CA2377899A1 - Methods, compositions and genetic sequences for modulating flowering in plants, and plants genetically modified to flower early and tardily - Google Patents

Abstract

The present invention relates to methods, compositions and genetic sequences for modulating flowering in plants and to plants genetically modified to flower early and to plants genetically modified to flower tardily. More particularly the present invention provides among others a genetic sequence encoding for a hydroxyjasmonic acid sulfotransferase and methods for producing transgenic plants using such a sequence.

Description

METHODS, COMPOSITIONS AND GENETIC SEQUENCES FOR MODULATING
FLOWERING IN PLANTS, AND PLANTS GENETICALLY MODIFIED TO
FLOWER EARLY AND TARDILY
BACKGROUND OF THE INVENTION
a) Field of the invention The invention relates to methods, compositions and genetic sequences to modulate flowering in plants and to plants genetically modified to flower early and plants genetically modified to flower tardily.
b) Brief description of the prior art In plants, the transition from vegetative to reproductive growth involves complex interactions between several endogenous biochemical pathways. These pathways are continuously evaluating the environmental conditions and the state of growth of the plant. When adequate conditions are met, cross-talk between pathways will ultimately result in the formation of a floral meristem.
For a long time, plant scientists have tried to control floral induction. The results of grafting experiments performed about 70 years ago led to the proposal of a hypothesis which states that a flower inducer, i.e. "a florigen", is synthesized in the leaves and translocated to the shoot apex to induce the development of the flower meristem. However, despite considerable research efforts, the search for the hypothetical "florigen" hormone was unsuccessful. Molecules such as cytokinins, gibberellins and carbon assimilates have also been proposed to act as flowering promoters in some species. For instance, U.S. patents Nos.
5,523,281;
6,020,288 and 6,057,157 disclose various methods and compositions for inducing, accelerating and prolonging flowering in plants or enhancing their growth.
However, some of the molecules or compositions described in these patents were found to be inactive or even inhibitory to flower formation in other plant species.
Some others are also known to affect the biomass or the plant morphology.
12-hydroxyjasmonic acid (see Fig. 1A) is a natural metabolite and was first isolated from the leaves of Solanum tuberosum (potato) (Yoshihara et al.
(1989),

2 Agric. Biol. Chem. 53: 2835). The biosynthesis of 12-hydroxyjasmonic acid has not been studied at the biochemical level but recent studies suggest that jasmonic acid is converted to 12-hydroxyjasmonic acid by a single oxidation step catalyzed by the jasmonic acid 12-hydroxylase (Yoshihara et al. (1996), Plant Cell Physiol.
37: 586). 11-hydroxyjasmonic acid (see Fig. 1 B) is also a natural metabolite for which the mechanism of biosynthesis have not been described either. However, based on the results obtained for the in vivo synthesis of 12-hydroxyjasmonic acid, one can predict that a jasmonic acid 11-hydroxylase converts jasmonic acid or methyljasmonic acid into the 11-hydroxylated compounds.
Although many functions have been associated with jasmonates metabolites such as 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid, these metabolites have never been associated with flower formation. For instance, U.S. patent No 5,935,809, suggests the use of jasmonate for inducing plant defense mechanisms. U.S. patent No 5,814,581 describes a plant growth promoter composition comprising jasmonate and brassinolide as active ingredients and Japanese patent application No 00292220 (A) published April 3, 1990, Yoshihara et al. (1989), Agric. Biol. Chem. 53: 2835-2837, Matsuki et al.
(1992), Biosci. Biotech. Biochem. 56: 1329.; and Koda and Okazawa (1988), Plant Cell Physiol. 29: 969), suggest the use of 12-hydroxyjasmonic acid for inducing tuber formation in potatoes. None of these documents disclose nor suggest that compounds of the jasmonates family are involved in flower formation pathways.
Accordingly, there is a need for effective methods and compositions to modulate flowering, particularly for plants which are used in the food-processing industry and plants with a horticultural value. There is also a need for plants genetically modified to flower early and for plants genetically modified to flower tardily as well as for methods for producing such genetically modified plants.
SUMMARY OF THE INVENTION
The present invention relates to the modulation of flowering in plants. More particularly, the present invention pertains to methods, compositions and genetic sequences for modulating flowering in plants and to plants genetically modified to flower early and to plants genetically modified to flower tardily.

3 According to an aspect of the invention, there is provided a method for modulating flowering in a plant. The method comprises the step of modifying in said plant the endogenous level of at least one compound of the jasmonate family, and more particularly compounds selected from the group consisting of jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, sulfate ester of hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, sulfate ester of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, sulfate ester of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, glucoside. of 11-hydroxymethyljasmonic acid, sulfate ester of 11-hydroXymethyljasmonic acid, and mixtures thereof.
According to another aspect of the invention, flowering of a plant is induced by increasing in the plant the endogenous level of at one flowering inducing F
compound selected from the previously mentioned jasmonate family compounds excluding sulfate ester of 12-hydroxyjasmonic acid, sulfate ester of 12-hydroxymethyljasmonic acid, sulfate ester of 11-hydroxyjasmonic acid, and sulfate ester of 11-hydroxymethyljasmonic acid. In a preferred embodiment, this can be achieved by:
a) applying to the plant at least one flowering inducing compound and/or salts thereof;
b) applying to the plant at least one inhibitor of a suffotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid;
c) applying to the plant at least one stimulator of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid;
d) increasing in the plant the endogenous level of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or e) lowering in the plant the endogenous level of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid.

4 Alternatively, flowering of a plant can be delayed by lowering the endogenous level in the plant of at least one of the above mentioned flowering inducing compounds. According to an embodiment of the invention this can be achieved by:
a) applying to the plant an inhibitor and/or an inactivator of at least one of the flowering inducing compounds;
b) applying to the plant at least one stimulator of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic;
c) applying to the plant at least one inhibitor of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid;
d) lowering in the plant the endogenous level of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or e) increasing in the plant the endogenous level of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid.
According to another aspect of the invention, compositions for modulating flowering are provided. In an embodiment of the invention, a composition for inducing flowering in a plant is provided, comprising a flowering inducing effective amount of at least one of the previously mentioned flowering inducing compounds or salts thereof, in combination with a diluent or a carrier such that an induction in flowering of the plant occurs when compared to a corresponding plant in the absence of the flowering inducing composition. Similarly, in another embodiment, is provided a flowering delaying composition for delaying flowering in a plant, the composition comprising a flowering delaying effective amount of an inhibitor or of an inactivator of the previously mentioned jasmonate family compounds excluding sulfate ester of 12-hydroxyjasmonic acid, sulfate ester of 12-hydroxymethyljasmonic acid, sulfate ester of 11-hydroxyjasmonic acid, and sulfate ester of 11-hydroxymethyljasmonic acid, in combination with a diluent or a carrier such that a delay in flowering of said plant occurs when compared to a corresponding plant in the absence of the flowering delaying composition.
According to a further aspect of the invention, there are provided genetically modified plants. In an embodiment, a plant is genetically modified to flower early when compared to a corresponding plant not genetically modified. The genetically modified plant exhibits an increased endogenous level of at least one compound selected from the previously mentioned jasmonate family compounds, excluding sulfate ester of 12-hydroxyjasmonic acid, sulfate ester of 12-hydroxymethyljasmonic acid, sulfate ester of 11-hydroxyjasmonic acid, and sulfate

5 ester of 11-hydroxymethyljasmonic acid, when compared to a corresponding non-genetically modified plant. In another embodiment a plant is genetically modified to flower tardily when compared to a corresponding plant not genetically modified, the genetically modified plant exhibiting a lowered level of at least one compound selected from the previously mentioned jasmonate family compounds excluding sulfate ester of 12-hydroxyjasmonic acid, sulfate ester of 12-hydroxymethyljasmonic acid, sulfate ester of 11-hydroxyjasmonic acid, and sulfate ester of 11-hydroxymethyljasmonic acid.
In another aspect, the present invention is directed to an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a plant hydroxyjasmonic acid sulfotransferase, and more particularly a plant 11 or 12-hydroxyjasmonic acid sulfotransferase. Preferably, the nucleotide sequence is selected from the group consisting of SEQ ID N0:1, nucleotide sequences having at least 50% similarity with SEQ ID N0:1, SEQ ID N0:2 nucleotide sequences having at least 50% similarity with SEQ ID N0:2, and sequences hybridizing under low stringency conditions to one or more of these sequences.
Advantageously, these sequences are incorporated into a vector.
According to a related aspect, the invention provides transgenic plants incorporating at least one of these nucleotide sequences so that the transgenic plants are capable of flowering early or tardily. The invention also provides methods for producing such transgenic plants.
An advantage of the present invention is that it allows to modulate flowering in plants without decreasing yield or modifying plant morphology. According to the invention it is possible to inhibit flowering in crop plants such as sugarcane, sugar beets or lettuce, just to mention a few, and thereby increase the taste, sweetness, and tenderness of these agricultural products. On the other hand, it is also possible according to the present invention, to induce flowering which is an d bic Richard 8 ROBIC (6e)514 845 6518; 09/211Q1 14:37; J~#257;Pane 9/37 fi advantage of great economic importance for horticultural plants and some crop plants such as caufifiower and broccoli.
ether objects and advantages of the present invention will be apparent upon reading the following non-restrictive description of several preferred embodiments, made with reference to the accompanying drawings and to the enclosed examples.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 A and 1 B show the chemical structures of 12-hydroxyjasmonic acid (Fig.,1A) and 11-hydroxyjasmonic acid (Fig. 1 B).
Figures 2A and 2B are pictures showing the effect on flowering time of a treatment with 12-hydroxyjasmonic acid (Fig. 2B) in Arabidopsis fhaliana, when compared to a treatment with water (Fig. 2A).
Figure 3 is a picture showing the phenotype of transgenic Arabidopsis plants expressing AtST2a gene under the control of a constitutive promoter iwhen compared to wild type non-transgenic plant (W'I7. S5, S6, S9, and S16 indicate independent transgenic lines.
Figure 4 is a Western blot of protein extracts from the plants shown in Flg. 3 probed with anti-AtST2a antibodies. MW: Molecular weight markers; 1NT: wild type plants; S5, S6, S9, and S16: independent transgenic lines.
Figure 5 is a picture showing the phenotype of transgenic Arabidopsis plants expressing the AtST2a gene in the antisense orientation under the control of a constitutive promoter (TL 7-2-5) when compared to non transgenic plants Nvir).
Figure 6 is a picture showing the effect of methyljasmonic acid treatment on the flowering time of wild type Arabidopsis thaliana plants (W f C24) and do transgenic Arabidopsis thaliana plants expressing the AfST2a gene in the antisense orientation under the control of a constitutive promoter (TL 7-2-5).
Figure 7: Shows nucleotide sequence of AfST2a gene (SEQ ID NO 1) taken from Arabidopsis thaliana database at Stanford University (clone number MOJ9, gene MOJ9.1B and the EST 119G6T7) and the GenBankT"' database (accession number AB010697, nucleotides 53936 to 55015).
AMENDED SHEET
AMENDED SHEET
Fm~fanRS~ait %I.>eD.~LU~31 ~~21-09-2001 °bic Richard 8 ROBIC (6ej514 845 6518; 09/21/0i 14:37;
JetFa~ #257;P~~~ ~

