CA2345923A1 - Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof - Google Patents

Abstract

The present invention relates to the surprising discovery that in an autosomally inherited disease, a homozygote mutant is found to be phenotypically normal and to the uses of such a discovery. The present invention further relates to easy and efficient means to detect mutations in the TIGR/MYOC gene. Further, the present invention relates to methods to diagnose and treat glaucoma or other diseases or conditions in which homoallelic complementation is observed.

Description

TITLE OF THE INVENTION
MOLECULAR DIAGNOSTIC OF GLAUCOMAS
ASSOCIATED WITH CHROMOSOME 1, AND METHOD OF TREATMENT
THEREOF
FIELD OF THE INVENTION
The present invention relates to the identification of mutations in the TIGRlMYOC gene in the GLCIA locus and the detection of these mutations in individuals. The invention also relates to the identification of individuals who are genotypically homozygote mutants of an autosomal dominant inherited disease and yet display a normal phenotype.
BACKGROUND OF THE INVENTION
Glaucoma encompasses a complex of ocular-disease entities characterized by an optic neuropathy in which degeneration of retinal ganglion cells leads to a characteristic excavation of the head of the optic nerve (Shields et al., 1996, The Glaucomas, 2:717-725). Such damage causes progressive narrowing of the visual fields and, when uncontrolled, blindness. Affected people often have ocular hypertension defined as intraocular pressures consistently >21 mm Hg in both eyes. Although ocular hypertension is no longer an obligatory diagnostic criterion for glaucoma, it is still recognized as one of the most important risk factors (Wilson et al., 1996, The Glaucomas, 2_:753-763). Until now, a diagnosis of glaucoma is made after observation of the characteristic atrophy of the optic nerve, which is associated with typical visual field defects.
In 1992, the World Health Organization estimated that, in the global population, 5.2 million people were blind as a result of glaucoma (Thylefors et al., 1994, World Health Organ. Bull., 72:323-326), making it the third leading cause of blindness worldwide. The most common form is adult-onset primary open-angle glaucoma (MIM 137760; McKusick, 1994. Johns Hopkins University Press, p. 272), which represents ~50% of all cases of glaucoma. Among Caucasians, this form of the disorder affects ~2% of the population >45 years old (Leske, 1983, Am. Epidemiol., 118:166-191; Thylefors et al., 1994, supra; Wilson et al., 1996, supra). In African Americans, prevalence of adult-onset open-angle glaucoma is three to four times higher than that 5 observed in White Americans. More than 5 million North Americans may have some form of glaucoma, but at least half of them may not be aware of it.
The glaucomas traditionally have been grouped into three categories: open angle, closed angle (also termed "angle closure"), and congenital. Each subtype has been further arbitrarily subdivided into primary, 10 when the anterior chamber of the eye appears normal and no cause for glaucoma can be identified, or secondary, when glaucomas are caused by underlying ocular or systemic conditions (Shields et al., 1996, supra).
Whereas the division between open and closed angles refers to the configuration of the irido-corneal angle in the anterior chamber of the eye, congenital glaucoma is 15 used to define one of the many types of developmental glaucoma that usually occurs within the 1 st year of life. The majority (60%-70%) of primary glaucomas are of the open-angle type. Primary open-angle glaucomas have been further subdivided into two groups according to age at onset, severity, and mode of inheritance: the more prevalent is middle- to late-age-onset chronic open-angle 20 glaucoma (COAL), by convention diagnosed after age 35 years and characterized by its slow, insidious course (Shields et al., 1996, supra;
Wilson et al., 1996, supra). The less common form, juvenile open-angle glaucoma (JOAG), occurs between 3 years of age and early adulthood and generally manifests highly elevated intraocular pressures with no angle abnormalities 25 (Goldwyn et al., 1970, Arch. Ophtalmol., 84:579-582; Fran~ois, 1980, Am. J.
Ophtalmol., 3:429-449; Johnson et al., 1996a, The Glaucomas, 1_:39-54).
Although the precise molecular defects leading to open-angle glaucomas remain partly unknown, numerous advances in basic and clinical sciences have begun to identify the molecular basis of glaucomas by mapping 30 the gene loci involved in the disease process. Due to recent mapping successes, the different forms of glaucoma will be further identified by the names of the loci to which they have been localized. According to the Human Genome Organization/Genome Database nomenclature, "GLC" is the general symbol for the glaucoma genes; "1", "2", and "3" are, respectively, the symbols 5 for the open-angle, angle-closure, and congenital subtypes of glaucoma; and "A", "B", and "C" refer, respectively, to the first, second, or third gene mapped in each subgroup.
JOAG is a rare but aggressive form of glaucoma that usually segregates in an autosomal dominant fashion with high penetrance (Stokes, 10 1940, Arch. Ophthalmol., 24:885-909; Crombie et al., 1964, Br. J.
Ophtalmol., 48:143-147; Lee et al., 1985, Ann. Ophtalmol., 17:739-741; Johnson et al., 1993, Ophthalmology, 100:524-529). In a single large American pedigree affected by an autosomal dominant form of JOAG, Sheffield et al. (1993, Nat.
Genet., 4:47-50) located a gene responsible for this condition, at 1q21-q31.
This 15 locus, being the first open-angle glaucoma locus to be mapped, was named "GLC1A." The TIGRlMYOC glaucoma disease gene consistently was first associated with onset of the glaucoma phenotype before the age of 45 years, highly elevated intraocular pressures, and typical excavation of the head of the optic nerve. Gonioscopy showed open angles with no anterior-chamber 20 abnormalities. The GLC9A locus has subsequently been reported by Nguyen et al. in US Patent 5,606,043 to encode the trabecular meshwork induced gfucocorticoid response (TIGR) gene. The gene sequence was first submitted {13-JAN-1997) by Nguyen et al. to the GeneBank accession # 085257. The TIGR sequence was modified on 19 April 1997 in GeneBank following 25 modifications by Nguyen submitted on 02-APR-1997. The accession number stayed the same # 085257.
Genetic maps of the human genome can be exploited to rapidly locate human monogenic disorders The final version of the Genethon linkage map, which spans close to 100 % of the human genome, was published 30 in March 1996 (Dib et al., 1996, Nature 380 152-154). This map consists of WO 99/16$98 PCT/CA98/00923 5,264 short tandem (ACITG)n repeat polymorphisms with a mean heterozygosity of 70%.
The nomenclature system for the markers is well known in the field. The nomenclature used is decided by the Human Genome Organization 5 (HUGO) nomenclature committee. It is as follows: for anonymous DNA
sequences, the convention is to use D which is equivalent to DNA followed by 1-22, X or Y to denote the chromosomal number and location, then S stands for a unique segment and finally a serial number. For example, marker D2S2161 is a DNA marker located on chromosome 2 representing a unique segment. Its 10 serial number is 2161.
The nomenclature for the glaucoma genes is the following:
"GLC" is the general symbol for the glaucoma genes; "1 ", "2", and "3" are, respectively, the symbols for the open-angle, angle-closure, and congenital subtypes of glaucoma; and, "A", "B" and "C" refer, respectively, to the first, 15 second, or third gene mapped in each subgroup. For example, the GLC1A locus was the first open-angle glaucoma locus to be mapped, in this case to chromosome 1 q23-q25 in 1993. It was later identified as the trabecular meshwork inducible giucocorticoid response gene product (TIGR) (Stone et al, 1997, Science, 275: 668-670). The TIGR gene is also known as MYOC.
20 These markers are accessible to all individuals. The central data resource for the human gene mapping effort is the Genome Data Base (GDB). It was established at Johns Hopkins University, School of Medicine. GDB
is updated regularly. It collects, organizes, stores and distributes human genome mapping information. GDB ~s accessible electronically at WWW-URL:
25 http://gdbwww.gdb.org/.
Alternatively, all the markers disclosed herein, except D6S967, are short (CA)n repeat markers that have been developed in the Genethon laboratory near Paris, France. These markers are also accessible electronically at WWW-URL http://www.genethon.frl.

