CA2331781C - De novo dna cytosine methyltransferase genes, polypeptides and uses thereof - Google Patents

De novo dna cytosine methyltransferase genes, polypeptides and uses thereof Download PDF

Info

Publication number
CA2331781C
CA2331781C CA002331781A CA2331781A CA2331781C CA 2331781 C CA2331781 C CA 2331781C CA 002331781 A CA002331781 A CA 002331781A CA 2331781 A CA2331781 A CA 2331781A CA 2331781 C CA2331781 C CA 2331781C
Authority
CA
Canada
Prior art keywords
seq
nucleic acid
dna
polypeptide
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CA002331781A
Other languages
French (fr)
Other versions
CA2331781A1 (en
Inventor
En Li
Masaki Okano
Shaoping Xie
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp filed Critical General Hospital Corp
Publication of CA2331781A1 publication Critical patent/CA2331781A1/en
Application granted granted Critical
Publication of CA2331781C publication Critical patent/CA2331781C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007Methyltransferases (general) (2.1.1.)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

De novo DNA cytosine methyltransferase polynucleotides and polypeptides and methods for producing said polypeptides are disclosed.
Also disclosed are methods for utilizing de novo DNA cytosine methyltransferase polynucleotides and polypeptides in diagnostic assays, for an in vitro DNA methylation application and therapeutic applications such as the treatment of neoplastic disorders.

Description

De novo DNA Cytosine Methyltransferase Genes, Polypeptides and Uses Thereof Background of the Invention Field of the Invention The present invention relates generally to the fields of molecular biology, developmental biology, cancer biology and medical therapeutics. Specifically, the present invention relates to novel DNA cytosine methyltransferases. More specifically, isolated nucleic acid molecules are provided encoding mouse Dnmt3a and Dnmt3b and human DNMT3A and DNMT3B de novo DNA
cytosine methyltransferase genes. Dnmt3a and Dnmt3b mouse and DNMT3A
and DNMT3B human polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. The invention further relates to an in vitro method for cytosine C5 methylation. Also provided is a diagnostic method for neoplastic disorders, and methods of gene therapy using the polynucleotides of the invention.

Related Art Methylation at the C-5 position of cytosine predominantly in CpG
dinucleotides is the major form of DNA modification in vertebrate and invertebrate animals, plants, and fungi. Two distinctive enzymatic activities have been shown to be present in these organisms. The de novo DNA cytosine methyltransferase, whose expression is tightly regulated in development, methylates unmodified CpG sites to establish tissue or gene-specific methylation patterns. The maintenance methyltransferase transfers a methyl group to cytosine in hemi-methylated CpG sites in newly replicated DNA, thus functioning to maintain clonal inheritance of the existing methylation patterns.
De novo methylation of genomic DNA is a developmentally regulated process (Jahaner, D. and Jaenish, R., "DNA Methylation in Early Mammalian Development," In DNA Methylation: Biochemistry and Biological Significance, Razin, A. et al., eds., Springer-Verlag (1984) pp. 189-219 and Razin, A., and Cedar, H., "DNA Methylation and Embryogenesis," in DNA Methylation:
Molecular Biology and Biological Significance, Jost., J. P. et al., eds., Birkhauser Verlag, Basel, Switzerland (1993) pp. 343-357). It plays a pivotal role in the establishment of parental-specific methylation patterns of imprinted genes (Chaillet, J. R. et al., Cell 66:77-83 (1991); Stoger., R. et al., Cell 73:61-(1993); Brandeis, M. et al., EMBOJ. 12:3669-3677 (1993); Tremblay, K. D. et al., Nature Genet. 9:407-413 (1995); and Tucker, K. L. et al., Genes Dev.
10:1008-1020 (1996)), and in the regulation of X chromosome inactivation in mammals (Brockdoff, N. "Convergent Themes in X Chromosome Inactivation and Autosomal Imprinting," in Genomic Imprinting: Frontiers in Molecular Biology, Reik, W. and Sorani, A. eds., IRL Press Oxford (1997) pp. 191-210;
Ariel, M. et al., Nature Genet. 9:312-315 (1995); and Zucotti, M. and Monk, M.
Nature Genet. 9:316-320 (1995)).
Thus, C5 methylation is a tightly regulated biological process important in the control of gene regulation. Additionally, aberrant de novo methylation can lead to undesirable consequences. For example, de novo methylation of growth regulatory genes in somatic tissues is associated with tumorigenesis in humans (Laird, P. W. and Jaenisch, R. Ann. Rev. Genet. 30:441-464 (1996); Baylin, S.
B.
et al., Adv. Cancer. Res. 72:141-196 (1998); and Jones, P. A. and Gonzalgo, M.
L. Proc. Natl. Acad. Sci. USA 94:2103-2105 (1997)).
The gene encoding the major maintenance methyltransferase, Dnmtl, was first cloned in mice (Bestor, T. H. et al., J. Mol. Biol. 203:971-983 (1988), and the homologous genes were subsequently cloned from a number of organisms, including Arabidoposis, sea urchin, chick, and human. Dnmtl is expressed ubiquitously in human and mouse tissues. Targeted disruption of Dnmtl results in a genome-wide loss of cytosine methylation and embryonic lethality (Li etal., 1992). Interestingly, Dnmtl is dispensable for the survival and growth of the embryonic stem cells, but appears to be required for the proliferation of differentiated somatic cells (Lei et al., 1996). Although it has been shown that the enzyme encoded by Dnmtl can nlethylate DNA de novo in vitro (Bestor, 1992). there is no evidence that Dnmt 1 is directly involved in de novo methylation in normal development. Dnmtl appears to function primarily as a maintenance methyltransferase because of its strong preference for hemi-methylated DNA and direct association with newly replicated DNA (Leonhardt, H. et al., Cell 71:865-873 (1992)). Additionally, ES cells homozygous for a null mutation of Dnmtl can methylate newly integrated retroviral DNA, suggesting that Dnmtl is not required for de novo methylation and an independently encoded de novo DNA
cytosine methyltransferase is present in mammalian cells (Lei et al., 1996).
Various methods of disrupting Dnmtl protein activity are known to those skilled in the art. For example, see PCT Publication No. W092/06985, wherein mechanism based inhibitors are discussed. Applications involving antisense technology are also known; U.S. Patent No. 5578716 discloses the use of antisense oligonucleotides to inhibit Dnmtl activity, and Szyf et al., J.
Biol.
Chem. 267: 12831-12836, 1992, demonstrates that myogenic differentiation can be affected through the antisense inhibition of Dnmtl protein activity.

Thus, while there is a significant amount of knowledge in the art regarding the maintenance C5 methyltransferase (Dnmtl ), there is no information regarding nucleic acid or protein structure and expression or enzymatic properties of the de novo C5 methyltransferase in mammals.

Summary of the Invention An object of the present invention is to provide de novo DNA cytosine methyltransferase genes, polypeptides and uses thereof. In accordance with an aspect of the present invention, there is provided an isolated nucleic acid molecule comprising a polynucleotide selected from the group consisting of:

-3a-(a) a polynucleotide sequence encoding a polypeptide comprising amino acids from about 1 to about 908 in SEQ ID NO:5;

(b) a polynucleotide sequence encoding a polypeptide comprising amino acids from about 1 to about 859 in SEQ ID NO:6;

(c) a polynucleotide sequence encoding a polypeptide comprising amino acids from about I to about 912 in SEQ ID NO:7;

(d) a polynucleotide sequence encoding a polypeptide comprising amino acids from about 1 to about 853 in SEQ ID NO:8; and (e) a polynucleotide sequence that is at least 90% identical to the polynucleotide sequence of (a), (b), (c) or (d).

In accordance with another aspect of the invention, there is provided an isolated nucleic acid molecule comprising polynucleotides selected from the group consisting of:

(a) at least 20 contiguous nucleotides of SEQ ID NO:I, provided that said nucleotides are not AA052791(SEQ ID NO: 9);
AA111043(SEQ ID NO:10); AA154890(SEQ ID NO:11); AA240794(SEQ ID
NO:12); AA756653(SEQ ID NO:13); W58898(SEQ ID NO:14); W59299(SEQ
ID NO:15); W91664(SEQ ID NO:16); W91665(SEQ ID NO:17); or any subfragment thereof; and (b) a nucleotide sequence complementary to a nucleotide sequence in (a).

In accordance with another aspect of the invention, there is provided an isolated nucleic acid molecule comprising polynucleotides selected from the group consisting of:

(a) at least 20 contiguous nucleotides of SEQ ID NO:2, provided that said nucleotides are not AA116694 (SEQ ID NO: 18); AA119979 (SEQ ID NO:19); AA177277 (SEQ ID NO:20); AA210568 (SEQ ID NO:21);
AA399749 (SEQ ID NO:22); AA407106 (SEQ ID NO:23); AA575617 (SEQ ID
NO:24); or any subfragment thereof; and -3b-(b) a nucleotide sequence complementary to a nucleotide sequence in (a).

In accordance with another aspect of the invention, there is provided an isolated nucleic acid molecule comprising polynucleotides selected from the group consisting of:
(a) at least 20 contiguous nucleotides of SEQ ID NO:3, provided that said nucleotides are not AA004310 (SEQ ID NO:25); AA004399 (SEQ ID NO:26); AA312013 (SEQ ID NO:27); AA355824 (SEQ ID NO:28);
AA533619 (SEQ ID NO:29); AA361360 (SEQ ID NO:30); AA364876 (SEQ ID
NO:31); AA503090 (SEQ ID NO:32); AA533619 (SEQ ID NO:33); AA706672 (SEQ ID NO:34); AA774277 (SEQ ID NO:35); AA780277 (SEQ ID NO:36);
H03349 (SEQ ID NO:37); H04031 (SEQ ID NO:38); H53133 (SEQ ID NO:39);
H53239 (SEQ ID NO:40); H64669 (SEQ ID NO:41); N26002 (SEQ ID NO:42);
N52936 (SEQ ID NO:43); N88352 (SEQ ID NO:44); N89594 (SEQ ID NO:45);
R19795 (SEQ ID NO:46); R47511 (SEQ ID NO:47); T50235 (SEQ ID NO:48);
T78023 (SEQ ID NO:49); T78186 (SEQ ID NO:50); W22886 (SEQ ID NO:51);
W67657 (SEQ ID NO:52); W68094 (SEQ ID NO:53); W76111 (SEQ ID NO:54);
Z38299 (SEQ ID NO:55); Z42012 (SEQ ID NO:56); G06200(SEQ ID NO:74);
or any subfragment thereof; and (b) a nucleotide sequence complementary to a nucleotide sequence in (a).

In accordance with another aspect of the invention, there is provided an isolated polypeptide molecule comprising an amino acid sequence selected from the group consisting of:

(a) amino acids from about 1 to about 908 in SEQ ID NO:5;
(b) amino acids from about 1 to about 859 in SEQ ID NO:6;
(c) amino acids from about 1 to about 912 in SEQ ID NO:7;

-3c-(d) amino acids fronl about I to about 853 in SEQ ID NO:8;
and (e) a polypeptide sequence at least about 90% identical to the amino acid sequence of (a), (b), (c) or (d).

In accordance with another aspect of the invention, there is provided an isolated polypeptide molecule, wherein except for at least one conservative amino acid substitution said polypeptide has a sequence selected from the group consisting of:

(a) amino acids from about I to about 908 in SEQ ID NO:5;
(b) amino acids from about I to about 859 in SEQ ID NO:6;
(c) amino acids from about I to about 912 in SEQ ID NO:7;
(d) amino acids from about I to about 853 in SEQ ID NO:8;
and (e) a polypeptide sequence at least about 90% identical to the amino acid sequence of (a), (b), (c) or (d).

In accordance with another aspect of the invention, there is provided a method for in vitro de novo methylation of DNA, comprising:

(a) contacting said DNA with an effective amount of a de novo DNA cytosine methyltransferase polypeptide;
(b) providing an appropriately buffered solution with substrate and cofactors; and (c) purifying said DNA.

In accordance with another aspect of the invention, there is provided a method for diagnosing or determining a susceptibility to neoplastic disorders, comprising:
(a) assaying a de novo DNA cytosine methyltransferase expression level in mammalian cells or body fluid; and (b) comparing said de novo DNA cytosine methyltransferase expression level with a standard de novo DNA cytosine methyltransferase expression level whereby an increase or decrease in said de novo DNA cytosine -3d-methyltransferase expression level over said staridard is indicative of an increased or decreased susceptibility to a neoplastic disorder.

In accordance with another aspect of the invention, there is provided an isolated de no vo DNA cytosine methyltransferasepolypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209933.

In accordance with another aspect of the invention, there is provided an isolated de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209934.

In accordance with another aspect of the invention, there is provided an isolated de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence encoded by the. cDNA clone contained in ATCC Deposit No. 98809.

In accordance with another aspect"of the invention, there is provided an isolated de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence encoded by the eDNA clone contained in ATCC Deposit No. 326637.

In accordance with another aspect of the invention, there is provided an isolated de novo DNA cytosine methyltransferase Dnmt3b polypeptide wherein, except for at least one conservative amino acid substitution, said polypeptide has a sequence selected from the group consisting of:

(a) aniino acid residues I to 362 and 383 to 859 from SEQ ID
NO:6; and (b) amino acid residues I to 362 and 383 to 749 and 813 to 859 from SEQ ID NO:6 In accordance with another aspect of the invention, there is provided an isolated de novo DNA cytosine methyltransferase D1TMT3B polypeptide wherein, except for at least one conservative amino acid substitution, said polypeptide has a sequence selected from the group consisting of:

-3e-(a) amino acid residues I to 355 and 376 to 853 from SEQ ID
NO:8; and (b) amino acid residues 1 to 355 and 376 to 743 and 807 to 853 from SEQ ID N0:8 In accordance with another aspect of the invention, there is provided a method of screening for an agonist or antagonist of DNMT3 DNA cytosine methyltransferase activity comprising:

(a) contacting a substrate to a DNMT3 DNA cytosine methyltransferase protein or polypeptide in the presence of a putative agonist or antagonist; and (b) assaying the activity of said agonist or said antagonist by determining at least one of the following:
(i) binding of said agonist or said antagonist to said DNMT3 DNA cytosine methyltransferase protein or polypeptide; and (ii) determining the activity of said to said DNMT3 DNA cytosine methyltransferase protein or polypeptide in the presence of said agonist or said antagonist.

A first aspect of the invention provides novel de novo DNA cytosine methyltransferase nucleic acids and polypeptides that are not available in the art.
A second aspect of the invention relates to de novo DNA cytosine methyltransferase recombinant materials and methods for their production. A
third aspect of the invention relates to the production of recombinant de novo DNA cytosine methyltransferase polypeptides. A fourth aspect of the invention relates to methods for using such de novo DNA cytosine methyltransferase polypeptides and polynucleotides. Such uses include the treatment of neoplastic disorders, among others. Yet another aspect of the invention relates to diagnostic assays for the detection of diseases associated with inappropriate de novo DNA
cytosine methyltransferase activity or levels and mutations in de novo DNA
cytosine methyltransferases that might lead to neoplastic disorders.

Brief Description of the Figures Figure lA-1D shows the nucleotide sequences of mouse Dnmt3a and Dnmt3b and human DNMT3A and DNMT3B genes, respectively.
Figure 2A-2D shows the deduced amino acid sequence of mouse Dnmt3a and Dnmt3b and human DNMT3A and DNMT3B genes, respectively. Sequences are presented in single letter amino acid code.
Figure 3A shows a comparison of mouse Dnmt3a and Dnmt3b amino acid sequences, and Figure 3B presents a comparison oi' the protein sequences of human DNMT3A and DNMT3B1.
Figure 4A presents a schematic comparison of mouse Dnmtl, Dnmt2, Dnmt3a and Dnmt3b protein structures. Figure 4B presents a schematic of the DNMT3A, DNMT3B and zebrafish Zmt3 proteins. Figure 4C and 4D present a schematic of the human DNMT3B gene organization and exon/intron junction sequences.
Figure 5A presents a comparison of highly conserved protein structural motifs for eukaryotic and prokaryotic C5 methyltransferase. Figure 5B presents a sequence alignment of the C-rich domain of vertebrate DNMT3 proteins and the X-lined ATRX gene. Figure 5C presents a non-rooted phylogenic tree of methyltransferase proteins.
Figure 6A-6C demonstrates the expression of Dnmt3a and Dnmt3b in mouse adult tissues, embryos, and ES cells by northern blot.
Figure 7A-7D demonstrates in vitro methyltransferase activities ofmouse Dnmt3a and Dnmt3b proteins.
Figure 8 demonstrates in vitro analysis of de novo and maintenance activities of Dnmt3a, Dnmt3bl and Dnmt3b2 proteins.
Figure 9 presents Northem blot expression analysis of DNMT3A and DNMT3B.
Figure 10 presents DNMT3 Northern Blot expression analysis of DNMT3A and DNMT3B in human tumor cell lines.

Detailed Description of the Preferred Embodiments Definitions In the description that follows, a number of terms used in recombinant DNA technology are utilized extensively. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided.
Cloning vector: A plasmid or phage DNA or other DNA sequence which is able to replicate autonomously in a host cell, and which is characterized by one or a small number ofrestriction endonuclease recognition sites at which such DNA
sequences may be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a DNA fragment may be spliced in order to bring about its replication and cloning. The cloning vector may further contain a marker suitable for use in the identification of cells transformed with the cloning vector. Markers, for example, provide tetracycline resistance or ampicillin resistance.

Expression vector: A vector similar to a cloning vector but which is capable of enhancing the expression of a gene which has been cloned into it, after RECTIFIED SHEET (RULE 91) ISA/EP
transformation into a host. The cloned gene is usually placed under the control of (i.e., operably linked to) certain control sequences such as promoter sequences.
Promoter sequences may be either constitutive or inducible.
Recombinant Host: According to the invention, a recombinant host may be any prokaryotic or eukaryotic host cell which contains the desired cloned genes on an expression vector or cloning vector. This term is also meant to include those prokaryotic or eukaryotic cells that have been genetically engineered to contain the desired gene(s) in the chromosome or genome of that organism. For examples of such hosts, see Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989). Preferred recombinant hosts are eukaryotic cells transformed with the DNA construct ofthe invention. More specifically, mammalian cells are preferred.
Recombinant vector: Any cloning vector or expression vector which contains the desired cloned gene(s).
HostAnimal: Transgenic animals, all of whose germ and somatic cells contain the DNA construct of the invention. Such transgenic animals are in general vertebrates. Preferred Host Animals are mammals such as non-human primates, mice, sheep, pigs, cattle, goats, guinea pigs, rodents, e.g. rats, and the like. The term Host Animal also includes animals in all stages of development, including embryonic and fetal stages.
Promoter: A DNA sequence generally described as the 5' region of a gene, located proximal to the start codon. The transcription of an adjacent gene(s) is initiated at the promoter region. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. According to the invention, preferred promoters are heterologous to the de novo DNA cytosine methyltransferase genes, that is, the promoters do not drive expression of the gene in a mouse or human.
Such promoters include the CMV promoter (InVitrogen, San Diego, CA), the SV40, MMTV, and hMTlIapromoters (U.S. 5,457,034), the HSV-14/5 promoter (U.S. 5,501,979), and the early intermediate HCMV promoter (W092/17581).
In one emdodiment, it is preferred that the promoter is tissue-specific, that is, it is induced selectively in a specific tissue. Also, tissue-specific enhancer elements may be employed. Additionally, such promoters may include tissue and cell-specific promoters of an organism.
Gene: A DNA sequence that contains information needed for expressing a polypeptide or protein.
Structural gene: A DNA sequence that is transcribed into messenger RNA (mRNA) that is then translated into a sequence of amino acids characteristic of a specific polypeptide.
Complementary DNA (cDNA): A "complementary DNA," or "cDNA"
gene includes recombinant genes synthesized by reverse transcription of mRNA
and from which intervening sequences (introns) have been removed.
Expression: Expression is the process by which a polypeptide is produced from a structural gene. The process involves transcription of the gene into mRNA and the translation of such mRNA into polypeptide(s).
Homologous/Nonhomologous: Two nucleic acid molecules are considered to be "homologous" if their nucleotide sequences share a similarity of greater than 40%, as determined by HASH-coding algorithms (Wilber, W.J. and Lipman, D.J., Proc. Natl. Acad. Sci. 80:726-730 (1983)). Two nucleic acid molecules are considered to be "nonhomologous" if their nucleotide sequences share a similarity of less than 40%.

Polynucleotide: This term generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single-and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications have been made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
"Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.
Polypeptide: This term refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent. cross-links, formation of cystine, formation of pyroglutamate, formylatiori, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, Proteins-Structure and Molecular Properties, 2nd Ecl., T. E. Creighton, W. H.
Freeman and Company, New York, 1993 and Wold, F.., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al., "Analysis for protein modifications and nonprotein cofactors", Methods in Enzymol. 182:626-646 (1990) and Rattan et al., "Protein Synthesis: Posttranslational Modifications and Aging", Ann NYAcad Sci 663:48-62 (1992).
Variant: The term used herein is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A
typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
Identity: This term refers to a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity" per- se has an art-recognized meaning and can be calculated using published techniques. (See, e.g.:
Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994;
Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987;
and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity"
is well known to skilled artisans (Carillo, H. & Lipton, D., SIAMJApplied Math 48:1073 (1988)). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988).
Methods to determine identity and similarity are codified in computer programs.
Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al., NucleicAcids Research 12(1):387 (1984)), BLASTP, BLASTN, FASTA
(Atschul, S.F., et al., J Mol. Biol 215:403 (1990)).

Therefore, as used herein, the term "identity" represents a comparison between a test and reference polynucleotide. More specifically, reference polynucleotides are identified in this invention as SEQ ID Nos: 1, 2, 3 and 4, and a test polynucleotide is defined as any polynucleotide that is 90% or more identical to a reference polynucleotide. As used herein, the term "90% or more"
refers to percent identities from 90 to 99.99 relative to the reference polynucleotide. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polynucleotide length of 100 nucleotides, that no more than 10% (i.e., 10 out of 100) nucleotides in the test polynucleotide differ from that of the reference polynucleotide. Such differences may be represented as point mutations randomly distributed over the entire length of the sequence or they may be clustered in one or more locations of varying length up to the maximum allowable 10 nucleotide difference.
Differences are defined as nucleotide substitutions, deletions or additions of sequence. These differences may be located at any position in the sequence, including but not limited to the 5' end, 3' end, coding and non coding sequences.
Fragment: A "fragment" of a molecule such as de novo DNA cytosine methyltransferases is meant to refer to any polypeptide subset of that molecule.
Functional Derivative: The term "functional derivatives" is intended to include the "variants," "analogues," or "chemical derivatives" of the molecule.
A "variant" of a molecule such as de novo DNA cytosine methyltransferases is meant to refer to a naturally occurring molecule substantially similar to either the entire molecule, or a fragment thereof. An "analogue" of a molecule such as de novo DNA cytosine methyltransferases is meant to refer to a non-natural molecule substantially similar to either the entire molecule or a fragment thereof.
A molecule is said to be "substantially similar" to another molecule if the sequence of amino acids in both molecules is substantially the same, and if both molecules possess a similar biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if one of the molecules contains additional amino acid residues not found in the other, or if the sequence of amino acid residues is not identical.
As used herein, a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's solubility, absorption, biological half-life, etc. The moieties may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, etc. Examples of moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980) and will be apparent to those of ordinary skill in the art.
Protein Activity or Biological Activity of the Protein: These expressions refer to the metabolic or physiologic function of de novo DNA cytosine methyltransferase protein including similar activities or improved activities or these activities with decreased undesirable side-effects. Also included are antigenic and immunogenic activities of said de novo DNA cytosine methyltransferase protein. Among the physiological or metabolic activities of said protein is the transfer of a methyl group to the cytosine C5 position of duplex DNA. Such DNA may completely lack any methylation of may be hemimethylated. As demonstrated in Example 8, de novo DNA cytosine methyltransferases methylate C5 in cytosine moieties in nonmethylated DNA.
De novo DNA Cytosine Methyltransferases Polynucleotides: This term refers to a polynucleotide containing a nucleotide sequence which encodes a de novo DNA cytosine methyltransferase polypeptide or fragment thereof or that encodes a de novo DNA cytosine methyltransferase polypeptide or fragment wherein said nucleotide sequence has at least 90% identity to a nucleotide sequence encoding the polypeptide of SEQ ID Nos: 5, 6, 7 or 8, or a corresponding fragment thereof, or which has sufficient identity to a nucleotide sequence contained in SEQ ID NO: 1, 2, 3 or 4.
De novo DNA Cytosine Metltyltransferases Polypeptides: This term refers to polypeptides with amino acid sequences sufficiently similar to the de novo DNA cytosine methyltransferase protein sequence in SEQ ID NO:5, 6, 7 or 8 and that at least one biological activity of the protein is exhibited.

Antibodies: As used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Fab or other immunoglobulin expression library.
Substantially pure: As used herein means that the desired purified protein is essentially free from contaminating cellular components, said components being associated with the desired protein in nature, as evidenced by a single band following polyacrylamide-sodium dodecyl sulfate gel electrophoresis. Contaminating cellular components may include, but are not limited to, proteinaceous, carbohydrate, or lipid impurities.
The term "substantially pure" is further meant to describe a molecule which is homogeneous by one or more purity or homogeneity characteristics used by those of skill in the art. For example, a substantially pure de novo DNA
cytosine methyltransferases will show constant and reproducible characteristics within standard experimental deviations for parameters such as the following:
molecular weight, chromatographic migration, amino acid composition, amino acid sequence, blocked or unblocked N-terminus, HPLC elution profile, biological activity, and other such parameters. The term, however, is not meant to exclude artificial or synthetic mixtures of the factor with other compounds. In addition, the term is not meant to exclude de novo DNA cytosine methyltransferase fusion proteins isolated from a recombinant host.
Isolated: A term meaning altered "by the hand of man" from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein. Thus, a polypeptide or polynucleotide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention. Also intended as an "isolated polypeptide" or an "isolated polynucleotide" are polypeptides or polynucleotides that have been purified, partially or substantially, from a recombinant host cell or from a native source.
For example, a recombinantly produced version of a de novo DNA cytosine methyltransferase polypeptide can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
Neoplastic disorder: This term refers to a disease state which is related to the hyperproliferation of cells. Neoplastic disorders include, but are not limited to, carcinomas, sarcomas and leukemias.
Gene Tlzerapy: A means of therapy directed to altering the normal pattern of gene expression of an organism. Generally, a recombinant polynucleotide is introduced into cells or tissues of the organism to effect a change in gene expression.
Antisense RNA gene/Antisense RNA. In eukaryotes, mRNA is transcribed by RNA polymerase II. However, it is also known that one may construct a gene containing a RNA polymerase II template wherein a RNA
sequence is transcribed which has a sequence complementary to that of a specific mRNA but is not normally translated. Such a gene construct is herein termed an "antisense RNA gene" and such a RNA transcript is termed an "antisense RNA."
Antisense RNAs are not normally translatable due to the presence of translation stop codons in the antisense RNA sequence.
Antisense oligonucleotide: A DNA or RNA molecule or a derivative of a DNA or RNA molecule containing a nucleotide sequence which is complementary to that of a specific mRNA. An antisense oligonucleotide binds to the complementary sequence in a specific mRNA and inhibits translation of the mRNA. There are many known derivatives of such DNA and RNA molecules.
See, for example, U.S. Patent Nos. 5,602,240, 5,596,091, 5,506,212, 5,521,302, 5,541,307, 5,510,476, 5,514,787, 5,543,507, 5,512,438, 5,510,239, 5,514,577, 5,519,134, 5,554,746, 5,276,019, 5,286,717, 5,264,423, as well as W096/35706, W096/32474, W096/29337 (thiono triester modified antisense oligodeoxynucleotide phosphorothioates), W094/17093 (oligonucleotide alkylphosphonates and alkylphosphothioates), W094/08004 (oligonucleotide phosphothioates, methyl phosphates, phosphoramidates, dithioates, bridged pliosphorothioates, bridge phosphoramidates, sulfones, sulfates, ketos, phosphate esters and phosphorobutylamines (van der Krol et al., Biotech. 6:958-976 (1988);
Uhlmann et aL, Chem. Rev. 90:542-585 (1990)), W094/02499 (oligonucleotide alkylphosphonothioates and arylphosphonothioates), and W092/20697 (3'-end capped oligonucleotides). Particular de novo DNA cytosine methyltransferase antisense oligonucleotides ofthe present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press (1989)). S-oligos (nucleoside phosphorothioates) are isoelectronic analogs of an oligonucleotide (0-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom. The S-oligos of the present invention may be prepared by treatment ofthe corresponding 0-oligos with 3h1-1,2-benzodithiol-3-one-1,1-dioxide which is a sulfur transfer reagent. See Iyer et al., J. Org.
Chem.
55:4693-4698 (1990); and Iyer et al., J. Am. Chem. Soc. 112:1253-1254 (1990).
Antisense Tl:erapy: A method of treatment wherein. antisense oligonucleotides are adniinistered to a patient in order to inhibit the expression of the corresponding protein.

L Deposited Material The invention relates to polynucleotides encoding and polypeptides of novel de novo DNA cytosine methyltransferase proteins. The invention relates especially to de novo DNA cytosine methyltransferase mouse Dnmt3a and Dnmt3b cDNAs and the human DNMT3A and DNMT3B cDNAs set out in SEQ
ID NOs: l. 2, 3 and 4, respectively. The invention also relates to mouse Dnmt3a and Dnint3b and human DNMT3A and DNMTB de novo DNA cytosine methyltransferase polypeptides set out in SEQ ID NOs:5, 6, 7, and 8, respectively:

The invention further relates to the de novo DNA cytosine methyltransferase -nucleotide sequences ofthe,mouse Dnmt3a cDNA (plastnid pMT3a) and Dnmt3b cDNA (plasmid pMT3b) and the human DNMTa cDNA (plasmid pMT3A) in ATCC Deposit Nos.209933, 209934, and 98809, respectively, and the amino acid sequences encoded therein. ' The nucleotide sequence of the human DNMT3B cDNA identified in SEQ

ID NO:4 is available in a clone (ATCC Deposit No. 326637) independently deposited by the I.M.A.G.E. Consortium. The invention relates to the de novo DNA cytosine methyltransferase polypeptide encoded therein.
Clones containing mouse Dnmt3a and Dnmt3b cDNAs were deposited with the American Type Culture Collection (ATCC), Manassas, Virginia 20110-2209, USA, on June 16, 1998, and assigned ATCC Deposit Nos. 209933 and 209934, respectively. The human DNMT3A cDNA was deposited witll the ATCC on July 10, 1998, and assigned ATCC Deposit No. 98809.
While the ATCC deposits are believed to contain the de novo DNA
cytosine methyltransferase cDNA sequences shown in SEQ ID NOs: 1, 2, 3, and 4, the nucleotide sequences of the polynucleotide contained in the deposited material, as well as the amino acid sequence of the polypeptide encoded thereby, are controlling in the event of any conflict with any description of sequences herein.
The deposits for mouse Dnmt3a and Dnmt3b cDNAs and the human DNMT3A cDNA were made under the terms of the Budapest Treaty on the international recognition of the deposit ofmicro-organisms for purposes of patent procedure. The deposits are provided merely as a convenience for those of skill in the art and are not an admission that a deposit is required for enablement.

II. Polynucleotides of the Invention Another aspect o,f the invention relates to isolated polynucleotides, and polynucleotides closely related thereto, which encode the de novo DNA cytosine methyltransferase polypeptides. As shown by the results presented in Figure 5, sequencing of the cDNAs contained in the deposited clones encoding mouse and human de novo DNA cytosine methyltransferases confirms that the de novo DNA
cytosine methyltransferase proteins of the invention are structurally related to other proteins of the DNA methyltransferase family.
The polynucleotides of the present invention encoding de novo DNA
cytosine methyltransferase proteins may be obtained using standard cloning and screening procedures as described in Example 1. Polynucleotides ofthe invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
Among particularly preferred embodiments of the invention are polynucleotides encoding de novo DNA cytosine methyltransferase polypeptides having the amino acid sequence set out in SEQ ID NO:5, SEQ ID NO:6, SEQ ID
NO:7, or SEQ ID NO:8, and variants thereof.
A particular nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide may be identical over its entire length to the coding sequence in SEQ ID NOs:l, 2, or 3. Alternatively, a particular nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide may be an alternate form of SEQ ID NOs: 1, 2, 3 and 4 due to degeneracy in the genetic code or variation in codon usage encoding the polypeptides of SEQ ID
NOs:5, 6, 7. or 8. Preferably, the polynucleotides of the invention contain a nucleotide sequence that is highly identical, at least 90% identical, with a nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide or at least 90% identical with the encoding nucleotide sequence set forth in SEQ ID NOs:l, 2, or 3. Polynucleotides of the invention may be 90 to 99% identical to the nucleotides sequence set forth in SEQ ID NO:4.
When a polynucleotide of the invention is used for the recombinant production of a de novo DNA cytosine methyltransferase polypeptide, the polynucleotide may include the coding sequence for the full-length polypeptide or a fragment thereof, by itself; the coding sequence for the full-length polypeptide or fragment in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro or prepro-protein sequence, or other fusion peptide portions. For example, a marker sequence that facilitates purification of the fused polypeptide can be encoded. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al., Proc Natl Acad Sci USA 86:821-824 (1989), or it may be the HA
tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell 37:767, 1984). The polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated.
sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
Embodiments of the invention include isolated nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90%
identical, and more preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
identical to (a) a nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence in SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7; (b) a nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209933, ATCC
Deposit No. 209934, or ATCC Deposit No. 98809; or (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b). Additionally, an isolated nucleic acid of the invention may be a polynucleotide at least 90%
but not more than 99% identical to (a) a nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence in SEQ ID NO:4; (b) a nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.326637; or (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b).

