CA2328181A1

CA2328181A1 - Immunomodulatory compositions of mmtv antigens and methods of using same

Info

Publication number: CA2328181A1
Application number: CA002328181A
Authority: CA
Inventors: Jonathan Gershoni; Thomas H. M. Stewart
Original assignee: Individual
Current assignee: International Bio Immune Systems Inc
Priority date: 1998-04-08
Filing date: 1999-04-08
Publication date: 1999-10-14
Also published as: AU3481699A; CN1305384A; EP1067964A1; IL138932A; AU745773B2; WO1999051268A9; IL138932A0; EP1067964A4; WO1999051268A1

Abstract

The present invention relates to methods for inducing an immune response in a human to an MMTV antigen for treating or preventing a disease or disorder in a human caused by infection with MMTV or caused by exposure to a biological or chemical agent that reacts with an antibody directed against an MMTV antigen.

Description

WO 99/51268 PCT/US99/077i2 IMMUNOMODULATORY COMPOSITIONS OF MMTV
ANTIGENS AND METHODS OF USTNG SAME
1. INTRODUCTION
The present invention relates to methods of administering to a human in need thereof an immunomodulatory composition comprising at least one mouse mammary tumor virus (MMTV) antigen for eliciting an immune response to such antigen. The present invention also relates to recombinant MMTV antigens encoded by MMTV nucleic acids and immunomodulatory compositions comprising the same, as well as for methods for efficiently producing such antigens. The present invention also relates to compositions comprising antibodies directed to MMTV antigens for use in passive immunotherapy.

2. BACKGROUND OF THE INVENTION
Breast cancer is itself diverse and the incidence of breast cancer in women varies world wide, Parkin et al., 1992, VI IARC Scientific Publications No. 120, International Agency for Research on Cancer. For example, circumpolar Tnuit have about half the incidence as compared to Denmark, Canada and Connecticut, Miller et al., 1996, Acta Oncologica 35:577-580. Changes in dietary cofactors or promoters has been proposed as the reason for the diversity in incidence of human breast cancer, including phytoestrogens, Wu et al., 1996r Cancer Epidemiology. Biomarkers and Prevention 5:901-906, and xenoestrogens, Davis et al., 1995, Scientific American, Oct: 166-172. However, the evidence for high fat diets and environmental xenoestrogens for causing an increase in human breast cancer is unconvincing, Modan et al., 1975, Cancer Res. 35:3503-3506; Hunter et al., 1996, N. Engl. J.
Med. 334:356-361; Krieger et al., 1994, J. Nat. Cancer Inst.
86:590-599.

WO 99/51265 . PCT/US99107712 One known causative agent for breast cancer, albeit in mice, is mouse mammary tumor virus. Mouse mammary tumor virus is a type B retrovirus and induces mammary carcinomas {breast cancer) in susceptible mice by insertional mutagenesis. The MMTV genome, similar to other retroviruses, encodes for three types of structural proteins, the non-glycosylated viral core proteins (gag}, the viral reverse transcriptase (pol); and the glycoproteins of the viral envelope (env). The major structural proteins are named according to their molecular weight and include glycoprotein {gp)55, gp34, protein (p)28, p18, p14 and p12. The 3' and 5' ends of the viral genome consist of repeated sequences known as the viral long terminal repeat (LTR) which is about 1300 base pairs (bp) in size. Within the 3' region of the LTR is an approximately 1000 by open reading frame (orf) whose protein product, called the superantigen (SAg), mediates a ~~ ,'profound effect on the host T cell population.
'' Unlike other oncogenic retroviruses, MMTV does not carry a unique oncogene. Rather, upon infection of mammary epithelial cells, insertion of the MMTV provirus into the host genome in the region of int-l or int-2 or other yet unidentified genes) results in the activation of these genes through the enhancer activity of the glucocorticoid response element in the MMTV LTR.
It has been demonstrated that mice free of MMTV can usually be immunized readily against MMTV antigens and are thereafter less susceptible to or completely resistant against challenge implants of MMTV-infected mammary tumor tissue, Blair, 1973., Isr. J. Med. Sci. 7:161-186; Wei et al., 1993, Cancer Biol. 4:205-213.
Efforts to demonstrate the presence of viruses in human breast cancer through search for viral particles, immunological cross-reactivity, or sequence homology have yielded contradictory results. Detectable MMTV env gene-related antigenic reactivity has been found in tissue sections of breast cancer, Mesa-Tejada et al., 1978, Proc:
Natl. Acad. Sci. USA 75:1529-1533; Levine et al., 1980, Proc.
Am. Assoc. Cancer Res. 21:170; Lloyd et al., 1983, Cancer 51:654-661; breast cancer cells in culture, Litvinov and Golovkina, 1989, Acta Virologica 33:137-142; human milk, Zotter et al.,. 1980, Eur. J. Cancer 16:455-467; in sera of patients, Day et al., 1981, Proc. Natl. Acad. Sci. USA
78:2483-2487; in cyst fluid, Witkin et al., 1981, J. Clin.
Invest. 67:216-222; and in particles produced by a human l~ breast carcinoma cell line, Keydar et al., 1984, Prvc. Natl.
Acad. Sci. USA 81:4188-4192. Sequence homology to MMTV has been found in human DNA under low stringency conditions of hybridization, Callahan et al., 1992, Proc. Natl. Acad. Sci.
USA 79:5503-5507, and RNA related to MMTV has been detected in human breast .cancer.cells, Axel et al., 1972, Nature 235:32-36. The presence of MMTV related sequences in lymphocytes from patients with breast cancer has been reported by Crepin et al., 1984, Biochem. Biophys. Res. Comm.
118:324-331, as well as detection of reverse transcriptase (RT) activity in their monocytes. A1-Sumidaie et al., 1988, Cancer Research 49:3879-3883 have reported the presence of MMTV-like sequences arranged as tandem repeats.only in DNA
from breast cancer cells.
However, these results have been difficult to interpret in view of the relatively recent discovery of human endogenous retroviral sequences ("HERs"), Westley et al., 1986, J. Virol. 60:743-749, Ono et al., 1986, J. Virol.
60:589-598, Faff et al., 1992, J.~ Gen: Virology 73:1087-1097, International Patent Publication WO 97/17470. Data which could be interpreted to demonstrate the presence of MMTV-related sequences could be more readily explained by exogenous human retroviral sequences, Pogo and Holland, 1.997, Biological Trace Element Res. 56:131-142. Adding further confusion to the picture, env-gene related antigenicity has been detected in epitopes of human proteins, Hareuveni et al., 1990, Int. J. Cancer 46:1234-1135. Thus, there have been many contradictory explanations for the cause of breast cancer.
Citation of a reference in this or any section of the specification shall not be construed that such reference is prior art to the present invention.
3. SZJ1~IARY OF THE INVENTION
The methods of the present invention are directed to the administration of an immunomodulatory composition comprising at least one NiNITV antigen to humans for eliciting an increase in a cellular or humoral immune response against MMTV for preventing or treating a disease or disorder in a human caused by MMTV infection. The present invention is based, in part, on the discovery that zoonotic transmission of MMTV to humans occurs and that MMTV infection can cause diseases and disorders in humans, including breast cancer and non-Hodgkins lymphoma. The present inventors have determined that the variable incidence of breast cancer around the world correlates with the prevalence and viral load of MMTV in mice in different geographic locations.
The methods of the present invention are also useful for preventing or treating a disease or disorder in a human caused by a biological or chemical agent that reacts with an antibody directed to a MMTV antigen. The immunomodulatory compositions comprise at ,least one MMTV
antigen and a pharmaceutically acceptable carrier.
In another embodiment of the invention, the composition comprises at least one antibody that is directed to a MMTV antigen, which composition can be used in passive immunotherapy for preventing or treating a disease or disorder in a human caused by NINITV infection or for WO 99!51268 PCT/US99/07712 preventing or treating a disease or disorder in a human caused by a biological or chemical agent that reacts with an antibody directed to a MMTV antigen The present invention also provides for methods for selecting a MMTV antigen that will elicit an immune response by determining whether a test MMTV antigen is reactive with an antibody or immune cell obtained from an individual that already exhibits an immune reaction to a MMTV antigen, i.e.,~
an individual such as a human or mouse that has been exposed to or infected with MMTV, or determining whether the test antigen is reactive with an antibody or immune cell obtained from an individual immunized with a MMTV antigen, and the use of such selected antigen in the immunomodulatory compositions of the invention.
The present invention also provides for methods for obtaining a peptide mimetic of a MMTV antigen by~screening a library, e.g., including but not limited to a combinatorial peptide library, a random peptide library or a phage expression library, with an antibody or immune cell obtained from an individual that already exhibits an immune reaction to a MMTV antigen, or screening with an antibody or immune cell obtained from an individual immunized with a MMTV
antigen, for example, a neutralizing mouse poly- or mono-clonal antibody. Those positively reacting members of the library (the mimeticy can be used in the immunomodulatory compositions of the present invention. Such mimetics can represent continuous or discontinuous epitopes of a MMTV
antigen.
3.1 DEFINITIONS
As used herein, the following terms will have the meaning indicated.
The term "MMTV antigen" refers to a peptide, which peptide comprises the full length native amino acid sequence, or a portion thereof, of a MMTV-encoded peptide, for example, including but not limited to the envelope peptide, reverse transcriptase, the core proteins, or the encoded superantigen. The term also refers to analogs of the peptide, which are functionally, e.g., antigenically, equivalent peptides, such as a peptide mimetic. Preferred analogs are those which are substantially homologous to the corresponding native amino acid sequence and comprise at least one native MMTV epitope, such as a neutralizing epitope. The term "MMTV antigen" also refers to a nucleic acid molecule which encodes for a peptide, which peptide comprises the full length native amino acid sequence, or a portion thereof, of a MMTV-encoded protein. The term also refers to analogs of the nucleic acid.molecule, vahich are functionally equivalent, e.g., the molecule encodes a MMTV
peptide. Analogs can be those which are substantially homologous to the corresponding native nucleotide sequence and which encode for a peptide comprising at least one native MMTV epitope, such as a neutralizing epitope. The term "MMTV
antigen" also refers to a peptide, which peptide comprises at 28 least one discontinuous epitope of MMTV, or an analog of the peptide. The term also refers to a nucleic acid molecule which encodes for a peptide, which peptide comprises at least one discontinuous epitope of MMTV, or an analog of the nucleic acid molecule.
The term "discontinuous epitope" refers to an epitope which comprises amino acid sequences derived from different positions in the primary amino acid sequence of the peptide but which are adjacent to each other in the three-dimensional structure of the peptide. The discontinuous epitope, also called a conformational epitope, can be encoded for by a nucleic acid molecule which comprises nucleic acid sequences encoding the three-dimensionally adjacent amino acid sequences. This is in contrast to a continuous epitope which is defined as an epitope in which the antigenic residues reside within a short sequence of amino acids, i.e, continuous to each other:
The term "effective amount" refers to an amount of an antigen sufficient to induce a measurable immune response in the subject to which it is administered. The immune response may comprise, without limitation, induction of antigen-reactive antibody production, or induction of cellular or humoral immunity.
The term "immunomodulatory composition" refers to a composition which comprises a MMTV antigen and a pharmaceutically acceptable carrier, which when administered to a subject causes a measurable change in the immune system t function of the subject, e.g., production of immunospecific antibodies, or production of antibodies that elicit a cell mediated immune response.
The term "pharmaceutically acceptable carrier"
refers to a carrier medium that does not interfere with the effectiveness of the biological activity of the active ingredient, is chemically inert, and is nat toxic to the patient to whom it is administered in the amount administered.
The term "treating or preventing a disease or disorder caused by MMTV" means to inhibit the replication of the MMTV virus, to inhibit MMTV transmission, or to prevent NINiTV from establishing itself in its host, or to ameliorate or alleviate the symptoms of a disease caused by MMTV
infection, including but not limited to, breast cancer and non-Hodgkins lymphoma. The term also encompasses ameliorating or alleviating the symptoms of a disease caused by a biological or chemical agent that reacts with an antibody directed to a MMTV antigen. The treatment is considered therapeutic if there is a reduction in viral load, e.g., number of copies of the virus in the blood, a decrease in mortality and/or morbidity.
4. BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the nucleotide sequence of the complete proviral genome of one strain of mouse mammary tumor virus (SEQ ID NO; l).
Figure 2 shows the encoded amino acid sequene~~of the gag-pol-pro polypeptide (SEQ ID N0:2).
Figure-3 shows the encoded amino acid sequence of the gag-pro polypeptide (SEQ ID N0:3).
Figure 4-shows the encoded amino acid sequence of the gag polypeptide (SEQ ID N0:4}.
Figure 5 shows the encoded amino acid sequence of the env polypeptide (SEQ ID N0:5).
Figure 6 shows the encoded amino acid sequence of the superantigen (SAg) polypeptide (SEQ ID N0:6).
5. DETAILED DESCRIPTION OF THE INVENTION
The methods of the present invention are directed to the administration of an immunomodulatory composition comprising at least one MMTV antigen to humans for eliciting an increase in'a cellular or humoral immune response against MMTV for preventing or treating a disease or disorder in a human caused by MMTV infection. The methods of the present invention are also useful for preventing or treating a disease or disorder in a human caused by a biological or chemical agent that reacts with an antibody directed to a MMTV antigen. The immunomodulatory compositions comprise at least one MMTV antigen and a pharmaceutically acceptable carrier. The MMTV antigen, as defined supra can be, ixa.ter alia, a peptide, peptide analog or nucleic acid molecule encoding such peptide or peptide analog. Such peptides can include the gag, pol and envelope proteins of MMTV as well as _ g -portions thereof. The present invention further relates to methods of expressing the MMTV antigen, inc3.uding expression vectors and cell lines, both eukaryotic and prokaryotic as well as viral expression vectors, and the use of such expressed antigen in the immunomodulatory compositions of the invention.
In another embodiment of the invention, the composition comprises at least one antibody that is directed to a MMTV antigen, which composition can be used in passive immunotherapy for preventing or treating a disease or l~ disorder in a human caused by MMTV infection or for preventing or treating a disease or disorder in a human caused by a biological or chemical agent that reacts with an antibody directed to a MMTV antigen.
The present invention also provides for methods for selecting a MMTV antigen that will elicit an immune response by determining whether a test MMTV antigen is reactive with an antibody or immune cell obtained from an individual that already exhibits an immune reaction to a MMTV antigen, i.e., an individual exposed to or infected with MMTV, or by 2Q determining whether the test antigen is reactive with an antibody or immune cell obtained from an individual immunized with an immunomodulatory composition of the present invention, and the use of such selected antigen in the immunomodulatory compositions of the invention. For example, the antibody can be a neutralizing mouse poly- or mono-clonal ~5 antibody.
The present invention also provides for methods for obtaining a peptide mimetic of a MMTV antigen by screening a library, e.g., including but not limited to a combinatorial peptide library, a random peptide library or a phage expression library, with an antibody or immune cell obtained from an individual that already exhibits an immune reaction to a MMTV antigen, or screening with an antibody or immune _ g _ cell obtained from an individual immunized with an immunomodulatory composition of the present invention. For example, the antibody can be a neutralizing mouse poly- or mono-clonal antibody. Those positively reacting members of the library (the mimetic) can be used in the immunomodulatory compositions of the present invention:
In an embodiment of the invention, at least one MMTV peptide that is antigenic or immunogenic is used in an immunomodulatory composition of the present invention. In another embodiment of the invention, at least one MMTV
nucleotide sequence is used in an immunomodulatory composition of the present invention, which nucleotide sequence, upon expression in an appropriate host cell, produces at least one MMTV peptide that is antigenic or immunogenic. An antigenic peptide is capable of being Z5 immunospecifically bound by an antibody to the peptide. An immunogenic peptide is capable of eliciting an immune response to the peptide, e.g., production of an antibody that immunospecifically binds the peptide or elicits a cell-mediated immune response directed against the peptide.
The immunomodulatory compositions can be used in a solely preventative way for those subjects not exposed to MMTV or to the MMTV antibody-reactive biological or chemical agent, or in a therapeutic procedure after the recipient is already infected or exposed to MMTV or to the MMTV antibody-reactive biological or chemical agent, or both. The MMTV
antigens of the invention also have utility in diagnostic immunoassays, passive immunotherapy, and generation of antiidiotypic antibodies.
5.1. MMTV PEPTIDES
The present invention encompasses MMTV peptides and immunogenic or antigenic portions thereof, as well as analogs of such peptides or portions, and peptides having an amino WO 99/51268 PCTIUS991077i2 acid sequence which represents at least one discontinuous epztope of MMTV and their use in the immunomodulatory compositions of the present invention. The peptides of the present invention include the following: (1) any peptide having an amino acid sequence which is immunologically reactive with a anti-MMTV antibody; (2) any peptide having an amino acid sequence comprising the amino acid sequence as shown in any of Figures 2-6 (SEQ ID NOS:2-6) or an immunogenic or antigenic portion thereof of at least 6 contiguous amino acids; and (3) any peptide having an amino ZO acid sequence that represents a discontinuous epitope of a MMTV antigen and reacts with a MMTV peptide-reactive antibody. For example, an antigenic portion of the peptide shown in Figure 2 useful in the compositions of the present invention has an amino acid sequence selected from the group consisting of about aaX ~to about aay, wherein aaX denotes from about amino acid number 1 to about amino acid number 1746 of SEQ ID N0:2 and aay is about amino acid number x+9 of SEQ ID
N0:2; i.e., an amino acid sequence selected from the group consisting of amino acid sequences comprising from about aal 20 to about aalo, about aa2 to about aall, about aa3 to about aal2, about aa4 to about aal3, about aas to about aal~, about aa~ to about aal5, about aa, to about aal6, about aa8 to about aal"
about aa9 to about aal8, about aala to about aal9, about aall to about aaZO; about aalz to about aa2l, about aal3 to about aaZZ~
about aal4 to about aa23, about aal5 to about aa24; about aals to about aa25, about aal~ to about aa26, about aale to about aa2~, about aal9 to about aa28, about aazo to about aa29, about aa21 to about aa3o, about aaz~ to about aa3l, about aa23 to about aa3z, about aa24 to about aa33 , about - aa25 to about aa34 , about aa26 to about aa35 , about aa~., to about aa36 , about aa28 to about aa3~ , 30 about aa29 to about aa3g, about aa3o to about aa39, about aa31 to about aa4o, about aa32 to about aa4l, about aa33 to about aa4z, about aa34 to about aa43, about aa3~ to about aa44, about aa36 to about aa45, about aa3., to about aa4s, about aa38 to about aa4."
about aa39 to about aa4a, about aa4o to about aa49, about aa41 to about aa5o, about aa4z to about aa5l, about aa43 to about aa~z, about aa44 to about aa53 , about aa45 to about aas4 , about aa4s to about aa55, about aa4, to about aass, about aa48 to about aa5"
about aa49 to about aa58, about aaso to about aas9, about aa51 to about aaso, about aasz to about aril, about aa53 to about aasz~
about aas9 to about aa63, about aass to about aas4, about aass to about aa65, about aas., to about aass, about aa58 to about aas~, about aa59 to about aa68, about aaso to about aas9, about aril to about aa,o, about aa6z to about aa~l, about aa63 to about aa.,z~
about aa64 to about aa.,3 , about aas5 to about aa,4 , about aass to about aa.,s, about aa67 to about aa,6, about aase to about aa~."
about aas9 to about aa.,s, about aa.,o to about aa.,9, about aa,l to about aaeo, about aa~z to about aael, about aa~3 to about aaez, about aa~4 to about aae3 , about aa~s to. about aae4 , about aa,s to about aaes, about aa~, to about aaes, about aa,g to about aa8."
about aa.,9 to about aase, about aaso to about aae9, about aa81 to about aa9o, about aa8z to about aa9l, about aa83 to about aa9z, about aae4 to about aa93, about aae5 to about aa94, about aaas to 2 0 about aa95 , about aa8~ to about aa9s , about aae$ to about aa9~ , about aae9 to about aa9g, about aa9o to about aa99, about aa91 to about aaloo~ about aa9z to about aalol, about aag3 to about aalaz~
about aa94 to about aalo3~ about aa95 to about aalo4. about aa9s to about aalos, about aa9, to about aalo6, about aa9a to about aalo" about aa99 to about aalo$, about aaloo to about aalo9, about aalol to about aallo. about aaloz to about aa111, about aalo3 to about aallz~ about aalo4 to about aall3, about aalos to about aa114~ about aalos to about aalls. about aalo., to about aalls~
about aaloe to about aall~, about aalo9 to about aalla. about aallo to about aall9, about aalll to about aalzo. about aallz to about aalzl. about aalla to about aalzz, about aa114 to about aalzs~
about aall5 to about aalz4~ about aalls to about aalzs, about aall~
to about aalzs~ about aall8 to about aalz." about aall9 to about aalz8,about aalzo about aalz9,about aalzl about aalao to to about aalzz to aboutaa131,about aalz3 to aboutaal3z about aa124 to to to about about about aal,3, aa134, about about aalzs aalzs aalss about aalz., about aal3s,about aalz8 about aal3."
to to about aalz9 to aboutaa138,about aalso to aboutaa139,about aai31 to to to about about about aal4o, aa141, about about aal3z aa133 aal4z,about aals4 about aa143,about aal3s about aa144, to to about aal3s to aboutaal4s,about aal~., to aboutaalgs,about aalsa to to to about about about aal4" ~
about aalQa, aa139 about aal4o aa149,about aa141 about aalso.about aal4z about aalsl, to to 10about aa143 to aboutaalsz.about aal4~ to aboutaals3,about aal4s to to to about about about aals4 aalss, about about aal4s aalq., aalss about aal4g about aals~,about aa149 about aalse, to to about aalso to aboutaals9,about aalsl to aboutaalso,about aalsz to to to about about about aalsl. aal6z.
about about aalss aals4 1~aa163,about aalss about aa164.about aalss about aalss to to about aals., to aboutaalssrabout aalse to aboutaals~,about aals9 to to to about about about aals8, aals9, about about aalso aalsl aal~o,about aalsz about aal.,l,about aals3 about aal,z, to to about aa164 to aboutaal7a about aalss to aboutaal,4,about aalss 20to to to about about about aal~s, aal.,6, about about aal6~ aalsa aal~~,about aals9 about aal,e,about aal7o about aal,9, to to about aal~l to aboutaalso,about aal.,z to aboutaalel.about aal,s to to to about about about aalez, aa183, about about aa174 aal,s aals4,about aal~s about aalas,about aal." abbut aa186 to to about aal~e to aboutaale."about aal.,9 to aboutaal$$,about aalso 25to to to about about about aaze9, aal9o, about about aalel aalsz aalgl,about aalg3 about aal9z,about aalg4 about aa193, to to about aalss to aboutaal9~,about aa186 to aboutaal9s,about aa187 to to to about about about aa196, aal9~, about about aalea aales aal9e,about aalso about aals9 about aal~1 about aazoo to to 30about aal9z to aboutaa2ol,about aal9a to aboutaa2oz,about aa194 to t aal9sto out aazo4, to about about ab about aal9s aazoa.
abou aazos,about aal9., about aazo~,about aa198 about aazo."
to to WO 99/5126$ PCT/US99/07712 about aa199 to about aazoe~ about aazoo to about aazo9, about aazol to about aazlo, about aazoz to about aazll, about aazos to about aa2lz. about aazo4 to about aazl3: about aazos to about aazl4, about aazos to about aazls~ about aazo., to about aazls~ about aazoe to about aazl." about aazo9 to about aazla~ about aazlo to about _.
aazl9, about aazll to about aazzo~ about aazlz to about aazzl~
about aazl3 to about aaz2z. about aazl4 to about aazza~ about aazls to about aazz4, about aazls to about aazzs, about aazl., to about aazzs~ about aazla to about aa2z~, about aazl9 to about aaz2e, about aazzo to about aazzs, about aazzl to about aaz3o, about aazzz to about aaz3,,, about aazz3 to about aaz3z, about aazz4 to about aaza3 , about aazzs to about aaza4 , about aazz6 to about aaz3s, about aazz~ to about aa23s~ about aazza to about aaz3." about aazzs to about aaz3B, about aazao to about aaz39, about aazal to about aaz4o, about aa23z to about aaz4l~ about aaza3 to about aaz4zl about aaz3g to about aaz43~ about aa23s to about aaz44l about aaz36 to about aaz~5, about aaz3., to about aaz4s~ about aaz3a to about aaz4." about aaz39 to about aaz4a, about aaz4o to about aaz49~
about aaz41 to about aazso, about aaz4z to about aazsl. about aaz43 to about aazsz, about aaz44 to about aazs3, about aaz4s to about aazs4 ~ about aaz4s to about aazss., about aaz4, to about aazs6, about aaz4a to about aaz5~, about aaz99 to about aazsa, about aazso to about aazs9, about aazsl to about aazso, about aazsz to about aazsl, about aazs3 to about aazsz. about aazs4 to about aazs3, about aa2ss to about aazs4, about aazss to about aa2ss. about aazs, to about aazss, about aazsa to about aa26~, about aazsg to about aazsa~ about aazso to about aaz69, about aazsl to about aaz.,o.
about aazsz to about aaz.,l, about aazsa to about aaz.,z, about aazs4 to about aaz.,3, about aazss to about aaz.,4, about aaz6s to about aaz.,s, about aa26., to about aaz~s, about aazsa to about aaz~"
about aazs9 to about aa2~8, about aaz~o to about aaz~9, about aaz,l to about aazao, about aaz.,z to about aazal~ about aaz~3 to about aazaz. about aaz.,4 to about aaza3; about aaz.,s to about aaZe~.
about aa2~6 to about aazas. about aaz." to about aazes. about aaz,a WO 99!51268 PCT/US991077i2 to about aazs" about aaz,9to about aaz88, about aazaoto about aaze9, about aazel to aboutaaz9o, about aazsz to aboutaazgl, about aaza3 to about aaz9z,about aaz84 to about aaz93,about aazBs to about aaz94, about aazssto about aaz9s, about aaz8.,to about aaz9s, about aazee to aboutaaz9~, about aa2a9 to aboutaazse about aaz9o to about aazs9about aaz91 to about aa3oo,about aaz9z to about aa3ol, about aaz93to about aa3oz about aazs4to about aa3o3 , about aaz9s to aa3o4 r about aaz96 to aa3os about about about aaz9~ to about aa~,o6,about aaz98 to about aa3o."about aazg9 to about aa3o8, about aa3ooto about aa3o9, about aa3o1to about aa3lo. about aa3oz to aboutaa311 about aa3o3 to aboutaa3lz about aa3o4 to about aa313about aa3os to about aa3l,~,about aa3o6 to about aa315, about aa3o7to about aa~l6, about aa3oeto about aa3l~, about aa3o9 to aboutaa318, about aa3zo to aboutaa319 about aa311 to about aa3zoabout aa3lz to about aa3u.about aa3la to about aa3zz about aa314to about aa3z3, about aa3lsto about aa3z4, about aa3ls to aboutaa3zs about aa3l, to aboutaa3zs.

