MXPA01005236A - Immortalized brain endothelial cells - Google Patents

Abstract

A brain microvessel endothelial cell having a Middle-T antigen gene from papovirus is disclosed. The brain microvessel endothelial cell exhibits normal cell phenotype, maintains the phenotype in culture and forms monolayers substantially impermeable to low molecular weight molecules. The cells are useful for in vitro studies involving the blood brain barrier. Also disclosed are methods of using and processes of making these cells.

Description

ENDOTHELIAL CEREBRAL CELLS I MORTALIZED Field of the Invention The invention relates to immortalized cell clones of cerebral icrovasos endothelial cells that have been produced by transfection with a plasmid containing the T-intermediate antigen gene from polyoma-virus. The cells that are described are present and maintain a phenotype of endothelial cells and spontaneously form confluent monolayers that are substantially impervious to molecules of the gland. The cells are therefore useful for models that study the barrier between blood and brain (= blood-brain barrier).

BACKGROUND OF THE INVENTION The blood-brain barrier (BBB) is composed of cerebral microvessel endothelial cells (referred to hereinbelow as CEMVC's) and acts as a regulatory interface for the permeability of drugs and solutes between the blood and the central nervous system.

(SNC). The isolation and cultivation of the CEMVC's have led to the development of model systems for the study of the BHE (Bo Man et al., REF .: 129513 1983, Audus and Borchardt, 1986). The BHE in vi tro model systems have been successfully derived from the brains of bovine, canine, human, murine, porcine and rat animals, and were found to have similar permeability properties due to the similarity between the physiological characteristics of the BHE. of all mammals (Cserr et al., 1984, Audus et al., 1990). In these models, CEMVCs retain the characteristics of cerebral endothelial cells including morphology, specific enzymatic markers for BHE, and tight intercellular junctions, which may be useful for studying a variety of drug delivery principles to the CNS, which fluctuate between passive diffusion, vehicle-mediated transport, and metabolism for specific factors that affect the permeability of the BBB. However, the recourse to passing the CEMVC's results in a loss of specific markers for the endothelium and the BHE as well as tight intercellular junctions (Brigthman and Neuwelt, 1989). Currently, only CEMVC's primary crops have been developed to address the permeability principles of the BHE i n vi tro. The isolated and cultured primary brain cells developed previously have presented different properties, mainly due to the considerable variety existing in the starting material. For example, with respect to transcellular transport, it has been very difficult to make a rigorous comparison of the data obtained between different laboratories (Pardridge et al., 1990, Masereeuw et al., 1994). The use of primary cells can affect the differentiation of cells and lead to the selection of clones that proliferate with maximum speed. In addition, it has been shown that the expression of some marker enzymes such as gamma-glutamyl-transpept idasa, as well as the complexity of the sealed connections, decrease with time in culture and with the number of passes (Méresse et al., 1989). It is known that papovaviruses such as SV-40 and polyoma-viruses produce tumors in rodents. The DNA sequence of the polyomaviruses has been determined and it has been indicated that the "early region", which includes the intermediate and large T antigens, is responsible for the formation of "tumors." See the citation of Soeda et al., 1980 The previous methods, which use the gene of a large SV-40 T antigen, describe the immortalization of endothelial cells from bovine brain capillaries, in which the cells retain the differentiated phenotype and appear as morphologically normal (Durieu-Trautmann et al., 1991) .The stem cells of fetal rats transfected with the intermediate T-antigen gene produced two endothelial cell lines that were not oncogenic; however, these cell lines do not spontaneously form a barrier to small hydrophilic molecules (Juillerat-Jeannere et al., 1992). Therefore, it is evident that currently available clones of cultures of immortalized CEMVCs suffer from individual disadvantages in terms of expression of phenotypes and homogeneous maintenance of that expression. This leads to difficulties with respect to accuracy and reproducibility in studies used by the CEMVC's.

SUMMARY OF THE INVENTION All of the above factors provide a strong incentive for the development of immortalized CEMVCs capable of maintaining a differentiated phenotype in culture and, therefore, measurements such as permeability can be made without the need for repeated isolations of the CEMVC's. The CEMVCs of the present invention provide a convenient bank of ready cells to be used as an efficient alternative to the use of primary CEMVCs. Therefore, it is an object of the invention to provide immortalized CEMVCs possessing a nucleic acid sequence encoding the gene for an intermediate T antigen from a papovavirus, said cells being capable of forming monolayers substantially impervious to molecules of low molecular weight. In preferred embodiments, CEMVCs are provided which have the gene for an intermediate T antigen from the polyoma papovavirus. A further object of the present invention is to provide a method of using the CEMVC's described herein for measuring permeability by means of passive diffusion or active transport, vehicle-mediated transport, a transport system of effusions such as glycoprotein P and proteins associated with resistance to multiple drugs (MRP); and metabolism of substances that cross the blood-brain barrier, such as pharmaceuticals.

