CA2325576A1 - Recombinant proteins of treponema pallidum and their use for a syphilis vaccine - Google Patents

Abstract

The invention provides nucleic acid molecules, polypeptides, and methods useful for vaccines against syphilis and other treponemal diseases.

Description

WO 99/53099 _1_ PCT/US99/07886 RECOMBINANT PROTEINS OF TREPONEMA PALLIDUM AND THEIR USE
FOR A SYPHILIS VACCINE
Field of the Invention Isolated nucleic acids and polypeptides from Treponema pallidum subspecies pallidum, pertenue, and errdemicum and the use of these molecules to elicit protective immunity against this organism.
Background of the Invention Primary syphilis is characterized by a painless primary ulcerative lesion called a "chancre" that generally develops at the site of inoculation after sexual contact with an infected person. The chancre is the site of proliferation of the spirochete Treponema pallidum subspecies pallidum (T. p. pallidum), which causes syphilis. The chancre gradually resolves, and weeks to months later a rash characteristic of secondary syphilis usually develops. Syphilis also can be transmitted congenitally.
Without appropriate antibiotic treatment, T. p. pallidum establishes a lifelong chronic infection. Approximately 30% of patients in late stages of the disease develop tertiary neurologic, bony, hepatic, or circulatory system manifestations which may occur decades after the primary infection event.
Pathogenic members of the genus Treponema include at least, four natural human pathogens and one natural rabbit pathogen. Based in part upon saturation reassociation kinetics assays {lVBao, R.M., and A.H. Fieldsteel, J. Bacteriol.
141:427 429, 1980) three of the human pathogens are currently classified as subspecies of Treponema pallidum. These are Treponema pallidum subspecies pallidum, Treponema pallidum subspecies pertenue, and Trepo»ema pallidum subspecies endemicum, which, respectively, cause venereal syphilis, yaws, and bejel. A
fourth WO 99/53099 PC'f/US99/07886 treponeme, Treponema carateum, causes a disease called pints. Yaws and bejel occur primarily in warm, humid, tropical areas of the world, primarily in children, and are transmitted by direct non-sexual contacT. Like syphilis, these diseases are characterized by primary lesions that heal within days or weeks, followed by a more serious secondary phase that is systemic. Some cases of bejel exhibit tertiary symptoms as well. In addition, poorly characterized spirochetes have been isolated in plaque associated with gingivitis and periodontal lesions, and are believed to be etiologic agents of that condition. These oral treponemes are known to be reactive with a monoclonal antiserum specific for a 47 kDa protein found in T. p.
pallidum, thus appear to be subspecies or strain of T. p. pallidum (Riviere et al., N.
Eng. J.
Med. 325:539-543, 1991). Another treponeme, Treponema paraluiscuniculi, causes venereal syphilis in rabbits, and is non-infectious to humans. These various pathogenic treponemes are morphologically identical and are antigenica.lly highly cross-reactive, e.g., currently available serological tests cannot distinguish yaws infection from syphilis.
Pathogenic varieties of T. pallidum, including subspecies pallidum, and endemicum, have remained refractory to being propagated in culture for more than a few passages, a circumstance that has hampered efforts to fully characterize these organisms and their pathology. However, these bacteria all can be propagated by serial inoculation of rabbit testes. Moreover, the rabbit provides a good experimental model for treponemal disease, in that rabbits develop primary chancres much like humans and also develop persistent infection in their lymph nodes and central nervous systems (Turner, T.B., and D.H. Hollander, Biology of the Trepo»ematoses, World Health Organization, Geneva, 1957). Rabbits, however, do not manifest secondary or tertiary syphilis.
A syphilis vaccine clearly is needed due to a recent upsurgence worldwide in the frequency of occurrence of this disease. Between 1985 and 1990, the number of reported syphilis cases in the United States increased from 27,131 to 50,578 (golfs, R.T., MMWR 42:13-19, 1993). Worldwide, over 3 million cases annually are estimated to have occurred during that time period. To exacerbate the problem, syphilis infections appear to increase the risk of acquisition and transmission of human immunodeficiency virus (HIV) (Greenblatt, R.M., et al., AIDS 2:47-50, 1988;
Simonsen, J.N., et al., N. Engl. J. Med 319:274-278, 1988; Darrow, W.N., et al., Am. J. Public Health 77:479-483, 1987). These circumstances have spurred efforts to develop a vaccine for syphilis, but as of yet no practical vaccine effective against this disease has been reported. Moreover, no vaccines exist for yaws or bejel, both of which are serious treponemal diseases that take a heavy toll in tropical and subtropical regions of the world.