about aa318 to about aa3z"about aa319 to about aa3ze,about aa3zo to about aa3z9. about aa3z1to about aa33o about aa3zzto about aa331 about aa3za to aboutaa33z, about aa3z4 to aboutaa3aa about aa3zs to about aa3a4.about aa3zs to about aa3asabout aa3z., to about aa33s, about aa3zeto about aa33." about aa3zsto about - aa33g, about aa33o to aboutaa339, about aa3a1 to aboutaa34o, about aa33z to about aa341,about aa3~3 to about aa34z,about aa334 to about aa34a . about to about aa344. about aa33sto about aa33s aa34s, about aa33~ to aboutaa34s, about aa338 to aboutaa34~, about aa339 to about aa34e.about aa34o to about aa349,about aa341 to about aa3so, about aa39zto about aa3sl, about aa343to about aa3sz r about aa34Q to aa3s3. about aa3~s to aboutaa3s4 about about aa34s to about aa3ssabout aa347 to about aa3ss.about aa3as to about aa3s~, about aa34sto about aa3s8, about aa3soto about' aa3s9, about aa3s1 to aboutaa3so. about aa3sz to aboutaa3sl about aa3sa to about aa3szabout aa3s4 to about aa3saabout aa3ss , , to about aa3s4 about aa3ssto about aa36s, about aa3s.,to about aa3ss,about aa3sa about aa3s."about aa359 about aa3sa, to to about aa3so to aboutaa3s9,about aa3s1 to about aa3.,o,about aa3sz .

to to to about about about aa~.,l, aa3~z, about about aa3s3 aa3s4 aa3.,3,about aa3ss about aa3~4,about aa3ss about aa3,5, to to about aa3s., to aboutaa3~s,about aa3s8 to about aa3~."about aa3ss to to to about about about aa3.,a, aa3~9, about about aa3~o aa3.,1 aa3ao about aa3.,z about aa3el.about aa3.,~ about aa3az , , to to about aa3.,4 to aboutaa3sa about aa37s to about aa3a4 about aa3.,s , , to to to about about about aa3a5, aaaes about about aa3~, aa3.,a aa38" about aa3.,9 about aa3as.about aa3ao about aa3a9, to to about aa3a1 to aboutaa39o,about aa3az to about aa3sl about aa3a3 to to to about about about aa39z. aa3s3, about about aa3a4 aa385 aa394,about aa3as about aa395,about aa38~ about aa39s;
to to about aa3ea to aboutaa39~,about aa3e9 to about aa39a,about aa39o to to to about about about aa399, aa4oo about about aa391 aa39z aa4ol about aa393 about aa4oz about aa394 about aa4o3 , to , to about aa395 to aboutaa,,o4,about aa39s to about aa4os,about aa39~

to to to about about about aa4os, aa4o."
about about aa3ga aa399 aa4o8,about aa4oo about aa4o9,about aa4o1 about aa4lo, to to about aa4oz to aboutaa411 about aa4o~ to about aa4lz,about aa4o4 2 0 to to to about about about aa413 aa414 , , about about aa4os aa4os aa415.about aa4o~ about aa4ls,about aa4oe about aa,l."
to to - about aaqo9 to aboutaa4le about aa4lo to about aa419,about aa411 to to to about about about aa4zo aa4zl about about aa4lz aa413 aa4zz about aa914 about aa4za about aa415 about aa4z4 , , to , to about aa4ls to aboutaa4zs about aa4l~ to about aa4zs,about aa418 to to to about about about aa4z." aa4za.
about about aa419 aa4zo aa4z9 about aa4z1 about aa43o,about aa4zz about aa431.
to to about aa4z3 to aboutaa4az,about aa4z4 to about aa43a about aa4zs to t aa4zsto to about about about aa434, aa4as, abou about aa4z., aa43s,about aa4ze about aa43."about aa4z9 about aa4as to to about aa4ao to aboutaa439,about aa4a1 to about aa44o about aa43z to t aa43~to out aa44z , to about about ab about aa434 aa441, abou aa44s.about aa435 about aa444 about aa43s about aa445, to to about aa43., to aboutaa44s,about aa43a to aboutaa44."about aa439 to aa44oto about- to about about aa449, aa44s. about about aa44, aa4so.about aa44z aboutaa4s" about aa,,43 about aa4sz to to about aa444 to about aa4s3about aa44s to aboutaa4s4.about aa44s , to aa44~to about to about about aa4ss, aa4ss. about about aa44a aa4s."about aa,,49 aboutaa4sa, about aa4so about aa4s9, to to .

about aa4s1 to about aa4so~about aa4sz to aboutaa4sl,about aa4s3 to aa4s4to about to about about aa4s3, aa,,sz, about about aa4ss aa4s4.about aa4ss aboutaa4ss about aa4s~ about aa4ss to to about aa4sa to about aa4s,"about aa4s9 to aboutaa4sa,about aa4so to to about to about about aa4.,o, aa4s9 about about aa4sz aa4s, aa4", about aa4s3 aboutaa4~z, about aa4s4 about aa4~3, to to about aa4ss to about aa4~4;about aa4ss to aboutaaq.,s,about aa4s, to to about to about about aa4.,."
aag.,s, about about aa4s9 aa4sa aa4.,a,about aa4.,o aboutaa4~9, about aa4~, about aa4so to to about aa4,z to about aa4al,about aa4.,3 to aboutaa4az,about aa~~4 to to about to about about aa4a4 aa4a3 , about , aa4.,6 about aa4,s aa4as about aa~7~ aboutaa4as, about aa4~a about aa4e~.
to to about aa4~9 to about aa4ea.about aa4ao to aboutaa4a9,about aa4a1 to to about to about about aa491, aa49o, about about aa4a3 aa4az aa49z about aa4a4 aboutaa493, about aa4as about aa494 ~ to to about aa4as to about aa49s.about aa4a~ to aboutaa49s,about aa4aa to to about to about about aa498, aa49" about about aa4so aa489 aa499,about aa49, aboutaasoo. about aa4sz about aasol to to about aa493 to about aasoz,about aa494 to aboutaaso3 about aa49s to to about to about about aasos, aaso4. about about aa49., aa~9s ~5 aasos about aa498 aboutaaso." about aa499 about aasos to to about aasoo to about aaso9,about aaso, to aboutaas,o,about aasoz to to about to about about aas,z, aasl" about about aaso4 aa5o3 aas,3,about aasos aboutaas,~, about aasos about aasls to to about aaso~ to about aas,s.about aasoa to aboutaas,."about aaso9 to to about to about about aas,9, aas,a, about abaut aasll aaslo aaszo about aas,z aboutaasz" about aas,3 about aaszz~
to to about aa514 to about aasz3about aas,s to aboutaasz4.about aasls to about aaszs, about aasl,to about aaszs, about aaslato about aasz.,, about aasl9 to aasza about aaszo to about aaszg about about aaszl to about aas3o,about aaszz to about aas3l:about aasza to about aas3z, about aasz4to about aas33, about aaszsto about S aas34 ~ about aaszs to aa53s , about aasz? to aboutaas3s, about about aasza to about aasa7.about aasz9 to about aas3a.about aas3o to about aas39, about aas31to about aas4o. about aasazto about aas4l. about aa53a to aboutaas4z, about aas34 to aboutaas43, about aasss to about aa5~4,about aas3s to about aas4s.about aas3?

to about aas4s about aasasto about aas4~, about aasa9to about aa548 ~ about aas4o to aas4s. about aas4l to aboutaa5so about about aas4z to about aassl,about aas43 to about aassz,about aas44 to about aass3, about aas4sto about aa5s4, about aas4sto about aasss . about aas4., to aasss , about aas4a to aboutaass~ , about about aas4s to about aassa,about aasse to about aass9,about aassl to about aasso about aasszto about aassl, about aa5s3to about aassz. about aass4 to aboutaassa about aasss to about aass4 about aasss to about aasss.about aass., to about aasss,about aassa to about aa5s.,, about to about aassa, about aassoto about aass9 aass9, about aassl to aboutaas.,o, about aassz to aboutaas.,l.

