CA2350749A1 - Immortalized brain endothelial cells - Google Patents

Abstract

A brain microvessel endothelial cell having a Middle-T antigen gene from papovirus is disclosed. The brain microvessel endothelial cell exhibits norm al cell phenotype, maintains the phenotype in culture and forms monolayers substantially impermeable to low molecular weight molecules. The cells are useful for in vitro studies involving the blood brain barrier. Also disclose d are methods of using and processes of making these cells.

Description

I
Immortalized Brsin Endothelial Cells s Related Applications This international application claims priority to U.S. Application Ser. No. 09/200,063, filed November 25, l0 1998.
Technical Field of Invention The invention relates to immortalized cellular clones Is of brain microvessel endothelial cells produced by transfection with a plasmid containing the middle-T antigen gene from polyoma virus. The cells described herein display and maintain an endothelial cell phenotype and spontaneously form confluent monolayers substantially impermeable to small 20 molecules. The cells are therefore useful for in vitro models studying the blood brain barrier.
Background of the Invention 2s The blood brain barrier (BBB) is composed of brain microvessel endothelial cells (referred to hereafter as BMECs) and acts as a regulatory interface for permeability of drugs and solutes between the blood and central nervous system (CNS). Isolation and culture of BMECs have led to the 30 development of in vitro model systems for studying the BBB
(Bowman et. al, 1983, Audus and Borchardt, 1986).

In vitro BBB model systems have been successfully derived from bovine, canine, human, murine, porcine, and rat brains and were found to have similar permeability properties due to similarity of the physiological characteristics of the BBB among all mammals (Cserr et al, 1984, Audus et al, 1990).
In these models, BMECs retain the characteristics of brain endothelial cells in vivo including morphology, specific BBB
enzyme markers, and tight intercellular junctions which can l0 be useful for studying a variety of CNS drug delivery issues ranging from passive diffusion, carrier mediated transport, and metabolism to specific factors affecting the BBB
permeability. However, passaging of BMECs results in loss of specific endothelial and BBB markers as well as tight intercellular junctions (Brightman and Neuwelt, 1989).
Presently, only primary cultures of BMECs have been developed to address the BBB permeability issues in vitro.
Isolated and cultured primary brain cells developed previously have exhibited different properties primarily due to considerable variety in the starting material. For example, with respect to transcellular transport, rigorous comparison of data between different laboratories has been very difficult (Pardridge et al., 1990, Masereeuw et al., 1999). Passaging primary cells can affect the differentiation of cells and lead to the selection of the most rapidly proliferating clones. Furthermore, the expression of some marker enzymes such as gamma-glutmayl transpeptidase as well as tight functional complexity has been shown to decrease wo oom2ao PcTius~nosos with time in culture and passage number (Meresse et. al., 1989) .
Papoviruses such as SV-40 and polyoma virus are known to produce tumors in rodents. The polyoma virus DNA sequence has been determined and the 'early region' which includes the small, middle and large T antigens has been indicated to be responsible for tumor formation. See Soeda et al., 1980, incorporated herein by reference. Previous methods using the SV 40 large T antigen gene disclose immortalization of bovine brain capillary endothelial cells in which the cells retain the differentiated phenotype and appear morphologically normal (Durieu-Trautmann et al., 1991). Fetal rat stems cells transfected with the middle T antigen gene produced two cell lines of endothelial cells that were not oncogenic, however, these cell lines do not spontaneously form a barrier to small hydrophilic molecules (Juillerat-Jeanneret et al., 1992).
Thus, it is apparent that the presently available clones of immortalized BMEC cultures suffer from individual drawbacks in terms of phenotype expression and homogeneic maintenance of that expression. This leads to difficulties with respect to accuracy and reproducibility in studies utilizing BMECs.
Summary of the Invention All of the above factors provide a strong incentive for the development of immortalized BMECs capable of maintaining a differentiated phenotype in culture and therefore, measurements such as permeability can be made without the need for repeated isolations of BMECs. The BMECs of the present invention provide a convenient, ready-to-use bank of cells as an efficient alternative to the use primary BMECs.
It is therefore an object of the invention to provide immortalized BMECs possessing a nucleic acid sequence encoding the middle-T antigen gene from a papovirus, such cells are capable of forming monolayers substantially impermeable to low molecular weight molecules. In preferred embodiments, there are provided BMECs having the middle-T
antigen gene from the polyoma papovirus.
It is a further object of the present invention to provide a method of using the BMECs described herein for measuring permeability via passive diffusion or active transport, carrier mediated transport, efflux transport system such as P-glycoprotein and multi-drug resistance associated proteins (MRP), and metabolism of substances crossing the blood brain barrier such as pharmaceuticals.
It is yet a further object of the present invention to provide a process of making the immortalized BMECs described herein by providing primary culture BMECs, subsequently transfecting them with a vector containing the middle-T
antigen gene from a papovirus, incubating the vectors and cells and subsequently isolating the immortalized BMECs possessing the middle-T antigen nucleic acid sequence.
These and other objectives will be readily appreciated by those of ordinary skill in the art based upon the following detailed disclosure of this invention.

