constitutive transcription of heterologous DNA to produce recombinant proteins in P. methanolica.
Within one aspect, the present invention provides an isolated DNA
molecule of up to 5000 nucleotides in length comprising nucleotide 93 to nucleotide 1080 of SEQ ID NO:1.
Within a second aspect of the invention there is provided a DNA
construct comprising the following operably linked elements: a first DNA
segment comprising at least a portion of the sequence of SEQ >D NO:1 from nucleotide 93 to 2 0 nucleotide 1092, wherein the portion is a functional transcription promoter; a second DNA segment encoding a protein of interest other than a Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase; and a third DNA segment comprising a transcription terminator. Within one embodiment, the first DNA segment is from to 1500 nucleotides in length. Within another embodiment, the first DNA
segment is 2 5 from 900 to 1000 nucleotides in length. Within an additional embodiment, the first DNA segment is substantially free of Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase gene coding sequence. The DNA construct may further comprise a selectable marker, preferably a Pichia methanolica gene, more preferably a Pichia methanolica ADE2 gene. The DNA construct may be a closed, circular molecule or a 3 0 linear molecule. Within other embodiments, the DNA constuct further comprises a secretory signal sequence, such as the S. cerevisiae alpha-factor pre-pro sequence, operably linked to the first and second DNA segments. Within additional embodiments, the third DNA segment comprises a transcription terminator of a Pichia methanolica AUGl or GAP2 gene.
3 5 Within a third aspect of the invention there is provided a Pichia methanolica cell containing a DNA construct as disclosed above. Within one embodiment, the DNA construct is genomically integrated. Within a related embodiment, the DNA construct is genomically integrated in multiple copies.
Within a further embodiment, the P. methanolica cell is functionally deficient in vacuolar proteases proteinase A and proteinase B.
Within a fourth aspect of the invention there is provided a method of producing a protein of interest comprising the steps of (a) culturing a P.
methanolica cell as disclosed above whereby the second DNA segment is expressed and the protein of interest is produced, and (b) recovering the protein of interest from the cultured cell.
Within a fifth aspect of the invention there is provided a DNA construct comprising the following operably linked elements: a first DNA segment comprising a Pichia methanolica gene transcription promoter; a second DNA segment encoding a protein of interest other than a Pichia methanolica protein; and a third DNA
segment comprising nucleotides 2095 to 2145 of SEQ ID NO:1.
These and other aspects of the invention will become evident upon reference to the following detailed description of the invention.
DETAILED DESCRIPTION OF THE INVENTION
The term "allelic variant" is used herein to denote an alternative form of a gene. Allelic variation is known to exist in populations and arises through mutation.
A "DNA construct" is a DNA molecule, either single- or double-t 0 stranded, that has been modified through human intervention to contain segments of DNA combined and juxtaposed in an arrangement not existing in nature.
A "DNA segment" is a portion of a larger DNA molecule having specified attributes. For example, a DNA segment encoding a specified polypeptide is a portion of a longer DNA molecule, such as a plasmid or plasmid fragment, that, when 2 5 read from the 5' to the 3' direction, encodes the sequence of amino acids of the specified polypeptide.
The term "functionally deficient" denotes the expression in a cell of less than 10% of an activity as compared to the level of that activity in a wild-type counterpart. It is preferred that the expression level be less than 1 % of the activity in 3 0 the wild-type counterpart, more preferably less than 0.01 % as determined by appropriate assays. It is most preferred that the activity be essentially undetectable (i.e., not significantly above background). Functional deficiencies in genes can be generated by mutations in either coding or non-coding regions.
The term "gene" is used herein to denote a DNA segment encoding a 3 5 polypeptide. Where the context allows, the term includes genomic DNA (with or without intervening sequences), cDNA, and synthetic DNA. Genes may include non coding sequences, including promoter elements.

The term "isolated", when applied to a polynucleotide, denotes that the polynucleotide has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. Such isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones.
"Operably linked", when referring to DNA segments, indicates that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.
A "polynucleotide" is a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.
Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"), nucleotides ("nt"), or kilobases ("kb"). Where the context allows, the latter two terms may describe polynucleotides that are single-stranded or double-stranded. When these terms are applied to double-stranded molecules they are used to denote overall length and will be understood to be equivalent to the term "base pairs". It will be recognized by those 2 0 skilled in the art that the two strands of a double-stranded polynucleotide may differ slightly in length and that the ends thereof may be staggered as a result of enzymatic cleavage; thus all nucleotides within a double-stranded polynucleotide molecule may not be paired. Such unpaired ends will in general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid residues joined by peptide 2 5 bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as "peptides".
The term "promoter" is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, 3 0 but not always, found in the 5' non-coding regions of genes. Sequences within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, and transcription factor binding sites. See, in general, Watson et al., eds., Molecular Biology of the Gene, 4th ed., The Benjamin/Cummings 3 5 Publishing Company, Inc., Menlo Park, CA, 1987.
A "pro sequence" is a DNA sequence that commonly occurs immediately 5' to the mature coding sequence of a gene encoding a secretory protein.