Still a further object of the present invention is to provide a method of producing the immortalized CEMVCs described herein by providing CEMVCs of primary cultures, subsequently transfecting them with a vector containing the intermediate T antigen gene from a papovavirus, incubating the vectors and cells, and subsequently isolating the immortalized CEMVCs that possess the nucleic acid sequence of an intermediate T antigen.

These and other objects will be readily appreciated by those of ordinary skill in the art based on the following detailed description of this invention.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: Shows the results of the PCR amplification performed by several primers from the region encoding a polyoma intermediate T antigen. Figure 2: shows the morphology of the CEMVC's reproduced by an optical microscope (200x = 200 magnification). Figure 3: shows the morphology of the TBEMC cell line, Pll reproduced by an optical microscope (200x).

Detailed Description of the Invention The cell line in question, herein cited as TBEMC, Pll has the designation number CRL-12414 in the ATCC, and has been filed on October 7, 1997. The present invention relates to embedded CEMVC's, preferably to CEMVC's of mammals, more preferably to CEMVC's of bovine animals, to processes for their production, and to methods of using these cells. For the first time, the present invention provides CEMVC's with the ability to retain a fully differentiated phenotype and, therefore, the endothelial nature of these cells. This is accomplished by transducing the CEMVCs with a vector such as a plasmid, which contains the entire coding region of the intermediate T antigen gene from papovaviruses such as those from polyoma or SV-40. In preferred embodiments, a plasmid carrying the nucleic acid sequence encoding an intermediate T antigen from a polyoma virus is provided, said plasmid in the present context being cited as the "polyoma intermediate T plasmid" (= pyMT). The clones of the transfected cells are characterized because they express and retain their differentiated phenotype. The CEMVCs according to the present invention grow in the form of monolayers and show a substantial impermeability to the substances of small size, which is conferred by their ability to form confluent monolayers. The aforementioned substances include hydrophilic and lipophilic pharmaceutical products as well as other chemical products, of low molecular weight. Examples of these low molecular weight molecules include: acetylsalicylic acid, acyclovir, aminopyrine, caffeine, chlorpromazine, cytidine, clonidine, corticosterone, desipramine, diazepam, dopamine, estradiol, hydrocortisone, indomethacin, mannitol, methyl-scopolamine, nicotine , phenytoin, pirenzepine, progesterone, propranolol, salicylic acid, scopolamine, sucrose, fasalazine, terbutaline, terona tes, uracil, dexamethasone, urea, warfarin, bremazocine, meloxicam, nevirapine, ranitidine, didanosine, zalcitabine, stavudine and Saquinavir. It should be understood that the term "differentiated phenotype", as used in the present invention, means the CEMVC's which form continuous monolayers of oblong cells inhibited to come into contact. It should be understood that the term "substantially impermeable", as used in the present invention, means having low permeability coefficients, similar to those of sucrose, which is a non-metabolizable paracellular marker. The immortalized CEMVCs, produced by transfection with a plasmid containing the gene of an intermediate T antigen from the polyoma virus, presented a phenotype of non-transformed endothelial cells, that is, stained by phenotypic genetic markers such as Factor VIII and a receptor. LDL, and retained the formation of tight joints and permeability characteristics. The cell morphology of one of the CEMVC's clones according to the present invention, the TBEMC, Pll, and cultures of CEMVC's was examined under a microscope using a phase contrast optical system. TBEMC, Pll cells form tightly packed, non-overlapping continuous monolayers of oblong cells inhibited to come into contact with morphology similar to primary CEMVCs when grown in Petri dishes coated with collagen and treated with fibronectin. In order to study the maintenance of the differentiated endothelial phenotype, TBEMC, Pll was grown in the form of monolayers on Trans ell® plates and the permeability of sucrose, which is a non-metabolizable paracellular marker, was measured in primary CEMVC's and in TBEMC, Pll and it was shown that their values were comparable. The values of the permeability coefficients for acyclovir and leucine at similar concentrations were also shown to be affordable. See Example 4. Therefore, it is also an object of the present invention to provide a method for measuring the permeability of a substance across the