To enable rational vaccine design more information is needed about treponemal interaction with the immune system and, specifically, the immune evasion mechanisms employed by T. p. pallidum. One of the central paradoxes of syphilis is the induction of a rapid humoral and cellular immune response that is capable of eliminating millions of treponemes from primary syphilitic lesions, but incapable of eradicating the few organisms that remain during latency. Macrophages are believed to be responsible for this rapid clearance of T. pallidum from early lesions, presumably through antibody-mediated treponemal opsonization and subsequent phagocytosis and killing by macrophages (e.g., see Lukehart and Miller, J.Immuno1.121:2014-2024, 1978; Baker-Zander and Lukehart, .I. InfecT. Dis. 165:69-74, 1992). In support of this, antibody has been demonstrated to enhance phagocytosis of treponemes by macrophages (Lukehart and lVfiller, J. Immunol. 121:2014-2024, 1978) and is required for macrophage-mediated killing of T. pallidum (Baker-Zander and Lukehart, J. InfecT. Dis 165:69-74, 1992). In addition, the systemic appearance of opsonic antibody has been shown to immediately precede bacterial clearance in the rabbit model (Baker-Zander et al., FEMS
Immureol.
Mec~ Microbiol. 6:273-280, 1993).
Although no success has been reported for efforts to protect animals by immunization with defined antigens of T. p. pallidum, complete protection against homologous challenge with T. p. pallidum was achieved in at least one instance following 60 injections of Y-irradiated T. p. pallidum (Miller, J. N., J.Immunol. 110:1206-1215, 1973). Moreover, persons infected with the highly related T. p. pertenue, which causes yaws, exhibit partial immunity to T. p.
pallidum, and similarly, persons infected with one strain of T. p. pallidum exhibit partial immunity against infections with other strains (Turner and Hollander, Biology of the Treponematoses, World Health Organization, 1957). These observations indicate that a vaccine that induces protective immunity against syphilis is a plausible goal, but that antigens useful for such a vaccine have not yet been discovered.
To date, most T. p. pallidum antigens considered as vaccine candidates have been selected simply on the basis of their reactivity with immune rabbit serum (IRS), i.e., the serum of rabbits that are immune to syphilis by virtue of having been previously infected with T. p. pallidum. This approach has led to the identification of a number of interesting and important lipoprotein and protein antigens, but has failed so far to provide any protein capable of protecting experimental animals from challenge with T. p. palliclum.
T. p. pallidum is a highly motile spirochete containing an outer membrane, a periplasmic space, a peptidoglycan-cytoplasmic membrane complex, and a protoplasmic cylinder. Proteins associated with the outer membrane are more likely to be exposed to the host immune system, and thus are more likely than other treponemal proteins to elicit an immune response by the infected hosT.
However, studies have indicated that T. p. pallidum has about 100-fold fewer traps-membrane proteins than does a typical gram negative bacterium (Radolf, J.D., et al., Proc. Natl.
Acad Sci. USA 86:2051-2055, 1989; Walker, E.M., et al., J. Bacteriol 171:5005-11, 1989). Because of their paucity, some investigators have assigned T. p.
pallidum outer membrane proteins a special name, "T. pallidum rare outer membrane proteins,"
or "TROMPS." Candidate TROMPS include 65-, 31- (basic and acidic pI forms), and 28- kDa proteins that are found in the outer membrane fraction (Blanco, D. R., et al., J. Bacteriol., 176:6088-6099, 1994; Blanco, D. R., et al., Emerg. I»fecT. Dis.
3:11-20, 1997). However, no TROMP nor any other T. p. pallidum protein has definitively been identified as being located in the outer membrane, nor has any candidate outer membrane protein been shown to induce a protective immune response {Radolf JD, et al., IrrfecT. Immun. 56:490-498, 1988; Radolf et al., InfecT. Immun. 56:1825-1828, 1988; Cunningham et al., J. Bacteriol., 170:5789-5796, 1988;[?J11; Blanco et al., J. Bacteriol. 176:6088-6099, 1994; Cox et al., Molec. Microbiol., 15:151-1164, 1995; Radolf, J. D., Molec. Microbiol., 16:1067-1073, 1995). For example, a recent report suggests that TROMP 1 is localized to the cytoplasmic membrane, suggesting it is not surface exposed (Akins, D. R., et al., J. Bacteriol., 179:5076-5086, 1997). Moreover, neither of the two TROMP genes so far identified is found in greater than one copy and therefore neither appears to function in antigenic variation. In addition, several of the highly immunogenic lipoprotein antigens (47, 34, 17, and 15 kDa) akeady identified for T.
pallidum have been shown to not be exposed on the outer membrane (Radolf, J.D., Mol.
Microbiol. 16:1067-1073, 1995).
On June 24, 1997, a preliminary copy of the entire genome of T. p. pallidum, Nichols strain, was posted on the Internet at http://utmmg.med.uth.tmc.edu/treponema/docs/update.html. This copy of the T. p. pallidum genome was not annotated to denote the positions of open reading WO 99/53099 PCTNS99/0'1886 frames, though subsequent updates to this original posting have noted open reading frames and have provided other information.
Su of the Invention Two genes and one multi-membered gene family have been identified that are useful for eliciting a protective immune response against infection by T. p.
pallidum, the bacterium that causes syphilis. The nucleotide sequences of these new genes have been determined. In an experimental rabbit model, immunization with the protein products of several of these genes elicited significant protection upon subsequent challenge with virulent T. p. pallidum. These proteins represent the first immunoprotective antigens that have been reported for T. pallidum subsp.
pallidum.