Conventional means utilizing known computer programs such as the BestFit program (Wisconsin Sequence Analysis Package, Version 10 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) may be utilized to determine if a particular nucleic acid molecule is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
identical to any one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID
NO:2, SEQ ID NO:3, or SEQ ID NO:4 or to any one of the nucleotide sequences of the deposited cDNA clones contained in ATCC Deposit No. 209933, ATCC
Deposit No. 209934, ATCC Deposit No. 98809, or ATCC Deposit No. 326637.
Further preferred embodiments are polynucleotides encoding de novo DNA cytosine methyltransferases and de novo DNA cytosine methyltransferase variants that have an amino acid sequence of the de novo DNA cytosine methyltransferase protein of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ
ID NO:8 in which several, 1, 1-2, 1-3, 1-5 or 5-10 amino acid residues are substituted, deleted or added, in any combination.
Further preferred embodiments of the invention are polynucleotides that are at least 90% identical over their entire length to a polynucleotide encoding a de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence set out in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID
NO:8, and polynucleotides which are complementary to such polynucleotides.
Most highly preferred are polynucleotides that comprise regions that are at least 90% identical over their entire length to a polynucleotide encoding the de novo DNA cytosine methyltransferase polypeptides of the ATCC deposited human DNMT3A cDNA clone and polynucleotides complementary thereto, and 90% to 99% identical over their entire length to a polynucleotide encoding the de novo DNA cytosine methyltransferase polypeptides of the ATCC deposited human DNMT3B cDNA clone and polynucleotides complementary thereto. In this regard, polynucleotides at least 95% identical over their entire length to the same are particularly preferred, and those with at least 97% identity are especially preferred. Furthermore, those with at least 98% identity are highly preferred and with at least 99% identity being the most preferred.

In a more specific embodiment, the nucleic acid molecules of the present invention, e.g., isolated nucleic acids comprising a polynucleotide having a nucleotide sequence encoding a de novo DNA cytosine methyltransferase polypeptide or fragment thereof, are not the sequence of nucleotides, the nucleic acid molecules (e.g., clones), or the nucleic acid inserts identified in one or more of the below cited public EST or STS GenBank Accession Reports.
The following public ESTs were identified that relate to portions of SEQ
ID NO:1: AA052791(SEQ ID NO:9); AA111043(SEQ ID NO:10);
AA154890(SEQ ID NO:11); AA240794(SEQ ID NO:12); AA756653(SEQ ID
NO:13); W58898(SEQ ID NO:14); W59299(SEQ ID NO:15); W91664(SEQ ID
NO:16); W91665(SEQ ID NO: 17); to portions of SEQ IDNO:2: AA116694 (SEQ
ID NO:18); AA119979 (SEQ ID NO:19); AA177277 (SEQ ID NO:20);
AA210568 (SEQ ID NO:21); AA399749 (SEQ ID NO:22); AA407106 (SEQ ID
NO:23); AA575617 (SEQ ID NO:24); to portions of SEQ ID NO:3: AA004310 (SEQ ID NO:25); AA004399 (SEQ ID NO:26); AA312013 (SEQ ID NO:27);
AA355824 (SEQ ID NO:28); AA533619 (SEQ ID NO:29); AA361360 (SEQ ID
NO:30); AA364876 (SEQ ID NO:3 1); AA503090 (SEQ ID NO:32); AA533619 (SEQ ID NO:33); AA706672 (SEQ ID NO:34); AA774277 (SEQ ID NO:35);
AA780277 (SEQ ID NO:36); H03349 (SEQ ID NO:37); H04031 (SEQ ID
NO:38); H53133 (SEQ ID NO:39); H53239 (SEQ ID NO:40); H64669 (SEQ ID
NO:41); N26002 (SEQ ID NO:42); N52936 (SEQ ID NO:43); N88352 (SEQ ID
NO:44); N89594 (SEQ ID NO:45); R19795 (SEQ ID NO:46); R47511 (SEQ ID
NO:47); T50235 (SEQ ID NO:48); T78023 (SEQ ID NO:49); T78186 (SEQ ID
NO:50); W22886 (SEQ ID NO:5 1); W67657 (SEQ ID NO:52); W68094 (SEQ ID
NO:53); W76111 (SEQ ID NO:54); Z38299 (SEQ ID NO:55); Z42012 (SEQ ID
NO:56); and that relate to SEQ ID NO:4: AA206103(SEQ ID NO:57);
AA206264(SEQ ID NO:58); AA216527(SEQ ID NO:59); AA216697(SEQ ID
NO:60); AA305044(SEQ ID NO:61); AA477705(SEQ ID NO:62);
AA477706(SEQ ID NO:63); AA565566(SEQ ID NO:64); AA599893(SEQ ID
NO:65); AA729418(SEQ ID NO:66); AA887508(SEQ ID NO:67); F09856(SEQ
ID NO:68); F12227(SEQ ID NO:69); N39452(SEQ ID NO:70); N48564(SEQ ID
NO:71); T66304(SEQ ID NO:72); and T66356(SEQ ID NO:73); AA736582(SEQ
RECTIFIED SHEET (RULE 91) ISA/EP
ID NO:77); AA748883(SEQ ID NO:78); AA923295(SEQ ID NO:79);
AAI000396(SEQ ID NO:80); A1332472(SEQ ID NO:81); W22473(SEQ ID
NO:82) and the I.M.A.G.E. Consortium clone ID 22089 (ATCC Deposit No.
326637)(SEQ ID NO:76). Additionally, STSs G06200(SEQ ID NO:74) and G15302(SEQ ID NO:75) were identified in a search with SEQ ID NOS.:3 and 4, respectively.
The present invention is further directed to fragments of SEQ ID NO: 1, 2 or 3, or to fragrnents of the cDNA nucleotide sequence found in ATCC Deposit Nos. 209933, 209934, or 98809. A fragment may be defined to be at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length. Such fragments are useful as diagnostic probes and primers as discussed herein. Ofcourse larger DNA
fragments are also useful according to the present invention, as are fragments corresponding to most, if not all, of the nucleotide sequence of the cDNA
clones contained in the plasmids deposited as ATCC DepositNo. 209933, ATCC Deposit No. 209934 or ATCC Deposit No. 98809,or as shown in SEQ ID NO:1, SEQ ID
NO:2, or SEQ ID NO:3. Generally, polynucleotide fragments of the invention may be defined algebraically in the following way: (a) for SEQ ID NO:1, as 15 + N, wherein N equals zero or any positive integer up to 4176; (b) for SEQ ID NO:2, as 15 + N, wherein N equals zero or any positive integer up to 4180; and (c) for SEQ ID NO:3, as 15 + N, wherein N equals zero or any positive integer up to 4401. By a fragment at least 20 nt in length, for example, is intended fragments which include 20 or more contiguous bases from a nucleotide sequence of the ATCC deposited cDNAs or the nucleotide sequence as shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.
In another embodiment, the invention is directed to fragments of SEQ ID
NO:4. Such fragments are defined as comprising the nucleotide sequence encoding the specific amino acid residues integral and immediately adj acent to the site where DNMT3B exons are spliced together. The DNMT3B sequence of SEQ ID NO:4 consists of 23 exon sequences defined accordingly: Exon 1 consists RECTIFIED SHEET (RULE 91) ISA/EP
of nucleotides 1-108 of SEQ ID NO:4; Exon 2 consists of nucleotides 109-256 of SEQ ID NO:4; Exon 3 consists of nucleotides 257-318 of SEQ ID NO:4;
Exon 4 consists of nucleotides 319-420 of SEQ ID NO:4; Exon 5 consists of nucleotides 421-546 of SEQ ID NO:4; Exon 6 consists of nucleotides 547-768 of SEQ ID NO:4; Exon 7 consists of nucleotides 769-927 of SEQ ID NO:4; Exon 8 consists of nucleotides 928-1035 of SEQ ID NO:4; Exon 9 consists of nucleotides 1036-1180 of SEQ ID NO:4; Exon 10 consists of nucleotides 1181-1240 of SEQ ID NO:4; Exon I 1 consists of nucleotides 1241-1366 of SEQ ID
NO:4; Exon 12 consists of nucleotides 1367-1411 of' SEQ ID NO:4; Exon 13 consists of nucleotide 1412-1491 of SEQ ID NO:4; Exon 14 consists of nucleotides 1492-1604 of SEQ ID NO:4; Exon 15 consists of nucleotides 1605-1788 of SEQ ID NO:4; Exon 16 consists of nucleotides 1789-1873 of SEQ ID
NO:4; Exon 17 consists of nucleotides 1874-2019 of SEQ ID NO:4; Exon 18 consists of nucleotides 2020-2110 of SEQ ID NO:4; Exon 19 consists of nucleotides 2111-2259 of SEQ ID NO:4; Exon 20 consists of nucleotides 2260-2345 of SEQ ID NO:4; Exon 21 consists of nucleotides 2346-2415 of SEQ ID
NO:4; Exon 22 consists of nucleotides 2416-2534 of SEQ ID NO:4; and Exon 23 consists of nucleotides 2535-4145 of SEQ ID NO:4.
It should be understood by those skilled in the art that with regards to SEQ
ID NO:4, Exon I and Exon 23 are herein defined for the purposes of the invention. The first nucleotide of Exon 1 may or may not be the transcriptional start site for the DNMT3B genomic locus, and the last nucleotide identified for Exon 23 may or may not reflect the last nucleotide transcribed in vivo.
Thus, by way of example, fragments of SEQ ID NO:4 comprise the following exon-exon junctions of 20 nucleotides in length: the exonl/exon 2 junction of nucleotides 98-118 of SEQ ID NO:4; the exon 2/exon 3 junction of nucleotides 246-266 of SEQ ID NO:4; the exon 3/exon 4 junction of nucleotides 308-328 of SEQ ID NO:4; the exon 4/exon 5 junction of nucleotides 410-430 of SEQ ID NO:4; the exon 5/exon 6 junction of nucleotides 536-556 of SEQ ID
NO:4; the exon 6/exon 7 junction of nucleotides 758-778 of SEQ ID NO:4; the exon 7/exon 8 junction of nucleotides 917-937 of SEQ ID NO:4; the exon 8/exon 9 junction of nucleotides 1025-1045 of SEQ ID NO:4; the exon 9/exon 10 junction of nucleotides 1170-1190 of SEQ ID NO:4; the exon 10/exon 11 junction of nucleotides 1230-1250 of SEQ ID NO:4; the exon 11/exon 12 junction of nucleotides 1356-1376 of SEQ ID NO:4; the exon 12/exon 13 junction of nucleotides 1401-1421 of SEQ ID NO:4; the exon 13/exon 14 junction of nucleotides 1481-1501 of SEQ ID NO:4; the exon 14/exon 15 junction of nucleotides 1594-1614 of SEQ ID NO:4; the exon 15/exon 16 junction of nucleotides 1778-1798 of SEQ ID NO:4; the exon 16/exon 17 junction of nucleotides 1863-1883 of SEQ ID NO:4; the exon 17/exon 18 junction of nucleotides 2009-2029 of SEQ ID NO:4; the exon 18/exon 19 junction of nucleotides 2100-2120 of SEQ ID NO:4; the exon 19/exon 20 junction of nucleotides 2249-2269 of SEQ ID NO:4; the exon 20/exon 21 junction of nucleotides 2335-2355 of SEQ ID NO:4; the exon 21/exon 22 junction of nucleotides 2405-2425 of SEQ ID NO:4; and the exon 22/exon 23 junction of nucleotides 2524-2544 of SEQ ID NO:4.
As will be clear to those skilled in the art, other exon-exon junction fragments of SEQ ID NO:4 are possible which comprise 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, etc., nucleotides of SEQ II) NO:4. For the purposes of constructing such fragments, the following exon-exonjunctions are identified:
the exon 1/exon 2 junction of nucleotides 108 and 109 of SEQ ID NO:4; the exon 2/exon 3 junction of nucleotides 256 and 257 of SEQ ID NO:4; the exon 3/exon 4 junction of nucleotides 318 and 319 of SEQ ID NO:4; the exon 4/exon 5 junction of nucleotides 420 and 421 of SEQ ID NO:4; the exon 5/exon 6 junction of nucleotides 546 and 547 of SEQ ID NO:4; the exon 6/exon 7 junction of nucleotides 768 and 769 of SEQ ID NO:4; the exon 7/exon 8 junction of nucleotides 927 and 928 of SEQ ID NO:4; the exon 8/exon 9 junction of nucleotides 1035 and 1036 of SEQ ID NO:4; the exon 9/exon 10 junction of nucleotides 1180 and 1181 of SEQ ID NO:4; the exon 10/exon 11 junction of nucleotides 1240 and 1241 of SEQ ID NO:4; the exon 11 /exon 12 junction of nucleotides 1366 and 1367 of SEQ ID NO:4; the exon 12/exon 13 junction of nucleotides 1411 and 1412 of SEQ ID NO:4; the exon 13/exon 14 junction of nucleotides 1491 and 1492 of SEQ ID NO:4; the exon 14/exon 15 junction of nucleotides 1604 and 1605 of SEQ ID NO:4; the exon 15/exon 16 junction of nucleotides 1788 and 1789 of SEQ ID NO:4; the exon 16/exon 17 junction of nucleotides 1873 and 1874 of SEQ ID NO:4; the exon 17/exon 18 junction of nucleotides 2019 and 2020 of SEQ ID NO:4; the exon 18/exon 19 junction of nucleotides 2110 and 2111 of SEQ ID NO:4; the exon 19/exon 20 junction of nucleotides 2259 and 2260 of SEQ ID NO:4; the exon 20/exon 21 junction of nucleotides 2345 and 2346 of SEQ ID NO:4; the exon 21/exon 22 junction of nucleotides 2415 and 2416 of SEQ ID NO:4; and the exon 22/exon 23 junction of nucleotides 2534 and 2535 of SEQ ID NO:4. Junction nucleotides may be located at any position of the selected SEQ ID NO:4 fragment.
The present invention further relates to polynucleotides that hybridize to the above-described sequences. In this regard, the present invention especially relates to polynucleotides that hybridize under stringent conditions to the above-described polynucleotides. As herein used, the term "stringent conditions"
means hybridization will occur only if there is at least 90% and preferably at least 95%
identity and more preferably at least 97% identity between the sequences.
Furthermore, a major consideration associated with hybridization analysis of DNA or RNA sequences is the degree of relatedness the probe has with the sequences present in the specimen under study. This is important with a blotting technique (e.g., Southern or Northern Blot), since a moderate degree of sequence homology under nonstringent conditions of hybridization can yield a strong signal even though the probe and sequences in the sample represent non-homologous genes.

The particular hybridization technique is not essential to the invention, any technique commonly used in the art is within the scope of the present invention. Typical probe technology is described in United States Patent 4,358,535 to Falkow et al. e For example, hybridization can be carried out in a solution containing 6 x SSC (10 x SSC:
1.5 M sodium chloride, 0.15 M sodium citrate, pH 7.0). 5 x Denhardt's (1 x Denhardt's: 0.2% bovine serum albumin, 0.2% polyvinylpyrrolidone, 0.02%
Ficoll 400), 10 mM EDTA, 0.5% SDS and about l 0' cpm of nick-translated DNA

for 16 hours at 65 C. Additionally, if hybridization is to an immobilized nucleic acid, a washing step may be utilized wherein probe binding to polynucleotides of low homology, or nonspecific binding of the probe, may be removed. For example, a stringent wash step may invol ve a buffer of 0.2 x SSC and 0.5% SDS
at a temperature of 65 C.
Additional information related to hybridization technology and, more particularly, the stringency ofhybridization and washing conditions may be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989), Polynucleotides of the invention which are sufficiently identical to a nucleotide sequences contained in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4, or in the cDNA inserts of ATCC Deposit No. 209933, ATCC
Deposit No. 209934, ATCC Deposit No. 98809 or ATCC Deposit No. 326637, may be used as hybridization probes for cDNA and genomic DNA, to isolate full-length cDNAs and genomic clones encoding de novo DNA cytosine methyltransferase proteins and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the de novo DNA cytosine methyltransferase genes. Such hybridization techniques are known to those of skill in the art. Typically, these nucleotide sequences are at least about 90%
identical, preferably at least about 95% identical, more preferably at least about 97%, 98% or 99% identical to that of the reference. The probes generally will comprise at least 15 nucleotides. Preferably, such probes will have at least nucleotides and may have at least 50 nucleotides. Particularly preferred probes will range between 30 and 50 nucleotides.
The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to animal and human disease.

III. Vectors, Host Cells, and Recombinant Expression The present invention also relates to vectors that comprise a polynucleotide of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the invention.
For recombinant production, host cells can be genetically engineered to incorporate expression systems for polynucleotides of the invention.
Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Sambrook et al., Molecular Cloning:
A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). For example, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, infection or any other means known in the art may be utilized.
Representative examples of appropriate hosts include bacterial cells, such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells;
fungal cells, such as yeast cells and Aspergillus cells; inse_L cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells; and plant cells.
A great variety of expression systems can be used. Such systems include, among others, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophages, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses, and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide in a host may be used. The appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., Molecular Cloning: A Laboratory Manual (supra).
RNA vectors may also be utilized for the expression of the de novo DNA
cytosine methyltransferases disclosed in this invention. These vectors are based on positive or negative strand RNA viruses that naturally replicate in a wide variety of eukaryotic cells (Bredenbeek, P.J. and Rice, C.M., Virology 3: 297-310, (1992)). Unlike retroviruses, these viruses lack an intermediate DNA life-cycle phase, existing entirely in RNA form. For example, alpha viruses are used as expression vectors for foreign proteins because they can be utilized in a broad range of host cells and provide a high level of expression; examples of viruses of this type include the Sindbis virus and Semliki Forest virus (Schlesinger, S., TIBTECH 11: 18-22, (1993); Frolov, I., et al., Proc. Natl. Acad. Sci. (USA) 93:
11371-11377, (1996)). As exemplified by Invitrogen's Sinbis expression system, the investigator may conveniently maintain the recombinant molecule in DNA
form (pSinrep5 plasmid) in the laboratory, but propagation in RNA form is feasible as well. In the host cell used for expression, the vector containing the gene of interest exists completely in RNA form and may be continuously propagated in that state if desired.
For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment appropriate secretion signals may be incorporated into the desired polypeptide.
These signals may be endogenous to the polypeptide or they may be heterologous signals.
As used herein, the term "operably linked," when used in the context of a linkage between a structural gene and an expression control sequence, e.g., a promoter, refers to the position and orientation of the expression control sequence relative to the structural gene so as to permit expression of the structural gene in any host cell. For example, an operable linkage would maintain proper reading frame and would not introduce any in frame stop codons.
As used herein, the term "heterologous promoter," refers to a promoter not normally and naturally associated with the structural gene to be expressed.
For example, in the context of expression of a de novo DNA cytosine methyltransferase polypeptide, a heterologous promoter would be any promoter other than an endogenous promoter associated with the de novo DNA cytosine methyltransferase gene in non-recombinant mouse or human chromosomes. In specific embodiments of this invention, the heterologous promoter is a prokaryotic or bacteriophage promoter, such as the lac promoter, T3 promoter, or T7 promoter. In other embodiments, the heterologous promoter is a eukaryotic promoter.
In other embodiments, this invention provides an isolated nucleic acid molecule comprising a de novo DNA cytosine methyltransferase structural gene operably linked to a heterologous promoter. As used herein, the term "a de novo DNA cytosine methyltransferase structural gene" refers to a nucleotide sequence at least about 90% identical to one of the following nucleotide sequences:

(a) a nucleotide sequence encoding the de novo DNA cytosine methyltransferase polypeptide having the complete amino acid sequence in SEQ
ID N0:5, SEQ ID NO:6, or SEQ ID NO:7;

(b) a nucleotide sequence encoding the de novo DNA cytosine methyltransferase polypeptide having the complete amino acid sequence encoded by the cDNA insert of ATCC Deposit No. 209933, ATCC Deposit No. 209934, or ATCC Deposit No. 98809; or (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b).
In preferred embodiments, the de novo DNA cytosine methyltransferase structural gene is 90%, and more preferably 91%, 92%, 93%, 94%, 95%, 97%, 98%, 99%, or 100% identical to one or more of nucleotide sequences (a), (b), or (c) supra.
In another embodiment the term "a de novo DNA cytosine methyltransferase structural gene" refers to a nucleotide sequence about 90%
to 99% identical to one of the following nucleotide sequences:
(a) a nucleotide sequence encoding the de novo DNA cytosine methyltransferase polypeptide having the complete amino acid sequence in SEQ
ID NO:8;
(b) a nucleotide sequence encoding the de novo DNA cytosine methyltransferase polypeptide having the complete amino acid sequence encoded by the cDNA insert of ATCC Deposit No. 326637; or (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b).
In preferred embodiments, the de novo DNA cytosine methyltransferase structural gene is 90%, and more preferably 91%, 92%, 93%, 94%, 95%, 97%, 98%, or 99% identical to SEQ ID NO:8, ATCC Deposit No. 326637 or polynucleotides complementary thereto.
This invention also provides an isolated nucleic acid molecule comprising a de novo DNA cytosine methyltransferase structural gene operably linked to a heterologous promoter, wherein said isolated nucleic acid molecule does not encode a fusion protein comprising the de novo DNA cytosine methyltransferase structural gene or a fragment thereof.
This invention further provides an isolated nucleic acid molecule comprising a de novo DNA cytosine methyltransferase structural gene operably linked to a heterologous promoter, wherein said isolated nucleic acid molecule is capable of expressing a de novo DNA cytosine methyltransferase polypeptide when used to transform an appropriate host cell.
This invention also provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence encoding a de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, wherein said isolated nucleic acid molecule does not contain a nucleotide sequence at least 90% identical to the 3' untranslated region of SEQ ID NO:1 (nucleotides 2942-4191), SEQ ID NO:2 (nucleotides 2847-4174), SEQ ID NO:3 (nucleotides 3090-4397) or SEQ ID NO:4 (nucleotides 2677-4127), or a fragment of the 3' untranslated region greater than 25, 50, 75, 100, or 125 bp in length.
This invention further provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 90%, 91%.
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence encoding a de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID
NO:8, wherein said isolated nucleic acid molecule does not contain a nucleotide sequence at least 90% identical to the 5' untranslated region of SEQ ID NO:1 (nucleotides 1-216), SEQ ID NO:2 (nucleotides 1-268), SEQ ID NO:3 (nucleotides 1-352) or SEQ ID NO:4 (nucleotides 1-114), or a fragment of the 5' untranslated region greater than 25, 35, 45, 55, 65, 75, 85, or 90 bp.
Suitable known prokaryotic promoters for use in the production of proteins of the present invention include the E. coli lacl and lacZ promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR and PL promoters and the trp promoter. Suitable eukaryotic promoters include the CMV immediate earl}r promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous Sarcoma Virus (RSV), adenovirus promoter, Herpes virus promoter, and metallothionein promoters, such as the mouse metallothionein-I promoter and tissue and organ-specific promoters known in the art.
If the de novo DNA cytosine methyltransferase polypeptide is to be expressed for use in screening assays, generally, it is preferred that the polypeptide be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. If de novo DNA cytosine methyltransferase polypeptide is secreted into the medium, the medium can be recovered in order to recover and purify the polypeptide; if produced intracellularly, the cells must first be lysed before the polypeptide is recovered.
De novo DNA cytosine methyltransferase polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.

IV. Polypeptides of the Invention The de novo DNA cytosine methyltransferase polypeptides of the present invention include the polypeptide of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, as well as polypeptides and fragments which have activity and have at least 90% identity to the polypeptide of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, or the relevant portion and more preferably at least 96%. 97% or 98% identity to the polypeptide of SEQ ID NO:5, SEQ ID
NO:6, SEQ ID NO:7 or SEQ ID NO:8, and still more preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polypeptide of SEQ ID NO:5. SEQ ID NO:6. SEQ ID NO:7 or SEQ ID NO:8.
The polypeptides of the present invention are preferably provided in an isolated form.

The polypeptides ofthe present invention include the polypeptide encoded by the deposited cDNAs; a polypeptide comprising amino acids from about I to about 908 in SEQ ID NO:5; a polypeptide comprising amino acids from about I
to about 859 in SEQ ID NO:6; a polypeptide comprising amino acids from about I to about 912 in SEQ ID NO:7 and a polypeptide comprising amino acids from about I to about 853 in SEQ ID NO:8; as well as polypeptides which are at least about 90% identical, and more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%; 99%, or 100% identical to the polypeptides described above and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
Polypeptides of the invention also include alternative splicing variants of the Dnmt3 sequences disclosed herein. For example, alternative variant spliced proteins of mouse Dnmt3 b include but are not limited to a polypeptide wherein, except for at least one conservative amino acid substitution, said polypeptide has a sequence selected from the group consisting of: (1) amino acid residues l to and 383 to 859 from SEQ ID NO:6; and (2) amino acid residues I to 362 and 383 to 749 and 813 to 859 from SEQ ID NO:6; and alternative variant splicedproteins of hunian DNMT3B include but are not limited to a polypeptide wherein, except for at least one conservative amino acid substitution, said polypeptide has a sequence selected from the group consisting of: (1) amino acid residues l to and 376 to 853 from SEQ ID NO:8; and (2) amino acid residues 1 to 355 and 376 to 743 and 807 to 853 from SEQ ID NO:8.

The de novo DNA cytosine methyltransferase polypeptides may be a part of a larger protein such as a fusion protein. It is often advantageous to include additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or additional sequence for stability during recombinant production.
Biologically active fragments of the de novo DNA cytosine methyltransferase polypeptides are also included in the invention. A fragment is a polypeptide having an amino acid sequence that entirely is the same as part but not all of the amino acid sequence of one of the aforementioned de novo DNA
cytosine methyltransferase polypeptides. As with de novo DNA cytosine methyltransferase polypeptides, fragments may be "free-standing," or comprised within a larger polypeptide of which they form a part or region, most preferably as a single continuous region. In the context of this invention, a fragment may constitute from about 10 contiguous amino acids identified in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. More specifically, polypeptide fragment lengths may be defined algebraically as follows: (a) for SEQ ID NO:5, as 10 + N, wherein N equals zero or any positive integer up to 898; (b) for SEQ
ID NO:6, as 10 + N, wherein N equals zero or any positive integer up to 849;
(c) for SEQ ID NO:7, as 10 + N, wherein N equals zero or any positive integer up to 902; and (d) for SEQ ID NO:8, as 10 + N, wherein N equals zero or any positive integer up to 843.
Preferred fragments include, for example, truncation polypeptides having the amino acid sequence of de novo DNA cytosine methyltransferase polypeptides, except for deletion of a continuous series of residues that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or deletion of two continuous series ofresidues, one including the amino terminus and one including the carboxyl terminus. Also preferred are fragments characterized by structural or functional attributes such as fragments that comprise alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions. Biologically active fragments are those that mediate protein activity, including those witli a similar activity or an improved activity, or with a decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal, especially in a human.
Thus, the polypeptides of the invention include polypeptides having an amino acid sequence at least 90% identical to that of SEQ ID NO:5, SEQ ID
NO:6, SEQ ID NO:7 or SEQ ID NO:8, or fragments thereof with at least 90%
identity to the corresponding fragment of SEQ ID NO:5, SEQ ID NO:6, SEQ ID
NO:7 or SEQ ID NO:8, all of which retain the biological activity of the de novo DNA cytosine methyltransferase protein, including antigenic activity. Included in this group are variants of the defined sequence and fragment. Preferred variants are those that vary from the reference by conservative amino acid substitutions, i.e., those that substitute a residue with another of like characteristics. Typical substitutions are among Ala, Val, Leu and Ile; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gln; and among the basic residues Lys and Arg, or aromatic residues Phe and Tyr. Particularly preferred are variants in which several, 5 to 10, 1 to 5, or I to 2 amino acids are substituted, deleted, or added in any combination.
The de novo DNA cytosine methyltransferase polypeptides of the invention can be prepared in any suitable manner. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.

V. In Vitro DNA Metl:ylation One preferred embodiment of the invention enables the in vitro methylation at the C5 position of cytosine in DNA. The starting substrate DNA
may be hemimethylated (i.e., one strand of the duplex DNA is methylated) or may lack methylation completely. The polypeptides of the invention, being de novo DNA cytosine methyltransferases. are uniquely suited to the latter function, owing to the fact that, unlike maintenance methyltransferases, their preferred substrate is not hemimethylated DNA.
As exemplified in Examples 7 and 8, isolated polypeptides of the invention function as in vitro DNA methyltransferases when combined in an appropriately buffered solution with the appropriate cofactors and a substrate DNA. The substrate DNA may be selected from any natural source, e.g., genomic DNA, or a recombinant source such as a DNA fragment amplified by the polymerase chain reaction. The substrate DNA may be prokaryotic or eukaryotic DNA. In a preferred embodiment, the substrate DNA is mammalian DNA, and most preferredly, the substrate DNA is human DNA.
It will be well appreciated by those in the art that in vitro methylation of DNA may be used to direct or regulate the expression of said DNA in a biological system. For example, over-expression, under-expression or lack of expression of a particular native DNA sequence in a host cell or organism may be attributed to the fact that the DNA is under-methylated (hypomethylated) or not methylated.
Thus, in vitro methylation of a recombinant form of said DNA, and the subsequent introduction of the methylated, recombinant DNA into the cell or organism, may effect an increase or decrease in the expression of the encoded polypeptide.
Also, it will be readily apparent to the skilled artisan that the in vitro methylation pattern will be maintained after introduction into a biological system by the action of maintenance methyltransferase polypeptides in said system.

In one embodiment of the invention, the biological system selected for the introduction of in vitro methylated DNA may be prokaryotic or eukaryotic. In a preferred embodiment, the biological system is mammalian, and the most preferred embodiment is when the biological system is human.
Methods for introducing the in vitro methylated DNA into the biological system are well known in the art, and the skilled artisan will recognize that the in vitro methylation of DNA may be a preliminary step to any system of gene therapy detailed herein.
VI. Genetic Screening and Diagnostic Assays To map the human chromosome locations, the GenBank STS database was searched using Dnmt3a and Dnmt3b sequences as queries. The search identified markers WI-6283 (GenBank Accession number G06200) and SHGC-15969 (GenBank Accession number G15302) as matching the cDNA sequence of Dnmt3a and Dnmt3b, respectively. WI-6283 has been mapped to 2p23 between D2S 171 and D2S 174 (48-50 cM) on the radiation hybrid map by Whitehead Institute/MIT Center for Genome Research. The corresponding mouse chromosome location is at 4.0 cM on chromosome 12. SHGC-15969 has been mapped to 20pl 1.2 between D20S184 and D20S106 (48-50 cM) by Stanford Human Genome Center. The corresponding mouse chromosome locus is at 84.0 cM on chromosome 2.
These data are valuable as markers to be correlated with genetic map data.
Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins, University Welch Medical Library).
The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritence of physically adjacent genes).
The differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
This invention also relates to the use of de novo DNA cytosine methyltransferase polynucleotides for use as diagnostic reagents. Detection of a mutated form of a de novo DNA cytosine methyltransferase gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of the mutated de novo DNA cytosine methyltransferase. Individuals canying mutations in one or more de novo DNA
cytosine methyltransferase genes may be detected at the DNA level by a variety of techniques.
Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis. RNA or cDNA
may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified DNA to labeled de novo DNA cytosine methyltransferase nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence differences may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (see, e.g., Myers, et al., Science 230:1242 (1985)). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (see Cotton, et al., Proc. Natl. Acad. Sci. USA
85:4397-4401 (1985)).
The diagnostic assays offer a process for diagnosing or determining a susceptibility to neoplastic disorders through detection of mutations in one or more de novo DNA cytosine methyltransferase genes by the methods described.
In addition, neoplastic disorders may be diagnosed by methods that determine an abnormally decreased or increased level of de novo DNA cytosine methyltransferase polypeptide or de novo DNA cytosine methyltransferase mRNA in a sample derived from a subject. Decreased or increased expression may be measured at the RNA level using any of the tnethods well known in the art for the quantitation of polynucleotides; for example, RT-PCR, RNase protection, Northern blotting and other hybridization methods may be utilized.
Assay techniques that may be used to determine the level of a protein, such as an de novo DNA cytosine methyltransferase protein, in a sample derived from a host are well known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western blot analysis and ELISA assays.
Additionally, methods are provided for diagnosing or determining a susceptibility of an individual to neoplastic disorders, comprising (a) assaying the de novo DNA cytosine methyltransferase protein gene expression level in mammalian cells or body fluid; and (b) comparing said de novo DNA cytosine methyltransferase protein gene expression level with a standard de novo DNA
cytosine methyltransferase protein gene expression level whereby an increase or decrease in said de novo DNA cytosine methyltransferase gene expression level over said standard is indicative of an increased or decreased susceptibility to a neoplastic disorder.

VII. De novo DNA Cytosine Methyltransferase Antibodies The polypeptides of the invention or their fragments or analogs thereof, or cells expressing them may also be used as immunogens to produce antibodies immunospecific for the de novo DNA cytosine methyltransferase polypeptides.
By "immunospecific" is meant that the antibodies have affinities for the polypeptides of the invention that are substantially greater in their affinities for related polypeptides such as the analogous proteins of the prior art.
Antibodies generated against the de novo DNA cytosine methyltransferase polypeptides can be obtained by administering the polypeptides or epitope-bearing fragments, analogs or cells to an animal, preferably a nonhuman, using routine protocols. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used.

Examples include the hybridoma technique (Kohler, G. and Milstein, C., Nature 256:495-497 (1975)), the trioma technique, the human B-cell hybridoma technique (Kozbor, et al., Immunology Today 4:72 (1983)) and the EBV-hybridoma technique (Cole, et al., Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss, Inc., (1985)).
Techniques for the production of single chain antibodies (U.S. Patent No.
4,946,778) may also be adapted to produce single chain antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms including other mammals, may be used to express humanized antibodies.
The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography.
Antibodies against de novo DNA cytosine methyltransferase polypeptides may also be employed to treat neoplastic disorders, among others.

VIII. Agonist and Antagonist Screening The de novo DNA cytosine methyltransferase polypeptides of the present invention may be employed in a screening process for compounds which bind one of the proteins and which activate (agonists) or inhibit activation of (antagonists) one of the polypeptides of the present invention. Thus, polypeptides of the invention may also be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures. These substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics (see Coligan, et al., Current Protocols in Immunology 1(2):Chapter 5 (1991)).
By "agonist" is intended naturally occurring and synthetic compounds capable of enhancing a de novo DNA cytosine methyltransferase activity (e.g., increasing the rate of DNA methylation). By "antagonist" is intended naturally occurring and synthetic compounds capable of inhibiting a de novo DNA cytosine methyltransferase activity.