Figure 8: Shows the deduced amino acid sequence (SEQ ID NO 3) of the protein encoded by the AtST2a gene shown in Fig. 7.
Figure 9: Shows the nucleotide sequence of AtST2b gene (SEQ 1D NO 2) taken from Arabidopsis thahana database at Stanford University (clone number MOJ9, gene MOJ9,15) and the GenBankT"" database (accession number AB010697, nucleotides 50627 to 51670).
t=lgure 10: Snows the deduced amino acid sequence (SEQ ID NO 4) of the protein encoded by the AfST2b gene shown in Fig. 9.
Figure 11 is a Northern blot of plants mRNA extracts showing the effect of various 12-hydroxyjasmonate concentrations on the expression of the AtST2a gene.
Figure 12 is a Northern blot of plants mRNA extracts showing the effect of the photoperiod on the expression of the ArST2a gene.
DETAILED DESDRIPTION OF THE INVENTION
A1 Definitions In order to provide an even clearer and more consistent understanding of the spec~cation and the claims, including the scope given herein to such terms, the following defrnitions are provided:
11-hydroxyjasmvnic aeld: 3-Oxo-2-(4-hydroxy-2-pentenyi)-cyclopentane-1-acetic acid. Its chemical structure is shown in Fig. 1 B.
11-hydroxyjasmonic acid gtucoside: 3-Oxo-2-(4-~i-D-glucopyranosytoxy-2-pentenyl)-cyclopentane-1-acetic acid 91-hyd>roxyjasmonic acid sulfate: 3-Oxo-2-(4-hydroxysulfonyloxy-2-pentenyl)-cyclopentane-1-acetic acid 12-hydroxyjasmonic acid: 3-Oxo-2-(5-hydroxy-2-pentenyl)-cyclopentane-1-acetic acid. Its chemical structure is shown in Fig. 1A.
12-hydroicyjasmottic acid gluCoside: 3-Oxo-2-(5-~i-D-glucapyranosyloxy-2-pentenyi)-cyclopentane-1-acetic acid.
12-hydroxyjasmonie acid sulfate: 3-Oxo-2-(5-hydroxysulfonyloxy-2-pentenyl)-cyclopentane-1-acetic acid.
AMENDED SHEET
AMENDED SHEET
Fmofan~cTOit 71.5a0. 711:31 Antisense: Refers to nucleic acids molecules capable of regulating the expression of a corresponding gene in a plant. An antisense molecule as used herein may also encompass a gene construct comprising a structural genomic gene, a cDNA gene or part thereof in reverse orientation relative to its or another promoter. Typically antisense nucleic acid sequences are not templates for protein synthesis but yet interact with complementary sequences in other molecules (such as a gene or RNA) thereby causing the function of those molecules to be affected.
Delay or retard or tardily: When used in conjunction with the term flowering, it refers to the increase of the time of vegetative growth before flowering of a plant. A flowering delay may be observed when compared with a corresponding plant where flowering has not been delayed.
Effective amount: Refers to the amount or concentration of a suitable compound that is administered to a plant such that the compound induces or delays flowering of a plant.
Exogenous nucleic acid: A nucleic acid sequence (such as cDNA, cDNA
fragments, genomic DNA fragments, antisense RNA, oligonucleotide) which is not normally part of a plant genome. The "exogenous nucleic acid" may be from any organism or purely synthetic. Typically, the "exogenous nucleic acid sequence"
encodes a plant gene such as a AtST2a, AtST2b or functional homologues of these genes.
Expression: The process whereby an exogenous nucleic acid, such as a nucleic acid sequence encoding a gene, is transcribed into a mKNH and afterwards translated into a peptide or a protein, in order to carry out its function, if any.
Flowering: Refers to the appearance of a flower bud in a plant. As it is known, the flower bud will eventually mature to a flower.
Functional homologue: Refers to a molecule having at least 50%, more preferably at least 55%, even more preferably at least 60%, still more preferably at least 65-70%, and yet even more preferably greater than 85% similarity at the level of nucleotide or amino acid sequence to at least one or more regions of a given nucleotide or amino acid sequence. According to preferred embodiments of the present invention, the terms "functional homologue" refer to proteins or nucleic acid sequences encoding an enzyme having a substantially similar biological activity as 11- or 12-hydroxyjasmonate sulfotransferase and isoenzyme(s) thereof.
Such a functional homologue may exist naturally or may be obtained following a single or multiple amino acid substitutions, deletions and/or additions relative to the naturally occurring enzymes) using methods and principles well known in the art. A functional homologue of a protein may or may not contain post-translational modifications such as covalently linked carbohydrate, if such modification is not necessary for the performance of a specific function. It should be noted, however, that nucleotide or amino acid sequences may have similarities below the above given percentages and still encode a 11- or 12-hydroxyjasmonate sulfotransferase-like molecule, and such molecules may still be considered within the scope of the present invention where they have regions of sequence conservation.
Geneticlnucleotide sequence: These terms are used herein in their most general sense and encompass any contiguous series of nucleotide bases encoding directly, or via a complementary series of bases, a sequence of amino acids comprising a hydroxyjasmonic acid sulfotransferase molecule, and more particularly a 11- or 12-hydroxyjasmonic acid sulfotransferase. Such a sequence of amino acids may constitute a full-length 11- or 12-hydroxyjasmonic acid sulfotransferase such as is set forth in SEQ ID No:1 and SEQ ID No:2 or an active truncated form thereof or a functional mutant, derivative, part, fragment, homologue or analogue thereof, or may correspond to a particular region such as an N-terminal, C-terminal or internal portion of the enzyme.
Genetic modification or genetic engineering: Refers to the introduction of an exogenous nucleic acid into one or more plant cells to create a genetically modified plant. Methods for genetically modifying a plant are well known in the art.
In some cases, in may be preferable that the genetic modification is permanent such that the genetically modified plant may regenerate into whole, sexually competent, viable genetically modified plants. A plant genetically modified in a permanent manner would preferably be capable of self-pollination or cross-pollination with other plants of the same species, so that the exogenous nucleic acid, carried in the germ line, may be inserted into or bred into agriculturally useful plant varieties.
Endogenous level(s): Refers to the concentration of a given substance which is normally found in a plant (intrinsic) at a given time and stage of growth.
5 Reference herein is made to the altering of the endogenous level of a compound or of an enzyme activity relating to an elevation or reduction in the compound's level or enzyme activity of up to 30% or more preferably of 30-50%, or even more preferably 50-75% or still more preferably 75% or greater above or below the normal endogenous or existing levels. The levels of a compound or the levels of 10 activity of an enzyme can be assayed using known method and techniques.
Isolated nucleic acid molecule: Means a genetic sequence in a non-naturally-occurring condition. Generally, this means isolated away from its natural state or formed by procedures not necessarily encountered in its natural environment. More specifically, it includes nucleic acid molecules formed or maintained in vitro, including genomic DNA fragments, recombinant or synthetic molecules and nucleic acids in combination with heterologous nucleic acids such as heterologous nucleic acids fused or operably-linked to the genetic sequences of the present invention. The term "isolated nucleic acid molecule" also extends to the genomic DNA or cDNA or part thereof, encoding a hydroxyjasmonic acid sulfotransferase, preferably a 11- or 12-hydroxyjasmonic acid sulfotransferase, or a functional mutant, derivative, part, fragment, homologue or analogue of 11-or 12-hydroxyjasmonic acid sulfotransferase in reverse orientation relative to its or another promoter. It further extends to naturally-occurring sequences following at least a partial purification relative to other nucleic acid sequences. The term isolated nucleic acid molecule as used herein is understood to have the same meaning as nucleic acid isolate.
Induce or increase: When used in conjunction with the term flowering, it refers to the reduction of the time of vegetative growth before flowering of a plant.
A flowering induction may be observed when compared with a corresponding plant wherein flowering has not been induced.
Modulation: Refers to the process by which a given variable is regulated to a certain proportion. According to preferred embodiments of the present invention, the term "modulate" refers in some cases to induction and in other cases delay, of flowering of a plant.
Plant: refers to a whole plant or a part of a plant comprising, for example, a cell of a plant, a tissue of a plant, an explant, or seeds of a plant. This term further contemplates a plant in the form of a suspension culture or a tissue culture including, but not limited to, a culture of calli, protoplasts, embryos, organs, organelles, etc.
SimilaritylComplementarity: In the context of nucleic acid sequences, these terms mean a hybridizable similarity under low, alternatively and preferably medium and alternatively and most preferably high stringency conditions, as defined below. Such a nucleic acid is useful, for example, in screening hydroxyjasmonic acid sulfotransferase genetic sequences, preferably a 11- or hydroxyjasmonic acid sulfotransferase genetic sequences from various sources or for monitoring an introduced genetic sequence in a transgenic plant. The preferred oligonucleotide is directed to a conserved hydroxyjasmonic acid sulfotransferase, preferably a 11- or 12-hydroxyjasmonic acid sulfotransferase genetic sequence or a sequence conserved within a plant genus, plant species and/or plant cultivar or variety.
Stringency: For the purpose of defining the level of stringency, reference can conveniently be made to Maniatis et al. (1982) at pages 387-389, and especially paragraph 11. A low stringency is defined herein as being in 4-6X
SSC/1 % (w/v) SDS at 37-45 °C for 2-3 hours. Depending on the source and concentration of nucleic acid involved in the hybridization, alternative conditions of stringency may be employed such as medium stringent conditions which are considered herein to be 1-4X SSC/0.5-1% (w/v) SDS at greater than or equal to 45°C for 2-3 hours or high stringent conditions considered herein to be 0.1-1X
SSC/0.1-1.0% SDS at greater than or equal to 60° C. for 1-3 hours.
Transformed plant: Refers to introduction of an exogenous nucleic acid, typically a gene, into a whole plant or a part thereof, and expression of the exogenous nucleic acid in the plant.