Comparative sequence analysis has indicated that one of the genes identified here (SEQ ID NO:1) encodes a 356 amino acid protein (SEQ D7 N0:2) that is a glycerophosphodiester phosphodiesterase (hereafter called "Gpd"), a . glycerol metabolizing enzyme previously identified in other bacteria, e.g., Haemophilus inJluenzae, Escherichia coli, Bacillus subtilis and Borrelia hermsii (3anson, H., et al., InfecT. Immun., 59:119-125, 1991; Munson, R.S., et al., J. Bacteriol., 175:4569-4571, 1993; Tommassen, J., et al., Mol. Gen. Genet., 226:321-327, 1991;
Schwan, T.G., et al., J. Clin. Microbiol. 34:2483-2492, 1996; Shand, E.S., et al., J.
Bacteriol., 179:2238-2246, 1997; N'~lsson, R.P. et al., Microbiol., 140:723-730, 1994).
The identification of this protein (SEQ TD N0:2) has been previously published (Stebeck et al., FF~IS Microbiol. Letters, 154:303-310, 1997; Shevchenko et al., InfecT. Immun., 65:4179-4189, 1997). Experiments were conducted to confirm that the product of the T. pallidum Gpd homologue (SEQ m NO:1) exhibited the expected Gpd activity, and anti-Gpd antibodies were used to confirm that T. p. pallidum indeed expresses a cross-reactive protein of the predicted molecular size. Injection of recombinant Gpd (SEQ ID N0:2) into rabbits was shown to elicit a partially protective immune response upon subsequent challenge with T. p.
pallidum.
In addition to Gpd (SEQ ID N0:2), the invention provides another protein believed to be associated with the outer membrane, and that has homology with the surface-exposed D15 protein from Haemophilus influenzae (Flack, F.S., et al., Gene, 156:97-99, 1995), and Oma87 from Pasteurella multocida (Ruffolo and Alder, InfecT. Immun., 64:3161-3167, 1996). This protein is herein referred to as the "D15/Oma87 homologue" and is encoded by the nucleic acid molecule having the sequence set forth in SEQ ID N0:3. The amino acid sequence of the D15/Oma87 homologue is set forth in SEQ ID N0:4. SEQ D7 NO:S sets forth the nucleic acid sequence of a portion of the coding region of the D15/Oma87 homologue gene (SEQ
D7 N0:3) that was expressed to yield a D15/Oma87 homologue polypeptide fragment (SEQ m N0:6) that was recovered and used for vaccine testing, as more fully described herein.
In addition to Gpd (SEQ D7 N0:2) and D15 (SEQ m N0:4), a novel polymorphic, multicopy gene family (called Msp) has been identified in T. p.
pallidum, T. p. pertenue and T. p. endemicum. Members of this gene fiunily have homology to the major outer sheath protein (Msp) of T. denticola. The members of this gene family are divided into several subfamilies, and present within each subfamily are regions that are highly conserved as well as variable regions that are far less conserved. Analysis of their amino acid sequences suggests that many of these molecules are likely to be outer surface exposed. Furthermore, injection of rabbits with several of these proteins has resulted in partial protective immunity of the rabbits upon challenge with a large dose of T. p. pallidum, thus these proteins are useful as vaccine antigens.
The nucleic acid sequences of cloned T. p. pallidum Msp genes (or portions thereof), and the proteins encoded by the T. p. pallidum Msp genes, are disclosed in the following sequence listing entries: Msp 1 (SEQ m N0:7), Msp 1 protein (SEQ
m N0:8); Msp2 (SEQ II7 N0:9), Msp2 protein (SEQ m NO:10); Msp3 (SEQ m NO:11), Msp3 protein (SEQ ID N0:12); Msp4 (SEQ m N0:13), ~ Msp4 protein (SEQ D3 N0:14); MspS (SEQ ID NO:15), MspS protein (SEQ m N0:16); Msp6 (SEQ m N0:17), Msp6 protein (SEQ D7 N0:18); Msp7 (SEQ D7 N0:19), Msp7 protein encoded by open reading frame A (SEQ m N0:20), Msp7 protein encoded by open reading frame B (SEQ ID N0:21); MspB (SEQ m N0:22), Msp8 protein (SEQ
m N0:23); Msp9 (SEQ m N0:24), Msp9 protein (SEQ m N0:25); MsplO (SEQ
m N0:26), Msp 10 protein (SEQ m N0:27); Msp 11 (SEQ m N0:28), Msp 11 protein (SEQ m N0:29); and Mspl2 (SEQ D7 N0:30), Mspl2 protein (SEQ m N0:31). The amino acid sequence of a highly conserved amino acid motif found within all of the Msp genes of T. p. pallidum is set forth in SEQ ID N0:32.