2 about aassa to about aas~zabout aass4 to about aas~3 about aasss 0 , , to about aas.,4, about to about aas~s, about aass.,to about aasss aas.,s, about aassa to aas.,.,, about aass9 to aas.,a, about about about aas,o to about aas.,9,about aas,l to about aasao.about aas~z to about aasal. about aas.,3to about aasaz , about aas,4to about aasa3, about aas~s to aboutaasa4. about aas~s to aboutaasas, about aas,~ to about aasas,about aas~a to about aasa~,about aas,9 to about aasas about aasaoto about aasa9, about aasalto about aas9o, about aasaz to aboutaas9l, about aassa to aboutaas9z about aase4 to about aa593,about aasas to about aas94,about aasas to about aas9s about aa58~to about aas9s, about aaseato about aa59." about aase9 to aboutaas9a, about aas9o to aboutaas99, about aas91 to about aasooabout aas9z to about aasol,about aass3 to about aasoz, about aas94to about aasoa. about aas9sto about _ 18 _ WO 99/51268 PCT/US991077i2 aa6o4.about aasss about aasos,about aa5s~ about aa6os to to about aassa to aboutaa6o."about aa5ss to aboutaa6oe:about aa6oo to to to about about about aafios, aaslo, about about aasol aa6oz aabll,about aa6o3 about aaslz.about aa6o4 about aa613 to to about aa6os to aboutaa614.about aa6os to aboutaa6ls about aaso, to to to about about about arils, aa6l~, about about aa6oe aasos aasla,about aa6lo about aa6ls about aasll about aa6zo to to about aa6lz to aboutaafizl,about aa6la to aboutaaszz.about aa614 to to to about about about aasza. aa6z4, about about aa6ls aa616 aa6zs about aa6l~ about aaszs about aasle about aasz."
to to about aa6ls to aboutaasza,about aaszo to aboutaa6z9,about aa6z1 to to to about about about aa6ao aa631:
about about aa6zz aasz3 aasaz about aa6z4 about aa6aa about aa6zs about aa634 , , to , to about aasz6 to aboutaa6~5,about aa6z., to aboutaasas about aa6ze to to to about about about aa6~." aa63a, about about aa6zs aasso 35 aa63s,about aa6al about aa64o.about aassz about aa641, to to about aa633 to aboutasfi~z,about aa6a4 to aboutaa643,about aa63s to to to about about about aa6~4 aa645, , about about aa63:, aa63s aa64s.about aa6ae about aa64" about aa63s about aa648, to to about aa64o to aboutaa64s,about aas41 to aboutaa6so,about aa64z to to to about about about aa6sl. aassz.
about about aa64a aa644 aassa about aa64s about aa654 about aab46 about aasss , to , to - about aa64~ to aboutaasss,about aa64$ to aboutaa65."about aas9s to to to about about about aa65a, aasss about about aa65o aassl aasso.about aafisz about aa6sl.about aafisa about aassz to to about aass4 to aboutaa6sa.about aa655 to aboutaa6s4.about aa6ss to to to about about about aasss. aa6ss about about aa65~ arise aa6s7,about aa65s about aasse,about aa6so about aa6ss to to about aa661 to aboutaas~o,about aa6sz to aboutaas~l,about aass3 to to to about about about aa6.,z, aa6.,3, about about aass4 aa6s5 aa6,4 about aa6ss about aas~5,about aa66~ about aa6~s , to to about aa6sa to aboutaas.,.,,about aa66s to aboutaa6~8,about aas~o to to t aa6.,zto about about about aas.,s, aaseo about abou aas.,l aa6sl about aa6~3 about aa6az about aa6~4 about aa6aa , to , to about aas~s to aboutaa6e4.about aa6.,6 to aboutaa6es.about aas,~

to to to about about about aa686, aa68.,, about about aas.,e aas,9 aa6ea.about aasso about aa689,about aa6e1 about aa69o, to to about aa68z to aboutaa691,about aass3 to aboutaas9z,about aa684 to to to about about about aa693 aa694 , , about about aa6ss aase6 aa69s,about aasa~ about aa6ss.about aa688 about aa69"
to to about aa689 to aboutaa698,about aas9o to aboutaa699,about aa691 to to to about about about aa.,oo aa.,ol, about about aas9z aa6~3 aa~oz about aa694 about aa~o3 about aasss about aa.,04 , , to , to about aa69s to aboutaa,os,about aa69, to aboutaa.,os.about aa698 10to to to about about about aa,o." aaTOa.
about about aas99 aa,oo aa~o9,about aa~ol about aa~~o,about aa.,oz about aa,ll to to about aa,o3 to aboutaa.,lz.about aa.,o4 to aboutaa,l3 about aa.,os , to to to about about about aa~l4, aa.,ls about about aa,o6 aa7o., aa.,l6,about aa~o$ about aa.,l~,about aa,o9 about aa~la, to to 15about to about aa.,l9about aa.,u to aboutaa.,zo.about aa.,lz aa.,l o to to to about about about aa.,zl, aa,zz, about about aa.,l3 aa.,lq aa,z3 about aa,ls about aa,24,about aa.,ls about aa.,zs , , to to about aa."~ to aboutaa.,z6.about aa.,le to aboutaa.,z."about aa~l9 to to to about about about aa.,ze aa,z9, about about aa.,zo aa~zl 2 aa~3o about aa~2z about aa~31,about aa7za about aa.,az , 0 ~ to to about aa.,2~ to aboutaa,33,about aa,zs to aboutaa.,a4.about aa,zs to to to about about about aa,3s, aa.,3s about about aa~z, aa,za aa.,3~,about aa~z9 about aa.,3eabout aa.,so about aa,3s to to about aa~31 to aboutaa.,4o.about aa~3z to aboutaa~4l,about aa~33 to to to about about about aa~4z, aa,43, about about aa~34 aa.,3s 25aa'44~about aa,36 about aa.,as.about aa.,3., about aa.,4s to to about aa.,38 to aboutaa,4" about aa.,as to aboutaa,4B,about aa~4o to to to about about about aa.,49 aa,so, about about aa~41 aa~4z aa~sl,about aa.,~3 about aa:,sz,about aa.,~4 about aa,sa to to about aa~~s to aboutaa~s4,about aa,46 to aboutaa.,ss.about aa~4, 30to to out aa~s~, to about about ab about aa~49 aa,s6, about aa,48 aa.,5g,about aa7so about aa7s9 about aa.,sl about aa.,so to to about aa.,sz to aboutaa.,sl.about aa~s3 to aboutaa~sz,about aa.,s4 to about aa.,s3. about to about aa,64 , about to about aa,ss aa.,ss aa~65, about aa.,5~ to aa~66, about aa.,se to aa.,s"
about about about aa,s9 to about aa~6g,about aa~so to about aa.,s9about aa,s, to about aa.,.,o, about to about aa.,.,l, about to about aa.,sa as?s3 aa,~2 , about aa.,64 to aa~.,3 ; about aa~6s to aa.,.,4 about about , about aa~66 to about aa~.,s,about aa,67 to about aa.,.,s,about aa~68 to about aa.,.,~, about to about aa.,.,e, about to about aa.,s9 aa.,.,o aa.,~9, about aa~?, to aa~ea, about aa.,~2 to aa.,el.
about about about aa,~3 to about aa.,82about aa~.,4 to about aa.,e3about aa~,s , , to about aa,e4, about aa~.,sto about aa,es, about aa,~.,to about aa786, about aa.,.,e to aa.,a~, about aa.,.,9 to aa.,$e.
about about about aa.,eo to about aa~~9,about aa.,e, to about aa~go,about aa~82 to about aa.,9" about aa~83to about aa~9z, about aa.,eQto about aa.,93 , about awes to aa.,94 , about aa,es to aa.,9s about about about aa~8., to about aa.,9sabout aa,88 to about aa.,9~,about aa~e9 1~ to about aa.,98, about to about aa.,99, about to about aa.,9o aa~91 aaeoo, about aa~92 to aboutaaeo,, about aa.,93 to aaeo2;
about about aa~94 to about aaeoaabout aa~9s to about aaeo4about aa,96 , , to about aaeos. about aa~9.,to about aaeo6, about aa.,9eto about aaeo" about aa.,99 to aboutaaeo8, about aaeoo to aboutaaeo9 about aaeoi to about aae,o,about aaeoa to about aae",about aaeo3 to about aa8,2, about aaeo4to about aae,3, about aaeosto about aae,4, about aaeo6 to aboutaae~s, about aaeo., to aae,6.
about about aaeoe to about aae,~,about aaeo9 to about aae,e,about aae,o to about aae,9, about aae"to about aaeao. about aae,2to about aa82" about aae" to about aaez2 , about aae,4 to aae2; , about about aae,s to about aa824.about aae,6 to about aae2s,about aae,., to about aae26, about aae,eto about aa$Z." about aae,9to about aae2e, about aae2o to aboutaa829, about aae2, to aboutaae3o, about aae2z to about aae3"about aae23 to about aae32about aaea4 , to about aae33, about aaeZSto about aae34, about aaezsto about aae3s, about aaez~ to aboutaaess about aa82a to aboutaa83."
~

aae38, about aae3o to about aae39,about aaB3, about aae29 to about to about aae4o , about to about aae4, , about to about aae3z aae3a WO 99/51268 PCT/US99/0??12 aa842,about aaa,4 about aa843.about aaa3s about aas44, to to about aaa3s to aboutaae4s,about aae3., to aboutaa846,about aae3a to to to about about about aa84." aa84s, about about aa839 aae4o aa849,about aa~41 about aaeso,about aa84z about aa$sl, to to about aa843 to aboutaa8s2 about aa844 to aboutaaes3 about aae4s , , to to to about about about aaes4, aa8ss, about about aae46 aa84, aae5s,about aas~e about aaes~,about aa849 about aa8s8, to to about aa8so to aboutaaes9 about aaesl to aboutaag6o,about aa8sa to to to about about about aa861, aaesz about .
aassa about aaBS4 aae63 about aaess about aa864 about aa856 about aaess , to , to about aaes~ to aboutaaess,about aa8se to aboutaa86.,,about aa8s9 to to to about about about aaase, aa~69, about about aa86o aaesl aa8~o,about aa~62 about aas,l,about aaesa about aa8~2.
to to about aaes4 to aboutaa8.,3,about aa86s to aboutaas~4,about aae6s to to to about about about aa8~s, aa$,6, about about aae6~ aaese aae~~ about aa869 about aae.,eabout aae.,o about aae,9, , to , to about aa8~1 to aboutaae8o,about aa8~2 to aboutaa881,about aas~3 to to to about about about aaes2, aa,~83, about about aae.,4 aa8~s aae84,about aa8,6 about aae$s,about aa8" about aa8a6, to to about aa$,8 to aboutaase~,about aae~9 to aboutaaeee,about aageo to to to about about about aa88g, aaeso about about aae81 aae82 aa891,about aa883 about aa892 about aa884 about aae9a , to , to about aaess to aboutaa894,about aae86 to aboutaa89s,about aae8., to to to about about about aae96, aae9~, about about aa888 aa889 aa898,about aa89o about aae99 about aae91 about aa9oo to to about aa892 to aboutaa9ol,about aaB93 to aboutaa9o2,about aaa94 2~

to to to about about about aa9o3 aago4, about about aae9s aaes6 aa9os,about aa89~ about aa9o6,about aaB98 about aa9o~, to to about aa899 to aboutaa9oe,about aa9oo to aboutaa9o9,about aa9o1 to to to about about about aa9lo, aa911, about about aa9o2 aa9o3 aa9lz,about aa9o4 about aa913,about aa9os about aa914, to to about aa9o6 to aboutaa9ls about aa9o., to aboutaa916.about aa9o$

to to to about about about aa9l." aa918, about about aa9o9 aa9lo aa919,about aa9,,1 about aa92o,about aa912 about aa921, to to WO 99151268 PCTlUS99/07712 about aa913 to about aa9zz,about aa914 about aa9za.about aa9ls to to aa9ls to about aa9l.,to about , about about aa9z4. aa9zs, about aa9z6 about aa918 aa9z."about 919 about aa9ze, to about aa to about aa9zo to about aa9z9,about aa9z1 about aa93a,about aa9zz to to aa9z3 to about aagz~ to about about about aa931, aa93z, about aag33,about aa9zs aa934,about 9zs about aa9as to about aa to about aa92., to aboutaa936,about aa9z8 about aa9a7.about aa9z9 to to aa93o to about aa931 to about about about aa938, aa939, about aa94o;about aa93z about aa941,about 9aa about aa94z to aa to about aa9a4 to about aa943 about aa93s about aas94 about aa93s , to , to aa9~~ to about aa93g to about about about aa9as, aa946, about aa94~,about aa939 about aa948,about 94o about aa949, .
to aa to about aa941 to about aa9so,about aa94z about aa951,about aag43 to to aa944 to about aa94s to about about about aa9sz aa9s3 , , about aa954,about aa94s about aa9ss,about about aa9s6, to aa94, to 15about aa948 to about aa9s~,about aa949 about aa9sg,about aa9so to to aa9s1 to about aa9sz to about about about aa95g, aa96o, about aa961,about aa9sa about aa9sz,about about aa963.
to aa9s4 to about aa9ss to about aa9s4 about aa9s6 about aa96s about aa9s~
, to , to aa9se to about aa9s9 to about about about aa96s. aa96~, about 20aa968,about aa96o about aa969,about about aa9~o, to aa961 to about aa96z to about aa9.,l,about aa9sa about aa9.,z,about aa964 to to aa96s to about aa966 to about about about aa9.,3, aa9~4, about aa9,s,about aa96~ about aagy6,about about aa9~."
to aa968 to about aags9 to about aa9,e,about aa9~o about aa9,9,about aa9.,1 to to aa9~z to about aa9~3 to about about about aa98o, aa981, about aa98z,about aa9.,4 about aa9g3,about about aag84, to aa9.,s to about aa9.,6 to aboutaages,about aa9,., about aa9g6,about aa9~e to to to about to about about about aa98o aa9a." aa988, about aa~.,9 aage9,about aa981 about aa99o,about about aa9el to aa98z to about aa983 to about aa99z,about aa9g4 about aa9g3,about aa98s to 30to to about to about about about aa98., aa994, aa99s about aa986 aa996,about aa9$$ about aa99?,about about aa99a, to aa9s9 to about aa99o to about aa999,about aa991 about aaloooabout to WO 99/51268 PCT/US99/077I~
aa99z to about aalool .
about aa993 to about aalooz .
about aa994 to about aaloo3. about aa99s to about aaloo4 , about aa99s to about aa,,oosabout aa99., to about about aa99a to about ~ aaloos. aaloo~

about aa999 to about aaloo8.
about aalooo to about aaloo9, about to aalooz aalooa about to to aalolo, about about aaloll.
aa about ~ool about aalolz , about aaloo4 about aalol3 , about aaloosabout to to aalol4,about aaloos to about aalols,about aaloo., to aboutaalols about aalooa to about aalol~,about aaloo9 to about aalolsabout aalo~o aalollto about aalozo. aboutaalolz to to about aalol9, about about aalozl: about aa~ol3 about aalozz. about aalol4 about to to 10aalozaabout aalols to about aaloz4about aalols to aboutaalozs ~ , about aalol., to about aalozs.about aalole to about aaloz."about aalol9to about aaloza. aboutaalozoto about aalozs aboutaalozl to about aalo3o, about aalozz about aalo3l, about aaloz3 about to to aaloazabout aaloz4 to about aalo3aabout aalozs ~o aboutaaloa4 ; , 15about aalozs to about aaloasabout aaloz~ to about aalo3sabout aa,,ozsto about aalo3~, aboutaa,,oz9to about aalo3s, aboutaaloao to about aaloa9 about aalo3l about aalo4o, about aaloaz about to to aalo,l,about aaloaa to about aalo4z.about aaloa4 to aboutaalo4a about aaloas to about aalo44.about aalo3s to about aalo4s,about 20aalo3~to about aalo,,s, aboutaaloseto about aalo4.,, aalo39 about to about aalo4s about aalo4o about aalo4s. about aa,,o41about to to aaloso. about aalo4z to aboutaalosl,about aalo4a to aboutaalosz about aalo44 to about aaloss.about aalo4s to about aalos4,about aa~o,sto about aalo55, aboutaalo4~to about aaloss. aboutaalo4g to about aalo5" about aalo4s about aalose, about aa,,osoabout to to 25aalos9about aalosl to about aalosoabout aalosz to aboutaaloel ~

about aalos3 to about aaloszabout aalos4 to about aalos3about ~ , aalossto about aalos,, aboutaalossto about aaloss. aboutaalos~
to about aaloss about aalose about aalos~~ about aalos9 about to to aaiosaabout aaloso to about aalos9.about aalosl to aboutaalo~o 30about aalosz to about aalo.,l.about aaloss to about aalo,zabout ~

aalos4to about aalo~3, aboutaalossto about aalo~4, aboutaaloss to about aalo,s ~ about , aalos~about aalo~s, about aaloss about to to aalo~."about aalos9 about aalo~e.about aalo~o about aalo.,9, to to about aalo.,l to aboutaaloso.about aalo~z to aboutaalosl about aalo.,3to about aalos2,about aalo~4to about aalosa:about aalo.,sto about aalos4. about lo,,s about aaloes. about about aa to aalo,., to aalossabout aalo~s about aalos."about aalo.,9 about aaloss, to to about aaloso to aboutaaloe9.about aalosl to aboutaaloso about ~