DNA methylation is an important, fundamental regulatory mechanism for gene expression, and, therefore, the methylated state of a particular DNA
sequence may be associated with many pathologies. Accordingly, it is desirous to find both compounds and drugs which stimulate de novo DNA cytosine methyltransferase activity and which can inhibit the function of de novo DNA
cytosine methyltransferase protein. In general, agonists are employed for therapeutic and prophylactic purposes including the treatment of ceratin types of neoplastic disorders. For example, de novo methylation of growth regulatory genes in somatic tissues is associated with tumorigenesis in humans (Laird, P.
W.
and Jaenisch, R. Ann. Rev. Genet. 30:441-464 (1996); Baylin, S. B. et al., Adv.
Cancer. Res. 72:141-196 (1998); and Jones, P. A. and Gonzalgo, M. L. Proc.
Natl. Acad. Sci. USA 94:2103-2105 (1997)).
In general, such screening procedures involve producing appropriate cells which express the polypeptide of the present invention. Such cells include cells from mammals, yeast, Drosophila or E. coli. Cells expressing the protein (or cell membrane containing the expressed protein) are then contacted with a test compound to observe binding, stimulation or inhibition of a functional response.
Alternatively, the screening procedure may be an in vitro procedure in which the activity of isolated DNMT3 protein is tested in the presence of a potential agonist or antagonist of DNMT3 de novo DNA cytosine methyltransferase activity. Such in vitro assays are known to those skilled in the art, and by way of example are demonstrated in Example 4.
The assays may simply test binding of a candidate compound wherein adherence to the cells bearing the protein is detected by means of a label directly or indirectly associated with the candidate compound or in an assay involving competition with a labeled competitor. Further, these assays may test whether the candidate compound affects activity of the protein, using detection systems appropriate to the cells bearing the protein at their surfaces. Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist in the presence of the candidate compound is observed. Standard methods for conducting such screening assays are well understood in the art.
Examples of potential de novo DNA cytosine methyltransferase protein antagonists include antibodies or, in some cases, oligonucleotides or proteins which are closely related to the substrate of the de novo DNA cytosine methyltransferase protein, e.g., small molecules which bind to the protein so that the activity of the protein is prevented.

IX. Gene Therapy Applications For overview of gene therapy, see Strachan, T. & Read A.P., Chapter 20, "Gene Therapy and Other Molecular Genetic-based T'herapeutic Approaches,"
(and references cited therein) in Human Molecular Genetics, BIOS Scientific Publishers Ltd. (1996).
Initial research in the area of gene therapy focused on a few well-characterized and highly publicized disorders: cystic fibrosis (Drumm, M.L. et al., Cell 62:1227-1233 (1990); Gregory, R.J. et al., Nature 347:358-363 (1990);
Rich, D.P. et al., Nature 347:358-363 (1990)); and Gaucher disease (Sorge, J. et al., Proc. Natl. Acad. Sci. (USA) 84:906-909 (1987); Fink, J.K. et al., Proc. Natl.
Acad. Sci. (USA) 87:2334-2338 (1990)); and certain forms of hemophilia-Bontempo, F.A. et al., Blood 69:1721-1724 (1987); Palmer, T.D. et al., Blood 73:438-445 (1989); Axelrod, J.H. et al., Proc. Natl. Acad. Sci. (USA) 87:5173-5177 (1990); Armentano, D. et al., Proc. Natl. Acad. Sci. (USA) 87:6141-6145 (1990)); and muscular dystrophy (Partridge, T.A. et al., Nature 337:176-179 (1989); Law, P.K. et al., Lancet 336:114-115 (1990); Morgan, J.E. et al., J.
Cell Biol. 111:2437-2449 (1990)).

More recently, the application of gene therapy in the treatment of a wider variety of disorders is progressing, for example: cancer (Runnebaum, I.B., Anticancer Res. 17(4B): 2887-2890, (1997)), heart disease (Rader, D.J., Int.
J.
Clin. Lab. Res. 27(1): 35-43, (1997); Malosky, S., Curr. Opin. Cardiol. 11(4):
361-368, (1996)), central nervous system disorders and injuries (Yang, K., et al., Neurotrauma J. 14(5): 281-297, (1997); Zlokovic, B.V.. et al., Neurosurgery 40(4): 789-803, (1997); Zlokovic, B.V., et al., Neurosurgery 40(4): 805-812, 41997)), vascular diseases (Clowes, A.W., Thromb. 1-laemost. 78(1): 605-610, 1997), muscle disorders (Douglas, J.T., et al., Neuromuscul. Disord. 7(5): 284-298, (1997); Huard, J., et al., Neuromuscul. Disord. 7(5): 299-313, (1997)), rheumatoid arthritis (Evans, C.H., et al., Curr. Opin. Rheumatol. 8(3): 230-234, (1996)) and epithelial tissue disorders (Greenhaigh, D.A., et al., lnvest Dermatol.
J. 103(5 Suppl.): 63S-93S, (1994)).
In a preferred approach, one or more isolated nucleic acid molecules of the invention are introduced into or administered to the animal. Such isolated nucleic acid molecules may be incorporated into a vector or virion suitable for introducing the nucleic acid molecules into the cells or tissues of the animal to be treated, to form a transfection vector. Techniques for the formation of vectors or virions comprising the de novo DNA cytosine methyltransferase-encoding nucleic acid molecules are well known in the art and are generally described in "Working Toward Human Gene Therapy," Chapter 28 in Recombinant DNA, 2nd Ed., Watson, J.D. et al., eds., New York: Scientific American Books, pp. 567-581 (1992). An overview of suitable vectors or virions is provided in an article by Wilson, J.M. (Clin. Exp. Immunol. 107(Suppl. 1): 31-32, (1997)). Such vectors are derived from viruses that contain RNA (Vile, R.G., et al., Br. Med Bull.
51(1): 12-30, (1995)) or DNA (Ali M., et al., Gene Ther. 1(6): 367-384, (1994)).
Example vector systems utilized in the art include the following: retroviruses (Vile, R.G., supra.), adenoviruses (Brody, S.L. et al., Ann. N. Y. Acad. Sci.
716:
90-101, (1994)), adenoviral/retroviral chimeras (Bilbao, G., et al., FASEB J.
11(8): 624-634, (1997)), adeno-associated viruses (Flotte, T.R. and Carter, B.J., Gene Ther. 2(6): 357-362, (1995)), herpes simplex virus (Latchman, D.S., Mol.
Biotechnol. 2(2): 179-195, (1994)), Parvovirus (Shaughnessy, E., et al., Semin Oncol. 23(1): 159-171, (1996)) and reticuloendotheliosis virus (Donburg, R., Gene Therap. 2(5): 301-310, (1995)). Also of interest in the art, the development of extrachromosomal replicating vectors for gene therapy (Calos, M.P., Trends Genet. 12(11): 463-466, (1996)).
Other, nonviral methods for gene transfer known in the art (Abdallah, B.
et al., Biol. Cel185(1): 1-7, (1995)) might be utilized for the introduction of de novo DNA cytosine methyltransferase polynucleotides into target cells; for example, receptor-mediated DNA delivery (Philips, S.C., Biologicals 23(1): 13-16, (1995)) and lipidic vector systems (Lee, R.J. and Huang, L., Crit. Rev.
Ther.
Drug Carrier Syst. 14(2): 173-206, (1997)) are promising alternatives to viral-based delivery systems.
General methods for construction of gene therapy vectors and the introduction thereof into affected animals for therapeutic purposes may be obtained in the above-referenced publications, the disclosures of which are specifically incorporated herein by reference in their entirety. In one such general method, vectors comprising the isolated polynucleotides of the present invention are directly introduced into target cells or tissues of the affected animal, preferably by injection, inhalation, ingestion or introduction into a mucous membrane via solution; such an approach is generally referred to as "in vivo"
gene therapy. Alternatively, cells, tissues or organs may be removed from the affected animal and placed into culture according to methods that are well-known to one of ordinary skill in the art; the vectors comprising the de novo DNA cytosine methyltransferase polynucleotides may then be introduced into these cells or tissues by any of the methods described generally above for introducing isolated polynucleotides into a cell or tissue, and, after a sufficient amount of time to allow incorporation of the de novo DNA cytosine methyltransferase polynucleotides, the cells or tissues may then be re-inserted into the affected animal. Since the introduction of a de novo DNA cytosine methyltransferase gene is performed outside of the body of the affected animal, this approach is generally referred to as "ex vivo" gene therapy.

For both in vivo and ex vivo gene therapy, the isolated de novo DNA
cytosine methyltransferase polynucleotides of the invention may altematively be operatively linked to a regulatory DNA sequence, which may be a de novo DNA

cytosine methyltransferase promoter or an enhancer, or a heterologous regulatory DNA sequence such as a promoter or enhancer derived from a different gene, cell or organism, to form a genetic construct as described above. This genetic construct may then be inserted into a vector, which is then used in a gene therapy protocol. The need for transcriptionally targeted and regulatable vectors providing cell-type specific and inducible promoters is well recognized in the art (Miller, N. and Whelan, J., Hum. Gene Therap. 8(7): 803-815, (1997); and Walther, W. and Stein, U., Mol. Med. J., 74(7): 379-392, (1996)), and for the purposes of de novo DNA cytosine methyltransferase gene therapy.

The construct/vector may be introduced into the animal by an in vivo gene therapy approach, e.g., by direct injection into the target tissue, or into the cells or tissues of the affected animal in an ex vivo approach. In another preferred embodiment, the genetic construct of the invention may be introduced into the cells or tissues of the animal, either in vivo or ex vivo, in a molecular conjugate with a virus (e.g., an adenovirus or an adeno-associated virus) or viral components (e.g., viral capsid proteins; see WO 93/07283). Alternatively, transfected host cells, which may be homologous or heterologous, may be encapsulated within a semi-permeable barrier device and implanted into the affected animal, allowing passage of de novo DNA cytosine methyltransferase polypeptides into the tissues and circulation of the animal but preventing contact between the animal's immune system and the transfected cells (see WO 93109222). These approaches result in increased production of de novo DNA
cytosine methyltransferase by the treated animal via (a) random insertion of the de novo DNA cytosine methyltransferase gene into the host cell genome; or (b) incorporation of the de novo DNA cytosine methyltransferase gene into the nucleus of the cells where it may exist as an extrachromosomal genetic element.
General descriptions of such methods and approaches to gene therapy may be found, for example, in U.S. Patent No. 5,578,461, WO 94/12650 and WO
93/09222.
Antisense oligonucleotides have been described as naturally occurring biological inhibitors of gene expression in both prokaryotes (Mizuno et al., Proc.
Natl. Acad. Sci. USA 81:1966-1970 (1984)) and eukaryotes (Heywood, Nucleic Acids Res. 14:6771-6772 (1986)), and these sequences presumably function by hybridizing to complementary mRNA sequences, resulting in hybridization arrest of translation (Paterson, et al., Proc. Natl.Acad. Sci. USA, 74:4370-4374(1987)).
Thus, another gene therapy approach utilizes antisense technology.
Antisense oligonucleotides are short synthetic DNA or RNA nucleotide molecules formulated to be complementary to a specific gene or RNA message.
Through the binding of these oligomers to a target DNA or mRNA sequence, transcription or translation of the gene can be selectively blocked and the disease process generated by that gene can be halted (see, for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press (1989)). The cytoplasmic location of mRNA provides a target considered to be readily accessible to antisense oligodeoxynucleotides entering the cell; hence much of the work in the field has focused on RNA as a target. Currently, the use of antisense oligodeoxynucleotides provides a useful tool for exploring regulation of gene expression in vitro and in tissue culture (Rothenberg, et al., J.
Natl.
Cancer Inst. 81:1539-1544 (1989)).
Antisense therapy is the administration of exogenous oligonucleotides which bind to a target polynucleotide located within the cells. For example, antisense oligonucleotides may be administered systemically for anticancer therapy (Smith, International Application Publication No. WO 90/09180).
The antisense oligonucleotides of the present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra). S-oligos (nucleoside phosphorothioates) are isoelectronic analogs of an oligonucleotide (0-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom. The S-oligos of the present invention may be prepared by treatment of the corresponding 0-oligos with 3H-1,2-benzodithiol-3-one-1,1-dioxide which is a sulfur transfer reagent. See lyer et al., J. Org. Chem. 55:4693-4698 (1990); and Iyer et al., J. Am. Chem. Soc.
112:1253-1254 (1990), the disclosures of which are fully incorporated by reference herein.
As described herein, sequence analysis of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3 or the SEQ ID NO:4 cDNA clone shows that sequence that is nonhomologous to known DNA methyltransferase sequences may be identified (see Figures 1 and 4). Thus, the antisense oligonucleotides of the present invention may be RNA or DNA that is complementary to and stably hybridize with such sequences that are specific for a de novo DNA cytosine methyltransferase gene of the invention. Use of an oligonucleotide complementary to such regions allows for selective hybridization to a de novo DNA cytosine methyltransferase mRNA and not to an mRNA encoding a maintenance methyltransferase protein.
Preferably, the antisense oligonucleotides of the present invention are a 15 to 30-mer fragment of the antisense DNA molecule coding for unique sequences of the de novo DNA cytosine methyltransferase cDNAs. Preferred antisense oligonucleotides bind to the 5'-end of the de novo DNA cytosine methyltransferase mRNAs. Such antisense oligonucleotides may be used to down regulate or inhibit expression of the gene.
Other criteria that are known in the art may be used to select the antisense oligonucleotides, varying the length or the annealing position in the targeted sequence.
Included as well in the present invention are pharmaceutical compositions comprising an effective amount of at least one of the antisense oligonucleotides of the invention in combination with a pharmaceutically acceptable carrier. In one embodiment, a single antisense oligonucleotide is utilized.

In another embodiment, two antisense oligonucleotides are utilized which are complementary to adjacent regions of the genome. Administration of two antisense oligonucleotides that are complementary to adjacent regions of the genome or corresponding mRNA may allow for more efficient inhibition of Qenomic transcription ormRNA translation, resulting in more effective inhibition of protein or mRNA production.
Preferably, the antisense oligonucleotide is coadministered with an agent which enhances the uptake of the antisense molecule by the cells. For example, the antisense oligonucleotide may be combined with a lipophilic cationic compound which may be in the form of liposomes. The use of liposomes to introduce nucleotides into cells is taught, for example, in U.S. Patent Nos.
4,897,355 and 4,394,448, (see also U.S. Patent Nos. 4,235,871, 4,231,877, 4,224,179, 4,753,788, 4,673,567, 4,247,411, and 4, 814,270 for general methods of preparing liposomes comprising biological materials).
Alternatively, the antisense oligonucleotide may be combined with a lipophilic carrier such as any one of a number of sterols including cholesterol, cholate and deoxycholic acid. A preferred sterol is cholesterol.
In addition, the antisense oligonucleotide may be conjugated to a peptide that is ingested by cells. Examples of useful peptides include peptide hormones, antigens or antibodies, and peptide toxins. By choosing a peptide that is selectively taken up by the targeted tissue or cells, specific delivery of the antisense agent may be effected. The antisense oligonucleotide may be covalently bound via the 5'OH group by formation of an activated aminoalkyl derivative.
The peptide of choice may then be covalently attached to the activated antisense oligonucleotide via an amino and sulfhydryl reactive hetero bifunctional reagent.
The latter is bound to a cysteine residue present in the peptide. Upon exposure of cells to the antisense oligonucleotide bound to the peptide, the peptidyl antisense agent is endocytosed and the antisense oligonucleotide binds to the target mRNA to inhibit translation (Haralambid et al., WO 8903849 and Lebleu et al., EP 0263740).

The antisense oligonucleotides and the pharmaceutical compositions of the present invention may be administered by any means that achieve their intended purpose. For example, administration may be by parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, or transdermal routes.
The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
Compositions within the scope of this invention include all compositions wherein the antisense oligonucleotide is contained in an amount effective to achieve the desired effect, for example, inhibition of proliferation and/or stimulation of differentiation of the subject cancer cells. While individual needs vary, determination of optimal ranges of effective amounts of each component is with the skill of the art.
Alternatively, antisense oligonucleotides can be prepared which are designed to interfere with transcription of the gene by binding transcribed regions of duplex DNA (including introns, exons, or both) and forming triple helices (e.g., see Froehler et al., WO 91/06626 or Toole, WO 92/10590). Preferred oligonucleotides for triple helix formation are oligonucleotides which have inverted polarities for at least two regions of the oligonucleotide (Id.).
Such oligonucleotides comprise tandem sequences of opposite polarity such as 3'---5'-L-5------ ', or 5'---3'-L-3'---5', wherein L represents a 0-10 base oligonucleotide linkage between oligonucleotides. The inverted polarity form stabilizes single-stranded oligonucleotides to exonuclease degradation (Froehler et al., supra).
The criteria for selecting such inverted polarity oligonucleotides is known in the art, and such preferred triple helix-forming oligonucleotides of the invention are based upon SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
In therapeutic application, the triple helix-forming oligonucleotides can be formulated in pharmaceutical preparations for a variety of modes of administration, including systemic or localized administration, as described above.
The antisense oligonucleotides of the present invention may be prepared according to any of the methods that are well known to those of ordinary skill in the art, as described above.

Ribozymes provide an alternative method to inhibit mRNA function.
Ribozymes may be RNA enzymes, self-splicing RNAs, and self-cleaving RNAs (Cech et al., Journal of Biological Chemistry 267:17479-17482 (1992)). It is possible to construct de novo ribozymes which have an endonuclease activity directed in trans to a certain target sequence. Since these ribozymes can act on various sequences, ribozymes can be designed for virtually any RNA substrate.
Thus, ribozymes are very flexible tools for inhibiting the expression of specific genes and provide an alternative to antisense constructs.
A ribozyme against chloramphenicol acetyltransferase mRNA has been successfully constructed (Haseloff et al., Nature 334:585-591 (1988);
Uhlenbeck et al., Nature 328:596-600 (1987)). The ribozyme contains three structural domains: 1) a highly conserved region of nucleotides which flank the cleavage site in the 5' direction; 2) the highly conserved sequences contained in naturally occurring cleavage domains of ribozymes, forming a base-paired stem; and 3) the regions which flank the cleavage site on both sides and ensure the exact arrangement of the ribozyme in relation to the cleavage site and the cohesion of the substrate and enzyme. RNA enzymes constructed according to this model have already proved suitable in vitro for the specific cleaving of RNA
sequences (Haseloff et al., supra).
Alternatively, hairpin ribozymes may be used in which the active site is derived from the minus strand of the satellite RNA of tobacco ring spot virus (Hampel et al., Biochemistry 28:4929-4933 (1989)). Recently, a hairpin ribozyme was designed which cleaves human immunodeficiency virus type 1 RNA (Ojwang et al., Proc. Natl. Acad. Sci. USA 89:10802-10806 (1992)). Other self-cleaving RNA activities are associated with hepatitis delta virus (Kuo et al., J. Virol. 62:4429-4444 (1988)).

As discussed above, preferred targets for ribozymes are the de novo DNA
cytosine methyltransferase nucleotide sequences that are not homologous with maintenance methyltransferase sequences such as Dnmt 1 or Dnmt 2. Preferably, the ribozyme molecule of the present invention is designed based upon the chloramphenicol acetyltransferase ribozyme or hairpin ribozymes, described above. Alternatively, ribozyme molecules are designed as described by Eckstein et al. (International Publication No. WO 92/07065) who disclose catalytically active ribozyme constructions which have increased stability against chemical and enzymatic degradation, and thus are useful as therapeutic agents.
In an alternative approach, an external guide sequence (EGS) can be constructed for directing the endogenous ribozyme, RNase P, to intracellular mRNA, which is subsequently cleaved by the cellular ribozyme (Altman et al., U.S. Patent No. 5,168,053). Preferably, the EGS comprises a ten to fifteen nucleotide sequence complementary to an mRNA and a 3'-NCCA nucleotide sequence, wherein N is preferably a purine (Id.). After EGS molecules are delivered to cells, as described below, the molecules bind to the targeted mRNA
species by forming base pairs between the mRNA and the complementary EGS
sequences, thus promoting cleavage of mRNA by RNase P at the nucleotide at the 5'side of the base-paired region (Id. ).
Included as well in the present invention are pharmaceutical compositions comprising an effective amount of at least one ribozyme or EGS of the invention in combination with a pharmaceutically acceptable carrier. Preferably, the ribozyme or EGS is coadministered with an agent which enhances the uptake of the ribozyme or EGS molecule by the cells. For example, the ribozyme or EGS
may be combined with a lipophilic cationic compound which may be in the fozm of liposomes, as described above. Alternatively, the ribozyme or EGS may be combined with a lipophilic carrier such as any one of a number of sterols including cholesterol, cholate and deoxycholic acid. A preferred sterol is cholesterol.

The ribozyme or EGS, and the pharmaceutical compositions of the present invention may be administered by any means that achieve their intended purpose. For example, administration may be by parenteral, subcutaneous.
intravenous, intramuscular, intra-peritoneal, or transdermal routes. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. For example, as much as 700 milligrams of antisense oligodeoxynucleotide has been administered intravenously to a patient over a course of 10 days (i.e., 0.05 mg/kg/hour) without signs of toxicity (Sterling, "Systemic Antisense Treatment Reported," Genetic Engineering News 12(12):1, 28 (1992)).
Compositions within the scope of this invention include all compositions wherein the ribozyme or EGS is contained in an amount which is effective to achieve inhibition of proliferation and/or stimulate differentiation of the subject cancer cells, or alleviate AD. While individual needs vary, determination of optimal ranges of effective amounts of each component is with the skill of the art.
In addition to administering the antisense oligonucleotides, ribozymes, or EGS as a raw chemical in solution, the therapeutic molecules may be administered as part of a pharmaceutical preparation containing suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the antisense oligonucleotide, ribozyme, or EGS into preparations which can be used pharmaceutically.
Suitable formulations for parenteral administration include aqueous solutions of the antisense oligonucleotides, ribozymes, EGS in water-soluble form, for example, water-soluble salts. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered.
Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides.
Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran. Optionally, the suspension may also contain stabilizers.
Alternatively, antisense RNA molecules, ribozymes, and EGS can be coded by DNA constructs which are administered in the form of virions, which are preferably incapable of replicating in vivo (see, for example, Taylor, WO
92/06693). For example, such DNA constructs may be administered using herpes-based viruses (Gage et al., U.S. Patent No. 5,082,670). Alternatively, antisense RNA sequences, ribozymes, and EGS can be coded by RNA constructs which are administered in the form of virions, such as retroviruses. The preparation of retroviral vectors is well known in the art (see, for example, Brown et al., "Retroviral Vectors," in DNA Cloning: A Practical Approach, Volume 3, IRL Press, Washington, D.C. (1987)).
Specificity for gene expression may be conferred by using appropriate cell-specific regulatory sequences, such as cell-specific enhancers and promoters.
Such regulatory elements are known in the art, and their use enables therapies designed to target specific tissues, such as liver, lung, prostate, kidney, pancreas, etc., or cell populations, such as lymphocytes, neurons, mesenchymal, epithelial, muscle, etc.
In addition to the above noted methods for inhibiting the expression of the de novo methyltransferase genes of the invention, gene therapeutic applications may be employed to provide expression of the polypeptides of the invention.

Examples Example 1: Cloning and Sequence Analysis of tlie Mouse Dnmt3a and Dnmt3b and the Human DNMT3A and DNMT3B Genes and Polypeptides In search of a mammalian de novo DNA methyltransferase, two independent approaches were undertaken, based on the assumption that an unknown mammalian DNA methyltransferase must contain the highly conserved cytosine methyltransferase motifs in the catalytic domain of known methyltransferases (Lauster, R. et al., J. Mol. Biol. 206:305-312 (1989) and Kumar, S. et al., Nucl. Acids Res. 22:1-10 (1994)). Our first approach, an RT/PCR-based screening using oligonucleotide primers corresponding to the conserved motifs of the known cytosine DNA methyltransferases, failed to detect any novel methyltransferase gene from Dnmtl null ES cells (data not shown).

The second approach was a tblastn search of the dbEST database using full length bacterial cytosine methyltransferase sequences as queries.
A search of the dbEST database was performed with the tblastn program (Altschul, S. F. et al., J. Mol. Biol. 215:403-410 (1990)) using bacterial cytosine methyltransferases as queries. Candidate EST sequences were used one by one as queries to search the non-redundant protein sequence database in GenBank with the blastx program. This process would eliminate EST clones corresponding to known genes (including known DNA methyltransferases) and those which show a higher similarity to other sequences than to DNA methyltransferases.
Two EST clones (GenBank numbers W7611 l and N88352) were found after the initial search. Two more EST sequences (fl2227 and T66356) were later found after a blastn search of dbEST with the EST sequence of W76111 as a query.
Two of the EST clones (W761 11 and T66356) were deposited by the I.M.A.G.E.
Consortium (Lawrence Livermore National Laboratory, Livermore, CA) and obtained from American Type Culture Collection (Manassas, VA). Sequencing of these two cDNA clones revealed that they were partial cDNA clones with large open reading frames corresponding to two related genes. The translated amino acid sequences revealed the presence of the highly conserved motifs characteristic of DNA cytosine methyltransferases. The EST sequences were then used as probes for screening mouse E7.5 embryo and ES cell cDNA libraries and a human heart cDNA library (Clontech, CA).
In a screening of the dbEST database using 35 bacterial cytosine-5 DNA
methyltransferase sequences as queries, eight EST clones were found to have the highest similarity but not to be identical to the known cytosine-5-DNA
methyltransferase genes. Six of the eight EST sequences were deposited by the I.M.A.G.E. Consortium (Lawrence Livermore National Laboratory, Livermore, CA) and obtained from TIGR/ATCC (American "Type Culture Collection, Manassas, VA). Sequencing of these 6 cDNA clones revealed that they were partial cDNA clones with large open reading frames corresponding to three novel genes. The translated amino acid sequences revealed the presence of the highly conserved motifs characteristic of DNA cytosine methyltransferases. The EST
sequences were then used as probes for screening a mouse ES cell cDNA library, a mouse E 11.5 embryonic cDNA library (Clontech, CA) and human heart cDNA
library.
Human and mouse cDNA libraries were screened using EST sequences as probes. Sequencing analysis of several independent cDNA clones revealed that two homologous genes were present in both human and mouse. This was further confirmed by Southern analysis of genomic DNA, intron/exon mapping and sequencing of genomic DNA (data not shown). The full length mouse cDNAs for each gene were assembled and complete sequencing revealed that both genes contained the highly conserved cytosine methyltransferase motifs and shared overall 51 % of amino acid identity (76% identity in the catalytic domain) (Fig. 3). Since these two genes showed little sequence similarities to Dnmtl(Bestor, T. H. et al., J. Mol. Biol. 203:971-983 (1988) and Yen, R-W. C.
et al., Nucleic Acids Res. 20:2287-2291 (1992)) and a recently cloned putative DNA methyltransferase gene, Dnmt2 (see Yoder, J. A. and Bestor, T. H. Hum.
Mol. Genet. 7:279-284 (1998)) and Okano, M., Xie, S. and Li, E., (submitted)), beyond the conserved methyltransferase motifs in the catalytic domain, they were named Dnmt3a and Dnmt3b.
The full length Dnmt3a and Dnmt3b genes encode 908 and 859 amino acid polypeptides, termed Dnmt3a and Dnmt3bl, respectively. Nucleotide and amino acid sequences of each are presented in Figures 1 A, 1 B, 2A, and 2B.
The Dnmt3b gene also produces through alternative splicing at least two shorter isoforms of 840 and 777 amino acid residues, termed Dnmt3b2 and Dnmt3b3, respectively, (Fig. 4).
To obtain full length human cDNA, fetal heart and fetal testis cDNA
libraries were screened using EST clones as probes. Sequencing analysis of several overlapping DNMT3A cDNA clones indicates that the DNMT3A gene encodes a polypeptide of 912 amino acid residues. DNMT3B cDNA clones were not detected in the fetal heart library, but several DNMT3B cDNA clones were obtained after screening the fetal testis library. PCR screening of large cDNA
clones from 24 human tissues was also performed using the Human Rapid-ScreenTM cDNA Library Panels (OriGene Technologies, MD). The largest cDNA
clone contained a 4.2 kb insert from a small intestine cDNA library.
Sequencing analysis of overlapping cDNA clones indicated that the deduced full length DMNT3B consists of 853 amino acid residues. Since in-frame stop codons are found upstream of the ATG of both DNMT3A and DNMT3B, it is concluded that these cDNA clones encode full-length DNMT3A and DNMT3B proteins.
The full length human DNMT3A and DNMT3B cDNAs encode 912 and 853 amino acid polypeptides, termed DNMT3A and DNMT3B1, respectively.
Nucleotide and polypeptide sequences are presented in Figures 1C, 1D, 2C and 2D, respectively. The DNMT3B gene also produces through alternative splicing at least two shorter isoforms, termed DNMT3B2 and DNMT3B3, respectively.
DNMT3B2 comprises amino acid residues 1 to 355 and 376 to 853 of SEQ ID
NO:4; and DNMT3B3 comprises amino acid residues 1 to 355 and 376 to 743 and 807 to 853 of SEQ ID NO:4.
Also identified through screening was a related zebrafish gene, termed Zmt-3, which from the EST database (GenBank number AF135438).
The GenBank STS database was used to map chromosome localization by using DNMT3A and DNMT3B sequences as queries. The results identified markers WI-6283 (GenBank Accession number G06200) and SHGC-15969 (GenBank Accession number G15302), which matched the cDNA sequence of DNMT3A and DNMT3B, respectively. WI-6283 has been mapped to 2p23 between D2S171 and D2S 174 (48-50 cM) on the radiation hybrid map by Whitehead Institute/MIT Center for Genome Research. The corresponding mouse chromosome location is at 4.0 cM on chromosome 12. SHGC-15969 has been mapped to 20pl 1.2 between D20S 184 and D20S 106 (48-50 cM) by Stanford Human Genome Center. The corresponding mouse chromosome locus is at 84.0 cM on chromosome 2.

Taking the advantage of the newly identified DNMT3A and DNMT3B
cDNA sequences, the human genomic sequence database was searched by BLAST.
While human DNMT3A cDNA did not match any related genornic sequences in the database, a DNMT3B genomic YAC clone from GenBank (AL035071) was identified when DNMT3B cDNA sequences were used as queries.
The DNMT3B cDNA and the genomic DNA GenBank (AL035071) clone were used to map all exons using BESTFIT of the GCG program. As shown in Figure 4C, there are total 23 exons, spanning some 48 kb genomic DNA. The putative first exon is located within a CpG island where the promoter is probably located as predicted by the GENSCAN program (Whitehead/MIT Center for Genome Research).
Sequencing of various cDNA clones indicates that the human DNMT3B
gene contains three alternatively spliced exons, exons 10, 21 and 22. Similar to the mouse gene, DNMT3B I contains a1123 exons, whereas DNMT3B2 lacks exon 10 and DNMT3B3 lacks exons 10, 21 and 22. The nucleotide sequences at the exon/intron boundaries are shown in Figure 4D. T'he elucidation of human DNMT3B gene structure may facilitate analysis of DNMT3B mutations in certain cancers with characteristic hypomethylation of genomic: DNA (Narayan, A., et al., Int. J. Cancer 77:833-838 (1998); Qu, G., et al., Mutan. Res. 423:91-101 (1999)).
Figure 3A presents an alignment of mouse Dnmt3a and Dnmt3b polypeptide sequences that was accomplished using the GCG program. The vertical lines indicate amino acid identity, while the dots and the colons indicate similarities. Dots in amino acid sequences indicate gaps introduced to maximize alignment. The conserved Cys-rich region is shaded. The full length mouse Dnmt3a and Dnmt3b genes encode 908 and 859 amino acid polypeptides.
Furthermore, the analysis reveals that both genes contained the highly conserved cytosine methyltransferase motifs and share overall 51 % of amino acid identity (76% identity in the catalytic domain). The Dnmt3b gene also produces at least two shorter isoforms of 840 and 777 amino acid residues, termed Dnmt3b2 and Dnmt3b3, respectively, through alternative splicing (Fig. 4).

Figure 3B presents a GCG program alignment using the of the protein sequences of human DNMT3A and DNMT3B 1. Vertical lines represent identical amino acid residues, whereas dots represent conserved changes. Dots in amino acid sequences indicate gaps introduced to maximize alignment.
In Figure 4A, presents a schematic diagram of the overall protein structures for mouse Dnmtl, mouse Dnmt2, a putative methyltransferase, and the family of Dnmt3a and Dnmt3b(1-3) methyltransferases. Dnmtl, Dnmt3a and Dnmt3bs all have a putative N-terminal regulatory domain. The filled bars represent the five conserved methyltransferase motifs (I, IV, VI, IX, and X).
The shaded boxes in Dnmt3a and Dnmt3bs represent the Cys-rich region that shows no sequence homology to the Cys-rich, Zn2+-binding region of Dnmtl polypeptide. Sites of alternative splicing at amino acid residues 362-383 and 813 in Dnmt3bs are indicated.
An analysis of the human DNMT3 proteins provides similar results as with the mouse Dnmt proteins. Figure 4B presents a similar schematic of the human DNMT3 proteins and zebrafish Znmt3 protein. The homology between differences between these DNMT3 proteins is indicated by the percentage of sequence identity when compared to DNMT3A.

In addition, the genomic organization of the human DNMT3B 1 locus is presented in Figure 4C as possessing 23 exons (filled rectangles), a CpG
island (dotted rectangle),a translation initiation codon (ATG) and a stop codon (TAG) in exons 2 and 23, respectively. Figure 4D presents the size of the exons and introns as well as sequences (uppercase for exons and lowercase for introns) at exon/intron boundaries.