Therefore markers are accessible either at GDB or at Genethon.
The first mutations identified in the TIGR gene that have been shown to give rise to glaucoma were first reported by Stone et. al (Science, 5 1997, 275:668-670). Twenty-eight mutations have now been reported. The methodology used to identify these mutations was by amplifying overlapping regions by polymerase chain reaction (PCR), performing single-strand conformational polymorphism (SSCP) on the amplification products and sequencing those DNA products that produced aberrant band pattern on the 10 SSCP. No quick method for mutational analyses for the TIGR has been proposed.
The prior art as a whole teaches that a homozygote mutant for an autosomal dominant disease should display a higher penetrance and severity for a human disorder than a heterozygote mutant. Heterozygotes for an 15 autosomal dominant disease often exhibit variable penetrance.
The present description refers to a number of documents the content of which is herein incorporated by reference.
SUMMARY OF THE INVENTfON
20 The invention concerns the mutational analyses in the GLC1A
gene locus encoding the TIGR gene (GeneBank accession no. U85257; SEQ
ID N0:1).
The present invention provides means to identify at least two nucleotide changes in the DNA sequence coding for TIGR that result in an 25 amino acid change in the TIGR gene.
The invention further demonstrates that these amino acid changes result in mutations producing a disease state in individuals, the disease being glaucoma.
The early detection of individuals at risk for developing 30 glaucoma is an important aspect of this invention. Early detection allows for intervention prior to the genesis of the disease process and disease progression and may obviate the symptoms and the onset of the disease.
A method for mutation analyses called amplification refractory mutation system (ARMS), that is simple, quick and adapted to glaucoma is disclosed herein. The proposed invention relates to the inclusion of primers and probes for the amplification and detection of all mutations in the TIGR gene.
Although the invention teaches the use of the method of ARMS for glaucoma, the invention is not so limited. Other methods of mutation analyses known in the field, such as allele specific oligonucleotide (ASO), denaturing gradient gel electrophoresis (DGGE) and artificially created restriction site (ACRS), can also be used.
The mutation detection and analyses thereof can be performed on either genomic DNA or cDNA by any method known to a person skilled in the art.
In addition the applicant has demonstrated for the first time a new type of dominance in mammals in which heterozygotes have a much higher penetrance rate for a disease gene mutation than their homozygotic counterparts.
Further, the present invention provides for the first time the identification in an autosomal dominant disease, of a homozygote mutant which is phenotypically normal, even though such an individual may give rise to an affected heterozygote offspring. This homoallelic complementation phenomenon has now been observed with 4 different patients.
The invention provides applications and uses for such a discovery. These include but are not limited to:
a) treatment of a heterozygote mutant (affected individuals with overexpressed mutant protein to induce protein complementation such that normal protein function can be restored, this application will apply to any autosomal dominant disease exhibiting the same mode of action as described herein (i.e. homoallelic complementation).

b) similarly an individual being a heterozygote for an autosomal dominant disorder exhibiting the same mode of action as described herein can be treated by gene therapy, such that a mutant allele is inserted into a vector and delivered to an individual thereby negating the effect of the heterozygote mutation by either allelic or protein complementation.
c) with the new knowledge of the present invention, a transgenic animal designed to carry a deleterious autosomal dominant mutation can be used to assess the requirement to produce a phenotypically normal animal, by either allelic complementation or protein complementation.
d) a diagnostic means to identify phenotypically normal genotypically mutant individuals that can transmit the mutant allele to their offsprings.
e) the teachings of the present invention can be used for showing dimezisation of TIGR peptides.
The present invention therefore also provides the means to identify novel mutations in the TIGR gene, wherein these mutations give rise to glaucoma. These mutations can also be identified by any other means known to a person skilled in the art. As well, the diagnostic methods of the present invention can be adapted in a kit format comprising probes, primers, oligonucleotides and reagents commonly known in the art to provide the means for detecting mutations that may cause glaucoma. The present invention further provides methods to treat diseases or conditions associated with homoallelic complementation.
The mutation analysis according to the present invention is useful for screening individuals at risk for glaucoma. Such individuals may have a family history of glaucoma, and for identifying individuals carrying a mutation in the glaucoma gene enabling early treatment which may obviate or minimise the progression of the disease.
In another embodiment of the present invention, there is provided a kit comprising all the necessary reagents to carry out the herein described methods of detection. As known to the person of ordinary skill, the kit comprises container means comprising oligonucleotide sequences or antibodies (or binding proteins) and reagents such as washing reagents, reagents for detection purposes and the like. It will also be readily recognized that the nucleic acid sequences or antibodies of the present invention could be incorporated into established kit formats.
The present invention thus discloses, for the first time, a mechanism termed "homoallelic complementation" wherein for example the K423E mutation is acting in a dominant negative fashion, thereby resulting in a defective TIGRwtlK423E protein heteromaltemers but functional TIGR
K23ElK23E homopolymers. This form of interaction may be interpreted as being somewhat similar to the "metabolic interference model" that suggested a deleterious defect due to interference between the protein products of the two different alleles (Johnson, 1980, Am. J. Hum. Genet. 32:374-86). The homoallelic complementation model of the present invention, however, further proposes that functional TIGRwtlwt and/or TIGR K23ElK23E homopolymers are generated by an admixture of normal and mutant subunits in TIGRwtlK432E
heterozygotes, thereby explaining, at least in part, the phenotypic variability observed in effected carriers as well as the unaffected mutant homozygotes described herein. It should be noted that Crick et al. (1964, J. Molec. Biol.
8:161-165) had previously suggested the theory of inter-allelic complementation.
White homoallelic complementation has been identified and validated with glaucoma, it is suspected to be a phenomenon which is not limited thereto. For example, a form of epilepsy and mental retardation linked to chromosome X, which only affects women, has been reported (Ryan et al., 1997, Nature Genetics 17:92-95).
In accordance with the present invention, there is thus provided an isolated DNA comprising the nucleotide sequence defined in SEQ.
ID. NO.: 1, wherein a mutation is identified therein There is also provided a method for detecting a mutant allele of the TIGRlMYOC gene which comprises the steps of contacting a DNA sample taken from an individual with an oiigonucleotide as defined in claims 3, 5 or and with an oligonucleotide primer of the present invention; obtaining an 5 amplified product in an amplification reaction; and detecting the amplification product as an indication of the presence of said mutant allele.
In accordance with the present invention, there is also provided a method for detecting a non-mutant allele of the TIGWMYOC gene which comprises the steps of contacting a DNA sample taken from an individual, 10 with an oligonucleotide primer (or a probe enabling a distinction between wild type and mutant); obtaining an amplified product in an amplification reaction;
and detecting the amplification product as an indication of the presence of the non-mutant allele.
The application further relates to a kit for the detection of 15 mutations in the TIGR gene comprising an oligonucleotide of the present invention; and suitable reagents required for obtaining amplified products in an amplification reaction.
In addition, in accordance with the present invention, there is provided a method to counteract glaucoma in a heterozygotic carrier of TIGR
20 mutations, an overexpression of mutated TIGR protein in a patient, thereby rendering the phenotype of said patient normal by homoallelic complementation.
Further, in accordance with the present invention, there is provided a method to counteract and/or treat heterozygotic carriers of an 25 autosomal dominant inherited disorder caused by a protein that forms homomultimers, comprising at least one of an overexpression of the mutated protein and an inhibition of the normal protein in a patient, thereby rendering said phenotype normal by homoallelic complementation.
Further, in accordance with the present invention, there is 30 provided a method to counteract a disease phenotype in a patient, wherein the disease phenotype is associated with the presence of a heterozygotic mutation in a protein in the patient, the method comprising at least one of an elevation of the expression of a mutated protein and an inhibition of expression and/or activity of the normal protein, to counteract the affected phenotype, thereby 5 rendering the phenotype normal by one of homoallelic complementation and haploinsufficiency.
DEFINITIONS AND TECHNOLOGICAL BACKGROUND
Nucleotide sequences are presented herein by single strand, 10 in the 5' to 3' direction, from left to right, using the one letter nucleotide symbols as commonly used in the art and in accordance with the recommendations of the IUPAC-IUB Biochemical Nomenclature Commission.
Unless defined otherwise, the scientific and technological terms and nomenclature used herein have the same meaning as commonly understood by a person of ordinary skill to which this invention pertains.
Generally, the procedures for cell cultures, infection, molecular biology methods and the like are common methods used in the art. Such standard techniques can be found in reference manuals such as for example Sambrook et al. (1989, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratories) and Ausubel et al. (1994, Current Protocols in Molecular Biology, Wiley, New York).
The present description refers to a number of routinely used recombinant DNA (rDNA) technology terms. Nevertheless, definitions of selected examples of such rDNA terms are provided for clarity and consistency.
As used herein, "TIGR" refers to the trabecular meshwork inducible glucocorticoid response gene product, also known as MYOC, present at the GLC1A locus. Herein, "TIGR" therefore refers to TIGRlMYOC. It should be noted that the TIGRlMYOC gene is sometimes referred to as the GLC1A
gene.
As used herein. the terminology "homoallelic complementation" refers to the novel description of mutant homozygotes being phenotypically normal with respect to an autosomal dominant inherited disease.
It should be noted that although the present invention focuses on autosomal dominant inherited diseases, the present invention also applies to haploinsufficiency. Broadly stated, the mechanism would be similar to a 5 suggested locus with a wild-type allele A and a mutant allele A', such that homozygosity for either allele, has no phenotypic consequences, but the heterozygous state AA' leads to a deleterious defect due to interference between the protein products of the two different alleles.
As used herein, "nucleic acid molecule", refers to a polymer of nucleotides. Non-limiting examples thereof include DNA (i.e. genomic DNA, cDNA) and RNA molecules (i.e. mRNA). The nucleic acid molecule can be obtained by cloning techniques or synthesized. DNA can be double-stranded or single stranded (coding strand or non-coding strand [antisense]).
The term "recombinant DNA" as known in the art refers to a DNA molecule resulting from the joining of DNA segments. This is often referred to as genetic engineering.
The term "DNA segment", is used herein, to refer to a DNA
molecule comprising a linear stretch or sequence of nucleotides. This sequence when read in accordance with the genetic code, can encode a linear stretch or sequence of amino acids which can be referred to as a polypeptide, protein, protein fragment and the like.
The terminology "amplification pair" or "primer pair" refers herein to a pair of oligonucleotides (oligos) of the present invention, which are selected to be used together in amplifying a selected nucleic acid sequence by one of a number of types of amplification processes, preferably a polymerase chain reaction. Other types of amplification processes include ligase chain reaction, strand displacement amplification, or nucleic acid sequence-based amplification. as explained in greater detail below. As commonly known in the art, the oligos are designed to bind to a complementary sequence under selected conditions.