The pro sequence encodes a pro peptide that serves as a cis-acting chaperone as the protein moves through the secretory pathway.
A "protein" is a macromolecule comprising one or more polypeptide chains. A protein may also comprise non-peptidic components, such as carbohydrate 5 groups. Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell.
Proteins are commonly defined in terms of their amino acid backbone structures;
substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
l0 The term "secretory signal sequence" denotes a DNA sequence that encodes a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway. A secretory peptide and a pro peptide may be collectively referred to as a pre-pro peptide.
The present invention provides isolated DNA molecules comprising a Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene promoter. The invention also provides isolated DNA molecules comprising a P.
methanolica GAPDH gene terminator. The promoter and terminator can be used within 2 0 methods of producing proteins of interest, including proteins of pharmaceutical or industrial value.
The sequence of a DNA molecule comprising a Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene promoter, coding region, and terminator is shown in SEQ ID NO:1. The gene has been designated GAP2.
Those 2 5 skilled in the art will recognize that SEQ ID NO: l represents a single allele of the P.
methanolica GAP2 gene and that other functional alleles (allelic variants) are likely to exist, and that allelic variation may include nucleotide changes in the promoter region, coding region, or terminator region.
The partial sequence of a second P. methanolica glyceraldehyde-3-30 phosphate dehydrogenase gene, designated GAPl, is shown in SEQ >D N0:2.
Within SEQ ID NO:I, the GAPDH open reading frame begins with the methionine codon (ATG) at nucleotides 1093 - 1095. The transcription promoter is located upstream of the ATG. Gene expression experiments showed that a functional promoter was contained within the ca. 1000 nucleotide 5'-flanking region of the GAP2 3 5 gene.
Preferred portions of the sequence shown in SEQ m NO:1 for use within the present invention as transcription promoters include segments comprising at least 900 contiguous nucleotides of the 5' non-coding region of SEQ >D NO:1, and preferably comprising nucleotide 93 to nucleotide 1080 of the sequence shown in SEQ
>D NO:1. Those skilled in the art will recognize that longer portions of the 5' non-coding region of the P. methanolica GAP2 gene can also be used. Promoter sequences of the present invention can thus include the sequence of SEQ ID NO:1 through nucleotide 1092 in the 3' direction and can extend to or beyond nucleotide 1 in the 5' direction. In general, the promoter used within an expression DNA construct will not exceed 1.5 kb in length, and will preferably not exceed 1.0 kb in length. In addition to these promoter fragments, the invention also provides isolated DNA molecules of up to l0 about 3300 bp, as well as isolated DNA molecules of up to 5000 bp, wherein said molecules comprise the P. methanolica GAP2 promoter sequence.
As disclosed in more detail in the examples that follow, the sequence of SEQ >D NO:1 from nucleotide 93 to nucleotide 1080 provides a functional transcription promoter. However, additional nucleotides can be removed from either or both ends of this sequence and the resulting sequence tested for promoter function by joining it to a sequence encoding a protein, preferably a protein for which a convenient assay is readily available.
Within the present invention it is preferred that the GAP2 promoter be substantially free of GAP2 gene coding sequence, which begins with nucleotide 1093 in 2 0 SEQ >D NO:1. As used herein, "substantially free" of GAP2 gene coding sequence means that the promoter DNA includes not more than 15 nucleotides of the GAP2 coding sequence, preferably not more than 10 nucleotides, and more preferably not more than 3 nucleotides. Within a preferred embodiment of the invention, the promoter is provided free of coding sequence of the P. methanolica GAP2 gene.
2 5 However, those skilled in the art will recognize that a GAP2 gene fragment that includes the initiation ATG (nucleotides 1093 to 1095) of SEQ >D NO:1 can be operably linked to a heterologous coding sequence that lacks an ATG, with the ATG providing for intition of translation of the heterologous sequence. Those skilled in the art will further recognize that additional GAP2 coding sequences can also be 3 0 included, whereby a fusion protein comprising GAP2 and heterologous amino acid sequences is produced. Such a fusion protein may comprise a cleavage site to facilitate separation of the GAP2 and heterologous sequences subsequent to translation.
In addition to the GAP2 promoter sequence, the present invention also provides transcription terminator sequences derived from the 3' non-coding region of 3 5 the P. methanolica GAP2 gene. A consensus transcription termination sequence (Chen and Moore, Mol. Cell. Biol. 12:3470-3481, 1992) is at nucleotides 2136 to 2145 of SEQ
m NO:1. Within the present invention, there are thus provided transcription terminator gene segments of at least about 50 bp, preferably at least 60 bp, more preferably at least 90 bp, still more preferably about 200 by in length. The terminator segments of the present invention may comprise 500-1000 nucleotides of the 3' non-coding region of SEQ >D NO:1. These segments comprise the termination sequence disclosed above, and preferably have as their 5' termini nucleotide 2095 of SEQ >D NO:l. Those skilled in the art will recognize, however, that the transcription terminator segment that is provided in an expression vector can include at its 5' terminus the TAA
translation termination codon at nucleotides 2092-2094 of SEQ 1D NO: l to permit the insertion of coding sequences that lack a termination codon.
1 o Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into a variety of host cells are well known in the art and are disclosed by, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Murray, ed., Gene Transfer and Expression Protocols, Humana Press, Clifton, NJ, 1991; Glick and Pasternak, Molecular Biotechnology: Principles and Applications of Recombinant DNA, ASM Press, Washington, D.C., 1994; Ausubel et al. (eds.), Short Protocols in Molecular Biolo~y, 3rd edition, John Wiley and Sons, Inc., NY, 1995; Wu et al., Methods in Gene Biotechnology, CRC Press, New York, 1997. DNA vectors, including expression vectors, commonly contain a selectable marker and origin of 2 0 replication that function in a bacterial host (e.g., E. coli) to permit the replication and amplification of the vector in a prokaryotic host. If desired, these prokaryotic elements can be removed from a vector before it is introduced into an alternative host.
For example, such prokaryotic sequences can be removed by linearization of the vector prior to its introduction into a P. methanolica host cell.
2 5 Within certain embodiments of the invention, expression vectors are provided that comprise a first DNA segment comprising at least a portion of the sequence of SEQ >D NO:1 that is a functional transcription promoter operably linked to a second DNA segment encoding a protein of interest. When it is desired to secrete the protein of interest, the vector will further comprise a secretory signal sequence operably 3 0 linked to the first and second DNA segments. The secretory signal sequence may be that of the protein of interest, or may be derived from another secreted protein, preferably a secreted yeast protein. A preferred such yeast secretory signal sequence is the S. cerevisiae alpha-factor (MFal) pre-pro sequence (disclosed by Kurjan et al., U.S.
Patent No. 4,546,082 and Brake, U.S. Patent No. 4,870,008).
3 5 Within other embodiments of the invention, expression vectors are provided that comprise a DNA segment comprising a portion of SEQ ID NO:1 that is a functional transcription terminator operably linked to an additional DNA
segment encoding a protein of interest. Within one embodiment, the GAP2 promoter and terminator sequences of the present invention are used in combination, wherein both are operably linked to a DNA segment encoding a protein of interest within an expression vector.
Expression vectors of the present invention further comprise a selectable marker to permit identification and selection of P. methanolica cells containing the vector. Selectable markers provide for a growth advantage of cells containing them.
The general principles of selection are well known in the art. The selectable marker is preferably a P. methanolica gene. Commonly used selectable markers are genes that encode enzymes required for the synthesis of amino acids or nucleotides. Cells having mutations in these genes cannot grow in media lacking the specific amino acid or nucleotide unless the mutation is complemented by the selectable marker. Use of such "selective" culture media ensures the stable maintenance of the heterologous DNA
within the host cell. A preferred selectable marker of this type for use in P.
methanolica is a P. methanolica ADE2 gene, which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21). See, Raymond, U.S. Patent No.
5,736,383. The ADE2 gene, when transformed into an ade2 host cell, allows the cell to grow in the absence of adenine. The coding strand of a representative P.
methanolica ADE2 gene sequence is shown in SEQ m N0:3. The sequence illustrated includes 2 0 1006 nucleotides of 5' non-coding sequence and 442 nucleotides of 3' non-coding sequence, with the initiation ATG codon at nucleotides 1007-1009. Within a preferred embodiment of the invention, a DNA segment comprising nucleotides 407-2851 is used as a selectable marker, although longer or shorter segments could be used as long as the coding portion is operably linked to promoter and terminator sequences. In the 2 5 alternative, a dominant selectable marker, which provides a growth advantage to wild type cells, may be used. Typical dominant selectable markers are genes that provide resistance to antibiotics, such as neomycin-type antibiotics (e.g., G418), hygromycin B, and bleomycin/phleomycin-type antibiotics (e.g., ZeocinTM; available from Invitrogen Corporation, San Diego, CA). A preferred dominant selectable marker for use in P.
3 o methanolica is the Sh bla gene, which inhibits the activity of ZeocinTM.
The use of P. methanolica cells as a host for the production of recombinant proteins is disclosed in WIPO Publications WO 97/17450, WO
97/17451, WO 98/02536, and WO 98/02565; and U.S. Patents Nos. 5,716,808, 5,736,383, 5,854,039, and 5,736,383. Expression vectors for use in transforming P.
methanolica 3 5 will commonly be prepared as double-stranded, circular plasmids, which are preferably linearized prior to transformation. To facilitate integration of the expression vector DNA into the host chromosome, it is preferred to have the entire expression segment of the plasmid flanked at both ends by host DNA sequences (e.g., AUGI 3' sequences).
Electroporation is used to facilitate the introduction of a plasmid containing DNA
encoding a polypeptide of interest into P. methanolica cells. It is preferred to transform P. methanolica cells by electroporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (~) of from 1 to 40 milliseconds, most preferably about 20 milliseconds.
Integrative transformants are preferred for use in protein production processes. Such cells can be propagated without continuous selective pressure because 1 o DNA is rarely lost from the genome. Integration of DNA into the host chromosome can be confirmed by Southern blot analysis. Briefly, transformed and untransformed host DNA is digested with restriction endonucleases, separated by electrophoresis, blotted to a support membrane, and probed with appropriate host DNA segments. Differences in the patterns of fragments seen in untransformed and transformed cells are indicative of integrative transformation. Restriction enzymes and probes can be selected to identify transforming DNA segments (e.g., promoter, terminator, heterologous DNA, and selectable marker sequences) from among the genomic fragments.
Differences in expression levels of heterologous proteins can result from such factors as the site of integration and copy number of the expression cassette among 2 0 individual isolates. It is therefore advantageous to screen a number of isolates for expression level prior to selecting a production strain. Isolates exhibiting a high expression level will commonly contain multiple integrated copies of the desired expression cassette. A variety of suitable screening methods are available.
For example, transformant colonies are grown on plates that are overlayed with membranes 2 5 (e.g., nitrocellulose) that bind protein. Proteins are released from the cells by secretion or following lysis, and bind to the membrane. Bound protein can then be assayed using known methods, including immunoassays. More accurate analysis of expression levels can be obtained by culturing cells in liquid media and analyzing conditioned media or cell lysates, as appropriate. Methods for concentrating and purifying proteins from 3 0 media and lysates will be determined in part by the protein of interest.
Such methods are readily selected and practiced by the skilled practitioner.
For production of secreted proteins, host cells having functional deficiencies in the vacuolar proteases proteinase A, which is encoded by the gene, and proteinase B, which is encoded by the PRBI gene, are preferred in order to 3 5 minimize spurious proteolysis. Vacuolar protease activity (and therefore vacuolar protease deficiency) is measured using any of several known assays. Preferred assays are those developed for Saccharomyces cerevisiae and disclosed by Jones, Methods WO 01/18182 PCT/iJS00/24110 Ei2zymol. 194:428-453, 1991. A preferred such assay is the APNE overlay assay, which detects activity of carboxypeptidase Y (CpY). See, Wolf and Fink, J. Bact.
123:1150-1156, 1975. Because the zymogen (pro)CpY is activated by proteinase A and proteinase B, the APNE assay is indicative of vacuolar protease activity in general. The 5 APNE overlay assay detects the carboxypeptidase Y-mediated release of (3-naphthol from N-acetyl-phenylalanine-(3-naphthyl-ester (APNE), which results in the formation of an isoluble red dye by the reaction of the (3-naphthol with the diazonium salt Fast Garnet GBC. Cells growing on assay plates (YEPD plates are preferred) at room temperature are overlayed with 8 ml RxM. RxM is prepared by combining 0.175 g 10 agar, 17.5 ml HBO, and 5 ml 1 M Tris-HCl pH 7.4, microwaving the mixture to dissolve the agar, cooling to ~55°C, adding 2.5 ml freshly made APNE (2 mg/ml in dimethylformamide) (Sigma Chemical Co., St. Louis, MO), and, immediately before assay, 20 mg Fast Garnet GBC salt (Sigma Chemical Co.). The overlay is allowed to solidify, and color development is observed. Wild-type colonies are red, whereas CPY
deletion strains are white. Carboxypeptidase Y activity can also be detected by the well test, in which cells are distributed into wells of a microtiter test plate and incubated in the presence of N benzoyl-L-tyrosine p-nitroanilide (BTPNA) and dimethylformamide.
The cells are permeabilized by the dimethylformamide, and CpY in the cells cleaves the amide bond in the BTPNA to give the yellow product p-nitroaniline. Assays for CpY
2 0 will detect any mutation that reduces protease activity so long as that activity ultimately results in the reduction of CpY activity.
P. methanolica cells are cultured in a medium comprising adequate sources of carbon, nitrogen and trace nutrients at a temperature of about 25°C to 35°C.
Liquid cultures are provided with sufficient aeration by conventional means, such as 2 5 shaking of small flasks or sparging of fermentors. A preferred culture medium for P.
methanolica is YEPD (2% D-glucose, 2% BactoTM Peptone (Difco Laboratories, Detroit, MI), 1 % BactoTM yeast extract (Difco Laboratories), 0.004% adenine, 0.006%
L-leucine).
For large-scale culture, one to two colonies of a P. methanolica strain 3 0 can be picked from a fresh agar plate (e.g, YEPD agar) and suspended in 250 ml of YEPD broth contained in a two-liter baffled shake flask. The culture is grown for 16 to 24 hours at 30°C and 250 rpm shaking speed. Approximately 50 to 80 milliliters of inoculum are used per liter starting fermentor volume (5 - 8% v/v inoculum).
A preferred fermentation medium is a soluble medium comprising 3 5 glucose as a carbon source, inorganic ammonia, potassium, phosphate, iron, and citric acid. As used herein, a "soluble medium" is a medium that does not contain visible precipitation. Preferably, the medium lacks phosphate glass (sodium hexametaphosphate). A preferred medium is prepared in deionized water and does not contain calcium sulfate. As a minimal medium, it is preferred that the medium lacks polypeptides or peptides, such as yeast extracts. However, acid hydrolyzed casein (e.g., casamino acids or amicase) can be added to the medium if desired. An illustrative fermentation medium is prepared by mixing the following compounds: (NH4)~S04 (11.5 grams/liter), KZHP04 (2.60 grams/liter), KH~P04 (9.50 grams/liter), FeS04~7H20 (0.40 grams/liter), and citric acid ( 1.00 gram/liter). After adding distilled, deionized water to one liter, the solution is sterilized by autoclaving, allowed to cool, and then supplemented with the following: 60% (w/v) glucose solution (47.5 milliliters/liter), lOx trace metals solution (20.0 milliliters/liter), 1 M MgS04 (20.0 milliliters/liter), and vitamin stock solution (2.00 milliliters/liter). The lOx trace metals solution contains FeS04~7H~0 (100 mM), CuS04~5H20 (2 mM), ZnS04~7H20 (8 mM), MnS04~H~0 (8 mM), CoC12~6H20 (2 mM), Na~Mo04~2H~0 (1 mM), H~B03 (8 mM), KI (0.5 mM), NiS04~6H20 (1 mM), thiamine (0.50 grams/liter), and biotin (5.00 milligrams/liter).
The vitamin stock solution contains inositol (47.00 grams/liter), pantothenic acid (23.00 grams/liter), pyrodoxine ( 1.20 grams/liter), thiamine (5.00 grams/liter), and biotin (0.10 gram/liter). Those of skill in the art can vary these particular ingredients and amounts.
For example, ammonium sulfate can be substituted with ammonium chloride, or the amount of ammonium sulfate can be varied, for example, from about 11 to about 2 0 grams/liter.
After addition of trace metals and vitamins, the pH of the medium is typically adjusted to pH 4.5 by addition of 10% H3P04. Generally, about 10 milliliters/liter are added, and no additional acid addition will be required.
During fermentation, the pH is maintained between about 3.5 to about 5.5, or about 4.0 to 2 5 about 5.0, depending on protein produced, by addition of 5 N NH40H.
An illustrative fermentor is a BIOFLO 3000 fermentor system (New Brunswick Scientific Company, Inc.; Edison, NJ). This fermentor system can handle either a six-liter or a fourteen-liter fermentor vessel. Fermentations performed with the six-liter vessel are prepared with three liters of medium, whereas fermentations 3 0 performed with the fourteen-liter vessel are prepared with six liters of medium. The fermentor vessel operating temperature is typically set to 30°C for the course of the fermentation, although the temperature can range between 27-31 °C
depending on the protein expressed. The fermentation is initiated in a batch mode. The glucose initially present is often used by approximately 10 hours elapsed fermentation time (EFT), at 3 5 which time a glucose feed can be initiated to increase the cell mass. An illustrative glucose feed contains 900 milliliters of 60% (w/v) glucose, 60 milliliters of 50% (w/v) (NH4)~S04, 60 milliliters of lOx trace metals solution, and 30 milliliters of 1 M MgS04.