Brief Description of the Drawings Fig. 1 . shows results of the PCR amplification performed various primers from the polyoma middle-T antigen coding region.
Fig. 2 . shows morphology BMEC by light microscopy (200x).
Fig. 3 . shows morphology of TBMEC, pll by light microscopy (200x) .
Detailed Description of the Invention The subject cell line referred to herein as TBMEC,P11 has the A.T.C.C. designation number CRL-12414 having been deposited on October 7, 1997.
The present invention relates to immortalized BMECs, preferably mammalian BMECs, more preferably bovine BMECs, processes of making and methods of using these cells. For the first time, the present invention provides BMECs with the capability of preserving a fully differentiated phenotype and thus, the endothelial nature of these cells. This is accomplished by transfecting the BMECs with a vector such as a plasmid, containing the entire coding region of middle-T
antigen gene from papoviruses such as polyoma or SV40. In preferred embodiments, there are provided a plasmid which carries the nucleic acid sequence encoding Middle T antigen from polyoma virus, such plasmid referred to herein as polyoma middle T (pyMT). Clones of the transfected cells are characterized in that they express and retain their differentiated phenotype. The BMECs according to the present invention grow as monolayers and show substantial impermeability to small substances imparted by their ability to form confluent monolayers. The aforementioned substances include low molecular weight hydrophilic and lipophilic pharmaceuticals and other chemicals. Examples of these low molecular weight molecules include:
acetylsalicylic acid, acyclovir, aminopyrine, caffeine, chlorpromazine, cimetidine, clonidine, corticosterone, desipramine, diazepam, dopamine, estradiol, hydrocortisone, indomethacin, mannitol, methyl scopolamine, nicotine, phenytoin, pirenzepine, progesterone, propranolol, salicylic acid, scopolamine, sucrose, sulfasalazine, terbutaline, testosterone, uracil, dexamethasone, urea, warfarin, bremazocine, meloxicam, nevirapine, ranitidine, didanosine, zalcitabine, stavudine and Saquinavir.
The term "differentiated phenotype" as used in the present invention shall be understood to mean BMECs forming continuous monolayers of oblong contact inhibited cells.
The term "substantially impermeable" as used in the present invention shall be understood to mean having low permeability coefficients similar to that of sucrose, a non-metabolizable paracellular marker.
Immortalized BMECs produced by transfection with a plasmid containing the middle-T antigen gene from polyoma virus displayed a non-transformed endothelial cell phenotype, i.e., they stained for phenotypical genetic markers such as Factor VIII and LDL receptor, and retained tight junction formation and permeability characteristics.
Cell morphology of one of the BMEC clones according to the present invention, TBMEC,P11 and BMEC cultures was examined with a microscope using phase contrast optics.
TBMEC,P11 cells form continuous non-overlapping tightly packed monolayers of contact inhibited oblong cells with similar morphology to the primary BMECs when grown on collagen-coated and fibronectin treated petri dishes. With respect to studying maintenance of differentiated endothelial phenotype, the TBMEC,P11 was grown as monolayers in Transwell° plates and the permeability of sucrose, a non-metabolizable paracellular marker, was measured in primary BMECS and the TBMEC,P11 and was shown to be comparable. The permeability coefficient values for acyclovir and leucine were also shown to be comparable at similar concentrations.
See Example 4.
It is therefore also an object of the present invention to provide a method of measuring blood brain barrier permeability of a substance by providing BMECs according to the invention in one or more confluent monolayers, contacting the substance with said confluent monolayer(s); and measuring the amount of said substance permeated across the BMEC monolayer(s). The method can measure passive diffusion or active transport and in addition can be varied, as appreciated by those skilled in the art, to perform characteristic measurements such as carrier mediated transport wherein permeability values as described in Example 3 are measured as a function of concentration of the solute or in the presence of ATP inhibitors such as sodium azide.
Efflux transport can be measured wherein measuring permeability values as described in Example 3 is performed in the presence of inhibitors of the efflux pumps such as, but not limited to, cyclosporin-A, dexamethasone, digoxin, FK506, methadone, phenytoin, prazosin, quinidine, rhodamine 123, tamoxifen, verapamil, and yohimibine as well as all those listed by Seelig 1997, incorporated herein by reference. The methods of the present invention can also be used to measure blood brain barrier metabolism of a substance by measuring permeability values as described in Example 3 and profiling the metabolic degradation of compounds of interest as a function of time using quantitative analytical techniques t5 such as high pressure liquid chromatography and mass spectrometry.
Immortalized BMECs provided by the present invention can be prepared by the following general method:
Primary cultures of BMECs can be prepared according to known methods. One example is bovine brain endothelium prepared from fresh calf brains as described previously (Audus and Borchardt, 1986). Briefly, three to four freshly excised bovine brains were purchased from a local slaughter house and transported to the laboratory in ice cold MEM. The capillaries and meninges were removed from each brain and the gray matter was scraped off and minced. The gray matter suspension was treated with protease and collagenase/dispase to separate the endothelial cells from the fat, myelin, and other cells. Microvessel endothelial cells were collected from a Percoll gradient, washed with MEM, and pelleted. They were then resuspended in a culture medium made of approximate equal parts MEM and F-12 Ham nutrient mix containing about 20~ horse serum and about 5% DMSO and frozen under liquid nitrogen for 0 - 12 months, preferably not more then six months.
The BMECs above are then transfected as follows:
The BMECs are transfected~with a plasmid containing the middle-T antigen gene from polyoma virus. The plasmid pyMT
(see example 5) carries the entire coding region of the Middle T antigen from polyoma virus {Soeda et al., 1980).
Here, both the pSV2 neo plasmid, which carries the neo gene (Southern and Berg) for resistance to the aminoglycoside 6418, and the pyMT plasmid were cotransfected into .a primary stock of BMECs at about 50~ confluency. About 20ug of each vector was used in a calcium phosphate transfection procedure. Plasmids were allowed to incubate with the cells for about 30 minutes at room temperature and then incubated in complete culture medium for about 2.5 hours at about 37°C.
The complete culture medium was made up of equal parts MEM
and F-12 Ham nutrient mix containing amphotericin B (2.5 ug/mL), ECGS (15 ug/mL), HEPES (10 mM), horse serum (l00), penicillin (100 Units/mL), polymoxin B (50 ug/mL), and streptomycin (100 ug/mL). After about 3 hours the cells were subjected to a DMSO (10~) osmotic shock for about 10 minutes.
The cells are then washed, preferably about 7 times, with complete culture medium and returned to the incubator. Cells were split 1:1 into complete culture medium supplemented with 6418 (300ug/ml, activity) after they reached confluency (about 48 hours). Selective medium was changed about every 2 to 3 days. Foci appeared within 10 days. The foci were trypsinized, pooled and cultured through several passages.
All clones had normal phenotypes but more regular and faster dividing time than the original primary BMECs (Figure 2B).
One of these clones, named TBMEC,P11 was further 5 characterized and used in permeability experiments.
In order that this invention be more fully understood, the following examples are set forth. These examples are for the purpose of illustrating preferred embodiments of this invention, and are not to be construed as 10 limiting the scope of the invention in any way.
Example 1 Detection of pyMT gene in TBMEC,P11 The presence of PyMT gene in TBMEC,P11 cells was IS determined by polymerase chain reaction (PCR). Genomic DNA
was extracted from non-transfected (WT) and transfected (TX) BMEC and used at 10 ng/ml for PCR amplification. PyMT
plasmid DNA was used as a positive control. The primers used for PCR amplification were as follows and were based on the published sequence (Soeda et. al, 1980).
230(S) - 5'CCCAGACAACTATGGGGGGAT 3' 281(S) - 5'CAGTCACTGCTACTGCACCCA 3' 971(S) - 5'GCAACCCGACCTATTCTGTTA 3' 660(AS) - 5'CGGGTTGGTGTTCCAAACCAT 3' 1030(AS)- 5'GTTGGAGAACTCGGGTTGGGG 3' 1150(AS) - 5'CCAGCTGGTCTTGGTCGCTTT 3' PCR reactions were set up using 45 ul PCR Supermix (Gibco BRL), 2.5 ul each of the sense (S) and antisense (AS) primers (20uM stock) and 10u1 of template DNA (lOng/ml). Thirty cycles of PCR amplification was performed by melting DNA at 95°C for 1 min, annealing at 50°C for 1 min and extending at 72°C for lmin for each cycle using GeneAmp PCR System 9600 (Perkin Elmer). After 30 cycles, the final extension was performed for 7 mins at 72°C and the products were resolved using 1.0$ agarose gels Detection of transfected pyMT gene encoding Middle T
Antigen:
Since TBMEC,P11 cells were co-transfected with a target DNA (pyMT) and a plasmid containing a selectable marker (pSV2neo), and then selected for 6418 antibiotic resistance, it was preferable to detect pyMT gene in G918-resistant clones. Results of the PCR amplification performed using various primers from the polyoma middle T antigen coding region are shown in Figure 1. Set A represents t5 amplification using primers 230(S) and 1030(AS) generating a PCR product of 701 bp, set B using primers 230(S) and 1150(AS) for a product of 821 bp, set C using primers 281(S) and 660(AS) for a product of 380 by and set D represents amplification using primers 971(S) and 1150(AS) giving rise to a PCR product of 180 bp. PCR amplification was detected only in the reactions where PyMT plasmid DNA and genomic DNA
from transfected cells were used as templates. Template DNA
from non-transfected BMEC cells did not show PCR
amplification. These results confirm the presence of PyMT
gene in TBMEC,P11 cells selected for 6418 resistance.