it will be clear to the person of ordinary skill that the present invention can be adapted to the detection of numerous mutations in TIGRlMYOC. As exemplified hereinbelow, using a particular embodiment of the present invention using ARMS with oligos having the sequences of SEQ ID
5 N0:5 and SEQ ID N0:7, mutations His366G1n and LYS424GLn were identified.
The nucleic acid (i.e. DNA or RNA) for practising the present invention may be obtained according to well known methods.
Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the 10 particular needs and targeted genomes employed. In general, the oligonucleotide probes or primers are at least 10 nucleotides in length, preferably between 15 and 24 nucleotides, and they may be adapted to be especially suited to a chosen nucleic acid amplification system. As commonly known in the art, the oligonucleotide probes and primers can be designed by 15 taking into consideration the melting point of hydrizidation thereof with its targeted sequence (in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).
"Nucleic acid hybridization" refers generally to the 20 hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel et al., 1989 supra) and are 25 commonly known in the art. In the case of a hybridization to a nitrocellulose filter, as for example in the well known Southern blotting procedure, a nitrocellulose filter can be incubated overnight at 65°C with a labeled probe in a solution containing 50% formamide, high salt ( 5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 Ng/ml denatured carried DNA ( i.e.
30 salmon sperm DNA). The non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency). The selected temperature is based on the melting temperature (Tm) of the DNA hybrid. Of course, 5 RNA-DNA hybrids can also be formed and detected. In such cases, the conditions of hybridization and washing can be adapted according to well known methods by the person of ordinary skill. High stringency conditions will be preferably used (Sambrook et a1.,1989, supra).
Probes or nucleic acid molecules of the invention can be 10 utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and a-nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic acid molecule. Acids Res., 14:5019. Probes of the invention can be 15 constructed of either ribonucleic acid {RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.
The types of detection methods in which probes can be used include Southern blots (DNA detection), dot or' slot blots (DNA, RNA), and Northern blots (RNA detection). Although less preferred, labelled proteins could 20 also be used to detect a particular nucleic acid sequence to which it binds. Other detection methods include kits containing probes on a dipstick setup and the like.
Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such 25 a label might be beneficial, by increasing the sensitivity of the detection.
Furthermore, it enables automation. Probes can be labelled according to numerous well known methods (Sambrook et al., 1989, supra). Non-limiting examples of labels include 3H, "C, 3zP, and 35S. Non-limiting examples of detectable markers include iigands, fluorophores, chemiluminescent agents, 30 enzymes, and antibodies. Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.
5 As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods. Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32P
ATP and polynucleotide kinase, using the Kienow fragment of Pol I of E. coli in the presence of radioactive dNTP (i.e. uniformly labelled DNA probe using 10 random oligonucleotide primers in low-melt gels;), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.
As used herein, "oligonucleotides" or "oligos" define a molecule having two or more nucleotides (ribo or deoxyribonucleotides). The 15 size of the oligo will be dictated by the particular situation and ultimately by the particular use thereof, and adapted accordingly by the person of ordinary skill.
An oligonucleotide can be synthetised chemically or derived by cloning according to well known methods.
As used herein, a "primer" defines an oligonucleotide which 20 is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for DNA synthesis under suitable conditions.
Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 25 1990, (Am. Biotechnol. Lab. 8:14-25). Numerous amplification techniques have been described and can be readily adapted to suit the particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Q~
30 replicase system and NASBA (Kwoh et al 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et al., 1988, BioTechnology 6:1197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253-260; and Sambrook et al., 1989, supra). Preferably, amplification will be carried out using PCR.
Polymerase chain reaction (PCR) is carried out in accordance 5 with known techniques. See, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202;
4,800,159; and 4,965,188 (the disclosures of all three U.S. Patent are incorporated herein by reference). In general, PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucieotide primer for each strand of 10 the specific sequence to be detected. An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the 15 same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analysed to assess whether the sequence or sequences to be detected are present. Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like. For a review on PCR techniques (see PCR Protocols, A Guide to Methods and Amplifications, Michael et al., Eds, Acad. Press, 1990).
Ligase chain reaction (LCR) is carried out in accordance with known techniques (Weiss, 1991, Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill.
Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).
As used herein, the term "gene" is well known in the art and relates to a nucleic acid sequence defining a single protein or polypeptide. A