aaloszto about aalo9labout aaloa3to about aalo9zabout aaloe4to about aalos3, about loss about aalos4. about about aa to aaloss to aalossabout aalos~ about aaloss.about aaloss about aalo9~, to to about aaloas to aboutaaloss.about aalo9o to aboutaalo99,about 10aaloslto about aalloolabout aaloszto about aal~ol,about aalo9ato about aalloz about lo94 about aalloa r about about aa to aaloss to aallo4about aaloss about aallosabout aalo9~ about aallos, ~ to ~ to about aalo9s to aboutaallo~~about aalos9 to aboutaallos.about aallooto about aallo9about aallolto about aalllo.about aallozto 15about aallll , about about aaluz . about about aallo3 to aallo4 to aa1113,about aallos about aallla,about aallos about aallls, to to about aallo~ to aboutaallls,about aallos to aboutaalll" about aallo9to about aallleabout aallloto about aalllsabout aallllto . ~

about aaliZO, about about aalizl, about about aalllz to aalll3 to 20aallzz~about aa1114 about aallza,about aallls about aa~lz4, to to about aall,s to aboutaallz5.about aalll, to aboutaa112s,about aalllsto about aallz.,about aalll9to about aallzs.about aallaoto ~

about aallz9, about about aa113o. about about aallzl to aa~122 to aa1131about aallz, about aallaz.about aallz4 about aallaa to to about aal~2s to aboutaalla4.about aallzs to aboutaa,,l3s,about aa11z7to about aallas,about aallzato about aa113,,about aallz9to about aallae about about aa1139, about about aallao to aa1131 to aa114o,about aallaz about aa1141.about aallaa about aa114z to to about aalla4 to aboutaa1143,about aa113s to aboutaa11~4,about aallasto about aallasabout aa113,to about aa114s,about aa113sto 30about aa114.,. about about aa114e. about about aa1139 to aa114o to aa114sabout aa1141 about aallsoabout ~al,4z about aallsl to to about aa114a to aboutaallsz,about aa1144 to aboutaallsa.about WO 99/5126$ PCTIU599/07712 aallasto about aalls4,about aa114sto about aalls5,about aa114.,to about aallss about 114a about aails" about ll4s about aa to aa to aa1158,about aallso about aalls9.about aallsl about aallso to to about aallsz to aboutaallsl.about aalls3 to aboutaalls2.about aa1354to about aalls3,about aallssto about aalls4.about aallssto about aallss, about lls, about aallss, about llse about aa to aa to aa,ls~,about aalls9 about aallsa.about aallso about aalls9 to to about aallsl to aboutaall,o,about aallsz to aboutaall~l,about aallssto about aall~zabout aalls4to about aa11~3,about aalis5to about aa11~4, about llss about aall,s, about lls, about aa to aa to aalys about aallsa about aall~~,about aallss about aall~s, ~ to to about aall~o to aboutaall~9,about aalln to about aallao.about aall~zto about aallel~about aa11~3to about aallaz.about aa11.,4to about aallea, about about aalle4. about about aall.,s to aal,.,s to aallasabout aal~7~ about aallesabout aa,l~e about aalla~, to to about aall.,9 to aboutaa118a,about aallao to aboutaal,s9,about aallalto about aall9o,about aallazto about aall9l,about aalleato about aall9z. about about aa1193, about about aalls4 to aallas to aa1194,about aallas about aall9sabout aalle? about aa119s to to about aallag to aboutaa119" about aallas to abautaallsaabout 2p aa119oto about aallss~about aall9lto about aalzooabout aa119zto about aalzol about about aalzoz. about about aallsa to aa1194 to - aalzoaabout aallgs about aalzos.about aa119s about aalzo5, to to about aall9., to aboutaalzos about aa;~l9a to aboutaalzo~about ~

aa1199to about aalzoa,about aalzooto about aalzo9.about aalzolto about aalzlo about about aalzll, about about aalzoz to aalzo3 to aalzlz,about aalzo4 about aalzl3about aalzos about aalzl4 to to about aalzos to aboutaalals about aal2o~ to aboutaalzls.about aalzoato about aalzl~,about aalzo9to about aaxzl8.about aalzloto about aalzl9. about about aalzzo about about aalzu to aalzlz to aalzzl.about aalzl3 about aalzzz:about aalzl4 about aalzz3 to to about aalzls to aboutaalzz4,about aalzls to aboutaalzzs.about aalzl~to about aalzzs.about aalzlato about aalzz."about aalzl9to about aalzza. about about aalzzs about about aalzzo to aalzzl to aalzso.about aalzzz about aalzalabout aalzz3 about aalz3z, to ~ to about aalzz4 to aboutaalz33,about aalzzs to aboutaalza4.about aalzze about aalzz~to about aalzas,about aalzze to about aalzas ~

about aalz3~, about about aalzae about about aalzzs to aalzao to aalz39.about aalzal about aalz4o.about aalz3z about aalz4l to to about aalzs3 to aboutaalz4z.about aalz34 to aboutaalz43 about aalzasto about aa1z49;about aalzasto about aalz4sabout aalz3~
to about aalz4s. about about aalz4." about about aalzas to aalza9 to aalz4sabout aalz4o about aalz49,about aalz~~ about aalzso to to about aalz4z to aboutaalzsl.about aalz43 to aboutaalzsz about ~0aalz~4to about aalzs3about aalz4sto about aalzs4.about aalz4s to about aalzss. about about aalzs6. about about aalz47 to aalz4e to aalzs.,,about aalz49 about aalzss,about aalzso about aalzss~
to to about aalzsl to aboutaalzso.about aalzsz to aboutaalzsl.about aalzsato about aalzszabout aaizs4to about aalzs3about aalzss to 25about aalzs4 ~ about about aal2ss about about aalzss ~o aalzs~ to aalzssabout aalzse about aalzs~,about aalzss about aa~zsa ~ to to about aalzso to aboutaalzs9.about aalzsl to aboutaalz~o,about aalzszto about aalz~l,about aalzs3to about aalz~zabout aalzs4 ~ to about aalz~3, about about aalz~4. about about aalzss to aalzss to 20aalz~s;about aalz6~ about aalz~s,about aalzss about aalz~~, to to about aalzs9 to aboutaalz~s,about aalz,o to aboutaalz~9.about aalz,lto about aalzeoabout aalz,zto about aalzslabout aalz.,3 to about aalzaz. about about aalzea. about about aalz~4 to aalz~s to aalzs4about aa~z.,s about aalzesabout aalz~., about aalzss ~ to to about aalz~a to aboutaalzs~,about aalx~9 to aboutaalzss about ~

25aalzsoto about aalze9,about aalzslto about aalz9o,about aalzsz to about about aalzaa about aalz9z about about to aa,ZS4 to aalz9l aalz93~about aalzss about aalz9~,about aalzss about aalzss to to about aalzs., to aboutaalzss,about aalzes to aboutaalz9~,about aalzs9to about aalzse.about aalz9oto about aalz99.about aalz9l to 30about aalaoo about about aal3ol, about about aalzsz to aalz9a to aal3ozabout aalz94 about aalaoa.about aalz9s about aalso4 ~ to to about aalzss to aboutaal3os.about aalz9, to aboutaal3os~about aalz9s about aalzss about aal3ooto to to about about aal3o~, aal3oe about aalaos about about aalslo r aboutl3oz about aalaol to ~ aa to aalall.about aal3oa about aa131z,about aa13o4 about aa1313 to to about aalao5 to aboutaa1314,about aalao6 to aboutaalals about aal3a~ about aal3oeto about aa131"about aalaosto to about aal3ls, about aa131e. about about aa1319, about l3u about aaialo to aa to aalazoabout aa131z about aa1321,about aalsls about aalsz2 to . ~o.

about aalal4 to aboutaal3zs about aa131~ to aboutaa13z4 about aalals about aa131.,to about aal3zsabout aa131eto to about aalazs~

about aal3z" about about aalaze about about aa131s to aalazo to ~~ aai3zsabout aalazl about aa133o,about aal3zz about aa1331 to to about aalazs to aboutaalaaz about aalaz4 to aboutaai333,about aalazsto about aa1334about aal,zsto about aalaa5.about aal3z~to , about aalsss about about aa133" about about aalsze to aal3zs to aal3seabout aala3o about aalsasabout aalasl about aala4o to to 1~ about aal3sz to aboutaala4l about aa1333 to aboutaa134z,about aa1~34to about aa13~3,about aalaasto about aa1344,about aal3ssto about aa1345. about about aala4s about about aa133., to aalssa to aa134."about aals3s about aala4aabout aala4o about aa134s to ~ to about aa1341 to aboutaalsso about aa134z to aboutaa13s1,about 20 aals4sto about aalasz.about aala4ato about aa13s3,about aa134sto about aa13~4, about about aal3ss about about aals4s to aa134., to aal3ssabout aala4e about aal3s"about aa134s about aal3ss to to about aalaso to aboutaalass about aa13s1 to aboutaal3so~about aal3szto about aa13s1,about aala5ato about aal3sz,about aa13s4to about aal3sa about about aalas4. about about aal3ss to aalas6 to aalsssabout aa135~ about aal3ss,about aa135g about aal3s~, to to about aal3$9 to aboutaal3se about aalsso to aboutaal3ss,about aa13s1t about aal3~o about aal3szto about aa13,1,about aalasato about aal3~z, about about aa13.,3, about about aal3s~ to aal3ss to aa13.,4,about aal,ss about aa13.,5,about aal3s~ about aa13.,6~
to to about aalase to aboutaal3~~,about aa13s9 to aboutaal3~B,about aal3.,oto about aa13,9,about, aa13~1to about .aal3eo.about aal~.,2to about aaI381, about about aalaez ~ about about aa13,3 to aa13.,4 to WO 99/51268 PCTIUS991077t2 aax3saabout aax3.,s about aa13e4.about aax3~s about aax3ss to to about aax3." toabout aal3es,about aal3,s to abouta.al3e"about aa13~9to about aax~ae.about aax3soto about aax3s9,about aax3sl to about aax39o, about x3sz about aaxs9l about xasa about aa to aa to aalaszabout aax3s4 about aax3sa.about aax3ss about aax394 to to about aax3es to aboutaax39s,about aax3s? to aboutaaxs9s.about aal3ssto about aax39."about aa~389to about aax3gs,about aaxaso to about aa1399~ about x391 about aax4oo. about xa9z about aa to aa to aax4ol.about aax3sa about aax,oz.about aaxa94 about aax4o3 to to about aax3ss to aboutaax4o4about aa139s to aboutaax4os,about aax3s~to about aax4os.about aaxa9ato about aax4o."about aax399 to about aax4as. about about aax4o9. about x4ol about aax4oo to aa to aax4xo,about aax4oz about aax411.about aax4os about aax4lz to to about aax4o4 to aboutaax4x3.about aax4os to aboutaal4x,.about aax4ostp about aax4lsabout aax~o~to about aax4lsabout aax4os to ~

. 15 about aax4x" about about aax~le, about about aa14o9 to aax4lo to aax419about aax411 about aax4zo.about aax4lz about aax4zl to to about aal~x3 to aboutaax4zzabout aax4x~ to aboutaaxQZa about aax4lsto about .aax4z4,about aax4lsto about aax4zsabout aa141., to about aaxszs about about aax4z" about about aax4ls to aax419 to aax4zsabout aax4zo about aax4z9about aax4zl about aax43o, to to about aal4zz to aboutaax43x,about aax4za to aboutaax4BZ about - aax4z4to about aax43aabout aax4zsto about aax434.about aax,,zs to about aax43s: about about aax4as. about about aal4z, to aax4za to aal,,3~.about aaxqz9 about aa143e.about aax4ao about aax4ss to to about aax4al to aboutaax44o,about aax4az to aboutaax441.about aax4aato about aax44zabout aax4a4to about aax443.about aax43s to about aax444. about about aaxa9s about about aax43s to aa143~ to aa144sabout aaxAas about aax44~.about aax439 about aax44s to to about aax44o to aboutaax44s,about aax441 to aboutaax,so.about aa144zto about aax4slabout aa1443to about aax4sz.about aax444 to about aax4sa. about about aax4s4. about about aax44s to aaxq4s to . aal4ssabout aax44., about aax4ssabout aax44s about aax4s~.
~ to ~ to about aax449 to aboutaal~ss,about aax4so to aboutaax4s9:about WO 99/5iZ6$ PCT/US99107712 aa14s1 about aal4sz about aal4sa to to to about about aal4so, aa14s1, about aal~sz, about 14s4 about aa14s3 about l4ss about aa to ' aa to aa14s4,about aal4ss about aal4ss.about aal4s., about aal4ss~
to to about aal4sa to aboutaal4s.,about aa14s9 to aboutaal4seabout ~

aal4soto about aa14s9.about aa14s1 about aa,,4sz to t;o about aal4.,o, about aa14~1: about 14s3 about aal4~z, about ~4s4 about aa to aa to aa14.,3,about aal4ss about aa14.,4,about aa14s6 about aal4~s, to to about aal4s, to aboutaal4.,s,about aal,sa to aboutaal4.,."about aal4s9to about aa14,8,about aal4~o about aa14~1 to to about aa14.,9, about aal,,ao, about about aa14s1. about 14.,3 about aal4~z to aa to aa14a2,about aa14.,4 about aal4eaabout aal4~s about aal4e4 to to about asl4.,s to aboutaal,,asabout aal4" to about aal4as,about aal4~sto about aal4a."about aa14.,9to about aal4ea,about aal4so to about aal4a9, about about aa149o, about about aal~el to aal4az to aal4s~,about aa14a3 about aal4gz.about aa1~84 about aa1493, to to about aal4as to aboutaa14,4,about aal4as to aboutaai49sabout v aa,4a7to about aa149s,about aal4aeto about aal4s,about aal4as to about aa149a, about about aal4gg, about about aa149o to aa14s1 to aalsooabout aa149z about aalsolabout aal4sa about aalsoz to to about aa1499 to aboutaalsoa.about aa1495 to aboutaalso4.about aal4ssto about aalsosabout aa1497to about aalsos,about aa149a to about aalso~, about about aalsoa~ about about aa14s9 to aalsoo to aalsosabout aa,,sol about aals~o,about aalsoz about aalsll, to to about aalso3 to aboutaalslz about aalso~ to aboutaalsl3,about aalsosto about aalsl4,about aalsosto about aals~s,about aalso., to about aalsls , about about aalsl., , about about aalsoa to aa15o9 to aalslaabout aalslo about aalsls,about aalsll about aalszo ~ to to about aalslz to aboutaalszl,about aalsl3 to aboutaalszz.about aaxsl4to about aalsz3,about aalslsto about, aalsz4.about aalsls to about aalszs about about aalszs. about about aalsl~ to aalsla to aa,,sz.,about aalsl9 about aalszeabout aalszo about aalsz9 , to , to about aalszl to aboutaalsao.about aalszz to aboutaalsslabout aa,,szato about aalsaz.about aalsz4to about aals3a.about aalszs to about aalsaa about about ' aals3s, about about aalszs to aalsz~ to aalsas.about aalsze about aals3."about aalsz9 about aalsae to to about aals3o to aboutaals3s,about aalsal to aboutaals4o.about to about aalsasto about aals4z.about aals34 about z to aals4l aalsa about aa1543, about lsss about aals44. about ls3s about aa to aa to aals4sabout aals3~ about aals4s,about aals3e about aals4~
to to about aalsa9 to aboutaals48 about aals4o to aboutaals49about aals4lto about aalsso.about aals4zto about aalssl;about aals4a to about aalssz. about ls~4 about aalss3. about ls4s about aa to aa to aalss4about aals~s about aalss5about aals4., about aalsss , to , to about aals48 to aboutaalss~,about aals4s to aboutaalsse.about 10, aa~5soto about aalss9,about aalsslto about aalsso~about aalssz to about aals6l, about about aalssz about lss4 about aalssa to aa to aalss3.about aalsss about aalss4.about aalsss about aalsss to to about aalss~ to aboutaalsss.about aalsse to aboutaalss~.about aalss9to about aalssB,about aalssoto about aalsss.about aalssl to about aals~o. about about aals~l. about about aalssz to aalss3 to aals~zabout aalss4 about aals,3about aalsss about aals~4 , to , to , about aalsss to aboutaals~s,about aalss., to aboutaals~s.about aalssato about aals.,."about aalss9to about aals.,a,about aals~o to about aals,,9, about about aalsao. about about aals~l to aals~z to aalsal~about aals.,3 about aalsazabout aa15.,4 about aalsea to to about aals.,s to aboutaalse4 about aals.,s to aboutaalsesabout . ~

aals~,to about aalsesabout aals,8to about aalse."about aals.,9 to about aalsee. about about aalse9, about about aalseo to aalssl to aals9o.about aalsaz about aalssl.about aalse3 about aa1s92, to to about aalse4 to aboutaals93,about aalsBS to aboutaalss4.about ~5 aalssst~ about aals9s,about aals~.,to about aals9s,about aalsaa to about aals9" about about aals9g, about about aalse9 to aalsgo to aalss9,about aa,,s91 about aalsoo.about aalssz about aalsol to to about aals9a to aboutaalsoz.about aals94 to aboutaalso3,about aals9sto about aalsoa,about aalsssto about aalsos.about aals9., to about aalsos. about about aalso~, about about aals9e to aals99 to aalsos.about aa,soo about aalsos. about aalslo~
to about aalso~
to about aalsoz to aboutaalsll~about aalsoa to aboutaalslz,about aalso9 about aalsosto about aalsl4,about aalsos to to about aalsla.