The nucleic acid sequence encoding the conserved amino acid sequence motif disclosed in SEQ D7 N0:32 is set forth in SEQ m N0:33.
The nucleic acid sequences of cloned T. p. pertem,~e Msp genes, and the proteins encoded by the T. p. pertenue Msp genes, are disclosed in the following sequence listing entries: T. p. pertenue Msp homologue 1 (SEQ m N0:34), Msp 3 5 homologue 1 protein (SEQ m N0:3 5); T. p. pertenue Msp homologue 2 (SEQ DJ

_'j_ N0:36), Msp homologue 2 protein (SEQ ID N0:37); T. p. perterrue Msp homologue 3 (SEQ ID N0:38), Msp homologue 3 protein (SEQ ID N0:39); T. p. pertenue Msp homologue 4 (SEQ ID N0:40}, Msp homologue 4 protein (SEQ 117 N0:41). The amino acid sequence of a highly conserved amino acid motif found within all of the Msp genes of T. p. pertenue is set forth in SEQ ID N0:42.
The nucleic acid sequences of a cloned T. p. pallidum Msp gene (T.P. 1.6) is disclosed in SEQ Zi7 N0:43, and the protein encoded by the nucleic acid sequence disclosed in SEQ ID N0:43 is disclosed in SEQ ID N0:44. SEQ ID N0:45 shows the nucleotide sequence of a subportion of the T.P. 1.6 DNA fragment (SEQ ID
N0:43) that was expressed to obtain a polypeptide (SEQ m N0:46) to be tested for e~cacy in eliciting a protective immune response against T. p. pallidum (see Example 10). SEQ ID N0:47 shows a highly conserved motif present in the amino acid sequence of SEQ ID N0:43.
Detailed Description of the Preferred Embodiment This invention relates to isolated nucleic acids, polypeptides and methods that are useful for preparing vaccines to protect against infection by Treponema spp., particularly Trepo»ema pallidum subspecies pallidum, Trepo»ema pallidum subspecies pertenue, and Treponema pallidum, subspecies e»demicum. As used here, the term "isolated" refers to a biological molecule that is separated from its natural milieu, i.e., from the organism or environment in which it is normally presenT. In certain embodiments, the invention provides isolated polypeptides capable of inducing a protective immunologic response to T. p. pallidum, T. p. pertenue, and T. p. endemicum when administered in an effective amount to an animal hosT.
Preferred embodiments of such polypeptides include those whose amino acid sequences are shown in SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 23, 25, 27, 29, 31, 32, 35, 37, 39, 41, 42, 44 and 46. The invention provides representative examples of nucleic acid molecules capable of encoding these polypeptides in SEQ ID
NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 22, 24, 26, 28, 30, 33, 34, 36, 38, 40, 43 and 45.
Isolated polypeptides and nucleic acids according to the invention maybe prepared by use of recombinant DNA techniques, or may be synthesized using widely available technology. The use of recombinant methods to prepare the subject vaccines provides the advantage that the immunogenic components of the vaccines can thus be prepared in substantially purified form free from undesired contaminants.

WO 99/53099 PCT/US99/0'7886 _g_ The invention, in one aspect, provides isolated nucleic acids capable of encoding the polypeptides whose amino acid sequences are disclosed herein.
In another aspect, the invention provides a nucleic acid molecule (SEQ m NO:1) encoding a newly identified T. p. pallidum protein (SEQ m N0:2) that has glycerophosphodiester phosphodiesterase activity (Gpd), and functional equivalents thereof. Also encompassed by the present invention is a polypeptide encoded by the nucleic acid of (SEQ m NO:1), and whose amino acid sequence is shown in (SEQ m N0:2). The term "functional equivalent," as used herein, is intended to include all immunogenically active substances capable of evoking an immune response in animals, including humans, to which the equivalent polypeptide or nucleic acid has been administered, wherein the resulting antibody has immunologic reactivity with the indicated polypeptide. Thus, equivalents of T. p. pallidum Gpd {SEQ m N0:2) may include mutant or recombinantly modified forms of the protein, or subportions of the Gpd molecule that retain sufixcient epitopic similarity to the native protein (SEQ m N0:2) to evoke an antibody response similar to that evoked by the epitope when present in the native protein.
The invention further provides nucleic acids (such as that shown in SEQ m N0:3) that encode a protein that has significant homology both with the D15 protein previously identified in H. influenzae and with the Oma87 protein previously identified in Pasteurella multocida. This T. p. pallidum protein hereafter is referred to as the "D 15/Oma87 homologue"), and its amino acid sequence is shown in SEQ

N0:4. Provided also is the nucleic acid molecule shown in SEQ B7 NO:S, which encodes a subportion of the amino acid sequence shown in SEQ m N0:4. The polypeptide encoded by the nucleic acid molecule of SEQ m NO:S encodes the polypeptide of SEQ m N0:6, which is useful as a vaccine against syphilis. The invention encompasses the D15/Oma87 polypeptides whose amino acid sequences are shown in SEQ B7 N0:4 and SEQ m N0:6, and functional equivalents thereof.
