WO1999016898A1 - Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof - Google Patents

Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof

Info

Publication number
WO1999016898A1
WO1999016898A1 PCT/CA1998/000923 CA9800923W WO1999016898A1 WO 1999016898 A1 WO1999016898 A1 WO 1999016898A1 CA 9800923 W CA9800923 W CA 9800923W WO 1999016898 A1 WO1999016898 A1 WO 1999016898A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
tigr
invention
protein
dna
present
Prior art date
Application number
PCT/CA1998/000923
Other languages
French (fr)
Inventor
Vincent Raymond
Jean Morissette
Pierre Falardeau
Gilles CÔTÉ
Jean-Louis Anctil
Original Assignee
Universite Laval
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Abstract

The present invention relates to the surprising discovery that in an autosomally inherited disease, a homozygote mutant is found to be phenotypically normal and to the uses of such a discovery. The present invention further relates to easy and efficient means to detect mutations in the TIGR/MYOC gene. Further, the present invention relates to methods to diagnose and treat glaucoma or other diseases or conditions in which homoallelic complementation is observed.

Description

TITLE OF THE INVENTION

MOLECULAR DIAGNOSTIC OF GLAUCOMAS ASSOCIATED WITH CHROMOSOME 1 , AND METHOD OF TREATMENT THEREOF

FIELD OF THE INVENTION

The present invention relates to the identification of mutations in the TIGR/MYOC gene in the GLCIA locus and the detection of these mutations in individuals. The invention also relates to the identification of individuals who are genotypically homozygote mutants of an autosomal dominant inherited disease and yet display a normal phenotype.

BACKGROUND OF THE INVENTION

Glaucoma encompasses a complex of ocular-disease entities characterized by an optic neuropathy in which degeneration of retinal ganglion cells leads to a characteristic excavation of the head of the optic nerve (Shields et al., 1996, The Glaucomas, 2:717-725). Such damage causes progressive narrowing of the visual fields and, when uncontrolled, blindness. Affected people often have ocular hypertension defined as intraocular pressures consistently >21 mm Hg in both eyes. Although ocular hypertension is no longer an obligatory diagnostic criterion for glaucoma, it is still recognized as one of the most important risk factors (Wilson et al., 1996, The Glaucomas, 2:753-763). Until now, a diagnosis of glaucoma is made after observation of the characteristic atrophy of the optic nerve, which is associated with typical visual field defects. In 1992, the World Health Organization estimated that, in the global population, 5.2 million people were blind as a result of glaucoma (Thylefors et al., 1994, World Health Organ. Bull., 72:323-326), making it the third leading cause of blindness worldwide. The most common form is adult-onset primary open-angle glaucoma (MIM 137760; McKusick, 1994, Johns Hopkins University Press, p. 272), which represents ~50% of all cases of glaucoma. Among Caucasians, this form of the disorder affects ~2% of the population >45 years old (Leske, 1983, Am. Epidemiol., 118:166-191 ; Thylefors et al., 1994, supra; Wilson et al., 1996, supra). In African Americans, prevalence of adult-onset open-angle glaucoma is three to four times higher than that observed in White Americans. More than 5 million North Americans may have some form of glaucoma, but at least half of them may not be aware of it.

The glaucomas traditionally have been grouped into three categories: open angle, closed angle (also termed "angle closure"), and congenital. Each subtype has been further arbitrarily subdivided into primary, when the anterior chamber of the eye appears normal and no cause for glaucoma can be identified, or secondary, when glaucomas are caused by underlying ocular or systemic conditions (Shields et al., 1996, supra). Whereas the division between open and closed angles refers to the configuration of the irido-corneal angle in the anterior chamber of the eye, congenital glaucoma is used to define one of the many types of developmental glaucoma that usually occurs within the 1 st year of life. The majority (60%-70%) of primary glaucomas are of the open-angle type. Primary open-angle glaucomas have been further subdivided into two groups according to age at onset, severity, and mode of inheritance: the more prevalent is middle- to late-age-onset chronic open-angle glaucoma (COAG), by convention diagnosed after age 35 years and characterized by its slow, insidious course (Shields et al., 1996, supra; Wilson et al., 1996, supra). The less common form, juvenile open-angle glaucoma (JOAG), occurs between 3 years of age and early adulthood and generally manifests highly elevated intraocular pressures with no angle abnormalities (Goldwyn et al., 1970, Arch. Ophtalmol., 84:579-582; Francois, 1980, Am. J. Ophtalmol., 3:429-449; Johnson et al., 1996a, The Glaucomas, 1:39-54).

Although the precise molecular defects leading to open-angle glaucomas remain partly unknown, numerous advances in basic and clinical sciences have begun to identify the molecular basis of glaucomas by mapping the gene loci involved in the disease process. Due to recent mapping successes, the different forms of glaucoma will be further identified by the names of the loci to which they have been localized. According to the Human Genome Organization/Genome Database nomenclature, "GLC" is the general symbol for the glaucoma genes; "1", "2", and "3" are, respectively, the symbols for the open-angle, angle-closure, and congenital subtypes of glaucoma; and "A", "B", and "C" refer, respectively, to the first, second, or third gene mapped in each subgroup.

JOAG is a rare but aggressive form of glaucoma that usually segregates in an autosomal dominant fashion with high penetrance (Stokes, 1940, Arch. Ophthalmol., 24:885-909; Crombie et al., 1964, Br. J. Ophtalmol., 48:143-147; Lee et al., 1985, Ann. Ophtalmol., 17:739-741 ; Johnson et al., 1993, Ophthalmology, 100:524-529). In a single large American pedigree affected by an autosomal dominant form of JOAG, Sheffield et al. (1993, Nat. Genet., 4:47-50) located a gene responsible for this condition, at 1q21-q31. This locus, being the first open-angle glaucoma locus to be mapped, was named "GLC1A." The TIGR/MYOC glaucoma disease gene consistently was first associated with onset of the glaucoma phenotype before the age of 45 years, highly elevated intraocular pressures, and typical excavation of the head of the optic nerve. Gonioscopy showed open angles with no anterior-chamber abnormalities. The GLC1A locus has subsequently been reported by Nguyen et al. in US Patent 5,606,043 to encode the trabecular meshwork induced glucocorticoid response (TIGR) gene. The gene sequence was first submitted (13-JAN-1997) by Nguyen et al. to the GeneBank accession # U85257. The TIGR sequence was modified on 19 April 1997 in GeneBank following modifications by Nguyen submitted on 02-APR-1997. The accession number stayed the same # U85257.

Genetic maps of the human genome can be exploited to rapidly locate human monogenic disorders. The final version of the Genethon linkage map, which spans close to 100 % of the human genome, was published in March 1996 (Dib et al., 1996, Nature, 380:152-154). This map consists of 5,264 short tandem (AC/TG)n repeat polymorphisms with a mean heterozygosity of 70%.

The nomenclature system for the markers is well known in the field. The nomenclature used is decided by the Human Genome Organization (HUGO) nomenclature committee. It is as follows: for anonymous DNA sequences, the convention is to use D which is equivalent to DNA followed by 1-22, X or Y to denote the chromosomal number and location, then S stands for a unique segment and finally a serial number. For example, marker D2S2161 is a DNA marker located on chromosome 2 representing a unique segment. Its serial number is 2161.

The nomenclature for the glaucoma genes is the following: "GLC" is the general symbol for the glaucoma genes; "1", "2", and "3" are, respectively, the symbols for the open-angle, angle-closure, and congenital subtypes of glaucoma; and, "A", "B" and "C" refer, respectively, to the first, second, or third gene mapped in each subgroup. For example, the GLC1A locus was the first open-angle glaucoma locus to be mapped, in this case to chromosome 1q23-q25 in 1993. It was later identified as the trabecular meshwork inducible glucocorticoid response gene product (TIGR) (Stone et al, 1997, Science, 275: 668-670). The TIGR gene is also known as MYOC. These markers are accessible to all individuals. The central data resource for the human gene mapping effort is the Genome Data Base (GDB). It was established at Johns Hopkins University, School of Medicine. GDB is updated regularly. It collects, organizes, stores and distributes human genome mapping information. GDB is accessible electronically at WWW-URL: http://gdbwww.gdb.org/.

Alternatively, all the markers disclosed herein, except D6S967, are short (CA)n repeat markers that have been developed in the Genethon laboratory near Paris, France. These markers are also accessible electronically at WWW-URL: http://www.genethon.fr/. Therefore markers are accessible either at GDB or at

Genethon.

The first mutations identified in the TIGR gene that have been shown to give rise to glaucoma were first reported by Stone et. al (Science, 1997, 275:668-670). Twenty-eight mutations have now been reported. The methodology used to identify these mutations was by amplifying overlapping regions by polymerase chain reaction (PCR), performing single-strand conformational polymorphism (SSCP) on the amplification products and sequencing those DNA products that produced aberrant band pattern on the SSCP. No quick method for mutational analyses for the TIGR has been proposed.

The prior art as a whole teaches that a homozygote mutant for an autosomal dominant disease should display a higher penetrance and severity for a human disorder than a heterozygote mutant. Heterozygotes for an autosomal dominant disease often exhibit variable penetrance.