blood-brain barrier, providing CEMVCs according to the invention in one or more confluent layer (s). (s), by contacting the substance with said confluent monolayers; and measuring the amount of said substance that has penetrated through the CEMVC's monolayer (s). The method can measure passive diffusion or active transport and can also be varied, as appreciated by those skilled in the art, to perform characteristic measurements such as those of vehicle-mediated transport, in which permeability values such as which are described in Example 3 are measured as a function of the concentration of the solute or in the presence of ATP inhibitors (= adenosine triphosphate) such as sodium azide. The transport of effusions can be measured by a method in which the measurement of the permeability values described in Example 3 is carried out in the presence of inhibitors of the effusion pumps, such as, but not limited to, cyclosporin- A, dexamethasone, digoxin, FK506, methadone, phenytoin, prazosin, guinidine, rhodamine 123, tamoxifen, verapamil and yohimbine, as well as all those listed by Seelig 1997, which is incorporated herein by reference. The methods of. present invention can also be used to measure the metabolism of the blood-brain barrier in a substance by measuring the permeability values as described in Example 3 and profiling the metabolic degradation of the compounds of interest over time using quantitative analytical techniques, such as high pressure lipography chromatography and mass spectrometry. The immortalized CEMVCs provided by the present invention can be prepared by the following general method: The primary cultures of CEMVC's can be prepared according to known methods. An example is the bovine cerebral endothelium prepared from freshly extracted calf brains, as has described previously (Audus and Borchardt, 1956). Briefly, they were purchased from a local slaughterhouse of three to four brains recently excised from calves and transported to the laboratory in an ice-cold MEM medium. The capillaries and meninges were extracted from each brain and the gray matter was removed by scraping and finely chopped. The gray matter suspension was treated with a protease and a mixture of collagenase with dispase to separate the endothelial cells with respect to fat, myelin, and other cells. The microvessel endothelial cells were collected from a Percoll gradient, washed with a MEM medium and pelleted. Then, these were resuspended in a culture medium made up of approximately equal parts of MEM and the Ham F-12 nutrient mixture containing approximately 20% horse serum and approximately 5% DMSO, and frozen under nitrogen. liquid for 0 - 12 months, preferably for no more than six months. The previous CEMVCs are transfected as follows: The CEMVC's are transfected with a plasmid containing the gene for an intermediate T antigen from the polyoma virus. The pyMT plasmid (see Example 5) carries the entire coding region of the intermediate T antigen from polyoma-virus (Soeda et al., 1980). Here, both the pSV2 neo plasmid, which carries the neo gene (Southern and Berg) for resistance to the amino-glycoside G418, and the plasmid pyMT were jointly transfected into a primary strain of CEMVC's at a confluence of about 50%. Approximately 20 μg of each of the vectors was used in a calcium phosphate transfection procedure. The plasmids were allowed to incubate with the cells for about 30 minutes at room temperature, and then incubated in a complete culture medium for about 2.5 hours at about 37 ° C. The complete culture medium consisted of equal parts of a MEM and of the Ham F-12 nutrient mixture, which contained amphotericin B (2.5 μg / ml), ECGS (15 μg / ml), HEPES (10 mM), serum of horse (10%), penicillin (100 units / ml), polymyxin B (50 μl / ml) and streptomycin (100 μg / ml). After about 3 hours, the cells were subjected to an osmotic shock with DMSO (10%) for about 10 minutes. The cells were then washed, preferably about 7 times, with the complete culture medium and returned to the incubator. The cells were dissociated at 1: 1 in a complete culture medium supplemented with G418 (300 μg / ml, activity) after which they reached confluence (in about 48 hours). The selective medium was changed around every 2 to 3 days. Foci appeared in the course of 10 days. The foci were trypsinized, grouped and cultivated through several passes. All clones had normal phenotypes but a more regular and faster division time than the original primary CEMVCs (Figure 2B). One of these clones, referred to as TBEMC, Pll, was further characterized and used in permeability experiments. In order that this invention be more fully understood, the following Examples are set forth. These Examples are given for the purpose of illustrating preferred embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way. .