about aa,sls~ about lso, about aa~sls. about lsoa about aa to aa to aalsl~,about aalso9 about aalslaabout aalslo about aalsls to to about aalsll to aboutaalszoabout aalslz to aboutaalszl.about .

aalsl3to about aalszx.about aslsl4to about aalsza.about aalsls to about aalsz4, about lsls about aalszs. about lsl~ about aa to aa to aalsxsabout aalsle about aals2~.about aalsl9 about aalsxa:
~ to to about aalsxo to aboutaalsx9,about aalszl to aboutaalsso.about aalszxto about aalsal.about aalsxato about aals3x.about aalsx4 to about aals3a. about lsxs about aals34. about about aa to aals2s to aals3sabout aal6z~ about aalsssabout aalsxa about aals3"
to ~ to about aalsx9 to aboutaalsaaabout aals3o to aboutaals39 about , aals3lto about aals4oabout aals3zto about aals4l.about salsas to about aals4x, about about aals43, about about aals34 to aals3s to aals44.about aals3s about aals~s~about aals3., about aals4s, to to about aals3a to aboutaals4"about salsas to aboutaals4a.about aals4oto about aals49.about aals4lto about aalsso.about aals4z to about aalssl. about about aalssz. about about aals4a to aals44 to aalss3about aals4s about aalss,about aals4s about aalsss ~ to . to about aals4~ to aboutaalsssabout aals4a to aboutaalss~.about 20 aals49to about aalssa.about aalssoto about aalss9~about aalssl to about aalsso about about aalssl. about about aalssz to aals53 to aalsszabout aalss~ about salsasabout aalsss about aalss4 . to ~ to about salsas to aboutsalsas.about salsa., to aboutsalsas about ~

salsasto about salsa."about aalss9to about salsas.about aalsso to about aalss9. about about aals~o, about about aalssl to aalssx to Z ~ aais~labout salsas about aals~xabout aalss4 about aals.,3 , to . to , about salsas to aboutaals,4.about salsas to aboutaals~s.about salsa,to about aals.,s,about salsasto about aals.,~,about aa,ss9 to about aals7s about about aals~9, about about aa~s~o to aals,l to aalseo.about aals.,z about aalsel.about aals~3 about aalsax to to 30 about aals.,4 to aboutaalsa3,.aboutaals,s to aboutsalsa" about aals~sto about salsas.about aals.,~to about salsas.about aals~e to about aalss~. about about salsas. about about aals~9 to aalsao to WO 99/51268 PCT/US99J077t2 aalse9,about aalsel to aboutaalsso about aalssz about aalssl ~ to about aalsea to about aals9zabout aalse4 to aboutaalssaabout , , aalsesto about aals94. aboutaalsas to about aals9s,about aals8., to about aals9s, about aalsee about aals9.,, about lse9 about to aa to aalssa.about aals9o to aboutaals99,about aalssl about aal~oo, to about aalssz to about aal.,ol,about aals9a to aboutaal~oz,about aa,ss4to about aal,o3, aboutaals9s to about aal~o4,about aalsss to about aal,os about aals9., about aal,os about ls9$ about to aa to aal.,o,,about aals99 to aboutaal.,o8,about aal~oo about aal~o9.
to about aaz~ol to about aal.,lo,about aal.,oz to aboutaal.,ll,about aal~o3to about aal?lz , aal~o4 to about aa1.,13about aal.,os about , to about aa1.,14, about aal~osabout aal.,ls, about about to aal.,o~ to aal,ls,about aa,~oo to aboutaal,l~,about aal,o9 about aal~le, to about aal.,lo to about aa1.,19,about aal.,ll to aboutaal?zo,about aal.,lzto about aal,zl. aboutaal.,lato about aal.,~z,about aa1,14 to Z5 about aal~z3. about aa1.,15about aal.,z4, about about to aal,ls to aal.,zs,about aal.,l~ to aboutaal~zs,about aal~ls about aal.,i~, to about aa1.,19 to about aa1~28,about aal.,zo to aboutaal~zs,about aal.,zlto about aal.,3o. aal~zz to about aa1,31.about aal.,z3 about to about aal.,3z, about aal.,z4about aal,aa about about to aal~zs to aa1~34,about aal~zs to aboutaal.,3s,about aal~z~ about aal.,3s, to about aal,ze to about aal~3.,;about aal.,z9 to aboutaa1.,38,about - aal,3oto about aa1.,39, aa1.,31to about aal?4oabout aal,az about to about aal.,~l, about aa1~33about aal~,,z, about about to aa1.,34 to aa1~43,about aal.,3s to aboutaa"44, about aal.,3s about aal,4s to about aal~3, to about aal.,4s,about aal.,3B to aboutaa~~4~,about aa1,39to about aa1,48, aboutaal~4o to about aa1.,49,about aa1~41 to about aal~so, about aal~4z about aa1,51, about about to aa1,43 to aal~sz.about aa1.,44 to aboutaal.,s3,about aal,4s about aal~s4 to about aa174s to about aal.,ssof SEQ ID N0:2.

In yet another example, portion an antigenic of the pepti de shown in Figure useful of the 2 in the compositions prese nt invention has an amino acid sequence selected from the wherein group aaX
consisting of about aaX
to about aaY, denotes from about amino acid number 1 to about amino acid number 1750 of SEQ ID N0:2 and aaY is about amino acid number x-~5 of SEQ ID N0:2; i.e., an amino acid sequence selected from the group consisting of amino acid sequences comprising from about aal to about aa6, about aaz to about aa" about aa3 to about aa8, about aa4 to about aag, about aas to about aalo, and so on, through about aa1.,49 to about aa1.,54 , and about aal~so to about aa1~55 of SEQ ID N0:2.
In addition; the invention also encompasses peptide analogs that are functionally equivalent to the MMTV peptides described above or encoded by the nucleic acid molecules described infra, as judged by a number of criteria, including but not limited to, the ability of the equivalent peptide to be recognized by a MMTV-reactive antibody. Such equivalent MMTV peptides may contain deletions, additions, substitutions of amino acid residues within the amino acid sequence, but which result in a silent change, thus producing a functionally equivalent MMTV peptide. Amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, - leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine and histidine; and negatively charged amino acids include aspartic acid and glutamic acid. "Functionally equivalent", as utilized herein, refers to a protein capable of being recognized by a MMTV peptide-reactive antibody.
While random mutations can be made to the MMTV
nucleotide sequences (using random mutagenesis techniques well known to those skilled in the art) and the resulting encoded MMTV peptides tested for activity, site directed mutations of the MMTV coding sequence can be engineered (using site-directed mutagenesis techniques well known to those in the art) to generate mutant MMTV peptides with increased function, e.g., leading to enhanced expression or antigenicity.
The MMTV peptides used in the immunomodulatory compositions of the present invention are substantially pure or homogenous. A peptide sample is considered substantially pure or homogenous when at least 60 to 75% of the sample exhibits a single peptide sequence. A substantially pure peptide will preferably comprise 60 to 90% of a peptide sample, more preferably about 95% and most preferably 99%.
Methods which are well known to those skilled in the art can be used to determine purity or homogeneity, such as polyacrylarnide gel electrophoresis of a sample, followed by visualizing a 'single peptide band on a stained gel.
Alternatively, resolution can be obtained using HPLC or other similar methods well known in the art. See, generally, Sambrook et al:, 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, and Ausubel et 2O al~ (eds.), 2989, Current Protocols in Molecular Biology , VoI.I, Green Publishing Associates, Inc., and John Wiley &
Sons, Inc., New York.
The present invention encompasses the use of MMTV
peptides which are typically purified from host cells expressing recombinant nucleotide sequences encoding the MMTV
peptides in the immunomodulatory compositions. Such protein purification can be accomplished by a variety of methods well known in the art. In one embodiment, a MMTV peptide of the present invention is expressed as a fusion protein with glutathione-S-transferase. The resulting recombinant fusion protein is purified by affinity chromatography and the MMTV
peptide domain is cleaved away from the heterologous moiety resulting in a substantially pure MMTV peptide sample. Other methods may be used, see for example, the techniques described in "Methods In Enzymology", 1990, Academic Press, Inc., San Diego, !'Protein Purification: Principles and practice", 1982, Springer-Verlag, New York.
5.2. MMTV NUCLEIC ACIDS
The present invention also encompasses nucleic acid molecules that encode for at least one MMTV peptide or immunogenic or antigenic portion thereof, as well as an analog of such peptide or portion, and a peptide having an amino acid sequence which represents at least one discontinuous epitope of MMTV and their use in the immunomodulatory compositions of the present invention. The nucleic acid molecules of the invention include the following: (1) a nucleic acid molecule having a nucleotide sequence which comprises the nucleotide sequence depicted in Figure 1 (SEQ ID N0:1) or a portion thereof of at least l8 contiguous nucleotides; (2) any nucleic acid molecule comprising a nucleotide sequence that encodes a peptide that is immunologically reactive with an antibody directed against a MMTV Peptide; (3) any nucleic acid molecule comprising a nucleotide sequence that encodes a peptide, which peptide comprises the amino acid sequence as shown in any of Figures 2-6 (SEQ ID NOS:2-6), or a portion thereof of at least 6 contiguous amino acids; (4) any nucleic acid molecule comprising a nucleotide sequence which encodes for at least one discontinuous epitope of MMTV; (5) any nucleic acid molecule comprising a nucleotide sequence that hybridizes to the complement of the DNA sequence as shown in Figure 1 (SEQ
ID N0:1) under highly stringent conditions, e.g., hybridization to filter-bound DNA in 0.5 M NaHP04, 7~ sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C; and washing in 0.1 x SSC/0.1~ SDS at &8°C (Ausubel et al., eds:, 1989, Current Protocols in Molecular Biology , Vol.I, Green Publishing - 3& -Associates; Inc., and John Wiley & Sons, Inc., New York, at p. 2~10~3) and encodes a functionally equivalent MMTV
peptide; (6) any nucleic acid molecule comprising a nucleotide sequence that hybridizes to the complement of the DNA sequence as shown in Figure 1 (SEQ ID NO: l) under less stringent conditions, such as moderately s ringent conditions, e.g., washing in 0.2 x SSC/0.1~ SDS at 42°C
(Ausubel et aT., 1989, supra), yet which encodes a functionally equivalent MMTV peptide; and (7) any nucleic acid molecule comprising a nucleotide sequence that hybridizes to the complement of the DNA sequence as shown in Figure 1 (SEQ ID NO:1) under less stringent conditions, such as low stringency conditions, e.g., washing in 0.2 x SSC/
0.1~ SDS at 37°C, and encodes a functionally equivalent MMTV
peptide.
,.
For eXample, a nucleic acid molecule useful in the methods of the present invention has a nucleotide sequence comprising a nucleotide sequence selected from the. group consisting of about ntX to about ntY of the sequence depicted in Figure 1 (SEQ ID N0:1), wherein ntX denotes from about nucleotide number 1 to about nucleotide number 8786 of SEQ ID
NO:l and nty is about nucleotide number x+17 of SEQ TD NO:1;
i.e., a nucleotide sequence selected from the group consisting of nucleotide sequences comprising from about ntl to about nt~o, about ntZ to about nt2l, about nt3 to about ntz2, about nt4 to about ntz3, about nts to about nt24, and so on, through about nts~es to about nt88o4, and about nte~B6 to about nta8o5 of SEQ ID NO:1.
In yet another example, a nucleic acid molecule useful in the methods of the present invention has a nucleotide sequence comprising a nucleotide sequence selected from the group consisting of about ntX to about ntY of the sequence depicted in Figure 1 (SEQ ID N0:1), wherein ntx denotes from about nucleotide number 1 to about nucleotide WO 99151268 ~ PCT/US99107712 number 8786 of SEQ ID NO:1 and ntY is about nucleotide number x+29 of SEQ ID NO:1; i.e., a nucleotide sequence selected from the group consisting of nucleotide sequences comprising from about ntl to about nt3p, about ntz to about nt3l, about nt3 ~ \to about nt32, about nt4 to about nt33, about nt to about nt34, and so on, through about nt8.,~5 to about ntseo4. and about nte.,~s to about nt88os of SEQ ID NO:1.
In addition, the invention also encompasses nucleic acid molecules that encode for MMTV peptide analogs that are functionally equivalent to the MMTV peptides described herein, as judged by a number of criteria, including but not limited to, the ability of the equivalent peptide to be recognized by a MMTV-reactive antibody. Such equivalent MMTV
peptides may contain deletions, additions, substitutions of -amino acid residues within the amino acid sequence, but which result in a silent change, thus.producing a functionally equivalent MMTV peptide. Such immunologically equivalent analogs of MMTV nucleic acids can be identified by (1) making analogs of the nucleic acid molecule encoding the peptide that are truncated at the 5' and/or 3' ends of. the sequence and/or have one or more internal deletions; (2) expressing the analog nucleotide sequences; and (3) determining whether the resulting expressed peptide immunologically interacts with a MMTV-reactive antibody or induces the production of such antibodies in vivo.
The nucleic acid molecules used in immunomodulatory compositions of the present invention are substantially pure or homogenous. A nucleic acid sample is considered substantially pure or homogenous when at least 60 to 75~ of the sample exhibits a single nucleotide sequence. A
substantially pure nucleic acid will preferably comprise 60 to 90~ of a nucleic acid sample, more preferably about 95~
and most preferably 99~. Methods which are well known to those skilled in the art can be used to determine purity or _ 88 _ homogeneity, such as polyacrylamide gel electrophoresis of a sample; followed by visualizing a single nucleic acid band on a staining gel. Higher resolution can be determined using HPLC or other similar methods well known in the art. See, generally, Sambrook et al,, 1989, Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Laboratory Press, and Ausubel et al. (eds.), 1989, Current Protocols in Molecular Biology , VoI.I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York.
about The invention also encompasses (1) nucleic acid expression vectors that contain any of the foregoing nucleic acid molecules operatively associated with a regulatory element that directs expression of the nucleotide coding sequences and (2) genetically engineered host cells that contain any of the foregoing nucleic acid molecules encoding a MMTV peptide operat,~vely associated with a regulatory element that directs the expression of the coding sequences in the host cell. As used herein, regulatory elements include but are not limited to, inducible and non-inducible promoters, enhancers, operators and other elements known to those skilled in the art that drive and regulate expression.
For a more detailed discussion, see Sections 5.4 and 5.5, infra .
The MMTV peptides or portions thereof or discontinuous epitopes can be produced by recombinant DNA
technology using techniques well known in the art. Thus, methods for preparing the peptides of the invention by expressing nucleic acid molecules containing MMTV nucleotide sequences are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing MMTV nucleotide sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro ' recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. See, for example, the techniques described in Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Laboratory Press, and Ausubel et al., 1989, supra. Alternatively, RNA capable of encoding a MMTV peptide, or a portion thereof, may be chemically synthesized using, for example, synthesizers.
See, for example, the techniques described in ''Oligonucleotide Synthesis", 1984, Gait, ed., IRL Press, Oxford, which is incorporated by reference herein in its entirety.
5.3. SELECTING ANTIGENS FOR THE
INlMUNOMODULATORY COMPOSITTONS
The present invention also provides far methods for selecting or identifying candidate MMTV antigens which v~rill l5 provoke an immune response by determining whether the candidate antigen is reactive with antibodies or immune cells obtained from an individual exposed to or infected with MMTV
or from an individual exposed to a chemical or biological agent that reacts with an antibody directed against MMTV, for example, a mouse neutralizing poly- or mono-clonal antibody.
The identified or selected antigens are useful in the _ immunomodulatory compositions of the present invention:
In one embodiment of the invention, the method is to create a peptide library of all possible peptides of a given length contained within a MMTV peptide. This library would represent a complete pepscan of the peptide. The pepscan library can then be screened with sera or immune cells obtained from an individual, for example, infected with MMTV, to determine which peptides represent an antigenic peptide, and thus, determine which peptides might be included in an immunomodulatory composition to induce an immune response in an individual. Far example, the sera can be obtained from a mouse infected with MMTV. Such a complete pepscan has been described by Baughn et al., 1996, Infection and Immunity 64:2457-2466, for the 15-kDa lipoprotein of ~'reponema pal.Iidum. Overlapping decapeptides (ten amino acids) were synthesized, each of which overlapped the next by nine amino acids and were offset by one amino acid, which allowed for a complete set of decapeptides of the protein.
These were then screened with sera from syphilitic rabbits in an ELISA (enzyme-linked immunosorbent assay) to find those peptides which reacted with antibodies against syphilis. A
similar approach can be used in the present invention by la using human sera to screen for MMTV antigens to be used in the compositions of the present invention.
Another method involves combinatorial phage display libraries, including a random peptide phage dispJ.ay library, in which the MMTV peptide encoding nucleic acid molecules are inserted into a phage display library, expressed, and then used in a screening assay with immune sera or immune cells obtained from an individual infected with MMTV or obtained from an individual exposed to a biological or~chemical agent that reacts with MMTV antibodies or from an individual who has MMTV reactive antibodies. For example, the sera or immune cells can be obtained from a mouse infected with MMTV.
Using such combinatorial phage display libraries, both continuous and discontinuous antigenic epitopes can be screened. A continuous epitope is defined as one in which the antigenic residues reside within a short sequence of amino acids, i.e, continuous to each other. Discontinuous epitopes are composed of amino acid sequences derived from different positions~in the primary amino acid sequence but which are adjacent in the three-dimensional structure of the protein. The discontinuous epitopes; also called conformational peptides, can be encoded for by a nucleic acid molecule which comprises nucleic acid sequences encoding the three-dimensionally adjacent amino acid sequences.