WO 00/31240 PCT/US99/2080$

Example 2 Histochemical Teehaiques Low density lipoprotein (LDL) uptake and Factor VIII
antigen and gamma-glutamyl transpeptidase expression, specific markers found only in endothelial cells, were examined by immunohistochemical techniques. Cells were grown to near confluence on non-autofluorescent 25 mm plastic dishes. Uptake of acetylated low density lipoprotein labelled with l,l'=dioctadecyl-3,3,3',3'-tetramethylinocabocyanine perchlorate (DiI-Ac-LDL) at l0ug/ml in PBS was performed for 4h at 37°C. The cells were examined by fluorescence microscopy. Negative controls used 50~ rabbit serum in HBSS as a substitute for the primary antibody.
BMECs grown in culture were also shown to stain IS histochemically positive for alkaline phosphatase, an enzyme marker for brain endothelial cells.
Example 3 Permeability Experiments BMEC and TBMEC,P11 cells were seeded at densities of 75,000 and 60,000 cells/mL respectively, onto polycarbonate filters in Transwell~,6-well plates (Costar Transwell° 12mm diameter, 0.4um pore size, Corning Costar Corp., Cambridge, MA) and were cultured in complete culture medium. The plates were maintained in an incubator at 37 °C and 5~ C02 and were used for permeability experiments within 10 to 12 days postseeding for BMEC cells and 4 to 6 days postseeding for TBMEC,P11 cells.

Drug solutions were prepared in HBSS. All drug solutions also contained 0.lmM of sucrose (~0.15uCi/mL of radiolabeled) as an internal standard paracellular marker. The permeability of sucrose for each well was determined along with that of the compound of interest to ascertain the confluence of the monolayers. Transport rates for both the monolayers and the filters' were then determined by taking samples at discrete time intervals and plotting the cumulative amount permeated as a function of time. Samples were analyzed by HPLC (Hewlett Packard, HP 1090) or counted on a liquid scintillation counter (Packard, Tri-Carb, A2700).
Monolayers were deemed to be confluent and acceptable for permeability measurements when sucrose leakage was less than 15$ per hour.
Permeability coefficients were then determined according to equation 1:
P = J/ACo (1) where J was the rate of appearance of the drug in the receiver chamber, Co was the initial concentration of the drug in the donor chamber, and A was the surface area of the filter. The .in vitro BBB permeability was reported as the permeability coefficient of drugs across the monolayers, Pm, and was determined according to equation 2:
1/Pm = 1/Pe - 1/Pf (2) where Pe was the effective permeability coefficient across the monolayer and the filter and Pf was the permeability coefficient across the filter only. Permeability measurements were done in at least triplicates for each compound.
Example 4 Permeability Measurements Transmembrane permeability of TBMEC,P11 monolayers was quantitated by sucrose, a non-metabolizable, membrane impermeant marker. The permeability coefficients of O.1M
sucrose solutions in HBSS for TBMEC,P11 monolayers compared to BMEC monolayers are presented in Table 1.
P x 105 (cm/sec) Com ound TBMEC-11 BMEC

Sucrose 2.6 t 0.6 3.3 f 0.6 Permeability of Select Compounds:
The permeability coefficients of acyclovir and leucine at O.1M in TBMEC,P11 and BMEC monolayers are shown in Table II. It can be seen that the permeability coefficients for these compounds in both transfected and primary cells are similar. These results demonstrate that the BMECs according to the present invention form monolayers substantially impermeable to low molecular weight molecules.
P x 105 (cm/sec) Com ound TBMEC-11 BMEC