In Figure 5, sequence analysis of the catalytic domain indicates that this new family of DNA methyltransferases contains conserved amino acid residues in each of the five highly conserved motifs, but significant differences are discernible when compared to the known consensus sequences.
Figure 5A presents an alignment by ClustalW 1.7 of the amino acid sequences of the five highly conserved motifs in eukaryotic methyltransferase genes. Amino acid residues which are conserved in five or more genes are highlighted. The Dnmt3 family methyltransferases ai=e most closely related to a bacterial DNA methyltransferase (M. Spr.). Sequence comparison of the catalytic domain of all known eukaryotic DNA methyltransferases and most of the bacterial cytosine methyltransferases used in the tblastn search indicates that this family of methyltransferases are distantly related to all the known eukaryotic DNA methyltransferases, including the Dnmt 1 polypeptide from vertebrate and plant (Bestor, T. H. et al., J. Mol. Biol. 203:971-983 (1988), Yen, R-W. C. et al., Nucleic Acids Res. 20:2287-2291 (1992) and Finnegan, E. J. and Dennis, E. S.
Nucleic Acids Res. 21:2383-2388 (1993)); the human and mouse Dnmt 2 polypeptides (Yoder, J. A. and Bestor, T. H. Hum. Mol. Genet. 7:279-284 (1998), Okano, M., Xie, S. & Li, E., (submitted)); and masc 1 from Ascobolus (Malagnac, F. et al., Cell 91:281-290 (1997)), indicating that the Dnmt3 gene family originated from a unique prokaryotic prototype DNA methyltransferase during evolution.

The cysteine-rich region located upstream of the catalytic domain was found to be conserved among all of the DNMT3 proteins (Fig. 5B). This Cysteine-rich region, however, is unrelated to the Cysteine-rich (or Zn'-, -binding) region of DNMT l(Bestor, T.H., et al., J. Mo. Biol. 203:971-983 (1998);
Bestor, T.H., EMBO J. 11:2611-2617 (1992)). Interestingly, the Cysteine-rich domain of DNMT3 proteins shares homology with a similar domain found in the X-linked ATRX gene of the SNF2/SWI family (Picketts, D.J., et al., Hum. Mol.
Genet. 5:1899-1907 (1996)), raising the interesting possibility that this domain may mediate protein-protein or protein-DNA interactions.

The evolutionary relatedness of cytosine-5 methyltransferases as shown by a non-rooted phylogenic tree is presented in Figure 5C. Amino acid sequences from motif I to motif VI of bacterial and eukaryotic cytosine-5 methyltransferases were used for sequence alignment, and the alignment data was analyzed by ClustalW 1.7 under conditions excluding positions with gaps. Results were visualized utilizing Phlip version 3.3. Amino acid sequences from motif IX to motif X were also analyzed and provided similar results (data not shown).
(Abbreviation Ath; Arabidopsis thaliana, Urc; sea urchin, Xen; Xenopus laevis).
Example 2: Baculovirus-mediated Expression of Dnmt3a andDnmt3b To test whether the newly cloned Dnmt3 genes encode active DNA
methyltransferases, the cDNAs ofDnmt3a, Dnmt3bl, Dnmt3b2, and Dnmtl were overexpressed in insect cells using the baculovirus-mediated expression system (Clontech, CA).
To construct the Dnmt3a expression vector, pSX134, the Xma I/Eco RI
fragment of Dnmt3a cDNA was first cloned into the Nco I/Eco RI sites of pET2 ld with the addition of an Xma I/Nco I adapter (SX165: 5'-CATGGGCAGCAGCCATCATCATCATCATCATGGGAATTCCATGCCC
TCCAGCGGCC and SX166: 5'-CCGGGGCCGCTGGAGGGCATGGA
ATTCCCATGATGATGATGATGATGGCTGCTGCC) that produced pSX 132His. pSX 134 was obtained by cloning the EcoR I/Xba 1 fragment of pSX
132His into the EcoR I/Xba I sites of pBacPAK9. The Dnmt3b 1 and Dnmt3b2 expression vectors, pSX153 and pSX154, were constructed by cloning Eco RI
fragments of Dnmt3bl and Dnmt3b2 cDNA into the Eco RI site of pBacPAK9, respectively. The Dnmtl expression vector pSX 148 was constructed by cloning the Bgl I/Sac I fragment of Dnmtl cDNA into the Bgl II/Sac 1 sites of pBacPAK-His2 with the addition of a Bgl 1/Bgl II adapter (SX180: 5'-GATCTATGCCAGCGCGAACAGCTCCAGCCCGAGTGCCTGCGCTTGC
CTCCC and SX 181: 5'- AGGCAAGCGCAGGCACTCGGGCTGGAGCTGTT
CGCGCTGGCATA).
pSX 134 (Dnmt3a), pSX 153 (Dnmt3b 1), pSX 153 (Dnmt3b2) and pSXl48 (Dnmtl) were used to make the recombinant baculoviruses according to the procedures recommended by the manufacturer. T175 flasks were used for cell culture and virus infection. SfZI host cells were grown in the SF-900 II SFM
medium with 10% of the certified FBS (both from GIBCO, MD) and infected with the recombinant viruses 12-24 hours after the cells were split when they reached 90-95% affluence. After 3 days, the infected insect cells were harvested and frozen in the liquid nitrogen for future use.

Example 3: RNA Expression Analysis ES cells were routinely cultured on a feeder layer of mouse embryonic fibroblasts in DMEM medium containing LIF (500 units/ml) and were differentiated as embryoid bodies in suspension culture as described (Lei, H., et al., Development 122:3195-3205 (1996)). Ten days after seeding, embryoid bodies were harvested for RNA preparation.

Total RNA was prepared from ES cells, ovary and testis tissue using the GTC-CsCl centrifugation method, fractionated on a formaldehyde denaturing 1%
agarose gel by electrophoresis and transferred to a nylon membrane. PolyA+
RNA blots (2 g per lane) of mouse and human tissues were obtained from Clontech, CA. All blots were hybridized to randoni-primed cDNA probes in hybridization solution containing 50% formamide at 42 C and washed with 0.2 X
SSC, 0.1 % SDS at 65 C and exposed to X-ray film (Kodak).
Fig. 6A presents mouse polyA+ RNA blots of adult tissues (left) and embryos (right) probed with full length Dnmt3a, Dnmt3b and a control (3-actin cDNA probe. Each lane contains 2 g of polyA+ RNA. (Ht, Heart; Br, Brain; Sp, Spleen; Lu, Lung; Li, Liver; Mu, Skeletal Muscle; Ki, Kidney; Te, Testis; and embryos at gestation days 7 (E7), 11 (E11), 15 (E15). and 17 (E17). Fig. 6B is a mouse total RNA blot (10 g per lane) of ES cell and adult organ RNA samples and Fig. 6C shows a mouse total RNA blot (20 g per lane) of undifferentiated (Undiff.) and differentiated (Diff.) ES cells RNA hybridized to Dnmt3a, Dnmt3b or P-actin probes.

It has been shown that the maintenance methylation activity is constitutively present in proliferating cells, whereas the de novo methylation activity is highly regulated. Active de novo methylation has been shown to occur primarily in ES cells (or embryonic carcinoma cells), early postimplantation embryos and primordial germ cells (Jahaner, D. and Jaenish, R., "DNA
Methylation in Early Mammalian Development," In DNA Methylation:
Biochemistry and Biological Significance, Razin, A. et al., eds., Springer-Verlag (1984) pp. 189-219; Razin, A., and Cedar, H., "DNA Methylation and Embryogenesis," in DNA Methylation: Molecular Biology and Biological Significance, Jost., J. P. etal., eds., Birkhauser Verlag, Basel, Switzerland (1993) pp. 343-3 57; Chaillet, J. R. et al., Ce1166:77-83 (1991;); and Li, E. "Role of DNA
Methylation in Development," in Genomic Imprinting: Frontiers in Molecular Biology, Reik, W. and Sorani, A. eds., IRL Press, Oxford (1997) pp. 1-20). The expression of both Dnmt3a and Dnmt3b in mouse embryos, adult tissues and ES
cells was examined. The results indicate that two Dnmt3a transcripts, 9.5 kb and 4.2kb, are present in embryonic and adult tissue RNA. The 4.2 kb transcript, corresponding to the size of the full length cDNA, was expressed at very low levels in most tissues, except for the E11.5 embryo sample (Fig. 6A). A single 4.4 kb Dnmt3b transcript is detected in embryo and adult organ RNAs, with relatively high levels in testes and E 11.5 embryo samples (Fig. 6A).
Interestingly, both genes are expressed at much higher levels in ES cells than in adult tissues (Fig. 6B), and their expression decreased dramatically upon differentiation of ES
cells in culture (Fig. 6C). In addition, Dnmt3a and Dnmt3b expression levels are unaltered in Dnmtl-deficient ES cells (Fig. 6C), suggesting that regulation of Dnmt3a and Dnmt3b expression is independent of Dnmtl.

These results suggest that both Dnmt3a and Dnmt3b are expressed specifically in ES cells and El 1.5 embryo and/or testes. The expression in the E11.5 embryo and testes may correlate with the presence of developing or mature germ cells in these tissues. Therefore, the expression pattern of Dnmt3a and Dnmt3b appears to correlate well with de novo methylation activities in development.

For the RNA expression analysis of human DNMT3 genes, polyA+ RNA
blots were hybridized using DNMT3A and DNMT3B cDNA fragments as probes.

Results indicate that DNMT3A RNA was expressed ubiquitously and was readily detected in most tissues examined at levels slightly lower than DNMTI RNA
(Fig. 9). Three major DNMT3A transcripts, approximately 4.0, 4.4, and 9.5 kb, were detected. The relative expression level of the transcripts appeared to vary from tissue to tissue. Transcripts of similar sizes were also detected in mouse tissues. Results utilizing DNMT3B cDNA probes indicate that transcripts of about 4.2 kb were expressed at much lower levels in most tissues, but could be readily detected in the testis, thyroid and bone marrow (Fig. 9). Sequence analyses of different cDNA clones indicate the presence of alternatively spliced transcripts, although the size differences between these transcripts are too small to be detected by Northern analysis.
Hypermethylation of tumor suppressor genes is a common epigenetic lesion found in tumor cells (Laird, P. W. & Jaenisch, R., Ann. Rev. Genet.
30:441-464 (1996); Baylin, S.B., Adv. Cancer Res. 72:141-196 (1998)). To investigate whether DNMT3A and DNMT38 ann abnormally activated in tumor cells, DNMT3 RNA expression was analyzed in several tumor cell lines by Northern blot hybridization. Results demonstrated that DNMT3A was expressed at higher levels in most tumor cell lines examined. (Figure 10). As in the normal tissues, three different size transcripts were also detected in tumor cells. The ratio of these transcripts appeared to be variable in different tumor cell lines.

expression was dramatically elevated in most tumor cell lines examined though it was expressed at very low levels in normal adult tissues (Figure 10). The expression levels of both DNMT3A and DNMT3B appear to be comparable and proportional to that of DNMTI.

The murine Dnmt3a and Dnmt3b genes are highly expressed in undifferentiated ES cells, consistent with their potential role in de novo methylation during early embryonic development. Additionally, both genes are highly expressed in early embryos. Differences in their expression patterns in adult tissues in both human and mice suggest that each gene may have a distinct function in somatic tissues and may methylate different genes or genomic sequences. The elevated expression of DNMT3 genes in human tumor cell lines suggests that the DNMT3 enzyme may be responsible for de novo methylation of CpG islands in tumor suppressor genes during tumor formation.

Example 4: Methyltransferase Activity Assay In order to demonstrate DNA cytosine methyltransferase activity, the polypeptides of the invention were expressed and purified from recombinant host cells for use in in vitro assays.
Infected insect Sf21 cells and NIH3T3 cells were homogenized by ultrasonication in lysis solution (20 mM Tris-HCI, p1-17.4, 10 mM EDTA, 500 mM NaC1, 10% glycerol, 1mM DTT, IrnM PMSF, 1 ug/ml leupeptin, 10 ug/ml TPCK, 10 ug/ml TLCK) and cleared by centrifugation at 100,000 g for 20 min.
The methyltransferase enzyme assay was carried out as described previously (Lei, H. et al., Development 122:3195-3205 (1996)). DNA substrates used in the assays include: poly (dI-dC), poly (dG-dC) (Pharmacia Biotech), lambda phage DNA (Sigma), pBluescriptIlSK (Stratagene, CA), pMu3 plasmid, which contains tandem repeats of 535bp RsaI-Rsal fcagment of MMLV LTR
region in pUC9, and oligonucleotides. The oligonucleotide sequences utilized include:

#1, 5'-AGACMGGTGCCAGMGCAGCTGAGCMGGATC-3', #2, 5'-GATCMGGCTCAGCTGMGCTGGCACMGGTCT-3', #3, 5'-AGACCGGTGCCAGCGCAGCTGAGCCGGATC-3', and #4, 5'-GATCCGGCTCAGCTGCGCTGGCACCGGTCT-3' (M represents 5-methylcytosine).

These sequences are the same as described in a previous study (Pradhan, S. et al., Nucleic Acids Res. 25:4666-4673 (1997)). Oligonucleotides were synthesized and purified by polyacrylamide gel electrophoresis (PAGE). To make double strand oligonucleotides, equimolar amounts of the two complimentary oligonucleotides were heated at 94"C for 10 min., mixed, incubated at 78 C for 1 hr and cooled down slowly at room temperature. The annealing products were quantified for the yield of double-stranded oligonucleotides (dsDNA) by PAGE and methylene blue staining. In all cases, the yield of dsDNA was higher than 95%. The dsDNA of #1 and #2 were used as 'fully' methylated substrates, dsDNA of #1 and #4 as the hemi-methylated substrates, and dsDNA of #3 and #4 as unmethylated substrates.
For Southern analysis of the methylation of retrovirus DNA, 2 ug of pMMLV8.3, an 8.3kb Hind III fragment of Moloney murine leukemia virus cDNA in pBluescriptlISK, was methylated in vitro for 15 hrs under the same reaction conditions described above except that 160 uM of cold SAM
(S-adenosyl-L-Met) was used instead of 3H-methyl SAM. Then, an equal volume of the solution containing 1% SDS, 400 mM NaC1, and 0.2 mg/ml Proteinase K was added, and the sample was incubated at 37 C for 1 hr. After phenol/chloroform extraction, DNA was precipitated with ethanol, dried and dissolved in TE buffer. This procedure was repeated 5 times. An aliquot of DNA was purified after the first, third and fifth reaction, digested with Hpa II
or Msp I in combination with Kpn I for 16 hrs, separated on 1% agarose gels, blotted and hybridized to the pMu3 probe.
In a standard methyltransferase assay, enzyme activity was detected with protein extracts from Sf21 cells overexpressing Dnmt3a and Dnmt3b polypeptides. Similar to the results obtained with the Dnmtl polypeptide, the overexpressed Dnmt3 proteins were able to methylate various native and synthetic DNA substrates, among which poly(dI-dC) consistently gave rise to the highest initial velocity (Fig. 7a). An analysis of the methylation of Hpa II
sites in retroviral DNA by these enzymes was also performed. An MMLV full length cDNA was methylated for 1-5 times by incubation with protein extract from control Sf21 cells or Sf21 cells infected with baculoviruses expressing Dnmtl, Dnmt3a or Dnmt3b polypeptides. The Hpa II/Msp I target sequence, CCGG, is resistant to the Hpa II restriction enzyme, but sensitive to Msp I
digestion when the internal C is methylated, and the restriction site becomes resistant to Msp I digestion when the external C is methylated (Jentsch, S. et al., Nucleic Acids Res.

9:2753-2759 (1981)). Both Dnmt3a and Dnmt3b polypeptides could methylate multiple Hpa II sites in the 3' LTR regions of the MMLV DNA, as indicated by the presence of Hpa II-resistant fragments, though less efficiently than Dnmtl polypeptide (Fig. 7b). Significantly, even after five consecutive rounds of in vitro methylation, the viral DNA was completely digested by Msp I. This result indicates that both Dnmt3a and Dnmt3b polypeptides methylate predominantly the internal cytosine residues, therefore, CpGs. Previously it was shown that the same region of the proviral DNA was efficiently methylated in Dnmtl null ES
cells infected by the MMLV virus (Lei, H. et al., Development 122:3195-3205 (1996)).
Fig. 7A shows 'H-methyl incorporation into different DNA substrates (poly (dI-dC), poly (dG-dC) (squares), lambda phage DNA (circles), pBluescriptIISK (triangles), and pMu3 (diamonds)) when incubated with protein extracts of Sf21 cells expressing Dnmtl, Dnmt3a, or Dnmt3bl. Fig. 7B shows Southern blot analysis of the in vitro methylation of untreated pMMLV DNA
(lanes 1-3) and pMMLV DNA incubated with MT1 (lane 4-10), MT3a (lanes 11-15), MT3(3 (lanes 16-20) or control Sf21 (lanes 21-25) extracts that were digested with Kpn I(K), Kpn I and Msp I(K/M) or Kpn I and Hpa II (K/H). Restriction enzyme digested samples were then subjected to Southern blot analysis using the pMu3 probe.
Dnmtl protein appears to function primarily as a maintenance methyltransferase because of its strong preference for hemimethylated DNA and direct association with newly replicated DNA (Leonhardt, H. et al., Cell 71:865-873 (1992)). To determine whether Dnmt3a and Dnmt3b polypeptides show any preference for hemimethylated DNA over unmethylated DNA, a comparison was done to examine the methylation rate of unmethylated versus hemimethylated oligonucleotides. Gel-purified double stranded oligonucleotides were incubated with protein extracts of Sf21 cells expressing Dnmtl, Dnmt3a, Dnmt3bl, Dnmt3b2 or NIH3T3 cell extract (unmethylated substrates (open circles), hemi-methylated substrates (half black diamonds) or completely methylated substrates (closed squares)). While baculovirus-expressed Dnmt 1 polypeptide or 3T3 cell extract showed much higher activities when hemimetliylated DNA was used as a substrate, Dnmt3a, Dnmt3bl and Dnmt3b2 polypeptides showed no detectable preference for hemimethylated DNA (Fig. 8).

INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in the description on page 16, line 1.

B. IDENTIFICATION OF DEPOSIT Further deposits are id~ntified on an additional sheet Name of depositary institution American Type Culture Collection (ATCC ) Address of depositary institution (including postal code and country) 10801 University Boulevard Manassas, Virginia 20110-2209 United States of America Date of deposit June 16. 1998 Accession Number 209933 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet pMT3a cDNA clone in bacterial cell DH5alpha D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (i>'the indications are notjor all designated States) E. SEPARATE FURNISHING OF INDICATIONS tlemY b1ank lnnropplieabte~

The indications listed below will be submitted to the intemational Bureau later (specifv the general narure of the indications, e.g., "Accession Number ojDeposiJ %

For receiving Office use only For Intemational Bureau use only YZ This sheet was received with the internationai application ~ This sheet was received by the lntemational Bureau on:
Authorized officer Authorized officer SGlljlt n - I
PCT Inlemadpnsl piyision Form PCT/RO/134 (July 1992) INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in the description on page 16, line I.

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution American Type Culture Collection (ATCC ) Address of depositary institution (including postal code and country) 10801 University Boulevard Manassas, Virginia 20110-2209 United States of America Date of deposit June 16. 1998 j Accession Number 209934 C. ADDITIONAL INDICATIONS (leave blank iJnot applicable) This infortnation is continued on an additional sheet 0 pMT3b cDNA clone in bacterial cell DH5alpha D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (ijthe indications are nor jor all designated States) E. SEPARATE FURNISHING OF INDICATIONS neave btank ynosappdcabrei The indications listed below will be submitted to the intemational Bureau later (specijv the generai nature of the indications, e.g., "Accession Number ojDeposit') For receivine Office use only For international Bureau use only )14-This sheet was received with the intemational application ~ This sheet was received by the intemational Bureau on:
Authorize officerem mm Authorized officer PCT lntematlorral Dlvlai=
Fonn PCT/RO/134 (July 1992) WO 99/67397 PCT/US99/14373 "

INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in the description on page 16, line 1.

B. IDENTIFICATION OF DEPOSIT Furthcr deposits are identified on an additional sheet ~
Name of depositary institution American Type Culture Collection (ATCC ) Address of depositary institution (including postal code and country) 10801 University Boulevard Manassas, Virginia 20110-2209 United States of America Date of deposit July 10, 1998 Accession Number 98809 C. ADDITIONAL INDICATIONS (leave blank ijnot applicable) This information is continued on an additional sheet ~
pMT3A (human) cDNA clone in bacterial cell DH5alpha D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (f the indications are notjor all designated States) E. SEPARATE FURNISHING OF INDICATIONS (leare blank Inot applicabrel The indications listed below will be submitted to the intemational Bureau later (specifv the general nature ojthe indications, e.g., "Accession iti'umber ojDeposil') For receiving Office use only For Intemational Bureau use onh)~1 This sheet was reccived with the intemational application ~ This sheet was received by the Intemational Bureau on:
Authorized officer Authorized officer SCt" seMM
PCT rrnemadcnw olyisim Fotm PCT/RO/l34 (July 1992) INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in the description on page 16, line l.

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet ~
Name of depositary institution American Type Culture Collection (ATCC) Address of depositary institution (including postal code and country) 10801 University Boulevard Manassas, Virginia 20 1 1 0-2209 United States of America Date of deposit July 10, 1998 Accession Number 98809 C. ADDITIONAL INDICATIONS (leave blank ijnot applicable) This information is continued on an additional sheet ~
pMT3A (human) cDNA clone in bacterial cell DH5alpha In respect of those designations in which a European Patent is sought a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28(4) EPC).

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (iJthe indications are nar jor all designared States) E. SEPARATE FURNISHING OF INDICATIONS Ilea+-e blank inoa applieab/e) The indications listed below will be submitted to the intemational Bureau later (specify the general nature ojthe indications, e.g., "Accession Number ojDeposit') For receiving Office use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the international Bureau on:
Authorizcd o~ ~ Authorized officer =PCf1T tntematloRW DlyeSbg Fortn PCT/RO/134 (July 1992) INDICATIONS RELATING TO A DEPOSITED MICROORGANISM.
(PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in the description on page 16, line 1.

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution American Type Culture Collection (ATCC) Address of depositary institution (including postal code and country) 10801 University Boulevard Manassas, Virginia 20 1 1 0-2209 United States of America Date of deposit June 16, 1998 Accession Number 209933 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This infotmation is continued on an additional sheet ~
pMT3a cDNA clone in bacterial cell DH5alpha In respect of those designations in which a European Patent is sought a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sampie to an expert nominated by the person requesting the sample (Rule 28(4) EPC).

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (itthe indications are not for all designated States) E. SEPARATE FURNISHING OF INDICATIONS tteavebtank;nm appi;eabie/
The indications listed below will be submitted to the intemational Bureau later (specify the general nature of the indications, e.g., "Accession Number of Deposit") For recciving Office use only For International Bureau use only IK This sheet was received with the intemational application ~ This sheet was received by the lnternational Bureau on:
Authorized ofticer Authorized officer 80f" ftf=
PCT tiftmaduua! OK41ple Form PCTIRO/134 (July 1992) WO 99/67397. PCT/US99/14373 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13bis) A. The indications made below relate to the microorganism referred to in the description on page line B. IDENTIFICATION OF DEPOSIT Funher deposits are identified on an additional sheet Name of depositary institution American Type Culture Collection (ATCC) Address of depositary institution (including postal code and country) 10801 University Boulevard Manassas, Virginia 20 1 1 0-2209 United States of America Date of deposit June 16, 1998 Accession Number 209934 C. ADDITIONAL INDICATIONS /leave blank ijnot applicable) This information is continued on an additional sheet 0 pMT3b cDNA clone in bacterial cell DH5alpha In respect of those designations in which a European Patent is sought a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28(4) EPC).