"structural gene" defines a DNA sequence which is transcribed into RNA and translated into a protein having a specific amino acid sequence thereby giving rise the a specific polypeptide or protein. It will be readily recognized by the person of ordinary skill, that the nucleic acid sequences of the present invention 5 can be incorporated into anyone of numerous established kit formats which are well known in the art.
The term "vector" is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can serve as a DNA
vehicle into which DNA of the present invention can be cloned. Numerous types 10 of vectors exist and are well known in the art.
The term "expression" defines the process by which a structural gene is transcribed into mRNA (transcription), the mRNA is then being translated (translation) into one polypeptide (or protein) or more.
The terminology "expression vector" defines a vector or 15 vehicle, as described above, but designed to enable the expression of an inserted sequence following transformation into a host. The cloned gene (inserted sequence) is usually placed under the control of control element sequences such as promoter sequences. The placing of a cloned gene under such control sequences is often referred to as being "operably linked" to control 20 elements or sequences.
Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain transcriptional elements such as enhancer elements, termination sequences, 25 tissue-specificity elements, and/or translational initiation and termination sites.
As used herein, the designation "functional derivative"
denotes, in the context of a functional derivative of a sequence, whether nucleic acid or amino acid sequence. a molecule that retains a biological activity (either functional or structural) that is substantially similar to that of the original 30 sequence. This functional derivative or equivalent may be a natural derivative . 17 or may be prepared synthetically. Such derivatives include amino acid sequences having substitutions, deletions, or additions of one or more amino acids, provided that the biological activity of the protein is conserved. The same applies to derivatives of nucleic acid sequences which can have substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the sequence is generally maintained. When relating to a protein sequence, the substituting amino acid has chemico-physical properties which are similar to that of the substituted amino acid. The similar chemico-physical properties include, similarities in charge, bulkiness, hydrophobicity, hydrophylicity and the like. The term "functional derivatives" is intended to include "fragments", °segments", "variants", "analogs" or "chemical derivatives"
of the subject matter of the present invention.
Thus, the term "variant" refers herein to a protein or nucleic acid molecule which is substantially similar in structure and biological activity to the protein or nucleic acid of the present invention.
The functional derivatives of the present invention can be synthesized chemically or produced through recombinant DNA technology. All these methods are well known in the art.
As used herein, "chemical derivatives" is meant to cover additional chemical moieties not normally part of the subject matter of the invention. Such moieties could affect the physica-chemical characteristic of the derivative (i.e. solubility, absorption, half life and the like, decrease of toxicity).
Such moieties are exemplified in Remington's Pharmaceutical Sciences (1980).
Methods of coupling these chemical-physical moieties to a polypeptide are well known in the art.
The term "allele" defines an alternative form of a gene which occupies a given locus on a chromosome.
As commonly known, a "mutation" is a detectable change in the genetic material which can be transmitted to a daughter cell. As well known, a mutation can be, for example, a detectable change in one or more deoxyribonucleotide. For example, nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position. Spontaneous mutations and experimentally induced mutations exist. The result of a mutations of nucleic acid molecule is a mutant nucleic acid molecule. A mutant polypeptide 5 can be encoded from this mutant nucleic acid molecule.
As used herein, the term "purified" refers to a molecule having been separated from a cellular component. Thus, for example, a "purified protein" has been purified to a level not found in nature. A "substantially pure"
molecule is a molecule that is lacking in all other cellular components.
10 The term "autosome" defines any chromosome other that the sex chromosomes, X and Y.
The term "dominant" refers to an allele that determines the phenotype displayed in a heterozygote with another normal or mutant allele.
The terminology "transgenic animal" defines an animal that 15 has had its germ line genetically modified to give rise to a progeny animal that is different from the parental type and carrying the modification in its germ line.
Non-human transgenic animals of the invention comprise animals having transgenic alteration of an endogenous gene which shows homoallelic complementation, in accordance with the present invention. Such 20 non-human animals are commonly known in the art and include vertebrates, and more especially mammalians, and especially rodents such as rats and more particularly mice. These transgenic animals have had introduced into their genomes, by non-natural means (i.e. by manipulation), one or more gene which does not occur naturally in the animal These non-naturally occuring genes in 25 the animal {known as transgenes) may be from the same species as the animal, although in such a case, the gene or genes are in a different configuration and/or chromosomal location. A transgenic non-human animal of the invention can be produced in accordance with well-known methods in the art. Non-limiting examples of such methods include viral integration, microinjection of zygotes 30 and the like.

"Single Strand Conformational Polymorphism (SSCP)" refers to a method for detecting the presence of a base pair change in an amplified DNA fragment. The method involves denaturing the double stranded amplified DNA and comparing the band pattern in a known non-mutant fragment to that 5 of an unknown fragment. A shift in the band pattern is indicative of a base pair change.
The designation "gene therapy" defines an attempt to treat disease by genetic modification of the cells of a patient.
"Allele Specific Oligonucleotide (ASO)" are designed to detect 10 known and identified base pair change by designing oligonucleotides that are specific to the DNA fragment with and without the base change. These oligonucleotides are used as probes in hybridisation protocols under stringent conditions. Differences in the hybridization patterns is indicative of the presence or absence of the base change.
15 "Artificially Created Restrictian Site (ACRS)" refers to a method for detection a known base change in a DNA sequence. It involves the designing of a primer that may either create or obviate a restriction site in the vicinity of known base change, such that the restriction endonuclease used can have a different digestion pattern for the changed and unchanged base.
20 For certainty, the sequences and poiypeptides useful to practice the invention include without being limited thereto mutants, homologs, subtypes, alleles and the like. It shall be understood that generally, the sequences of the present invention should encode a functional (albeit defective) interaction domain. it will be clear to the person of ordinary skill that whether an 25 interaction domain of the present invention, variant, derivative, or fragment thereof retains its function in binding to its partner can be readily determined by using the teachings and assays of the present invention and the general teachings of the art.
Also contemplated within the scope of the present invention 30 are fusion proteins comprising one of the interacting domains of the present invention. As exemplified herein below in one embodiment, at feast one of an interaction domain of the present invention may be provided as a fusion protein.
The design of constructs therefor and the expression and production of fusion proteins and are well known in the art (Sambrook et al., 1989, supra; and 5 Ausubel et al., 1994, supra). Non-limiting examples of fusion proteins include LexA-fusions, B42-fusions, hemaglutinin fusions and Gluthione-S-transferase (GST) fusions and Maltose binding protein (MBP) fusions. In certain embodiments, it might be beneficial to introduce a protease cleavage site between the two polypeptide sequences which have been fused. Such protease 10 cleavage sites between two heterologously fused polypeptides are well known in the art.
In certain embodiments, it might also be beneficial to fuse the interaction domains of the present invention to signal peptide sequences enabling a secretion of the fusion protein from the host cell. Signal peptides from 15 diverse organisms are well known in the art. Bacterial OmpA and yeast Suc2 are two non limiting examples of proteins containing signal sequences. In certain embodiments, it might also be beneficial to introduce a linker {commonly known) between the interaction domain and the heterologous polypeptide portion. Such fusion protein find utility in the assays of the present invention as well as for 20 purification purposes, detection purposes and the like.
The interaction domains of the present invention can be modified, for example by in vitro mutagenesis, to dissect the structure-function relationship thereof and permit a better design and identification of modulating compounds (i.e. to deactivate or inhibit the normal protein). However, some 25 derivative or analogs having lost their biological function of interacting with their respective interaction partner may provide further advantages as compared to known mutant protein, as well they may also find utility, for example for raising antibodies. Such analogs or derivatives could be used for example to raise antibodies to the interaction domains of the present invention. These antibodies 30 could be used for detection or purification purposes. In addition, these antibodies could also act as competitive or non-competitive inhibitor and be found to be modulators of the protein-protein interactions of the present invention.
In general, techniques for preparing antibodies (including monoclonal antibodies and hybridomas) and for detecting antigens using antibodies are well known in the art (Campbell, 1984, In "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publisher, Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody - A Laboratory Manual, CSH Laboratories). The present invention also provides polyclonal, monoclonal antibodies, or humanized versions thereof, chimeric antibodies and the like which inhibit or neutralize their respective interaction domains and/or are specific thereto.
The present invention also provides antisense nucleic acid molecules which can be used for example to decrease or abrogate the expression of the normal allele. An antisense nucleic acid molecule according to the present invention refers to a molecule capable of forming a stable duplex or triplex with a portion of its targeted nucleic acid sequence (DNA or RNA).
The use of antisense nucleic acid molecules and the design and modification of such molecules is well known in the art as described for example in WO 96/32966, WO 96/11266, WO 94/15646, WO 93/08845, and USP 5,593,974. Antisense nucleic acid molecules according to the present invention can be derived from the nucleic acid sequences and modified in accordance to well known methods.
For example, some antisense molecules can be designed to be more resistant to degradation to increase their affinity to their targeted sequence, to affect their transport to chosen cell types or cell compartments, and/or to enhance their lipid solubility by using nucleotide analogs and/or substituting chosen chemical fragments thereof, as commonly known in the art From the specification and appended claims, the term therapeutic agent should be taken in a broad sense so as to also include a combination of at least two such therapeutic agents Further, the DNA segments or proteins according to the present invention can be introduced into individuals in a number of ways. For example, erythropoietic cells can be isolated from the afflicted individual, transformed with a DNA construct according to the invention and reintroduced to the afflicted individual in a number of ways, including intravenous injection. Alternatively, the DNA construct can be administered 5 directly to the afflicted individual, for example, by injection in the bone marrow.
The DNA construct can also be delivered through a vehicle such as a liposome, which can be designed to be targeted to a specific cell type, and engineered to be administered through different routes.
For administration to humans, the prescribing medical 10 professional will ultimately determine the appropriate form and dosage for a given patient, and this can be expected to vary according to the chosen therapeutic regimen (i.e DNA construct, protein, cells), the response and condition of the patient as well as the severity of the disease.
Composition within the scope of the present invention should 15 contain the active agent (i.e. fusion protein, nucleic acid, and molecule) in an amount effective to achieve the desired therapeutic effect while avoiding adverse side effects. Non-limiting examples of active agents include the mutant protein according to the present invention a nucleic acid molecule encoding such a mutant protein, an antisense molecule to a normal allele according to the 20 present invention, etc. Typically, the nucleic acids in accordance with the present invention can be administered to mammals (i.e. humans) in doses ranging from 0.005 to 1 mg per kg of body weight per day of the mammal which is treated. Pharmaceutically acceptable preparations and salts of the active agent are within the scope of the present invention and are well known in the art 25 (Remington's Pharmaceutical Science, 16th Ed., Mack Ed.). For the administration of polypeptides, antagonists, agonists and the like, the amount administered should be chosen so as to avoid adverse side effects. The dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient.
Typically, 30 0.001 to 50 mg/kg/day will be administered to the mammal.