In other aspects of the invention, SEQ D7 NOS:7, 9, 11, 13, 15, 17, 19, 22, 24, 26, 28 and 30 depict nucleic acids encoding portions of 12 different T. p.
pallidum polypeptides (having amino acid sequences set forth in SEQ )I? NOS:B, 10, 12, 14, 16, 18, 20, 21, 23, 25, 27, 29 and 31) that have homology with the previously described major sheath protein of T. denticola. These T. p. pallidum Msp homologues hereafter are referred to as "T. p. pallidum Msp proteins (or "homologues" or polypeptides)," whether the reference is to the full-length protein, or to a subportion of the protein. The invention therefore provides the polypeptides having the amino acid sequences shown in SEQ m NOS:B, 10, 12, 14, 16, 18, 20, 21, 23, 25, 27, 29 and 31, and functional equivalents thereof.
The terminology used for the T. p. pallidum genome project (posted at http://utmmg.med.uth.tmc.edu/treponema/docs/update.html) refers to the Msp genes as "treponemal pallidum repeats" rather than "Msp" genes, and designates them as "TPR A L". The nomenclature used herein refers instead to Tpr A L as Msp 1-Msp 12. Msps 1-12 correspond, respectively, to Tgr G, F, E, D, C, B, A, L, K, J, I and H. The full-length open reading frames for these 12 genes, according to the present version of the T. p. pallidum genome project, encode proteins of the following sizes: Msp 1, 756 amino acids; Msp 2, 364 amino acids; Msp 3, 762 amino acids; Msp 4, 598 amino acids; Msp 5, 598 amino acids; Msp 6, 644 amino acids;
Msp 7 (ORF A), 253 amino acids; Msp 7 (ORF B), 389 amino acids; Msp 8, 443 amino acids, Msp 9, 480 amino acids; Msp 10, 758 amino acids; Msp 11, 609 amino acids; Msp 12, 693 amino acids.
All of the T. p. pallidum Msp homologues contain a highly conserved peptide motif encoded by the nucleic acid molecule whose nucleotide sequence is shown in SEQ ID N0:33, and whose amino acid sequence is shown in SEQ ID N0:32. In view of its high degree of conservation, this conserved peptide (SEQ m N0:32) may be important in eliciting antibodies that will cross-react with all of the T.
p. pallidum Msps.
To facilitate the expression of useful amounts of T. p. pallidum Msp proteins, the invention further provides the PCR primers shown in Table 1, in which "S"
indicates the sense primer, and "AS" indicates the primer binding to the opposite strand, i.e., the antisense primer.

WO 99/53099 PC'fNS99/07886 aN
o ~- z a °z~
w ~o ~, z A~~
i~ O f~ ~ N M
00 °
o °z °z °z °z z E~ ~ ~ ~ o, w w w w w ~-~ z ~ ~o r oo a~
~n O N cri °z oo ° zz o z o a z z b ~ ~, a~ w w z w .w~.,W ~ w x w v _~ H H d a ~ H ~ w c7 d ~ ~ H H ~ U
d U
V ~ U d E.., ~ U ~ ~ H H H
N ~ ~ ~ V ~ ~ ~ U C~7 U ~ H ~ d d d ~ H H
U ~ C7 d E.., ~ E.~., ~ E-r C7 ~ H
U ~ ~ ~ d ~ U
'c U ~ H ~ U d CH7 H d H E.., ~ t7 d ~ d H
U ~ E-' ~ ~ ~ ~ ~ C~'~ E~-r ~ ~ H~
U ~ ~ U E~-~ ~ ~ ~ Ed-~ U ~ EU
w v, ~n U d U E-~ U U d U U C7 a .-W O ~D I~ n o0 0o Ov Cv N N
d ~-r N c~1 d' ~1 ~D

Each of the primer pairs in Table 1 can be used to specifically amplify a portion of the T. p. pallidum Msp genes) as indicated in the last column of the table.
In addition, the invention provides a PCR primer pair having the following nucleotide sequences: 5'-ACCAGTCCTTCCTGTGTGGTTAA (sense) (SEQ m N0:60), and 5'-ACTCCTTGGTTAGATAGGTAGCTC (antisense) (SEQ » N0:61).
This primer pair is useful for amplifying not only one of the Msp genes of T. p. pallidum, i.e., TP 1.6 (SEQ m N0:43), but also for amplifying a portion of at least four different T. p. pertenue Msp genes, thus defining four genes in the T. p. pertenue genome that are highly related to the T. p. pallidum Msp gene family, and that are encompassed by the present invention. These four amplified T. p. pertenue Msp DNA fragments have the nucleotide sequences shown in SEQ B7 NOS:34, 36, 38 and 40, and the predicted amino acid sequences translated from these four amplicons are shown, respectively, in SEQ m NOS:35, 37, 39 and 41. Three of these amplicons (SEQ D7 NOS:36, 38 and 40) contain the same number of nucleotides, but differ somewhat in nucleotide sequence, thus appear to represent fragments from different Msp homologues.