Pichia methanolica fermentation is robust and requires high agitation, aeration, and oxygen sparging to maintain the percentage dissolved oxygen saturation above 30%.
The percentage dissolved oxygen should not drop below 15% for optimal expression and growth. The biomass typically reaches about 30 to about 80 grams dry cell weight per liter at 48 hours EFT.
Proteins produced according to the present invention are recovered from the host cells using conventional methods. If the protein is produced intracellulary, the cells are harvested (e.g., by centrifugation) and lysed to release the cytoplasmic contents. Methods of lysis include enzymatic and mechanical disruption. The crude l0 extract is then fractionated according to known methods, the specifics of which will be determined for the particular protein of interest. Secreted proteins are recovered from the conditioned culture medium using standard methods, also selected for the particular protein. See, in general, Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York, 1994.
The materials and methods of the present invention can be used to produce proteins of research, industrial, or pharmaceutical interest. Such proteins include enzymes, such as lipases, cellulases, and proteases; enzyme inhibitors, including protease inhibitors; growth factors such as platelet derived growth factor (PDGF), fibroblast growth factors (FGF), epidermal growth factor (EGF), vascular 2 0 endothelial growth factors (VEGFs); glutamic acid decarboxylase (GAD);
cytokines, such as erythropoietin, thrombopoietin, colony stimulating factors, interleukins, and interleukin antagonist; hormones, such as insulin, proinsulin, leptin, and glucagon; and receptors, including growth factor receptors, which can be expressed in truncated form ("soluble receptors") or as fusion proteins with, for example, immunoglobulin constant 2 5 region sequences. DNAs encoding these and other proteins are known in the art. See, for example, U.S. Patents Nos. 4,889,919; 5,219,759; 4,868,119; 4,968,607;
4,599,311;
4,784,950; 5,792,850; 5,827,734; 4,703,008; 4,431,740; and 4,762,791; and WIPO
Publications WO 95/21920 and WO 96/22308.
It is particularly preferred to use the present invention to produce 3 0 unglycosylated pharmaceutical proteins. Yeast cells, including P.
methanolica cells, produce glycoproteins with carbohydrate chains that differ from their mammalian counterparts. Mammalian glycoproteins produced in yeast cells may therefore be regarded as "foreign" when introduced into a mammal, and may exhibit, for example, different pharmacokinetics than their naturally glycosylated counterparts.
3 5 The invention is further illustrated by the following, non-limiting examples.

EXAMPLES
Example 1 To clone the P. methanolica GAPl gene, sense (ZC11,356; SEQ ID
N0:4) and antisense (ZC11,357; SEQ ID NO:S) PCR primers were designed from an alignment of the coding regions of GAPDH genes of Saccharomyces cerevisiae, Kluyveromyces lactis, and mouse. The primers were then used to amplify P.
methanolica genomic DNA. An amplified sequence 608 by long was recovered and was found to have 78.1 °7o homology to the corresponding S. cerevisiae GAPDH gene sequence.
A P. methanolica genomic library was constructed in the vector pRS426 (Christianson et al., Gene 110:119-122, 1992), a shuttle vector comprising 2~
and S.
cerevisiae URA3 sequences, allowing it to be propagated in S. cerevisiae.
Genomic DNA was prepared from strain CBS6515 according to standard procedures.
Briefly, cells were cultured overnight in rich media, spheroplasted with zymolyase, and lysed with SDS. DNA was precipitated from the lysate with ethanol and extracted with a phenol/chloroform mixture, then precipitated with ammonium acetate and ethanol. Gel electrophoresis of the DNA preparation showed the presence of intact, high molecular weight DNA and appreciable quantities of RNA. The DNA was partially digested with Sau 3A by incubating the DNA in the presence of a dilution series of the enzyme.
2 0 Samples of the digests were analyzed by electrophoresis to determine the size distribution of fragments. DNA migrating between 4 and 12 kb was cut from the gel and extracted from the gel slice. The size-fractionated DNA was then ligated to pRS426 that had been digested with Bam HI and treated with alkaline phosphatase.
Aliquots of the reaction mixture were electroporated into E. coli MC1061 cells using an 2 5 electroporator (Gene PulserTM; BioRad Laboratories, Hercules, CA) as recommended by the manufacturer.
The library was screened by PCR using sense (ZC11,733; SEQ ID
N0:6) and antisense (ZC11,734; SEQ m N0:7) primers designed from the sequenced region of the P. methanolica GAPDH. The PCR reaction mixture was incubated for 3 0 one minute at 94°C; followed by 34 cycles of 94°C, one minute, 52°C, 45 seconds, 72°C, two minutes; and a termination cycle of 94°C, one minute, 54°C, one minute, 72°C, eleven minutes. Starting with 43 library pools, positive pools were identified and broken down to individual colonies. A single colony with a pRS426 plasmid containing the P. methanolica GAPDH gene as its insert was isolated. The orientation 3 5 of the GAPDH gene and the length of the 5' and 3' flanking sequences in the insert were deduced by DNA sequencing (SEQ ID N0:2). This gene was designated GAPl.

Within SEQ ~ N0:2, the GAPDH open reading frame begins with the methionine codon (ATG) at nucleotides 1733 - 1735. The transcription promoter is located upstream of the ATG. Gene expression experiments showed that a functional promoter was contained within the ca. 900 nucleotide 5'-flanking region of the GAPI
gene. Analysis of this promoter sequence revealed the presence of a number of sequences homologous to Saccharomyces cerevisiae promoter elements. These sequences include a concensus TATAAA box at nucleotides 1584 to 1591, a consensus Raplp binding site (Graham and Chambers, Nuc. Acids Res. 22:124-130, 1994) at nucleotides 1355 to 1367, and potential Gcrlp binding sites (Shore, Trends Genet.
10:408-412, 1994) at nucleotides 1225 to 1229, 1286 to 1290, 1295 to 1299, 1313 to 1317, 1351 to 1354, 1370 to 1374, 1389 to 1393, and 1457 to 1461. A consensus transcription termination sequence (Chen and Moore, Mol. Cell. Biol. 12:3470-3481, 1992) was identified at nucleotides 2774 to 2787 of SEQ ~ N0:2.
A plasmid containing the GAPl gene, designated pGAPDH, has been deposited as an E. coli strain MC 1061 transformant with American Type Culture Collection, Manassas, VA under the terms of the Budapest Treaty. The deposited strain has been assigned the designation PTA-3 and a deposit date of May 4, 1999.
Example 2 2 0 Analysis of the P. methanolica genome by Southern blotting, using a PCR product from the coding region of the cloned GAPI gene as a probe, indicated the presence of three independent GAPDH genes. Primers designed from the cloned sequence were used in various combinations to amplify P. methanolica genomic DNA.
Positive pools were screened by PCR, and positives were re-amplified. PCR
products 2 5 were sequenced. Eight pools were found to be the same and corresponded to the previously cloned GAPI gene. Two pools were distinct from the previously cloned gene and were identical to each other. Each of these two pools was plated and amplified by PCR through several rounds of sub-dividing. Sub-pools were streaked, and single colonies were picked for a final round of PCR screening. Positive clones 3 0 were analyzed by PCR and restriction digestion. Each clone was found to be carried on a ~5 kb genomic segment. This gene, which was designated GAP2, was partially sequenced. The sequenced region included an open reading frame of 1002 base pairs (including the termination codon), a 5' non-coding region of 1092 base pairs, and a 3' non-coding region of 1239 base pairs (SEQ m NO:1).