The present description refers to a number of documents the content of which is herein incorporated by reference.

SUMMARY OF THE INVENTION The invention concerns the mutational analyses in the GLC1A gene locus encoding the TIGR gene (GeneBank accession no. U85257; SEQ ID NO:1).

The present invention provides means to identify at least two nucleotide changes in the DNA sequence coding for TIGR that result in an amino acid change in the TIGR gene.

The invention further demonstrates that these amino acid changes result in mutations producing a disease state in individuals, the disease being glaucoma.

The early detection of individuals at risk for developing glaucoma is an important aspect of this invention. Early detection allows for intervention prior to the genesis of the disease process and disease progression and may obviate the symptoms and the onset of the disease. A method for mutation analyses called amplification refractory mutation system (ARMS), that is simple, quick and adapted to glaucoma is disclosed herein. The proposed invention relates to the inclusion of primers and probes for the amplification and detection of all mutations in the TIGR gene. Although the invention teaches the use of the method of ARMS for glaucoma, the invention is not so limited. Other methods of mutation analyses known in the field, such as allele specific oligonucleotide (ASO), denaturing gradient gel electrophoresis (DGGE) and artificially created restriction site (ACRS), can also be used.

The mutation detection and analyses thereof can be performed on either genomic DNA or cDNA by any method known to a person skilled in the art. In addition the applicant has demonstrated for the first time a new type of dominance in mammals in which heterozygotes have a much higher penetrance rate for a disease gene mutation than their homozygotic counterparts.

Further, the present invention provides for the first time the identification in an autosomal dominant disease, of a homozygote mutant which is phenotypically normal, even though such an individual may give rise to an affected heterozygote offspring. This homoallelic complementation phenomenon has now been observed with 4 different patients.

The invention provides applications and uses for such a discovery. These include but are not limited to: a) treatment of a heterozygote mutant (affected individuals with overexpressed mutant protein to induce protein complementation such that normal protein function can be restored, this application will apply to any autosomal dominant disease exhibiting the same mode of action as described herein (i.e. homoallelic complementation). b) similarly an individual being a heterozygote for an autosomal dominant disorder exhibiting the same mode of action as described herein can be treated by gene therapy, such that a mutant allele is inserted into a vector and delivered to an individual thereby negating the effect of the heterozygote mutation by either allelic or protein complementation. c) with the new knowledge of the present invention, a transgenic animal designed to carry a deleterious autosomal dominant mutation can be used to assess the requirement to produce a phenotypically normal animal, by either allelic complementation or protein complementation. d) a diagnostic means to identify phenotypically normal genotypically mutant individuals that can transmit the mutant allele to their offsprings. e) the teachings of the present invention can be used for showing dimezisation of TIGR peptides. The present invention therefore also provides the means to identify novel mutations in the TIGR gene, wherein these mutations give rise to glaucoma. These mutations can also be identified by any other means known to a person skilled in the art. As well, the diagnostic methods of the present invention can be adapted in a kit format comprising probes, primers, oligonucleotides and reagents commonly known in the art to provide the means for detecting mutations that may cause glaucoma. The present invention further provides methods to treat diseases or conditions associated with homoallelic complementation.

The mutation analysis according to the present invention is useful for screening individuals at risk for glaucoma. Such individuals may have a family history of glaucoma, and for identifying individuals carrying a mutation in the glaucoma gene enabling early treatment which may obviate or minimise the progression of the disease.

In another embodiment of the present invention, there is provided a kit comprising all the necessary reagents to carry out the herein described methods of detection. As known to the person of ordinary skill, the kit comprises container means comprising oligonucleotide sequences or antibodies (or binding proteins) and reagents such as washing reagents, reagents for detection purposes and the like. It will also be readily recognized that the nucleic acid sequences or antibodies of the present invention could be incorporated into established kit formats.

The present invention thus discloses, for the first time, a mechanism termed "homoallelic complementation" wherein for example the K423E mutation is acting in a dominant negative fashion, thereby resulting in a defective TIGRwt/K423E protein heteromaltemers but functional TIGR K23E/K23E homopolymers. This form of interaction may be interpreted as being somewhat similar to the "metabolic interference model" that suggested a deleterious defect due to interference between the protein products of the two different alleles (Johnson, 1980, Am. J. Hum. Genet. 32:374-86). The homoallelic complementation model of the present invention, however, further proposes that functional TIGRwt/wt and/or TIGR K23E/K23E homopolymers are generated by an admixture of normal and mutant subunits in TIGRwt/K432E heterozygotes, thereby explaining, at least in part, the phenotypic variability observed in effected carriers as well as the unaffected mutant homozygotes described herein. It should be noted that Crick et al. (1964, J. Molec. Biol.

8:161-165) had previously suggested the theory of inter-allelic complementation.

While homoallelic complementation has been identified and validated with glaucoma, it is suspected to be a phenomenon which is not limited thereto. For example, a form of epilepsy and mental retardation linked to chromosome X, which only affects women, has been reported (Ryan et al., 1997, Nature Genetics 17:92-95).

In accordance with the present invention, there is thus provided an isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1 , wherein a mutation is identified therein. There is also provided a method for detecting a mutant allele of the TIGR/MYOC gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 3, 5 or 7 and with an oligonucleotide primer of the present invention; obtaining an amplified product in an amplification reaction; and detecting the amplification product as an indication of the presence of said mutant allele.

In accordance with the present invention, there is also provided a method for detecting a non-mutant allele of the TIGR/MYOC gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide primer (or a probe enabling a distinction between wild type and mutant); obtaining an amplified product in an amplification reaction; and detecting the amplification product as an indication of the presence of the non-mutant allele.

The application further relates to a kit for the detection of mutations in the TIGR gene comprising an oligonucleotide of the present invention; and suitable reagents required for obtaining amplified products in an amplification reaction.

In addition, in accordance with the present invention, there is provided a method to counteract glaucoma in a heterozygotic carrier of TIGR mutations, an overexpression of mutated TIGR protein in a patient, thereby rendering the phenotype of said patient normal by homoallelic complementation.

Further, in accordance with the present invention, there is provided a method to counteract and/or treat heterozygotic carriers of an autosomal dominant inherited disorder caused by a protein that forms homomultimers, comprising at least one of an overexpression of the mutated protein and an inhibition of the normal protein in a patient, thereby rendering said phenotype normal by homoallelic complementation.

Further, in accordance with the present invention, there is provided a method to counteract a disease phenotype in a patient, wherein the disease phenotype is associated with the presence of a heterozygotic mutation in a protein in the patient, the method comprising at least one of an elevation of the expression of a mutated protein and an inhibition of expression and/or activity of the normal protein, to counteract the affected phenotype, thereby rendering the phenotype normal by one of homoallelic complementation and haploinsufficiency.

DEFINITIONS AND TECHNOLOGICAL BACKGROUND

Nucleotide sequences are presented herein by single strand, in the 5' to 3' direction, from left to right, using the one letter nucleotide symbols as commonly used in the art and in accordance with the recommendations of the IUPAC-IUB Biochemical Nomenclature Commission.

Unless defined otherwise, the scientific and technological terms and nomenclature used herein have the same meaning as commonly understood by a person of ordinary skill to which this invention pertains. Generally, the procedures for cell cultures, infection, molecular biology methods and the like are common methods used in the art. Such standard techniques can be found in reference manuals such as for example Sambrook et al. (1989, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratories) and Ausubel et al. (1994, Current Protocols in Molecular Biology, Wiley, New York).

The present description refers to a number of routinely used recombinant DNA (rDNA) technology terms. Nevertheless, definitions of selected examples of such rDNA terms are provided for clarity and consistency. As used herein, "TIGR" refers to the trabecular meshwork inducibie glucocorticoid response gene product, also known as MYOC, present at the GLC1A locus. Herein, "TIGR' therefore refers to TIGR/MYOC. It should be noted that the TIGR/MYOC gene is sometimes referred to as the GLC1A gene.

As used herein, the terminology "homoallelic complementation" refers to the novel description of mutant homozygotes being phenotypically normal with respect to an autosomal dominant inherited disease. It should be noted that although the present invention focuses on autosomal dominant inherited diseases, the present invention also applies to haploinsufficiency. Broadly stated, the mechanism would be similar to a suggested locus with a wild-type allele A and a mutant allele A', such that homozygosity for either allele, has no phenotypic consequences, but the heterozygous state AA' leads to a deleterious defect due to interference between the protein products of the two different alleles.

As used herein, "nucleic acid molecule", refers to a polymer of nucleotides. Non-limiting examples thereof include DNA (i.e. genomic DNA, cDNA) and RNA molecules (i.e. mRNA). The nucleic acid molecule can be obtained by cloning techniques or synthesized. DNA can be double-stranded or single stranded (coding strand or non-coding strand [antisense]).

The term "recombinant DNA" as known in the art refers to a DNA molecule resulting from the joining of DNA segments. This is often referred to as genetic engineering.