A clovir 5.2 t 0.6 3.9 t 1.0 Leucine 6.1 t 2.2 4.3 t 3.9 Example 5 Construction of plasmid pyMT
5 Construction of a modified polyoma virus early region encoding only the middle-T protein was made by the methods as described by Treisman, Novak, Favaloro and Kamen, Nature, Vol 292, 13 August 1981, incorporated herein by reference.
10 In brief, a recombinant plasmid containing the full length viral (polyoma) wild type viral DNA was cut with the endonuclease Ava 1 to remove an intervening sequence that contained the middle-T antigen coding region.
This fragment was ligated into a recombinant ampicillin-15 resistant vector, at sites previously cut with Msp 1 plus Ava 1 and dephosphorylated with calf alkaline phosphatase. The ligation product was transfected into E. coli strain HB101, and ampicillin-resistant colonies were selected. Small preparations of DNA was prepared from the resulting colonies and digested with AvaI, AvaII, Hinfl and MspI and run on agarose-polyacrylamide gels to determine that the colonies contained the middle-T coding region fragment. A colony containing the appropriate digestion pattern by electrophoresis was termed pPyMTl and propagated to produce milligram quantities of DNA by cesium chloride gradient purification, for transfection of mammalian cells. Studies from the reference cited above had determined that this recombinant plasmid containing the middle-T antigen could transform Fisher rat cells (F2408 cell line). Cells wo oor~izao Pcnus99noao8 transfected with the pPyMTl plasmid alone formed foci, grew poorly on plastic and grew poorly at low density.
REFERENCES
Audus, Ii. L., Bartel, R.L., Hidalgo, I.J., and Borchardt, R.T., The use of cultured epithelial and endothelial cells for drug transport and metabolism studies, Pharm. Res. 7, l0 435-451 (1990) Masereeuw, R.; Jaehde, U.: Langemeijer, M.W.E.; de Boer, A.G.; Breimer, D.D. In vitro and in vivo transport of zidovudine (AZT) across the blood-brain barrier and the effect of transport inhibitors. Pharm. Res. 1994, 11, 324-330.
Meresse, S., Dehouck, M-P., Delorme, P., Bensa3d, M., Tauber, J-P., Delbart, C., Fruchart, J-C., and Ceccelli, R., Bovine brain endothelial cells express tight junctions and monoamine oxidase activity in long-term culture, J. Neuorchem. 53, 1363-1371 (1989) Pardridge, W.M., Triguero, D., Yang, J., and Cancilla, P.A., Comparison of in vitro and in vivo models of drug transcytosis through the blood-brain barrier, J. Pharmacol.
Exp. Thera. 253, 884-891 (1990) Soeda, E., Arrand, J.R., Smolar, N., Walsh, J.E., and Griffin, B.E., Nature 283, 445-953 (1980) Cserr, H.F. and Bindgaard, M., Blood-brain interfaces in vertebrates: a comparative approach, Am. J. Physiol. 296, 8277-8288 (1984) Juillerat-Jeanneret, L., Aguzzi, A, Wiestler, O.D., Darekar, P., ands Jnazer, R.C., Dexamethasone selectively regulates the activity of enzymatic markers of cerebral endothelial cells lines, In Vitro Cell Dev. Biol. 28A, 537-543 (1992) Soeda E., Arrand, J.R., Smolar, N., Walsh, J.E., and Griffin, B.E., Coding potential and regulatory signals of the polyoma virus genome, Nature, 283, 445-453 (1980) Durieu-Tautmann, O., Foignant-Chaverot, N., Perdomo, J., Gounon, P., Strosberg, A.D., and Conrad, P.O., Immortalization of brain capillary endothelial cells with maintenance of structural characteristics of the blood-brain barrier endothelium, In vitro Cell. Dev. B.io. 27A, 771-778 (1991) Seelig, A., A general pattern for substrate recognition by P-glycoprotein, Eur. J. Bioch. 251, 252-261 (1998) Treisman, R., Novak, U., Favaloro, J. & Kamen, R.
Transformation of rat cells by an altered polyoma virus genome expressing only the middle-T protein. Nature, 292, 595-600 (1981) .