r _~
r~: . . _ . . , ' r. ~~ on ., n 1 , . n ~ A f .~ ~, f1 C i/
fn . _ _ _. _ . O O
~ C C O 0 BRIEF DESCRIPTION OF THE DRAWINGS
Having thus generally described the invention, reference will now be made to the accompanying drawings, showing by way of illustration a preferred embodiment thereof, and in which:
Figure 1 a-Figure 1 a show the sequence that encodes the wild-type TIGR~IVIYOC cDNA sequence (SEQ ID N0:1) localized at the GLC9A
locus on chromosome 1 q23-q25.
Figure 2 shows the characterization of a carrier homozygous for the Lys423G1u TIGR mutation. a, Structure of the TIGR encoded protein. The leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein. The Lys423G1u mutation is depicted by an open circle in the olfactomedin homology domain represented by a striped box within the C-terminal half of the protein. Amino acids comparison between human TIGRlMYOC protein (amino acids 415-437), human neuronal olfactomedin, rat and bullfrog neuronal olfactomedin-related proteins (GeneBank accession 079299, 003417, L13595, respectively) and C. elegans F11c3.2 protein (GeneBank accession 281499) is represented. Identical amino acids are shaded in black, conserved amino acids are further boxed by white squares. The codon numbers correspond to those of the TIGWMYOC protein, b, Identification of an homozygous carrier of the Lys423G1u TIGR mutation. Direct sequencing of genomic DNA revealed that persons VI-3 and VI-9 were, respectively, heterozygotic and homozygotic carriers of the Lys423G1u TIGR mutation. The arrows indicate the A to G transition. Person VI-2 carried two wild-type TIGR
alleles.
Figure 3 shows the amplification refractory mutation system (ARMS) as a method to type specific alleles at a polymorphic locus. In the present invention, this method, ARMS, was used for detecting a specific pathogenic mutation. The allele-specific oligonucleotide primers were designed to discriminate between two target DNA sequences {wild-type (normal) versus pathogenic) that differed by a single nucleotide in the region of interest (either AMENOEO SHEET

one of the two mutations). Designed primers that differed at the extreme 3' terminus were synthetised. This was done because the DNA synthesis step in the PCR reaction is crucially dependent on correct base pairing at the 3' end.
The primers that were designed are differing in their 3' ends and can therefore 5 specifically amplify the DNA fragment of interest, either normal or mutated.
This figure is a pictorial representation of ARMS for the adenine to guanine transition at nucleotide 1267. The amplification strategy is demonstrated for the wild-type;
or non-mutant allele, and the mutant aiiele.
Figure 4 shows the phenotypic status and segregation 10 analyses of the GLC1A disease haplotype and Lys423Gfu in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatelfite markers spanning the GLC1A locus and tested for the presence of the Lys423G1u TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in 15 pedigree GV-001 and sizes of the allele associated with the GLC1A disease haplotype are represented on top. The position of the TIGR gene is indicated relative to genetic markers. Sex-averaged recombination distances, depicted between marker loci in centiMorgans, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open 20 symbols, and deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols. A
solid 25 black box indicates the common GLC1A disease hapiotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person VII-5 represents a microsatellite mutation at locus D152790.
Person VII-5 also inherited a paternal recombination between loci D152815 and 30 D1S2790. Results of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423G1u mutant primers. The internal control PCR
product is shown. Persons VI-2, VI-5, VI-6, VI-10 and VI-12 carried the wild-type allele on both chromosomes 1. Persons VI-1, Vl-7, Vl-9 and VI-11 are wild-type 5 negative and mutant positive, therefore, homozygous for the Lys423G1u mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.
Figure 5 shows the characterization of carriers for the HIS366GIn and GIn368Stop TIGR mutations. a, Structure of the TIGR encoded 10 protein. The leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein. The His366G1n mutation is depicted by a black circle in the olfactomedin homology domain represented by a striped box within the C-terminal half of the protein. The GIn368Stop mutation is depicted by a stop codon in the olfactomedin homology domain. The codon numbers correspond 15 to those of the TIGR protein. b, Identification of carriers for the His366G1n and GIn368Stop TIGR mutations. Direct sequencing of genomic DNA revealed that persons CT-003 and LA-002 were, respectively, heterozygotic carriers of the GIn368Stop and His366G1n TIGR mutations. The arrows indicate the C to T
transition or C to G transversion.
20 Figure 6 shows that the TIGR wild-type protein and Lys423G1u mutated TIGR protein form high molecular weight complexes in vivo and in vitro. a, Western analyses of TIGR wild-type and TIGR Lys423G1u polypeptides in transfected cells. COS-7 cells were transiently transfected with expression vectors containing wild-type TIGR, pRc/CMV or TIGRK423E
25 (pRcTIG432E) cDNA (20 mg per sample), alone or in combination. Twenty-four hours after transfection, protein extracts from total cell lysates were resolved by SDS-PAGE and TIGR polypeptides were detected by immunoblotting. The two fines above the immunoblot depict the relative amount of each cDNA tested per sample on a scale of 0 (0 mg) to 100 (20 mg). For instance, TIGR wild-type (TIGRwt) 50- TIGR Lys423G1u (TIGRK423E) 50 indicates that 10 mg of each cDNA were added in this transfection. Two high molecular weight complexes are generated by TIGR polypeptides in COS-7 cells b, Western analyses of extracts obtained from dissected human trabecular meshwork (HTM) tissues. This analysis shows that TIGR polypeptides also form high molecular weight 5 complexes in vivo. COS-7 cell extracts from cultures transfected with TIGRwt or TIGRK423E cDNA (20 mg) are depicted for comparison. Three distinct subtypes of T1GR monomers are observed after treating HTM tissue extracts with DTT, A brief exposure time period was performed to clearly visualize these monomers. c, Western analyses of in vitro synthesized TIGR wild-type and 10 TIGR Lys423G1u polypeptides. pRcTIG or pRcTIG423E plasmids were added to a reticulocyte lysate transcription/translation coupled system containing pancreatic microsomal membranes. 0.5 microgram of each plasmid were tested per reaction. This analysis shows that both TIGR wild-type and TiGR Lys423Giu polypeptides can form homodimers in vitro. a-c, All samples were separated on 15 6% denaturing polyacrylamide gels and analyzed using a specific polyclonal antibody made against the non-glycosylated form of the protein. DTT indicates samples that were treated with dithiothreitol (0.1 mM) prior to electrophoresis.
Position of molecular weight markers and of the expected monomers, dimers and tetramers are illustrated adjacent to the immunoblots.
20 Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of preferred embodiments with reference to the accompanying drawing which is exemplary and should not be interpreted as limiting the scope of the present invention.

DESCRIPTION OF THE PREFERRED EMBODIMENT
The invention thus concerns novel mutations in the TIGR
gene, a quick method for an easy detection of identified mutations and the teachings for the first time of mutant homozygotes being phenotypically normal 30 in an autosomally dominant inherited disease.

The surprising and unexpected showing that homoallelic complementation restores a normal phenotype opens the way to new and powerful therapeutic approaches for diseases or conditions in which such a type of heterozygous state (AA') leads to a deleterious defect due to interference 5 between the protein products of the two different alleles A and A', and in particular to an autosomal dominance state.
The present invention is illustrated in further detail by the following non-limiting examples.