Example 3 A fragment of GAP2 DNA (SEQ ID NO:1 ) was isolated by PCR using two primers. Primer ZC19,334 (SEQ ~ N0:8) contained 26 by of vector flanking sequence and 25 by corresponding to the 5' end of the first 1000 by of the 5 promoter. Primer ZC 19,333 (SEQ ID N0:9) contained 35 by of the 3' end corresponding to S. cerevisiae alpha factor pre-pro sequence and 29 by corresponding to the 3' end of the GAP2 promoter. The latter primer altered the 5' flanking sequence at nucleotides 1081-1092 to GAATTCAAAAGA (SEQ ID NO:10), resulting in the introduction of an EcoRI site. The PCR reaction conditions (five tubes in all) were: 20 10 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; followed by a 4°C soak. The five samples were combined into one tube and precipitated with 2 volumes of 100% ethanol. The resulting pellet was resuspended in 10 ~1 of water. The sample was serially diluted into TE (10 mM Tris, 2mM EDTA) as 1:5, 1:25, and 1:125 dilutions. DNA concentration was estimated by running the PCR product on a 1 %

15 agarose gel. The expected approximately 1 kb fragment was seen. The remaining 8 ~l of product was used for recombination as described below.
An expression plasmid named pTAP96, containing the P. methanolica GAP2 promoter, S. cerevisiae alpha factor pre-pro sequence, and a cDNA
encoding leptin with an amino-terminal Glu-Glu affinity tag (Grussenmeyer et al., Proc.
Natl.
2 0 Acad. Sci. USA 82:7952-4, 1985), was constructed via homologous recombination using portions of the plasmids pTAP37 and pCZR189. Plasmid pTAP37 comprises a modified P. methanolica GAPI promoter, the P. methanolica ADE2 selectable marker, the gene for ampicillin resistance in E. coli, the S. cerevisiae URA3 selectable marker, and the CEN-ARS of S. cerevisiae. pCZR189 comprises the S. cerevisiae alpha factor 2 5 pre-pro sequence and the leptin coding sequence. One hundred microliters of competent yeast cells (S. cerevisiae) were combined with 7 ~1 of a mixture containing approximately 1 ~g of NotI-cut pCZR189, 1 ~g PCR product containing the GAP2 promoter as described above, and 100 ng of EcoRI-cut pTAP37 vector, and the mixture was transferred to a 0.2 cm electroporation cuvette. The yeast/DNA mixture was 3 0 electropulsed at 0.75 kV (5 kV/cm), infinite ohms, 25 ~.F. To each cuvette was added 600 ~ul of 1.2 M sorbitol, and the yeast was then plated in two 300-~l aliquots onto two -URA D plates and incubated at 30°C.
After about 48 hours, the Ura+ yeast transformants from a single plate were resuspended in 1 ml H20 and spun briefly to pellet the yeast cells. The cell pellet 3 5 was resuspended in 1 ml of lysis buffer (2% t-octylphenoxypolyethoxyethanol (Triton~
X-100), 1% SDS, 100.mM NaCI, 10 mM Tris, pH 8.0, 1 mM EDTA). Five hundred microliters of the lysis mixture was added to a microcentrifuge tube containing 300 ~1 acid-washed glass beads and 200 q1 phenol-chloroform, vortexed for 1 minute intervals two or three times, followed by a 5 minute spin in a microcentrifuge at maximum speed. Three hundred microliters of the aqueous phase was transferred to a fresh tube, and the DNA was precipitated with 600 ~ul ethanol, followed by centrifugation for 10 minutes at 4°C. The DNA pellet was resuspended in 100 ~,1 HBO.
Forty ~1 of electrocompetent E. coli cells (MC1061; Casadaban et al., J.
Mol. Biol. 138, 179-207, 1980) were transformed by electroporation with 1 ~,1 of the yeast DNA preparation at 2.0 kV, 25 ~F, and 400 ohms. Following electroporation, 0.6 ml SOC (2% BactoTM Tryptone (Difco Laboratories), 0.5% yeast extract (Difco 1 o Laboratories), 10 mM NaCI, 2.5 mM KCI, 10 mM MgCI~, 10 mM MgS04, 20 mM
glucose) was plated in one aliquot on LB + Amp plates (LB broth, 1.8% BactoTM
Agar (Difco Laboratories), 100 mg/L Ampicillin).
Cells harboring the correct expression construct for the GAP2 promoter driving synthesis of the alpha factor pre-pro/leptin fusion were screened via PCR using the same primers used to generate the GAP2 promoter. The PCR conditions were:

cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; followed by a 4°C soak. Two positive clones were identified on a 1 % agarose gel and were subjected to sequence analysis. One of the correct clones was selected and designated pTAP96.
2 0 Plasmid pTAP96 DNA was prepared by anion exchange chromatography using a commercially available plasmid isolation kit (QIAGEN~
Plasmid Maxi Kit; Qiagen, Inc., Valencia, CA). DNA was diagnostically cut with ScaI, producing the expected bands of approximately 1700 bp, 2250 by doublet, and 6000 by on a 1 % gel. 1 ~.g of pTAP96 DNA was then cut with NotI and transformed into electrocompetent P. methanolica strain PMAD16 (disclosed in Example 4, below) as disclosed in U.S. Patent No. 5,854,039. Transformants were selected on -ADE DS
plates (Table 1 ).