Such phage display peptide libraries are typically constructed in the following manner. Phages consist of DNA
surrounded by coat proteins; which enable the phage to infect host bacteria and replicate themselves, producing many copies of the phage. To exploit this property, DNA equences coding for the peptide of interest are inserted into the gene coding for a phage coat protein. As long as these insertions do not interfere with the life cycle of the phage, these modified phages will have coat proteins which display the foreign peptide. Filamentous phages are the preferred vectors, because two of their coat proteins can be easily modified to . display foreign peptides, and thus foreign epitopes, on their surface. In general, these modifications are well tolerated.
However, even if the modifications are riot tolerated, the phage can still be rescued by a variety of techniques, Z5 including co-infection with a wild-type phage, known in the art as a helper phage.
The two coat proteins of the filamentous phage of types such as M13, fd and f2 are known as pIII and pVIII.
There are only five copies of pITI on the phage coat, while there are about 2700 copies of pVIII on the coat. However, pIII can generally tolerate large insertions of up to a few hundred amino acids in length, while pVIII can tolerate only five or six amino acid insertions. As noted above, other techniques can be used to rescue phage with pVIII proteins containing larger insertions.
In one embodiment of the invention, a continuous peptide library can be constructed by substantially digesting the MMTV genome, .z.e., 90~ or greater digestion, such that a plurality of nucleic acid fragments are obtained and inserting a fragment obtained from the digest into a phage.
The nucleic acid fragments are then expressed and the phages can be screened for reactivity with immune sera or immune cells obtained, e.g., from an individual infected with MMTV

or from an individual who has an immunologic reaction to MMTV
antigens. The phages which react with the immune sera or immune cells can be purified and the MMTV nucleic acid fragment or encoded peptide can be included in an immunomodulatory composition for administration to a human.
In another embodiment of the invention, a discontinuous peptide library can be constructed by substantially digesting the MMTV genome, i.e., greater than 90~ digestion, such that a plurality of nucleic acid fragments are obtained, ligating the fragments to form at least one ligated fragment and inserting a ligated fragment obtained from the digest into a phage. The ligated nucleic acid fragments are then expressed and the phages can be screened for reactivity with immune sera or immune cells obtained, e.g., from an individual exposed to or infected '"Tith MMTV or from an individual who has an immunologic reaction to MMTV antigens, e.g., obtained from a mouse infected with MMTV. The phages which react with the immune sera or immune cells can be purified and the nucleic acid fragment or encoded peptide comprising the discontinuous epitope can be included in an imrnunomodulatory composition for administration to a human.
In yet another embodiment of the invention, a random peptide phage display library obtained from any source can be used to screen for MMTV epitopes:
5:4. EXPRESSION SYSTEMS
The present invention encompasses the use of expression systems, both eukaryotic and procaryotic expression vectors, as well as viral expression vectors, which may be used to express both full-length and truncated portions of MMTV peptides, as well as discontinuous epitopes identified by the methods in Section 5.3, supra.

In one embodiment of the invention, the nucleotide sequence of FIG. 1 or a portion thereof, encoding a MMTV
peptide is expressed in eukaryotic, procaryotic, or viral expression vectors. The nucleic acid and amino acid sequences depicted in Figures l-6 were obtained from GenBank, Accession No. AF033807, and depict the nucleotide and encoded amino acid sequences of one isolate of MMTV. It is envisioned that other nucleotide.and amino acid sequences of other NINiTV isolates can be used in the present invention. In yet another embodiment, a nucleotide sequence isolated by the method described in Section 5.3, supra, is, expressed in an eukaryoti.c, procaryotic, or viral expression vector.
One embodiment of the invention encompasses the expression of MMTV peptides in a baculovirus system. Another embodiment of the invention encompasses the expression of a nucleotide sequence which encodes for a discontinuous MMTV
epitope in a baculovirus system. Yet another embodiment encompasses expression of a nucleotide sequence that encodes for a discontinuous MMTV epitope in a mammalian cell system.
A variety of host-expression vector systems may be utilized to express the nucleotide sequences of the present invention. Such host-expression systems represent vehicles by which the nucleotide coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequence, express a MMTV
peptide of the invention on the cell surface. These include, but are not limited to, microorganisms such as bacteria (-e.g., E. coli, B. subti~is) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing MMTV nucleotide coding sequences; yeast 34 (e.gr., Saccharomyces spp., Pichia spp.} transformed with recombinant yeast expression vectors_containing MMTV
nucleotide coding sequences; insect cell systems infected W0 99/51268 PCTlUS99/07712 with recombinant viral expression vectors (e. g., baculovirus) containing MMTV nucleotide coding sequences; plant cell systems infected with recombinant viral expression vectors (e. g:, cauliflower mosaic virus, CaMV,~ tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e. g., Ti plasmid) containing MMTV nucleotide coding sequences; and mammalian cell systems (e. g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing MMTV nucleotide coding sequences under the control of promoters derived from the genome of mammalian cells (e. g., metallothionein promoter) or from mammalian viruses (e. g., the adenovirus late promoter, the vaccinia virus 7.5K
promoter).
In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended fox the MMTV nucleotide sequence being expressed.
For example, when a large quantity of a peptide is to be produced, for example, for the generation of pharmaceutical compositions for raising antibodies to the peptide or for inclusion of the' peptide in an immunomodulatory composition, vectors which direct the expression of high levels of the peptide and allow fox ready purification may be desirable.
Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J.
2:1791), in which an encoding nucleotide sequence of the present invention may be ligated individually into a vector in frame with the lacZ coding region so that a fusion .protein is produced; pIN vectors (Inouye ~ Inouye, 1985, Nucleic Acids Res. 13:3101-3109;'Van Heeke & Schuster, 1989, J. Biol.
Chem. 264:5503-5509); and the like. pGEX vectors may also be used to express foreign peptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by _ 45 WD 99151268 PCTIUS9910??12 elution in the presence of free glutathione. The pGEX
vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells,. A MMTV gene coding sequence, e.g., the pol protein coding sequence, may be cloned into a non-essential region (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of a peptide coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the 1' polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. (E.g., see Smith et al., 1983, J. Virol. 46:
584; Smith, U.S. Patent No. 4,215,051).
In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, a MMTV nucleic acid molecule of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene 2~ may then be inserted in the adenovirus genome by in vitro or in ~crivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing the peptide encoded by the nucleic acid molecule of interest in infected hosts. (E. g., See Logan & Shenk; 1984, Proc.
Natl. Acad. Sci. USA 81:3655-3659). Specific initiation signals may also be required for efficient translation of the inserted coding sequence. These signals include the ATG
- 4s -WO 99/512b8 PCTIUS99107712 initiation codon and other adjacent sequences. In cases where an entire gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG
initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc: (see l5 gittner et al., 1987, Methods in Enzymol. 153:516-544}.
Other viral expression systems'can also be employed in the present invention. Such systems include, but are not limited to, vaccinia virus, recombinant viruses, or canary pox viral expression system, and the like.
5.5 CELL LINES
The present invention encompasses the expression of MMTV peptides in animal and insect cell lines. in one embodiment of the present invention, the env glycoprotein, or a portion thereof, is expressed in a baculovirus vector in an insect cell line. In another embodiment of the invention, the gag protein, or a portion thereof, is expressed in a stably transfected mammalian cell line. In yet another, embodiment, a nucleic acid molecule comprising a nucleotide sequence that encodes a discontinuous epitope of MMTV is expressed in a mammalian cell line.
A host cell strain may be chosen which modulates the expression~of the nucleic acid coding sequence, or modifies and processes the expressed peptide in a specific desired fashion. Such modifications (e. g., glycosylation) and processing (e.g. cleavage? of the expressed peptide may be important for its function, e.g., antigenicity. Different host cells have characteristics of and specific mechanisms for the post-translational processing and modification of the expressed peptides: Appropriate cell lines or host systems can be chosen to ensure the correct modification of the expressed peptide. To this end, eukaryotic host cells which l~ possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the expressed peptide may be used. Such mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3 and WI38 cell lines.
For long term, high-yield production of recombinant ~5 proteins; stabl°e expression is preferred. For example, cell lines which stably express the env glycoprotein, or a portion thereof, may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e. g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium; and then are switched to a.selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasrnid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express, for example, the MMTV env 3~ glycoprotein.
A number of selection systems may be used, including but not limited to the herpes simplex virus _ ~8 _ thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska &
Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes can be employed in tk', hgprt' or aprt' cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl: Acad. Sci. USA 77:3567; O~Hare, et al., 1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981; Proc. Natl.
Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al:, 1981, J. Mol.
Biol. 150:1): and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30:147).
Alternatively, any expressed peptide may be readily purified by utilizing an antibody specific for the peptide being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl. Acad. Sci. USA 88:
8972-8976). In this system, the gene of interest is - subcloned into a vaccinia recombination plasmid such that the gene's open reading frame is translationally fused to an amino-terminal tag consisting of six histidine residues.
Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni2*~nitriloacetic acid-agarose columns and the expressed histidine-tagged peptide is selectively eluted with imidazole-containing buffers.
5.6 IMMUNOMODULATORY COMPOSITIONS
AND METHODS OF ADMINISTRATION
The immunomodulatory compositions of the present invention comprise an effective amount of an immunogenically active ingredient, i.e., one or more MMTV antigens, effective to produce a measurable immune response against the antigen in a subject, and a pharmaceutically acceptable carrier.
The preparation of immunomodulatory compositions containing an immunogenic peptide or a nucleic acid molecule encoding such peptide as the active ingredient is known to those of skill in the art.
5.6.1. DETERMINATION OF
IMMUNOMODULATORY COMPOSITION
EFFICACY
The immunopotency of the MMTV antigen can be determined by monitoring the immune response in test animals following immunization with the MMTV antigen, or by use of any immunoassay known in the art. Generation of a humoral 1S (antibody) response and/or cell-mediated,immunity,~may be taken as an indication of an immune response: Test animals may include mice, hamsters, dogs,~cats, monkeys, rabbits, chimpanzees, etc., and human subjects.
Methods of introducing the immunomodulatory composition may include oral, i:ntracerebral; intradermal, intramuscular, intraperitoneal; intravenous, subcutaneous, intranasal or any other standard route of immunization. The immune response of the test subjects can be analyzed by various approaches such as: the reactivity of the resultant immune serum to the MMTV antigen, as assayed by known techniques, e.g., immunosorbant assay (ELISA), immunoblots, radioimmunoprecipitations, and the like, or in the case where the MMTV antigen displays antigenicity or immunogenicity, by protection of the immunized host from infection by MMTV
and/or attenuation of symptoms due to infection by MMTV in the immunized host or by attenuation of symptoms due to exposure to a chemical or biological agent that cross-reacts with antibodies to a I~ITV antigen.

As one example of suitable animal testing of a MMTV
immunomodulatory composition, a composition of the invention may be tested in mice for the ability to induce an antibody response to a MMTV antigen. BALB/c mice maybe used. The test group each receives a fixed concentration of the composition. A control group receives an injection of a buffer, e.g., 1 mM Tris-HC1 pH 9.0, without the MMTV antigen.
Blood samples may be drawn from the mice every one or two weeks, and serum analyzed for antibodies to the MM2V.
antigen. The presence of antibodies specific for the antigen may be assayed, e.g., using an ELISA.
5.6.2. IMMUNOMODULATORY COMPOSITIONS
Suitable formulations of such compositions include injectables, either as liquid solutions or suspensions; solid forms suitable for solution in or suspension in liquid prior to injection may also be prepared. The compositions may also be emulsified, or the MMTV antigen encapsulated in liposomes or conjugated to polysaccharides and/or other polymers for use in a such formulation. The active immunogeni~c ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water saline, dextrose, glycerol, ethanol or the like, and combinations thereof. In addition, if desired, the composition may also include minor amounts of auxiliary substances such as wetting or emulsifying agents, pH
buffering agents, and/or adjuvants which enhance the effectiveness of the composition.
Examples of adjuvants which may be effective, include, but are not limited to: mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin, pluronic polyols; polyanions; oil emulsions; alum; MDP; N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP); N-acetyl-- ~i -WO 99/51268 PG"T/US99/07712 nor-muramyl-L-alanyl-D-isoglutamine; and N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxx)-ethylamine. The effectiveness of an adjuvant may be determined by measuring the induction of antibodies directed against MMTV antigen-containing compositions in the presence of and in the absence of various adjuvants.
The MMTV antigen may be formulated into the composition as neutral or salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with free amino groups of the peptide) and which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, oxalic, tartaric, malefic, and the like. Salts formed with free carboxyl groups may also be derfived from finorganic bases, such as, for example, sodium potassium,~ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the lfike.
The compositions of the invention may be multivalent or univalent. Multivalent compositions can be made from recombinant viruses that direct the expression of more than one antigen.
Many methods may be used to introduce the immunomodulatory compositions of the invention; these include but are not limited to oral, intradermal, intramuscular, fintraperitoneal, intravenous, subcutaneous, intranasal routes, and via scarification (scratching through the top layers of skin, e.g., using a bifurcated needle). Oral compositions can include standard carriers such as pharmaceutical grades of mannitol, lactose; starch, magnesium stearate, sodfium saccharine, cellulose, magnesium carbonate, etc. The compositions comprisfing nucleic acids of the present invention can be administered by any method known in the art for delivery of a nucleic acid to a subject, e.g., as described herein.
The patient to which an immunamodulatory composition of the present invention is administered is a mammal, preferably a human, but can also be a non-human animal including but not limited to cows, horses, sheep, pigs, fowl (e. g., chickens), goats, cats, dogs; hamsters, mice and rats. The patient is most preferably a human who has not been exposed to MMTV or a human who has no immunogenic reaction to MMTV antigens.
Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
Where the composition is administered by injection, an ampoule of sterile diluent can be provided so that the ingredients may be mixed prior to administration.
In a specific embodiment, a lyophilized MMTV
antigen of the invention,is provided in a first container; a second container comprises diluent consisting of an aqueous solution of 50% glycerin, 0.25% phenol, and an antiseptic - (e. g., 0.005% brilliant green).
The precise dose of an immunomodulatory composition to be employed will also depend on the route of administration, and the nature of the patient, and should be decided according to the judgment of the practitioner and each patient s circumstances according to standard clinical techniques. An effective immunizing amount is that amount sufficient to produce an immune response to the antigen in the host to which the composition is administered.
Use of purified antigens as immunomodulatory compositions can be carried out by standard methods. For example, the purified peptides) should be adjusted to an appropriate concentration, formulated with any suitable adjuvant and packaged for use. In instances where the NINITV
antigen is a hapten, i:e., a molecule that is antigenic in that it can react selectively with cognate antibodies, but not immunogenic in that it cannot elicit an immune response, the hapten may be covalently bound to a carrier or immunogenic molecule; for instance, a large protein such as serum albumin will confer immunogenicity to the hapten coupled to it. The hapten-carrier may be formulated for use as an immunomodulatory composition.
to Effective doses in humans of the compositions of the invention can also be extrapolated from-dose-response curves derived from animal model test systems.
5.6.3. USE OF ANTIBODIES GENERATED
BY THE COMPOSITIONS OF THE
INVENTION
The antibodies generated against the antigen by administration of a MMTV antigen of the present invention also have potential uses in diagnostic immunoassays, passive immunotherapy, and generation of antiidiotypic antibodies.
The generated antibodies may be isolated by standard techniques known in the art (e. g., immunoaffinity chromatography, centrifugation, precipitation, etc.) and used in diagnostic immunoassays. The antibodies may also be used to monitor treatment and/or disease progression. Any immunoassay system known in the art, such as those listed supra, may be used for this purpose including but not limited to competitive and noncompetitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme-linked immunosorbent assays), "sandwich" immunoassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays and immunoelectrophoresis assays, to name but a few.
The immunomodulatory compositions of the present invention can also be used to produce antibodies for use in passiue immunotherapy, in which short-term protection of a host is achieved by the administration of a pre-formed antibody directed against an MMTV antigen.
The antibodies generated by the immunomodulatory compositions of the present invention can also be used in the production of antiidiotypic antibody: The antiidiotypic antibody can then in turn be used for immunization, in order to produce a subpopulation of antibodies that bind the initial antigen of the pathogenic microorganism or agent (Jerne, 1974, Ann. Immunol. (Paris) 125c:373; Jerne, et al., 1982, EMBO J. 1:234).
5.6.4 PACKAGING
The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack. may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. Associated with such pack or dispenser devices) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
Compositions comprising an antigen of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labelled for treatment of an indicated condition.
The present invention is not to be limited in scope by the specific embodiments desdribed herein. Indeed, WO 99!51268 PCTIUS99/07712 various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the amended claims.
Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.