Example 1 Detection of the pyMT gene in TBEMC, Pll The presence of the pyMT gene in TBEMC, Pll cells was determined by a polymerase chain reaction (PCR). Genomic DNA was extracted from untransfected (WT) and transfected (TX) CEMVC cells, and used at 10 μg / ml for PCR amplification. The plasmid DNA pyMT was used as a positive control. The primers used to perform the PCR amplification were as follows, and were based on the published sequence (Soeda et al., 1980). 230 (S) - 5'CCCAGACAACTATGGGGGGAT 3 '281 (S) - 5'CAGTCACTGCTACTGCACCCA 3' 971 (S) - 5'GCAACCCGACCTATTCTGTTA 3 '660 (AS) - 5' CGGGTTGGTGTTCCAAACCAT 3 '1030 (AS) - 5' GTTGGAGAACTCGGGTTGGGG 3 ' 1150 (AS) - 5 'CCAGCTGGTCTTGGTCGCTTT 3' PCR reactions were adjusted using 45 μl of Super ix PCR (Gibco BRL), 2.5 μl of each of the sense (S) and antisense (AS) primers (20 μM strain) and 10 μl of DNA mold (10 ng / ml). Thirty cycles of PCR amplification were performed by melting the DNA at 95 ° C for 1 min, reannealing it at 50 ° C for 1 mm and 'spreading it at 72 ° C for 1 min for each cycle using the GeneAmp PCR System 9600 system (from Perkin Elmer). After 30 cycles, the final extension was performed for 7 min at 72 ° C and the products were resolved using 1.0% agarose gels. Detection of the transfected pyMT gene encoding an intermediate T antigen: Since the TBEMC, Pll cells were transfected together with a target DNA (from pyMT) and a plasmid containing a selectable marker (psV2neo), and were then selected as to resistance to the antibiotic G418, it was preferable to detect the pyMT gene in clones resistant to G418. The results of PCR amplification performed using various primers from the coding region of a polyoma intermediate T antigen are shown in Figure 1. Set A represents an amplification using the primers 230 (S) and 1030 (AS) to generate a PCR product with a size of 701 bp (base pairs), set B represents an amplification using the primers 230 (S) and 1150 (AS) to generate a product with a size of 821 bp, the set C represents a amplification using the primers 281 (S) and 660 (AS) to generate a product with a size of 380 bp and the set D represents an amplification using the primers 971 (S) and 1150 (AS) to give rise to a PCR product with a size of 180 bp. A PCR amplification was only detected in the reactions in which plasmid pyMT DNA and genomic DNA from transfected cells were used as templates. The template DNA from untransfected CEMVC cells does not show PCR amplification. These results confirm the presence of the pyMT gene in TBEMC, Pll cells selected for resistance to G418. Example 2 Histochemical techniques The absorption of low density lipoproteins (LDL) and the expression of Factor VIII antigen and gamma-glutamyl transpeptidase, specific markers that are found only in endothelial cells, were examined by immunohistochemical techniques. The cells were grown to near confluence on 25 mm plastic dishes that were not self-fluorescent. Absorption of acetylated low density lipoproteins, labeled with 1,1'-dioctadecyl-3,3,3 ', 3'-tetramethyl-cyclocyanine perchlorate (Dil-Ac-LDL) at 10 μg / ml in PBS was carried out for 4 h at 37 ° C. The cells were examined by means of a fluorescence microscope. Negative controls used 50% rabbit serum in HBSS as a substitute for the primary antibody. It was also shown that the CEMVC's that had grown in culture stained histochemically in a positive way for alkaline phosphatase, which is an enzymatic marker for cerebral endothelial cells. Example 3 Permeability experiments CEMVC's and TBEMC cells were seeded, Pll at densities of 75,000 and 60,000 cells / ml respectively, on polycarbonate filters in 6-well plates Transwell (Costar Transwell 12mm diameter, 0.4 um pore size, Corning Costar Corp., Cambridge, MA) and cultured in a complete culture medium. The plates were kept in an incubator at 37 ° C and C02 5% and used for permeability experiments during 10 to 12 days after sowing for CEMVC's cells and in 4 to 6 days of planting for TBEMC cells, Pll. Drug solutions were prepared in HBSS. All drug solutions also contained 0.1 mM sucrose (~ 0.15 μCi / ml radiologically labeled material) as an internal standard paracellular marker. The permeability of sucrose for each well was determined together with that of the compound of interest to find out the confluence of the monolayers. The transport speeds for both the monolayers and for the filters were then determined by taking samples at discrete time intervals and plotting the cumulative quantity that had penetrated as a function of time. The samples were analyzed by HPLC [= high performance liquid chromatography] (Hewlett Packard, HP 1090) or counted in a liquid scintillation counter (Packard, Tri-Carb, A2700). It was estimated that the monolayers were confluent and acceptable for permeability measurements, when the sucrose output was less than 15% per hour. permeability coefficients according to equation 1 is then determined: in gue J was the rate of appearance of the drug in the receiver chamber, C0 was the initial drug concentration in the chamber of the donor, and A was the surface area of filter. vi tro as the coefficient of permeability of drugs was reported BBB permeability in through the monolayers, Pm, and is determined according to equation 2: gue Pe was the permeability coefficient cash through monolayer and filter and Pf was the coefficient of permeability only through the filter. Permeability measurements were performed at least in triplicate for each of the compounds. Example 4 Measurements of permeability The transmembrane permeability of the TBEMC, Pll monolayers was quantified by sucrose, which is a non-metabolizable marker, which does not penetrate through membranes. The permeability coefficients of 0.1 M sucrose solutions in HBSS for monolayers of TBEMC, Pll, compared to those of monolayers of CEMVC's, are presented in Table 1.