The primer pairs shown in Table 1 as well as the primer pair 5'-ACCAGTCCTTCCTGTGTGGTTAA (sense) (SEQ m N0:60), and 5'-ACTCCTTGGTTAGATAGGTAGCTC (antisense) (SEQ m N0:61) can be used in accord with this invention to amplify portions of the T. p. pallidum genome. The resulting amplified DNA (amplicons) can be expressed as recombinant proteins in E. coli or another suitable host, and the recombinant proteins thus derived used to formulate vaccines useful for eliciting a protective immune response against syphilis, yaws, bejel, or other treponemal diseases. For example, the primers designated as "Set 1" in Table 1 are useful for amplifying portions of at least three Msp genes found in the genome of T. p. perterrue, and three Msp genes in the genome of T. p. endemicum (Example 7).
In addition to the aforementioned nucleic acids, PCR primers and polypeptides, the invention provides two novel methods for identifying T. p.
pallidum proteins useful as vaccine candidates. The first of these methods involves the identification of T. p. pallidum proteins that are immunologically reactive with an opsonizing serum against T. p. pallidum but that are immunologically unreactive with a non-opsonizing serum (Stebeck et al., FEMS Microbiol. Lett., 154:303-310, 1997).
Such proteins are likely to elicit protective immunity, hence are vaccine candidates, i.e., useful for vaccine trials and for eventual inclusion in a vaccine.
Vaccine candidates are tested in a suitable host, i.e., one susceptible to infection with T. p. pallidum, for their ability to elicit an immune response that is protective against challenge by this organism. Rabbits, for example, can provide a suitable host for this purpose. Proteins that prove to be capable of eliciting such an immune response are determined to be vaccine candidates. This method for selecting vaccine candidates can be applied to identify polypeptides capable of eliciting a protective immune response against yaws, bejel, or any other disease caused by a subspecies of T. p~allidum that is susceptible to opsonizing antibodies.
The rationale for the above-described strategy for obtaining vaccine candidates is that opsonizing antibodies are known to be involved in treponeme clearance during primary syphilis, thus a vaccine containing antigens capable of eliciting opsonizing antibodies should produce resistance or immunity against infection with T. p. pallidum. The disclosed method for identifying T. p.
pallidum proteins that are targets for opsonizing antibody requires the use of both opsonic and non opsonic antisera. One means of preparing opsonic serum is to use the rabbit model system. To prepare opsonic rabbit serum (ORS) using this system, serum from rabbits infected with T. p. pallidum is adsorbed to remove activity against the major known treponemal antigens, none of which is capable of eliciting protective immunity.
Opsonic activity can be assessed by applying the rabbit macrophage phagocytosis assay (Lukehart and Miller, J. Immunol., 121:2014-2024, 1978). Non opsonic rabbit serum (HORS) can be derived from rabbits injected with heat-killed T. p.
pallidum.
To obtain clones corresponding to proteins that are targets for ORS, an expression library is constructed from T. p. pallidum genomic DNA, and the proteins thereby expressed are screened using both ORS and NORS. Plaques that interact with ORS
but not with NORS are isolated and the proteins they express are tested to determine whether they are capable of eliciting protective immunity in a susceptible hosT. In the representative examples given below, the application of this method has identified three different T. p. pallidum proteins, the above-described Gpd (four independent clones), the D 15/Oma87 homologue, and one member of the T. p. pallidum Msp family. Because of the method by which they were obtained, each of these three proteins appears to be a target for opsonizing antibodies, and all three likely are to be exposed on the surface of T. p. pallidum cells and capable if included in a vaccine of eliciting a protective immune response against syphilis.
Prior efforts to identify the potential targets of opsonic antibody have focused primarily on direct isolation of these proteins from the syphilis bacteria themselves.

However, such efforts have been hampered because the T. p. pallidum outer membrane is extremely fragile and has a relatively low number of surface proteins (Walker et al., J. Bacteriol., 171:5005-5011, 1989; Radolf et al., Proc. Natl.
AcaaL
Sci., 86:2051-2055, 1989 The invention further provides another method for obtaining vaccine candidates that involves identifying proteins that are expressed by genes that are present in the genome of T. p. pallidum but that are not present in the genome of the closely related treponeme, T. paraluiscuniculi, a pathogen that causes syphilis in rabbits but that does not infect humans. The genes thus isolated are presumed to IO provide some function that enables T. p. pallidum to infect human cells.
Accordingly, genes present in T. p. pallidum but absent from T. paraluiscuniculi are considered to be effective as a vaccine for syphilis, because antibodies directed against them are expected to protect against infection by T. p. pallidum. This method is applicable for identifying pathogenicity-related genes present in the genomes of other treponemes I S that infect humans but not rabbits, e.g., the genomes of T. p. pertenue and T. p. endemicum.