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (f the indications are not jor all designated States) E. SEPARATE FURNISHING OF INDICATIONS tteme btmik t/naappiscab/e/
The indications listed below will be submitted to the intemational Bureau later (specify the general nature of the indications, e.g..
"Accession Number ojDeposit') For receiving Office use only For International Bureau use only This sheet was received with the intemational application ~ This sheet was received by the Intemational Bureau on:
Authorized officer Authorized officer ~ mmbpw omaim Form PCT/RO/134 (July 1992) -~.-SEQUENCE LISTING
<110> The General Hospital Corporation <120> De Novo DNA Cytosine Methyltransferase Genes, Polypeptides & Uses Thereof <130> 184-336 <140> CA 2,331,781 <141> 1999-06-25 <150> PCT/US99/14373 <151> 1999-06-25 <150> 60/090,906 <151> 1998-06-25 <150> 60/093,993 <151> 1998-07-24 <160> 82 <170> PatentIn Ver. 2.0 <210> 1 <211> 4192 <212> DNA
<213> Mus musculus <220>
<221> Unsure <222> (4161) .. (4161) <223> May be any nucleic acid <400> 1 gaattccggc ctgctgccgg gccgcccgac ccgccgggcc acacggcaga gccgcctgaa 60 gcccagcgct gaggctgcac ttttccgagg gcttgacatc agggtctatg tttaagtctt 120 agctcttgct tacaaagacc acggcaattc cttctctgaa gccctcgcag ccccacagcg 180 ccctcgcagc cccagcctgc cgcctactgc ccagcaatgc.cctccagcgg ccccggggac 240 accagcagct cctctctgga gcgggaggat gatcgaaagg aaggagagga acaggaggag 300 aaccgtggca aggaagagcg ccaggagccc agcgccacgg cccggaaggt ggggaggcct 360 ggccggaagc gcaagcaccc accggtggaa agcagtgaca cccccaagga cccagcagtg 420 accaccaagt ctcagcccat ggcccaggac tctggcccct cagatctgct acccaatgga 480 gacttggaga agcggagtga accccaacct gaggaaggga gcccagctgc agggcagaag 540 ggtggggccc cagctgaagg agagggaact gagaccccac cagaagcctc cagagctgtg 600 gagaatggct gctgtgtgac caaggaaggc cgtggagcct ctgcaggaga gggcaaagaa 660 cagaagcaga ccaacatcga atccatgaaa atggagggct cccggggccg actgcgaggt 720 ggcttgggct gggagtccag cctccgtcag cgacccatgc caagactcac cttccaggca 780 ggggacccct actacatcag caaacggaaa cgggatgagt ggctggcacg ttggaaaagg 840 gatgctgaga agaaagccaa ggtaattgca gtaatgaatg ctgtggaaga gaaccaggcc 900 tctggagagt ctcagaaggt ggaggaggcc agccctcctg ctgtgcagca gcccacggac 960 cctgcttctc cgactgtggc caccacccct gagccagtag gaggggatgc tggggacaag 1020 aatgctacca aagcacccga cgatgagcct gagtatgagg atggccgggg ctttggcatt 1080 ggagagctgg tgtgggggaa acttcggggt ttctcttggt ggccaggccg aattgtgtct 1140 tggtggatga caggccggag ccgagcagct gaaggcactc gctgggtcat gtggttcgga 1200 gatggcaagt tctcagtggt gtgtgtggag aagctcatgc cgctgagctc cttctgcagt 1260 gcattccacc aggccaccta caacaagcag cccatgtacc gcaaagccat ctacgaagtc 1320 ctccaggtgg ccagcagccg tgccgggaag ctgtttccag cttgccatga cagtgatgaa 1380 agtgacagtg gcaaggctgt ggaagtgcag aacaagcaga tgattgaatg ggccctcggt 1440 ggcttccagc cctcgggtcc taagggcctg gagccaccag aagaagagaa gaatccttac 1500 aaggaagttt acaccgacat gtgggtggag cctgaagcag ctgcttacgc cccaccccca 1560 ccagccaaga aacccagaaa gagcacaaca gagaaaccta aggtcaagga gatcattgat 1620 gagcgcacaa gggagcggct ggtgtatgag gtgcgccaga agtgcagaaa catcgaggac 1680 atttgtatct catgtgggag cctcaatgtc accctggagc acccattctt cattggaggc 1740 atgtgccaga actgtaagaa ctgcttcttg gagtgtgctt accagtatga cgacgatggg 1800 taccagtcct attgcaccat ctgctgtggg gggcgtgaag tgctcatgtg tgggaacaac 1860 aactgctgca ggtgcttttg tgtcgagtgt gtggatctct tggtggggcc aggagctgct 1920 caggcagcca ttaaggaaga cccctggaac tgctacatgt gcgggcataa gggcacctat 1980 gggctgctgc gaagacggga agactggcct tctcgactcc agatgttctt tgccaataac 2040 catgaccagg aatttgaccc cccaaaggtt tacccacctg tgccagctga gaagaggaag 2100 cccatccgcg tgctgtctct ctttgatggg attgctacag ggctcctggt gctgaaggac 2160 ctgggcatcc aagtggaccg ctacattgcc tccgaggtgt gtgaggactc catcacggtg 2220 ggcatggtgc ggcaccaggg aaagatcatg tacgtcgggg acgtccgcag cgtcacacag 2280 aagcatatcc aggagtgggg cccattcgac ctggtgattg gaggcagtcc ctgcaatgac 2340 ctctccattg tcaaccctgc ccgcaaggga ctttatgagg gtactggccg cctcttcttt 2400 gagttctacc gcctcctgca tgatgcgcgg cccaaggagg gagatgatcg ccccttcttc 2460 tggctctttg agaatgtggt ggccatgggc gttagtgaca agagggacat ctcgcgattt 2520 cttgagtcta accccgtgat gattgacgcc aaagaagtgt ctgctgcaca cagggcccgt 2580 tacttctggg gtaaccttcc tggcatgaac aggcctttgg catccactgt gaatgataag 2640 ctggagctgc aagagtgtct ggagcacggc agaatagcca agttcagcaa agtgaggacc 2700 attaccacca ggtcaaactc tataaagcag ggcaaagacc agcatttccc cgtcttcatg 2760 aacgagaagg aggacatcct gtggtgcact gaaatggaaa gggtgtttgg cttccccgtc 2820 cactacacag acgtctccaa catgagccgc ttggcgaggc agagactgct gggccgatcg 2880 tggagcgtgc cggtcatccg ccacctcttc gctccgctga aggaatattt tgcttgtgtg 2940 taagggacat gggggcaaac tgaagtagtg atgataaaaa agttaaacaa acaaacaaac 3000 aaaaaacaaa acaaaacaat aaaacaccaa gaacgagagg acggagaaaa gttcagcacc 3060 cagaagagaa aaaggaattt aaagcaaacc acagaggagg aaaacgccgg agggcttggc 3120 cttgcaaaag ggttggacat catctcctga gttttcaatg ttaaccttca gtcctatcta 3180 aaaagcaaaa taggcccctc cccttcttcc cctccggtcc taggaggcga actttttgtt 3240 ttctactctt tttcagaggg gttttctgtt tgtttgggtt tttgtttctt gctgtgactg 3300 aaacaagaga gttattgcag caaaatcagt aacaacaaaa agtagaaatg ccttggagag 3360 gaaagggaga gagggaaaat tctataaaaa cttaaaatat tggttttttt tttttttcct 3420 tttctatata tctctttggt tgtctctagc ctgatcagat aggagcacaa acaggaagag 3480 aatagagacc ctcggaggca gagtctcctc tcccaccccc cgagcagtct caacagcacc 3540 attcctggtc atgcaaaaca gaacccaact agcagcaggg cgctgagaga acaccacacc 3600 agacactttc tacagtattt caggtgccta ccacacagga aaccttgaag aaaaccagtt 3660 tctagaagcc gctgttacct cttgtttaca gtttatatat atatgataga tatgagatat 3720 atatatataa aaggtactgt taactactgt acatcccgac ttcataatgg tgctttcaaa 3780 acagcgagat gagcaaagac atcagcttcc gcctggccct ctgtgcaaag ggtttcagcc 3840 caggatgggg agaggggagc agctggaggg ggttttaaca aactgaagga tgacccatat 3900 caccccccac ccctgcccca tgcctagctt cacctgccaa aaaggggctc agctgaggtg 3960 gtcggaccct ggggaagctg agtgtggaat ttatccagac tcgcgtgcaa taaccttaga 4020 atatgaatct aaaatgactg cctcagaaaa atggcttgag aaaacattgt ccctgatttt 4080 gaattcgtca gccacgttga aggccccttg tgggatcaga aatattccag agtgagggaa 4140 agtgacccgc cattaacccc ncctggagca aataaaaaaa catacaaaat gt 4192 <210> 2 <211> 4195 <212> DNA
<213> Mus musculus <400> 2 gaattccggg cgccggggtt aagcggccca agtaaacgta gcgcagcgat cggcgccgga 60 gattcgcgaa cccgacactc cgcgccgccc gccggccagg acccgcggcg cgatcgcggc 120 gccgcgctac agccagcctc acgacaggcc cgctgaggct tgtgccagac cttggaaacc 180 tcaggtatat acctttccag acgcgggatc tcccctcccc catccatagt gccttgggac 240 caaatccagg gccttctttc aggaaacaat gaagggagac agcagacatc tgaatgaaga 300 agagggtgcc agcgggtatg aggagtgcat tatcgttaat gggaacttca gtgaccagtc 360 ctcagacacg aaggatgctc cctcaccccc agtcttggag gcaatctgca cagagccagt 420 ctgcacacca gagaccagag gccgcaggtc aagctcccgg ctgtctaaga gggaggtctc 480 cagccttctg aattacacgc aggacatgac aggagatgga gacagagatg atgaagtaga 540 tgatgggaat ggctctgata ttctaatgcc aaagctcacc cgtgagacca aggacaccag 600 gacgcgctct gaaagcccgg ctgtccgaac ccgacatagc aatgggacct ccagcttgga 660 gaggcaaaga gcctccccca gaatcacccg aggtcggcag ggccgccacc atgtgcagga 720 gtaccctgtg gagtttccgg ctaccaggtc tcggagacgt cgagcatcgt cttcagcaag 780 cacgccatgg tcatcccctg ccagcgtcga cttcatggaa gaagtgacac ctaagagcgt 840 cagtacccca tcagttgact tgagccagga tggagatcag gagggtatgg ataccacaca 900 ggtggatgca gagagcatat atggagacag cacagagtat caggatgata aagagtttgg 960 aataggtgac ctcgtgtggg gaaagatcaa gggcttctcc tggtggcctg ccatggtggt 1020 gtcctggaaa gccacctcca agcgacaggc catgcccgga atgcgctggg tacagtggtt 1080 tggtgatggc aagttttctg agatctctgc tgacaaactg gtggctctgg ggctgttcag 1140 ccagcacttt aatctggcta ccttcaataa gctggtttct tataggaagg ccatgtacca 1200 cactctggag aaagccaggg ttcgagctgg caagaccttc tccagcagtc ctggagagtc 1260 actggaggac cagctgaagc ccatgctgga gtgggcccac ggtggcttca agcctactgg 1320 gatcgagggc ctcaaaccca acaagaagca accagtggtt aataagtcga aggtgcgtcg 1380 ttcagacagt aggaacttag aacccaggag acgcgagaac aaaagtcgaa gacgcacaac 1440 caatgactct gctgcttctg agtccccccc acccaagcgc ctcaagacaa atagctatgg 1500 cgggaaggac cgaggggagg atgaggagag ccgagaacgg atggcttctg aagtcaccaa 1560 caacaagggc aatctggaag accgctgttt gtcctgtgga aagaagaacc ctgtgtcctt 1620 ccaccccctc tttgagggtg ggctctgtca gagttgccgg gatcgcttcc tagagctctt 1680 ctacatgtat gatgaggacg gctatcagtc ctactgcacc gtgtgctgtg agggccgtga 1740 actgctgctg tgcagtaaca caagctgctg cagatgcttc tgtgtggagt gtctggaggt 1800 gctggtgggc gcaggcacag ctgaggatgc caagctgcag gaaccctgga gctgctatat 1860 gtgcctccct cagcgctgcc atggggtcct ccgacgcagg aaagattgga acatgcgcct 1920 gcaagacttc ttcactactg atcctgacct ggaagaattt gagccaccca agttgtaccc 1980 agcaattcct gcagccaaaa ggaggcccat tagagtcctg tctctgtttg atggaattgc 2040 aacggggtac ttggtgctca aggagttggg tattaaagtg gaaaagtaca ttgcctccga 2100 agtctgtgca gagtccatcg ctgtgggaac tgttaagcat gaaggccaga tcaaatatgt 2160 caatgacgtc cggaaaatca ccaagaaaaa tattgaagag tggggcccgt tcgacttggt 2220 gattggtgga agcccatgca atgatctctc taacgtcaat cctgcccgca aaggtttata 2280 tgagggcaca ggaaggctct tcttcgagtt ttaccacttg ctgaattata cccgccccaa 2340 ggagggcgac aaccgtccat tcttctggat gttcgagaat gttgtggcca tgaaagtgaa 2400 tgacaagaaa gacatctcaa gattcctggc atgtaaccca gtgatgatcg atgccatcaa 2460 ggtgtctgct gctcacaggg cccggtactt ctggggtaac ctacccggaa tgaacaggcc 2520 cgtgatggct tcaaagaatg ataagctcga gctgcaggac tgcctggagt tcagtaggac 2580 agcaaagtta aagaaagtgc agacaataac caccaagtcg aactccatca gacagggcaa 2640 aaaccagctt ttccctgtag tcatgaatgg caaggacgac gttttgtggt gcactgagct 2700 cgaaaggatc ttcggcttcc ctgctcacta cacggacgtg tccaacatgg gccgcggcgc 2760 ccgtcagaag ctgctgggca ggtcctggag tgtaccggtc atcagacacc tgtttgcccc 2820 cttgaaggac tactttgcct gtgaatagtt ctacccagga ctggggagct ctcggtcaga 2880 gccagtgccc agagtcaccc ctccctgaag gcacctcacc tgtccccttt ttagctcacc 2940 tgtgtggggc ctcacatcac tgtacctcag ctttctcctg ctcagtggga gcagagcctc 3000 ctggcccttg caggggagcc ccggtgctcc ctccgtgtgc acagctcaga cctggctgct 3060 tagagtagcc cggcatggtg ctcatgttct cttaccctga aactttaaaa cttgaagtag 3120 gtagtaagat ggctttcttt taccctcctg agtttatcac tcagaagtga tggctaagat 3180 accaaaaaaa caaacaaaaa cagaaacaaa aaacaaaaaa aaacctcaac agctctctta 3240 gtactcaggt tcatgctgca aaatcacttg agattttgtt tttaagtaac ccgtgctcca 3300 catttgctgg aggatgctat tgtgaatgtg ggctcagatg agcaaggtca aggggccaaa 3360 aaaaattccc cctctccccc caggagtatt tgaagatgat gtttatggtt taagtcttcc 3420 tggcaccttc cccttgcttt ggtacaaggg ctgaagtcct gttggtcttg tagcatttcc 3480 caggatgatg atgtcagcag ggatgacatc accaccttta gggcttttcc ctggcagggg 3540 cccatgtggc tagtcctcac gaagactgga gtagaatgtt tggagctcag gaagggtggg 3600 tggagtggcc ctcttccagg tgtgagggat acgaaggagg aagcttaggg aaatccattc 3660 cccactccct cttgccaaat gaggggccca gtccccaaca gctcaggtcc ccagaacccc 3720 ctagttcctc atgagaagct aggaccagaa gcacatcgtt ccccttatct gagcagtgtt 3780 tggggaacta cagtgaaaac cttctggaga tgttaaaagc tttttacccc acgatagatt 3840 gtgtttttaa ggggtgcttt ttttaggggc atcactggag ataagaaagc tgcatttcag 3900 aaatgccatc gtaatggttt ttaaacacct tttacctaat tacaggtgct attttataga 3960 agcagacaac acttcttttt atgactctca gacttctatt ttcatgttac catttttttt 4020 gtaactcgca aggtgtgggc ttttgtaact tcacaggtgt ggggagagac tgccttgttt 4080 caacagtttg tctccactgg tttctaattt ttaggtgcaa agatgacaga tgcccagagt 4140 ttacctttct ggttgattaa agttgtattt ctctaaaaaa aaaaaaaaaa aaaaa 4195 <210> 3 <211> 4416 <212> DNA
<213> Homo sapiens <400> 3 ggccggcgtc gaccgacagc gagcggaggg agggagcgag cgagcgagca gcagcggccg 60 ggagggaggg agggcgcgcg ggcggcggcg gcggcgagag cagaggacga gccgggacgc 120 ggcgccgcgg caccagggcg cgcagccggg ccggcccgac cccaccggcc atacggtgga 180 gccatcgaag cccccaccca caggctgaca gaggcaccgt tcaccagagg gctcaacacc 240 gggatctatg tttaagtttt aactctcgcc tccaaagacc acgataattc cttccccaaa 300 gcccagcagc cccccagccc cgcgcagccc cagcctgcct cccggcgccc agatgcccgc 360 catgccctcc agcggccccg gggacaccag cagctctgct gcggagcggg aggaggaccg 420 aaaggacgga gaggagcagg aggagccgcg tggcaaggag gagcgccaag agcccagcac 480 cacggcacgg aaggtggggc ggcctgggag gaagcgcaag caccccccgg tggaaagcgg 540 tgacacgcca aaggaccctg cggtgatctc caagtcccca tccatggccc aggactcagg 600 cgcctcagag ctattaccca atggggactt ggagaagcgg agtgagcccc agccagagga 660 ggggagccct gctggggggc agaagggcgg ggccccagca gagggagagg gtgcagctga 720 gaccctgcct gaagcctcaa gagcagtgga aaatggctgc tgcaccccca aggagggccg 780 aggagcccct gcagaagcgg gcaaagaaca gaaggagacc aacatcgaat ccatgaaaat 840 ggagggctcc cggggccggc tgcggggtgg cttgggctgg gagtccagcc tccgtcagcg 900 gcccatgccg aggctcacct tccaggcggg ggacccctac tacatcagca agcgcaagcg 960 ggacgagtgg ctggcacgct ggaaaaggga ggctgagaag aaagccaagg tcattgcagg 1020 aatgaatgct gtggaagaaa accaggggcc cggggagtct cacaaggtgg aggaggccag 1080 ccctcctgct gtgcagcagc ccactgaccc cgcatccccc actgtggcta ccacgcctga 1140 gcccgtgggg tccgatgctg gggacaagaa tgccaccaaa gcaggcgatg acgagccaga 1200 gtacgaggac ggccggggct ttggcattgg ggagctggtg tgggggaaac tgcggggctt 1260 ctcctggtgg ccaggccgca ttgtgtcttg gtggatgacg ggccggagcc gagcagctga 1320 aggcacccgc tgggtcatgt ggttcggaga cggcaaattc tcagtggtgt gtgttgagaa 1380 gctgatgccg ctgagctcgt tttgcagtgc gttccaccag gccacgtaca acaagcagcc 1440 catgtaccgc aaagccatct acgaggtcct gcaggtggcc agcagccgcg cggggaagct 1500 gttcccggtg tgccacgaca gcgatgagag tgacactgcc aaggccgtgg aggtgcagaa 1560 caagcccatg attgaatggg ccctgggggg cttccagcat tatggcccta agggcctgga 1620 gccaccagaa gaagagaaga atccctacaa agaagtgtac acggacatgt gggtggaacc 1680 tgaggcagct gcatacgcac cacctccacc agccaaaaag ccccggaaga gcacagcgga 1740 gaagcccaag gtcaaggaga ttattgatga gcgcacaaga gagcggctgg tgtacgaggt 1800 gcggcagaag tgccggaaca ttgaggacat ctgcatctcc tgtgggagcc tcaatgttac 1860 cctggaacac cccctcttcg ttggaggaat gtgccaaaac tgcaagaact gctttctgga 1920 gtgtgcgtac cagtacgacg acgacggcta ccagtcctac tgcaccatct gctgtggggg 1980 ccgtgaggtg ctcatgtgcg gaaacaacaa ctgctgcagg tgcttttgcg tggagtgtgt 2040 ggacctcttg gtggggccgg gggctgccca ggcagccatt aaggaagacc cctggaactg 2100 ctacatgtgc gggcacaagg gtacctacgg gctgctgcgg cggcgaaagg actggccctc 2160 ccggctccag atgttcttcg ctaataacca cgaccaggaa tttgaccctc caaaggttta 2220 cccacctgtc ccagctgaga aaaggaagcc catccgggtg ctgtctctct ttgatggaat 2280 cgctacaggg ctcctggtgc tgaaggactt gggcattcag gtggaccgct acattgcctc 2340 ggaggtgtgt gaggactcca tcacggtggg catggtgcgg caccagggga agatcatgta 2400 cgtcggggac gtccgcagcg tcacacagaa gcatatccag gagtggggcc cattcgatct 2460 ggtgattggg ggcagtccct gcaatgacct ctccatcgtc aaccctgctc gcaagggcct 2520 ctacgagggc actggccggc tcttctttga gttctaccgc ctcctgcatg atgcgcggcc 2580 caaggaggga gatgatcgcc ccttcttctg gctctttgag aatgtggtgg ccatgggcgt 2640 tagtgacaag agggacatct cgcgatttct cgagtccaac cctgtgatga ttgatgccaa 2700 agaagtgtca gctgcacaca gggcccgcta cttctggggt aaccttcccg gtatgaacag 2760 gccgttggca tccactgtga atgataagct ggagctgcag gagtgtctgg agcatggcag 2820 gatagccaag ttcagcaaag tgaggaccat tactacgagg tcaaactcca taaagcaggg 2880 caaagaccag cattttcctg tcttcatgaa tgagaaagag gacatcttat ggtgcactga 2940 aatggaaagg gtatttggtt tcccagtcca ctatactgac gtctccaaca tgagccgctt 3000 ggcgaggcag agactgctgg gccggtcatg gagcgtgcca gtcatccgcc acctcttcgc 3060 tccgctgaag gagtattttg cgtgtgtgta agggacatgg gggcaaactg aggtagcgac 3120 acaaagttaa acaaacaaac aaaaaacaca aaacataata aaacaccaag aacatgagga 3180 tggagagaag tatcagcacc cagaagagaa aaaggaattt aaaacaaaaa ccacagaggc 3240 ggaaataccg gagggctttg ccttgcgaaa agggttggac atcatctcct gatttttcaa 3300 tgttattctt cagtcctatt taaaaacaaa accaagctcc cttcccttcc tcccccttcc 3360 cttttttttc ggtcagacct tttattttct actcttttca gaggggtttt ctgtttgttt 3420 gggttttgtt tcttgctgtg actgaaacaa gaaggttatt gcagcaaaaa tcagtaacaa 3480 aaaatagtaa caataccttg cagaggaaag gtgggaggag aggaaaaaag ggaaattttt 3540 aaagaaatct atatattggg ttgttttttt ttttgttttt tgtttttttt ttttgggttt 3600 ttttttttta ctatatatct tttttttgtt gtctctagcc tgatcagata ggagcacaag 3660 caggggacgg aaagagagag acactcaggc ggcagcattc cctcccagcc actgagctgt 3720 cgtgccagca ccattcctgg tcacgcaaaa cagaacccag ttagcagcag ggagacgaga 3780 acaccacaca agacattttt ctacagtatt tcaggtgcct accacacagg aaaccttgaa 3840 gaaaatcagt ttctagaagc cgctgttacc tcttgtttac agtttatata tatatgatag 3900 atatgagata tatatataaa aggtactgtt aactactgta caacccgact tcataatggt 3960 gctttcaaac agcgagatga gtaaaaacat cagcttccac gttgccttct gcgcaaaggg 4020 tttcaccaag gatggagaaa gggagacagc ttgcagatgg,cgcgttctca cggtgggctc 4080 ttccccttgg tttgtaacga agtgaaggag gagaacttgg gagccaggtt ctccctgcca 4140 aaaagggggc tagatgaggt ggtcgggccc gtggacagct gagagtggga ttcatccaga 4200 ctcatgcaat aaccctttga ttgttttcta aaaggagact ccctcggcaa gatggcagag 4260 ggtacggagt cttcaggccc agtttctcac tttagccaat tcgagggctc cttgtggtgg 4320 gatcagaact aatccagagt gtgggaaagt gacagtcaaa accccacctg gagcaaataa 4380 aaaaacatac aaaacgtaaa aaaaaaaaaa aaaaaa 4416 <210> 4 <211> 4145 <212> DNA
<213> Homo sapiens <400> 4 ggccgcgaat tcggcacgag ccctgcacgg ccgccagccg gcctcccgcc agccagcccc 60 gacccgcggc tccgccgccc agccgcgccc cagccagccc tgcggcagga aagcatgaag 120 ggagacacca ggcatctcaa tggagaggag gacgccggcg ggagggaaga ctcgatcctc 180 gtcaacgggg cctgcagcga ccagtcctcc gactcgcccc caatcctgga ggctatccgc 240 accccggaga tcagaggccg aagatcaagc tcgcgactct ccaagaggga ggtgtccagt 300 ctgctaagct acacacagga cttgacaggc gatggcgacg gggaagatgg ggatggctct 360 gacaccccag tcatgccaaa gctcttccgg gaaaccagga ctcgttcaga aagcccagct 420 gtccgaactc gaaataacaa cagtgtctcc agccgggaga ggcacaggcc ttccccacgt 480 tccacccgag gccggcaggg ccgcaaccat gtggacgagt cccccgtgga gttcccggct 540 accaggtccc tgagacggcg ggcaacagca tcggcaggaa cgccatggcc gtcccctccc 600 agctcttacc ttaccatcga cctcacagac gacacagagg acacacatgg gacgccccag 660 agcagcagta ccccctacgc ccgcctagcc caggacagcc agcagggggg catggagtcc 720 ccgcaggtgg aggcagacag tggagatgga gacagttcag agtatcagga tgggaaggag 780 tttggaatag gggacctcgt gtggggaaag atcaagggct tctcctggtg gcccgccatg 840 gtggtgtctt ggaaggccac ctccaagcga caggctatgt ctggcatgcg gtgggtccag 900 tggtttggcg atggcaagtt ctccgaggtc tctgcagaca aactggtggc actggggctg 960 ttcagccagc actttaattt ggccaccttc aataagctcg tctcctatcg aaaagccatg 1020 taccatgctc tggagaaagc tagggtgcga gctggcaaga ccttccccag cagccctgga 1080 gactcattgg aggaccagct gaagcccatg ttggagtggg cccacggggg cttcaagccc 1140 actgggatcg agggcctcaa acccaacaac acgcaaccag tggttaataa gtcgaaggtg 1200 cgtcgtgcag gcagtaggaa attagaatca aggaaatacg agaacaagac tcgaagacgc 1260 acagctgacg actcagccac ctctgactac tgccccgcac ccaagcgcct caagacaaat 1320 tgctataaca acggcaaaga ccgaggggat gaagatcaga gccgagaaca aatggcttca 1380 gatgttgcca acaacaagag cagcctggaa gatggctgtt tgtcttgtgg caggaaaaac 1440 cccgtgtcct tccaccctct ctttgagggg gggctctgtc agacatgccg ggatcgcttc 1500 cttgagctgt tttacatgta tgatgacgat ggctatcagt cttactgcac tgtgtgctgc 1560 gagggccgag agctgctgct ttgcagcaac acgagctgct gccggtgttt ctgtgtggag 1620 tgcctggagg tgctggtggg cacaggcaca gcggccgagg ccaagcttca ggagccctgg 1680 agctgctaca tgtgtctccc gcagcgctgt catggcgtcc tgcggcgccg gaaggactgg 1740 aacgtgcgcc tgcaggcctt cttcaccagt gacacggggc ttgaatacga agcccccaag 1800 ctgtaccctg ccattcccgc agcccgaagg cggcccattc gagtcctgtc attgtttgat 1860 ggcatcgcga caggctacct agtcctcaaa gagttgggca taaaggtagg aaagtacgtc 1920 gcttctgaag tgtgtgagga gtccattgct gttggaaccg tgaagcacga ggggaatatc 1980 aaatacgtga acgacgtgag gaacatcaca aagaaaaata ttgaagaatg gggcccattt 2040 gacttggtga ttggcggaag cccatgcaac gatctctcaa atgtgaatcc agccaggaaa 2100 ggcctgtatg agggtacagg ccggctcttc ttcgaatttt accacctgct gaattactca 2160 cgccccaagg agggtgatga ccggccgttc ttctggatgt ttgagaatgt tgtagccatg 2220 aaggttggcg acaagaggga catctcacgg ttcctggagt gtaatccagt gatgattgat 2280 gccatcaaag tttctgctgc tcacagggcc cgatacttct ggggcaacct acccgggatg 2340 aacaggcccg tgatagcatc aaagaatgat aaactcgagc tgcaggactg cttggaatac 2400 aataggatag ccaagttaaa gaaagtacag acaataacca ccaagtcgaa ctcgatcaaa 2460 caggggaaaa accaactttt ccctgttgtc atgaatggca aagaagatgt tttgtggtgc 2520 actgagctcg aaaggatctt tggctttcct gtgcactaca cagacgtgtc caacatgggc 2580 cgtggtgccc gccagaagct gctgggaagg tcctggagcg tgcctgtcat ccgacacctc 2640 ttcgcccctc tgaaggacta ctttgcatgt gaatagttcc agccaggccc caagcccact 2700 ggggtgtgtg gcagagccag gacccaggag gtgtgattcc tgaaggcatc cccaggccct 2760 gctcttcctc agctgtgtgg gtcataccgt gtacctcagt tccctcttgc tcagtggggg 2820 cagagccacc tgactcttgc aggggtagcc tgaggtgccg cctccttgtg cacaaatcag 2880 acctggctgc ttggagcagc ctaacacggt gctcattttt tcttctccta aaactttaaa 2940 acttgaagta ggtagcaacg tggctttttt tttttccctt cctgggtcta ccactcagag 3000 aaacaatggc taagatacca aaaccacagt gccgacagct ctccaatact caggttaatg 3060 ctgaaaaatc atccaagaca gttattgcaa gagtttaatt tttgaaaact gggtactgct 3120 atgtgtttac agacgtgtgc agttgtaggc atgtagctac aggacatttt taagggccca 3180 ggatcgtttt ttcccagggc aagcagaaga gaaaatgttg tatatgtctt ttacccggca 3240 cattcccctt gcctaaatac aagggctgga gtctgcacgg gacctattag agtattttcc 3300 acaatgatga tgatttcagc agggatgacg tcatcatcac attcagggct attttttccc 3360 ccacaaaccc aagggcaggg gccactctta gctaaatccc tccccgtgac tgcaatagaa 3420 ccctctgggg agctcaggaa ggggtgtgct gagttctata atataagctg ccatatattt 3480 tgtagacaag tatggctcct ccatatctcc ctcttcccta ggagaggagt gtgaagcaag 3540 gagcttagat aagacacccc ctcaaaccca ttccctctcc aggagaccta ccctccacag 3600 gcacaggtcc ccagatgaga agtctgctac cctcatttct catcttttta ctaaactcag 3660 aggcagtgac agcagtcagg gacagacata catttctcat accttcccca catctgagag 3720 atgacaggga aaactgcaaa gctcggtgct ccctttggag attttttaat ccttttttat 3780 tccataagaa gtcgttttta gggagaacgg gaattcagac aagctgcatt tcagaaatgc 3840 tgtcataatg gtttttaaca ccttttactc ttcttactgg tgctattttg tagaataagg 3900 aacaacgttg acaagttttg tggggctttt tatacacttt ttaaaatctc aaacttctat 3960 ttttatgttt aacgttttca ttaaaatttt tttgtaactg gagccacgac gtaacaaata 4020 tggggaaaaa actgtgcctt gtttcaacag tttttgctaa tttttaggct gaaagatgac 4080 ggatgcctag agtttacctt atgtttaatt aaaatcagta tttgtctaaa aaaaaaaaaa 4140 aaaaa 4145 <210> 5 <211> 908 <212> PRT
<213> Mus musculus <400> 5 Met Pro Ser Ser Gly Pro Gly Asp Thr Ser Ser Ser Ser Leu Glu Arg Glu Asp Asp Arg Lys Glu Gly Glu Glu Gln Glu Glu Asn Arg Gly Lys Glu Glu Arg Gln Glu Pro Ser Ala Thr Ala Arg Lys Val Gly Arg Pro Gly Arg Lys Arg Lys His Pro Pro Val Glu Ser Ser Asp Thr Pro Lys Asp Pro Ala Val Thr Thr Lys Ser Gln Pro Met Ala Gln Asp Ser Gly Pro Ser Asp Leu Leu Pro Asn Gly Asp Leu Glu Lys Arg Ser Glu Pro Gln Pro Glu Glu Gly Ser Pro Ala Ala Gly Gln Lys Gly Gly Ala Pro Ala Glu Gly Glu Gly Thr Glu Thr Pro Pro Glu Ala Ser Arg Ala Val Glu Asn Gly Cys Cys Val Thr Lys Glu Gly Arg Gly Ala Ser Ala Gly Glu Gly Lys Glu Gln Lys Gln Thr Asn Ile Glu Ser Met Lys Met Glu Gly Ser Arg Gly Arg Leu Arg Gly Gly Leu Gly Trp Glu Ser Ser Leu Arg Gln Arg Pro Met Pro Arg Leu Thr Phe Gln Ala Gly Asp Pro Tyr Tyr Ile Ser Lys Arg Lys Arg Asp Glu Trp Leu Ala Arg Trp Lys Arg Asp Ala Glu Lys Lys Ala Lys Val Ile Ala Val Met Asn Ala Val Glu Glu Asn Gln Ala Ser Gly Glu Ser Gln Lys Val Glu Glu Ala Ser Pro Pro Ala Val Gin G1n Pro Thr Asp Pro Ala Ser Pro Thr Val Ala Thr Thr Pro Glu Pro Val Gly Gly Asp Ala Gly Asp Lys Asn Ala Thr Lys Ala Pro Asp Asp Glu Pro Glu Tyr Glu Asp Gly Arg Gly Phe Gly Ile Gly Glu Leu Val Trp Gly Lys Leu Arg Gly Phe Ser Trp Trp Pro Gly Arg Ile Val Ser Trp Trp Met Thr Gly Arg Ser Arg Ala Ala Glu Gly Thr Arg Trp Val Met Trp Phe Gly Asp Gly Lys Phe Ser Val Val Cys Val Glu Lys Leu Met Pro Leu Ser Ser Phe Cys Ser Ala Phe His Gln Ala Thr Tyr Asn Lys Gln Pro Met Tyr Arg Lys Ala Ile Tyr Glu Val Leu Gln Val Ala Ser Ser Arg Ala Gly Lys Leu Phe Pro Ala Cys His Asp Ser Asp Glu Ser Asp Ser Gly Lys Ala Val Glu Val Gln Asn Lys Gln Met Ile Glu Trp Ala Leu Gly Gly Phe Gln Pro Ser Gly Pro Lys Gly Leu Glu Pro Pro Glu Glu Glu Lys Asn Pro Tyr Lys Glu Val Tyr Thr Asp Met Trp Val Glu Pro Glu Ala Ala Ala Tyr Ala Pro Pro Pro Pro Ala Lys Lys Pro Arg Lys Ser Thr Thr Glu Lys Pro Lys Val Lys Glu Ile Ile Asp Glu Arg Thr Arg Glu Arg Leu Val Tyr Glu Val Arg Gln Lys Cys Arg Asn Ile Glu Asp Ile Cys Ile Ser Cys Gly Ser Leu Asn Val Thr Leu Glu His Pro Phe Phe Ile Gly Gly Met Cys Gln Asn Cys Lys Asn Cys Phe Leu Glu Cys Ala Tyr Gln Tyr Asp Asp Asp Gly Tyr Gin Ser Tyr Cys Thr Ile Cys Cys Gly Gly Arg Glu Val Leu Met Cys Gly Asn Asn Asn Cys Cys Arg Cys Phe Cys Val Glu Cys Val Asp Leu Leu Val Gly Pro Gly Ala Ala Gln Ala Ala Ile Lys Glu Asp Pro Trp Asn Cys Tyr Met Cys Gly His Lys Gly Thr Tyr Gly Leu Leu Arg Arg Arg Glu Asp Trp Pro Ser Arg Leu Gln Met Phe Phe Ala Asn Asn His Asp Gln Glu Phe Asp Pro Pro Lys Val Tyr Pro Pro Val Pro Ala Glu Lys Arg Lys Pro Ile Arg Val Leu Ser Leu Phe Asp Gly Ile Ala Thr Gly Leu Leu Val Leu Lys Asp Leu Gly Ile Gln Val Asp Arg Tyr Ile Ala Ser Glu Val Cys Glu Asp Ser Ile Thr Val Gly Met Val Arg His Gln Gly Lys Ile Met Tyr Val Gly Asp Val Arg Ser Val Thr Gln Lys His Ile Gln Glu Trp Gly Pro Phe Asp Leu Val Ile Gly Gly Ser Pro Cys Asn Asp Leu Ser Ile Val Asn Pro Ala Arg Lys Gly Leu Tyr Glu Gly Thr Gly Arg Leu Phe Phe Glu Phe Tyr Arg Leu Leu His Asp Ala Arg Pro Lys Glu Gly Asp Asp Arg Pro Phe Phe Trp Leu Phe Glu Asn Val Val Ala Met Gly Val Ser Asp Lys Arg Asp Ile Ser Arg Phe Leu Glu Ser Asn Pro Val Met Ile Asp Ala Lys Glu Val Ser Ala Ala His Arg Ala Arg Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg Pro Leu Ala Ser Thr Val Asn Asp Lys Leu Glu Leu Gln Glu Cys Leu Glu His Gly Arg Ile Ala Lys Phe Ser Lys Val Arg Thr Ile Thr Thr Arg Ser Asn Ser Ile Lys Gln Gly Lys Asp Gin His Phe Pro Val Phe Met Asn Glu Lys Glu Asp Ile Leu Trp Cys Thr Glu Met Glu Arg Val Phe Gly Phe Pro Val His Tyr Thr Asp Val Ser Asn Met Ser Arg Leu Ala Arg Gln Arg Leu Leu Gly Arg Ser Trp Ser Val Pro Val Ile Arg His Leu Phe Ala Pro Leu Lys Glu Tyr Phe Ala Cys Val <210> 6 <211> 859 <212> PRT
<213> Mus musculus <400> 6 Met Lys Gly Asp Ser Arg His Leu Asn Glu Glu Glu Gly Ala Ser Gly Tyr Glu Glu Cys Ile Ile Val Asn Gly Asn Phe Ser Asp Gln Ser Ser Asp Thr Lys Asp Ala Pro Ser Pro Pro Val Leu Glu Ala Ile Cys Thr Glu Pro Val Cys Thr Pro Glu Thr Arg Gly Arg Arg Ser Ser Ser Arg Leu Ser Lys Arg Glu Val Ser Ser Leu Leu Asn Tyr Thr Gin Asp Met Thr Gly Asp Gly Asp Arg Asp Asp Glu Val Asp Asp Gly Asn Gly Ser Asp Ile Leu Met Pro Lys Leu Thr Arg Glu Thr Lys Asp Thr Arg Thr Arg Ser Glu Ser Pro Ala Val Arg Thr Arg His Ser Asn Gly Thr Ser Ser Leu Glu Arg Gln Arg Ala Ser Pro Arg Ile Thr Arg Gly Arg Gin Gly Arg His His Val Gln Glu Tyr Pro Val Glu Phe Pro Ala Thr Arg Ser Arg Arg Arg Arg Ala Ser Ser Ser Ala Ser Thr Pro Trp Ser Ser Pro Ala Ser Val Asp Phe Met Glu Glu Val Thr Pro Lys Ser Val Ser Thr Pro Ser Val Asp Leu Ser Gln Asp Gly Asp Gln Glu Gly Met Asp Thr Thr Gln Val Asp Ala Glu Ser Ile Tyr Gly Asp Ser Thr Glu Tyr Gln Asp Asp Lys Glu Phe Gly Ile Gly Asp Leu Val Trp Gly Lys Ile Lys Gly Phe Ser Trp Trp Pro Ala Met Val Val Ser Trp Lys Ala Thr Ser Lys Arg Gln Ala Met Pro Gly Met Arg Trp Val Gln Trp Phe Gly Asp Gly Lys Phe Ser Glu Ile Ser Ala Asp Lys Leu Val Ala Leu Gly Leu Phe Ser Gln His Phe Asn Leu Ala Thr Phe Asn Lys Leu Val Ser Tyr Arg Lys Ala Met Tyr His Thr Leu Glu Lys Ala Arg Val Arg Ala Gly Lys Thr Phe Ser Ser Ser Pro Gly Glu Ser Leu Glu Asp Gln Leu Lys Pro Met Leu Glu Trp Ala His Gly Gly Phe Lys Pro Thr Gly Ile Glu Gly Leu Lys Pro Asn Lys Lys Gln Pro Val Val Asn Lys Ser Lys Val Arg Arg Ser Asp Ser Arg Asn Leu Glu Pro Arg Arg Arg Glu Asn Lys Ser Arg Arg Arg Thr Thr Asn Asp Ser Ala Ala Ser Glu Ser Pro Pro Pro Lys Arg Leu Lys Thr Asn Ser Tyr Gly Gly Lys Asp Arg Gly Glu Asp Glu Glu Ser Arg Glu Arg Met Ala Ser Glu Val Thr Asn Asn Lys Gly Asn Leu Glu Asp Arg Cys Leu Ser Cys Gly Lys Lys Asn Pro Val Ser Phe His Pro Leu Phe Glu Gly Gly Leu Cys Gln Ser Cys Arg Asp Arg Phe Leu Glu Leu Phe Tyr Met Tyr Asp Glu Asp Gly Tyr Gln Ser Tyr Cys Thr Val Cys Cys Glu Gly Arg Glu Leu Leu Leu Cys Ser Asn Thr Ser Cys Cys Arg Cys Phe Cys Val Glu Cys Leu Glu Val Leu Val Gly Ala Gly Thr Ala Glu Asp Ala Lys Leu Gln Glu Pro Trp Ser Cys Tyr Met Cys Leu Pro Gln Arg Cys His Gly Val Leu Arg Arg Arg Lys Asp Trp Asn Met Arg Leu Gln Asp Phe Phe Thr Thr Asp Pro Asp Leu Glu Glu Phe Glu Pro Pro Lys Leu Tyr Pro Ala Ile Pro Ala Ala Lys Arg Arg Pro Ile Arg Val Leu Ser Leu Phe Asp Gly Ile Ala Thr Gly Tyr Leu Val Leu Lys Glu Leu Gly Ile Lys Val Glu Lys Tyr Ile Ala Ser Glu Val Cys Ala Glu Ser Ile Ala Val Gly Thr Val Lys His Glu Gly Gln Ile Lys Tyr Val Asn Asp Val Arg Lys Ile Thr Lys Lys Asn Ile Glu Glu Trp Gly Pro Phe Asp Leu Val Ile Gly Gly Ser Pro Cys Asn Asp Leu Ser Asn Val Asn Pro Ala Arg Lys Gly Leu Tyr Glu Gly Thr Gly Arg Leu Phe Phe Glu Phe Tyr His Leu Leu Asn Tyr Thr Arg Pro Lys Glu Gly Asp Asn Arg Pro Phe Phe Trp Met Phe Glu Asn Val Val Ala Met Lys Val Asn Asp Lys Lys Asp Ile Ser Arg Phe Leu Ala Cys Asn Pro Val Met Ile Asp Ala Ile Lys Val Ser Ala Ala His Arg Ala Arg Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg Pro Val Met Ala Ser Lys Asn Asp Lys Leu Glu Leu Gln Asp Cys Leu Glu Phe Ser Arg Thr Ala Lys Leu Lys Lys Val Gln Thr Ile Thr Thr Lys Ser Asn Ser Ile Arg Gln Giy Lys Asn Gln Leu Phe Pro Val Val Met Asn Gly Lys Asp Asp Val Leu Trp Cys Thr Glu Leu Glu Arg Ile Phe Gly Phe Pro Ala His Tyr Thr Asp Val Ser Asn Met Gly Arg Gly Ala Arg Gln Lys Leu Leu Gly Arg Ser Trp Ser Val Pro Val Ile Arg His Leu Phe Ala Pro Leu Lys Asp Tyr Phe Ala Cys Glu <210> 7 <211> 912 <212> PRT
<213> Homo sapiens <400> 7 Met Pro Ala Met Pro Ser Ser Gly Pro Gly Asp Thr Ser Ser Ser Ala Ala Glu Arg Glu Glu Asp Arg Lys Asp Gly Glu Glu Gln Glu Glu Pro Arg Gly Lys Glu Glu Arg Gln Glu Pro Ser Thr Thr Ala Arg Lys Val Gly Arg Pro Gly Arg Lys Arg Lys His Pro Pro Val Glu Ser Gly Asp Thr Pro Lys Asp Pro Ala Val Ile Ser Lys Ser Pro Ser Met Ala Gln Asp Ser Gly Ala Ser Glu Leu Leu Pro Asn Gly Asp Leu Glu Lys Arg Ser Glu Pro Gln Pro Glu Glu Gly Ser Pro Ala Gly Gly Gln Lys Gly Gly Ala Pro Ala Glu Gly Glu Gly Ala Ala Glu Thr Leu Pro Glu Ala Ser Arg Ala Val Glu Asn Gly Cys Cys Thr Pro Lys Glu Gly Arg Gly Ala Pro Ala Glu Ala Gly Lys Glu Gln Lys Glu Thr Asn Ile Glu Ser Met Lys Met Glu Gly Ser Arg Gly Arg Leu Arg Gly Gly Leu Gly Trp Glu Ser Ser Leu Arg Gln Arg Pro Met Pro Arg Leu Thr Phe Gln Ala Gly Asp Pro Tyr Tyr Ile Ser Lys Arg Lys Arg Asp Glu Trp Leu Ala Arg Trp Lys Arg Glu Ala Glu Lys Lys Ala Lys Val Ile Ala Gly Met Asn Ala Val Glu Glu Asn Gln Gly Pro Gly Glu Ser His Lys Val Glu Glu Ala Ser Pro Pro Ala Val Gln Gln Pro Thr Asp Pro Ala Ser Pro Thr Val Ala Thr Thr Pro Glu Pro Val Gly Ser Asp Ala Gly Asp Lys Asn Ala Thr Lys Ala Gly Asp Asp Glu Pro Glu Tyr Glu Asp Gly Arg Gly Phe Gly Ile Gly Glu Leu Val Trp Gly Lys Leu Arg Gly Phe Ser Trp Trp Pro Gly Arg Ile Val Ser Trp Trp Met Thr Gly Arg Ser Arg Ala Ala Glu Gly Thr Arg Trp Val Met Trp Phe Gly Asp Gly Lys Phe Ser Val Val Cys Val Glu Lys Leu Met Pro Leu Ser Ser Phe Cys Ser Ala Phe His Gln Ala Thr Tyr Asn Lys Gln Pro Met Tyr Arg Lys Ala Ile Tyr Glu Val Leu Gln Val Ala Ser Ser Arg Ala Gly Lys Leu Phe Pro Val Cys His Asp Ser Asp Glu Ser Asp Thr Ala Lys Ala Val Glu Val Gln Asn Lys Pro Met Ile Glu Trp Ala Leu Gly Gly Phe Gln His Tyr Gly Pro Lys Gly Leu Glu Pro Pro Glu Glu Glu Lys Asn Pro Tyr Lys Glu Val Tyr Thr Asp Met Trp Val Glu Pro Glu Ala Ala Ala Tyr Ala Pro Pro Pro Pro Ala Lys Lys Pro Arg Lys Ser Thr Ala Glu Lys Pro Lys Val Lys Glu Ile Ile Asp Glu Arg Thr Arg Glu Arg Leu Val Tyr Glu Val Arg Gln Lys Cys Arg Asn Ile Glu Asp Ile Cys Ile Ser Cys Gly Ser Leu Asn Val Thr Leu Glu His Pro Leu Phe Val Gly Gly Met Cys Gln Asn Cys Lys Asn Cys Phe Leu Glu Cys Ala Tyr Gln Tyr Asp Asp Asp Gly Tyr Gln Ser Tyr Cys Thr Ile Cys Cys Gly Gly Arg Glu Val Leu Met Cys Gly Asn Asn Asn Cys Cys Arg Cys Phe Cys Val Glu Cys Val Asp Leu Leu Val Gly Pro Gly Ala Ala Gln Ala Ala Ile Lys Glu Asp Pro Trp Asn Cys Tyr Met Cys Gly His Lys Gly Thr Tyr Gly Leu Leu Arg Arg Arg Lys Asp Trp Pro Ser Arg Leu Gln Met Phe Phe Ala Asn Asn His Asp Gln Glu Phe Asp Pro Pro Lys Val Tyr Pro Pro Val Pro Ala Glu Lys Arg Lys Pro Ile Arg Val Leu Ser Leu Phe Asp Gly Ile Ala Thr Gly Leu Leu Val Leu Lys Asp Leu Gly Ile Gln Val Asp Arg Tyr Ile Ala Ser Glu Val Cys Glu Asp Ser Ile Thr Val Gly Met Val Arg His Gln Gly Lys Ile Met Tyr Val Gly Asp Val Arg Ser Val Thr Gln Lys His Ile Gin Glu Trp Gly Pro Phe Asp Leu Val Ile Gly Gly Ser Pro Cys Asn Asp Leu Ser Ile Val Asn Pro Ala Arg Lys Gly Leu Tyr Glu Gly Thr Gly Arg Leu Phe Phe Glu Phe Tyr Arg Leu Leu His Asp Ala Arg Pro Lys Glu Gly Asp Asp Arg Pro Phe Phe Trp Leu Phe Glu Asn Val Val Ala Met Gly Val Ser Asp Lys Arg Asp Ile Ser Arg Phe Leu Glu Ser Asn Pro Val Met Ile Asp Ala Lys Glu Val Ser Ala Ala His Arg Ala Arg Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg Pro Leu Ala Ser Thr Val Asn Asp Lys Leu Glu Leu Gln Glu Cys Leu Glu His Gly Arg Ile Ala Lys Phe Ser Lys Val Arg Thr Ile Thr Thr Arg Ser Asn Ser Ile Lys Gln Gly Lys Asp Gln His Phe Pro Val Phe Met Asn Glu Lys Glu Asp Ile Leu Trp Cys Thr Glu Met Glu Arg Val Phe Gly Phe Pro Val His Tyr Thr Asp Val Ser Asn Met Ser Arg Leu Ala Arg Gln Arg Leu Leu Gly Arg Ser Trp Ser Val Pro Val Ile Arg His Leu Phe Ala Pro Leu Lys Glu Tyr Phe Ala Cys Val <210> 8 <211> 853 <212> PRT
<213> Homo sapiens <400> 8 Met Lys Gly Asp Thr Arg His Leu Asn Gly Glu Glu Asp Ala Gly Gly Arg Glu Asp Ser Ile Leu Val Asn Gly Ala Cys Ser Asp Gin Ser Ser Asp Ser Pro Pro Ile Leu Glu Ala Ile Arg Thr Pro Glu Ile Arg Gly Arg Arg Ser Ser Ser Arg Leu Ser Lys Arg Glu Val Ser Ser Leu Leu Ser Tyr Thr Gln Asp Leu Thr Gly Asp Gly Asp Gly Glu Asp Gly Asp Gly Ser Asp Thr Pro Val Met Pro Lys Leu Phe Arg Glu Thr Arg Thr Arg Ser Glu Ser Pro Ala Val Arg Thr Arg Asn Asn Asn Ser Val Ser Ser Arg Glu Arg His Arg Pro Ser Pro Arg Ser Thr Arg Gly Arg Gln Gly Arg Asn His Val Asp Glu Ser Pro Val Glu Phe Pro Ala Thr Arg Ser Leu Arg Arg Arg Ala Thr Ala Ser Ala Gly Thr Pro Trp Pro Ser Pro Pro Ser Ser Tyr Leu Thr Ile Asp Leu Thr Asp Asp Thr Glu Asp Thr His Gly Thr Pro Gln Ser Ser Ser Thr Pro Tyr Ala Arg Leu Ala Gln Asp Ser Gln Gln Gly Gly Met Glu Ser Pro Gln Val Glu Ala Asp Ser Gly Asp Gly Asp Ser Ser Glu Tyr Gln Asp Gly Lys Glu Phe Gly Ile Gly Asp Leu Val Trp Gly Lys Ile Lys Gly Phe Ser Trp Trp Pro Ala Met Val Val Ser Trp Lys Ala Thr Ser Lys Arg Gin Ala Met Ser Gly Met Arg Trp Val Gln Trp Phe Gly Asp Gly Lys Phe Ser Glu Val Ser Ala Asp Lys Leu Val Ala Leu Gly Leu Phe Ser Gln His Phe Asn Leu Ala Thr Phe Asn Lys Leu Val Ser Tyr Arg Lys Ala Met Tyr His Ala Leu Glu Lys Ala Arg Val Arg Ala Gly Lys Thr Phe Pro Ser Ser Pro Gly Asp Ser Leu Glu Asp Gln Leu Lys Pro Met Leu Glu Trp Ala His Gly Gly Phe Lys Pro Thr Gly Ile Glu Gly Leu Lys Pro Asn Asn Thr Gln Pro Val Val Asn Lys Ser Lys Val Arg Arg Ala Gly Ser Arg Lys Leu Glu Ser Arg Lys Tyr Glu Asn Lys Thr Arg Arg Arg Thr Ala Asp Asp Ser Ala Thr Ser Asp Tyr Cys Pro Ala Pro Lys Arg Leu Lys Thr Asn Cys Tyr Asn Asn Gly Lys Asp Arg Gly Asp Glu Asp Gln Ser Arg Glu Gln Met Ala Ser Asp Val Ala Asn Asn Lys Ser Ser Leu Glu Asp Gly Cys Leu Ser Cys Gly Arg Lys Asn Pro Val Ser Phe His Pro Leu Phe Glu Gly Gly Leu Cys Gln Thr Cys Arg Asp Arg Phe Leu Glu Leu Phe Tyr Met Tyr Asp Asp Asp Gly Tyr Gln Ser Tyr Cys Thr Val Cys Cys Glu Gly Arg Glu Leu Leu Leu Cys Ser Asn Thr Ser Cys Cys Arg Cys Phe Cys Val Glu Cys Leu Glu Val Leu Val Gly Thr Gly Thr Ala Ala Glu Ala Lys Leu Gln Glu Pro Trp Ser Cys Tyr Met Cys Leu Pro Gln Arg Cys His Gly Val Leu Arg Arg Arg Lys Asp Trp Asn Val Arg Leu Gln Ala Phe Phe Thr Ser Asp Thr Gly Leu Glu Tyr Glu Ala Pro Lys Leu Tyr Pro Ala Ile Pro Ala Ala Arg Arg Arg Pro Ile Arg Val Leu Ser Leu Phe Asp Gly Ile Ala Thr Gly Tyr Leu Val Leu Lys Glu Leu Gly Ile Lys Val Gly Lys Tyr Val Ala Ser Glu Val Cys Glu Glu Ser Ile Ala Val Gly Thr Val Lys His Glu Gly Asn Ile Lys Tyr Val Asn Asp Val Arg Asn Ile Thr Lys Lys Asn Ile Glu Glu Trp Gly Pro Phe Asp Leu Val Ile Gly Gly Ser Pro Cys Asn Asp Leu Ser Asn Val Asn Pro Ala Arg Lys Gly Leu Tyr Glu Gly Thr Gly Arg Leu Phe Phe Glu Phe Tyr His Leu Leu Asn Tyr Ser Arg Pro Lys Glu Gly Asp Asp Arg Pro Phe Phe Trp Met Phe Glu Asn Val Val Ala Met Lys Val Gly Asp Lys Arg Asp Ile Ser Arg Phe Leu Glu Cys Asn Pro Val Met Ile Asp Ala Ile Lys Val Ser Ala Ala His Arg Ala Arg Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg Pro Val Ile Ala Ser Lys Asn Asp Lys Leu Glu Leu Gln Asp Cys Leu Glu Tyr Asn Arg Ile Ala Lys Leu Lys Lys Val Gln Thr Ile Thr Thr Lys Ser Asn Ser Ile Lys Gln Gly Lys Asn Gln Leu Phe Pro Val Val Met Asn Gly Lys Glu Asp Val Leu Trp Cys Thr Glu Leu Glu Arg Ile Phe Gly Phe Pro Val His Tyr Thr Asp Val Ser Asn Met Gly Arg Gly Ala Arg Gln Lys Leu Leu Gly Arg Ser Trp Ser Val Pro Val Ile Arg His Leu Phe Ala Pro Leu Lys Asp Tyr Phe Ala Cys Glu <210> 9 <211> 393 <212> DNA
<213> Mus musculus <400> 9 tttctacagt atttcaggtg cctaccacac aggaaacctt gaagaaaacc agtttctaga 60 agccgctgtt acctcttgtt tacagtttat atatatatga tagatatgag atatatatat 120 ataaaaggta ctgttaacta ctgtacatcc cgacttcata atggtgcttt caaaacagcg 180 agatgagcaa agacatcagc ttccgcctgg ccctcgtgtg caaatggcgt ttcatgccca 240 tggatggtgt agaggggagc agctggaggg ggtttcacaa actgaaggat gacccatatc 300 accccccacc cctgccccat gcctagcttc acctgccaaa aaggggctca gctgaggtgg 360 tcggaccctg gggaagctga gtgtggaatt tat 393 <210> 10 <211> 424 <212> DNA
<213> Mus musculus <400> 10 gaagaaaacc agtttctaga agccgctgtt acctcttgtt tacagtttat atatatatga 60 tagatatgag atatatatat ataaaaggta ctgttaacta ctgtacatcc cgacttcata 120 atggtgcttt caaaacagcg agatgagcaa agacatcagc ttccgcctgg ccctctgtgc 180 aaagggtttc agcccaggat ggtgagaggg gagcatctgg agggggtttt aacaaactga 240 aggatgaccc atatcacccc ccacccctgc cccatgccta gcttcacctg ccaaaaaggg 300 gctcagctga ggtggtcgga ccctggggaa gctgagtgtg gaatttatcc agactcgcgt 360 gcaataacct tagaatatga atctaaaatg actgcctcag aaaaatggct tgagaaaaca 420 ttgt 424 <210> 11 <211> 461 <212> DNA
<213> Mus musculus <400> 11 ,tttaaagcaa accacagagg aggaaaacgc cggaggcttg gccttgcaaa agggttggac 60 atcatctcct gagttttcaa tgttaacctt cagtcctatc taaaaagcaa aataggcccc 120 tccccttcgt tcccctccgg tcctaggagg cgaacttttt gttttctact ctttttcaga 180 ggggttttct gtttgtttgg gtttttgttt cttgctgtga ctgaaacaag agagttattg 240 cagcaaaatc agtaacaaca aaaagtagaa atgccttgga gcggaaaggg agagagggaa 300 aattctataa aaacttaaaa tattggtttt tttttttttc cttttctata tatctctttg 360 gttgtctcta gcctgatcag ataggagcac aaacaggaag agaatagaga ccctcggagg 420 cagagtctcc tctcccaccc cccgagcagt ctcaacagca c 461 <210> 12 <211> 465 <212> DNA
<213> Mus musculus <400> 12 tcagaggggt tttctgtttg tttgggtttt tgtttcttgc tgtgactgaa acaagagagt 60 tattgcagca aaatcagtaa caacaaaaag tagaaatgcc ttggagagga aagggagaga 120 gggaaaattc tataaaaact taaaatattg gttttttttt tttttccttt tctatatatc 180 tctttggttg tctctagcct gatcagatag gagcacaaac aggaagagaa tagagaccct 240 cggaggcaga gtctcctctc ccaccccccg agcagtctca acagcaccat tcctggtcat 300 gcaaaacaga acccaactag cagcagggcg ctgagagaac accacaccag acacttttct 360 acagtatttc aggtgcctac cacacaggaa accttgaaga aaaccagttt ctagaagccg 420 ctgttacctc ttgtttacag tttatatata tatgatagat atgag 465 <210> 13 <211> 393 <212> DNA
<213> Mus musculus <400> 13 aaaacgccgg aggcctttgc cttgcacaag ggttggacat catctcctga gttttcaatg 60 ttaaccttca gtcctatcta aaaagcaaaa taggcccctc cccttcttcc cctccggtcc 120 taggaggcga actttttgtt ttctactctt tttcagaggg gttttctgtt tgtttgggtt 180 tttgtttctt gctgtgactg aaacaagaga gttattgcag caaaatcagt aacaacaaaa 240 agtagaaatg ccttggagag gaaagggaga gagggaaaat tctataaaaa cttaaaatat 300 tggttttttt ttttttcctt ttctatatat cgctttggtt gtctctagcc tgatcagata 360 ggagcacaaa caggaagaga atagagaccc tcg 393 <210> 14 <211> 309 <212> DNA
<213> Mus musculus <400> 14 gtgatgattg acgccaaaga agtgtctgct gcacacaggg cccgttactt ctaggggtaa 60 ccttcctggc atgaacaggc ctttggatcc actgtgaatg ataagctgga gctgcaagag 120 tgtctggagc acggcagaat agccaagttc agcaaagtga ggaccattac caccaggtca 180 aactctataa agcagggcaa agaccagcat ttccccgtct tcatgaacga gaaggaggac 240 atcctgtggt gcactgaaat ggaaagggtc tttggcttcc ccgtccacta cacagacgtc 300 tccaacatg 309 <210> 15 <211> 341 <212> DNA
<213> Mus musculus <400> 15 tgttaacctt cagtcctatc taaaaagcaa aataggcccc tccccttctt cccctccggt 60 cctaggaggc gaactttttg ttttctactc tttttcagag gggttttctg tttgtttggg 120 tttttgtttc ttgctgtgac tgaaacaaga gagttattgc agcaaaatca gtaacaacaa 180 aaagtagaaa tgccttggag aggaaaggga gagagggaaa attctataaa aacttaaaat 240 attggttttt ttttttttcc ttttctatat atctctttgg ttgtctctag cctgatcaga 300 taggagcaca aacaggaaga gaatagagac cctcggaggc a 341 <210> 16 <211> 240 <212> DNA
<213> Mus musculus <220>
<221> Unsure <222> (32)..(32) <223> May be any nucleic acid <400> 16 acattttgta tgttttttta tttgctccag gnggggttaa tggcgggtca ctttccctca 60 ctctggaata tttctgatcc cacaaggggc cttcaacgtg gctgacgaat tcaaaatcag 120 ggacaatgtt ttctcaagcc atttttctga ggcagtcatt ttagattcat attctaaggt 180 tattgcacgc gagtctggat aaattccaca ctcagcttcc ccagggtccg accacctcag 240 <210> 17 <211> 256 <212> DNA
<213> Mus musculus <220>
<221> Unsure <222> (75)..(75) <223> May be any nucleic acid <400> 17 atcagcttcc gcctggccct ctgtgcaaag ggtttcagcc caggatgggg agaggggagc 60 agctggaggg ggttntaaca aactgaagga tgacccatat caccccccac ccctgcccca 120 tgcctagctt cacctgccaa aaaggggctc agctgaggtg gtcggaccct ggggaagctg 180 agtgtggaat ttatccagac tcgcgtgcaa taaccttaga atatgaatct aaaatgactg 240 cctcagaaaa atggct 256 <210> 18 <211> 435 <212> DNA
<213> Mus musculus <400> 18 gtggaagccc atgcaatgat ctctctaacg tcaatcctgc ccgcaaaggt ttatatgagg 60 gcacaggaag gctcttcttc gagttttacc acttgctgaa ttatacccgc cccaaggagg 120 gcgacaaccg tccattcttc tggatgttcg agaatgttgt ggccatgaaa gtgaatgaca 180 agaaagacat ctcaagattc ctggcatgta acccagtgat gatcgatgcc atcaaggtgt 240 ctgctgctca cagggcccgg tacttctggg gtaacctacc cggaatgaac aggcccgtga 300 tggcttcaaa gaatgataag ctcgagctgc aggactgcct ggagttcagt aggacagcaa 360 agttaaagaa agtgcagaca ataaccacca agtcgaactc catcagacag ggcaaaaacc 420 agcttttccc tgtag 435 <210> 19 <211> 522 <212> DNA
<213> Mus musculus <400> 19 gatgatgtca gcagggatga catcaccacc tttagggctt ttccctggca ggggcccatg 60 tggctagtcc tcacgaagac tggagtagaa tgtttggagc tcaggaaggg tgggtggagt 120 ggagtctctt ccaggtgtga gggatacgaa ggaggaagct tagggaaatc cattccccac 180 tccctcttgc caaatgaggg gcccagtccc caacagctca ggtccccaga accccctagt 240 tcctcatgag aagctaggac cagaagcaca tcgttcccct tatctgagca gtgtttgggg 300 aactacagtg aaaaccttct ggagatgtta aaagcttttt accccacgat agattgtgtt 360 tttaaggggt gcttttttta ggggcatcac tggagataag aaagctgcat ttcagaaatg 420 ccatcgtaat ggtttttaaa caccttttac ctaattacag gtgctatttt atagaagcag 480 acaacacttc tttttatgac tctcagactt ctattttcat gt 522 <210> 20 <211> 348 <212> DNA
<213> Mus musculus <400> 20 aaaggaggcc cattagagtc ctgtctctgt ttgatggaat tgcaacgggg tacttggtgc 60 tcaaggagtt gggtattaaa gtggaaaagt acattgcctc cgaagtctgt gcagagtcca 120 tcgctgtggg aactgttaag catgaaggcc agatcaaata tgtcaatgac gtccggaaaa 180 tcaccaagaa aaatattgaa gagtggggcc cgttcgactt ggtgattggt ggaagcccat 240 gcaatgatct ctctaacgtc aatcctgccc gcaaaggttt atatgagggc acaggaaggc 300 tcttcttcga gttttaccac ttgctgaatt atacccgccc caaggagg 348 <210> 21 <211> 258 <212> DNA
<213> Mus musculus <400> 21 gtttatggtt taagtcttcc tggcaccttc cccttgcttt ggtacaaggg ctgaagtcct 60 gttggtcttg tagcatttcc caggatgatg atgtcagcag ggatgacatc atcaccttta 120 gggcttttcc ctggcagggg cccatgtggc tagtcctcac gaagactgga gtagaatgtt 180 tggagctcag gaagggtggg tggagtgtgc ctcttccagg tgtgagggat acgaaggagg 240 aagcttaggg aaatccat 258 <210> 22 <211> 334 <212> DNA
<213> Mus musculus <400> 22 tggggtaacc tacccggaat gaacagttaa agaaagtgca gacaataacc accaagtcga 60 actccatcag acagggcaaa aaccagcttt tccctgtagt catgaatggc aaggacgacg 120 ttttgtggtg cactgagctc gaaaggatct tcggcttccc tgctcactac acggacgtgt 180 ccaacatggg ccgcggcgcc cgtcagaagc tgctgggcag gtcctggagt gtaccggtca 240 tcagacacct gtttgccccc ttgaaggact actttgcctg tgaatagttc tacccaggac 300 tggggagctc tcggtcagag ccagtgccca gagt 334 <210> 23 <211> 299 <212> DNA
<213> Mus musculus <220>
<221> Unsure <222> (59)..(59) <223> May be any nucleic acid <220>
<221> Unsure <222> (173)..(173) <223> May be any nucleic acid <400> 23 ctgtttttgt ttgttttttt ggtatcttag ccatcacttc tgagtgataa actcaggang 60 gtaaaagaaa gccatcttac tacctacttc aagttttaaa gtttcagggt aagagaacat 120 gagcaccatg ccgggctact ctaagcagcc aggtctgagc tgtgcacacg ganggagcac 180 cggggctccc ctgcaaggcc aggaggctct gctcccactg agcaggagaa agctgaggta 240 cagtgatgtg aggccccaca caggtgagct aaaaagggga caggtgaggt gccttcagg 299 <210> 24 <211> 455 <212> DNA
<213> Mus musculus <400> 24 gatcgcttcc tagagctctt ctacatgtat gatgaggacg gctatcagtc ctactgcacc 60 gtgtctgtga gggccgtgaa ctgctgctgt gcagtaacac aagctgctgc agatgcttct 120 gtgtggagtg tctggaggtg ctggtgggcg caggacagct gaggatgcca agctgcagga 180 accctggagc tgctatatgt gcctccctca gcgctgccat ggggtcctcc gacgcaggaa 240 agattggaac atgcgcctgc aagacttctt cactactgat cctgacctgg aagaatttca 300 ggagccaccc aagttgtacc cagcaattcc tgcagccaaa aggaggccca ttagagtcct 360 gtctctgttt gatggaattg caacggggta cttggtgctc aaggagttgg gtattaaagt 420 ggaaaagtac attgcctccg aagtctgtgc agagt 455 <210> 25 <211> 368 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (307)..(307) <223> May be any nucleic acid <220>
<221> Unsure <222> (335)..(335) <223> May be any nucleic acid <220>
<221> Unsure <222> (353)..(353) <223> May be any nucleic acid <220>
<221> Unsure <222> (360)..(360) <223> May be any nucleic acid <400> 25 acgttttgta tgttttttta tttgctccag gtggggtttt gactgtcact ttcccacact 60 ctggattagt tctgatccca ccacaaggag ccctcgaatt ggctaaagtg agaaactggg 120 cctgaagact ccgtaccctc tgccatcttg ccgagggagt ctccttttag aaaacaatca 180 aagggttatt gcatgagtct ggatgaatcc cactctcagc ttgtccacgg gcccgaccac 240 ctcatctagc cccctttttg gcaagggaga acctggctcc caagttctcc tccttcactt 300 tcgttancaa accaaggggg aagaagccca ccgtngagaa cgcgccatct tgnaaagctn 360 ggtcttcc 368 <210> 26 <211> 399 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (87) .. (87) <223> May be any nucleic acid <220>
<221> Unsure <222> (314)..(314) <223> May be any nucleic acid <220>
<221> Unsure <222> (318)..(318) <223> May be any nucleic acid <220>
<221> Unsure <222> (370)..(370) <223> May be any nucleic acid <400> 26 gaacatgagg atggagagaa gtatcagcac ccagaagaga aaaaggaatt taaaacaaaa 60 accacagagg cggaaatacc ggaggcnttt gcttgcgaaa agggttggac atcatctcct 120 gatttttcaa tgttattctt cagtcctatt taaaaacaaa accaagctcc cttcccttcc 180 tcccccttcc cttttttttc ggtcagacct tttattttct actcttttca gaggggtttt 240 ctgtttgttt gggttttgtt tcttgctgtg actgaaacaa gaaggttatt gcagcaaaaa 300 tcaggtaaca aaanatangt aacaatacct tgcagaggaa aggtgggagg agaggaaaaa 360 agggaaattn ctatagaaat ctatatattg gggttggtt 399 <210> 27 <211> 318 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (205)..(205) <223> May be any nucleic acid <220>
<221> Unsure <222> (275)..(275) <223> May be any nucleic acid <400> 27 gtacgaggtg cggcagaagt gccggaacat tgaggacatc tgcatctcct gtgggagcct 60 caatgttacc ctggaacacc ccctcttcgt tggaggaatg tgccaaaact gcaagaactg 120 ctttctggag tgtgcgtacc agtacgacga cgacggctac cagtcctact gcaccatctg 180 ctgtgggggc cgtgaggtgc tcatntgcgg aaacaacaac tgctgcaggt gcttttgcgt 240 ggagtgtgtg gacctcttgg tggggccggg ggctncccag gcagcagtta aggaagatca 300 tgtacgtcgg ggacgtcc 318 <210> 28 <211> 259 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (227)..(227) <223> May be any nucleic acid <220>
<221> Unsure <222> (234)..(234) <223> May be any nucleic acid <400> 28 gagccgagca gctgaaggca cccgctgggt catgtggttc ggagacggca aattctcagt 60 ggtgtgtgtt gagaagctga tgccgctgag ctcgttttgc agtgcgttcc accaggccac 120 gtacaacaag cagcccatgt accgcaaagc catctacgag gtcctgcagg tggccagcag 180 ccgcgcgggg aagctgttcc cggtgtgcca cgacagcgat gagagtnaca ctgncaaggc 240 cgtgggaggt gcagaacaa 259 <210> 29 <211> 483 <212> DNA
<213> Homo sapiens <400> 29 tttttttttt ttgtatgttt ttttatttgc tccaggtggg gttttgactg tcactttccc 60 acactctgga ttagttctga tcccaccaca aggagccctc gaattggcta aagtgagaaa 120 ctgggcctga agactccgta ccctctgcca tcttgccgag ggagtctcct tttagaaaac 180 aatcaaaggg ttattgcatg agtctggatg aatcccactc tcagctgtcc acggggccga 240 ccacctcatc taggcccctt tttggcaagg agaacccggg tcccaagttc tcctccttca 300 cttcgttaca aaccaggggg aaaaagccca cgtgaaaacg cggcatctgc aaaatggttc 360 cctttcttca tccctgggga aacctttgcg ccaaggcaac gtggaaactg atggttttac 420 tcaactcgct gttttgaagc gccattatga aatcggggtt gtacgtaggt aaagtcccgt 480 gcc 483 <210> 30 <211> 337 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (41) . . (41) <223> May be any nucleic acid <220>
<221> Unsure <222> (45).. (45) <223> May be any nucleic acid <220>
<221> Unsure <222> (176)..(176) <223> May be any nucleic acid <220>
<221> Unsure <222> (190)..(190) <223> May be any nucleic acid <220>
<221> Unsure <222> (207)..(207) <223> May be any nucleic acid = CA 02331781 2005-04-22 <220>
<221> Unsure <222> (265)..(265) <223> May be any nucleic acid <220>
<221> Unsure <222> (290)..(290) <223> May be any nucleic acid <220>
<221> Unsure <222> (317)..(317) <223> May be any nucleic acid <220>
<221> Unsure <222> (322)..(322) <223> May be any nucleic acid <400> 30 gggcattcag gtggaccgct acattgcctc ggaggtgtgt naggnctcca tcacggtggg 60 catggtgcgg caccagggga agatcatgta cgtcggggac gtccgcagcg tcacacagaa 120 gcatatccag gagtggggcc cattcgatct ggtgattggg ggcagtccct gcaatnacct 180 ctccatcgtn aaccctgctc gcaaggncct ctacgagggc actggccggc tcttctttaa 240 gttctaccgc ctcctgcatg atgcncggcc caaggagggg agatgatcgn cccttcttct 300 ggctctttaa gaatgtngtg gnccatgggc gtttagt 337 <210> 31 <211> 271 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (234)..(234) <223> May be any nucleic acid <400> 31 cttgtttaca gtttatatat atatgataga tatgagatat atatataaaa ggtactgtta 60 actactgtac aacccgactt cataatggtg ctttcaaaca gcgagatgag taaaaacatc 120 agcttccacg ttgccttctg cgcaaagggt ttcaccaagg atggagaaag ggagacagct 180 tgcagatggc gcgttctcac ggtgggctct tccccttggt ttgtaacgaa gtgnaggagg 240 agaacttggg agccaggttc tccctgccaa a 271 <210> 32 <211> 430 <212> DNA
<213> Homo sapiens <400> 32 acgttttgta tgttttttta tttgctccag gtggggtttt gactgtcact ttcccacact 60 ctggattagt tctgatccca ccacaaggag ccctcgaatt ggctaaagtg agaaactggg 120 cctgaagact ccgtaccctc tgccatcttg ccgagggagt ctcctttaga aaacaatcaa 180 agggttattg catgagtctg gatgaatccc actctcagct gtccacgggc ccgaccacct 240 catctagccc cctttttggc agggagaacc tggctcccaa gttctcctcc ttcacttcgt 300 tacaaaccaa ggggaagagc ccaccgtgag aacgcgccat ctgcaagctg tctccctttc 360 tccatccttg gtgaaacccc tttgcgcaga aggcaacgtg gaagctgatg tttttactca 420 tctcgctgtt 430 <210> 33 <211> 483 <212> DNA
<213> Homo sapiens <400> 33 tttttttttt ttgtatgttt ttttatttgc tccaggtggg gttttgactg tcactttccc 60 acactctgga ttagttctga tcccaccaca aggagccctc gaattggcta aagtgagaaa 120 ctgggcctga agactccgta ccctctgcca tcttgccgag ggagtctcct tttagaaaac 180 aatcaaaggg ttattgcatg agtctggatg aatcccactc tcagctgtcc acggggccga 240 ccacctcatc taggcccctt tttggcaagg agaacccggg tcccaagttc tcctccttca 300 cttcgttaca aaccaggggg aaaaagccca cgtgaaaacg cggcatctgc aaaatggttc 360 cctttcttca tccctgggga aacctttgcg ccaaggcaac gtggaaactg atggttttac 420 tcaactcgct gttttgaagc gccattatga aatcggggtt gtacgtaggt aaagtcccgt 480 gcc 483 <210> 34 <211> 411 <212> DNA
<213> Homo sapiens <400> 34 ttttttttta cgttttgtat gtttttttat ttgctccagg tggggttttg actgtcactt 60 tcccacactc tggattagtt ctgatcccac cacaaggagc cctcgaattg gctaaagtga 120 gaaactgggc ctgaagactc cgtaccctct gccatcttgc cgagggagtc tccttttaga 180 aaacaatcaa agggttattg catgagtctg gatgaatccc actctcagct gtccacgggc 240 ccgaccacct catctagccc ccttttggca gggagaacct ggctcccaag ttctcctcct 300 tcacttcgtt acaaaccaag gggaagagcc caccgtgaga acgcgccatc tgcaagctgt 360 ctccctttct ccatccttgg tgaaaccctt tgcgcagaag gcaacgtgga a 411 <210> 35 <211> 530 <212> DNA
<213> Homo sapiens <400> 35 cgcctggacg agcccagact gctgggccgg tcatggagcg cgccagtcat ccgccacctc 60 ttcgctccgc tgaaggcgta ttttgcgtgt gtctaaggga catgggggca aactgaggta 120 gcgacacaaa gttaaacaca caaacacccc acacacaaca taatacaaca ccaagaacat 180 gaggatggag agaagtatca gccacccaga agagaacaag gaatttaaaa ccaaaaccac 240 agaggcggaa ataccggagg actttgcctt gcgaccaggg ttggacatca tctcctgatt 300 tttcaatgtt attcttcagt cctatttaaa aacaaaacca agctcccttc ccttcctgcg 360 gcttcccttt tttttcggtc agacctttta ttttctactc ttttcagagg ggttttctgt 420 ttgtttgggt tttgtttctt gctgtgactg aaacaagaag gttattgcag caaaaatcag 480 taacaaaaaa tagtaacaat accttgcaga ggaaaggtgg gagagaggaa 530 <210> 36 <211> 535 <212> DNA
<213> Homo sapiens <400> 36 tttacgtttt gtatgttttt ttatttgctc caggtggggt tttgactgtc actttcccac 60 actctggatt agttctgatc ccaccacaag gagccctcga attggctaaa gtgagaaact 120 gggcctgaag actccgtacc ctctgccatc ttgccgaggg agtctccttt tagaaaacaa 180 tcaaagggtt attgcatgag tctggatgaa tcccactctc agctgtccac gggcccgacc 240 acctcatcta gccccctttt tggcagggag aacctggctc ccaagttctc ctccttcact 300 tcgttacaaa ccacggggaa gagcccaccg tgagaacgcg ccatctgcaa gctgtctccc 360 tttctccatc cttggtgaaa ccctttgcgc agaaggcaac gtggaagctg atgtttttac 420 tcatctcgct gtttgaaagc accattatga agtcgggttg tacagtagtt aacagtacct 480 tttatatata tatctcatat ctatcatata tatataaact gtaaacaaga ggtaa 535 <210> 37 <211> 428 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (12) .. (12) <223> May be any nucleic acid <220>
<221> Unsure <222> (15) .. (15) <223> May be any nucleic acid <220>
<221> Unsure <222> (415)..(415) <223> May be any nucleic acid <220>
<221> Unsure <222> (424)..(424) <223> May be any nucleic acid <400> 37 acgttttgta tntantttta tttgctccag gtggggtttt gactgtcact ttcccacact 60 ctggattagt tctgatccca ccacaaggag ccctcgaatt ggctaaagtg agaaactggg 120 cctgaagact ccgtaccctc tgccatcttg ccgagggagt ctccttttag aaaacaatca 180 aagggttatt gcatgagtct ggatgaatcc cactctcagc tgtccacggg cccgaccacc 240 tcatctagcc ccctttttgg cagggagaac ctgggctccc aagttctcct ccttcacttc 300 gttacaaacc aaggggaagg agcccaccgt gagaacggcg ccatcttgca agctgtctcc 360 ctttctccat ccttgggtga aacccttttg cgcagaaggg caacgtggga agctngatgt 420 tttntaac 428 <210> 38 <211> 419 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (306)..(306) <223> May be any nucleic acid <220>
<221> Unsure <222> (325)..(325) <223> May be any nucleic acid -4 l -<220>
<221> Unsure <222> (341)..(341) <223> May be any nucleic acid <220>
<221> Unsure <222> (367)..(367) <223> May be any nucleic acid <220>
<221> Unsure <222> (385)..(385) <223> May be any nucleic acid <400> 38 atgggcgtta gtgacaagag ggacatctcg cgatttctcg agtccaaccc tgtgatgatt 60 gatgccaaag aagtgtcagc tgcacacagg gcccgctact tctggggtaa ccttcccggt 120 atgaacaggc cgttggatcc actgtgaatg ataagctgga gctgcaggag tgtctggagc 180 atggcaggat agccaagttc agcaaagtga ggaccattac tacgaggtca aactccataa 240 agcagggcaa agaccagcat tttcctgtct tcatgaatga gaaagaggac atcttatggt 300 gcactnaaat tggaaagggt atttngggtt tcccagtcca ntatactgac gtctccaaca 360 tgagccnctt tgggagggca gagantgctg gggccggttc atgggagcgt gcccagttc 419 <210> 39 <211> 437 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (2)..(2) <223> May be any nucleic acid <220>
<221> Unsure <222> (11) . . (11) <223> May be any nucleic acid <220>
<221> Unsure <222> (23) . . (23) <223> May be any nucleic acid <220>
<221> Unsure <222> (76) .. (76) <223> May be any nucleic acid <220>