Pediarees and ophthalmologic assessments 1.1 Pediaree reconstitution The pedigree genealogy was reconstituted using the registers compiled from the Catholic parish records, which systematically list births, marriages, and deaths 15 of 98% of the Quebec population. Validation of the family tree and new data on recent births were obtained through interviews with key family members. The Archives Nationales du Quebec, the Quebec Civil register, and the Institut de recherche sur /'etude des populations (/REP) data base (Bouchard et al., 1991, Histoire d'un genome. Population et genetique dans Pest du Quebec, Presses 20 de 1'Universite Laval, Sillery, Quebec, pp 607) were also consulted.
1.2 Ophthalmologic investigations All subjects, affected or not, gave informed consent before entering the study.
Clinical assessments comprised complete ophthalmologic evaluation, including best corrected visual acuity; optic disk examination; slit-lamp biomicroscopy;
25 applanation tonometry; gonioscopy; and visual-field evaluation. Three criteria were required for primary open-angle glaucoma (POAG) diagnosis: a) intraocular pressures above 22 mm Hg in both eyes, b) characteristic optic disk damage and/or visual field impairment, and c) grade III or IV (open-angle) gonioscopy. In the absence of optic disk damage or visual-field alteration, 30 subjects with intraocular pressures above 22 mm Hg in both eyes and grade III

or IV gonioscopy were diagnosed with ocular hypertension (OHT). Members of the families were considered normal when they presented normal optic disks and showed highest intraocular pressures ever recorded at 22 mm Hg or less.
Persons with other forms of giaucomas, including grade 0 (closed angle); grade 5 I or II (narrow-angle); congenital; and secondary glaucomas, or with other nonglaucomatous ocular disorders were considered unaffected. Blindness in deceased ancestors was confirmed by at least two independent sources.

10 Genetic analyses 2.1 Source of DNA
Blood samples were obtained from direct descendants of the founder as well as spouses of affected patients with children; from each, 20 ml of blood was drawn by venipuncture in heparinized tubes. One additional 10 ml blood sample was 15 drawn from each subject to establish fymphoblastoid cell lines using the method of Anderson et al. (1984, In Vitro, 20:856-858).
2.2 Isolation of DNA
DNA was extracted from whole blood using the guanidine hydrochloride-proteinase K method developed by Jeanpierre (1987, Nucl. Acids.
20 Res.15:9611-9611).
2.3 Genotyping procedures To accelerate genotyping, a protocol similar to the procedure of Vignal et al.
(1993, Methods in molecular genetics, Academic Press, 1_:211-221 ) which was derived from the multiplex sequencing technique of Church and Kieffer-Higgins 25 (1988 Science 240:185-188) was used. Briefly, polymerase chain reactions (PCR) were performed in a total volume of 50 NI containing 100 ng of genomic DNA, 50 pmol of each primer, 125 mM dNTPs, 50 mM KCI, 10 mM Tris (pH 9), 1.5 mM MgCl2, 0.01 % gelatin, 0.1 % Triton X-100, and 1 U Taq polymerase (Perkin-Elmer-Cetus). Amplifications were carried out using a "hot-start"
30 procedure. Taq polymerase was added after a 5-min denaturation step at 96°C.

Samples were then processed through 35 cycles of denaturation (94° C
for 40 s) and annealing (55°C for 30 s), followed by one last step of elongation (2 min at 72°C). Usually, three amplification products synthesized with separate primer sets on identical DNA samples were coprecipitated and comigrated in a single 5 lane of 6% polyacrylamide denaturing gels. Separated products were then transferred onto Hybond N; nylon membranes (Arnersham), hybridized with a (CA)Z° oligomer 3' labeled with Digoxigenin-11-ddUTP, and detected by chemiluminescence using the DIG system (Boehringer-Mannheim) with Kodak XAR-5 films. Genotypes were scored relative to reference alleles of the mother 10 of the CEPH family 1347 (individual 134702). Genotyping was repeated upon detection of incompatibilities or recombination events.
2.4 Selection of microsatellite markers In Figure 4, the markers used for haplotype analyses are shown. Wth the exception of two markers (AFMGLC21 and AFMGLC22), all AFM (Genethon) 15 markers reported above were described in Dib et al. (1996, supra). For AFMGLC21, the sequences were primer a: GATCTCTTATCAGTCAGGCA
(SEQ ID N0:7), and primer m: TTTCTAAGGCTGAATAATATTCG SEQ ID
N0:8). For AFMGLC22, the sequences were primer a:
TTAACTCACCACTCCCTGCC (SEQ ID N0:9), and primer m:
20 AATTATGGCCTTCGCCC (SEQ ID N0:10). Assignment of the genetic location of these markers was established according to the method of Weissenbach et al. (1992, Nature, 359:795-801) and has been validated by construction of a 10-cM physical map (Clepet et al., 1996, Eur. J. Hum.Genet., 4:250-259).
2.5 Haplotype analysis 25 Haplotypes were analysed to phase the marker genotypes with the disease gene The haplotype inherited by an affected child constituted the "disease"
haplotype and was compared with the common disease hapiotype inherited from the founder. The remaining three haplotypes were considered the "normal"
haplotypes.

Discovery of the phenotyrpic normal-homozy~gote mutant 3.1 Phenotvc~ic normal-homozygote mutant (Figure 4~
Phenotypic status and segregation analyses of the GLC1A disease haplotype 5 and Lys423G1u TIGR mutation in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatellite markers spanning the GLC1A locus and tested for the presence of the Lys423G1u TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele 10 associated with the GLC1A disease haplotype are represented on top. The position of the TIGRlMYOC gene is indicated relative to genetic markers.
Sex-averaged recombination distances, depicted between marker loci in centiMorgans, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and deceased subjects 15 reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols. A solid black box 20 indicates the common GLC9A disease haplotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person VII-5 represents a microsatellite mutation at locus D152790. Person VII-5 also inherited a paternal recombination between loci D152815 and D1S2790. Results 25 of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423G1u mutant primers. The internal control PCR product is shown. Persons VI-2, VI-5, VI-6, VI-10 and VI-12 carried the wild-type allele on both chromosomes 1. Persons VI-1, VI-7, VI-9 and VI-11 are wild-type negative and 30 mutant positive, therefore, homozygous for the Lys423G1u mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.
3.2 Initial screening for mutations (Figure 21 To obtain a wild-type TIGR cDNA, RT-PCR was performed using the Superscript 5 RT protocol (GibcoIBRL), 500 ng of oligo-dT and 10 Ng of total RNA isolated from a pool of trabecular meshwork tissue dissected from 10 pairs of human eyes. To obtain the mutated TIGR cDNA, the same protocol was followed using 10 pg of total RNA isolated from homozygote VI-9 immortalized lymphoblasts.
One to 3 NI of first strand cDNA synthesis was amplified with primers 41 F:
10 AGAGCTTTCCAGAGGAAGCC (SEQ ID N0:11 ), and 1731 R:
GGTCTACGCCCTCAGACTAC (SEQ 1D N0:12), before a second round of PCR
with internal primers 31 F: AGAGACAGCAGCACCCAACG (SEQ ID N0:13), and 21 R: TCTGCCATTGCCTGTACAGC (SEQ ID N0:14). PCR products were directly cloned into the pCRll vector using the TA cloning kit (InV'~trogen) 15 according to the manufacturer's protocol. Cloned products were sequenced using the T7 sequencing kit (Pharmacia).
3.3 Sequencing To confirm mutations, genomic DNA sequencing was also performed on selected individuals by direct asymmetric PCR sequencing using modifications 20 of the protocol described by Gyllensten et al. (1988, Proc. Natl. Acad.
Sci., $_5:7652-7656}. The mutation was recognized by the approximately equal peak intensity of the bands on the autoradiogram. All sequencing was performed bidirectionally.