Genes identified by either of the aforementioned methods are tested to determine whether their gene products are capable of eliciting in an animal host an immune response that is protective against challenge with T. p. pallidum. This test 20 may be performed by any convenient means, for example, by inoculating rabbits intradermally or intramuscularly according to standard immunologic procedures with the protein being tested, then challenging the rabbit with a dose of T. p.
pallidum that is capable of causing syphilis in an uninoculated rabbiT.
One means for identif5ang proteins present in subspecies of T. pallidum but 25 absent from T. paraluiscuniculi is to use representation difference analysis (RDA), a PCR based technique that selectively amplifies nucleic acid molecules that are present in one population of nucleic acids but absent from another. This method is effective using DNA from any subspecies of T. pallidum, including T. p. pallidum, T. p. pertenue, and T. P. endemicum. In the study described in Example 5, RDA
was 30 used to obtain clones that permitted the isolation of a fragment of DNA, called herein "TP 1.6," (SEQ ID N0:43) that was found to be unique to the T. p. pallidum genome. The protein encoded by the nucleotide sequence shown in SEQ m N0:43 is set out in SEQ m N0:44. Both are included within the scope of this invention.
Sequence analysis of TP 1.6 (SEQ m N0:44) indicated that it shared a significant 35 degree of homology with Mspl (SEQ m N0:8) and Msp2 (SEQ m NO:10) of the T. p. pallidum Msp gene family. It should be noted that another member of the Msp family, Msp 9 (SEQ ID N0:25), was also identified as described above by virtue of its specific reactivity with opsonizing antibody against T. p. pallidum. Thus, members of the T. p. pallidum Msp family have been identified by two independent methods designed for isolating syphilis vaccine candidates.
Experiments using the rabbit model system have borne out the expectation that the T. p. pallidum proteins reactive with ORS but not NORS are capable of eliciting antibodies that protect against T. p. pallidum (see Example 10).
Accordingly, the subject invention provides a vaccine that includes a physiologically acceptable carrier together with an effective amount of an isolated T. p.
pallidum polypeptide capable of inducing a protective immunologic response to T. p.
pallidum when administered to a suitable host, the isolated polypeptide being immunologically reactive with an opsonizing serum against T. p. pallidum but immunologically unreactive with a non-opsonizing serum against T. p. pallidum.
A rabbit model was used to test the capacity of these newly identified T. p. pallidum proteins to elicit protective immunity against T. p. pallidum because proteins that elicit protective immunity in rabbits are expected to have a similar effect in humans. This is because the clinical course of the disease is similar in both hosts and also because the range of antibody reactivities, measured by immunoblot, appears to be the same in both rabbits and humans following infection with T. p.
pallidum.
For example, in both hosts, reactive IgM becomes detectable within days after the appearance of clinical disease, and declines after clearance, while IgG
responses rise somewhat later, peak at about the time of clearance, and persist for a long period thereafter at relatively high levels (e.g., see Baker-Zander et al., .I. InfecT. Dis., 151:264-272, 1985; Baker-Zander et al., Sex. Traps. Dis., 13:214-220, 1986; Lukehart et al., Sex Traps. Dis., 13:9-15, 1986). Moreover, these same studies indicated that antibodies directed against many of the same antigenic proteins appeared in both hosts during corresponding stages of the disease. These observations demonstrate that the human immune system sees basically the same antigens for this pathogen as seen by the rabbit immune system, and that both hosts' immune systems attack the pathogen in a similar fashion. Similarly, rabbits are a suitable animal model for testing the efficacy of yaws or bejel vaccines prepared according to the above-discussed methods.
The present studies confirm that the rabbit and human immune systems respond similarly to infection with T. p. pallidum. Sera from rabbits infected with T. p. pallidum, Nichols strain, or from human syphilis patients infected with unknown strains both were observed here to contain antibodies against several members of the Msp family, and both exhibited especially high levels of activity against Msp 9 (SEQ
ID N0:25) and the D15/Oma87 homologue (SEQ ID N0:4). Moreover, immune rabbit serum (IRS) was observed to react with Gpd (SEQ ID N0:2).
As detailed in Example 10, T. p. pallidum proteins to be tested in rabbits for their protective capacity were expressed in E. coli, and the corresponding recombinant molecules were purified and used as immunizing antigens. In all cases, rabbits were immunized three times with 200 ~tg of the recombinant antigen.
The rabbits were subsequently challenged with 103 or 103 T. p. pallidum at multiple dernial sites three weeks after the last boost, and lesion development was monitored by comparison to a control group of rabbits that had received no immunization prior to challenge. Typical red, indurated ulcerating lesions appeared in the control unimmunized animals at days 5-7 post-challenge in animals that had received lOs treponemes, or at days 12 to 14 post-challenge for animals that had received treponemes (Gpd challengers). The rabbits immunized with four of the Msp proteins were protected from challenge and did not exhibit typical development of progressive lesions at the corresponding time points. The mild lesions that did develop in the immunized rabbits healed very quickly compared to control animals, and T. p. pallidum could not be detected by darkfield analysis in most of these atypical lesions.