The term "DNA segment", is used herein, to refer to a DNA molecule comprising a linear stretch or sequence of nucleotides. This sequence when read in accordance with the genetic code, can encode a linear stretch or sequence of amino acids which can be referred to as a polypeptide, protein, protein fragment and the like.

The terminology "amplification pair" or "primer pair" refers herein to a pair of oligonucleotides (oligos) of the present invention, which are selected to be used together in amplifying a selected nucleic acid sequence by one of a number of types of amplification processes, preferably a polymerase chain reaction. Other types of amplification processes include ligase chain reaction, strand displacement amplification, or nucleic acid sequence-based amplification, as explained in greater detail below. As commonly known in the art, the oligos are designed to bind to a complementary sequence under selected conditions. It will be clear to the person of ordinary skill that the present invention can be adapted to the detection of numerous mutations in

TIGR/MYOC. As exemplified hereinbelow, using a particular embodiment of the present invention using ARMS with oligos having the sequences of SEQ ID NO:5 and SEQ ID NO:7, mutations His366Gln and LYS424GLn were identified.

The nucleic acid (i.e. DNA or RNA) for practising the present invention may be obtained according to well known methods.

Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted genomes employed. In general, the oligonucleotide probes or primers are at least 10 nucleotides in length, preferably between 15 and 24 nucleotides, and they may be adapted to be especially suited to a chosen nucleic acid amplification system. As commonly known in the art, the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hydrizidation thereof with its targeted sequence (in Sambrook et al., 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).

"Nucleic acid hybridization" refers generally to the hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel et al., 1989 supra) and are commonly known in the art. In the case of a hybridization to a nitrocellulose filter, as for example in the well known Southern blotting procedure, a nitrocellulose filter can be incubated overnight at 65°C with a labeled probe in a solution containing 50% formamide, high salt ( 5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 μg/ml denatured carried DNA ( i.e. salmon sperm DNA). The non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency). The selected temperature is based on the melting temperature (Tm) of the DNA hybrid. Of course, RNA-DNA hybrids can also be formed and detected. In such cases, the conditions of hybridization and washing can be adapted according to well known methods by the person of ordinary skill. High stringency conditions will be preferably used (Sambrook et al.,1989, supra).

Probes or nucleic acid molecules of the invention can be utilized with naturally occurring sugar-phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and α-nucleotides and the like. Modified sugar-phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic acid molecule. Acids Res., 14:5019. Probes of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.

The types of detection methods in which probes can be used include Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Although less preferred, labelled proteins could also be used to detect a particular nucleic acid sequence to which it binds. Other detection methods include kits containing probes on a dipstick setup and the like.

Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial, by increasing the sensitivity of the detection. Furthermore, it enables automation. Probes can be labelled according to numerous well known methods (Sambrook et al., 1989, supra). Non-limiting examples of labels include 3H, 14C, 32P, and 35S. Non-limiting examples of detectable markers include ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe. As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods. Non-limiting examples thereof include kinasing the 5' ends of the probes using gamma 32P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP (i.e. uniformly labelled DNA probe using random oligonucleotide primers in low-melt gels), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.

As used herein, "oligonucleotides" or "oligos" define a molecule having two or more nucleotides (ribo or deoxyribonucleotides). The size of the oligo will be dictated by the particular situation and ultimately by the particular use thereof, and adapted accordingly by the person of ordinary skill. An oligonucleotide can be synthetised chemically or derived by cloning according to well known methods.

As used herein, a "primer" defines an oligonucleotide which is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for DNA synthesis under suitable conditions.

Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, (Am. Biotechnol. Lab. 8:14-25). Numerous amplification techniques have been described and can be readily adapted to suit the particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Qβ replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et al., 1988, BioTechnology 6:1197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253-260; and Sambrook et al., 1989, supra). Preferably, amplification will be carried out using PCR.

Polymerase chain reaction (PCR) is carried out in accordance with known techniques. See, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188 (the disclosures of all three U.S. Patent are incorporated herein by reference). In general, PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected. An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analysed to assess whether the sequence or sequences to be detected are present. Detection of the amplified sequence may be carried out by visualization following EtBr staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like. For a review on PCR techniques (see PCR Protocols,

A Guide to Methods and Amplifications, Michael et al., Eds, Acad. Press, 1990).

Ligase chain reaction (LCR) is carried out in accordance with known techniques (Weiss, 1991 , Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).

As used herein, the term "gene" is well known in the art and relates to a nucleic acid sequence defining a single protein or polypeptide. A "structural gene" defines a DNA sequence which is transcribed into RNA and translated into a protein having a specific amino acid sequence thereby giving rise the a specific polypeptide or protein. It will be readily recognized by the person of ordinary skill, that the nucleic acid sequences of the present invention can be incorporated into anyone of numerous established kit formats which are well known in the art.

The term "vector" is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can serve as a DNA vehicle into which DNA of the present invention can be cloned. Numerous types of vectors exist and are well known in the art.

The term "expression" defines the process by which a structural gene is transcribed into mRNA (transcription), the mRNA is then being translated (translation) into one polypeptide (or protein) or more.

The terminology "expression vector" defines a vector or vehicle, as described above, but designed to enable the expression of an inserted sequence following transformation into a host. The cloned gene (inserted sequence) is usually placed under the control of control element sequences such as promoter sequences. The placing of a cloned gene under such control sequences is often referred to as being "operably linked" to control elements or sequences.

Expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites.

As used herein, the designation "functional derivative" denotes, in the context of a functional derivative of a sequence, whether nucleic acid or amino acid sequence, a molecule that retains a biological activity (either functional or structural) that is substantially similar to that of the original sequence. This functional derivative or equivalent may be a natural derivative or may be prepared synthetically. Such derivatives include amino acid sequences having substitutions, deletions, or additions of one or more amino acids, provided that the biological activity of the protein is conserved. The same applies to derivatives of nucleic acid sequences which can have substitutions, deletions, or additions of one or more nucleotides, provided that the biological activity of the sequence is generally maintained. When relating to a protein sequence, the substituting amino acid has chemico-physical properties which are similar to that of the substituted amino acid. The similar chemico-physical properties include, similarities in charge, bulkiness, hydrophobicity, hydrophylicity and the like. The term "functional derivatives" is intended to include "fragments", "segments", "variants", "analogs" or "chemical derivatives" of the subject matter of the present invention.

Thus, the term "variant" refers herein to a protein or nucleic acid molecule which is substantially similar in structure and biological activity to the protein or nucleic acid of the present invention.

The functional derivatives of the present invention can be synthesized chemically or produced through recombinant DNA technology. All these methods are well known in the art.

As used herein, "chemical derivatives" is meant to cover additional chemical moieties not normally part of the subject matter of the invention. Such moieties could affect the physico-chemical characteristic of the derivative (i.e. solubility, absorption, half life and the like, decrease of toxicity). Such moieties are exemplified in Remington's Pharmaceutical Sciences (1980). Methods of coupling these chemical-physical moieties to a polypeptide are well known in the art.

The term "allele" defines an alternative form of a gene which occupies a given locus on a chromosome.

As commonly known, a "mutation" is a detectable change in the genetic material which can be transmitted to a daughter cell. As well known, a mutation can be, for example, a detectable change in one or more deoxyribonucleotide. For example, nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position. Spontaneous mutations and experimentally induced mutations exist. The result of a mutations of nucleic acid molecule is a mutant nucleic acid molecule. A mutant polypeptide can be encoded from this mutant nucleic acid molecule.

As used herein, the term "purified" refers to a molecule having been separated from a cellular component. Thus, for example, a "purified protein" has been purified to a level not found in nature. A "substantially pure" molecule is a molecule that is lacking in all other cellular components. The term "autosome" defines any chromosome other that the sex chromosomes, X and Y.

The term "dominant" refers to an allele that determines the phenotype displayed in a heterozygote with another normal or mutant allele. The terminology "transgenic animal" defines an animal that has had its germ line genetically modified to give rise to a progeny animal that is different from the parental type and carrying the modification in its germ line.

Non-human transgenic animals of the invention comprise animals having transgenic alteration of an endogenous gene which shows homoallelic complementation, in accordance with the present invention. Such non-human animals are commonly known in the art and include vertebrates, and more especially mammalians, and especially rodents such as rats and more particularly mice. These transgenic animals have had introduced into their genomes, by non-natural means (i.e. by manipulation), one or more gene which does not occur naturally in the animal. These non-naturally occuring genes in the animal (known as transgenes) may be from the same species as the animal, although in such a case, the gene or genes are in a different configuration and/or chromosomal location. A transgenic non-human animal of the invention can be produced in accordance with well-known methods in the art. Non-limiting examples of such methods include viral integration, microinjection of zygotes and the like. "Single Strand Conformational Polymorphism (SSCP)" refers to a method for detecting the presence of a base pair change in an amplified DNA fragment. The method involves denaturing the double stranded amplified DNA and comparing the band pattern in a known non-mutant fragment to that of an unknown fragment. A shift in the band pattern is indicative of a base pair change.

The designation "gene therapy" defines an attempt to treat disease by genetic modification of the cells of a patient.