Two mutations including ARMS
4.1 ARMS test for the Lyrs423G1u mutation (Figure ~
To test for the presence of the Lys423G1u mutation, we developed an amplification refractory mutation system (ARMS) exploiting procedures 30 described by ~itt~e (1997, Current Protocols in human genetics, Eds.
Dracopoli, N.C. et al., 9.8.1. - 9.8.12). Two complementary PCR reactions were conducted with.the same substrate. The first reaction contained a forward primer specific for the wild-type allele, SEQ. NO. 3, (GLC1A1313AA}:
TCGAACAAACCTGGGAGACAAACATCCGAA. The second reaction contained 5 a fonrvard primer specific for the Lys423G1u TIGR allele, SEQ. NO. 2, (GLC1A1313GG): TCGAACAAACC T GGGAGACAAACATCCGGG. In each reaction, a common reverse primer, GLC1A1479R, was used; its sequence was:
SEQ. NO. 4 CAAAGAGCTTCTTCTCCAGGGGGTTGTAGT. Both reactions gave a 225 by amplified fragment. To serve as internal control, a second pair of 10 primers that co-amplified a 438 by fragment within TIGR exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was:
AGAGCTTTCCAGAGGAAGCC (SEQ ID N0:11), the reverse TIGR exon 1 primer was TTGGGTTTCCAGCTGGTC (SEQ ID N0:15). PCR was performed using standard protocols, annealing temperature was at 60°C.
Amplification 15 products were electrophoresed in 1,5% agarose gels before ethidium staining and scored by two independent observers.
4.2 ARMS test for the His366G1n mutation To test for the presence of the His366G1n mutation, we developed an amplification refractory mutation system (ARMS) exploiting procedures 20 described by Little (1997). Two complementary PCR reactions were conducted with the same substrate. The first reaction contained a forward primer specific for the wild-type allele, SEQ. NO. 6 (GLC1A1098C~:
GAGAAGGAAATCCCTGGAGCTGGCTACCTC. The second reaction contained a forward primer specific for the His366G1n TIGR allele, SEQ. NO. 5, 25 (GLC1A1098GT): GAGAAGGAAATCCCTGGAGCTGGCTACCTG. In each reaction, SEQ N0:4 was used as a common reverse primer. Both reactions gave a 393 by amplified fragment. To serve as internal control, a second pair of primers that co-amplified a 438 by fragment within TIGR exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was:
30 AGAGCTTTCCAGAGGAAGCC (SEQ ID N0:11), the reverse TIGR exon 1 primer was TTGGGTTTCCAGCTGGTC (SEQ ID NO:15). PCR was performed using standard protocols, annealing temperature was at 60°C.
Amplification products were electrophoresed in 1.5% agarose gels before ethidium staining and scored by two independent observers.

The TIGR wild-tvae protein and Lys423G1u mutated TIGR protein form hi4h molecular weight complexes in vivo and in vitro Methods 10 Construction of cDNA expression vectors. To create an eukaryotic expression vector encoding the wild-type TIGR cDNA, a 1831 by HindIII/Notl fragment encompassing 36 by of the 5' untranslated region, the full-length 1512 by ORF and 188 by of the 3' untranslated region of TIGRwt cDNA was purified from pTIGwt and subcloned directionnally into the 15 HindIII/Notl sites of plasmid pRc/CMV (Invitrogen). This new construct was named pRcTIG and produced high constitutive levels of mRNA due to the presence of CMV enhancer-promoter sequences. An expression vector encoding a TIGR cDNA carrying the Lys423G1u mutation was then generated by site-directed mutagenesis of pRcTIG using the QuikChange mutagenesis kit 20 (Stratagene). The primers used to generate the A to G transition in pRcTIG
were: 5'-GGGAGACAAACATCCGTGAGCAGTCAGTCGCC-3' (SEQ ID N0:16) and 5'-GGCGACTGACTGCTCACGGATGTTTGTCTCCC-3' (SEQ ID N0:17).
This second expression vector was named pRcTIG423E. All constructions were verified by sequencing the inserts bidirectionnally between the Hindlll and Notl 25 sites.
Transfections COS-7 cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL) supplemented with 10% fetal bovine serum (Gibco BRL) and antibiotics (100 U/ml penicillin, 100 mg/ml streptomycin (Gibco 30 BRL)). Cells were plated at a density of 2x106 cells per 75 cm2 tissue culture flask. Twenty-four h later, transient transfection was performed using the DNA/DEAE-dextran transfection method coupled with a chloroquine treatment and followed by a dimethylsulfoxide shock. Each DNAIDEAE-dextran transfection sample contained a total of 20 mg/flask of plasmid pRcTIG or 5 pRcTIG423E, alone or in combination. Briefly, COS-7 cells were exposed to the DNA/DEAE-dextran solution (0.5 mg/ml of DEAF in PBS; 5ml/flask) for 30 min before addition of 20 ml of DMEM (w/o serum)/flask containing chforoquine to reach a final concentration of 0.02 mg/ml for a further 2.5 h incubation period.
The solutions were then aspirated and the cells exposed to DMSO (10% DMSO
10 in 5 ml DMEM with serum/flask) for exactly 90 seconds. The solutions were again aspirated and the cells incubated in 25 ml DMEM supplemented with 10%
fetal bovine serum and antibiotics for 2 days before protein extraction. The culture medium was replaced between the second and third day.
Reticulocyte lysate transcription-translation coupled system.
15 In vitro transcription/translation was performed using the TNT Coupled Reticulocyte Lysate System (Promega) according to the manufacturer's protocol.
As both pRcTIG and pRcTIG423E constructs carried the T7 RNA promoter, no additional DNA modifications were done before testing. Reactions contained 0.5 microgram of each plasmid and a complete amino acid mixture instead of 20 35S-methionine. Canine Pancreatic Microsomal Membranes (Promega) (2.5 ml (2EQ/ml)/ 25 ml reaction) were added to the samples to optimize cotranslational processing. The samples were incubated for 90 min at 30°C before protein analysis.
Protein extraction 25 SDS-PAGE and Western-blot analysis Confluent cells from tissue culture flasks were washed twice with cold PBS, scraped in 2 ml of ice cold lysis buffer (10 mM tris-HCI pH 7.5) containing the Complete Protease Inhibitor Cocktail (Boehringer Mannheim) (1 tablet/40 ml Tris-HCI). Human trabeculum meshwork (HTM) tissues were dissected from donor eyes obtained 30 from the CHUL Eye Bank and lysed in 1 ml of cold lysis buffer. Protein concentration was estimated and, dithiothreitol (DDT; 0.1 mM) was added to selected samples for 10 minutes, prior to electrophoresis, to reduce disulfide links that may be involved in multimerization. SDS-PAGE was performed on 6%
resolving acrylamide gels using 5% stacking gels. Protein were transferred onto 5 nitrocellulose, using a Trans-Blot SD Semi-Dry Transfer Cell apparatus (Bio-Rad) for 1 h at 150 mA. Nitrocellulose membranes were saturated for 4 h at 4°C in TBS containing 0.1 % Tween-20 (TBS-T) and 5% (w/v) skimmed milk powder (blotto), rinsed once (15 min) in TBS-T and incubated O/N at 4°C
with purified TIGR antibodies diluted (1/2000) in blotto (1%). After 1-15 min and 3 10 min washes with TBS-T, the nitrocellulose membranes were incubated for 1 h at room temperature with goat-anti rabbit antibodies labeled with horseradish peroxidase (1:5000, Amersham) in blotto (1%), washed four times (1-15 min and 3-5 min) with TBS-T, revealed 2 min with Renaissance Western blot Chemiluminescence Reagent (Dupont NEN), and exposed to Reflection 15 autoradiography films (Dupont NEN) during increasing periods of time ranging from 30 s to 5 min.
According to homoallelic complementation, the Lys423G1u mutation acts in a dominant negative fashion resulting in defective TIGR
wildtype/Lys423G1u protein heteromultimers but functional TIGR
20 Lys423G1u/Lys423G1u homopolymers. This model also demonstrates that a locus with a wild-type allele A and a mutant allele A', such that homozygosity for either allele has no phenotypic consequence, but the heterozygous state AA' leads to a deleterious defect due to interference between the protein products of the two different alleles. Homoallelic complementation further refers to 25 affected heterozygotes in which some functional TIGR wild-type/wild-type and/or TIGR Lys423G1u/Lys423G1u homopolymers are also generated by an admixture of normal and mutant subunits, thereby explaining part of the phenotypic variability observed at this locus.
Examination of the amino acid sequence of the TIGR gene 30 product revealed two features potentially involved in protein-protein interactions WO 99!16898 PCT/CA98/00923 1 ) a leucine zipper domain containing seven motifs within the N-terminal half of the polypeptide and 2) a conserved cysteine at position 433 in a region highly homologous to bullfrog olfactomedin in which the equivalent cysteine residue may promote the formation of disulfide-linked homopolymers (Figure 2).
5 The discovery that the TIGR wild-type protein and Lys423G1u TIGR mutated protein form high molecular weight complexes in vivo and in vitro (Figure 6) provides evidence for homoallelic complementation as the mechanism accounting for the unaffected status of TIGR Lys423G1u/Lys423G1u mutant homozygotes. As shown in Figure 5, the TIGR wild-type protein and Lys423G1u 10 TIGR mutated protein form high molecular weight complexes in vivo and in vitro.
COS-7 cells were transiently transfected with expression vectors encoding the TIGR wild-type or TIGR Lys423G1u gene products, alone or in combination, and newly synthesized proteins were analyzed by immunoblotting. In cells transfected with the TIGR wild-type cDNA construct, pRcTIG, bands of 15 immunoreactivity were detected as two major complexes composed of TIGR
polypeptides migrating at approximately 120 kD and 240 kD (Figure 6 a and b).
When the denaturing agent dithiothreitol (DDT) was added to the extracts prior to electrophoresis, both complexes were resolved into two lower molecular weight forms migrating at approximately 57 kD and 62 kD (Figure 6 a and b). As 20 deduced from the nucleotide sequence, the 57 kD form corresponded to TIGR
monomers originating at the first translation initiation site of the TIGR mRNA
while the 62 kD form represented partially glycosylated monomers. In cells transfected with increasing concentrations of TIGR Lys423G1u cDNA in the presence of decreasing amount of the wild-type construct, the pattern of 25 immunoreactivity was identical to that detected when transfections were performed with pRcTIG alone indicating that TIGR Lys423G1u gene products did not disrupt the formation of the two major complexes (Figure 6 a and b).
Immunoblotting of protein extracts obtained from human trabecular meshwork (HTM) tissues dissected from donor eyes revealed a similar pattern of migration 30 establishing that TIGR polypeptides also formed high molecular weight complexes in vivo (Figure 6b). Under denaturing condition, HTM TIGR
polypeptides were resolved into three distinct monomers: the 57 and 62 kD
products and a smaller, approximately 55 kD, TIGR polypeptide resulting from internal cleavage or, utilization of a second initiation site for translation 5 (Figure 6b).
To show that TIGR polypeptides did not required extraneous proteins to undergo oligomerization, we used an in vitro reticulocyte lysate system in which transcription of TIGR wild-type and TIGR Lys423G1u cDNAs was coupled to translation of their respective mRNAs. Following protein 10 extraction and immunoblotting, we observed that both TIGR wild-type and TIGR
Lys423G1u polypeptides formed homodimers migrating at the expected 120 kD
position (Figure 6c). These data showed that the high molecular weight complexes observed in COS-7 cells were produced by multimerization of TIGR
monomers, generating homodimers and homotetramers.
15 Although the present invention has been described hereinabove by way of preferred embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.