Transgenic plant: Refers to a whole plant or a part thereof stably transformed with an exogenous nucleic acid introduced into the genome of an individual plant cell using genetic engineering methods.
Vector: A self-replicating RNA or DNA molecule which can be used to transfer an RNA or DNA segment from one organism to another. Vectors are particularly useful for manipulating genetic constructs and different vectors may have properties particularly appropriate to express proteins) in a recipient during cloning procedures and may comprise different selectable markers. Bacterial plasmids are commonly used vectors. Preferably, the vectors of the invention are capable of facilitating transfer of a nucleic acid into a plant cell and/or facilitating integration into a plant genome.
B) General overview of the invention The present inventors have now discovered that compounds of the jasmonate family are involved in the flowering of plants. They have also characterized the biological function of two highly homologous genes from A.
thaliana (AtST2a and AtST2b) which encode enzymes that inactivate by sulfonation the biological activity of 11-hydroxyjasmonic acid and 12 hydroxyjasmonic acid. The inventors have also determine that expression of the AtST2a gene in under the control of photoperiod. These properties suggest that flowering could be induced or delayed, and yield to the elaboration of the following model which is given for purposes of clarification and not to limit the scope of the present invention.

Proposed model for the control of flower induction in plants:
INACTIVE
12-hydroxyjasmonate sulfate 11-hydroxyjasmonate sulfate Short days expression of AtST2a and AtST2b Jasmonate 12-hydroxylase 12-hydroxyJasmonate Jasmonic Flowering acid Jasmonate 11-hydroxyjasmonate Long days 11-hydroxylase no expression ACTIVE of AtST2a and AtST2b Using methods, compositions and genetically modified plants the present application demonstrates that flowering can actually be modulated in plants.
According to an aspect of the invention, flowering of a plant is modulated by modifying in the plant the endogenous level of at least one compound of the jasmonate family selected from the group consisting of jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, sulfate ester of 12-hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, sulfate ester of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, sulfate ester of hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, glucoside of 11-hydroxymethyljasmonic acid, and sulfate ester of 11-hydroxymethyljasmonic acid.
In practice, flowering modulation is achieved in two different ways: it is induced or it is delayed. Although many approaches may be used to achieve these effects, the approaches described hereinafter are preferably used according to the invention.

1 ) Chemical approach i) Flowering induction According to the invention, flowering is induced by increasing in a plant the endogenous level of at least one given flowering inducing compound of the jasmonate family selected preferably from the group consisting of jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11-hydroxymethyljasmonic acid.
All these compounds have been tested for their biological activity and all of them have been shown to induce flowering at various levels (data not shown). More preferably, levels of 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid are increased. The flowering induction and the endogenous level increased is detectable when compared to a corresponding plant in which the endogenous level of said compound has not been modified. However, it could be preferable in some cases to genetically modify a plant to induce its flowering prior to apply thereto a product or composition further inducing its flowering. The increase of the endogenous level would then have to be compared with the endogenous level of the genetically modified plant in which flowering has previously been induced.
According to a preferred embodiment of the invention, the endogenous level of a selected jasmonate compound is increased by:
a) applying to the plant at least one selected jasmonate compound and/or salts thereof;
b) applying to the plant at least one inhibitor of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic; and/or c) applying to the plant at least one stimulator of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid.
More preferably, the selected jasmonate compound which is applied is 12-hydroxyjasmonic acid or 11-hydroxyjasmonic acid. However, amino acid conjugates, glucosides, sulfate esters, salts, derivatives or any others natural or chemically synthesized compounds having a similar biological activity on flowering induction, is suitable according to the invention. For instance, inactive compounds such sulfate ester of 12-hydroxyjasmonic acid, sulfate ester of 12-5 hydroxymethyljasmonic acid, sulfate ester of 11-hydroxyjasmonic acid, and sulfate ester of 11-hydroxymethyljasmonic acid could be applied to a plant and it is possible that the bacterial or fungal flora of the plant or of its soil would hydrolyze these compounds in active jasmonate compounds. Any of the above mentioned compounds can be applied in a pure form or as a mixture of a plurality of 10 compounds.
Inhibitors of hydroxyjasmonic acid sulfotransferase(s) should prevent in vivo inactivation of the flower-inducing molecule by sulfonation. To the contrary, stimulators of jasmonic acid hydroxylase(s) should help in the production of jasmonate family compound(s).
15 The above mentioned jasmonate compounds, stimulators and/or inhibitors can be part of a composition for inducing flowering in a plant. Such a composition would comprise a flowering inducing effective amount of at least one selected jasmonate compound, in combination with a diluent or a carrier. The compounds) and their amount would be selected such that an early flowering of the plant would occur following application of the flower inducing composition when compared to a corresponding plant in the absence of said compound(s).
The carrier or diluent can be a solvent such as water, oil or alcohol. The composition may also comprise others active agents such as fertilizers and growth regulators. The inducing composition may also be formulated with emulsifying agents in the presence or absence of fungicides or insecticides, if required.
The precise amount of compound employed in the practice of the present invention will depend upon the type of response desired, the formulation used and the type of plant treated. In the following examples, the plant culture medium was supplemented with about 10 NM of 12-hydroxyjasmonate or with 50 pM
methyljasmonic acid for flowering induction.

i) Flowering retardation According to the invention, flowering is delayed by lowering the endogenous level in a plant of at least one given compound of the jasmonate family selected preferably from the group consisting of jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11-hydroxymethyljasmonic acid. More preferably, the levels of 12-hydroxymethyljasmonic acid and of 11-hydroxymethyljasmonic acid are reduced.
The flowering delay and the endogenous level lowering is detectable when compared to a corresponding plant in which the endogenous level of the compound has not been modified. However, it could be preferable in some cases to genetically modify a plant to delay its flowering prior to apply thereto a product or composition further delaying its flowering. The lowering of the endogenous level would then have to be compared with the endogenous level of the genetically modified plant in which flowering has previously been delayed.
According to a preferred embodiment of the invention, the endogenous level of a selected jasmonate compound is lowered by:
a) applying to the plant at least one inhibitor and/or an inactivator of a selected jasmonate compound;
b) applying to the plant at least one stimulator of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid; and/or c) applying to the plant at least one inhibitor of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid.
Inhibitors) and/or an inactivator(s) of jasmonate compounds should block or inhibit the biological activity of jasmonate compound(s).
Stimulators) of hydroxyjasmonic acid sulfotransferase(s) should stimulate in vivo inactivation of the flower-inducing molecule by sulfonation. To the contrary, s~ ~bic Richard 8 ROBIC (6e)514 845 6518; 09/21/01 14:37; J~tFa: 1~257;P~-- "
'~' inhibitors of jasmonic acid hydroxylase(s) should prevent the production of hydroxylated jasmonate compound(s).
As for the flowering compounds, the above stimulators andlor inhibitors can be applied in a pure form, as a mixture of a plurality of compounds or be part of a flowering delaying composition.
2) Malecufar approach In accordance with the present invention, genetic sequences encoding a plant hydroxyjasmonic acid sulfotransferase have been identified, cloned and used to generate transgenic plants.
SEQ ID NO 1 (Fig. 7; GenBankTM: accession number AB010697, nucleotides 53936 to 55015; and Stanford University Arabidopsis thaliana database: clone number MOJ9, gene MOJ9.16 and EST 119G6T7) corresponds to the gene AtST2a in Arabidopsis tha6ana. SEQ ID NO 3 (Fig. 8) is an amino acid sequence deduced from 5E4 ID NO 1. This amino acid sequence is of public domain and comes from the Kazusa Arabidopsis Opening Site (KAOS) of the Kazusa DNA Research Institute (KDRI) (htto:llwww.kazusa.or.jplkaosh done number MOJ9, gene MOJ9.16). The present inventors have found that the AtST2a gene from Arabidopsis tlaaliana encodes a SUlfotransferase that sulfonates 12-hydroxyjasmonic acid.and 11-hydroxyjasmonie acid with high specificity.
Although not shown, results obtained demonstrated that this hydroxyjasmonic acid sulfotransferase exhibits high affinity for its substrate with a Krn value of 11 NM for 12-hydroxyjasmonic acid and fi0 NM for 11-hydroxyjasmonic acid. The enzyme did not accept structurally related compounds. such ~as cucurbic acid, arachidonyl alcohol or prostaglandins. Maximum enzyme activityr was observed at pN 7,5 In TrisIHCI buffer and did not require divalent cations for activity. The purled recombinant protein expressed in E. coil migrated in SDS-PAGE at a position corresponding to approximately.35,000 daltons (see Fig. 4).
SEQ 1D NO 2 (Fig. 9; GenBankT"": accession number AB010697, nucleotides 50627 to 51670; and Stanford University Arabidopsis thailana database: clone number MOJ9 gene MOJ9.15), corresponds to the gene AfST2b in Arabidopsls thaliana. SECT ID NO 4. (Fig. 10) is an amino acid sequence deduced from SECT
ID
AMENDED SHEET
AMENDED SHEET
Gmnfone~7oit 9l. Con. 9(1'.1 NO 1. This amino acid sequence is of public domain and comes from the Kazusa Arabidopsis Opening Site (KAOS) of the Kazusa DNA Research Institute (KDRI) (http://www.kazusa.or.jp/kaos/; clone number MOJ9, gene MOJ9.15). Amino acid sequence alignment between SEQ ID NOS 3 and 4 indicates that they share 85%
amino acid sequence identity and 92% similarity, suggesting that AtST2a and AtST2b are functional homologues encoding isoenzymes.
Accordingly, one aspect of the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a plant hydroxyjasmonic acid sulfotransferase enzyme. More particularly, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence preferably selected from the group consisting of SEQ ID N0:1, nucleotide sequences having at least 50% similarity with SEQ ID
N0:1, SEQ ID N0:2, nucleotide sequences having at least 50% similarity with SEQ ID N0:2, and sequences hybridizing under low stringency conditions to one or more of theses sequences.
The nucleic acid molecules contemplated herein may exist in either orientation alone or in combination with a vector and preferably an expression-vector capable of facilitating transfer and expression of the nucleic acid into the plant cell and/or facilitating integration into the plant genome. Such a vector may, for example, be adapted for use in electroporation, microprojectile bombardment, Agrobacterium-mediated transfer or insertion via DNA or RNA viruses. The vector and/or the nucleic acid molecule contained therein may or may not need to be stably integrated into the plant genome. The vector may also replicate and/or express in prokaryotic cells. Preferably, the vector molecules or parts thereof are capable of integration into the plant genome. The nucleic acid molecule and/or the vector may additionally contain a promoter sequence capable of directing expression of the nucleic acid molecule in a plant cell. The nucleic acid molecule and/or the vector may also be introduced into the cell by any number of means such as those described above. The vector may also comprise a genetic sequence encoding a ribozyme capable of cleaving a hydroxyjasmonic acid sulfotransferase mRNA transcript.