SEQUENCE LISTING
(1) GENERAL INFORMATION
(i) APPLICANT: Stewart, T.
Gershoni, J.
(ii) TITLE OF THE INVENTION: IMMUNOMODULATORY COMPOSITIONS OF MMTV
ANTIGENS AND METHODS OF USING SAME
{iii) NUMBER OF SEQUENCES: 6 {iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Pennie & Edmonds LLP
(B) STREET: 1155 Avenue of the Americas {C) CITY: New York (D) STATE: New York (E) COUNTRY: USA
{F) ZIP: 10036 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette (B) COMPUTER: IBM Compatible (C) OPERATING SYSTEM: DOS
{D) SOFTWARE: FastSEQ Version 2.0 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B} FILING DATE:
(C} CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Gordon, Jennifer (B) REGISTRATION NUMBER: 30,753 2 0 (C) REFERENCE/DOCKET NUMBER: 9345-004 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 212-790-9090 (B) TELEFAX: 212-869-9741 (C) TELEX: 66141 PENNIE
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8805 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear {ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

j~ _ TTCTGTTCTA

AGAGTTTTAT

TTTACAAGAT

GGATAGTATA

GCAATCAGAC

GGAAGGTTTA

AACAGCATAT

ACCATATGAA

AAAGAAGGTA

GGCCTTTTTA

AGAGGAACAA

GGTGGTTAAG

AGGAGCGATG

TATGGGAGAG

AAAGGAATTG

GGTAGACATG

TACCTTGTCT

AATGGTACAA

AAGGCTGCAG GCAAGCGAAA GGGCAAGGTC'TCTCTTGATA TGTTACTGGG 1440 GACTGGGCAA

TGTCACCACA

TGTATTAGCA

CGAGGAAGCT

ATTGGCGTGG

AGGAACTATA

TATGGCATAT

TGGTGGGGGA

AGGACACATC

CTGCCCCAGA

AGATGGGAAT

GGGCAGTCCC

GAAGCCCCAC

GACCTGTCAT

ACCTTAGTGA

AATTATAAAA

ATCAAGGTTA

GCACAACTGC

~TTGCTGCC ATATTTAAAA TTAGCCAATC CTGTAATCAA GGAAGAACGA GGCTCAGAAG2520 GCAGATAAAA

GAGAGTTCTC

CGTTGGCAAC

TTCACCTTAT

CCAGATGATT

TATCTTGGAA

TACAGGCTTT

ATAGCCCTTG , 2 G~TACGCCT GTTTTTGTCA TTAAAAAGAA GTCAGGAAAA TGGAGACTGT TACAAGACCT3120 TGCCGTCCCC

GCTTTTTTAA

CCCCTAATTT

AAAATAGCCC

AATAGCAAGA

GATCCATTGT

CGATGA.AATA CTTACTTCCA TGATACAGGC CCTTAACAAA CATGGCCTTG 3540 TAGTATCCAC

AGAGAAGATT GAAAP:ATATG ATAATCTCAA ATATTTGGGA ACTCATATAC 3600 AGGGTGATTC

AGTGTCTTAT CAAAA.ATTAC AGATTAGGAC AGATAAATTA AGAACCTTAA 3660 ATGATTTCCA

30 AAp,GCTATTA GGAAATATTA ATTGGATACG TCCTTTCTTA AAATTAACTA 3720 CGGGAGAGTT

GAAAACTTAC

CTCGGGTAAA

ATACCCCCAC

TTTCACCAAA

TCAGTTTCACATCACTCGTGAACAAGCGCGAGA~1ATAGTAAAATTATGTCCCAATTGCCC4740 CCGTGGGATGGGGAAGTACAGACCCCATTAGAGTTCTGACAAATCAAACCATGTAT'TTGG5760 _ TCACTGCACTAGTCCCCCATACAGAATTGTTTCGCTTAGTCGCAGCCTCAAGACATCTTA6420 GCCAAGGGGTTGTTTCCCACCAAGGACGACCCGTCTGCGGACAAFaCGGATGAGCCCATCA7500 GAGGCAAGGA

TATAAAGTGT TATACAGGTCCCTCTCCTTTCCiTGAAAGGCTCGCCAGGGCTAGACCTCCT8160 TGGTGTATGT TGACTCAGGAAGAGAAP.AA.CGACATGAAACAACAGGTACATGATTATATT8220 (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1755 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Gly Val Ser Gly Ser Lys Gly Gln Lys Leu Phe Val Ser Va1 Leu Gln Arg Leu Leu Ser Glu Arg Gly Leu His Val Lys Glu Ser Ser Ala Ile Glu Phe Tyr Gln Phe Leu Ile Lys Val Ser Pro Trp Phe Pro Glu Glu Gly Gly Leu Asn Leu Gln Asp Trp Lys Arg Val Gly Arg Glu Met Lys Arg Tyr Ala Ala Glu His Gly Thr Asp Ser Ile Pro Lys Gln Ala 65 70 , 75 80 Tyr Pro Ile Trp Leu Gin Leu Arg Glu Ile Leu Thr Glu Gln Ser Asp Leu Val Leu Leu Ser Ala Glu Ala Lys Ser Val Thr Glu Glu Glu Leu loo 105 110 Glu Glu Gly Leu Thr Gly Leu,Leu Ser Thr Ser Ser Gln Glu Lys Thr Tyr Gly Thr Arg Gly Thr Ala Tyr Ala Glu Ile Asp Thr Glu Val Asp Lys Leu Ser Glu His Ile Tyr Asp Glu Pro Tyr Glu Glu Lys Glu Lys Ala Asp Lys Asn Glu Glu Lys Asp His Va1 Arg Lys Ile Lys Lys Val Val Gln Arg Lys Glu Asn Ser Glu Gly Lys Arg Lys Glu Lys Asp Ser Lys Ala Phe Leu Ala Thr Asp Trp Asn Asp Asp Asp Leu Ser Pro Glu Asp Trp Asp Asp Leu Glu Glu Gln Ala Ala His Tyr His Asp Asp Asp _ 4 Glu LeuIle LeuProVal LysArg LysValVal LysLys LysPro Gln Ala LeuArg ArgLysPro LeuPro ProValGly PheAla GlyAla Met Ala GluAla ArgGluLys GlyAsp LeuThrPhe ThrPhe ProVal Val Phe MetGly GluSerAsp GluAsp AspThrPro ValTrp GluPro Leu Pro LeuLys ThrLeuLys GluLeu GlnSerAla ValArg ThrMet Gly Pro SerA1a ProTyrThr LeuGln Va1Va1Asp MetVal AlaSer Gln Trp LeuThr ProSerAsp TrpHis GlnThrAla ArgAla ThrLeu Ser Pro GlyAsp TyrValLeu TrpArg ThrGluTyr GluGlu LysSer Lys Glu MetVal GlnLysAla AlaGly LysArgLys GlyLys ValSer Leu Asp MetLeu LeuGlyThr GlyGln PheLeuSer ProSer SerGln Ile Lys LeuSer LysAspVaI LeuLys AspValThr ThrAsn AlaVa1 Leu Ala TrpArg AlaIlePro ProPro GlyValLys LysThr ValLeu Ala Gly LeuLys GlnGlyAsn GluGlu SerTyrGlu ThrPhe IleSer Arg Leu GluGlu AlaValTyr ArgMet MetProArg GlyGlu GlySer Asp 435 . 440 445 Ile LeuIle LysGlnLeu AlaTrp GluAsnAla AsnSer LeuCys Gln Asp LeuI1e ArgProIle ArgLys ThrGlyThr IleGln AspTyr Ile Arg AlaCys LeuAspAla SexPro AlaValVal GlnGly MetAla Tyr Ala AlaAla MetArgGly GlnLys TyrSerThr PheVal LysGln Thr ~'r GlyGly GlyLysGly GlyGln GlyAlaGlu GlyPro ValCys Phe Sex CysGly LysThrGly HisIle ArgLysAsp CysLys AspGlu Lys Gly SerLys ArgAlaPro ProGly LeuCysPro ArgCys LysLys Gly Tyr HisTrp LysSerGlu CysLys SerLysPhe AspLys AspGly Asn Pro LeuPro ProLeuGlu ThrAsn AlaGluAsn SerLys AsnLeu Val LYs GlyGln SerProSer ProAla GlnLysGly AspGly ValLys Gly Ser GlyLeu AsnProGlu AlaPro ProPheThr IleHis AspLeu Pro Arg GlyThr ProGlySer AlaGly LeuAspLeu SerSer GlnLys Asp Leu IleLeu SerLeuGlu AspGly ValSerLeu ValPro ThrLeu Vai Lys GlyThr LeuProGlu GlyThr ThrGlyLeu IleIle GlyArg Ser 3 Ser AsnTyr LysLysGly LeuGlu ValLeuPro G1yVal IleAsp Ser Asp PheGln GlyGluIle LysVal MetValLys AlaAla LysAsn Ala Val IleIle HisLysGly GluArg IleAlaGln LeuLeu LeuLeu Pro Tyr LeuLys LeuPro AsnProVal IleLys GluGluArg GlySer Glu G1y PheGly SerThr SerHisVal HisTrp ValGlnGlu IleSer Asp Ser ArgPro MetLeu HisTleTyr LeuAsn GlyArgArg PheLeu Gly Leu LeuAsp ThrGly AlaAspLys ThrCys IleAlaGly ArgAsp Trp Pro AlaAsn TrpPro IleHisGln ThrGlu SerSerLeu GlnGly Leu Gly MetAla CysGly ValA1aArg SerSer Gln.ProLeu ArgTrp Gln 805 810 81s His GluAsp LysSer GlyIleIle HisPro PheValIle ProThr Leu Pro PheThr LeuTrp GlyArgAsp IleMet LysAspIle LysVal Arg Leu MetThr AspSer ProAspAsp SerGln AspLeuMet IleGly Ala Ile GluSer AsnLeu PheAlaAsp GlnIle SerTrpLys SerAsp Gln Pro Val-Trp LeuAsn GlnTrpPro LeuLys GlnGluLys LeuGln Ala Leu GlnG1n LeuVal ThrGluGln LeuGln LeuGlyHis LeuGlu Glu Ser AsnSer ProTrp AsnThrPro ValPhe ValIleLys LysLys Ser GIy LysTrp ArgLeu LeuGlnAsp LeuArg AlaValAsn AlaThr Met His AspMet GlyAla LeuGlnPro GlyLeu ProSerPro ValA1a Val 945. 950 955 960 Pro LysGly TrpGlu IleIleIle IleAsp LeuGlnAsp CysPhe Phe Asn IleLys LeuHis ProGluAsp CysLys ArgPheAla PheSer Val Pro SerPro AsnPhe LysArgPro TyrGln ArgPheGln Trp~Lys Val 2 0 Leu ProGln GlyMet LysAsnSer ProThr LeuCysGln LysPhe Val Asp LysAla IleLeu ThrValArg AspLys TyrG1nAsp SerTyr Ile Val HisTyr MetAsp AspIleLeu LeuAla HisProSer ArgSer Ile Val AspGlu IleLeu ThrSerMet IleGln AlaLeuAsn LysHis Gly Leu ValVal SerThr GluLysIle GlnLys TyrAspAsn LeuLys Tyr Leu GlyThr HisIle GlnGlyAsp SerVal SerTyrGln LysLeu Gln Ile ArgThr AspLys LeuArgThr LeuAsn AspPheGln ,LysLeu Leu Gly AsnIle AsnTrp IleArgPro PheLeu LysLeuThr ThrGly Glu Leu LysPro LeuPhe GluIleLeu AsnGly AspSerAsn ProIle Ser Thr ArgLys LeuThr ProGluAla CysLys AlaLeuGln LeuMet Asn Glu ArgLeu SerThr AlaArgVal LysArg LeuAspLeu SerGln Pro Trp SerLeu CysIle LeuLysThr GluTyr ThrProThr AlaCys Leu Trp Gln AspGiyVal ValGlu TzpIleHis LeuPro HisIleSer Pro Lys Val IleThrPro TyrAsp IlePheCys ThrGln LeuileIle Lys Gly Arg HisArgSer LysGlu LeuPheSer LysAsp ProAspTyr Ile Val Val ProTyrThr LysVal GlnPheAsp LeuLeu LeuGlnGlu Lys 1250 ~ 1255 1260 Glu Asp TrpProIle SerLeu LeuGlyPhe LeuGly GluValHis Phe His Leu ProLysAsp ProLeu LeuThrPhe ThrLeu GlnThrAla Iie Ile Phe ProHisMet ThrSer ThrThrPro LeuGlu LysGlyIle Val Ile Phe ~ThrAspGly SerAla AsnGlyArg SerVal ThrTyrIle Gln Gly Arg GluProIle IleLys GluAsnThr GlnAsn ThrAlaGln Gln Ala Glu IleValAla ValIle ThrAlaPhe GluGlu VaiSerGIn Pro Phe Asn LeuTyrThr AspSer LysTyrVal ThrGly LeuPhePro Glu Ile Glu ThrAlaThr LeuSer ProArgThr LysIle TyrThrGlu Leu Lys His LeuGlnArg LeuIle HisLysArg GlnGlu LysPheTyr Ile Gly His IleArgGly HisThr GlyLeuPro GlyPro LeuAiaGln Gly ~.51410 1415 1420 Asn Ala TyrAlaAsp SerLeu ThrArgIle LeuThr AlaLeuGlu Ser Ala Gln GluSerHis AlaLeu HisHisGln AsnAla AlaAlaLeu Arg Phe Gln PheHisIle ThrArg GluGlnAla ArgGlu IleValLys Leu Cys Pro AsnCysPro AspTrp GlyHisAla ProGln LeuGlyVal Asn Pro Arg GlyLeuLys ProArg ValLeuTrp GlnMet AspValThr His p Val Ser GluPheGly LysLeu LysTyrVal HisVal ThrValAsp Thr Tyr Ser HisPheThr PheAl.aThrAlaArg ThrGly GluAlaThr Lys Asp Val LeuGlnHis LeuAla GlnSerPhe AlaTyr MetGlyIle Pro Gln Lys IleLysThr AspAsn AlaPxoAla TyrVal SexArgSer Ile 2 Gln Glu PheLeuAla ArgTrp LysIleSer HisVal ThrGlyIie Pro Tyr Asn ProGlnGly GlnAla IleValGlu ArgThr HisGlnAsn Ile Lys Ala GlnLeuAsn LysLeu GlnLysAla GiyLys TyrTyrThr Pro His His LeuLeuAla HisAla LeuPheVal LeuAsn HisVa1Asn Met Asp Asn GlnGlyHis ThrAla AlaGluArg HisTrp GiyProIie Ser 3 Ala Asp ProLysPro MetVal MetTrpLys AspLeu LeuThrGly Ser Trp Lys GlyProAsp ValLeu IleThrAla GlyArg GlyTyrAla Cys Val Phe ProGlnAsp AlaGlu ThrProIle TrpVal ProAspArg Phe _ 7 Ile Arg Pro Phe Thr Glu Arg Lys Glu Ala Thr Pro Thr Pro Gly Thr Ala Glu Lys Thr Pro Pro Arg Asp Glu Lys Asp Gln Gln Glu Ser Pro Lys Asn Glu Ser Ser Pro His Gln Arg Glu Asp Gly Leu Ala Thr Ser Ala Gly Val Asp Leu Arg Ser Gly Gly Gly Pro (2) INFORMATION FOR SEQ ID N0:3: .
(i) SEQUENCE CHARACTERISTICS:
(A} LENGTH: 860 amino acids (B) TYPE: amino acid (C} STRANDEDNESS:
(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Met Gly Val Ser Gly Ser Lys Gly Gln Lys Leu Phe Val Ser Val Leu G1n Arg Leu Leu Ser Glu Arg Gly Leu His Val Lys Glu Ser Ser Ala Ile Glu Phe Tyr Gln Phe Leu Ile Lys Val Ser Pro Trp Phe Pro Glu Glu Gly Gly Leu Asn Leu Gln Asp Trp Lys Arg Val Gly Arg Glu Met Lys Arg Tyr Ala Ala Glu His Gly Thr Asp Ser Ile Pro Lys Gln Ala Tyr Pro Ile Trp Leu Gln Leu Arg Glu Ile Leu Thr Glu Gln Ser Asp Leu Val Leu Leu Ser Ala Glu Ala Lys Ser Val Thr Glu Glu Glu Leu Glu Glu G1y Leu Thr Gly Leu Leu Ser Thr Ser Ser Gln Glu Lys Thr Tyr Gly Thr Arg Gly Thr Ala Tyr Ala Glu Ile Asp Thr Glu Val Asp Lys Leu Sex Glu His Ile Tyr Asp Glu Pro Tyr G1u Glu Lys Glu Lys Ala Asp Lys Asn Glu G1u Lys Asp His Val Arg Lys Ile Lys Lys Val Val Gln Arg Lys Glu Asn Ser Glu Gly Lys Arg Lys Glu Lys Asp Ser lso le5 lgo Lys Ala Phe Leu Ala Thr Asp Trp Asn Asp Asp Asp Leu Ser Pro Glu Asp Trp Asp Asp Leu Glu Glu Gln Ala Ala His Tyr His Asp Asp Asp Glu Leu Ile Leu Pro Val Lys Arg Lys Val Val Lys Lys Lys Pro Gln Ala Leu Arg Arg Lys Pro Leu Pro Pro Val Gly Phe Ala Gly Ala Met Ala Glu Ala Arg Glu Lys Gly Asp Leu Thr Phe Thr Phe Pro Val Val Phe Met Gly Giu Ser Asp Glu Asp Asp Thr Pro Val Trp Glu Pro Leu Pro Leu Lys Thr Leu Lys Glu Leu Gln Ser Ala Val Arg Thr Met Gly 5 _ Pro SerAla ProTyr ThrLeuGln ValVal AspMetVal AlaSer Gln Trp LeuThr ProSer AspTrpHis GlnThr AlaArgAla ThrLeu Ser Pro GlyAsp TyrVal LeuTrpArg ThrGlu TyrGluGlu LysSer Lys Glu MetVal GlnLys AlaAlaGly LysArg LysGlyLys ValSer Leu Asp MetLeu LeuGly ThrGlyGln PheLeu SerProSer SerGln Ile Lys LeuSer LysAsp ValLeuLys AspVal ThrThrAsn AlaVal Leu Ala TrpArg AlaIle ProProPro GlyVal LysLysThr ValLeu Ala Gly LeuLys GlnGly AsnGluGlu SerTyr GluThrPhe IleSer .Arg Leu GluGlu AlaVa1 TyrArgMet MetPro ArgGlyGlu GlySer Asp Ile LeuIle LysGln LeuAlaTrp GluAsn AlaAsnSer LeuCys Gln Asp LeuIle ArgPro IleArgLys ThrGly ThrIleG1n AspTyr Ile Arg AlaCys LeuAsp AlaSerPro AlaVal ValGlnGly MetAla Tyr Ala AlaAla MetArg GlyGlnLys TyrSer ThrPheVal LysGln Thr Tyr GlyG1y GlyLys GlyGlyGln GlyAla GluGlyPro ValCys Phe 515 .520 525 Ser CysGly LysThr GlyHisIle ArgLys AspCysLys AspGlu Lys Gly SerLys ArgAla ProProGly LeuCys ProArgCys LysLys Gly Tyr HisTrp LysSer GluCysLys SerLys PheAspLys AspG1y Asn Pro LeuPro ProLeu GluThrAsn AlaGlu AsnSerLys AsnLeu Val Lys GlyGln SerFro SerProA1a GlnLys GlyAspGly ValLys Gly Ser GlyLeu AsnPro GluAlaFro ProPhe ThrIleHis AspLeu Fro Arg GlyThr ProGly SerAlaGly LeuAsp LeuSerSer GlnLys Asp Leu IleLeu SerLeu GluAspGly ValSer LeuValPro ThrLeu Val Lys GlyThr LeuPro GluGlyThr ThrGly LeuIleIle GlyArg Ser 2 5 Ser AsnTyr LysLys GlyLeuGlu ValLeu FroGlyVal IleAsp Ser Asp PheGln GlyGlu Ile,LysVal MetV~1 LysAlaAla LysAsn Ala Val IleIle HisLys GlyGluArg IleAla GlnLeuLeu LeuLeu Pro Tyr LeuLys LeuPro AsnProVal IleLys GluGluArg GlySer Glu Gly PheGly SerThr SerHisVal HisTrp ValGlnGlu IleSer Asp 3 0 Ser ArgPro MetLeu HisIleTyr LeuAsn GlyArgArg FheLeu Gly Leu LeuAsp ThrGly AlaAspLys ThrCys IleAlaGly ArgAsp Trp Pro AlaAsn TrpPro IleHisGln ThrGlu SerSerLeu GlnGly Leu _ g _ Gly Met Ala Cys Gly Val Ala Arg Ser Ser Gln Pro Leu Arg Trp Gln His Glu Asp Lys Ser Gly Ile I1e His Pro Phe Val Ile Pro Thr Leu Pro Phe Thr Leu Trp Gly Arg Asp Ile Met Lys Asp Ile Lys Val Arg Leu Met Thr Asp Ser Pro Asp Asp Ser Gln Asp Leu (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 591 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
Met Gly Val Ser Gly Ser Lys Gly Gln Lys Leu Phe Val Ser Val Leu Gln Arg Leu Leu Ser Glu Arg Gly Leu His Val Lys Glu Ser Ser Ala Ile Glu Phe Tyr Gln Phe Leu Ile Lys Val Ser Pro Trp Phe~Pro Glu Glu Gly Gly Leu Asn Leu Gln Asp Trp Lys Arg Val Gly Arg Glu Met Lys Arg Tyr Ala Ala Glu His Gly Thr Asp Ser Ile Pro Lys Gln Ala Tyr Pro Ile Trp Leu Gln Leu Arg Glu Ile Leu Thr Glu Gln Ser Asp Leu Val Leu Leu Ser Ala Glu Ala Lys Ser Val Thr Glu Glu Glu Leu Glu Glu Gly Leu Thr Gly Leu Leu Ser Thr Ser Ser Gln Glu Lys Thr Tyr Gly Thr Arg Gly Thr Ala Tyr Ala Glu Ile Asp Thr Glu Val Asp Lys Leu Ser Glu His Ile Tyr Asp Glu Pro Tyr Glu Glu Lys Glu Lys Ala Asp Lys Asn Glu Glu Lys Asp His Val Arg Lys Ile Lys Lys Val Val Gln Arg Lys Glu Asn Ser Glu Gly Lys Arg Lys Glu Lys Asp Ser Lys Ala Phe Leu Ala Thr Asp Trp Asn Asp Asp Asp Leu Ser Pro Glu Asp Trp Asp Asp Leu Glu Glu Gln Ala Ala His Tyr His Asp Asp Asp Glu Leu Ile Leu Pro Val Lys Arg Lys Val Val Lys Lys Lys Pro Gln Ala Leu Arg Arg Lys Pro Leu Pro Pro Val Gly Phe Ala Gly Ala Met Ala Glu Ala Arg Glu Lys Gly Asp Leu Thr Phe Thr Phe Pro Val Val Phe Met Gly Glu Ser Asp Glu Asp Asp Thr Pro Val Trp Glu Pro Leu Pro Leu Lys Thr Leu Lys Glu Leu Gln Ser Ala Val Arg Thr Met Gly WO 99/5126$ PCTlUS99/07712 Pro Ser Ala Pro Tyr Thr Leu Gln Val Val Asp Met Val Ala Ser GIn Trp Leu Thr Pro Ser Asp Trp His Gln Thr Ala Arg Ala Thr Leu Ser Pro Gly Asp Tyr Val Leu Trp Arg Thr Glu Tyr Glu Glu Lys Ser Lys Glu Met Val Gln Lys Ala Ala GIy Lys Arg Lys Gly Lys Val Ser Leu Asp Met Leu Leu Gly Thr Gly Gln Phe Leu Ser Pro Ser Ser Gln Ile Lys Leu Ser Lys Asp Va1 Leu Lys Asp Val Thr Thr Asn Ala Val Leu Ala Trp Arg Ala Ile Pro Pro Pro Gly Val Lys Lys Thr Val Leu Ala Gly Leu Lys Gln Gly Asn Glu Glu Ser Tyr Glu Thr Phe Ile Ser Arg Leu Glu Glu Ala Val Tyr Arg Met Met Pro Arg Gly Glu Gly Ser Asp Ile Leu Ile Lys Gln Leu Ala Trp Glu Asn Ala Asn Ser Leu Cys Gln Asp Leu Ile Arg Pro Ile Arg Lys Thr Gly Thr Ile Gln Asp Tyr I1e Arg Ala Cys Leu Asp Ala Ser Pro Ala Val Val Gln Gly Met Ala Tyr Ala Ala Ala Met Arg G1y Gln Lys Tyr Ser Thr Phe Val Lys Gln Thr Tyr Gly Gly Gly Lys Gly Gly Gln Gly Ala Glu Gly Pro Val Cys Phe Ser Cys Gly Lys Thr Gly His Ile Arg Lys Asp Cys Lys Asp Glu Lys Gly Ser Lys Arg Ala Pro Pro Gly Leu Cys Pro Arg Cys Lys Lys Gly Tyr His Trp Lys Ser Glu Cys Lys Ser Lys Phe Asp Lys Asp Gly Asn Pro Leu Pro Pro Leu-Glu Thr Asn Ala Glu Asn Ser Lys Asn Leu 2Q (2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 688 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
Met Pro Lys His Gln Ser Gly Ser Pro Thr Asp Ser Ser Asp Leu Leu Leu Ser Gly Lys Lys Gln Arg Pro His Leu Ala Leu Arg Arg Lys Arg 3 0 Arg Arg Glu Met Arg Lys Ile Asn Arg Lys Val Pro Arg Met Asn Leu Val Pro Ile Lys Glu Lys Thr Ala Trp Gln His Leu Gln Ala Leu I1e Ser Glu Ala Glu Glu Val Leu Lys Thr Ser Gln Thr Pro Gln Thr Ser WO 99/51268 PCT/US991077t2 Leu Thr LeuPheLeu AlaLeu LeuSerVal LeuGlyPro ProPro Val g5 90 95 Thr Gly GluSerTyr TrpAla TyrLeuPro LysProPro IleLeu His Pro Val GlyTrpGly SerThr AspProIle ArgValLeu ThrAsn Gln Thr Met TyrLeuGly GlySex ProAspPhe HisG1yPhe ArgAsn Met Ser Gly AsnValHis PheGlu GlyLysSer AspThrLeu ProIle Cys Leu Ser PheSerPhe SerThr ProThrGly CysPheGln ValAsp Lys Gln Val PheLeuSer AspThr ProThrVal AspAsnAsn LysPro GIy Gly Lys GlyAspLys ArgArg MetTrpGlu LeuTrpLeu ThrThr Leu Gly Asn SerGlyAla AsnThr LysLeuVal ProIleLys LysLys Leu Pro Pro LysTyrPro HisCys GlnIleAla PheLysLys AspAla Phe Trp Glu GlyAspGlu SerAla ProProArg TrpLeuPro CysAla Phe Pro Asp GlnGlyVal SerPhe SerProLys GlyAlaLeu GlyLeu Leu Trp Asp PheSerLeu ProSex ProSerVal AspGlnSer AspGln Ile 15 Lys Ser LysLysAsn LeuPhe GlyAsnTyr ThrProPro ValAsn Lys Glu Val HisArgTrp TyrGlu A1aGlyTrp ValGluPro ThrTrp Phe Trp Glu AsnSerPro LysAsp ProAsnAsp ArgAspPhe ThrAla Leu 325 330 ~ -335 Val Pro HisThrGlu LeuPhe ArgLeuVal AlaAlaSer ArgHis Leu Ile Leu LysArgPro GlyPhe GlnGluHis Gl~uMetIle ProThr Ser 20 Ala Cys ValThrTyr ProTyr AlaIleLeu LeuGlyLeu ProGln Leu Ile Asp IleGluLys ArgGly SerThrPhe HisIleSer CysSer Ser Cys Arg LeuThrAsn CysLeu AspSerSer AlaTyrAsp TyrAla Ala Ile Ile ValLysArg ProPro TyrVal.LeuLeuProVal AspIIe Gly Asp Glu ProTrpPhe AspAsp SerAlaIle GlnThrPhe ArgTyr Ala Thr Asp LeuIleArg AlaLys ArgPheVal AlaAlaIle IleLeu Gly Ile Ser AlaLeuIle AlaIle IleThrSer PheAlaVal AlaThr Thr Ala Leu ValLysGlu MetGln ThrAlaThr PheValAsn AsnLetzHis Arg Asn Va1ThrLeu AlaLeu SerGluGln ArgIleIle AspLeu Lys Leu Glu AlaArgLeu AsnAla LeuGluGlu ValValLeu GluLeu Gly Gln Asp ValAlaAsn LeuLys ThrArgMet SerThrArg CysHis Ala Asn Tyr AspPheIle CysVal ThrProLeu ProTyrAsn AlaThr Glu Asn Trp Glu Arg Thr Arg Ala His Leu Leu G1y Ile Trp Asn Asp Asn Glu Ile Ser Tyr Asn Ile Gln Glu Leu Thr Asn Leu 2le Ser Asp Met Ser Lys Gln His Ile Asp Ala Va1 Asp Leu Ser G1y Leu Ala:Gln Ser 595 ~ 600 605 Phe Ala Asn Gly Val Lys Ala Leu Asn Pro Leu Asp Trp Thr Gln Tyr Phe Ile Phe Ile Gly Val Gly Ala Leu Leu Leu Val Ile Val Leu Met Ile Phe Pro Ile VaI Phe G1n Cys Leu Ala Lys Ser Leu Asp Gln Val Gln Ser Asp Leu Asn Val Leu Leu Leu Lys Lys Lys Lys Gly Gly Asn Ala Ala Pro Ala Ala Glu Met Val Glu Leu Pro Arg Val Ser Tyr Thr ZO (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 320 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D} TOPOLOGY: unknown (ii} MOLECULE TYPE: peptide ZS (xi} SEQUENCE DESCRIPTION: SEQ ID N0:6:
Met Pro Arg Leu Gln Gln Lys Trp Leu Asn Ser Arg Glu Cys Pro Thr Leu Arg Gly Glu Ala Ala Lys Gly Leu Phe Pro Thr Lys Asp Asp Pro Ser Ala His Lys Arg Met Ser Pro Ser Asp Lys Asp Ile Leu Ile Leu ...