Tahla 1 -ADE DS
0.056% -Ade -Trp -Thr powder 0.67% yeast nitrogen base without amino acids 2% D-glucose 0.5% 200X tryptophan, threonine solution 18.22% D-sorbitol -Ade -Trp -Thr powder powder made by combining 3.0 g arginine, 5.0 g aspartic acid, 2.0 g histidine, 6.0 g isoleucine, 8.0 g leucine, 4.0 g lysine, 2.0 g methionine, 6.0 g phenylalanine, 5.0 g serine, 5.0 g tyrosine, 4.0 g uracil, and 6.0 g valine (all L-amino acids) 200X tryptophan, threonine solution 3.0% L-threonine, 0.8% L-tryptophan in HBO
For plates, add 1.8% BactoTM agar (Difco Laboratories) White colonies, indicating the presence of the ADE2 gene, were patched onto -ADE plates, and cells were allowed to grow overnight. The cells were then 2 0 replica plated onto YEPD plates and overlaid with a nitrocellulose membrane. The next day the filters were washed gently under deionized HZO, then denatured in Western denaturing buffer (625 mM Tris, 625 mM glycine, pH9.0, 5 mM (3-mercaptoethanol) at 65°C for 10 minutes. Filters were blocked for 30 minutes in TTBS
(160 mM NaCI, 20 mM Tris pH7.4, 0.1% Tween 20) and 5% non-fat dry milk. The 2 5 filters were then exposed to an anti-Glu-Glu tag antibody conjugated to horseradish peroxidase (5 ~,1 of antibody diluted into 10 ml TTBS + 5% non-fat dry milk) at room temperature for 1 hour. Filters were washed twice for 5 minutes in TTBS with no milk and rinsed briefly in water. The filters were screened using commercially available chemiluminescence reagents (ECLTM direct labelling kit; Amersham Corp., Arlington 3 0 Heights, IL) as a 1:1 dilution, and the filters were immediately exposed to film. One clone produced a detectable signal.
Example 4 To generate a P. methanolica strain deficient for vacuolar proteases, the 3 5 PEP4 and PRBI genes were identified and disrupted. PEP4 and PRBl sequences were amplified by PCR in reaction mixtures containing 100 pmol of primer DNA, 1X
buffer as supplied (Boehringer Mannheim, Indianapolis, IN), 250 ~M dNTPs, 1-100 pmol of template DNA, and 1 unit of Taq polymerise in a reaction volume of 100 ~1. The DNA
was amplified over 30 cycles of 94°C, 30 seconds; 50°C, 60 seconds; and 72°C, 60 seconds.
Using an alignment of PEP4 sequences derived from S. cerevisiae (Ammerer et al., Mol. Cell. Biol. 6:2490-2499, 1986; Woolford et al., Mol.
Cell. Biol.
6:2500-2510, 1986) and P. pastoris (Gleeson et al., U.S. Patent No.
5,324,660), several sense and antisense primers corresponding to conserved regions were designed.
One primer set, ZC9118 (SEQ ID NO:11 ) and ZC9464 (SEQ ID N0:12) produced a PCR
product of the expected size from genomic DNA, and this set was used to identify a genomic clone corresponding to the amplified region. DNA sequencing of a portion of this genomic clone (shown in SEQ ID N0:13) revealed an open reading frame encoding a polypeptide (SEQ ID N0:14) with 70% amino acid identity with proteinase A
from S.
cerevisiae.
Primers for the identification of P. methanolica PRB 1 were designed on the basis of alignments between the PRBI genes of S. cerevisiae (Moehle et al., Mol.
Cell. Biol. 7:4390-4399, 1987), P. pastoris (Gleeson et al., U.S. Pat. No.
5,324,660), and Kluyveromyces lactis (Fleer et al., WIPO Publication WO 94/00579). One primer set, ZC9126 (SEQ LD NO:15) and ZC9741 (SEQ ID N0:16) amplified a ca. 400 by fragment from genomic DNA (SEQ ID N0:17). This product was sequenced and found 2 0 to encode a polypeptide (SEQ ID N0:18) with 70% amino acid identity with proteinase B from S. cerevisiae. The PRB primer set was then used to identify a genomic clone encompassing the P. methanolica PRBI gene.
Deletion mutations in the P. methanolica PEP4 and PRBI genes were generated using available restriction enzyme sites. The cloned genes were restriction 2 5 mapped. The pep4a allele was created by deleting a region of approximately 500 by between BamHI and NcoI sites and including nucleotides 1 through 393 the sequence shown in SEQ m N0:13. The prbl4 allele was generated by deleting a region of approximately 1 kbp between NcoI and EcoRV sites and including the sequence shown in SEQ ID N0:17. The cloned PEP4 and PRBI genes were subcloned into pCZR139, 3 0 a phagemid vector (pBluescript~ II KS(+), Stratagene, La Jolla, CA) that carried a 2.4 kb SpeI ADE2 insert, to create the deletions. In the case of PEP4 gene, the unique BamHI site in pCZR139 was eliminated by digestion, fill-in, and relegation.
The vector was then linearized by digestion with EcoRI and HindllI, and a ca. 4 kb EcoRI -HindIll fragment spanning the PEP4 gene was legated to the linearized vector to produce 35 plasmid pCZR142. A ca. 500 by deletion was then produced by digesting pCZR142 with BamHI and NcoI, filling in the ends, and relegating the DNA to produce plasmid pCZR143. The PRBI gene (~5 kb XhoI - BamHI fragment) was subcloned into pCZR139, and an internal EcoRV - NcoI fragment, comprising the sequence shown in SEQ ID N0:17, was deleted to produce plasmid pCZR 153.
Plasmid pCZR143 was linearized with Asp718, which cut at a unique site. The linearized plasmid was introduced into the P. methanolica PMAD11 strain (an ade2 mutant generated as disclosed in U.S. Patent No. 5,736,383).
Transformants were grown on -ADE DS (Table 1 ) to identify Ade+ transformants. Two classes of white, Ade+ transformants were analyzed. One class arose immediately on the primary transformation plate; the second became evident as rapidly growing white papillae on the edges of unstable, pink transformant colonies.
Southern blotting was used to identify transformants that had undergone the desired homologous integration event. 100 q1 of cell paste was scraped from a 24-48 hour YEPD plate and washed in 1 ml water. Washed cells were resuspended in ~1 of spheroplast buffer (1.2 M sorbitol, 10 mM Na citrate pH 7.5, 10 mM EDTA, mM DTT, 1 mg/ml zymolyase 100T) and incubated at 37°C for 10 minutes.
Four hundred ~l of 1 % SDS was added, the cell suspension was mixed at room temperature until clear, 300 ~,1 of 5 M potassium acetate was mixed in, and the mixture was clarified by microcentrifugation for 5 minutes. 750 ~l of the clarified lysate was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), 600 ~,1 was transferred to a fresh tube, 2 volumes of 100% ethanol was added, and the DNA
was 2 0 precipitated by microcentrifugation for 15 minutes at 4°C. The pellet was resuspended in 50 ~.1 of TE (10 mM Tris pH 8.0, 1 mM EDTA) containing 100 ~,g/ml of RNAase A.
Ten ~l of DNA (approximately 100 ng) was digested in 100 q,1 total volume with appropriate enzymes, precipitated with 200 ~1 ethanol, and resuspended in 10 ~1 of DNA loading dye. The DNA was separated in 0.7% agarose gels and transferred to 2 5 nylon membranes (Nytran N+, Amersham Corp., Arlington Heights, IL) in a semi-dry blotting apparatus (BioRad Laboratories, Richmond, CA) as recommended by the manufacturer. Transferred DNA was denatured, neutralized, and cross-linked to the membrane with UV light using a Stratalinker (Stratagene, La Jolla, CA). To identify strains with a tandem integration at PEP4, two probes were used. One was a 1400 by 3 0 EcoRI - HindIll fragment from the 3' end of PEP4. The second was a 2000 by BamHI
- EcoRI fragment from the 5' end of PEP4. Fragments were detected using chemiluminescence reagents (ECLTM direct labelling kit; Amersham Corp., Arlington Heights, IL).
Parent strains harboring a tandem duplication of the wild-type and 3 5 deletion alleles of the gene were grown in YEPD broth overnight to allow for the generation of looped-out, Ade- strains. These cells were then plated at a density of 2000-5000 colonies per plate on adenine-limited YEPD plates, grown for 3 days at 30°C and 3 days at room temperature. The shift to room temperature enhanced pigmentation of rare, pink, Ade- colonies. Loop-out strains were consistently detected at a frequency of approximately one pink, Ade- colony per 10,000 colonies screened.
These strains were screened for retention of the wild-type or mutant genes by Southern 5 blotting or by PCR using primers that spanned the site of the deletion. An ade2-ll pep4d strain was designated PMAD15.
The PRBl gene was then deleted from PMAD15 essentially as described above by transformation with plasmid pCZR153. Blots were probed with PCR-generated probes for internal portions of the PRBI and ADE2 genes. The PRBI
probe 10 was generated by subcloning a 2.6 kb CIaI - SpeI fragment of PRBI into the phagemid vector pBluescript~ II KS(+) to produce pCZR150, and amplifying the desired region by PCR using primers ZC447 (SEQ ID N0:19) and ZC976 (SEQ ID N0:20). The ADE2 probe was generated by amplifying the ADE2 gene in pCZR139 with primers ZC9079 (SEQ ID N0:21 ) and ZC9080 (SEQ ID N0:22). The resulting ade2-ll pep4d 15 prbl d strain was designated PMAD 16.
From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the 2 0 invention. Accordingly, the invention is not limited except as by the appended claims.

SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> PICHIA METHANOLICA GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE 2 PROMOTER AND TERMINATOR
<130> 98-57PC
<160> 22 <170> FastSEQ for Windows Version 3.0 <210>1 <211>3333 <212>DNA