WO 00/31?s10 PCTNS99/Z0808 SEQUENCE LISTING
<110> Yazdanian, Mehran Bormann, Barbara J
-<120> IMMORTALIZED BRAIN ENDOTHELIAL CELLS
<130> 9/139 PCT
<140> 09/200,063 .._ <141> 1998-11-25 <160> 2 <170> PatentIn Ver. 2.0 <210> 1 <211> 5297 <2I2> DNA
<213> Polyomavirus sp.
-:
<220>
<221> gene <222> (1)..(5297) <223> Polyoma T-antigen <900> 1 gggggcccct ggcctccgct tactctggag aaaaagaaga gaggcattgt agaggcttcc 60 agaggcaacttgtcaaaacaggactggcgccttggaggcgctgtggggccacccaaattg120 atataattaagccccaaccgcctcttcccgcctcatttcagcctcaccaccatcatggat180 agagttctgagcagagctgacaaagaaaggctgctagaacttctaaaacttcccagacaa290 ctatggggggattttggaagaatgcagcaggcatataagcagcagtcactgctactgcac300 ccagacaaaggtggaagccatgccttaatgcaggaattgaacagtctctggggaacattt360 aaaactgaagtatacaatctgagaatgaatctaggaggaaccggcttccaggtaagaagg420 ctacatgcggatgggtggaatctaagtaccaaagacacctttggtgatagatactaccag980 IS cggttctgcagaatgcctcttacctgcctagtaaatgttaaatacagctcatgtagttgt540 atattatgcctgcttagaaagcaacatagagagctcaaagacaaatgtgatgccaggtgc600 ctagtacttggagaatgtttttgtcttgaatgttacatgcaatggtttggaacaccaacc660 cgagatgtgctgaacctgtatgcagacttcattgcaagcatgcctatagactggctggac720 ctggatgtgcacagcgtgtataatccaagtaagtatcaagagggcgggtgggtatttacg780 gcctatattcttacagggctctccccctagaacggcggagcgaggaactgaggagagcgg890 ccacagtccactacacgatgactactggtcattcagctatggaagcaagtacttcacaag900 ggaatggaatgatttcttcagaaagtgggaccccagctaccagtcgccgcctaagactgc960 cgagtcttctgagcaacccgacctattctgttatgaggagccactcctatcccccaaccc1020 gagttctccaacagatacacccgcacatactgctggaagaagacgaaatccttgtgttgc1080 tgagcccgatgacagcatatccccggacccccccagaactcctgtatccagaaagcgacc1140 aagaccagct ggagccactg gaggaggagg aggaggagta catgccaatg gaggatctgt 1200 atttggacat cctaccgggg gaacaagtac cccagctcat ccccccccct atcattccca 1260 gggcgggtct gagtccatgg gagggtctga ttcttcggga tttgcagagg gctcatttcg 1320 atccgatcct agatgcgagt cagagaatga gagctactca cagagctgct ctcagagctc 1380 attcaatgca acgccaccta agaaggctag ggaggaccct gctcctagtg actttcctag 1940 cagccttact gggtatttgt ctcatgctat ttattctaat aaaacgttcc cggcatttct 1500 agtatactcc accaaagaga aatgcaaaca attatatgat accataggga agttcaggcc 1560 cgaattcaaa tgcctggtcc attatgagga ggggggcatg ctgttctttc taactatgac 1620 taagcacagg gtttcagcag ttaagaatta ttgctctaag ctttgccgca gcttcctaat 1680 gtgtaaggca gtcaccaagc ctatggaatg ctatcaagtt gtaaccgcag caccatttca 1740 gttaataacagaaaataagccaggcctccaccaattcgagtttacagacgagccagaaga1800 acagaaagcagtagactggattatggtagcagactttgcactagaaaacaaccttgatga1860 tcccctgttaattatggggtattatcttgattttgccaaagaggttccttcatgcataaa1920 gtgtagcaaagaggaaacccgcctccaaatacattggaaaaaccatagaaagcatgcaga1980 gaatgcagacctcttcctgaattgtaaagctcaaaagacaatctgtcagcaggcagctgc2040 gagtctggcatccaggagactgaaattagtagagtgtacccgcagccagctattaaagga2100 gagattgcaacagtctctcctcaggctaaaagaacttggctcctccgatgctctactcta2160 l5 cctagcaggtgtcgcttggtaccagtgtcttttagaggactttcctcaaaccctgtttaa2220 gatgcttaagctgctaacagaaaatgtgccaaaacgacgcaacatactttttagaggacc2280 agttaattcaggaaagacaggcctagcagccgcgcttattagcctgttaggaggcaagtc2390 tctcaacataaattgccctgcagataaacttgcttttgagcttggtgtggcacaggacca2400 gtttgtggtctgttttgaagatgtaaagggtcaaatagccttgaacaaacaactgcagcc2960 agggatgggagtggctaatctagataatctcaggactacctggaatgggagtgtaaaggt2520 caatctagaaaaaaagcacagcaacaaaaggtcacaactctttccaccctgtgtgtgtac2580 aatgaatgaatatctcctaccacaaacagtatgggcccggtttcacatggtgttggattt2690 cacctgcaaaccccatctggcccaatctcttgaaaagtgtgaatttttgcaaagggaaag2700 aattattcagagtggagatacccttgccctattactcatatggaatttcacttcagatgt2760 atttgatcctgatattcagggtcttgtgaaggaggttcgtgaccagtttgctagtgagtg2820 ctcctacagt ttgttttgtg atatactttg taatgtgcaa gaaggcgacg accccttgaa 2880 ggacatatgt gatatagctg aatacacagt ttattgaata aacattaatt tccaggaaat 2990 acagtctttg tttttccaaa gcggtcaaca tagcgcgtca tatcagggtc ccccggtaca 3000 ggttcagtcc catcatacac tctaacctcc tctacctggg tgttctcccc ttccatgggt 3060 tggccctgca cttgggggag catgttgttg aaaagggaac ttatgaggga ggccatggga 3120 tagggatttt tgacccatct ttttctcagg gtgattttga aatatctggg aaagcccttc 3180 tccagtgatg acacatagtt tcttgtaact ctccagccca ttatatctac acaggagagg 3290 tataggccct ctcctttaca gaggggccca actccatttt catctaggag cacagttgtc 3300 agggtgtttg tgaactgcag gacgggtgga gctgttgtgc ctccagtgta attgccaaag 3360 taccttgtgt tctcattttt tgctggatct ggatgccaga tttcaactgg atacattccg 3420 tccttatccagcttggccttgctaattggattcaggacttggtctttgttgaccatgtcc3480 ttctttgtgattgttttgattgttactaccccttcttccttgtattttgttctggcatct3540 gtcacaagtccctggaggtcaagcggttccccgccaccagcaaacacatgatattggctg3600 ccttccactggagtggaatttcctttgtgtttactgaatctgtgggttttgttgaaccca3660 tgcacatctaacagtgagccagagcccaccacctcggttttcactgagactgcctcccac3720 10..