"Allele Specific Oligonucleotide (ASO)" are designed to detect known and identified base pair change by designing oligonucleotides that are specific to the DNA fragment with and without the base change. These oligonucleotides are used as probes in hybridisation protocols under stringent conditions. Differences in the hybridization patterns is indicative of the presence or absence of the base change. "Artificially Created Restriction Site (ACRS)" refers to a method for detection a known base change in a DNA sequence. It involves the designing of a primer that may either create or obviate a restriction site in the vicinity of known base change, such that the restriction endonuclease used can have a different digestion pattern for the changed and unchanged base. For certainty, the sequences and polypeptides useful to practice the invention include without being limited thereto mutants, homologs, subtypes, alleles and the like. It shall be understood that generally, the sequences of the present invention should encode a functional (albeit defective) interaction domain. It will be clear to the person of ordinary skill that whether an interaction domain of the present invention, variant, derivative, or fragment thereof retains its function in binding to its partner can be readily determined by using the teachings and assays of the present invention and the general teachings of the art.

Also contemplated within the scope of the present invention are fusion proteins comprising one of the interacting domains of the present invention. As exemplified herein below in one embodiment, at least one of an interaction domain of the present invention may be provided as a fusion protein. The design of constructs therefor and the expression and production of fusion proteins and are well known in the art (Sambrook et al., 1989, supra; and Ausubel et al., 1994, supra). Non-limiting examples of fusion proteins include LexA-fusions, B42-fusions, hemaglutinin fusions and Gluthione-S-transferase (GST) fusions and Maltose binding protein (MBP) fusions. In certain embodiments, it might be beneficial to introduce a protease cleavage site between the two polypeptide sequences which have been fused. Such protease cleavage sites between two heterologously fused polypeptides are well known in the art.

In certain embodiments, it might also be beneficial to fuse the interaction domains of the present invention to signal peptide sequences enabling a secretion of the fusion protein from the host cell. Signal peptides from diverse organisms are well known in the art. Bacterial OmpA and yeast Suc2 are two non limiting examples of proteins containing signal sequences. In certain embodiments, it might also be beneficial to introduce a linker (commonly known) between the interaction domain and the heterologous polypeptide portion. Such fusion protein find utility in the assays of the present invention as well as for purification purposes, detection purposes and the like.

The interaction domains of the present invention can be modified, for example by in vitro mutagenesis, to dissect the structure-function relationship thereof and permit a better design and identification of modulating compounds (i.e. to deactivate or inhibit the normal protein). However, some derivative or analogs having lost their biological function of interacting with their respective interaction partner may provide further advantages as compared to known mutant protein, as well they may also find utility, for example for raising antibodies. Such analogs or derivatives could be used for example to raise antibodies to the interaction domains of the present invention. These antibodies could be used for detection or purification purposes. In addition, these antibodies could also act as competitive or non-competitive inhibitor and be found to be modulators of the protein-protein interactions of the present invention.

In general, techniques for preparing antibodies (including monoclonal antibodies and hybridomas) and for detecting antigens using antibodies are well known in the art (Campbell, 1984, In "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publisher, Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody - A Laboratory Manual, CSH Laboratories). The present invention also provides polyclonal, monoclonal antibodies, or humanized versions thereof, chimeric antibodies and the like which inhibit or neutralize their respective interaction domains and/or are specific thereto.

The present invention also provides antisense nucleic acid molecules which can be used for example to decrease or abrogate the expression of the normal allele. An antisense nucleic acid molecule according to the present invention refers to a molecule capable of forming a stable duplex or triplex with a portion of its targeted nucleic acid sequence (DNA or RNA). The use of antisense nucleic acid molecules and the design and modification of such molecules is well known in the art as described for example in WO 96/32966, WO 96/11266, WO 94/15646, WO 93/08845, and USP 5,593,974. Antisense nucleic acid molecules according to the present invention can be derived from the nucleic acid sequences and modified in accordance to well known methods. For example, some antisense molecules can be designed to be more resistant to degradation to increase their affinity to their targeted sequence, to affect their transport to chosen cell types or cell compartments, and/or to enhance their lipid solubility by using nucleotide analogs and/or substituting chosen chemical fragments thereof, as commonly known in the art.

From the specification and appended claims, the term therapeutic agent should be taken in a broad sense so as to also include a combination of at least two such therapeutic agents. Further, the DNA segments or proteins according to the present invention can be introduced into individuals in a number of ways. For example, erythropoietic cells can be isolated from the afflicted individual, transformed with a DNA construct according to the invention and reintroduced to the afflicted individual in a number of ways, including intravenous injection. Alternatively, the DNA construct can be administered directly to the afflicted individual, for example, by injection in the bone marrow. The DNA construct can also be delivered through a vehicle such as a liposome, which can be designed to be targeted to a specific cell type, and engineered to be administered through different routes.

For administration to humans, the prescribing medical professional will ultimately determine the appropriate form and dosage for a given patient, and this can be expected to vary according to the chosen therapeutic regimen (i.e DNA construct, protein, cells), the response and condition of the patient as well as the severity of the disease.

Composition within the scope of the present invention should contain the active agent (i.e. fusion protein, nucleic acid, and molecule) in an amount effective to achieve the desired therapeutic effect while avoiding adverse side effects. Non-limiting examples of active agents include the mutant protein according to the present invention a nucleic acid molecule encoding such a mutant protein, an antisense molecule to a normal allele according to the present invention, etc. Typically, the nucleic acids in accordance with the present invention can be administered to mammals (i.e. humans) in doses ranging from 0.005 to 1 mg per kg of body weight per day of the mammal which is treated. Pharmaceutically acceptable preparations and salts of the active agent are within the scope of the present invention and are well known in the art (Remington's Pharmaceutical Science, 16th Ed., Mack Ed.). For the administration of polypeptides, antagonists, agonists and the like, the amount administered should be chosen so as to avoid adverse side effects. The dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.001 to 50 mg/kg/day will be administered to the mammal. BRIEF DESCRIPTION OF THE DRAWINGS

Having thus generally described the invention, reference will now be made to the accompanying drawings, showing by way of illustration a preferred embodiment thereof, and in which: Figure 1 (e-a) shows the sequence that encodes the wild-type

TIGR/MYOC cDNA sequence (SEQ ID NO:1) localized at the GLC1A locus on chromosome 1q23-q25.

Figure 2 shows the characterization of a carrier homozygous for the Lys423Glu TIGR mutation, a, Structure of the TIGR encoded protein. The leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein. The Lys423Glu mutation is depicted by an open circle in the olfactomedin homology domain represented by a striped box within the C-terminal half of the protein. Amino acids comparison between human TIGR/MYOC protein (amino acids 415-437), human neuronal olfactomedin, rat and bullfrog neuronal olfactomedin-related proteins (GeneBank accession U79299, U03417, L13595, respectively) and C. elegans F11c3.2 protein (GeneBank accession Z81499) is represented. Identical amino acids are shaded in black, conserved amino acids are further boxed by white squares. The codon numbers correspond to those of the TIGR/MYOC protein, b, Identification of an homozygous carrier of the Lys423Glu TIGR mutation. Direct sequencing of genomic DNA revealed that persons VI-3 and VI-9 were, respectively, heterozygotic and homozygotic carriers of the Lys423Glu TIGR mutation. The arrows indicate the A to G transition. Person VI-2 carried two wild-type TIGR alleles. Figure 3 shows the amplification refractory mutation system

(ARMS) as a method to type specific alleles at a polymorphic locus. In the present invention, this method, ARMS, was used for detecting a specific pathogenic mutation. The allele-specific oligonucleotide primers were designed to discriminate between two target DNA sequences (wild-type (normal) versus pathogenic) that differed by a single nucleotide in the region of interest (either one of the two mutations). Designed primers that differed at the extreme 3' terminus were synthetised. This was done because the DNA synthesis step in the PCR reaction is crucially dependent on correct base pairing at the 3' end. The primers that were designed are differing in their 3' ends and can therefore specifically amplify the DNA fragment of interest, either normal or mutated. This figure is a pictorial representation of ARMS for the adenine to guanine transition at nucleotide 1267. The amplification strategy is demonstrated for the wild-type, or non-mutant allele, and the mutant allele.

Figure 4 shows the phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatellite markers spanning the GLC1A locus and tested for the presence of the Lys423Glu TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele associated with the GLC1A disease haplotype are represented on top. The position of the TIGR gene is indicated relative to genetic markers. Sex-averaged recombination distances, depicted between marker loci in centiMorgans, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols. A solid black box indicates the common GLC1A disease haplotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person VII-5 represents a microsatellite mutation at locus D1S2790. Person VII-5 also inherited a paternal recombination between loci D1S2815 and D1 S2790. Results of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423Glu mutant primers. The internal control PCR product is shown. Persons VI-2, VI-5, VI-6, VI-10 and VI-12 carried the wild-type allele on both chromosomes 1. Persons VI-1 , VI -7, VI-9 and VI-11 are wild-type negative and mutant positive, therefore, homozygous for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.