Permeability of selected compounds: The permeability coefficients of acyclovir and leucine concentrated at 0.1 M in monolayers of TBEMC, Pll and CEMVC's are shown in Table II. It can be seen that the permeability coefficients for these compounds are similar in both transfected and primary cells. These results demonstrate that the CEMVCs according to the present invention form monolayers that are substantially impervious to molecules of low molecular weight.

Example 5 Construction of pyMT plasmid The construction of a modified early region of a polyoma virus, which encodes only the intermediate T protein, was performed by the methods described by Treisman, Novak, Favaloro and Kamen, in Nature, volume 292 , August 13, 1981, which is incorporated herein by reference.

Briefly, a recombinant plasmid containing the full length wild-type (polyoma) virus wild-type viral DNA was cut with the Ava 1 endonuclease to remove an intermediate sequence containing the coding region of an intermediate T antigen. This fragment was ligated into a recombinant vector resistant to ampicillin, in sites that had previously been cut with Msp 1 plus Ava 1, and dephosphorylated with calf alkaline phosphatase. The ligation product was transfected into strain HB10I of E. col i; and colonies resistant to ampicillin were selected. Small DNA preparations were produced from the resulting colonies and digested with Aval, Avall, Hinfl and Mspl, and passed through agar and poly (acrylamide) gels to determine if the colonies contained the coding region fragment an intermediate T A colony containing the appropriate pattern of digestion by electrophoresis was designated pPyMT1 and was propagated to produce quantities in the order of milligrams of DNA by purification with a gradient of cesium chloride, for the transfection of mammalian cells. Studies from the aforementioned reference citation had determined that this recombinant plasmid containing the intermediate T antigen could transform to Fisher rat cells (cell line F2408). The cells transfected with the plasmid pyMTl alone formed foci, grew poorly on the plastic material and grew poorly at low density. REFERENCES Audus, K.L., Bartel, R.L., Hidalgo, I.J. and Borchardt, R.T. The use of cultured epithelial and endothelial cells for drug transport and metabolism studies, Pharm. Res. 7, 435-451 (1990).

Masereeuw, R .; Jaehde, U .; Langemeijer, M.W.E .; de Boer, A.G .; Breimer, D.D. In vi tro and in vi vo transport of zidovudine (AZT) across the blood-brain barrier and the effect of transport inhibitors. Pharm. Res. 1994, 11, 324-330.

Méresse, S., Dehouck, MP., Delorme, P., Bensa? D, M., Tauber, JP., Delbart, O., Fruchart, JC and Ceccelli, R. Bovine endothelial cells express tight junctions and monoamine oxidase brain activity in long-term culture, J. Ne urochem. 53.1363-1371 (1989).

Pardridge, W.M., Triguero, 0., Yang, J., and Cancilla, P.A. Comparison of in vi tro and i n vi o models of drug transcytosis through the blood-brain barrier, J. Pharmacol. Exp. Thera. 253, 884-891 (1990). 'Soeda, E., Arrand, J.R., Smolar, N., Walsh, J.E. and Griffin, B.E. Nature 283, 445-453 (1980).

Cserr, H.F and Bindgaard, M., Blood-brain interfaces in vertebrates: a comparative approach, Am, J. Phys. 246, R277-R288 (1984).