atttgtagggtgtcacaggtgaggtcctcattgaggcatgggaagctggactttgccata3780 ctccatgtgggaagtgtattatttcggggaatccacgtatctgatgtagccaaattaatc3840 15cctctgctccaaccatagtattgccctccctctgttaggctttcaggggtgggtggctgc3900 cccattctggggttcagaaaagcttctatttctgtcacactgtctggccctgtcacaagg3960 tccagcacctccataccccctttaataagcagtttgggaacgggtgcgggtcttggacag4020 gcctttgtacattttgtctcgcatttagagacgccgctttttcttttgggggccatcttc4080 ctctatgactgttgcccaagtaggtgtgatatcaccgtacagccctagaattaaaggaag4140 25catccagtcaggagtgactctttggtgggacaccacctgggcctgatagaactttatcac4200 ctcacctgactcatcctgtatatgtgctgcaggggtaggcccaccatttcccatgctccc4260 ttctatgcgattaaagagtgctctcctctgtggtggattaagacctagttgcctataata4320 gtcacttagtgatgagtaccctgagctcgctgatgaggcacctctgttgattgcatctat4380 ggctgactgaggagcattagaaaccacccaccgggtgttttcaagtagcctagctaggcc9440 35atccaggaatgtatgtgtctgtcttacagttagttctcttacagctccttccagtctgtg4500 ttgtgtttcctgcacaaccatttgccacacatatcttcccacggaatgaagtaggccatg4560 gccccaatcatgtactacatttagagcatgagcaaactgattaactcctgggaagtatat4620 40_ atcgagaagggctggatcccgccatggtatcaacgccatatttctatttacagtagggac4680 ctcttcgttgtgtaggtaccgctgtattcctagggaaatagtagaggcaccttgaactgt4740 45 ctgcatcagc catatagccc ccgctgttcg acttacaaac acaggcacag tactgacaaa 4800 cccatacacc tcctctgaaa tacccatagt tgctagggct gtctccgaac tcattacacc 4860 ctccaaagtc agagctgtaa tttcgccatc aagggcagcg agggcttctc cagataaaat 4920 agcttctgcc gagagtcccg taagggtaga cacttcagct aatccctcga tgaggtctac 4980 tagaatagtc agtgcggctc ccattttgaa aattcactta cttgatcagc ttcagaagat 5040 ggcggagggc ctccaacaca gtaattttcc tcccgactct taaaatagaa aatgtcaagt 5100 cagttaagca ggaagtgact aactgaccgc agctggccgt gcgacatcct cttttaatta 5160 gttgctaggc aactgccctc cagagggcag tgtggttttg caagaggaag caaaaagcct 5220 ctccacccag gcctagaatg tttccaccca atcattacta tgacaacagc tgtttttttt 5280 agtattaagc agaggcc 5297 _:
<210> 2 <211> 1328 <212> DNA
<213> Polyomavirus sp.
<220>
<223> middle T antigen polyoma virus from nt 73 - 1500 <400> 2 tcatggatag agttctgagc agagctgaca aagaaaggct gctagaactt ctaaaacttc 60 ccagacaact atggggggat tttggaagaa tgcagcaggc atataagcag cagtcactgc 120 tactgcaccc agacaaaggt ggaagccatg ccttaatgca ggaattgaac agtctctggg 180 gaacatttaa aactgaagta tacaatctga gaatgaatct aggaggaacc ggcttccagg 290 taagaaggct acatgcggat gggtggaatc taagtaccaa agacaccttt ggtgatagat 300 actaccagcg gttctgcaga atgcctctta cctgcctagt aaatgttaaa tacagctcat 360 gtagttgtat attatgcctg cttagaaagc aacatagaga gctcaaagac aaatgtgatg 420 ccaggtgcct agtacttgga gaatgttttt gtcttgaatg ttacatgcaa tggtttggaa 480 caccaacccg agatgtgctg aacctgtatg cagacttcat tgcaagcatg cctatagact 540 ggctggacct ggatgtgcac agcgtgtata atccaagtaa gtatcaagag ggcgggtggg 600 tatttacggc ctatattctt acagggctct ccccctagaa cggcggagcg aggaactgag 660 :
gagagcggcc acagtccact acacgatgac tactggtcat tcagctatgg aagcaagtac 720 ttcacaaggg aatggaatga tttcttcaga aagtgggacc ccagctacca gtcgccgcct 780 aagactgccg agtcttctga gcaacccgac ctattctgtt atgaggagcc actcctatcc 890 wo oor~i24o Pcrius~nosos cccaacccga gttctccaac agatacaccc gcacatactg ctggaagaag acgaaatcct 900 tgtgttgctg agcccgatga cagcatatcc ccggaccccc ccagaactcc tgtatccaga 960 aagcgaccaa gaccagctgg agccactgga ggaggaggag gaggagtaca tgccaatgga 1020 ggatctgtat ttggacatcc taccggggga acaagtaccc cagctcatcc ccccccctat 1080 cattcccagg gcgggtctga gtccatggga gggtctgatt cttcgggatt tgcagagggc 1140 tcatttcgat ccgatcctag atgcgagtca gagaatgaga gctactcaca gagctgctct 1200 cagagctcat tcaatgcaac gccacctaag aaggctaggg aggaccctgc tcctagtgac 1260 tttcctagca gccttactgg gtatttgtct catgctattt attctaataa aacgttcccg 1320 gcatttct 1328