<221> Unsure <222> (224)..(224) <223> May be any nucleic acid <220>
<221> Unsure <222> (290)..(290) <223> May be any nucleic acid <220>
<221> Unsure <222> (362)..(362) <223> May be any nucleic acid <220>
<221> Unsure <222> (376)..(376) <223> May be any nucleic acid <220>
<221> Unsure <222> (386)..(386) <223> May be any nucleic acid <220>
<221> Unsure <222> (426)..(426) <223> May be any nucleic acid <400> 39 tnttttgttg nctctagcct gancagatag gagcacaagc aggggacgga aagagagaga 60 cactcaggcg gcacanttcc ctcccagcca ctgagctgtc gtgccagcac cattcctggt 120 cacgcaaaac agaacccagt tagcagcagg gagacgagaa caccacacaa gacatttttc 180 tacagtattt caggtgccta ccacacagga aaccttgaag aaantcagtt tctaggaagc 240 cgctgttacc tcttgtttac agtttatata tatatgatag atatgagatn tatatataaa 300 aggtactgtt aactactgta caacccgact tcataatggg tgctttcaaa caggcgaggt 360 gngtaaaaac atcagnttcc acgttngcct tttgcgcaaa gggtttcacc aggttgggga 420 aagggngaca gcttttt 437 <210> 40 <211> 385 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (340)..(340) <223> May be any nucleic acid <220>
<221> Unsure <222> (365)..(365) <223> May be any nucleic acid <220>
<221> Unsure <222> (376)..(376) <223> May be any nucleic acid <400> 40 tacgttttgt atgttttttt atttgctcca ggtggggttt tgactgtcac tttcccacac 60 tctggattag ttctgatccc accacaagga gccctcgaat tggctaaagt gagaaactgg 120 gcctgaagac tccgtaccct ctgccatctt gccgagggag tctcctttta gaaaacaatc 180 aaagggttat tgcatgagtc tggatgaatc ccactctcag ctgtccacgg gcccgaccac 240 ctcatctagc cccctttttg gcagggagaa cctgggctcc caagttctcc tccttcactt 300 cgttacaaac caaggggaag agcccaccgt gagaacgcgn catctgcaag ctgtctccct 360 ttttncatcc ttggtngaaa ccctt 385 <210> 41 <211> 294 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (66) .. (66) <223> May be any nucleic acid <220>
<221> Unsure <222> (73) . . (73) <223> May be any nucleic acid <220>
<221> Unsure <222> (267)..(267) <223> May be any nucleic acid <400> 41 aaaggtggga gagaggaaaa aaggaaattc tatagaaatc tatatattgg gttgtttttt 60 tttttntttt ttnttttttt ttttttgggt tttttttttt tactatatat cttttttttg 120 ttgtctctag cctgatcaga taggagcaca agcaggggac ggaaagagag agacactcag 180 gcggcacatt tgccctccca gccactgagc tgtcgtgcca gcaccattcc tgggtcacgc 240 aaaacagaac ccagttagca gcagggnaga cgagaacacc acacaagaca tttt 294 <210> 42 <211> 610 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (576)..(576) <223> May be any nucleic acid <220>
<221> Unsure <222> (590)..(590) <223> May be any nucleic acid <400> 42 tacgttttgt atgttttttt atttgctcca ggtggggttt tgactgtcac tttcccacac 60 tctggattag ttctgatccc accacaagga gccctcgaat tggctaaagt gagaaactgg 120 gcctgaagac tccgtaccct ctgccatctt gccgagggag tctcctttta gaaaacaatc 180 aaagggttat tgcatgagtc tggatgaatc ccactctcag ctgtccacgg gcccgaccac 240 ctcatctagc cccctttttg gcagggagaa cctggctccc aagttctcct ccttcacttc 300 gttacaaacc aaggggaaga gcccaccgtg agaacgcgcc atctgcaagc tgtctccctt 360 tctccatcct ttggtggaaa cccttttgcg cagaaggcaa cgtggaagct gatgttttta 420 ctcatctcgc tgtttgaaag caccattatg aagtcgggtt gtacagtagt taacagtacc 480 ttttatatat atatctcata tctatcatat atatataaac tggtaaacaa gaggtaacag 540 cgggcttcta gaaactgatt ttcttcaagg tttccngtgt ggtaggcacn tgaaatactg 600 gtagaaaatg 610 <210> 43 <211> 283 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (72)..(72) <223> May be any nucleic acid <220>
<221> Unsure <222> (272)..(272) <223> May be any nucleic acid <400> 43 taactttgtg tcgctacctc agtttgcccc catgtccctt acacacacgc aaaatactcc 60 ttcagcggag anacgaggtg gcggatgact ggcacgctcc atgaccggcc cagcagtctc 120 tgcctcgcca agcggctcat gttggagacg tcagtatagt ggactgggaa accaaatacc 180 ctttccattt cagtgcacca taagatgtcc tctttctcat tcatgaagac aggaaaaatg 240 ctggtctttg gcctgcttta tggagttttg anctcgtaag taa 283 <210> 44 <211> 383 <212> DNA
<213> Homo sapiens <400> 44 gcggggacgt ccgcagcgtc acacagaagc atatccagga gtggggccca ttcgatctgg 60 tgattggggg cagtccctgc aatgacctct ccatcgtcaa ccctgctcgc aagggcctct 120 acgagggcac tggccggctc ttctttgagt tctaccgcct cctgcatgat gcgcggccca 180 aggagggaga tgatcgcccc ttctctggct ctttgagaat ttggtggcca tggcgttagt 240 acacagagag gacacatctc gcgatttctc gagtccaacc ctgtatatga ttgatgccaa 300 agaagtctca tctgcacaga ggcccctcta cttctggggt cacctccccg tattaacagg 360 ccgtaggatc cactgttatt ata 383 <210> 45 <211> 447 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (445) .. (445) <223> May be any nucleic acid <400> 45 acgttttgta tgttttttta tttgctccag gtggggtttt gactgtcact ttcccacact 60 ctggattagt tctgatccca ccacaaggag ccctcgaatt ggctaaagtg agaaactggg 120 cctgaagact ccgtaccctc tgccatcttg ccgagggagt ctccttttag aaaacaatca 180 aagggttatt gcatgagtct ggatgaatcc cactctcagc tgtccacggg cccgaccacc 240 tcatctaagc cccctttttg gcagggagaa cctggctccc aagttctcct ccttcacttc 300 gttacaaacc aaggggaaga gcccaccgtg agaacgcgcc atctgcaagc tgtctccctt 360 tctccatcct tggtgaaacc tttgcgcaga aggcaacgtg gaaagctgaa ggtttttact 420 catctcgctg tttgaaaagc accanta 447 <210> 46 <211> 100 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (96) . . (96) <223> May be any nucleic acid <400> 46 acaccaagaa catgagggat ggagagaagt atcagcaccc agaagagaaa aaggaattta 60 aaacaaaaac cacagaggcg gaaataccgg tgactnttct 100 <210> 47 <211> 150 <212> DNA
<213> Homo sapiens <400> 47 tactccttca gcgggtagga ggtggcggat gactggcacg ctccatgacc ggcccagcag 60 tctctgcctc gccaagcgct catgttggag aggtcagtat agtggactgg gaaaccaaat 120 accctttcca tttcagtgca ccataagatg 150 <210> 48 <211> 237 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (7) . . (7) <223> May be any nucleic acid <220>
<221> Unsure <222> (42)..(42) <223> May be any nucleic acid <220>
<221> Unsure <222> (45)..(45) <223> May be any nucleic acid <400> 48 gctgtcncag gggtgtgtgg gtctaggagc ctggctggag gncancgctg ggtgggagct 60 tgggacaccg atgggcctgc atctgacctg ttgtgctcac tgcttaggac cctccaaagg 120 tttacccacc tgtcccagct gagaagagga agcccatccg ggtgctgtct ctctttgatg 180 gaatcgctac aggtgagggg tgcaggccca agaggtgctg gcctcgtgcg aattcct 237 <210> 49 <211> 442 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (19)..(19) <223> May be any nucleic acid <220>
<221> Unsure <222> (91)..(91) <223> May be any nucleic acid <220>
<221> Unsure <222> (137)..(137) <223> May be any nucleic acid <220>
<221> Unsure <222> (388)..(388) <223> May be any nucleic acid <220>
<221> Unsure <222> (397)..(397) <223> May be any nucleic acid <220>
<221> Unsure <222> (428)..(428) <223> May be any nucleic acid <400> 49 ttttttacta tatatcttnt ttttgttgtc tctagcctga tcagatagga gcacaagcag 60 gggacggaaa gagagagaca ctcaggcggc natttccctc ccagccactg agctgtcgtg 120 ccagcaccat tcctggncac gcaaaacaga acccagttag cagcagggag acgagaacac 180 cacacaagac atttttctac agtatttcag gtgcctacca cacaggaaac cttgaagaaa 240 atcagtttct aggaagccgc tgttacctct tgtttacagt ttatatatat atggatagga 300 tatgaggata tatatataaa agggtactgt ttaactactg taccaacccg actttcataa 360 tgggtgcttt tcaaacagcc gaggatgngg ttaaaancat cagcttccac gttgccttct 420 gcggcaangg gtttcaccag gg 442 <210> 50 <211> 395 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (343)..(343) <223> May be any nucleic acid <220>
<221> Unsure <222> (372)..(372) <223> May be any nucleic acid <220>
<221> Unsure <222> (379)..(379) <223> May be any nucleic acid <220>
<221> Unsure <222> (384)..(384) <223> May be any nucleic acid <400> 50 tacgttttgt atgttttttt atttgctcca ggtggggttt tgactgtcac tttcccacac 60 tctggattag ttctgatccc accacaagga gccctcgaat tggctaaagt gagaaactgg 120 gcctgaagac tccgtaccct ctgccatctt gccgagggag tctcctttta gaaaacaatc 180 aaagggttat tgcatgagtc tggatgaatc ccactctcag ctgtccacgg gcccgaccac 240 ctcatctagc cccctttttg ggcagggaga aacctgggct cccaagttct cctccttcac 300 ttcgttaaca aaccaagggg aagagcccac cgtgaggaac ggngccatct ggcaaggttg 360 ttctcccttt tnttccatnc cttnggtgaa aaccc 395 <210> 51 <211> 835 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (2) . . (9) <223> May be any nucleic acid <220>
<221> Unsure <222> (11)(16) <223> May be any nucleic acid <220>
<221> Unsure <222> (19)..(21) <223> May be any nucleic acid <220>
<221> Unsure <222> (32)..(32) <223> May be any nucleic acid <220>
<221> Unsure <222> (37)..(37) <223> May be any nucleic acid <220>
<221> Unsure <222> (46)..(46) <223> May be any nucleic acid <220>
<221> Unsure <222> (48)..(49) <223> May be any nucleic acid <220>
<221> Unsure <222> (62)..(63) <223> May be any nucleic acid <220>
<221> Unsure <222> (75)..(76) <223> May be any nucleic acid <220>
<221> Unsure <222> (120)..(120) <223> May be any nucleic acid <220>
<221> Unsure <222> (140)..(140) <223> May be any nucleic acid <220>
<221> Unsure <222> (146)(146) <223> May be any nucleic acid <220>
<221> Unsure <222> (199)..(199) <223> May be any nucleic acid <220>
<221> Unsure <222> (300)..(300) <223> May be any nucleic acid <220>
<221> Unsure <222> (365)..(365) <223> May be any nucleic acid <220>
<221> Unsure <222> (388)..(388) <223> May be any nucleic acid <220>
<221> Unsure <222> (397)..(397) <223> May be any nucleic acid <220>
<221> Unsure <222> (403)..(403) <223> May be any nucleic acid <220>
<221> Unsure <222> (421)..(421) <223> May be any nucleic acid <220>
<221> Unsure <222> (441)..(441) <223> May be any nucleic acid <220>
<221> Unsure <222> (461)..(461) <223> May be any nucleic acid <220>
<221> Unsure <222> (475)..(475) <223> May be any nucleic acid <220>
<221> Unsure <222> (494)..(494) <223> May be any nucleic acid <220>
<221> Unsure <222> (514)..(514) <223> May be any nucleic acid <220>
<221> Unsure <222> (536)..(537) <223> May be any nucleic acid <220>
<221> Unsure <222> (545)..(545) <223> May be any nucleic acid <220>
<221> Unsure <222> (550)..(550) <223> May be any nucleic acid <220>
<221> Unsure <222> (554)..(554) <223> May be any nucleic acid <220>
<221> Unsure <222> (562)..(562) <223> May be any nucleic acid <220>
<221> Unsure <222> (565)..(565) <223> May be any nucleic acid <220>
<221> Unsure <222> (569)..(569) <223> May be any nucleic acid <220>
<221> Unsure <222> (580)..(580) <223> May be any nucleic acid <220>
<221> Unsure <222> (584)..(584) <223> May be any nucleic acid <220>
<221> Unsure <222> (587)..(587) <223> May be any nucleic acid <220>
<221> Unsure <222> (595)..(595) <223> May be any nucleic acid <220>
<221> Unsure <222> (599)..(599) <223> May be any nucleic acid <220>
<221> Unsure <222> (617)..(617) <223> May be any nucleic acid <220>
<221> Unsure <222> (629)..(629) <223> May be any nucleic acid <220>
<221> Unsure <222> (639)..(639) <223> May be any nucleic acid <220>
<221> Unsure <222> (658)..(658) <223> May be any nucleic acid <220>
<221> Unsure <222> (660)..(660) <223> May be any nucleic acid <220>
<221> Unsure <222> (663) .. (663) <223> May be any nucleic acid <220>
<221> Unsure <222> (695)..(696) <223> May be any nucleic acid <220>
<221> Unsure <222> (699)..(701) <223> May be any nucleic acid <220>
<221> Unsure <222> (706)..(706) <223> May be any nucleic acid <220>
<221> Unsure <222> (710)..(710) <223> May be any nucleic acid <220>
<221> Unsure <222> (716)..(719) <223> May be any nucleic acid <220>
<221> Unsure <222> (727)..(727) <223> May be any nucleic acid <220>
<221> Unsure <222> (731)..(731) <223> May be any nucleic acid <220>
<221> Unsure <222> (735)..(737) <223> May be any nucleic acid <220>
<221> Unsure <222> (739)..(739) <223> May be any nucleic acid <220>
<221> Unsure <222> (743)..(745) <223> May be any nucleic acid <220>
<221> Unsure <222> (754)..(755) <223> May be any nucleic acid <220>
<221> Unsure <222> (781)..(781) <223> May be any nucleic acid <220>
<221> Unsure <222> (787)..(787) <223> May be any nucleic acid <220>
<221> Unsure <222> (790)..(790) <223> May be any nucleic acid <220>
<221> Unsure <222> (800)..(801) <223> May be any nucleic acid <220>
<221> Unsure <222> (805)..(805) <223> May be any nucleic acid <220>
<221> Unsure <222> (809)..(809) <223> May be any nucleic acid <220>
<221> Unsure <222> (820)..(820) <223> May be any nucleic acid <220>
<221> Unsure <222> (827)..(830) <223> May be any nucleic acid <220>
<221> Unsure <222> (832)..(832) <223> May be any nucleic acid <400> 51 cnnnnnnnng nnnnnnttnn nctgccttta tnctcgntgc cgatantnnt atccatcatc 60 annttcttgg tgttnnatta tgttttgtgt tttttgtttg tttgtttaac tttgtgtcgn 120 tacctcagtt tgcccccatn tccctnacac acacgcaaaa tactccttca gcggagcgaa 180 gaggtggcgg atgactggna cgctccatga ccggcccagc agtctctgcc tcgccaagcg 240 gatcatgttg gagacgtcag tatagtggac tgggaaacca aatacccttt ccatttcagn 300 gcaccataag atgtcctctt tctcattcat gaagacaggg aaaatgctgg tctttggcct 360 gctcnatgga gtttgactcc gtagtaangg ccctcanttt ggntgacttg ggctatcctg 420 ncatgctcca gacacttccg nagggtcaca acagaagcat nttccagggg gtggnggcca 480 ttccgacctt tggnggattg ggggggaagc cccnaaaaat aaccccttca aacggnnaaa 540 ccctngttcn gaangggccc cnttncgang ggaaactggn ccgnttnttt ctttngggnt 600 tcctcccccc ccccccnaaa ataatgggng gccccaagna ggggaattac cccccccncn 660 ttnttttttt tttggaaatt tgggggcccg ggggnnaann naaaanggcn acttcnnnnt 720 ttttggnccc ncccnnnant ttnnncccaa aaannttaat taaaaaggcc cttttctggg 780 ncccccnttn aaccgccccn ngatnggtnc ttggttcccn aacacannnn cncaa 835 <210> 52 <211> 479 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (364)..(364) <223> May be any nucleic acid <220>
<221> Unsure <222> (416)..(416) <223> May be any nucleic acid <220>
<221> Unsure <222> (464)..(464) <223> May be any nucleic acid <400> 52 tacgttttgt atgttttttt atttgctcca ggtggggttt tgactgtcac tttcccacac 60 tctggattag ttctgatccc accacaagga gccctcgaat tggctaaagt gagaaactgg 120 gcctgaagac tccgtaccct ctgccatctt gccgagggag tctcctttta gaaaacaatc 180 aaagggttat tgcatgagtc tggatgaatc ccactctcag ctgtccacgg gcccgaccac 240 ctcatctagc cccctttttg gcagggagaa cctggctccc aagttctcct ccttcacttc 300 gttacaaacc aaggggaaga gcccaccatg agaacgcgcc atctgcaagc tgtctccctt 360 tctncatcct tggtgaaacc tttgcgcaga aggcaacgtg gaagctgatg tttttntcat 420 ctcgctgttt gaaagcacca ttatgaagtc gggttgtaca gtantaacag tacttttag 479 <210> 53 <211> 521 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (327)..(327) <223> May be any nucleic acid <220>
<221> Unsure <222> (507)..(507) <223> May be any nucleic acid <400> 53 agaacaccac acaagacatt tttctacagt atttcaggtg cctaccacac aggaaacctt 60 gaagaaaatc agtttctaga agccgctgtt acctcttgtt tacagtttat atatatatga 120 tagatatgag atatatatat aaaaggtact gttaactact gtacaacccg acttcataat 180 ggtgctttca aacagcgaga tgagtaaaaa catcagcttc cacgttgcct tctgcgcaaa 240 gggtttcacc aaggatggag aaagggagac agcttgcaga tggcgcgttc tcatggtggg 300 ctcttcccct tggtttgtaa cgaagtntag gaggagaact tgggagccag gttctccctg 360 ccaaaaaggg ggctagatga ggtggtcggg cccgtggaca gctgagagtg ggattcatcc 420 agactcatgc aataaccctt tgattgtttc taaaaggaga ctccctcggc aagatggcag 480 agggtacgga gtcttcaggc ccagttntca ctttagccaa t 521 <210> 54 <211> 440 <212> DNA
<213> Homo sapiens <400> 54 ctctctttga tggaatcgct acagggctcc tggtgctgaa ggacttgggc attcaggtgg 60 accgctacat tgcctcggag gtgtgtgagg actccatcac ggtgggcatg gtgcggcacc 120 aggggaagat catgtacgtc ggggacgtcc gcagcgtcac acagaagcat atccaggagt 180 ggggcccatt cgatctggtg attgggggca gtccctgcaa tgacctctcc atcgtcaacc 240 ctgctcgcaa gggcctctac gagggcactg gccggctctt ctttgagttc taccgcctcc 300 tgcatgatgc gcggcccaag gagggagatg atcgcccctt cttctggctc tttgagaatg 360 tggtggccat gggcgtttag tgacaagagg gacatctcgc gatttctcga gtccaaccct 420 gtgatgattg atgccaaaga 440 <210> 55 <211> 273 <212> DNA
<213> Homo sapiens <400> 55 acgttttgta tgttttttta tttgctccag gtggggtttt gactgtcact ttcccacact 60 ctggattagt tctgatccca ccacaaggag ccctcgaatt ggctaaagtg agaaactggg 120 cctgaagact ccgtaccctc tgccatcttg ccgagggagt ctccttttag aaaacaatca 180 aagggttatt gcatgagtct ggatgaatcc cactctcagc tgtccacggg cccgaccacc 240 tcatctagcc ccctttttgg cagggagaac ctg 273 <210> 56 <211> 190 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (39)..(39) <223> May be any nucleic acid <220>
<221> Unsure <222> (83)..(83) <223> May be any nucleic acid <220>
<221> Unsure <222> (181)..(181) <223> May be any nucleic acid <400> 56 aaaaacacaa aacataataa aacaccaaga acatgaggnt ggagagaagt atcagcaccc 60 agaagagaaa aaggaattta aancaaaaac cacagaggcg gaaataccgg agggctttgc 120 cttgcgaaaa gggttggaca tcatctcctg atttttcaat gttattcttc agtcctattt 180 naaaacaaag 190 <210> 57 <211> 445 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (167)..(167) <223> May be any nucleic acid <220>
<221> Unsure <222> (353)..(353) <223> May be any nucleic acid <400> 57 ttagacaaat actgatttta attaaacata aggtaaactc taggcatccg tcatctttca 60 gcctaaaaat tagcaaaaac tgttgaaaca aggcacagtt ttttccccat atttgttacg 120 tcgtggctcc agttacaaaa aaattttaat gaaaacgtta aacatanaaa tagaagtttg 180 agattttaaa aagtgtataa aaagccccac aaaacttgtc aacggttgtt ccttattcta 240 caaaatagca ccagtaagaa gagtaaaagg tgttaaaaac catttatgac agcatttctg 300 aaatgcagct tgtctgaatt cccggttctc cctaaaaacg acttctttat ggnattaaaa 360 aagggtttaa aaaaatctcc aaaggggagc accgagcttt gcaggttttc cctgtcatct 420 ctcagatgtg ggggaagctc gtggc 445 <210> 58 <211> 287 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (38)..(38) <223> May be any nucleic acid <220>
<221> Unsure <222> (171)..(171) <223> May be any nucleic acid <220>
<221> Unsure <222> (204)..(204) <223> May be any nucleic acid <220>
<221> Unsure <222> (274)..(274) <223> May be any nucleic acid <400> 58 ttccccacat ctgagagatg acagggaaaa ctgcaaanct cggtgctccc tttggagatt 60 ttttaatcct tttttattcc ataagaagtc gtttttaggg agaacgggaa ttcagacaag 120 ctgcatttca gaaatgctgt cataatggtt tttaacacct tttactcctc nttactggtg 180 ctatttttgt agaataaggg aacnacgttg acaagttttg gtgggggcct ttttatacac 240 cttttttaaa atctccaact tcctaatttt taanggttta accgttt 287 <210> 59 <211> 535 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (452)..(452) <223> May be any nucleic acid <220>
<221> Unsure <222> (526)..(526) <223> May be any nucleic acid <400> 59 tagacaaata ctgattttaa ttaaacataa ggtaaactct aggcatccgt catctttcag 60 cctaaaaatt agcaaaaact gttgaaacaa ggcacagttt tttccccata tttgttacgt 120 cgtggctcca gttacaaaaa aattttaatg aaaacgttaa acataaaaat agaagtttga 180 gattttaaaa agtgtataaa aagccccaca aaacttgtca acgttgttcc ttattctaca 240 aaatagcacc agtaagaaga gtaaaaggtg ttaaaaacca ttatgacagc atttctgaaa 300 tgcagcttgt ctgaattccc gttctcccta aaaacgactt cttatggaat aaaaaaggat 360 taaaaaatct ccaaagggag caccgagctt tgcagttttc cctgtccgtc tctcagatgt 420 ggggaaggta tgagaaatgt atgtctgtcc cngactgctg tcactgcctc tgagttagta 480 aaaggtgaga atgagggtag cagcttccca tctggggcct gtgccngtgg agggt 535 <210> 60 <211> 449 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (7) . . (7) <223> May be any nucleic acid <220>
<221> Unsure <222> (200) . . (200) <223> May be any nucleic acid <400> 60 atcgcancag gctacctagt cctcaaagag ttgggcataa aggtaggaaa gtacgtcgct 60 tctgaagtgt gtgaggagtc cattgctgtt ggaaccgtga agcacgaggg gaatatcaaa 120 tacgtgaacg acgtgaggaa catcacaaag aaaaatattg aagaatgggg cccatttgac 180 ttggtgattg gcggaaccan tgcaacgatc tctcaaatgt gaatccagcc aggaaaggcc 240 tgtatgaggg tacaggccgg ctcttcttcg aattttacca cctgctgaat tactcacgcc 300 ccaaggaggg tgatgaccgg ccgttcttct ggatgtttga gaatgttgta gccatgaagg 360 ttggcgacaa gagggacatc tcacggttcc tggagtgtaa tccagtgatg attgatgcca 420 tccaaagttt ctgctgctca cagggcccg 449 <210> 61 <211> 522 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (146)..(146) <223> May be any nucleic acid <220>
<221> Unsure <222> (281)..(281) <223> May be any nucleic acid <220>
<221> Unsure <222> (304) . . (304) <223> May be any nucleic acid <400> 61 aagagggaca tctcacggtt cctggagtgt aatccagtga tgattgatgc catcaaagtt 60 tctgctgctc acagggcccg atacttctgg ggcaacctac ccgggatgaa caggcccgtg 120 atagcatcaa agaatgataa actcgngctg caggactgct tggaatacaa taggatagcc 180 aagttaaaga aagtacagac aataaccacc aagtcgaact cgatcaaaca ggggaaaaac 240 caacttttcc ctgttgtcat gaatggcaaa gaagatgttt ngtggtgcac tgagctcgaa 300 aggntctttg gctttcctgt gcactacaca gacgtgtcca acatgggccg tggtgcccgc 360 cagaagctgc tgggaaggtc ctggagcgtg cctgtcatcc gacacctctt cgcccctctg 420 aaggactact ttgcatgtga atagttccag ccagggccca agcccactgg ggtgtgtggc 480 agagcaggac ccaggaggtg tgattctgaa ggcatcccca gg 522 <210> 62 <211> 573 <212> DNA
<213> Homo sapiens <400> 62 ctaagatcca ttttctaaac tccaattgag cattctctgt atctgggtgg tttttacttt 60 tttacttaat cttgcttgat caggaactct ggtgtcttct tggcccccca cgtgatctcg 120 ttcatggtca cttttttgtt tatctcattt tctctgaggc tggtccttcc tgttaacgtc 180 ttggcatttg tgggaagcac aaaatgttct tgtccctcca actctgcttt tcgctccctg 240 ccctgccatt cctctcccgc gcctgccctc tcccttccat ctttcccagg tacttttctc 300 tcccagccct gccactcttc tgccgcacct gcgctctccc ctccatcttt cccaggtact 360 tttgagcctt gactccccag gtcccttcat tctgtgctca ctccatgatg tcattttgtt 420 ctccagttaa agaaagtaca gacaataacc accaagtcga actcgatcaa acaggggaaa 480 aaccaacttt tccctgttgt catgaatggc aaagaagatg ttttgtggtg cactgagctc 540 gaaaggatct ttggctttcc tgtgcactac aca 573 <210> 63 <211> 559 <212> DNA
<213> Homo sapiens <400> 63 agacaaatac tgattttaat taaacataag gtaaactcta ggcatccgtc atctttcagc 60 ctaaaaatta gcaaaaactg ttgaaacaag gcacagtttt ttccccatat ttgttacgtc 120 gtggctccag ttacaaaaaa attttaatga aaacgttaaa cataaaaata gaagtttgag 180 attttaaaaa gtgtataaaa agccccacaa aacttgtcaa cgttgttcct tattctacaa 240 aatagcacca gtaagaagag taaaaggtgt taaaaaccat tatgacagca tttctgaaat 300 gcagcttgtc tgaattcccg ttctccctaa aaacgacttc ttatggaata aaaaaggatt 360 aaaaaatctc caaagggagc accgagcttt gcagttttcc ctgtcatcta tcagatgtgg 420 ggaaggtatg agaaatgtat gtctgtccct gactgctgtc actgcctctg agtttagtaa 480 aaagatgaga aatgagggta gcagacttct catctgggga cctgtgcctg tggagggtag 540 gtctcctgga gagggaatg 559 <210> 64 <211> 391 <212> DNA
<213> Homo sapiens <400> 64 ttttttttta gacaaatact gattttaatt aaacataagg taaactctag gcatccgtca 60 tctttcagcc taaaaattag caaaaactgt tgaaacaagg cacagttttt tccccatatt 120 tgttacgtcg tggctccagt tacaaaaaaa attttaatga aaacgttaaa cataaaaata 180 gaagtttgag attttaaaaa gtgtataaaa agccccacaa aacttgtcaa cgttgttcct 240 tattctacaa aatagcacca gtaagaagag taaaaggtgt taaaaaccat tatgacagca 300 tttctgaaat gcagcttgtc tgaattcccg ttctccctaa aaacgacttc ttatggaata 360 aaaaaggatt aaaaaatctc caaagggagc a 391 <210> 65 <211> 517 <212> DNA
<213> Homo sapiens <400> 65 acaaatactg attttaatta aacataaggt aaactctagg caggggcatc tttcagccta 60 aaaattagca aaaactgttg aaacaaggca cagttttttc cccatatttg ttacgtcgtg 120 gctccagtta cggaaaaatt ttaatgaaaa cgttaaacat aaaaatagaa gtttgagatt 180 ttaaaaagtg tataaaaagc cccacaaaac ttgtcaacgt tgttccttat tctacaaaat 240 agcaccagta agaagagtaa aaggtgttaa aaaccattat gacagcattt ctgaaatgca 300 gcttgtctga attcccgttc tccctaaaaa cgacttctta tggaataaaa aaggattaaa 360 aaatctccaa agggagcacc gagctttgca gttttccctg tcatctctca gatgtgggga 420 aggtatgaga aatgtatgtc tgtccctgac tgctgtcact gcctctgagt ttagtaaaaa 480 gatgagaaat gagggtagca gacttctcat ctgggga 517 <210> 66 <211> 442 <212> DNA
<213> Homo sapiens <400> 66 gacaaatact gattttaatt aaacataagg taaactctag gcatccgtca tctttcagcc 60 taaaaattag caaaaactgt tgaaacaagg cacagttttt tccccatatt tgttacgtcg 120 tggctccagt tacaaaaaaa attttaatga aaacgttaaa cataaaaata gaagtttgag 180 attttaaaaa gtgtataaaa agccccacaa aacttgtcaa cgttgttcct tattctacaa 240 aatagcacca gtaagaagag taaaaggtgt taaaaaccat tatgacagca tttctgaaat 300 gcagcttgtc tgaattcccg ttctccctaa aaacgacttc ttatggaata aaaaaggatt 360 aaaaaatctc caaagggagc accgagcttt gcagttttcc ctgtcatctc gcagatgtgg 420 ggaaggtatg agaaatgtat gt 442 <210> 67 <211> 396 <212> DNA
<213> Homo sapiens <400> 67 gcagtcaggg acagacatac atttctcata ccttccccac atctgagaga tgacagggaa 60 aactgcaaag ctcggtgctc cctttggaga ttttttaatc cttttttttt ccataagaag 120 tcgtttttag ggagaacggg aattcagaca agctgcattt cagaaatgct gtcataatgg 180 tttttaacac cttttactct tcttactggt gctattttgt agaataagga acaacgttga 240 caagttttgt ggggcttttt atacactttt taaaatctca aacttctatt tttatgttta 300 acgttttcat taaaattttt ttgtaactgg agccacgacg taacaaatat ggggaaaaaa 360 ctgtgccttg tttcaacagt ttttgctaat ttttag 396 <210> 68 <211> 287 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (7) . . (7) <223> May be any nucleic acid <220>
<221> Unsure <222> (169)..(169) <223> May be any nucleic acid <400> 68 agacaantac tgattttaat taaacataag gtaaactcta ggcatccgtc atctttcagc 60 ctaaaaatta gcaaaaactg ttgaaacaag gcacagtttt tcccccatat ttgttacgtc 120 gtggctccag ttacaaaaaa aattttaatg aaaacgttaa acataaaant agaagtttga 180 gattttaaaa agtgtataaa aagccccaca aaacttgtca acgttgttcc ttattctaca 240 aaatagcacc agtaagaaga gtaaaaggtg ttaaaaacca ttatgac 287 <210> 69 <211> 356 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (193)..(193) <223> May be any nucleic acid <400> 69 attgaagaat ggggcccatt tgacttggtg attggcggaa ccgatgcaac gatctctcaa 60 atgtgaatcc agccaggaaa ggcctgtatg agggtacagg ccggctcttc ttcgaatttt 120 accacctgct gaattactca cgccccaagg agggtgatga ccggccgttc ttctggatgt 180 ttgagaatgt tgnagccatg aaggttggcg acaagaggga catctcacgg ttcctggagt 240 gtaatccagt gatgattgat gccatcaaag tttctgctgc tcacagggcc cgatacttct 300 ggggcaacct acccgggatg aacaggatct ttggctttcc tgtgcactac acagac 356 <210> 70 <211> 408 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (408)..(408) <223> May be any nucleic acid <400> 70 tttagacaaa tactgatttt aattaaacat aaggtaaact ctaggcatcc gtcatctttc 60 agcctaaaaa ttagcaaaaa ctgttgaaac aaggcacagt tttttcccca tatttgttac 120 gtcgtggctc cagttacaaa aaaaatttta atgaaaacgt taaacataaa aatagaagtt 180 tgagatttta aaaagtgtat aaaaagcccc ac.aaaacttg tcaacgttgt tccttattct 240 acaaaatagc accagtaaga agagtaaaag gtgttaaaaa ccattatgac agcatttctg 300 aaatgcagct tgtctgaatt cccgttctcc ctaaaaacga cttcttatgg aataaaaaag 360 gattaaaaaa tctccaaagg gagcaccgag ctttgcagtt ttccctgn 408 <210> 71 <211> 439 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (50) . . (50) <223> May be any nucleic acid <220>
<221> Unsure <222> (85)..(85) <223> May be any nucleic acid <220>
<221> Unsure <222> (405)..(405) <223> May be any nucleic acid <400> 71 gcatgtagct acaggacatt tttaagggcc caggatcgtt ttttcccagn tgcaagcaga 60 agagaaaatg ttgtatatgt ctttnacccg gcacattccc cttgcctaaa tacaagggct 120 ggagtctgca cgggacctat tagagtattt tccacaatga tgatgatttc agcagggatg 180 acgtcatcat cacattcagg gctatttttt cccccacaaa cccaagggca ggggccactc 240 ttagctaaat ccctccccgt gactgcaata gaaccctctg gggagctcag gaaagggggt 300 gtgctgagtt ctataatata agctgccata tattttgtag acaagtatgg ctcctcccat 360 atctccctct tccctaggag aggagtgtga aagcaaggga gcttngataa gacaccccct 420 caaacccatt ccctctcca 439 <210> 72 <211> 491 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (26) . . (27) <223> May be any nucleic acid <220>
<221> Unsure <222> (33) . . (33) <223> May be any nucleic acid <220>
<221> Unsure <222> (188)..(188) <223> May be any nucleic acid <220>
<221> Unsure <222> (301)..(301) <223> May be any nucleic acid <220>
<221> Unsure <222> (339)..(339) <223> May be any nucleic acid <220>
<221> Unsure <222> (360)..(360) <223> May be any nucleic acid <220>
<221> Unsure <222> (379)..(379) <223> May be any nucleic acid <400> 72 ttaattaaac ataaggtaaa ctctanngca tcngtcatct ttcagcctaa aaattagcaa 60 aaactgttga aacaaggcac agttttttcc ccatatttgt tacgtcgtgg ctccagttac 120 aaaaaaaatt ttaatgaaaa cgttaaacat aaaaatagaa gtttgagatt ttaaaaagtg 180 tataaaangc cccacaaaac ttgtcaacgt tgttccttat tctacaaaat agcaccagta 240 agaagagtaa aaggtgttaa aaaccattat gacagcattt ctgaaatgca gcttgtctga 300 nttcccgttc tccctaaaaa cgacttctta tgggataana aagggattaa aaaatctccn 360 aaagggaggc accgagcttt gcaggttttc cctggtcatc tctcaggatg tggggggagg 420 gtatggggaa atggtatggt ctggtccctg gactggctgg tcactgcctc tggggtttng 480 gtaaaagggt g 491 <210> 73 <211> 443 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (9) . . (9) <223> May be any nucleic acid <220>
<221> Unsure <222> (11)..(11) <223> May be any nucleic acid <220>
<221> Unsure <222> (23) .. (24) <223> May be any nucleic acid <220>
<221> Unsure <222> (126)..(126) <223> May be any nucleic acid <220>
<221> Unsure <222> (157)..(157) <223> May be any nucleic acid <220>
<221> Unsure <222> (170)..(170) <223> May be any nucleic acid <220>
<221> Unsure <222> (341)..(341) <223> May be any nucleic acid <220>
<221> Unsure <222> (347)..(347) <223> May be any nucleic acid <220>
<221> Unsure <222> (371)..(371) <223> May be any nucleic acid <220>
<221> Unsure <222> (405)..(405) <223> May be any nucleic acid <220>
<221> Unsure <222> (412)..(412) <223> May be any nucleic acid <220>
<221> Unsure <222> (430)..(430) <223> May be any nucleic acid <400> 73 ttggcggcna ntgcaacgat ctnnaaatgt gaatcagcca ggaaaggctg tatgagggac 60 aggcggctct tcttcgaatt ttccacctgc tgaattactc acgccccaag gagggtgatg 120 accggncgtt cttctggatg tttgagaatg ttgtagncat gaaggttggn gacaagaggg 180 acatctcacg gttcctggag tgtaatccag tgatgattga tgccatcaaa gtttctgctg 240 ctcacagggc ccgatacttc tggggcaacc tacccgggat gaacaggatc tttggctttc 300 ctgtgcacta cacagacgtg tcccaacatg gggccgtggg ngccgcncca ggaagcttgc 360 tggggaaggt nctggggagc gttgccttgt tcatcccgac acctntttcg gnccctattg 420 gaagggattn atttttgcca tgt 443 <210> 74 <211> 273 <212> DNA
<213> Homo sapiens <400> 74 acgttttgta tgttttttta tttgctccag gtggggtttt gactgtcact ttcccacact 60 ctggattagt tctgatccca ccacaaggag ccctcgaatt ggctaaagtg agaaactggg 120 cctgaagact ccgtaccctc tgccatcttg ccgagggagt ctccttttag aaaacaatca 180 aagggttatt gcatgagtct ggatgaatcc cactctcagc tgtccacggg cccgaccacc 240 tcatctagcc ccctttttgg cagggagaac ctg 273 <210> 75 <211> 250 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (26)..(27) <223> May be any nucleic acid <220>
<221> Unsure <222> (33)..(33) <223> May be any nucleic acid <220>
<221> Unsure <222> (188)..(188) <223> May be any nucleic acid <400> 75 ttaattaaac ataaggtaaa ctctanngca tcngtcatct ttcagcctaa aaattagcaa 60 aaactgttga aacaaggcac agttttttcc ccatatttgt tacgtcgtgg ctccagttac 120 aaaaaaaatt ttaatgaaaa cgttaaacat aaaaatagaa gtttgagatt ttaaaaagtg 180 tataaaangc cccacaaaac ttgtcaacgt tgttccttat tctacaaaat agcaccagta 240 agaagagtaa 250 <210> 76 <211> 443 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (9) . . (9) <223> May be any nucleic acid <220>
<221> Unsure <222> (11)..(11) <223> May be any nucleic acid <220>
<221> Unsure <222> (23) . . (24) <223> May be any nucleic acid <220>
<221> Unsure <222> (126)..(126) <223> May be any nucleic acid <220>
<221> Unsure <222> (157)..(157) <223> May be any nucleic acid <220>
<221> Unsure <222> (170)..(170) <223> May be any nucleic acid <220>
<221> Unsure <222> (341)..(341) <223> May be any nucleic acid <220>
<221> Unsure <222> (347)..(347) <223> May be any nucleic acid <220>
<221> Unsure <222> (371)..(371) <223> May be any nucleic acid <220>
<221> Unsure <222> (405). .(405) <223> May be any nucleic acid <220>
<221> Unsure <222> (412)..(412) <223> May be any nucleic acid <220>
<221> Unsure <222> (430)..(430) <223> May be any nucleic acid <400> 76 ttggcggcna ntgcaacgat ctnnaaatgt gaatcagcca ggaaaggctg tatgagggac 60 aggcggctct tcttcgaatt ttccacctgc tgaattactc acgccccaag gagggtgatg 120 accggncgtt cttctggatg tttgagaatg ttgtagncat gaaggttggn gacaagaggg 180 acatctcacg gttcctggag tgtaatccag tgatgattga tgccatcaaa gtttctgctg 240 ctcacagggc ccgatacttc tggggcaacc tacccgggat gaacaggatc tttggctttc 300 ctgtgcacta cacagacgtg tcccaacatg gggccgtggg ngccgcncca ggaagcttgc 360 tggggaaggt nctggggagc gttgccttgt tcatcccgac acctntttcg gnccctattg 420 gaagggattn atttttgcca tgt 443 <210> 77 <211> 394 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (1) . (1) <223> May be any nucleic acid <400> 77 nttttttttt ttttgaaaaa attgtgaaaa aatttaaacc ccaggggact atccaagggg 60 aaaagtgaaa tatggaaaaa ttggcggtat gaccaatttg ggcattgcaa agagccttgc 120 agaattatga agcataaaag gaaattattg gcttttggag agttttcttt tctctcttct 180 ttttttgtaa tttcaatcta tatcagtagt ggaaaggtca tagcaaaata tggagaatcc 240 aaatggtaga tacaacctga tatcttgtgg aacaaggcat acaacagcaa agcaacacca 300 gtgaaaccaa ggacaccaaa cagtccccag agaactccag ctgtcatgag gtctcttcta 360 tagccatcag gtcctgagat ggagactggc actg 394 <210> 78 <211> 277 <212> DNA
<213> Homo sapiens <400> 78 gtcatctttc agcctaaaaa ttagcaaaaa ctgttgaaac aaggcacagt tttttcccca 60 tatttgttac gtcgtggctc cagttaccaa aaaattttaa tgaaaacgtt aaacataaaa 120 atagaagttt gagattttaa aaagtgtata aaaagcccca caaaacttgt caacgttgtt 180 ccttattcta caaaatagca ccagtaagaa gagtaaaagg tgttaaaaac cattatgaca 240 gcatttctga aatgcagctt gtctgaattc ccgttct 277 <210> 79 <211> 469 <212> DNA
<213> Homo sapiens <400> 79 ttttagacaa atactgattt taattaaaca taaggtaaac tctaggcatc cgtcatcttt 60 cagcctaaaa attagcaaaa actgttgaaa catggcacag ttttttcccc atatttgtta 120 cgtcgtggct ccagttacaa aaaaatttta atgaaaacgt taaacataaa aatagaagtt 180 tgagatttta aaaagtgtat aaaaagcccc acaaaacttg tcaacgttgt tccttattct 240 acaaaatagc accagtaaga agagtaaaag gtgttaaaaa ccattatgac agcatttctg 300 aaatgcagct tgtctgaatt cccgttctcc ctaaaaacga cttcttatgg aataaaaaag 360 gattaaaaaa tctccaaagg gagcaccgag ctttgcagtt ttccctgtca tctctcagat 420 gtggggaagg tatgagaaat gtatgtctgt ccctgactgc tgtcactgc 469 <210> 80 <211> 206 <212> DNA
<213> Homo sapiens <400> 80 gacaaatact gatcccccct acacataagg taaactctag gcatccgtca tctttcagcc 60 taaaaattag caaaaactgt tgaaacaagg cacagttttt tccccatatt tgttacgtcg 120 tggctccagt tacgaaaaaa attttaatga aaacgttaaa cataaaaata gaagtttgag 180 attttaaaaa gtgtataaaa agcccc 206 <210> 81 <211> 391 <212> DNA
<213> Homo sapiens <400> 81 ttttagacaa atactgattt taattaaaca taaggtaaac tctaggcatc cgtcatcttt 60 cagcctaaaa attagcaaaa actgttgaaa caaggcacag ttttttcccc atatttgtta 120 cgtcgtggct ccagttacaa aaaaaatttt aatgaaaacg ttaaacataa aaatagaagt 180 ttgagatttt aaaaagtgta taaaaagccc cacaaaactt gtcaacgttg ttccttattc 240 tacaaaatag caccagtaag aagagtaaaa ggtgttaaaa accattatga cagcatttct 300 gaaatgcagc ttgtctgaat tcccgttctc cctaaaaacg acttcttatg gaataaaaaa 360 ggattaaaaa atctccaaag ggagcaccga g 391 <210> 82 <211> 755 <212> DNA
<213> Homo sapiens <220>
<221> Unsure <222> (10) .. (10) <223> May be any nucleic acid <220>
<221> Unsure <222> (19)..(19) <223> May be any nucleic acid <220>
<221> Unsure <222> (47) . . (47) <223> May be any nucleic acid <220>
<221> Unsure <222> (117)..(117) <223> May be any nucleic acid <220>
<221> Unsure <222> (119)..(119) <223> May be any nucleic acid <220>
<221> Unsure <222> (134)..(134) <223> May be any nucleic acid <220>
<221> Unsure <222> (136)..(136) <223> May be any nucleic acid <220>
<221> Unsure <222> (138)..(139) <223> May be any nucleic acid <220>
<221> Unsure <222> (146)..(147) <223> May be any nucleic acid <220>
<221> Unsure <222> (149)..(149) <223> May be any nucleic acid <220>
<221> Unsure <222> (157)..(158) <223> May be any nucleic acid <220>
<221> Unsure <222> (160)..(160) <223> May be any nucleic acid <220>
<221> Unsure <222> (162)..(162) <223> May be any nucleic acid <220>
<221> Unsure <222> (164)..(164) <223> May be any nucleic acid <220>
<221> Unsure <222> (170)..(172) <223> May be any nucleic acid <220>
<221> Unsure <222> (176)..(178) <223> May be any nucleic acid <220>
<221> Unsure <222> (180)..(181) <223> May be any nucleic acid <220>
<221> Unsure <222> (186)..(186) <223> May be any nucleic acid <220>
<221> Unsure <222> (191)..(194) <223> May be any nucleic acid <220>
<221> Unsure <222> (199)..(199) <223> May be any nucleic acid <220>
<221> Unsure <222> (205)..(205) <223> May be any nucleic acid <220>
<221> Unsure <222> (215)..(215) <223> May be any nucleic acid <220>
<221> Unsure <222> (217)..(217) <223> May be any nucleic acid <220>
<221> Unsure <222> (219)..(220) <223> May be any nucleic acid <220>
<221> Unsure <222> (226)..(226) <223> May be any nucleic acid <220>
<221> Unsure <222> (231)..(231) <223> May be any nucleic acid <220>
<221> Unsure <222> (234)..(234) <223> May be any nucleic acid <220>
<221> Unsure <222> (237)..(237) <223> May be any nucleic acid <220>
<221> Unsure <222> (243)..(244) <223> May be any nucleic acid <220>
<221> Unsure <222> (257)..(257) <223> May be any nucleic acid <220>
<221> Unsure <222> (259)..(259) <223> May be any nucleic acid <220>
<221> Unsure <222> (275)..(275) <223> May be any nucleic acid <220>
<221> Unsure <222> (298)..(298) <223> May be any nucleic acid <220>
<221> Unsure <222> (301)..(301) <223> May be any nucleic acid <220>
<221> Unsure <222> (338)..(338) <223> May be any nucleic acid <220>
<221> Unsure <222> (374)..(374) <223> May be any nucleic acid <220>
<221> Unsure <222> (382)..(832) <223> May be any nucleic acid <220>
<221> Unsure <222> (416). .(416) <223> May be any nucleic acid <220>
<221> Unsure <222> (436)..(436) <223> May be any nucleic acid <220>
<221> Unsure <222> (481)..(481) <223> May be any nucleic acid <220>
<221> Unsure <222> (486)..(486) <223> May be any nucleic acid <220>
<221> Unsure <222> (498) . . (498) <223> May be any nucleic acid <220>
<221> Unsure <222> (502)..(502) <223> May be any nucleic acid <220>
<221> Unsure <222> (504)..(504) <223> May be any nucleic acid <220>
<221> Unsure <222> (524)..(524) <223> May be any nucleic acid <220>
<221> Unsure <222> (528)..(528) <223> May be any nucleic acid <220>
<221> Unsure <222> (568)..(568) <223> May be any nucleic acid <220>
<221> Unsure <222> (572)..(572) <223> May be any nucleic acid <220>
<221> Unsure <222> (577)..(577) <223> May be any nucleic acid <220>
<221> Unsure <222> (579)..(579) <223> May be any nucleic acid <220>
<221> Unsure <222> (587)..(587) <223> May be any nucleic acid <220>
<221> Unsure <222> (596)..(596) <223> May be any nucleic acid <220>
<221> Unsure <222> (598)..(599) <223> May be any nucleic acid <220>
<221> Unsure <222> (615)..(615) <223> May be any nucleic acid <220>
<221> Unsure <222> (619)..(619) <223> May be any nucleic acid <220>
<221> Unsure <222> (624)..(624) <223> May be any nucleic acid <220>
<221> Unsure <222> (626)..(626) <223> May be any nucleic acid <220>
<221> Unsure <222> (628)..(628) <223> May be any nucleic acid <220>
<221> Unsure <222> (631)..(631) <223> May be any nucleic acid <220>
<221> Unsure <222> (638)..(638) <223> May be any nucleic acid <220>
<221> Unsure <222> (643)..(643) <223> May be any nucleic acid <220>
<221> Unsure <222> (655)..(655) <223> May be any nucleic acid <220>
<221> Unsure <222> (663)..(663) <223> May be any nucleic acid <220>
<221> Unsure <222> (666)..(666) <223> May be any nucleic acid <220>
<221> Unsure <222> (668)..(668) <223> May be any nucleic acid <220>
<221> Unsure <222> (701)..(701) <223> May be any nucleic acid <220>
<221> Unsure <222> (716)..(716) <223> May be any nucleic acid <220>
<221> Unsure <222> (739)..(739) <223> May be any nucleic acid <220>
<221> Unsure <222> (747)..(747) <223> May be any nucleic acid <400> 82 tcttcgaagn cgagtcggnc tgtaccctca tacaggcctt tcctggntgg attcacattt 60 gagagatcgt tgcatgggct tccgccaatc accaagtcaa atgggcccca ttcttcnana 120 tttttctttg gggngngnnc cccccnngnc ccccccnngn tntntttttn nntttnnncn 180 ngtccncccg nnnngggtnc tcacncactt cagangngnn gggctntcct nccnttntgg 240 ccnnctcttt gcggatngnt aggctgtcgc gatgncatca aacaatgaca ggactcgnct 300 nggcgccttc gggctgcggg aatgggagga tctttggntt tcctgtgcac tacacagacg 360 tgtccaacat gggncgtggt gnccgccaga agcttgctgg ggaaggtcct tggagnggtg 420 tcttgtcaat cccganaacc tctttccggc cccccttgga aggggcttac ttctgggaat 480 ngttgnattt ggtcccangc cnangggccc caaaaggccc ccantttngg gggttgtttt 540 ttggaaagga ggcccaaggg accccccngg gnggggngnt tgtttcnccc ctgggnanng 600 ggaattcccc cccangggnc cccngntntt nttccccncc aantttttgg ggttnggggt 660 tanaanancc cgggggtttc ccccccaagg ccccccctct ntttgggttc aaaaangggg 720 gggggggaag gggcccccnc cctgaanttt ttttc 755