Figure 5 shows the characterization of carriers for the HIS366Gln and Gln368Stop TIGR mutations, a, Structure of the TIGR encoded protein. The leucine zipper domain (amino acids 117-166) is shown within the N-terminal half of the protein. The His366Gln mutation is depicted by a black circle in the olfactomedin homoiogy domain represented by a striped box within the C-terminal half of the protein. The Gln368Stop mutation is depicted by a stop codon in the olfactomedin homoiogy domain. The codon numbers correspond to those of the TIGR protein, b, Identification of carriers for the His366Gln and Gln368Stop TIGR mutations. Direct sequencing of genomic DNA revealed that persons CT-003 and LA-002 were, respectively, heterozygotic carriers of the Gln368Stop and His366Gln TIGR mutations. The arrows indicate the C to T transition or C to G transversion. Figure 6 shows that the TIGR wild-type protein and

Lys423Glu mutated TIGR protein form high molecular weight complexes in vivo and in vitro, a, Western analyses of TIGR wild-type and TIGR Lys423Glu polypeptides in transfected cells. COS-7 cells were transiently transfected with expression vectors containing wild-type TIGR, pRc/CMV or TIGRK423E (pRcTIG432E) cDNA (20 mg per sample), alone or in combination. Twenty-four hours after transfection, protein extracts from total cell lysates were resolved by SDS-PAGE and TIGR polypeptides were detected by immunoblotting. The two lines above the immunoblot depict the relative amount of each cDNA tested per sample on a scale of 0 (0 mg) to 100 (20 mg). For instance, TIGR wild-type (TIGRwt) 50- TIGR Lys423Glu (TIGRK423E) 50 indicates that 10 mg of each cDNA were added in this transfection. Two high molecular weight complexes are generated by TIGR polypeptides in COS-7 cells b, Western analyses of extracts obtained from dissected human trabecular meshwork (HTM) tissues. This analysis shows that TIGR polypeptides also form high molecular weight complexes in vivo. COS-7 cell extracts from cultures transfected with TIGRwt or TIGRK423E cDNA (20 mg) are depicted for comparison. Three distinct subtypes of TIGR monomers are observed after treating HTM tissue extracts with DTT. A brief exposure time period was performed to clearly visualize these monomers, c, Western analyses of in vitro synthesized TIGR wild-type and TIGR Lys423Glu polypeptides. pRcTIG or pRcTIG423E plasmids were added to a reticulocyte lysate transcription/translation coupled system containing pancreatic microsomal membranes. 0.5 microgram of each plasmid were tested per reaction. This analysis shows that both TIGR wild-type and TIGR Lys423Glu polypeptides can form homodimers in vitro, a-c, All samples were separated on 6% denaturing polyacrylamide gels and analyzed using a specific polyclonal antibody made against the non-glycosylated form of the protein. DTT indicates samples that were treated with dithiothreitol (0.1 mM) prior to electrophoresis. Position of molecular weight markers and of the expected monomers, dimers and tetramers are illustrated adjacent to the immunoblots. Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of preferred embodiments with reference to the accompanying drawing which is exemplary and should not be interpreted as limiting the scope of the present invention.

DESCRIPTION OF THE PREFERRED EMBODIMENT

The invention thus concerns novel mutations in the TIGR gene, a quick method for an easy detection of identified mutations and the teachings for the first time of mutant homozygotes being phenotypically normal in an autosomally dominant inherited disease. The surprising and unexpected showing that homoallelic complementation restores a normal phenotype opens the way to new and powerful therapeutic approaches for diseases or conditions in which such a type of heterozygous state (AA1) leads to a deleterious defect due to interference between the protein products of the two different alleles A and A', and in particular to an autosomal dominance state.

The present invention is illustrated in further detail by the following non-limiting examples.

EXAMPLE 1

Pedigrees and ophthalmoloqic assessments

1.1 Pedigree reconstitution

The pedigree genealogy was reconstituted using the registers compiled from the Catholic parish records, which systematically list births, marriages, and deaths of 98% of the Quebec population. Validation of the family tree and new data on recent births were obtained through interviews with key family members. The Archives Nationales du Quebec, the Quebec Civil register, and the Institut de recherche sur I'etude des populations (IREP) data base (Bouchard et al., 1991 , Histoire d'un genome. Population et genetique dans Test du Quebec, Presses de I'Universite Laval, Sillery, Quebec, pp 607) were also consulted.

1.2 Ophthalmoloqic investigations

All subjects, affected or not, gave informed consent before entering the study. Clinical assessments comprised complete ophthalmologic evaluation, including best corrected visual acuity; optic disk examination; slit-lamp biomicroscopy; applanation tonometry; gonioscopy; and visual-field evaluation. Three criteria were required for primary open-angle glaucoma (POAG) diagnosis: a) intraocular pressures above 22 mm Hg in both eyes, b) characteristic optic disk damage and/or visual field impairment, and c) grade III or IV (open-angle) gonioscopy. In the absence of optic disk damage or visual-field alteration, subjects with intraocular pressures above 22 mm Hg in both eyes and grade III or IV gonioscopy were diagnosed with ocular hypertension (OHT). Members of the families were considered normal when they presented normal optic disks and showed highest intraocular pressures ever recorded at 22 mm Hg or less. Persons with other forms of glaucomas, including grade 0 (closed angle); grade I or II (narrow-angle); congenital; and secondary glaucomas, or with other nonglaucomatous ocular disorders were considered unaffected. Blindness in deceased ancestors was confirmed by at least two independent sources.

EXAMPLE 2 Genetic analyses

2.1 Source of DNA

Blood samples were obtained from direct descendants of the founder as well as spouses of affected patients with children; from each, 20 ml of blood was drawn by venipuncture in heparinized tubes. One additional 10 ml blood sample was drawn from each subject to establish lymphoblastoid cell lines using the method of Anderson et al. (1984, In Vitro, 20:856-858).

2.2 Isolation of DNA

DNA was extracted from whole blood using the guanidine hydrochloride-proteinase K method developed by Jeanpierre (1987, Nucl. Acids. Res. 15:9611-9611).

2.3 Genotyping procedures

To accelerate genotyping, a protocol similar to the procedure of Vignal et al. (1993, Methods in molecular genetics, Academic Press, 1:211-221) which was derived from the multiplex sequencing technique of Church and Kieffer-Higgins (1988 Science 240:185-188) was used. Briefly, polymerase chain reactions (PCR) were performed in a total volume of 50 μl containing 100 ng of genomic DNA, 50 pmol of each primer, 125 mM dNTPs, 50 mM KCI, 10 mM Tris (pH 9), 1.5 mM MgCI2, 0.01% gelatin, 0.1% Triton X-100, and 1 U Taq polymerase (Perkin-Elmer-Cetus). Amplifications were carried out using a "hot-start" procedure. Taq polymerase was added after a 5-min denaturation step at 96° C. Samples were then processed through 35 cycles of denaturation (94° C for 40 s) and annealing (55° C for 30 s), followed by one last step of elongation (2 min at 72°C). Usually, three amplification products synthesized with separate primer sets on identical DNA samples were coprecipitated and comigrated in a single lane of 6% polyacrylamide denaturing gels. Separated products were then transferred onto Hybond N+ nylon membranes (Amersham), hybridized with a (CA)20 oligomer 3' labeled with Digoxigenin-11-ddUTP, and detected by che iluminescence using the DIG system (Boehringer-Mannheim) with Kodak XAR-5 films. Genotypes were scored relative to reference alleles of the mother of the CEPH family 1347 (individual 134702). Genotyping was repeated upon detection of incompatibilities or recombination events.

2.4 Selection of microsatellite markers

In Figure 4, the markers used for haplotype analyses are shown. With the exception of two markers (AFMGLC21 and AFMGLC22), all AFM (Genethon) markers reported above were described in Dib et al. (1996, supra). For AFMGLC21 , the sequences were primer a: GATCTCTTATCAGTCAGGCA (SEQ ID N0:7), and primer m: TTTCTAAGGCTGAATAATATTCG SEQ ID NO:8). For AFMGLC22, the sequences were primer a: TTAACTCACCACTCCCTGCC (SEQ ID NO:9), and primer m: AATTATGGCCTTCGCCC (SEQ ID NO: 10). Assignment of the genetic location of these markers was established according to the method of Weissenbach et al. (1992, Nature, 359:795-801) and has been validated by construction of a 10-cM physical map (Clepet et al., 1996, Eur. J. Hum. Genet., 4:250-259).