Cys Cys Lys taeu Gly Ile Ala Leu Leu Cys Leu Gly Leu Leu Gly Glu Val Ala Val Arg Ala Arg Arg Ala Leu Thr Leu Asp Ser Phe Asn Ser Ser Ser Val Gln Asp Tyr Asn Leu Asn Asp Ser Glu Asn Ser Thr Phe .. 85 90 95 Leu Leu Arg Gln Gly Pro Gln Pro Thr Ser Ser Tyr Lys Pro His Gln Pro Cys Pro Ser Glu Ile Glu Tle Arg Met Leu Ala Lys Asn Tyr Ile Phe Thr Asn Lys Thr Asn Pro Ile Gly Arg Leu Leu Val Thr Met Leu 2r~ 130 135 140 Arg Asn Glu Ser Leu Pro Phe Ser Thr Ile Phe Thr Gln Ile Gln Arg Leu Glu Met Gly Ile Glu Asn Arg Lys Arg His Ser Thr Ser Val Glu 165 170 '175 Glu Gln Val Gln Gly Leu Arg Ala Ser Gly Leu Glu Val Lys Arg Gly Lys Arg Ser Ala Leu Val Lys Ile Gly Asp Arg Trp Trp Gln Pro Gly Thr Tyr Arg Gly Pro Tyr Ile Tyr Arg Pro Thr Asp Ala Pro Leu Pro Tyr Thr Gly Arg Tyr Asp Leu Asn Phe Asp Arg Trp Val Thr Val Asn Gly Tyr Lys Val Leu Tyr Arg Ser Leu Ser Phe Arg Glu Arg Leu Ala 13 _ Arg Ala Arg Pro Pro Trp Cys Met Leu Thr Gln Glu Glu Lys Asn Asp Met Lys Gln Gln Val His Asp Tyr Ile Tyr Leu Gly Thr Gly Met Ser Ser Ile Trp Gly Lys Ile Phe His Thr Lys Glu Arg Thr Val Ala Ala Leu Ile Glu His Tyr Ser Ala Lys Thr Tyr Gly Met 5er Tyr Tyr Asp

Claims

WHAT IS CLAIMED IS:

1. A method for inducing an immune response to MMTV in a human subject comprising administering to the subject an immunomodulatory composition comprising a pharmaceutical carrier and at least one MMTV antigen in an amount sufficient to elicit an increase in a MMTV specific cellular or humoral response.

2. The method according to claim 1, in which the antigen is the MMTV env peptide or a portion thereof.

3. The method according to claim 2, in which the portion comprises at least 6 contiguous amino acids of the MMTV env peptide.

4. The method according to claim 1, in which the antigen is a MMTV core peptide or portion thereof.

5. The method according to claim 4, in which the portion comprises at least 6 contiguous amino acids of a MMTV
core peptide.

6. The method according to claim 1, in which the antigen is the MMTV pol peptide or portion thereof.

7. The method according to claim 6, in which the portion comprises at least 6 contiguous amino acids of the MMTV pol peptide.

8. The method according to claim 1, in which the antigen is a nucleic acid molecule which encodes for at least one MMTV antigen.

9. The method according to claim 8, in which the nucleic acid encodes for the MMTV env peptide or a portion thereof.

10. The method according to claim 9, in which the portion encodes at least 6 contiguous amino acids of the MMTV
env peptide.

11. The method according to claim 8, in which the nucleic acid encodes for a MMTV core peptide or portion thereof.

12. The method according to claim 11, in which the portion encodes at least 6 contiguous amino acids of a MMTV
core peptide.

13. The method according to claim 8, in which the nucleic acid encodes for the MMTV pol peptide or portion thereof.

14. The method according to claim 13, in which the portion encodes at least 6 contiguous amino acids of a MMTV
core peptide.

15. The method according to claim 8 in which the nucleic acid encodes for a discontinuous epitope of MMTV.

16. The method according to claim 1 in which the human subject has not been exposed to or infected with MMTV
prior to administration of the immunomodulatory composition.

17. The method according to claim 1 in which the human subject has no immune reactivity to a MMTV antigen prior to administration of the immunomodulatory composition:

18. The method according to claim 1, in which the immunomodulatory composition is administered by a route selected from the group consisting of an oral route, an intranasal route, an intradermal route, an intravenous route, an intraperitoneal route and a subcutaneous route.

19. A discontinuous epitope of MMTV produced by a method comprising (a) substantially digesting the genome of MMTV to produce a plurality of MMTV nucleic acid fragments;
(b) ligating the fragments to produce at least one ligated nucleic acid fragment which encodes at least one peptide; (c) expressing the ligated fragment in an expression system such that the encoded peptide is expressed; (d) screening the expressed peptide with sera comprising antibodies or immune cells reactive with at least one MMTV antigen; and (e) purifying the expressed peptide that positively reacts with the antibodies or immune cell.

20. A method for inducing an immune response to MMTV in a human subject comprising administering to the subject an immunomodulatory composition comprising a pharmaceutically acceptable carrier and a discontinuous epitope of MMTV produced by a method comprising (a) substantially digesting the genome of MMTV to produce a plurality of MMTV nucleic acid fragments; (b) ligating the fragments to produce at least one ligated nucleic acid fragment which encodes at least one peptide; (c) expressing the ligated fragment in an expression system such that the encoded peptide is expressed; (d) screening the expressed peptide with sera comprising antibodies or immune cells reactive with at least one MMTV antigen; and (e) purifying the expressed peptide that positively reacts with the antibodies or immune cell, in an amount sufficient to elicit an increase in a MMTV specific cellular or humoral response.