The present invention is exemplified using nucleic acid sequences derived from Arabidopsis thaliana since this plant is commonly studied in and it represents a convenient and easily accessible source of material. However, one skilled in the art will immediately appreciate that similar sequences can be isolated from any number of sources such as other plants or certain microorganisms (e.g. fungi or bacteria). All such nucleic acid sequences encoding directly or indirectly a hydroxyjasmonic acid sulfotransferase are encompassed by the present invention regardless of their source. Examples of other suitable sources of genes encoding hydroxyjasmonic acid sulfotransferase include, but are not limited to Brassica napus, Brassica oleracea and Brassica juncea.
i) Flowering induction An aspect of the invention contemplates a plant genetically modified to flower early when compared to a corresponding plant not genetically modified, wherein the genetically modified plant has an increased endogenous level of at least one given compound of the jasmonate family selected preferably from the group consisting of jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12 hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11 hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11 hydroxymethyljasmonic acid, when compared to the corresponding non-genetically modified plant.
In a preferred embodiment, the endogenous level of the selected jasmonate compound is increased by:
a) increasing in the plant the endogenous level of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or b) lowering in the plant the endogenous level of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid.

According to a preferred embodiment of the invention this is achieved by genetically modifying the plant so as to lower the expression or the sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid, and functional homologues of this sulfotransferase. More preferably, the 5 plant is modified for inhibiting or blocking the expression of at least one gene selected from the group consisting of AtST2a, AtST2b and functional homologues of AtST2a or of AtST2b.
Many methods for inhibiting expression of genes in plants are well known in the art, such as techniques using ribozymes, targeted mutagenesis, T-DNA
10 insertion mutagenesis, and antisense techniques to name a few, and these methods could be used to reduce the present invention in practice. According to a preferred embodiment of the invention, the expression of one of the above mentioned gene is inhibited by providing a transgenic plant expressing an exogenous nucleic acid sequence antisense to this gene. More preferably, the 15 endogenous level of the sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid is lowered by expressing into a genetically modified plant an exogenous nucleic acid sequence, the exogenous nucleic acid sequence encoding i) for a nucleic acid sequence antisense to a gene encoding at least one of said sulfotransferases or ii) for a nucleic acid sequence antisense to a 20 fragment of this gene.
Accordingly, another aspect of the invention contemplates a method for producing a transgenic plant with reduced endogenous or existing hydroxyjasmonic acid sulfotransferase activity, such transgenic plant thereby being capable of flowering early. Preferably, the altered level would be less than the endogenous or existing level of activity in a comparable non-transgenic plant.
According to one embodiment, the method comprises the steps of:
a) introducing into a cell of a suitable plant an exogenous nucleic acid molecule comprising a sequence of nucleotides antisense to a sequence encoding a plant hydroxyjasmonic acid sulfotransferase, preferably a 11- or 12 hydroxyjasmonic acid sulfotransferase;
b) regenerating a transgenic plant from the cell; and where necessary c) growing the transgenic plant for a time and under conditions sufficient to permit expression of the antisense sequence and thereby inhibiting expression of the hydroxyjasmonic acid sulfotransferase.
In a related embodiment, the method for producing a transgenic plant with reduced endogenous or existing hydroxyjasmonic acid sulfotransferase activity comprises the step of altering the hydroxyjasmonic acid sulfotransferase gene(s), preferably the 11- or 12-hydroxyjasmonic acid sulfotransferase gene, through modification of the endogenous sequences via homologous recombination from an appropriately altered hydroxyjasmonic acid sulfotransferase gene or derivative or part thereof introduced into the plant cell, and regenerating a transgenic plant from the cell.
ii) Flowerinc~retardation An aspect of the invention contemplates a plant, genetically modified to flower tardily when compared to a corresponding plant not genetically modified, wherein the genetically modified plant has a lowered endogenous level of at least one given compound of the jasmonate family selected preferably from the group consisting jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11-hydroxymethyljasmonic acid, when compared to the corresponding non-genetically modified plant.
In a preferred embodiment, the endogenous level of the selected jasmonate compound is lowered by:
a) lowering in the plant the endogenous level of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or b) increasing in the plant the endogenous level of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid.

According to a preferred embodiment of the invention this is achieved by genetically modifying the plant so as to increase the expression of the sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid, or functional homologues of this sulfotransferase. More preferably, the plant is modified to increase the expression of at least one gene selected from the group consisting of AtST2a, AtST2b and functional homologues of AtST2a or of AtST2b.
Methods for increasing expression of genes in plants are well known in the art, such as activation tagging, transgenesis under the control of a strong promoter, and these methods could be used to reduce the present invention in practice. According to a preferred embodiment of the invention, the expression of one of the above-mentioned genes is increased by expressing into the plant a gene expressing the sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic under the control of a constitutive or an inducible promoter.
Accordingly, another aspect of the invention contemplates a method for producing a transgenic plant with increased endogenous or existing hydroxyjasmonic acid sulfotransferase activity, such transgenic plant thereby being capable of flowering tardily. Preferably, the altered level would be higher than the endogenous or existing level of activity in a comparably non-transgenic plant.
According to a preferred embodiment, the method comprises the step of:
a) introducing into a cell of a suitable plant an exogenous nucleic acid molecule comprising a sequence of nucleotides encoding a plant hydroxyjasmonic acid sulfotransferase, preferably a 11- or 12-hydroxyjasmonic acid sulfotransferase;
b) regenerating a transgenic plant from the cell; and where necessary c) growing the transgenic plant for a time and under conditions sufficient to permit expression of the nucleic acid sequence into a plant hydroxyjasmonic acid sulfotransferase, preferably a 11- or 12-hydroxyjasmonic acid sulfotransferase.
***
The details of the construction of transgenic plants are known to those skilled in the art of plant genetic engineering and do not differ in kind from those practices which have previously been demonstrated to be effective in tobacco, petunia and other model plant species (e.g. electroporation, microprojectile bombardment, Agrobacterium-mediated transfer or insertion via DNA or RNA
viruses). One skilled in the art will immediately recognize the variations applicable to the methods of the present invention, such as increasing or decreasing the expression of the sulfotransferase naturally present in a target plant leading to modulation of flowering to this plant. The present invention, therefore, extends to all transgenic plants containing all or part of the nucleic acid sequence of the present invention, or antisense forms thereof and/or any homologues or related forms thereof and in particular those transgenic plants which exhibit altered flowering properties.
The transgenic plants may contain an introduced nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding a hydroxyjasmonic acid sulfotransferase. Generally, the nucleic acid would be stably introduced into the plant genome, although the present invention also extends to the introduction of a hydroxyjasmonic acid sulfotransferase nucleotide sequence within an autonomously-replicating nucleic acid sequence such as a DNA or RNA virus capable of replicating within the plant cell. The invention also extends to cut flowers and seeds from such transgenic plants.
***
A further aspect of the present invention is directed to an isolated plant hydroxyjasmonic acid sulfotransferase, and more particularly to an isolated hydroxyjasmonic acid sulfotransferase selected from the group of:
a) an enzyme whose amino acid sequence is represented by SEQ ID NO 3 or SEQ ID NO 4; and b) functional homologues of enzyme a), isolated from a plant or derived from enzyme a) by substitution, deletion or addition of one or several amino acids in the amino acid sequences defined in a), and having similar biological activity or function(s).
These enzymes may be purified from plants or produced with routine recombinant techniques using SEQ ID NO 1, SEQ ID NO 2, or portions) thereof.
Various methods of purification and molecular biology techniques for producing recombinant proteins are described in the art such that a skilled technician could obtain these enzymes without large amounts of trial and error, or complicated experimentation. Isolated hydroxyjasmonic acid sulfotransferase will provide a source of material for research to develop, for example, more active enzymes and to produce antibodies binding with affinity thereto.
Accordingly, a related aspect of the invention is directed to antibodies binding with affinity to one or more of the above mentioned hydroxyjasmonic acid sulfotransferases. Persons skilled in the art are aware that antibodies can be made against virtually any protein and should be capable of producing such antibodies using conventional techniques. Antibodies binding to hydroxyjasmonic acid sulfotransferases could be particularly useful in flowering retardation compositions and also for studying the biological activity of this type of enzymes.
EXAMPLES
The following examples are illustrative of the wide range of applicability of the present invention. The invention is not restricted to the control of flowering in Arabidopsis thaliana but can be applied to various plant species. It should readily occur that the recognition of activation or retardation of flowering using the compositions, and methods according to the present invention in connection with other plants not specifically illustrated herein, is readily within the capabilities of one skilled in the art. The following examples are intended only to illustrate the invention and are not intended to limit its scope. Modifications and variations can be made therein without departing from the spirit and scope of the invention.
The following experimental procedures and materials were used for the examples set fort below.
A) Materials And Methods Growing of plants A. thaiiana plants of ecotype Columbia (ColO) and C24 were used for this study. The plants were grown in soil in a growth chamber during a 16-hour photoperiod, at a day-time temperature of 24 °C and a night-time temperature of 20 °C. For some experiments, the plants were grown in magenta boxes under sterile conditions according to the following protocol. Seeds of Arabidopsis thaliana were sterilized fior 5 minutes in a solution containing 1.5% sodium hypochlorite and 0.02% SDS, and washed five times in sterile water. Seeds were vernalized for four days at 4 °C. Seeds were then spread on agar-solidified medium containing Murashige and Skoog salts, 1 % sucrose and vitamins.