2.5 Haplotype analysis Haplotypes were analysed to phase the marker genotypes with the disease gene. The haplotype inherited by an affected child constituted the "disease" haplotype and was compared with the common disease haplotype inherited from the founder. The remaining three haplotypes were considered the "normal" haplotypes. EXAMPLE 3 Discovery of the phenotypic normal-homozyqote mutant

3.1 Phenotypic normal-homozvαote mutant (Figure 4) Phenotypic status and segregation analyses of the GLC1A disease haplotype and Lys423Glu TIGR mutation in family GV-510. All living individuals were investigated for glaucoma, genotyped with microsatellite markers spanning the GLC1A locus and tested for the presence of the Lys423Glu TIGR mutation using ARMS. Selected AFM markers with their corresponding GDB number, number of alleles observed for each marker in pedigree GV-001 and sizes of the allele associated with the GLC1A disease haplotype are represented on top. The position of the TIGR/MYOC gene is indicated relative to genetic markers. Sex-averaged recombination distances, depicted between marker loci in centiMorgans, were not drawn to scale. Glaucoma patients are depicted by solid black symbols, unaffected individuals by open symbols, and deceased subjects reported as blind by at least two independent family members by a black quadrant in the upper left corner of their respective symbols. OHT persons are represented by open symbols containing a central solid dot. Present ages of normal and OHT patients as well as ages of affected carriers at time of diagnosis are depicted above their respective symbols. A solid black box indicates the common GLC1A disease haplotype. The right side of each phased haplotype indicates the haplotype inherited from the father; the left side indicates the haplotype inherited from the mother. An asterisk in the genotype of person VII-5 represents a microsatellite mutation at locus D1S2790. Person VII-5 also inherited a paternal recombination between loci D1S2815 and D1S2790. Results of the ARMS tests are depicted below each subject's genotype; W, ARMS test performed using the wild-type primers; M, ARMS test performed using the Lys423Glu mutant primers. The internal control PCR product is shown. Persons VI-2, VI-5, VI-6, VI-10 and VI-12 carried the wild-type allele on both chromosomes 1. Persons VI-1 , VI-7, VI-9 and VI-11 are wild-type negative and mutant positive, therefore, homozygous for the Lys423Glu mutation. All other individuals are both wild-type positive and mutant positive, therefore, heterozygotes for the mutation.

3.2 Initial screening for mutations (Figure 2)

To obtain a wild-type TIGR cDNA, RT-PCR was performed using the Superscript RT protocol (Gibco/BRL), 500 ng of oligo-dT and 10 μg of total RNA isolated from a pool of trabecular meshwork tissue dissected from 10 pairs of human eyes. To obtain the mutated TIGR cDNA, the same protocol was followed using 10 μg of total RNA isolated from homozygote VI-9 immortalized lymphoblasts. One to 3 μl of first strand cDNA synthesis was amplified with primers 41 F: AGAGCTTTCCAGAGGAAGCC (SEQ ID NO: 11), and 1731R: GGTCTACGCCCTCAGACTAC (SEQ ID NO: 12), before a second round of PCR with internal primers 31 F: AGAGACAGCAGCACCCAACG (SEQ ID NO: 13), and 21 R: TCTGCCATTGCCTGTACAGC (SEQ ID NO:14). PCR products were directly cloned into the pCRIi vector using the TA cloning kit (InVitrogen) according to the manufacturer's protocol. Cloned products were sequenced using the T7 sequencing kit (Pharmacia).

3.3 Sequencing

To confirm mutations, genomic DNA sequencing was also performed on selected individuals by direct asymmetric PCR sequencing using modifications of the protocol described by Gyllensten et al. (1988, Proc. Natl. Acad. Sci., §5:7652-7656). The mutation was recognized by the approximately equal peak intensity of the bands on the autoradiogram. All sequencing was performed bidirectionally.

EXAMPLE 4

Two mutations including ARMS

4.1 ARMS test for the Lvs423Glu mutation (Figure 3) To test for the presence of the Lys423Glu mutation, we developed an amplification refractory mutation system (ARMS) exploiting procedures described by Little (1997, Current Protocols in human genetics, Eds. Dracopoli, N.C. et al., 9.8.1. - 9.8.12). Two complementary PCR reactions were conducted with the same substrate. The first reaction contained a forward primer specific for the wild-type allele, SEQ. NO. 3, (GLCf Λ1313AA): TCGAACAAACCTGGGAGACAAACATCCGAA. The second reaction contained a forward primer specific for the Lys423Glu TIGR allele, SEQ. NO. 2, (GLCf Λ1313GG): TCGAACAAACCTGGGAGACAAACATCCGGG. In each reaction, a common reverse primer, GLC7/A1479R, was used; its sequence was: SEQ. NO. 4 CAAAGAGCTTCTTCTCCAGGGGGTTGTAGT. Both reactions gave a 225 bp amplified fragment. To serve as internal control, a second pair of primers that co-amplified a 438 bp fragment within TIGR exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was: AGAGCTTTCCAGAGGAAGCC (SEQ ID NO: 11), the reverse TIGR exon 1 primer was TTGGGTTTCCAGCTGGTC (SEQ ID NO: 15). PCR was performed using standard protocols, annealing temperature was at 60°C. Amplification products were electrophoresed in 1 ,5% agarose gels before ethidium staining and scored by two independent observers. 4.2 ARMS test for the His366Gln mutation

To test for the presence of the His366Gln mutation, we developed an amplification refractory mutation system (ARMS) exploiting procedures described by Little (1997). Two complementary PCR reactions were conducted with the same substrate. The first reaction contained a forward primer specific for the wild-type allele, SEQ. NO. 6 (GLC1 A 1098CT): GAGAAGGAAATCCCTGGAGCTGGCTACCTC. The second reaction contained a forward primer specific for the His366Gln TIGR allele, SEQ. NO. 5, (GLC1 AW98GT): GAGAAGGAAATCCCTGGAGCTGGCTACCTG. In each reaction, SEQ NO:4 was used as a common reverse primer. Both reactions gave a 393 bp amplified fragment. To serve as intemal control, a second pair of primers that co-amplified a 438 bp fragment within TIGR exon 1 was added to the ARMS reaction. The forward TIGR exon 1 primer was: AGAGCTTTCCAGAGGAAGCC (SEQ ID NO: 11), the reverse TIGR exon 1 primer was TTGGGTTTCCAGCTGGTC (SEQ ID NO:15). PCR was performed using standard protocols, annealing temperature was at 60°C. Amplification products were electrophoresed in 1.5% agarose gels before ethidium staining and scored by two independent observers.

EXAMPLE 5 The TIGR wild-type protein and Lys423Glu mutated TIGR protein form high molecular weight complexes in vivo and in vitro Methods Construction of cDNA expression vectors. To create an eukaryotic expression vector encoding the wild-type TIGR cDNA, a 1831 bp Hindlll/Notl fragment encompassing 36 bp of the 5' untranslated region, the full-length 1512 bp ORF and 188 bp of the 3' untranslated region of TIGRwt cDNA was purified from pTIGwt and subcloned directionnally into the Hindlll/Notl sites of plasmid pRc/CMV (Invitrogen). This new construct was named pRcTIG and produced high constitutive levels of mRNA due to the presence of CMV enhancer-promoter sequences. An expression vector encoding a TIGR cDNA carrying the Lys423Glu mutation was then generated by site-directed mutagenesis of pRcTIG using the QuikChange mutagenesis kit (Stratagene). The primers used to generate the A to G transition in pRcTIG were: 5'-GGGAGACAAACATCCGTGAGCAGTCAGTCGCC-3' (SEQ ID NO: 16) and 5'-GGCGACTGACTGCTCACGGATGTTTGTCTCCC-3' (SEQ ID NO: 17). This second expression vector was named pRcTIG423E. All constructions were verified by sequencing the inserts bidirectionnally between the Hindlll and Notl sites.

Transfections

COS-7 cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL) supplemented with 10% fetal bovine serum (Gibco BRL) and antibiotics (100 U/ml penicillin, 100 mg/ml streptomycin (Gibco BRL)). Cells were plated at a density of 2x106 cells per 75 cm2 tissue culture flask. Twenty-four h later, transient transfection was performed using the DNA/DEAE-dextran transfection method coupled with a chloroquine treatment and followed by a dimethylsulfoxide shock. Each DNA/DEAE-dextran transfection sample contained a total of 20 mg/flask of plasmid pRcTIG or pRcTIG423E, alone or in combination. Briefly, COS-7 cells were exposed to the DNA/DEAE-dextran solution (0.5 mg/ml of DEAE in PBS; 5ml/flask) for 30 min before addition of 20 ml of DMEM (w/o serum)/flask containing chloroquine to reach a final concentration of 0.02 mg/ml for a further 2.5 h incubation period. The solutions were then aspirated and the cells exposed to DMSO (10% DMSO in 5 ml DMEM with serum/flask) for exactly 90 seconds. The solutions were again aspirated and the cells incubated in 25 ml DMEM supplemented with 10% fetal bovine serum and antibiotics for 2 days before protein extraction. The culture medium was replaced between the second and third day.