<213>Pichia methanolica <220>
<221> CDS
<222> (1093)...(2094) <400>

cataaaccataatagtataatttgttagacaagttcaaagaatttccaataaaagtgtaa60 ttttcacatgcatttcaacccggagaataaaattttaagaaatccgattggatagtgtag120 aattattgttcatattgtgttataataattgcaattacccaacaaaacttgcattggtta180 gtcatcgtatttcatgctattagctgaaagtagggtaatcgagcggtttgaatggctctg240 taaatctaaactctttatctgaaatgtatattagatccgacatgatgcatttggaggttc300 tgagaggtaccgcattgaatttctgtgtggaattagatgagttgttgtaccagaagaggg360 aaaatgggcaagtggtggcaatagtaaattatgggaagtatggtggatattggcccggcg420 tagtgacatcctcaccttaaaattgccttaggggataatgtgccgggcacgtccagctaa480 ctaatttagtagtcgtctaaaactggggaacatttgttgttcctttgatagttatacgaa540 actgattgaataaaaagtttatattcttcttgatgatccttctgtctaattgatagaata600 ggaatttagatagaaatatggaaatacacaaaatatatgtaataaaatcaaaaggggaac660 aattcaaaggattcagcaatcaaaagggatgagtgattctgggtaataaatgagcaataa720 attagtaataaattagtaacaagttagtaataaattagtaataaattagcaacaaatgaa780 caatagtaaaagctaaaagataaaacaaaaggtaggagataagcagtaaagtccgaaagt840 aatcaggtgactagagtaaggatgagaatgaaggacagattccttacagctacataagta900 gatgagctgttgacggtcagatggtgccttggtccatggtttcatatataaagaccctct960 tcgtctccttttgttcgcttgtttcacactcaactgtttctgattttaccttttttcccc1020 tgcttgattcccccattgaatcagatcaagtgttttcatagaacccacttttatttattt1080 tagttgcaca as atg gcc att aac gtt ggt att aac ggt ttc ggg aga atc 1131 Met Ala Ile Asn Val Gly Ile Asn Gly Phe Gly Arg Ile ggc aga tta gtc ttg aga gtt gcc tta tcg aga aaa gac atc aac gtc 1179 Gly Arg Leu Val Leu Arg Val Ala Leu Ser Arg Lys Asp Ile Asn Val gtt get gtc aac gat cct ttc att get cct gat tac get get tac atg 1227 Val Ala Ual Asn Asp Pro Phe Ile Ala Pro Asp Tyr Ala Ala Tyr Met ttc aag tac gat tcc act cac ggt aag tac act ggt gaa gtt tca agt 1275 Phe Lys Tyr Asp Ser Thr His Gly Lys Tyr Thr Gly Glu Ual Ser Ser gat ggt aaa tac tta atc att gat ggt aag aag att gaa gtt ttc caa 1323 Asp Gly Lys Tyr Leu Ile Ile Asp Gly Lys Lys Ile Glu Val Phe Gln gaa aga gat cca gcc aac atc cca tgg ggg aaa gaa ggt gtt cag tac 1371 Glu Arg Asp Pro Ala Asn Ile Pro Trp Gly Lys Glu Gly Val Gln Tyr gtt att gaa tcc act ggc gtt ttc acc acc ttg get ggt get caa aag 1419 Val Ile Glu Ser Thr Gly Val Phe Thr Thr Leu Ala Gly Ala Gln Lys cac att gat get ggt gcg gaa aag gtt atc atc act get cca tct tct 1467 His Ile Asp Ala Gly Ala Glu Lys Val Ile Ile Thr Ala Pro Ser Ser gat get cca atg ttt gtt gtt ggt gtt aac gaa aag gaa tac act cct 1515 Asp Ala Pro Met Phe Val Val Gly Val Asn Glu Lys Glu Tyr Thr Pro gac ttg aag att gtt tca aat gcc tca tgt acc acc aac tgc gtg get 1563 Asp Leu Lys Ile Val Ser Asn Ala Ser Cys Thr Thr Asn Cys Val Ala aca tta get aaa gtt gtt gac gat aac ttt gga att gaa tct ggg tta 1611 Thr Leu Ala Lys Ual Val Asp Asp Asn Phe Gly Ile Glu Ser Gly Leu atg acc get gtt cac gcc att act get tcc caa aag atc gtc gat ggt 1659 Met Thr Ala Ual His Ala Ile Thr Ala Ser Gln Lys Ile Ual Asp Gly ccc tcc cac aag gac tgg aga ggt ggt aga acc get tcc ggc aac att 1707 Pro Ser His Lys Asp Trp Arg Gly Gly Arg Thr Ala Ser Gly Asn Ile atc cca tca tca act ggt get get aag get gtt ggt aag gtt ttg cca 1755 Ile Pro Ser Ser Thr Gly Ala Ala Lys Ala Ual Gly Lys Ual Leu Pro get tta get ggc aag cta acc ggt atg tct ata agg gtt cct act act 1803 Ala Leu Ala Gly Lys Leu Thr Gly Met Ser Ile Arg Ual Pro Thr Thr gat gtt tcc gtt get gat tta acc gtt aac tta aag act get acc acc 1851 Asp Ual Ser Val Ala Asp Leu Thr Ual Asn Leu Lys Thr Ala Thr Thr tac cag gaa att tgc get get ata aag aag get tct gaa ggt gaa tta 1899 Tyr Gln Glu Ile Cys Ala Ala Ile Lys Lys Ala Ser Glu Gly Glu Leu aag ggt att tta ggt tac act gaa gat gcc gtt gtt tca acc gac ttc 1947 Lys Gly Ile Leu Gly Tyr Thr Glu Asp Ala Ual Ual Ser Thr Asp Phe tta acc gat agc aga tcg tct atc ttc gat gcc aaa get ggt atc tta 1995 Leu Thr Asp Ser Arg Ser Ser Ile Phe Asp Ala Lys Ala Gly Ile Leu tta acc cca acc ttc gtt aag cta atc tct tgg tac gat aac gaa tac 2043 Leu Thr Pro Thr Phe Ual Lys Leu Ile Ser Trp Tyr Asp Asn Glu Tyr ggt tat tcc acc aga gtt gtt gac tta cta caa cat gtt get tcc gcc 2091 Gly Tyr Ser Thr Arg Ual Ual Asp Leu Leu Gln His Ual Ala Ser Ala taa atcttccaac ctaaattgcg aaatataagc aagcaaaaat tatatgtata 2144 tttgtcttccattgcataagtctatctttcctgagaaataacaaaaatatgttcttttcg2204 agacacttaagttttatttttgcccttagtacaaggcatccatttgcagttgctgcttac2264 agccctgaaggctattgcatcagcccaattggaaacaagtatagcatactgatttgaggg2324 tttaattatctgtaatattcaagtacttatatgcgtagaacctccaaatagcaacacgaa2384 aatccatcatccaacaatcaaagatgtggagcaggccaagcaagatgatattttctcggt2444 ggtggcggtttcaatttctggggtgcgttattgtgtggcttgtaccttgcagggtaaacc2504 ttcgccagcagttccagtggtctcttcgacgaacaacaggctgaaattcggctgtttcag2564 catggcttgtttttcctccatgggactagcgtagatttatccccccagaaagtttctctt2624 cttgaatatctctggtaccgaccactaactagattatagattactgcgacatgttaaagc2684 attgtcggggtctttaagcatgctcaaccaacaggttgcctgaagagctgcgtactaacc2744 tggaacagggttcacagaaagagggcaacccagaaaaaacactatttgttaacccttata2804 gtgaagagtgggggtacaaaatctttgacccgtactccactacgacagttttgataaaca2864 cttgcagattacctaatttggtatgtacaatttctaggcatgggataagtatagctttta2924 atccggaaggttcggataaatactgtgctgtgtgccaggcaaatgcgtcccactggagaa2984 aaaggtaaagccgactaaccgaagacccacctacaataaatttaccgagccaccgaaaaa3044 ctcacgttactcaatatatgagtaatgtactactataactatgtgtggaatagaattgta3104 ttgtatagtagctcagctttcttcctggtatacggtcgactttagcctaaacacttgttg3164 gttcagtgaatacagcctgattagactaaaaggtagaaggactataaaggtgtacatacg3224 gaaatcctactccccacttaaatagacaaaacccctctaagtgttgtttcgacgtaaagc3284 tttgtttactgacaagccttggcaccgatcccccgggctgcaggaattc 3333 <210>2 <211>4409 <212>DNA

<213>Pichia methanolica <220>
<221> CDS
<222> (1733)...(2734) <400>