Studies using a vector:
For transgenic studies a EcoR1-Hindlll cassette, from the plasmid pBl-525 comprising two CaMV 35S promoters in tandem followed by an AMV translational enhancer and a NOS terminator, was ligated to the plasmid pBl-101 which was 10 previously digested with the same restriction endonucleases. The resulting vector called pBl-101-525 contained two CaMV 35S minimal promoters in tandem followed by an AMV translational enhancer, a NOS terminator and a kanamycin resistance gene. AtST2a cDNA (SEQ ID NO 1; Fig. 7) was cloned both in the sense and the antisense orientation at the BaMHI site in a polylinker lying 15 downstream of the AMV enhancer. Various other promoters may be used to drive the expression of an exogenous gene in a plant. For example the ubiquitin promoter may be used for constitutive expression. Alternatively, inducible promoters may also be used such as the ethanol-inducible promoter or the glucocorticoid-inducible promoter.
Aarobacterium transformation:
A. tumefaciens strain GV3101 pMP90 was transformed with the AtST2a-pBl-101-525 sense and antisense constructs by the method described in Gynheung et al. (1988) Biology Manual, A3:1-19.
Arabidopsis transformation:
A, thaliana plants of ecotype Columbia (ColO) were transformed with Agrobacterium containing the AtST2a gene in the sense orientation by the vacuum infiltration method as described previously in Benchtold et al. (1993), CR
Acad.
Sci. Paris, Life Sciences, 316: 1194. A. thaliana pants or ecotype ~~4 were transformed with the pBl-101-525 vector containing the AtST2a gene in the antisense orientation by the root explant method as described in Valvekans et al.

(1988) Proc Natl Acad Sci USA, 85: 5536. Seeds were collected from the T°
plants, their surface was sterilized and transformants were selected on MS
salt medium containing vitamins and supplemented with 50 Ng/ml of kanamycin. For phenotypic analysis of the transgenic plants, the T2 or T3 seeds were vernalized for four days at 4 °C. Seeds were then spread on agar-solidified medium containing Murashige and Skoog salts, 1 % sucrose and vitamins. Alternatively, the vernalized seeds were planted in soil and grown in a growth chamber under a 16-hour photoperiod, at a day temperature of 24 °C and a night temperature of 20 °C.
Western blot of protein extracts Protein extracts from wildtype and transgenic plants were subjected to 12%
SDS-PAGE. Following electrophoresis, the proteins were transferred to nitrocellulose membranes using a Bio-RadT~~ semidry transblot apparatus according to the manufacturer instructions. Blots were incubated with rabbit anti-ATST2a primary antibodies. Immunodetection was carried on with alkaline phosphatase-conjugated anti rabbits antibodies and the immunodetection kit from Bio-RadT"".
Quantification of endogenous levels of 12-hydroxyiasmonate and 12 hydroxyiasmonate sulfate from Arabidopsis plants i) 72-hydroxyjasmonate Fresh plant material (1 g) was homogenized with 10 ml methanol and 100 ng 12-(2H3)OAc-jasmonate as internal standard, the filtrate was evaporated and acetylated with Py/Ac20 at 20 °C overnight. The evaporated mixture was loaded on a 3 ml DEAE-SephadexT"" A25 columns (Acetate-form, methanol) and the column washed with 3 ml of methanol. After washing with 3 ml of 0.1 M
acetic acid in methanol, fractions eluted with 5 ml of 1 M acetic acid in methanol were collected, evaporated and separated on preparative HPLC and analyzed by GC-MS.
HPLC: EurospherT"" 100-C~8, (5 Nm, 250 x 4 mm), elution with a mixture methanol - 0.2 % acetic acid in H20 (1 : 1) at a flow rate of 1 ml min-, UV
detector 210 nm, fractions between Rt 5-6.5 min were evaporated.

Derivatization: Samples were dissolved in 200 p1 CHC13/N,N-diisopropylethylamine (1 : 1) and derivatized with 10 p1 pentafluorobenzylbromide at 20 °C overnight. The evaporated samples were dissolved in 5 ml n-hexane and passed through a SiOH-column (500mg; Machery-NageIT""). The pentafluorobenzyl esters were eluted with 7 ml n-hexane / diethylether (2 : 1 ), evaporated, dissolved in 100 p1 MeCN and analysed by GC-MS
GC-MS: (GCQ FinniganT""), 70 eV, NCI, ionization gas NH3 , source temperature 140°, column Rtx-5 (30 m x 0.25 mm, 0.25 ~.m film thickness), injection temperature 250°C, interface temperature 275°; Helium 40 cm s-';
splitless injection; column temperature program: 1 min 60°C, 25°min-' to 180° C, 5° min-' to 270° C ,1 min 270 °, 10° min-' to 300°, 25 min 300° .
ii) 12-hydroxyjasmonic acid sulfate The negative ion electrospray (ES) mass spectra were obtained from a FinniganT"" MAT TSQ 7000 instrument (electrospray voltage 4 kV; heated capillary temperature 220 °C; sheath gas: nitrogen) coupled with a Micro-Tech Ultra-Plus MicroLCT"" system equipped with a RP18-column (4 wm, 1x100 mm, UltrasepT"").
For the HPLC a gradient system was used starting from H20:CH3CN 90:10 (each of them containing 0.2% HOAc) to 10:90 within 15 min followed by a 10 min isocratic period at a flow rate of 70 p1 min-'. The collision-induced dissociation (CID) mass spectra during the HPLC run were performed with a collision energy of eV; collision gas: argon, collision pressure: 1.8 x 10-3 Torr. All mass spectra are averaged and background subtracted.
25 B) RESULTS
Example 1: Flowering induction by treating A. thaliana plants with 12-hydroxyjasmonic acid Arabidopsis plants of ecotype Colombia (ColO) were grown in magenta boxes containing phytoagar and vitamins in a growth chamber under a sixteen 30 hour photoperiod at a day-time temperature of 24 degrees and a night-time temperature of 20 degrees for a period of 18 days. The plants were then treated with 10 pM of 12-hydroxyjasmonic acid (Fig. 2B) or with water as a negative control (Fig 2A) for a period of 6 days.
As seen in Figure 2B, plants treated with 12-hydroxyjasmonate flowered earlier (2 days) than the plants treated with water alone. Despite the fact that a treatment with 12-hydroxyjasmonic induces the hydroxyjasmonic acid sulfotransferase, early flowering is observed in the treated plants. The early flowering phenotype might be amplified if the treatment is coupled with an inhibitor of the hydroxyjasmonic acid sulfotransferase.
These results are of great economic importance since they show that it is possible to induce flower formation by the exogenous application of 12 hydroxyjasmonate and/or others compounds of the jasmonate family to crop plants. Therefore it shows that one may induce early flowering when required by a simple application of a selected flower inducer to plants, particularly 12 hydroxyjasmonate.
Example 2: Transgenic plants flowering tardily In this example, A. thaliana plants genetically modified were created by inserting therein a nucleic acid molecule encoding the AtST2a gene in the sense orientation under the control of a constitutive promoter. The results demonstrate that a higher endogenous expression of the hydroxyjasmonic acid sulfotransferase encoded by this gene is effective to delay flowering.
Figure 3 shows the phenotype of wild type non transgenic ColO Arabidopsis plants (WT) as compared to transgenic plants expressing the AtST2a gene under the control of the CaMV35S promoter 27 days after germination (S5, S6, S9, and S16). As shown in Figure 3, expression of AtST2a gene in transgenic Arabidopsis thaliana affects flowering time since all the transgenic lines exhibited delayed flowering as compared with non-transformed plants.
Fig. 4 shows a Western blot of protein extracts of these plants probed with anti-AtST2a antibodies. This figure clearly shows that the length of the delay is correlated with the level of expression of the transgene. This suggests that it is possible to vary the length of the delay by selecting transgenic lines expressing AtST2a at different levels. Delaying flowering time results in increased vegetative growth and biomass which is a major advantage for crop such as lettuce, carrot, cabbage, sugar cane, sugar beet, to mention a few.
Table 1 hereinbelow also shows that a higher endogenous expression of the hydroxyjasmonic acid sulfotransferase results in higher endogenous level of 12-hydroxyjasmonate sulfate in the transgenic line S9.
TABLE 1:
Wildtype (WT) Transgenic (S9) 12-hydroxyjasmonate sulfate211 peak area/g 2234 peak area/g Example 3: Transgenic plants flowering early in non-inductive flowering conditions In this example, A. thaliana plants genetically modified were created by inserting therein a nucleic acid molecule encoding the AtST2a gene in the antisense orientation under the control of a constitutive promoter. The results demonstrate that a lower endogenous expression of the hydroxyjasmonic acid sulfotransferase is effective to induce flowering.
Figure 5 shows the phenotype of wild type Arabidopsis plants of ecotype C24 (WT) as compared to transgenic plants expressing the AtST2a gene in the antisense orientation under the control of the CAMV35S promoter (TL 7-2-5). In this experiment, the plants were grown under short days which is non-inductive for flowering in Arabidopsis thaliana. Under these conditions the wildtype plants will flower after approximately 95 days of vegetative growth. The photograph was taken 65 days after germination and shows clearly an early flowering phenotype for the transgenic plants. As shown in this figure, inhibition of regular expression of the AtST2a gene in transgenic Arabidopsis thaliana affects flowering time since all the transgenic lines exhibited early flowering as compared with non-transformed plants.
Table 2 hereinbelow also shows that a lower endogenous expression of the hydroxyjasmonic acid sulfotransferase results in a higher endogenous level of hydroxyjasmonate and in a lower endogenous level of 12-hydroxyjasmonate sulfate in plants.