Juillerat-Jeanneret, L., Aguzzi, A., Wiestler, O.D., Darekar, P. and Jnazer, R.C. Dexamethasone selectively regulates the activity of enzymatic markers of cerebral endothelial cells lines, in vi tro Cell. Dev. Bi ol. 28A, 537-543 (1992).

Soeda, E., Arrand, J.R., Smolar, N. Walsh J.E. and Griffin, B.E. Coding potential and regulatory signatures of the polyoma virus genome, Na t ure 283, 445-453 (1980).

Durieu-Tautmann, 0., Foignant-Chaverot, N., Perdomo, J., Gounon, P., Strosberg, A.D. and Conrad, P.O., Immortalization of brain capillary endothelial cells with maintenance of structural characteristics of the blood-brain barrier endothelium, In vi tro Cel l. Dev. Bi or 27A, 771-778 (1991).

Seelig, A., A general pattern for substrate recognition by P-glycoprotein, Eur J. Bi och. 251, 252-261 (1998).

Treisman, R., Novak, U., Favaloro, J. & and Kamen, R. Transformation of rat cells by an altered polyoma virus genome expressing only the middle-T protein. Nature 292, 595-600 (1981).

It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (13)

R E I V I N D I C A I N N E S Having described the invention as above, the content of the following claims is claimed as property:

1. An endothelial cell of cerebral microvessels (CEMVC), characterized in that it comprises a nucleic acid sequence that encodes the gene for an intermediate T antigen from a papovavirus in which said cell is capable of forming monolayers substantially impermeable to molecules of low molecular weight.

2. The endothelial cell of cerebral microvessels according to claim 1, characterized in that the papovavirus is polyoma.

3. The cerebral microvessel endothelial cell according to claim 1, characterized in that the low molecular weight molecule is a hydrophilic and / or lipophilic pharmaceutical product.

4. The cerebral microvessel endothelial cell according to claim 2, characterized in that the low molecular weight molecule is a hydrophilic and / or lipophilic pharmaceutical product.

5. A method of measuring the permeability of a substance through the blood-brain barrier, in which the measured permeability is passive diffusion or active transport, characterized in that the method comprises: providing CEMVC's according to claim 1 in one or more confluent monolayer (s); and contacting said substance with said confluent monolayer (s); and measure the amount of the substance that has penetrated through the CEMVC's monolayer (s).

6. The method of measuring the permeability of a substance through the blood-brain barrier, according to claim 5, characterized in that the substance is a hydrophilic or lipophilic pharmaceutical product of low molecular weight.

7. A method of measuring the transport of a substance mediated by a vehicle through the blood-brain barrier, characterized in that the method comprises: providing CEMVC's according to claim 1 in one or more confluent monolayer (s); contacting the substance with the confluent monolayer (s) in the presence of one or more ATP inhibitors; and measure the amount of the substance that has penetrated through the CEMVC's monolayer (s).

8. A method of measuring the transport of effusions of a substance through the blood-brain barrier, characterized in that the method comprises: providing CEMVC's according to claim 1 in one or more confluent monolayer (s); contacting the substance with the confluent monolayer (s) in the presence of one or more effusion pump inhibitors; and measure the amount of the substance that has penetrated through the CEMVC's monolayer (s).

9. A method of measuring the metabolism of a substance through the blood-brain barrier, characterized in that the method comprises: providing CEMVO's according to claim 1 in one or more confluent monolayer (s); incubate the substance with the confluent monolayer (s); and measuring the amount of metabolites of the substance that has penetrated through the CEMVC's monolayer (s).

10. A method of producing immortalized endothelial cells of cerebral microvessels, comprising a nucleic acid sequence encoding an intermediate T antigen from a papovavirus, characterized in that the method comprises: providing a primary culture of cerebral microvessel endothelial cells; transfecting the endothelial cells of cerebral microvessels with a vector containing the nucleic acid sequence encoding the intermediate T antigen from the papovavirus; incubate vectors and cells; and isolating the immortalized endothelial cells from cerebral microvessels having the nucleic acid sequence encoding an intermediate T antigen from papovavirus.

11. The method according to claim 10, characterized in that the papovavirus is a polyoma virus.

12. The method according to claim 11, characterized in that the vector is a plasmid. The method according to claim 12, characterized in that the cerebral microvessel endothelial cells are jointly transfected with a plasmid containing a selectable marker. The endothelial cell of cerebral microvessels according to claim 1, characterized in that this cell is TBEMC, Pll having the designation number CRL-12414 in the A.T.C.C.