cccgggggatcttattttctgcaagaacttaaccgagggacatgtcaaaccaagcatact 60 gtaaaagaaatagccgatggtttatatatatatatacttgcgttagtagaaacagtttat 120 gcatgcatggatgcaagaactcagatatcaggttatcaagaaacatggagaaattcctaa 180 acagaaacggaattaatccgaaattctcggtctcccaaagaaaatagatgcacaagctaa 240 tacagcttgctaactagcttcaactttcaaaaaaaattctaagctattgaatattcatca 300 agataatagtctatataaagatgtaaagtcattattattgggatatataaacgtcctata 360 tattgctgaaatgttaggtgtatgtactgaaaacaatcagtttgagtttaccagagagag 420 acgatggatctacagatcaatagagagagaataagatgagaataagatgattaatagtga 480 gaggtagtagccactggcgggaggatgaaaatatcccggataaacttagaaagaaattaa 540 ttacacgtataggtaacatttgttattgtcgaatctcagatcagttgatgcctggaacag 600 atcgacttatagatattatcagatcataatcatgaggcgaggtgcgactagtaccaggtg660 atgatatattgtttccggttatttcaaatagttgacgtcgttgtgtgattgggaaggcgt720 cggagtaacagaaacagtaacggtacaagcatcattatgagttgagggtatgtagggaag780 cagttgtttgtaagcatgtttacaaatgcaatgcatgttacgattggactacaattaaat840 ccgaatgtacctatataacgtgttgtacgtgttgtgccgtaagtagcccgatactagatg900 cttactacgtcactgatctgttcggatctcagtccattcatgtgtcaaaatagttagtag960 ctaagggggatacagggaagatgtttggtacgattatcggagggatgtgtcttctgaggg1020 gggaggagagagggcgtgtaaggagtttgtttgtttgtttgtttgttgagagaagggggg1080 gagaagagggggtggtgggctgatggcaattgatatagagggagagtgtgcgttaactgt1140 ttagtgtggtggcggtacggggtacactgtagagggggacattataatggttatgtgtat1200 atgctgtatatatgaatacaagtagggagtgactacacattgcaattgataatatgtgta1260 tgtgtgcgcatcagtatatacactcggaggttctgaaagccatcattgtattggacgttt1320 gaatggtattagatgacttgttgtactagaggacggagaatgggtgagtggaagcaatag1380 ataataatggaaagtttgctcggtggtggacattggcccggagtagtgataccgtcacct1440 taaaattgcagttaggggatgatgctccggggcacgacctgccaactaatttaatagtcg1500 tctaacgctggaacaggtgttgttccacaagtagatgagtttgttggttggctggtcaaa1560 tgctgccttgatccatcgttttatatataaagactcacttctcctcctcttgttcaattg1620 tttcacactcaactgcttctcccttatcttttttttttccctgttttattccccattgaa1680 ctagatcacatcttttcatattacacacttttatttattataattacacaas atg 1738 get Met Ala att aac gtt ggt att aac ggt ttc ggt aga atc ggt aga tta gtc ttg 1786 Ile Asn Ual Gly Ile Asn Gly Phe Gly Arg Ile Gly Arg Leu Val Leu aga gtt get tta tca aga aag gac atc aac att gtt get gtc aat gat 1834 Arg Ual Ala Leu Ser Arg Lys Asp Ile Asn Ile Ual Ala Ual Asn Asp cct ttc att get get gaa tac get get tac atg ttc aag tac gat tcc 1882 Pro Phe Ile Ala Ala Glu Tyr Ala Ala Tyr Met Phe Lys Tyr Asp Ser act cac ggt aag tac gcc ggc gaa gtt tcc agt gac ggt aaa tac tta 1930 Thr His Gly Lys Tyr Ala Gly Glu Ual Ser Ser Asp Gly Lys Tyr Leu atc att gat ggt aag aag att gaa gtt ttc caa gaa aga gac cca gtt 1978 Ile Ile Asp Gly Lys Lys Ile Glu Ual Phe Gln Glu Arg Asp Pro Ual aac atc cca tgg ggt aaa gaa ggt gtc caa tac gtt att gac tcc act 2026 Asn Ile Pro Trp Gly Lys Glu Gly Val Gln Tyr Val Ile Asp Ser Thr ggt gtt ttc act acc ttg get ggt get caa aag cac att gat gcc ggt 2074 Gly Val Phe Thr Thr Leu Ala Gly Ala Gln Lys His Ile Asp Ala Gly get gaa aag gtt atc atc act get cca tct get gat get cca atg ttc 2122 Ala Glu Lys Val Ile Ile Thr Ala Pro Ser Ala Asp Ala Pro Met Phe gtt gtt ggt gtt aac gaa aag gaa tac act tct gac ttg aag att gtt 2170 Val Val Gly Val Asn Glu Lys Glu Tyr Thr Ser Asp Leu Lys Ile Val tct aac get tca tgt acc acc aac tgt ttg get cca tta get aag gtt 2218 Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Leu Ala Lys Val gtt aac gac aac ttt ggt att gaa tca ggt tta atg acc act gtc cac 2266 Val Asn Asp Asn Phe Gly Ile Glu Ser Gly Leu Met Thr Thr Val His tcc att acc get acc caa aag acc gtc gat ggt cca tca cac aag gac 2314 Ser Ile Thr Ala Thr Gln Lys Thr Val Asp Gly Pro Ser His Lys Asp tgg aga ggt ggt aga act get tcc ggt aac att atc cca tca tct act 2362 Trp Arg Gly Gly Arg Thr Ala Ser Gly Asn Ile Ile Pro Ser Ser Thr ggt get get aag get gtt ggt aag gtt tta cct gtc tta get ggt aag 2410 Gly Ala Ala Lys Ala Val Gly Lys Val Leu Pro Ual Leu Ala Gly Lys tta acc ggt atg tct tta aga gtt cct act acc gat gtt tcc gtt gtt 2458 Leu Thr Gly Met Ser Leu Arg Val Pro Thr Thr Asp Ual Ser Val Ual gat tta acc gtt aac tta aag act cca acc act tac gaa get att tgt 2506 Asp Leu Thr Val Asn Leu Lys Thr Pro Thr Thr Tyr Glu Ala Ile Cys get get atg aag aag get tct gaa ggt gaa tta aag ggt gtt tta ggt 2554 Ala Ala Met Lys Lys Ala Ser Glu Gly Glu Leu Lys Gly Ual Leu Gly tac act gaa gac get gtt gtt tcc act gat ttc tta acc gat aac aga 2602 Tyr Thr Glu Asp Ala Ual Ual Ser Thr Asp Phe Leu Thr Asp Asn Ang tca tct atc ttt gat get aag get ggt atc tta tta acc cca act ttc 2650 Ser Ser Ile Phe Asp Ala Lys Ala Gly Ile Leu Leu Thr Pro Thr Phe gtt aag tta atc tct tgg tac gat aac gaa tac ggt tac tcc acc aga 2698 Ual Lys Leu Ile Ser Trp Tyr Asp Asn Glu Tyr Gly Tyr Ser Thr Arg gtt gtt gat tta cta caa cac gtt get tcc get taa atcttacaat 2744 Ual Ual Asp Leu Leu Gln His Ual Ala Ser Ala ctagattgtgaagtataagtaagcaaaaattatatatatatttgtctttcatagtataag2804 tatagttttcatgagaaatacagataaacaacaaaaaataagttctttttgaaaaagtta2864 gattttattcttgaacttagtaaaagccttccttttacagctgcttacttacaaccttga2924 aggctattgcataagctcaattgaaaacgagtataatatactgatttcaaggtttaatta2984 tctgtaattttcaagtacttccatacgtggaaacctcccacaattaacagcaacacgaaa3044 catccatcatccaacaaccgagatgcggattaggcccggagagataatatttttcggtgt3104 ggcggtggtttcaactccgaacgcagcgcagccaaaagcaaacagatgatttagtgaact3164 cttcttatgatagatttttggctgattgagttgatctgacctgtgtggttcgatcgaatt3224 ctattgtgtttgatgccctggtagtggtgtgcttcatcttattgtgaagtgtgaatccta3284 gcgattatggcatttggacgccaactactagctctgacggtagtggcttctacgaatgta3344 acttacaattctgctcaattcgaacatcttttcagtaagagaagttatatatgtatgtgt3404 gtatgtgtatgtaaatatacataaccgcttgtgggggtgatttttggtttgtactgatgt3464 gaaactcagtgctatcggatgatgctgtcaccaacaacagctgcttaaccttctttttac3524 tattctgatacagaattaggaaagtttccggatttgtgatgtgcggctttggttgccatt3584 agtctcctttttttggagggaggagtgaagtggtgcgttatgtgccctgatccaatggtt3644 ttgaaagagggagctagggatagttaatgggtagacctatgaacattgtgtattaatata3704 ttgaaatatacaaacataacggctgaaaacagcaagaaatcaaaaaggcacaatttcaat3764 ggtatataacttcaataatgatagtaatagtaatggtagtagttattacaggaggaataa3824 tatcaagaaaggaaaactaaaagtacaccaacgtattcagaaatacaaaaacagcgaaca3884 aaatcgtcgattagtaattcatatcatgattgccatccaaacagctttctttcattgaac3944 tcacgagggcttgcactattttccctgcttgatgagtaatccatcatttcaaactcggtt4004 gaacctgtagcaccagaagcgccatttgacgtaattggccttgtaatttgctgttgttgt4064 tgggatatgtttgattcattttggaaacgttcatgatgccctctttttttgttgtttgtt4124 gttggtatcggtgaattcgatctagatgcagaactgccactattgttgttattgccgttg4184 ttcgcattattgttatcgtcaaagtcaaagtcaagtaatggaagaccaagggaagcatca4244 acaccaaaatcattcaacatcagtaaatccgagtacgacttaatggtatctgcctgaatc4304 gttgcttgctgctgattatgctgttgttggttttgttgttgctgtttcgcagtcagttgg4364 aaatgatccactagttctagagcggccgccaccgcggtggagctc 4409 <210>3 <211>3077 <212>DNA