TABLE 2:
Wildtype (WT) Transgenic (TL 7-2-5) 12-hydroxyjasmonate 7.7 ng/g 54.1 ng/g 12-hydroxyjasmonate 990 peak area/g 448 peak area/g sulfate I

Interestingly, apart from early flowering, the growth behavior and the size of the transgenic plants could not be distinguished from the non-transformed control 5 plants.
Example 4: Transgenic plants flowering early under favorable flowering conditions Treatment with methyljasmonic acid of wild type Arabidopsis plants grown 10 under favorable flowering day time conditions leads to elevated endogenous levels of both jasmonic acid and 12-hydroxyjasmonic acid (data not shown), conditions which should favor flowering. However, flowering was induced in an extent lower than what was anticipated (data not shown). As it will be explained hereinafter, a highly probable explanation for these results is that AtST2a gene expression is 15 strongly induced under these favorable flowering day time conditions when treated with methyljasmonate thereby blocking the positive effects of the increase level of 12-hydroxyjasmonic acid.
To confirm this hypothesis, 15 days old A, thaliana plants and transgenic plants expressing the AtST2a gene in the antisense orientation under the control 20 of a constitutive promoter were treated with 50 NM methyljasmonic acid for a period of nine days, and the plants were grown under favorable flowering day time conditions.
Figure 6 shows the effect of methyljasmonic acid treatment on the phenotype of wild type non transgenic C24 Arabidopsis plants (WT C24) as 25 compared to transgenic plants expressing the AtST2a in the antisense orientation under the control of the CAMV35S promoter (TL 7-2-5), 24 days after germination.
As shown in this figure, expression of AtST2a in the antisense orientation results in lowered levels of the AtST2 protein and allows the transgenic plants to flower early in presence of methyljasmonic acid.
This confirms that it is preferable, under certain conditions, to genetically modify a plant to induce its flowering prior to apply thereto a product further inducing its flowering.
Example 5: AtST2a gene expression is regulated by 12-hydroxyjasmonate Fifteen days-old Arabidopsis plants (ColO) were grown in magenta boxes in presence or in absence of 12-hydroxyjasmonate for a period of 24 hours. At the end of the incubation period, the plants were frozen in liquid nitrogen, ground to a fine powder and total mRNAs were extracted using the kit from the company QiagenT"". The mRNA extracts were resolved by agarose gel electrophoresis, and transferred by capillarity to a nylon membrane. The blot was probed with the sequence encoding AtST2a.
The results presented in Figure 11 show that 12-hydroxyjasmonic acid induces the expression of the AtST2a gene and that the level of expression is proportional to the amount of inducer. Furthermore, the results show that the level of expression is very low in untreated plants. The induction of AtST2a expression by its substrate suggests that the level of 12-hydroxyjasmonic acid present in the plant is tightly controlled. This result is not surprising considering the important role of 12-hydroxyjasmonic acid in the induction of flowering.
Example 6: Expression of AtST2a is under the control of photoperiod.
Fifteen days old Arabidopsis plants grown under long day conditions were transferred in the dark. At different time intervals, plants were collected, frozen in liquid nitrogen, ground to a fine powder and total mRNAs were extracted using a kit from the company QiagenT"". The mRNA extracts were resolved by agarose gel electrophoresis, and transferred by capillarity to a nylon membrane. The blot was probed with the sequence encoding AtST2a.
The results presented in Figure 12 show that expression of AtST2a increases with time when the plants are kept in the dark reaching significant levels after 8 hours of dark treatment. This result suggests that plants monitor photoperiod by modulating the level of 11- and 12-hydroxyjasmonic acids. When the plants are grown under short day conditions, the increased level of expression of AtST2a leads to the sulfonation of 11- and 12-hydroxyjasmonic acids resulting in delayed flowering. When the plants are grown under long day conditions, AtST2a is not expressed and the levels of 11- and 12-hydroxyjasmonic acids increase resulting in an early flowering time.
CJ CONCLUSION
As shown in the above examples, AtST2a and AtST2b gene expression is induced after the application of 12-hydroxyjasmonate with a maximum of six hours after the beginning of the treatment. This pattern of induction demonstrates that the level of 12-hydroxyjasmonic acid is tightly regulated in vivo suggesting that 12-hydroxyjasmonic acid plays an important role in the plant. AtST2a and AtST2b gene expression is also induced when the plants are grown in the dark. The kinetic of accumulation of AtST2a and AtST2b mRNA is slow with a maximum observed after 12 hours in the dark. Furthermore, there is a fast decrease in AtST2a and AtST2b mRNA levels when the plants are transferred back to light. Taken together, these results suggest that the biological function of AtST2a and AtST2b is to modulate the activity of 12-hydroxyjasmonic acid and 11-hydroxyjasmonic acid in relation to the photoperiod. The model presented in the section "General overview of the invention" integrates the different results obtained and tries to explain the role of the hydroxylated jasmonates and of the AtST2a and AtST2b genes in the control of flowering time. According to this model, 11- and 12-hydroxyjasmonic acids are synthesized slowly into the leaves from jasmonic acid or from early fatty acids precursors. The accumulation of these metabolites up to a threshold value induces flowering. When the plants are growing under short day time conditions, AtST2a and/or AtST2b will be expressed during the night and will inactivate 11- and 12-hydroxyjasmonic acids by sulfonation. This mechanism will retard flowering time until the photoperiod is favorable. When the plants are growing under long day time conditions, the level of expression of AtST2a and/or AtST2b is low and 11- and 12-hydroxyjasmonic acids will accumulate to levels sufficient to induce flowering.

While several embodiments of the invention have been described, it will be understood that the present invention is capable of further modifications, and this application is intended to cover any variations, uses, or adaptations of the invention, following in general the principles of the invention and including such departures from the present disclosure as to come within knowledge or customary practice in the art to which the invention pertains, and as may be applied to the essential features hereinbefore set forth and falling within the scope of the invention or the limits of the appended claims.

obic Richard 8 ROBIC (6e)514 845 8518; 09121!01 14:38; JetFa~c #257;P~~~

SEQUENCE LISTING
<110> VARIN, LUC

GIDDA, SATINDER

<120> METHODS, GENETIC MODULATING
COMPOSITIONS AND SEQUENCES
FOR

FLOWERING IN PLAN?S, PLANTS TFIED TO
AND GENETICALLY FLOWER
MOD

EARLY AND TARLILY .

<130> 29963-0002 <lao> ecicAOOiooaol <141> 2000-07-06 <150> C1~ 2, 274, <151> 1999-0?-06 <I60> 4 <170> PatentIn v~rsion 3.0 <710> 1 <211> 1077 <212> DNA

<213> Arabidopsis thaliana <4D0> 1 atggctacct casgcatgaagagcattccaatggcgatcccaagtttctccatgtgtcac60 aagctcgagc tccttaaagaaggcaaaactcgcgac:gtcccgaaagccgaagaagatgaa120 gqgctaagct gcgagttccaagagatgttggattctcttcctaaggagagaggatggaga180 actcgttacc tttacctattcceagggttttggtgccaagccaaagagatt~aagccatc240 atgtct=zcc eaaaacatttccaatccctcgaaaacgacg~tcgttctegccaccatacct300 aaatccggta caacctggctaaaagctttaactttcaCCatccttaaccgtcaccggttt360 gatccggttg cctcgagtaccaaccaccctcttttcactttcaaccctcatgaccttgta420 cctttcttcg agta~:aagctttacgccaacggagatgttcccgatctctcgggtctagcc480 agtccaagaa cgttcgcaacccacttaccgttcggttccctaaaggaaacqatcqag$aa590 t cccggtgtga aggtcgtgtacttgtgccggaacccgtttgacacattcatctcttcgtgg500 cattacacca acaacatcaaatccgagtcagtgagcccagtcttgctagaccaaqctttt660 -!