Claims (33)

WHAT IS CLAIMED IS:

1. An isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1, wherein the nucleotide located at position 1267 is a guanidine residue in lieu of an adenine residue , said guanidine residue being a specific nucleotide of a mutant allele of the TIGR gene.

2. An isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1, wherein the nucleotide located at position 1096 is a guanidine residue in lieu of a cytosine residue , said guanidine residue being a specific nucleotide of a mutant allele of the TIGR gene.

3. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with said specific nucleotide , as defined in claim 1, or a complementary sequence thereof.

4. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with a non mutant nucleotide corresponding to said specific nucleotide, as defined in claim 1, or a complementary sequence thereof.

5. An oligonucleotide as defined in claim 3, which is incapable of priming a polymerase priming extension when annealed to a non mutant allele.

6. An oligonucleotide as defined in claim 4, which is incapable of priming a polymerase priming extension when annealed to said mutant allele.

7. An oligonucleotide as defined in claim 5, which has the nucleotide sequence of SEQ. ID. NO.: 2.

8. An oligonucleotide as defined in claim 6, which has the nucleotide sequence of SEQ. ID. NO.: 3.

9. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide having a nucleotide sequence shared by said mutant allele and a non mutant allele, as defined in claim 1, and a complementary sequence thereof.

10. An oligonucleotide as defined in claim 9, which has the nucleotide sequence of SEQ. ID. NO.: 4.

11. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with said specific nucleotide , as defined in claim 2, or a complementary sequence thereof.

12. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide ending at its 3' end with a non mutant nucleotide corresponding to said specific nucleotide, as defined in claim 2, or a complementary sequence thereof.

13. An oligonucleotide as defined in claim 11, which is incapable of priming a polymerase priming extension when annealed to a non mutant allele.

14. An oligonucleotide as defined in claim 12, which is incapable of priming a polymerase priming extension when annealed to said mutant allele.

15. An oligonucleotide as defined in claim 13 ,which has the nucleotide sequence of SEQ. ID. NO.: 5.

16. An oligonucleotide as defined in claim 14, which has the nucleotide sequence of SEQ. ID. NO.: 6.

17. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1, said oligonucleotide having a nucleotide sequence shared by said mutant allele and a non mutant allele, as defined in claim 2, and a complementary sequence thereof.

18. An oligonucleotide as defined in claim 17, which has the nucleotide sequence of SEQ. ID. NO.: 4.

19. A method for detecting a mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 3, 5 er 7 and with an oligonucleotide as defined in claim 9 or 10; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.

20. A method for detecting a mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide as defined in claims 11,13 or 15 and with an oligonucleotide as defined in claim 17 or 18; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.

21. A method for detecting a non-mutant allele of the TIGR
gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide as defined in claim 4, 6 or 8 and with an oligonucleotide as defined in claim 9 or 10; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said non-mutant allele.

22. A method for detecting a non-mutant allele of the TIGR
gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide as defined in claim 12, 14 or 16 and with an oligonucleotide as defined in claim 17 or 18; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said non-mutant allele.

23. A kit for the detection of mutations in the TIGR gene comprising an oligonucleotide as defined in any one of claims 3, 5, 7, 11,13 and 15; an oligonucleotide as defined in any one of claims 4, 6, 8, 12, 14 and 16;
and an oligonucleotide as defined in any one of claims 9, 10, 17 and 18; and suitable reagents required for obtaining amplified products in an amplification reaction.

24. The kit of claim 23, wherein amplification products are detectable.

25. A method for detecting in an individual the inheritance of two of said mutant alleles as defined in claim 1, said individual being homozygote for said mutant allele and phenotypically normal, and said individual being capable of transmitting said mutant allele to an offspring whereby said offspring is at risk for developing glaucoma, with said method comprising the steps of reproducing the methods of claims 19 and 21; a positive result obtained from the method of claim 19 and a negative result from the method of claim 21, being an indication that said individual is homozygote for said mutant allele.

26. A method to counteract glaucoma in a heterozygotic carrier of TIGR mutations, comprising an overexpression of a mutated TIGR
protein in said heterozygotic carrier to counteract the glaucoma phenotype associated with said heterozygocity, thus rendering the phenotype of said carrier normal by homoallelic complementation.

27. A method to counteract and/or treat a heterozygotic carrier of an autosomal dominant inherited disorder caused by a protein that forms homomultimers, said homomultimers comprising at least one subunit of a normal and mutated protein associated with said disorder, said method comprising at least one of (1) an overexpression of said mutated protein in said heterozygotic carrier; and (2) an inhibition of said normal protein in said carrier, thereby rendering said phenotype normal by homoallelic complementation.

28. The method of claim 27, wherein said autosomal dominant inherited disorder is glaucoma and said normal protein is normal TIGR
protein.

29. A method to counteract a glaucoma phenotype in a heterozygotic carrier of TIGR mutations comprising an inhibition of expression of a normal TIGR protein, to counteract said glaucoma phenotype associated with said heterozygocity, thus rendering the phenotype of said patient normal by homoallelic complementation.

30. A method to counteract a disease phenotype in a patient, wherein said disease phenotype is associated with a presence of a heterozygotic mutation in a protein in said patient, said method comprising at least one of an elevation of the expression of a mutated protein and an inhibition of expression and/or activity of the normal protein, to counteract the affected phenotype, thereby rendering said phenotype normal by one of homoallelic complementation and haploinsufficiency.

31. The method of claim 30, wherein said inhibition of expression is carried out using an antisense molecule which is specific for a nucleic acid encoding said normal protein.

32. The method of claim 30, wherein said inhibition of the activity of said normal protein is effected using an ligand specific thereto.

33. The method of claim 32, wherein said ligand is an antibody specific to said normal protein.