<213>Pichia methanolica <400>

cagctgctctgctccttgattcgtaattaatgttatccttttactttgaactcttgtcgg 60 tccccaacagggattccaatcggtgctcagcgggatttcccatgaggtttttgacaactt 120 tattgatgctgcaaaaacttttttagccgggtttaagtaactgggcaatatttccaaagg 180 ctgtgggcgttccacactccttgcttttcataatctctgtgtattgttttattcgcattt 240 tgattctcttattaccagttatgtagaaagatcggcaaacaaaatatcaacttttatctt 300 gaacgctgacccacggtttcaaataactatcagaactctatagctataggggaagtttac 360 tgcttgcttaaagcggctaaaaagtgtttggcaaattaaaaaagctgtgacaagtaggaa 420 ctcctgtaaagggccgattcgacttcgaaagagcctaaaaacagtgactattggtgacgg 480 aaaattgctaaaggagtactagggctgtagtaataaataatggaacagtggtacaacaat 540 aaaagaatgacgctgtatgtcgtagcctgcacgagtagctcagtggtagagcagcagatt 600 gcaaatctgttggtcaccggttcgatccggtctcgggcttccttttttgctttttcgata 660 tttgcgggtaggaagcaaggtctagttttcgtcgtttcggatggtttacgaaagtatcag 720 ccatgagtgtttccctctggctacctaatatatttattgatcggtctctcatgtgaatgt 780 ttctttccaagttcggctttcagctcgtaaatgtgcaagaaatatttgactccagcgacc 840 tttcagagtcaaattaattttcgctaacaatttgtgtttttctggagaaacctaaagatt 900 taactgataagtcgaatcaacatctttaaatcctttagttaagatctctgcagcggccag 960 tattaaccaatagcatattcacaggcatcacatcggaacattcagaatggactcgcaaac 1020 tgtcgggattttaggtggtggccaacttggtcgtatgatcgttgaagctgcacacagatt 1080 gaatatcaaaactgtgattctcgaaaatggagaccaggctccagcaaagcaaatcaacgc 1140 tttagatgaccatattgacggctcattcaatgatccaaaagcaattgccgaattggctgc 1200 caagtgtgatgttttaaccgttgagattgaacatgttgacactgatgcgttggttgaagt 1260 tcaaaaggcaactggcatcaaaatcttcccatcaccagaaactatttcattgatcaaaga 1320 taaatacttgcaaaaagagcatttgattaagaatggcattgctgttgccgaatcttgtag 1380 tgttgaaagtagcgcagcatctttagaagaagttggtgccaaatacggcttcccatacat 1440 gctaaaatctagaacaatggcctatgacggaagaggtaattttgttgtcaaagacaagtc 1500 atatatacctgaagctttgaaagttttagatgacaggccgttatacgccgagaaatgggc 1560 tccattttcaaaggagttagctgttatggttgtgagatcaatcgatggccaagtttattc 1620 ctacccaactgttgaaaccatccaccaaaacaacatctgtcacactgtctttgctccagc 1680 tagagttaacgatactgtccaaaagaaggcccaaattttggctgacaacgctgtcaaatc 1740 tttcccaggtgctggtatctttggtgttgaaatgtttttattacaaaatggtgacttatt 1800 agtcaacgaaattgccccaagacctcacaattctggtcactataccatcgacgcttgtgt1860 cacctcgcaatttgaagctcatgttagggccattactggtctacccatgccgaagaactt1920 cacttgtttgtcgactccatctacccaagctattatgttgaacgttttaggtggcgatga1980 gcaaaacggtgagttcaagatgtgtaaaagagcactagaaactcctcatgcttctgttta2040 cttatacggtaagactacaagaccaggcagaaaaatgggtcacattaatatagtttctca2100 atcaatgactgactgtgagcgtagattacattacatagaaggtacgactaacagcatccc2160 tctcgaagaacagtacactacagattccattccgggcacttcaagcaagccattagtcgg2220 tgtcatcatgggttccgattcggacctaccagtcatgtctctaggttgtaatatattgaa2280 gcaatttaacgttccatttgaagtcactatcgtttccgctcatagaaccccacaaagaat2340 ggccaagtatgccattgatgctccaaagagagggttgaagtgcatcattgctggtgctgg2400 tggtgccgctcatttaccgggaatggttgcggcgatgacgccgctgcctgttattggtgt2460 ccctgttaaaggctctactttggatggtgttgattcactacactccatcgttcaaatgcc2520 aagaggtattcctgttgctactgtggctattaacaatgctactaacgctgccttgctagc2580 tatcacaatcttaggtgccggcgatccaaatacttgtctgcaatggaagtttatatgaac2640 aatatggaaaatgaagttttgggcaaggctgaaaaattggaaaatggtggatatgaagaa2700 tacttgagtacatacaagaagtagaaccttttatatttgatatagtacttactcaaagtc2760 ttaattgttctaactgttaatttctgctttgcatttctgaaaagtttaagacaagaaatc2820 ttgaaatttctagttgctcgtaagaggaaacttgcattcaaataacattaacaataaatg2880 acaataatatattatttcaacactgctatatggtagttttataggtttggttaggatttg2940 agatattgctagcgcttatcattatccttaattgttcatcgacgcaaatcgacgcatttc3000 cacaaaaattttccgaacctgtttttcacttctccagatcttggtttagtatagcttttg3060 acacctaatacctgcag 3077 <210> 4 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC11,356 <400> 4 ttacatgttc aagtacgat 19 <210> 5 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC11,357 <400> 5 tgatttcatc gtaagtgg 18 <210> 6 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC11,733 <400> 6 atcccatggg gtaaagaagg 20 <210> 7 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC11,734 <400> 7 ataccggtta acttaccagc 20 <210> 8 <211> 55 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19,334 <400> 8 ccatgattac gccaagctag cggccgcaat ttttaagaaa tccgattgga tagtg 55 <210> 9 <211> 64 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC19,333 <400> 9 gtaaaaatag aaggaaatct cattcttttg aattcaaata aataaaagtg ggttctatga 60 aaac 64 <210> 10 <211> 12 <212> DNA
<213> Artificial Sequence <220>
<223> engineered sequence <400> 10 gaattcaaaa ga 12 <210> 11 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC9118 <400> 11 acctcccagt aagcctt 17 <210> 12 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC9464 <221> misc_feature <222> (1). .(17) <223> n = A,T,C or G
<400> 12 ttyggnaart tygaygg 17 <210> 13 <211> 421 <212> DNA
<213> Pichia methanolica <220>
<221> CDS
<222> (2)...(421) <400> 13 g gaa ggt aac gtt tct cag gat act tta get tta ggt gat tta gtt att 49 Glu Gly Asn Val Ser Gln Asp Thr Leu Ala Leu Gly Asp Leu Val Ile cca aaa caa gac ttt gcc gaa get act tct gag cca ggt tta gca ttc 97 Pro Lys Gln Asp Phe Ala Glu Ala Thr Ser Glu Pro Gly Leu Ala Phe gca ttt ggt aaa ttt gat ggt att tta ggt tta get tac gat agc att 145 Ala Phe Gly Lys Phe Asp Gly Ile Leu Gly Leu Ala Tyr Asp Ser Ile tcg gtc aac aag att gtt cct cct att tat aat get tta aac ttg ggt 193 Ser Val Asn Lys Ile Val Pro Pro Ile Tyr Asn Ala Leu Asn Leu Gly tta tta gat gaa cct caa ttt gcc ttc tac cta ggt gat act aac acc 241 Leu Leu Asp Glu Pro Gln Phe Ala Phe Tyr Leu Gly Asp Thr Asn Thr aat gaa gaa gat ggt ggt ctt gcc act ttt ggt ggt gtt gat gag tcc 289 Asn Glu Glu Asp Gly Gly Leu Ala Thr Phe Gly Gly Val Asp Glu Ser aag tat act ggt aaa gtt aca tgg tta cca gtc aga aga aag get tac 337 Lys Tyr Thr Gly Lys Val Thr Trp Leu Pro Val Arg Arg Lys Ala Tyr tgg gaa gtt tca tta gac ggt att tca tta ggt gat gaa tac gcg cca 385 Trp Glu Val Ser Leu Asp Gly Ile Ser Leu Gly Asp Glu Tyr Ala Pro tta gaa ggc cat gga get gcc att gat aca ggt acc 421 Leu Glu Gly His Gly Ala Ala Ile Asp Thr Gly Thr <210> 14 <211> 140 <212> PRT
<213> Pichia methanolica <400> 14 Glu Gly Asn Ual Ser Gln Asp Thr Leu Ala Leu Gly Asp Leu Ual Ile Pro Lys Gln Asp Phe Ala Glu Ala Thr Ser Glu Pro Gly Leu Ala Phe Ala Phe Gly Lys Phe Asp Gly Ile Leu Gly Leu Ala Tyr Asp Ser Ile Ser Ual Asn Lys Ile Ual Pro Pro Ile Tyr Asn Ala Leu Asn Leu Gly Leu Leu Asp Glu Pro Gln Phe Ala Phe Tyr Leu Gly Asp Thr Asn Thr Asn Glu Glu Asp Gly Gly Leu Ala Thr Phe Gly Gly Ual Asp Glu Ser Lys Tyr Thr Gly Lys Ual Thr Trp Leu Pro Ual Arg Arg Lys Ala Tyr Trp Glu Ual Ser Leu Asp Gly Ile Ser Leu Gly Asp Glu Tyr Ala Pro Leu Glu Gly His Gly Ala Ala Ile Asp Thr Gly Thr <210> 15 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC9126 <400> 15 atgtcaacac atttacc 17 <210> 16 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC9741 <221> misc_feature <222> (1). .(17) <223> n = A.T,C or G
<400> 16 cayggnacnc aytgygc 17 <210> 17 <211> 368 <212> DNA
<213> Pichia methanolica <220>
<221> CDS
<222> (1)...(366) <221> misc_feature <222> (1). .(368) <223> n = A,T,C or G
<400> 17 ggg tcc gna cnc atg gtg ttt cta aga att gcc cac att gtt gcc gtc 48 Gly Ser Xaa Xaa Met Val Phe Leu Arg Ile Ala His Ile Val Ala Val aaa gtt tta aga tct aac ggt tca ggt tct atg ccc gat gtt gtc aag 96 Lys Val Leu Arg Ser Asn Gly Ser Gly Ser Met Pro Asp Val Val Lys ggt gtt gaa tat get ccc aat get cac ctt gcg gaa gcc aag get aac 144 Gly Val Glu Tyr Ala Pro Asn Ala His Leu Ala Glu Ala Lys Ala Asn aag agt ggt ttt aaa ggt tct acc gcg aac atg tca tta ggt ggt ggt 192 Lys Ser Gly Phe Lys Gly Ser Thr Ala Asn Met Ser Leu Gly Gly Gly aaa tct cca get tta gat atg tct gtt aac get cct gtt aaa gca ggt 240 Lys Ser Pro Ala Leu Asp Met Ser Val Asn Ala Pro Val Lys Ala Gly tta cac ttt gcc gtt acc get ggt aac gat aac act gat gca tgt aac 288 Leu His Phe Ala Val Thr Ala Gly Asn Asp Asn Thr Asp Ala Cys Asn tat tct cca gcc act act gaa aat act gtc act gtt gtt get tcc act 336 Tyr Ser Pro Ala Thr Thr Glu Asn Thr Val Thr Ual Val Ala Ser Thr tta tct gat tcg aga get gac atg tct aac tc 368 Leu Ser Asp Ser Arg Ala Asp Met Ser Asn <210> 18 <211> 122 <212> PRT
<213> Pichia methanolica <220>
<221> VARIANT
<222> (1)...(122) <223> Xaa = Any Amino Acid <400> 18 Gly Ser Xaa Xaa Met Val Phe Leu Arg Ile Ala His Ile Val Ala Val Lys Val Leu Arg Ser Asn Gly Ser Gly Ser Met Pro Asp Val Val Lys Gly Val Glu Tyr Ala Pro Asn Ala His Leu Ala Glu Ala Lys Ala Asn Lys Ser Gly Phe Lys Gly Ser Thr Ala Asn Met Ser Leu Gly Gly Gly Lys Ser Pro Ala Leu Asp Met Ser Val Asn Ala Pro Val Lys Ala Gly Leu His Phe Ala Val Thr Ala Gly Asn Asp Asn Thr Asp Ala Cys Asn Tyr Ser Pro Ala Thr Thr Glu Asn Thr Val Thr Val Val Ala Ser Thr Leu Ser Asp Ser Arg Ala Asp Met Ser Asn <210> 19 <211> 17 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC447 <400> 19 taacaatttc acacagg 17 <210> 20 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC976 <400> 20 cgttgtaaaa cgacggcc 1g <210> 21 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC9079 <400> 21 cagctgccta ggactagttt cctcttacga gcaactaga 39 <210> 22 <211> 38 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer ZC9080 <400> 22 tgatcaccta ggactagtga caagtaggaa ctcctgta 38

Claims (16)

Claims What is claimed is:

1. An isolated DNA molecule of up to 5000 nucleotides in length comprising nucleotide 93 to nucleotide 1080 of SEQ ID NO:1.

2. A DNA construct comprising the following operably linked elements:
a first DNA segment comprising at least a portion of the sequence of SEQ ID
NO:1 from nucleotide 93 to nucleotide 1092, wherein said portion is a functional transcription promoter;
a second DNA segment encoding a protein of interest other than a Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase; and a third DNA segment comprising a transcription terminator.

3. The DNA construct of claim 2 wherein said first DNA segment is from 900 to 1500 nucleotides in length.

4. The DNA construct of claim 2 wherein the first DNA segment comprises nucleotide 93 to nucleotide 1080 of SEQ ID NO:1.

5. The DNA construct of claim 2 wherein the first DNA segment is substantially free of Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase gene coding sequence.

6. The DNA construct of claim 2, further comprising a selectable marker.

7. The DNA construct of claim 2, further comprising a secretory signal sequence operably linked to the first and second DNA segments.

8. The DNA construct of claim 7, wherein the secretory signal sequence is the S. cerevisiae alpha-factor pre-pro sequence.

9. The DNA construct of claim 2 wherein said third DNA segment comprises a transcription terminator of a Pichia methanolica AUG1 or GAP2 gene.

10. The DNA construct of claim 9, wherein said terminator comprises nucleotides 2095 to 2145 of SEQ ID NO:1.

11. A Pichia methanolica cell containing the DNA construct of any of claims 2-10.

12. The Pichia methanolica cell of claim 11 wherein the DNA construct is genomically integrated.

13. The Pichia methanolica cell of claim 12 wherein the DNA construct is genomically integrated in multiple copies.

14. The Pichia methanolica cell of claim 11, wherein the cell is functionally deficient in vacuolar proteases proteinase A and proteinase B.

15. A method of producing a protein of interest comprising:
culturing the cell of any of claims 11-14 whereby the second DNA segment is expressed and the protein of interest is produced; and recovering the protein of interest from the cultured cell.

16. A DNA construct comprising the following operably linked elements:
a first DNA segment comprising a Pichia methanolica gene transcription promoter;
a second DNA segment encoding a protein of interest other than a Pichia methanolica protein; and a third DNA segment comprising nucleotides 2095 to 2145 of SEQ ID NO:2.