gatctgtatt gccggggaqtgatcgggtttggcccqtttt_gggaacacatgttgggatac720 tgyagagaga gcttga~3agaccagagzaagtcttctttttaaggtacgaggatctcaaa78D

gacgacatcq agaccaacttgaagaggcttgcaactttcttagagcttcctttcaccgaa840 gaagaggaac gaaagggagttqtgaaggctstcqccgagctgtgtagcttcgagaatctg900 aa4aagttgg dggt(~aacaagtraaacaagtcgatcaagaacr.ttgagaatcgattcttg960 tttcggaaag qagaagtgagtgattgggttaactatttgtcaccttcacaagtggaaaga1020 i AMENDED SHEET
FmDfanxc7ail 7l.~aD. %Il:;il y obic Richard 8 ROBIC (8e)514 845 8518; 09/21/01 14:38; )etFsz It257;Pw '~'~' ttgtcagcct tagtggatga caagttaggt ggatctggtc tcactttctsg gttgagc 1077 <210> 2 <211> 1041 <212> DNA
<213> Arabidopsis thaliana <900> 2 atggcgatcc caagtttctc catgtgtcac aagcccgagc tccttaagga aggcaaaagc 60 gaaggecaag aagaagaagg gctaagetac gagttccaag agatgttgga ctetettect i20 aaggagagaggacggagaaatcgttacctttacttat=ccaagggtttcgctgccaagct180 aaggagattcaagcta=cacgtctttccaaaaacattttcagtcccttccagacgacgtt240 gtcctcgccaccatacctaaatctggcacaacctggttaaaagctttaactttcaccatc300 cttacccgtcatcggtttgatccggtttcctcatcaagttccgaccaccctcttctcaca360 tccaaccctcacgacctcgtacctttcttcgagtacaagctttacgccaacggaaatgtt420 cccgatctctegggtctagccagtccaagaacattcgcaacccacgtaccgttcggtgcc980 cttaaggattcggtcgagaatcccagtgtgaaggttgtgtacctgtgccggaaCCCgttt540 gacacattcatctccatgtggcattacatcsacaacatcacttccgag=cagtgagcgca600 gtcttgctagacgaagcttttgatctatattgccggggattactgatcggatttggcccg660 tzttgggaacacatyttgggatactggagagagagcttgaagaggccagagaaagtctta?20 cttttaaagtacgaggatcccaaagaagacatcgagaccaacttgaagaagctagcaagt780 tccttaggacttcctttcaccga8gaagaggaacaaaagggagttgtgaaagctatcgct840 gatctgtgtagctttgagaatctgaagaagttggaggtgaacaagtcaagcaaattgatc900 cagaactatgagaaccggttcttgtttaggaaaggagaagtgagtgatttggttaactat960 ttc~tcgCCatcscaagtggaaagattgtcagccttagtggatgacaagttagctggatct1020 ggtctcactttcagattgagt 1091 <2i0> 3 -) <211> 359 <212> eRT
<213> Arabidopsis thaliana <900> 3 ' Met Ala Thr Ser Ser Met Lya~Ser Ile Pro Met Ala Ile Pro Ser phe 1 5 10 . 15 Ser Met Cys His Lys Leu Glu Leu Leu Lys Glu Gly Ly5 Tar Arg Asp 20 25 ~ 30 AMENDED SHEET
Cmnf~neo~oit 9l.Can. ~~:Zl s~ ~bic Richard & R~BIC (6e)514 845 6518; 09/21101 14:38; JetFar #257;P- " "
'~' 3s Val P=o Lys Ala Glu Glu Asp Glu Gly Leu Ser Cys Glu Phe Gln Glu ' 3~ 40 g5 .
M2t Lei Asp Ser Leu Pro Lys Glu Arg Gly Trp Arg Thr Arg Tyr Leu Tyr Leu Phe Gln Gly Phe Trp Cys Gln Ala Lys Glu Ile Gln Ala Ile '05 _ 70 75 80 Met Ser Phe Gln Lys Ais Phe Gln Ser Leu ulu Asn Asp Val Val Leu e5 90 95 T,la Thr Ile Pro Lys Ser Gly Thr Thr Trp Leu Lys Ala Leu Thr Phe ihr Ile Leu Asn Arg His Arg Phe F,sp Pro Val Ala Sar Ser Thr Asn His Pro Len Pha Thr 5er Asn Pro His Asp Leu '!al Pro Phe Phe Glu Tyr Lys Leu Tyr Ala Asn Gly Asp Val Pro Asp Leu Ser Gly Lau Ala 195 150 155 160 ' Ser Pro Arg Thx Phe Ala Thr His Leu Pro Phe Gly Ser Leu Lys Glu l05 170 175 ' Thr Ile Glu Lys Pro G_y Val Lys Val Val Tyr Leu Cys Arg Asn Pro Phe Asp Thr Phe I.Le Ser Ser Trp His Tyr Thr Asn Asn Ile Lys Ser Glu Ser Val Ser P=o Val Leu Leu Asp Gln Ala Phe Asp Leu Tyr Cys r Arg Gly Val Ile Gly Phe Gly Pro Phe Trp Gic His Met Lsu Gly Tyr 225 2.0 235 240 Trp Arg Glu Ser Leu L~ys Arg Pro Glu Lys Val Phe Phe Leu Arg Tyr Glu Asp Leu Lys asp Asp Ile Glu Thr Asn Leu Lys Arg Leu Ala Thr 26D 265 2.70 ~ ' L
Pile Leu Glu Leu Pro Phe Thr Glu Glu Glu Glu Arg Lys Gly Val Val Lys Ala Ile Ala G1~ Leu Cys Ser Phe Glu Asn Lsu Lys Lys Leu Glu 29C 295 3~0 Val Asn Lys Ser Asn Lys Ser Ile Lys Asn Phe Glu Asn Arg Phe Leu 305 . 31a 315 320 Phe Arg Lys GIy Glu Val Ser Asp Trp Val Asn Tyr Lau Ser Fro Ser Gln Va7. Glu Arg Leu Se_~ Ala Leu Val Asp Asp Lys Leu Gly Gly Ser AMENDED SHEET
~mnf~nreTOit 9l.SpD. 711:31 obic Richard 8 ROBIC (6e)514 845 E5i9; 09/21/01 14:38; ]etFax #257;P--- ' ~21-09-2001 CA 02377899 2002-O1-07 CA0000801 -Gly Leu Thr Phe Arg Leu Ser <210> 9 <211> 34?
<212> PRT
<~~13> A;abidopsis thaliana <400> 4 Met Ala Ile Pro Ser Phe Ser Met Cys His Lys Pro Glu I,eu LeU Lys _ 10 15 G,lu G1y Lys Ser Glu G1y Gln Glu Glu Glu Gly Leu Ser Tyr Glu Phe Gln Glu Met Leu Asp Ser Leu Pro Lys Glu Arg Gly Arg Arg Asn Arg Tyr Leu Tyr Leu Phe Gln Gly Phe Arg Cys Gln Ala Lys Jlu Ile Gln Ala lle Thr Ser Phe Gln Lys His Phe Gln Ser Lau Pro Asp Asp Val 65 70 %5 80 Val Le:~ Ala Thr Ile Pro Lys Ser Gly Thr Thr Trp Leu Lys Ala Leu Thr Phe Thr Ile Leu Thr Arg His Arg Phe Asp Pro Va1 Ser 5er Ser Ser Se~ Asp Idis Pro Leu Leu Thr Ser Asn Pro liis Asp Leu 'lal Pro Phe Phe Glu Tyr Lys Leu Tyr Ala Asn Gly Asn Val Pro Asp Leu 3er 130 '135 190 Gly Leu Ala Ser Pro Arg Thr Phe Ala Thr His Val Pro Phe Gly Ala 195 150 . 155 160 Leu Lys Asp Ser Val Glu Asn Pro Ser Val Lys Val Val Tyr Leu Cys Arg Asn Pro Phe Asp Thr. Phe Ile Ser Met Trp His Tyr zle Asn Asn Ile Thr Ser Glu SEr Val Ser Ala Val Leu Leu Asp Glu Ala Phe Asp Lsu Tyr Cys Arg Gly Leu Leu Ile Gly Phe G1y Pro Phe Trp Glu His Met Leu Gly Tyr Trp Arg Glu Ser Leu Lys Arg Pro Glu Lys Val Leu 225 23~~ , 235 , 240 Phe Leu Lys Tyr Glu Asp Leu Lys Glu Asp I_e Glu Thr Aan Leu Lys Lys Leu Ala Se~ Phe Lea Gly Leu Pro Phe Thr G_u Glu Glu Glu Gln AMENDED SHEET
Fmnf~nec~ait 71.~a~. 111:;1 sc~ - ~ -obic Richard & ROBIG 4se)514 845 6518; 09/21101 14:38; jEtFsz #257;P
""""

Lys Gly Val Val Lys Ala Ile Ala Asp Leu Cys Ser ?Ae Glu Asn Leu Lys Lys Leu Glu Val Asn Lys Ser Ser Lys Leu Ile Gln Asn Tyr Glu Asn Ark Phe Leu phe 310 Lys Gly Glu Val Ser Asp i.eu Val Asn Tyr Leu Ser Pro Ser Gln Val GIu.F,rg Leu Ser Ala Leu Val Asp Asp Lys .325 330 l.eu Ala Gly Ser Gly Leu Thr Phe Arg Leu Ser 390 3q5 r AMENDED SHEET
EmPfanbSie~t LI~SeP. LU:31

Claims (51)

CLAIMS:

1. A method for modulating flowering in a plant, comprising modifying in said plant the endogenous level of at least one compound selected from the group consisting of jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, sulfate ester of hydroxyjasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, sulfate ester of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, sulfate ester of hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, glucoside of 11-hydroxymethyljasmonic acid, sulfate ester of 11-hydroxymethyljasmonic acid, and mixtures thereof.

2. The method of claim 1, wherein flowering of said plant is induced by increasing in said plant the endogenous level of at least one flowering inducing compound selected from the group consisting of jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11-hydroxymethyljasmonic acid, said flowering induction and said endogenous level increase being compared to a corresponding plant wherein the endogenous level of said at least one compound has not been modified.

3. The method of claim 2, wherein the endogenous level of said at least one flowering inducing compound is increased by a method selected from the group consisting of:

a) applying to said plant at least one of said flowering inducing compounds and/or salts thereof;
b) applying to said plant at least one inhibitor of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic; and c) applying to said plant at least one stimulator of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid.

4. The method of claim 2, wherein the endogenous level of said at least one flowering inducing compound is increased by:
a) increasing in said plant the endogenous level of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or b) lowering in said plant the endogenous level of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic.

5. The method of claim 4, wherein the endogenous level of the sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic is lowered subsequently to a genetic modification of said plant.

6. The method of claim 5, wherein said genetic modification comprises the step of inhibiting the expression of at least one gene selected from the group consisting of AtST2a, AtST2b and functional homologues of AtST2a or of AtST2b.