Claims (26)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. An isolated nucleic acid molecule comprising a polynucleotide selected from:
(a) a polynucleotide sequence encoding a polypeptide comprising amino acids from about 1 to about 908 in SEQ ID NO:5;
(b) a polynucleotide sequence encoding a polypeptide comprising amino acids from about 1 to about 859 in SEQ ID NO:6;
(c) a polynucleotide sequence encoding a polypeptide comprising amino acids from about 1 to about 912 in SEQ ID NO:7;
(d) a polynucleotide sequence encoding a polypeptide comprising amino acids from about 1 to about 853 in SEQ ID NO:8; or (e) a polynucleotide sequence encoding a polypeptide that is capable of methylation of cytosine at position C5 in DNA, said polynucleotide sequence being at least 90% identical to a polynucleotide sequence selected from SEQ ID NO:1, SEQ ID
NO:2, SEQ ID NO:3 or SEQ ID NO:4.
2. The nucleic acid according to Claim 1, having the coding sequence of the cDNA
contained in ATCC Deposit No. 209933, 209934, 98809 or 326637.
3. A method of making a recombinant vector comprising inserting the isolated nucleic acid molecule of Claim 1, into a DNA vector or a RNA vector.
4. A recombinant vector comprising the isolated nucleic acid molecule of Claim 1.
5. A method of making a recombinant host cell comprising introducing the recombinant vector of Claim 4, into a host cell.
6. A recombinant host cell comprising the vector of Claim 4.
7. A method for producing a de novo DNA cytosine methyltransferase polypeptide, comprising culturing the recombinant host cell of Claim 6, under conditions such that said polypeptide is expressed and recovering said polypeptide.
8. An isolated nucleic acid molecule selected from:
(a) a polynucleotide consisting essentially of 50 to 4192 contiguous nucleotides of SEQ ID NO: 1, wherein said polynucleotide is other than a polynucleotide consisting of the nucleotide sequence as set forth in AA052791(SEQ ID NO: 9), AA111043(SEQ
ID NO:10), AA154890(SEQ ID NO:11), AA240794(SEQ ID NO:12), AA756653(SEQ
ID NO:13), W58898(SEQ ID NO:14), W59299(SEQ ID NO:15), W91664(SEQ ID
NO:16) or W91665(SEQ ID NO:17); or (b) a polynucleotide having a nucleotide sequence complementary to a nucleotide sequence in (a), wherein said nucleic acid molecule is for use as a probe, a primer or for inhibiting expression of de novo cytosine methyltransferase.
9. An isolated nucleic acid molecule selected from:
(a) a polynucleotide consisting essentially of 30 to 4195 contiguous nucleotides of SEQ ID NO:2, wherein said polynucleotide is other than a polynucleotide consisting of the nucleotide sequence as set forth in AA116694 (SEQ ID NO:18), AA119979 (SEQ ID NO:19), AA177277 (SEQ ID NO:20), AA210568 (SEQ ID NO:21), AA399749 (SEQ ID NO:22), AA407106 (SEQ ID NO:23) or AA575617 (SEQ ID
NO:24); or (b) a polynucleotide having a nucleotide sequence complementary to a nucleotide sequence in (a), wherein said nucleic acid molecule is for use as a probe, a primer or for inhibiting expression of de novo cytosine methyltransferase.
10. An isolated nucleic acid molecule selected from:

(a) a polynucleotide consisting essentially of 100 to 4416 contiguous nucleotides of SEQ ID NO:3, wherein said polynucleotide is other than a polynucleotide consisting of the nucleotide sequence as set forth in AA004310 (SEQ ID NO:25), AA004399 (SEQ ID NO:26), AA312013 (SEQ ID NO:27), AA355824 (SEQ ID NO:28), AA533619 (SEQ ID NO:29), AA361360 (SEQ ID NO:30), AA364876 (SEQ ID
NO:31), AA503090 (SEQ ID NO:32), AA533619 (SEQ ID NO:33), AA706672 (SEQ
ID NO:34), AA774277 (SEQ ID NO:35), AA780277 (SEQ ID NO:36), H03349 (SEQ
ID NO:37), H04031 (SEQ ID NO:38), H53133 (SEQ ID NO:39), H53239 (SEQ ID
NO:40), H64669 (SEQ ID NO:41), N26002 (SEQ ID NO:42), N52936 (SEQ ID
NO:43), N88352 (SEQ ID NO:44), N89594 (SEQ ID NO:45), R19795 (SEQ ID
NO:46), R47511 (SEQ ID NO:47), T50235 (SEQ ID NO:48), T78023 (SEQ ID
NO:49), T78186 (SEQ ID NO:50), W22886 (SEQ ID NO:51), W67657 (SEQ ID
NO:52), W68094 (SEQ ID NO:53), W76111 (SEQ ID NO:54), Z38299 (SEQ ID
NO:55), Z42012 (SEQ ID NO:56) or G06200(SEQ ID NO:74); or (b) a polynucleotide having a nucleotide sequence complementary to a nucleotide sequence in (a), wherein said nucleic acid molecule is for use as a probe, a primer or for inhibiting expression of de novo cytosine methyltransferase.
11. An isolated polypeptide molecule comprising an amino acid sequence selected from:
(a) an amino acid sequence having amino acids from about 1 to about 908 in SEQ ID NO:5;
(b) an amino acid sequence having amino acids from about 1 to about 859 in SEQ ID NO:6;
(c) an amino acid sequence having amino acids from about 1 to about 912 in SEQ ID NO:7;
(d) an amino acid sequence having amino acids from about 1 to about 853 in SEQ ID NO:8; or (e) an amino acid sequence of a polypeptide that is capable of methylation of cytosine at position C5 in DNA, said amino acid sequence being at least about 90%
identical to the amino acid sequence of (a), (b), (c) or (d).
12. An isolated de novo cytosine methyltransferase polypeptide molecule, wherein except for from 1 to 10 conservative amino acid substitution(s), said polypeptide has an amino acid sequence selected from:
(a) an amino acid sequence having amino acids from about 1 to about 908 in SEQ ID NO:5;
(b) an amino acid sequence having amino acids from about 1 to about 859 in SEQ ID NO:6;
(c) an amino acid sequence having amino acids from about 1 to about 912 in SEQ ID NO:7; or (d) an amino acid sequence having amino acids from about 1 to about 853 in SEQ ID NO:8.
13. A method for in vitro de novo methylation of DNA, comprising:
(a) contacting DNA with an effective amount of a de novo DNA cytosine methyltransferase polypeptide encoded by the nucleic acid molecule of Claim 1;
(b) providing an appropriately buffered solution with cofactors; and (c) purifying methylated DNA.
14. A method for diagnosing or determining a susceptibility to neoplastic disorders, comprising:
(a) assaying a de novo DNA cytosine methyltransferase expression level in mammalian cells, tissues or body fluid; and (b) comparing said de novo DNA cytosine methyltransferase expression level with a standard de novo DNA cytosine methyltransferase expression level whereby an increase or decrease in said de novo DNA cytosine methyltransferase expression level over said standard is indicative of an increased or decreased susceptibility to a neoplastic disorder, wherein said de novo DNA cytosine methyltransferase is encoded by the nucleic acid molecule of claim 1 and wherein said standard de novo DNA cytosine methyltransferase expression level is the de novo DNA cytosine methyltransferase expression level in normal cells, normal tissues or normal body fluid.
15. The method of Claim 14, wherein said de novo DNA cytosine methyltransferase expression level is assayed by detecting de novo DNA cytosine methyltransferase protein with an antibody that specifically binds to said de novo DNA cytosine methyltransferase.
16. The method of Claim 14, wherein said de novo DNA cytosine methyltransferase expression level is assayed by detecting de novo DNA cytosine methyltransferase mRNA.
17. An isolated de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence as set forth in SEQ ID NO:5 and being encoded by the cDNA
clone contained in ATCC Deposit No. 209933.
18. An isolated de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence as set forth in SEQ ID NO:6 and being encoded by the cDNA
clone contained in ATCC Deposit No. 209934.
19. An isolated de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence as set forth in SEQ ID NO:7 and being encoded by the cDNA
clone contained in ATCC Deposit No. 98809.
20. An isolated de novo DNA cytosine methyltransferase polypeptide having the amino acid sequence as set forth in SEQ ID NO:8 and being encoded by the cDNA
clone contained in ATCC Deposit No. 326637.
21. An isolated de novo DNA cytosine methyltransferase Dnmt3b polypeptide wherein, except for from 1 to 10 conservative amino acid substitution(s), said polypeptide has an amino acid sequence selected from:

(a) an amino acid sequence having amino acid residues 1 to 362 and 383 to 859 from SEQ ID NO:5; or (b) an amino acid sequence having amino acid residues 1 to 362 and 383 to 749 and 813 to 859 from SEQ ID NO:5.
22. An isolated de novo DNA cytosine methyltransferase DNMT3B polypeptide wherein, except for from 1 to 10 conservative amino acid substitution(s), said polypeptide has an amino acid sequence selected from:
(a) an amino acid sequence having amino acid residues 1 to 355 and 376 to 853 from SEQ ID NO:8; or (b) an amino acid sequence having amino acid residues 1 to 355 and 376 to 743 and 807 to 853 from SEQ ID NO:8.
23. A method of screening for an agonist or antagonist of DNMT3 DNA cytosine methyltransferase activity comprising:
(a) contacting a substrate to a DNMT3 DNA cytosine methyltransferase protein or polypeptide encoded by the nucleic acid molecule of Claim 1, in the presence of a putative agonist or antagonist; and (b) assaying the activity of said agonist or said antagonist by determining at least one of the following:

(i) binding of said agonist or said antagonist to said DNMT3 DNA
cytosine methyltransferase protein or polypeptide; and (ii) determining the activity of said DNMT3 DNA cytosine methyltransferase protein or polypeptide in the presence of said agonist or said antagonist.
24. A plasmid contained in ATCC Deposit No. 209933.
25. A plasmid contained in ATCC Deposit No. 209934.
26. A plasmid contained in ATCC Deposit No. 98809.
CA002331781A 1998-06-25 1999-06-25 De novo dna cytosine methyltransferase genes, polypeptides and uses thereof Expired - Fee Related CA2331781C (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US9090698P 1998-06-25 1998-06-25
US60/090,906 1998-06-25
US9399398P 1998-07-24 1998-07-24
US60/093,993 1998-07-24
PCT/US1999/014373 WO1999067397A1 (en) 1998-06-25 1999-06-25 De novo dna cytosine methyltransferase genes, polypeptides and uses thereof

Publications (2)

Publication Number Publication Date
CA2331781A1 CA2331781A1 (en) 1999-12-29
CA2331781C true CA2331781C (en) 2008-01-08

Family

ID=26782776

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002331781A Expired - Fee Related CA2331781C (en) 1998-06-25 1999-06-25 De novo dna cytosine methyltransferase genes, polypeptides and uses thereof

Country Status (2)

Country Link
CA (1) CA2331781C (en)
WO (1) WO1999067397A1 (en)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997035589A1 (en) 1996-03-26 1997-10-02 Kopreski Michael S Method enabling use of extracellular rna extracted from plasma or serum to detect, monitor or evaluate cancer
US7785842B2 (en) 1996-03-26 2010-08-31 Oncomedx, Inc. Comparative analysis of extracellular RNA species
US6759217B2 (en) 1996-03-26 2004-07-06 Oncomedx, Inc. Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer
US8043835B1 (en) 1996-03-26 2011-10-25 Oncomedx, Inc. Methods for detecting and monitoring cancer using extracellular RNA
US8440396B2 (en) 1997-03-14 2013-05-14 Oncomedx, Inc. Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer
US8163524B2 (en) 1998-09-22 2012-04-24 Oncomedx, Inc. Comparative analysis of extracellular RNA species
AU7926400A (en) * 1999-10-15 2001-04-23 Ulla Aapola Novel gene encoding a dna methyltransferase, dnmt3l
EP1384787A1 (en) * 2002-07-25 2004-01-28 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Screening method for the identification and characterization of DNA methyltransferase inhibitors
US7405287B2 (en) * 2004-08-03 2008-07-29 Board Of Regents, The University Of Texas System Method of treating a cancer

Also Published As

Publication number Publication date
CA2331781A1 (en) 1999-12-29
WO1999067397A1 (en) 1999-12-29

Similar Documents

Publication Publication Date Title
CA2331781C (en) De novo dna cytosine methyltransferase genes, polypeptides and uses thereof
US6521437B2 (en) Human sphingosine lyase polypeptides
US20040234997A1 (en) De novo DNA cytosine methyltransferase genes, polypeptides and uses thereof
US6709653B1 (en) Antibodies specific for human inositol monophosphatase H1
US6284504B1 (en) Human DNA ligase III
US20080131901A1 (en) De novo DNA cytosine methyltransferase genes, polypeptides and uses thereof
US20040259829A1 (en) Compositions and methods for sensitizing and inhibiting growth of human tumor cells
US20020182681A1 (en) Isolated human drug-metabolizing proteins, nucleic acid molecules encoding human drug-metabolizing proteins, and uses thereof
US6403310B1 (en) Human inositol monophosphatase H1
US6552174B2 (en) Human MutT2 antibodies
US6455274B1 (en) Human DNA Ligase IV
US6432708B1 (en) Human choline acetyltransferase
CA2412880C (en) Glutamine fructose-6-phosphate amidotransferase splice variant and its expression product
US6261819B1 (en) Compounds
US5914258A (en) Human deoxycytidine kinase 2
US6255077B1 (en) Human DNA topoisomerase I α
US6225090B1 (en) Compounds
WO1996030524A1 (en) Human dna ligase iii
US20020065393A1 (en) Human hypoxanthine- (guanine) phosphoribosy1 transferase-2
US20040171059A1 (en) Interleukin-1 beta converting enzyme like apoptosis protease-3 and -4
US20030176375A1 (en) Method of treating anemia
EP1392358A2 (en) Immunogenic tumor antigens: nucleic acids and polypeptides encoding the same and methods of use thereof
JPH10512749A (en) Human deoxycytidine kinase 2
JPH10509871A (en) Human choline acetyltransferase
JPH10509320A (en) Human MutT2

Legal Events

Date Code Title Description
EEER Examination request
MKLA Lapsed