Reticulocyte lysate transcription-translation coupled system. In vitro transcription/translation was performed using the TNT Coupled Reticulocyte Lysate System (Promega) according to the manufacturer's protocol. As both pRcTIG and pRcTIG423E constructs carried the T7 RNA promoter, no additional DNA modifications were done before testing. Reactions contained 0.5 microgram of each plasmid and a complete amino acid mixture instead of 35S-methionine. Canine Pancreatic Microsomal Membranes (Promega) (2.5 ml (2EQ/ml)/ 25 ml reaction) were added to the samples to optimize cotranslational processing. The samples were incubated for 90 min at 30°C before protein analysis. Protein extraction SDS-PAGE and Western-blot analysis. Confluent cells from tissue culture flasks were washed twice with cold PBS, scraped in 2 ml of ice cold lysis buffer (10 mM tris-HCI pH 7.5) containing the Complete Protease Inhibitor Cocktail (Boehringer Mannheim) (1 tablet/40 ml Tris-HCI). Human trabeculum meshwork (HTM) tissues were dissected from donor eyes obtained from the CHUL Eye Bank and lysed in 1 ml of cold lysis buffer. Protein concentration was estimated and, dithiothreitol (DDT; 0.1 mM) was added to selected samples for 10 minutes, prior to electrophoresis, to reduce disulfide links that may be involved in multimerization. SDS-PAGE was performed on 6% resolving acrylamide gels using 5% stacking gels. Protein were transferred onto nitrocellulose, using a Trans-Blot SD Semi-Dry Transfer Cell apparatus (Bio-Rad) for 1 h at 150 mA. Nitrocellulose membranes were saturated for 4 h at 4°C in TBS containing 0.1% Tween-20 (TBS-T) and 5% (w/v) skimmed milk powder (blotto), rinsed once (15 min) in TBS-T and incubated O/N at 4°C with purified TIGR antibodies diluted (1/2000) in blotto (1%). After 1-15 min and 3 -5 min washes with TBS-T, the nitrocellulose membranes were incubated for 1 h at room temperature with goat-anti rabbit antibodies labeled with horseradish peroxidase (1 :5000, Amersham) in blotto (1%), washed four times (1-15 min and 3-5 min) with TBS-T, revealed 2 min with Renaissance Western blot Chemiluminescence Reagent (Dupont NEN), and exposed to Reflection autoradiography films (Dupont NEN) during increasing periods of time ranging from 30 s to 5 min.

According to homoallelic complementation, the Lys423Glu mutation acts in a dominant negative fashion resulting in defective TIGR wildtype/Lys423Glu protein heteromultimers but functional TIGR Lys423Glu/Lys423Glu homopolymers. This model also demonstrates that a locus with a wild-type allele A and a mutant allele A', such that homozygosity for either allele has no phenotypic consequence, but the heterozygous state AA' leads to a deleterious defect due to interference between the protein products of the two different alleles. Homoallelic complementation further refers to affected heterozygotes in which some functional TIGR wild-type/wild-type and/or TIGR Lys423Glu/Lys423Glu homopolymers are also generated by an admixture of normal and mutant subunits, thereby explaining part of the phenotypic variability observed at this locus.

Examination of the amino acid sequence of the TIGR gene product revealed two features potentially involved in protein-protein interactions: 1 ) a leucine zipper domain containing seven motifs within the N-terminal half of the polypeptide and 2) a conserved cysteine at position 433 in a region highly homologous to bullfrog olfactomedin in which the equivalent cysteine residue may promote the formation of disulfide-linked homopolymers (Figure 2). The discovery that the TIGR wild-type protein and Lys423Glu

TIGR mutated protein form high molecular weight complexes in vivo and in vitro (Figure 6) provides evidence for homoallelic complementation as the mechanism accounting for the unaffected status of TIGR Lys423Glu/Lys423Glu mutant homozygotes. As shown in Figure 5, the TIGR wild-type protein and Lys423Glu TIGR mutated protein form high molecular weight complexes in vivo and in vitro. COS-7 cells were transiently transfected with expression vectors encoding the TIGR wild-type or TIGR Lys423Glu gene products, alone or in combination, and newly synthesized proteins were analyzed by immunoblotting. In cells transfected with the TIGR wild-type cDNA construct, pRcTIG, bands of immunoreactivity were detected as two major complexes composed of TIGR polypeptides migrating at approximately 120 kD and 240 kD (Figure 6 a and b). When the denaturing agent dithiothreitol (DDT) was added to the extracts prior to electrophoresis, both complexes were resolved into two lower molecular weight forms migrating at approximately 57 kD and 62 kD (Figure 6 a and b). As deduced from the nucleotide sequence, the 57 kD form corresponded to TIGR monomers originating at the first translation initiation site of the TIGR mRNA while the 62 kD form represented partially glycosylated monomers. In cells transfected with increasing concentrations of TIGR Lys423Glu cDNA in the presence of decreasing amount of the wild-type construct, the pattern of immunoreactivity was identical to that detected when transfections were performed with pRcTIG alone indicating that TIGR Lys423Glu gene products did not disrupt the formation of the two major complexes (Figure 6 a and b). Immunoblotting of protein extracts obtained from human trabecular meshwork (HTM) tissues dissected from donor eyes revealed a similar pattern of migration establishing that TIGR polypeptides also formed high molecular weight complexes in vivo (Figure 6b). Under denaturing condition, HTM TIGR polypeptides were resolved into three distinct monomers: the 57 and 62 kD products and a smaller, approximately 55 kD, TIGR polypeptide resulting from intemal cleavage or, utilization of a second initiation site for translation (Figure 6b).

To show that TIGR polypeptides did not required extraneous proteins to undergo oligomerization, we used an in vitro reticulocyte lysate system in which transcription of TIGR wild-type and TIGR Lys423Glu cDNAs was coupled to translation of their respective mRNAs. Following protein extraction and immunoblotting, we observed that both TIGR wild-type and TIGR Lys423Glu polypeptides formed homodimers migrating at the expected 120 kD position (Figure 6c). These data showed that the high molecular weight complexes observed in COS-7 cells were produced by multimerization of TIGR monomers, generating homodimers and homotetramers. Although the present invention has been described hereinabove by way of preferred embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.

Claims

WHAT IS CLAIMED IS:
1. An isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1 , wherein the nucleotide located at position 1267 is a guanidine residue in lieu of an adenine residue , said guanidine residue being a specific nucleotide of a mutant allele of the TIGR gene.
2. An isolated DNA comprising the nucleotide sequence defined in SEQ. ID. NO.: 1 , wherein the nucleotide located at position 1096 is a guanidine residue in lieu of a cytosine residue , said guanidine residue being a specific nucleotide of a mutant allele of the TIGR gene.
3. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1 , said oligonucleotide ending at its 3' end with said specific nucleotide , as defined in claim 1 , or a complementary sequence thereof.
4. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1 , said oligonucleotide ending at its 3' end with a non mutant nucleotide corresponding to said specific nucleotide, as defined in claim 1, or a complementary sequence thereof.
5. An oligonucleotide as defined in claim 3, which is incapable of priming a polymerase priming extension when annealed to a non mutant allele.
6. An oligonucleotide as defined in claim 4, which is incapable of priming a polymerase priming extension when annealed to said mutant allele.
7. An oligonucleotide as defined in claim 5, which has the nucleotide sequence of SEQ. ID. NO.: 2.
8. An oligonucleotide as defined in claim 6, which has the nucleotide sequence of SEQ. ID. NO.: 3.
9. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1 , said oligonucleotide having a nucleotide sequence shared by said mutant allele and a non mutant allele, as defined in claim 1 , and a complementary sequence thereof.
10. An oligonucleotide as defined in claim 9, which has the nucleotide sequence of SEQ. ID. NO.: 4.
11. An oligonucleotide comprising at least 10 nucleotides of
SEQ. ID. NO.: 1 , said oligonucleotide ending at its 3' end with said specific nucleotide , as defined in claim 2, or a complementary sequence thereof.
12. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1 , said oligonucleotide ending at its 3' end with a non mutant nucleotide corresponding to said specific nucleotide, as defined in claim 2, or a complementary sequence thereof.
13. An oligonucleotide as defined in claim 11 , which is incapable of priming a polymerase priming extension when annealed to a non mutant allele.
14. An oligonucleotide as defined in claim 12, which is incapable of priming a polymerase priming extension when annealed to said mutant allele.
15. An oligonucleotide as defined in claim 13 .which has the nucleotide sequence of SEQ. ID. NO.: 5.
16. An oligonucleotide as defined in claim 14, which has the nucleotide sequence of SEQ. ID. NO.: 6.
17. An oligonucleotide comprising at least 10 nucleotides of SEQ. ID. NO.: 1 , said oligonucleotide having a nucleotide sequence shared by said mutant allele and a non mutant allele, as defined in claim 2, and a complementary sequence thereof.
18. An oligonucleotide as defined in claim 17, which has the nucleotide sequence of SEQ. ID. NO.: 4.
19. A method for detecting a mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual with an oligonucleotide as defined in claims 3, 5 or 7 and with an oligonucleotide as defined in claim 9 or 10; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.
20. A method for detecting a mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide as defined in claims 11 ,13 or 15 and with an oligonucleotide as defined in claim 17 or 18; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said mutant allele.
21. A method for detecting a non-mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide as defined in claim 4, 6 or 8 and with an oligonucleotide as defined in claim 9 or 10; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said non-mutant allele.
22. A method for detecting a non-mutant allele of the TIGR gene which comprises the steps of contacting a DNA sample taken from an individual, with an oligonucleotide as defined in claim 12, 14 or 16 and with an oligonucleotide as defined in claim 17 or 18; obtaining an amplified product in an amplification reaction; and detecting said amplification product as an indication of the presence of said non-mutant allele.
23. A kit for the detection of mutations in the TIGR gene comprising an oligonucleotide as defined in any one of claims 3, 5, 7, 11,13 and
15; an oligonucleotide as defined in any one of claims 4, 6, 8, 12, 14 and 16; and an oligonucleotide as defined in any one of claims 9, 10, 17 and 18; and suitable reagents required for obtaining amplified products in an amplification reaction.
24. The kit of claim 23, wherein amplification products are detectable. 99/16898
42
25. A method for detecting in an individual the inheritance of two of said mutant alleles as defined in claim 1 , said individual being homozygote for said mutant allele and phenotypically normal, and said individual being capable of transmitting said mutant allele to an offspring whereby said offspring is at risk for developing glaucoma, with said method comprising the steps of reproducing the methods of claims 19 and 21 ; a positive result obtained from the method of claim 19 and a negative result from the method of claim 21 , being an indication that said individual is homozygote for said mutant allele.
26. A method to counteract glaucoma in a heterozygotic carrier of TIGR mutations, an overexpression of mutated TIGR protein in a patient to counteract the glaucoma phenotype associated with said heterozygocity, thus rendering the phenotype of said patient normal by homoallelic complementation.
27. A method to counteract and/or treat heterozygotic carriers of an autosomal dominant inherited disorder caused by a protein that forms homomultimers, comprising at least one of an overexpression of the mutated protein and an inhibition of the normal protein in a patient, to counteract the affected phenotype, thereby rendering said phenotype normal by homoallelic complementation.
28. The method of claim 27, wherein said autosomal dominant inherited disorder is glaucoma and said normal protein is normal TIGR protein.
29. A method to counteract glaucoma in a heterozygotic carrier of TIGR mutations comprising an inhibition of expression of the normal
PCT/CA1998/000923 1997-09-30 1998-09-29 Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof WO1999016898A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA2,216,997 1997-09-30
CA 2216997 CA2216997A1 (en) 1997-09-30 1997-09-30 Molecular diagnostic of glaucomas associated with chromosomes 1
CA2,231,720 1998-05-12
CA 2231720 CA2231720A1 (en) 1998-05-12 1998-05-12 Molecular diagnostic of glaucomas associated with chromosome 1 and method of treatment thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CA 2345923 CA2345923A1 (en) 1997-09-30 1998-09-29 Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof

Publications (1)

Publication Number Publication Date
WO1999016898A1 true true WO1999016898A1 (en) 1999-04-08

Family

ID=25679667

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA1998/000923 WO1999016898A1 (en) 1997-09-30 1998-09-29 Molecular diagnostic of glaucomas associated with chromosomes 1, and method of treatment thereof

Country Status (1)

Country Link
WO (1) WO1999016898A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000042220A1 (en) * 1999-01-11 2000-07-20 The Regents Of The University Of California Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US6150161A (en) * 1994-11-03 2000-11-21 The Regents Of The University Of California Methods for the diagnosis of glaucoma
US6171788B1 (en) 1997-01-28 2001-01-09 The Regents Of The University Of California Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
EP1491627A1 (en) * 2002-03-29 2004-12-29 Sysmex Corporation Gene examination method for judging the onset risk of glaucoma
US6956103B2 (en) 1994-04-28 2005-10-18 The University Of Iowa Research Foundation Glaucoma therapeutics and diagnostics
US7138511B1 (en) 1997-01-28 2006-11-21 The Regents Of The University Of California Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014411A1 (en) * 1994-11-03 1996-05-17 The Regents Of The University Of California Methods for the diagnosis of glaucoma

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014411A1 (en) * 1994-11-03 1996-05-17 The Regents Of The University Of California Methods for the diagnosis of glaucoma

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ALWARD W ET AL: "The phenotype of primary open angle glaucoma patients with mutations in the GLAIA gene", INVESTIGATIVE OPHTHALMOLOGY AND VISUAL SCIENCE, vol. 38, no. 4 (Part 1-2), 11 May 1997 (1997-05-11) - 16 May 1997 (1997-05-16), pages S930, XP002094313 *
NEWTON C R ET AL: "ANALYSIS OF ANY POINT MUTATION IN DNA. THE AMPLIFICATION REFRACTORY MUTATION SYSTEM (ARMS)", NUCLEIC ACIDS RESEARCH, vol. 17, no. 7, 11 April 1989 (1989-04-11), pages 2503 - 2516, XP000141596 *
RAYMOND V ET AL: "Homozygotes for autosomal dominant open-angle glaucoma at the GLCIA locus", AMERICAN JOURNAL OF HUMAN GENETIC, vol. 59, no. 4 (suppl), 29 October 1996 (1996-10-29) - 2 November 1996 (1996-11-02), pages A280, XP002094310 *
RAYMOND V ET AL: "Normal homozygotes for autosomal dominant open-angle glaucoma at tzhe GLAIA locus", INVESTIGATIVE OPTHALMOLOGY AND VISUAL SCIENCE, vol. 38, no. 4 (part 1-2), 11 May 1997 (1997-05-11) - 16 May 1997 (1997-05-16), pages S576, XP002094311 *
RAYMOND V ET AL: "Normal homozygotes for primary open-angle glaucoma caused by the TIGR/GLCIA gene: evidence for a new form of dominance in man", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 61, no. 4 (suppl), 28 October 1997 (1997-10-28) - 1 November 1997 (1997-11-01), pages A21, XP002094309 *
STOILOVA D ET AL: "Identification of a new TIGR mutation in a family with juvinile-onset primary open angle glaucoma", OPHTHALMIC GENETICS, vol. 18, no. 3, September 1997 (1997-09-01), pages 109 - 18, XP002094312 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6956103B2 (en) 1994-04-28 2005-10-18 The University Of Iowa Research Foundation Glaucoma therapeutics and diagnostics
US6150161A (en) * 1994-11-03 2000-11-21 The Regents Of The University Of California Methods for the diagnosis of glaucoma
US7138511B1 (en) 1997-01-28 2006-11-21 The Regents Of The University Of California Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US6171788B1 (en) 1997-01-28 2001-01-09 The Regents Of The University Of California Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
WO2000042220A1 (en) * 1999-01-11 2000-07-20 The Regents Of The University Of California Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
EP1491627A1 (en) * 2002-03-29 2004-12-29 Sysmex Corporation Gene examination method for judging the onset risk of glaucoma
EP1491627A4 (en) * 2002-03-29 2005-05-04 Sysmex Corp Gene examination method for judging the onset risk of glaucoma

Similar Documents

Publication Publication Date Title
Sherrington et al. Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease
Roberds et al. Missense mutations in the adhalin gene linked to autosomal recessive muscular dystrophy
Toh et al. An hPer2 phosphorylation site mutation in familial advanced sleep phase syndrome
La Spada et al. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy
US5989815A (en) Methods for detecting predisposition to cancer at the MTS gene
US6274332B1 (en) Mutations in the KCNE1 gene encoding human minK which cause arrhythmia susceptibility thereby establishing KCNE1 as an LQT gene
Aoki et al. Genomic organization of the dysferlin gene and novel mutations in Miyoshi myopathy
Levy-Lahad et al. Candidate gene for the chromosome 1 familial Alzheimer's disease locus
Vollrath et al. Loss-of-function mutations in the LIM-homeodomain gene, LMX1B, in nail-patella syndrome
Felbor et al. Adult vitelliform macular dystrophy is frequently associated with mutations in the peripherin/RDS gene
US20040265849A1 (en) Genetic polymorphisms associated with Alzheimer's disease, methods of detection and uses thereof
US6720472B2 (en) HMGI proteins in cancer and obesity
US7179620B2 (en) Gene responsible for stargardt-like dominant macular dystrophy
Datz et al. Predominance of the HLA-H Cys282Tyr mutation in Austrian patients with genetic haemochromatosis
US5879884A (en) Diagnosis of depression by linkage of a polymorphic marker to a segment of chromosome 19P13 bordered by D19S247 and D19S394
Ehrmann et al. Characterization of genes encoding translation initiation factor eIF-2γ in mouse and human: Sex chromosome localization, escape from X-inactivation and evolution
US6201107B1 (en) Cystic fibrosis gene
Jääskeläinen et al. Mutations in the cardiac myosin-binding protein C gene are the predominant cause of familial hypertrophic cardiomyopathy in eastern Finland
WO1995025429A1 (en) Mts gene, mutations therein, and methods for diagnosing cancer using mts gene sequence
WO1997023598A2 (en) A long qt syndrome gene which encodes kvlqt1 and its association with mink
WO2005040367A1 (en) Vitamin k epoxide recycling polypeptide vkorc1, a therapeutic target of coumarin and their derivatives
Hiraoka et al. Insertion and deletion mutations in the dinucleotide repeat region of the Norrie disease gene in patients with advanced retinopathy of prematurity
Hu et al. The human FE65 gene: genomic structure and an intronic biallelic polymorphism associated with sporadic dementia of the Alzheimer type
US20050064416A1 (en) Methods for diagnosing and treating heart disease
US6277978B1 (en) KVLQT1—a long QT syndrome gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase in:

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 09509516

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2345923

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2345923

Country of ref document: CA