7. The method of claim 6, wherein said gene expression is inhibited by expressing into said plant an exogenous sequence coding for a nucleic acid sequence antisense to said gene.

8. The method of claim 7, wherein said exogenous sequence is expressed under the control of a constitutive or an inducible promoter.

9. The method of any one of claims 5 to 8, wherein said plant is transgenic.

10. The method of claim 3, wherein said plant has been genetically modified to flower early prior application thereto of said flowering compound(s), said sulfotransferase inhibitor(s) and/or said hydroxylase stimulator(s).

11. The method of any one of claims 2 to 10, wherein said plant is selected from crop plants.

12. A plant genetically modified to flower early when compared to a corresponding plant not genetically modified, said genetically modified plant having an increased endogenous level of jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate.
jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11-hydroxymethyljasmonic acid, when compared to said corresponding non-genetically modified plant.

13. The plant of claim 12, wherein said genetic modification comprises:
a) increasing in said genetically modified plant the endogenous level an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or b) lowering in said genetically modified plant the endogenous level of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic.

14. The genetically modified plant of claim 12 or 13, wherein said genetic modification comprises inhibiting the expression of at least one gene selected from the group consisting of AtST2a, AtST2b and functional homologues of AtST2a or of AtST2b:

15. The genetically modified plant of claim 13, wherein the endogenous level of the sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic is lowered by expressing into said plant an exogenous nucleic acid sequence, said exagenous nucleic acid sequence encoding: i) for a nucleic acid sequence antisense to a gene encoding at least one of said sulfotransferases; or ii) for a nucleic acid sequence antisense to a portion of said gene.

16. The genetically modified plant of claim 15, wherein said exogenous sequence is expressed under the control of a constitutive or inducible promoter.

17. The genetically modified plant of any one of claims 12 to 16, wherein said plant is transgenic.

18. A cut flower from the genetically modified plant of any one of claims 12 to 17.

19. A composition for inducing flowering in a plant comprising a flowering inducing effective amount of a compound selected from the group consisting of, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, giucoside of 12-hydroxyjasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxyrnethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyijasmonic acid, glucoside of 11-hydroxymethyljasmonic acid, salts thereof, and mixtures thereof, in combination with a diluent or a carrier such that an induction in flowering of said plant occurs when compared to a corresponding plant in the absence of said composition.

20. The composition of claim 19, further comprising a compound selected from the group consisting of fertilizers, growth regulators, fungicides, insecticides, emulsifying agents and mixtures thereof.

21. The method of claim 1, wherein flowering of said plant is delayed by lowering in said plant the endogenous level of at least one compound selected from the group consisting of jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, Jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethylJasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 12-hydroxymethyljasmonic acid, said flowering delay and said lower endogenous level being compared to a corresponding plant wherein the endogenous level of said at least one compound has not been modified.

22. The method of claim 21, wherein the endogenous level of said at least one compound is lowered by:

a) applying to said plant an inhibitor and/or an inactivator of at least one of said compounds;
b) applying to said plant at least one stimulator of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic; and/or c) applying to said plant at least one inhibitor of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid.

23. The method of claim 21, wherein the endogenous level of said at least one compound is lowered by:

a) towering in said plant the endogenous level of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or b) increasing in said plant the endogenous level of a sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic acid.

24. The method of claim 23, wherein the endogenous level of said sutfotransferase is increased subsequently to a genetic modification in the genome of said plant.

44 26. The method of claim 24, wherein said genetic modification comprises the steps of increasing the expression of at least one gene selected from the group consisting of AtST2a, AtST2b and functional homologues of AtST2a or of AtST2b.

26. The method of claim 25, wherein said gene expression is increased by placing said gene under the control of a constitutive or of an inducible promoter.

27. The method of any one of claims 21 to 26, wherein said plant is transgenic.

28. The method of claim 22, wherein said plant has been genetically modified to flower lately prior application thereto of said compound(s), said sulfotransferase stimulator(s) and/or said hydroxylase inhibitor(s).

29. A plant genetically modified to flower tardily when compared to a corresponding plant not genetically modified, said genetically modified plant having a lowered endogenous level of at least one compound selected from the group consisting of jasmonic acid, jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, methyljasmonic acid, 12-hydroxymethyljasmonic acid, glucoside of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic add, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11-hydroxymethyljasmonic acid, when compared to said corresponding non-genetically modified plant.

30. The plant of claim 29, wherein said genetic modification comprises:

a) lowering in said genetically modified plant the endogenous level of an hydroxylase hydroxylating jasmonic acid and/or methyljasmonic acid; and/or b) increasing in said genetically modified plant the endogenous level a sulfotransferase sulfonating 12-hydroxyjasrnonic acid and/or 11-hydroxyjasmonic.

31. The genetically modified plant of claims 29 or 30, wherein said genetic modification comprises increasing the expression of at least one gene selected from the group consisting of AtST2a, AtST2b and functional homologues of AtST2a or AtST2b.

32. The genetically modified plant of claim 30, wherein the endogenous level of the sulfotransferase sulfonating 12-hydroxyjasmonic acid and/or 11-hydroxyjasmonic is increased by expressing into said genetically modified plant a nucleic acid sequence encoding said sulfotransferase under the control of a constitutive or an inducible promoter.

33. The genetically modified plant of any one of claims 29 to 32, wherein said plant is transgenic.

34. A composition for delaying flowering in a plant comprising a flowering delaying effective amount of an inhibitor or of an inactivator of a compound selected from the group consisting of jasmonic acid-tyrosine conjugate, jasmonic acid-tryptophan conjugate, jasmonic acid-phenylalanine conjugate, jasmonic acid-isoleucine conjugate, jasmonic acid-leucine conjugate, jasmonic acid-valine conjugate, 12-hydroxyjasmonic acid, glucoside of 12-hydroxyjasmonic acid, 12-hydroxymethyljasmonic acid, glucaslde of 12-hydroxymethyljasmonic acid, 11-hydroxyjasmonic acid, glucoside of 11-hydroxyjasmonic acid, 11-hydroxymethyljasmonic acid, and glucoside of 11-hydroxymethyljasmonic acid, in combination with a diluent or a carrier such that a delay in flowering of said plant occurs when compared to a corresponding plant in the absence of said composition.

35. The composition of claim 34, further comprising a compound selected from the group consisting of fertilizers, growth regulators, fungicides, insecticides, emulsifying agents and mixtures thereof.

36. An isolated ar purified nucleic acid molecule encoding a punt 11-hydroxyjasmonic acid or 12-hydroxyjasmonic acid sulfotransferase.

37. The isolated nucleic acid molecule of claim 36, comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1, nucleotide sequences having at least 50% similarity with SEQ ID N0:1, SEQ ID NO:2, nucleotide sequences having at least 50% similarity with SEQ ID NO:2 end nucleotide sequences complementary thereto.

38. The isolated nucleic acid molecule of claim 36, comprising a nucleotide sequence which hybridizes under low stringency conditions to a nucleotide sequence selected from the group consisting of SEQ ID NO:1, a complementary strand of SEQ ID NO:1, SEQ ID NO:2 and a complementary strand of SEQ ID NO:2.

39. The isolated nucleic acid molecule of any one of claims 36 to 38, wherein the hydroxyjasmonic acid sulfotransferase is of Arabidopsis thaliana origin.

40. A vector comprising the nucleic acid molecule of any one of claims 36 to 39.

41. The vector of claim 40, wherein the vector is capable of replication and expression in a plant cell.

42. A transgenic plant comprising the nucleic acid molecule of any one of claims 36 to 39.

43. A method for producing a transgenic plant capable to flower early, said method comprising the steps of:

a) introducing into a cell of a suitable plant an exogenous nucleic acid molecule comprising a sequence of nucleotides antisense to a sequence encoding a plant hydroxyjasmonic acid sulfotransferase;

b) regenerating a transgenic plant from the cell; and c) growing said transgenic plant for a time and under conditions sufficient to inhibit expression of the hydroxyjasmonic acid sulfotransferase.

44. The method of claim 43, wherein the exogenous nucleic acid molecule comprises a nucleotide sequence antisense to a nucleotide sequence selected from the group consisting of SEO ID NO:1, nucleotide sequences having at least 50% similarity with SEQ ID NO:1, SEQ ID NO:2 and nucleotide sequences having at least 50% similarity with SEQ ID NO:2.

45. A method for producing a transgenic plant capable to flower tardily, said method comprising the steps of:

a) introducing into a cell of a suitable plant an exogenous nucleic acid molecule encoding a plant hydroxyjasmonic acid sulfotransferase;

b) regenerating a transgenic plant from the cell; and c) growing said transgenic plant for a time and under conditions sufficient to permit expression of the nucleic acid sequence into an hydroxyjasmonic acid sulfotransferase.

46. The method of claim 45, wherein the exogenous nucleic acid molecule comprises a nucleotide sequence selected from the group insisting of: SEQ ID
NO:1, nucleotide sequences having at least 50% similarity with SEQ ID NO:1, SEQ ID NO:2 and nucleotide sequences having at least 50% similarity With SEQ
ID NO:2.

47. The method of any one of claims 43 to 46, wherein the hydroxyjasmonic acid sulfotransferase is a 11- or a 12- hydroxyjasmonic acid sulfotransferase.

48. An isolated or purified polypeptide having the biological activity of a plant 11-hydroxyjasmonic acid or 12-hydroxyjasmonic acid sulfotransferase.

49. The polypeptide of claim 48, encoding a sulfotransferase enzyme selected from the group consisting of:

a) an enzyme whose amino acid sequence is represented by SEQ ID NO: 3 or SEQ ID NO: 4; and b) functional homologues of enzyme a) isolated from a plant, or derived from enzyme a) by substitution, deletion or addition of one or several amino acids in the amino acid sequences defined in a) and having similar biological activity or function(s).

50. An antibody binding with affinity to a polypeptide as defined in claim 48 or 49.

51. The antibody of claim 50 used for delaying flowering in a plant.