Claims (14)

What is Claimed is:

1. A brain microvessel endothelial cell comprising a nucleic acid sequence encoding Middle-T antigen gene from a papoviruse, wherein said cell is capable of forming monolayers substantially impermeable to low molecular weight molecules.

2. The brain microvessel endothelial cell according Claim 1 wherein the papovirus is polyoma.

3. The brain microvessel endothelial cell according Claim 1 wherein the low molecular weight molecule is a hydrophilic and/or lipophilic pharmaceutical.

4. The brain microvessel endothelial cell according Claim 2 wherein the low molecular weight molecule is a hydrophilic and/or lipophilic pharmaceutical.

5. A method of measuring blood brain barrier permeability of a substance, wherein the permeability measured is passive diffusion or active transport, said method comprising:
providing BMECs according to claim 1 in one or more confluent monolayers;
contacting said substance with said confluent monolayer(s); and measuring the amount of said substance permeated across the BMEC monolayer(s).

6. The method of measuring blood brain barrier permeability of a substance according to claim 5 wherein said substance is a low molecular weight hydrophilic or lipophilic pharmaceutical.

7. A method of measuring blood brain barrier carrier mediated transport of a substance, said method comprising:
providing BMECs according to claim 1 in one or more confluent monolayers;
contacting said substance with said confluent monolayer(s) in the presence of one or more ATP inhibitors;
and measuring the amount of said substance permeated across the BMEC monolayer(s).

8. A method of measuring blood brain barrier efflux transport of a substance, said method comprising:
providing BMECs according to claim 1 in one or more confluent monolayers;
contacting said substance with said confluent monolayer(s) in the presence of one or more inhibitors of the efflux pumps; and measuring the amount of said substance permeated across the BMEC monolayer(s).

9. A method of measuring blood brain barrier metabolism of a substance, said method comprising:
providing BMECs according to claim 1 in one or more confluent monolayers;
Incubating said substance with said confluent monolayer(s); and measuring the amount metabolites of said substance permeated across the BMEC monolayer(s).

10. A process of making immortalized brain microvessel endothelial cells comprising nucleic acid sequence encoding Middle-T antigen from a papovirus, said method comprising:
providing a primary culture brain microvessel endothelial cells; transfecting the brain microvessel endothelial cells with a vector containing the nucleic acid sequence encoding middle-T antigen from the papovirus: incubating the vectors and cells; and isolating the immortalized brain microvessel endothelial cells having the nucleic acid sequence encoding Middle-T antigen from papovirus.

11. The process according to Claim 10 wherein the papovirus is polyoma virus.

12. The process according to Claim 11 wherein the vector is a plasmid.

13. The process according to Claim 12 wherein the brain microvessel endothelial cells are co-transfected with a plasmid containing a selectable marker.

14. The brain microvessel endothelial cell according Claim 1 wherein the cell is TBMEC,P11 having the A.T.C.C.
designation number CRL-12414.