The term "vaccine" as used herein is understood to refer to a composition capable of evoking a specific immunologic response that enables the recipient to resist or overcome infection when compared with individuals that did not receive the vaccine. Thus, the immunization according to the present invention is a process of causing increased or complete resistance to infection with Treponema species.
The vaccines of the present invention involve the administration of an immunologically effective amount of one or more of the polypeptides described above, i.e., the entire proteins, or a functional equivalent thereof, in combination with a physiologically acceptable carrier. This carrier may be any carrier or vehicle usually employed in the preparation of vaccines, e.g., a diluent, a suspending agent, an adjuvant, or other similar carrier. Preferably, the vaccine will include an adjuvant in order to increase the immunogenicity of the vaccine preparation. For example, the adjuvant may be selected from Freund's complete or incomplete adjuvant, aluminum hydroxide, a saponin, a muramyl dipeptide, an immune-stimulating complex (ISCOM) and an oil, such as vegetable oil, or a mineral oil, though other adjuvants may be.used as well.
In another aspect of the invention, the immunogenicity of the immunogenic protein may be coupled to a macromolecular carrier, usually a non-toxic biologically compatible polysaccharide or protein, e.g., bovine serum albumin.
One route by which the syphilis treponemes can enter the body is through the mucosal membranes, thus an effective vaccine optimally will prime the immune response at mucosal surfaces to recognize T. p. pallidum. Strategies that may be used to administer the subject vaccines in order to elicit a mucosal immune response include using E. coli heat labile enterotoxin as an adjuvant, expression of immunogenic antigens by plasmids carried in attenuated Salmonella spp., microsphere or liposome delivery vehicles, ISCOMS, or naked DNA encoding antigenic proteins (Staats et al., Curr. Opin. Imm~nol., 6:572-583, 1994). DNA vaccines stimulate strong CTL responses, as well as helper T cell and B cell responses. Since CTL
are known to be present in syphilis primary and secondary lesions, and since infection with T. p. pallidum itself is known to be associated with the generation of protective immunity, a DNA vaccine thus is a preferred embodiment of the subject vaccine compositions.
In a further aspect of the invention, genes encoding the vaccine polypeptides of the present invention may be inserted into the genome of a non-pathogenic organism to provide a live vaccine for administration of the vaccines of the subject invention. For example recombinant vaccinia viruses have been employed for this purpose, as well as attenuated Salmonella spp. Efficient vaccines can be prepared by inserting a variety of immunogenic genes into the same live vaccine, thus providing immunity against several different diseases in a single vaccine vehicle, e.g., a vaccine against many different sexually transmitted diseases. A particularly advantageous live vaccine is one that is engineered to express one or more of the subject immunogens on the outer surface of the bacteria expressing the vaccine proteins, thus maximizing the recipient's exposure to the immunogens in an orientation likely to resemble that found in the treponemal pathogen, thereby eliciting an appropriate immune response.
The amount of immunogenically effective component used in the vaccine will of course vary, depending on the age and weight of the vaccine recipient, as well as the immunogenicity of the particular vaccine componenT. For most purposes, a suitable dose will be in the range of l-1000 wg of each immunogen, and more preferably, 5-500 wg of each immunogen.

The present invention provides vaccines that include the T. p. pallidum glycerophosphodiester phosphodiesterase, D15/Oma87 homologue, and the members of the Msp family, each to be administered alone or in various combinations in amounts su~cient to induce a protective immunologic response to infection by T. p. pallidum in a host animal that is normally susceptible to syphilis. It is understood that the vaccine of the subject invention may contain one or more of the aforementioned proteins, as well as additional T. p. pallidum proteins identified by the above described methods. For example, the vaccine may include T. p. pallidum glycerophosphodiester phosphodiesterase in combination with one or more of the Msps, or may include in addition the D 15/Oma87 homologue.
With regards to the T. p. pallidum glycerophosphodiester phosphodiesterase, this may be provided by expressing in a suitable expression vector system a nucleic acid having the nucleotide sequence shown in SEQ 117 NO:1. The isolated T. p. pallidum D15/Oma87 homologue may be obtained by expressing in a suitable vector system a nucleic acid molecule having the nucleotide sequence shown in SEQ
ID N0:4. The isolated T. p. pr~llidum Msp may be derived by expressing in a suitable vector the full-length T. p. pallidum Msp genes, as their positions in the genome are now known, or alternatively, may be derived by PCR from the variable portions of the Msp genes, as set out in the Examples below. The variable regions of Msps 1, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 are shown in SEQ D7 NOS:7, 11, 13, 15, 17, 19, 22, 24, 26, 28 and 30, respectively, and polypeptides corresponding to these sequences can be obtained by standard recombinant technology, i.e., by expression in a suitable bacterium, yeast, or other expression system. Alternatively, the Msp polypeptide for use in a vaccine of the subject invention may be provided by the nucleic acid molecules shown in SEQ ID N0:43 or SEQ ID N0:45, or their polypeptide products, shown in SEQ ID N0:44 and SEQ ID N0:46, respectively. In one embodiment of the invention, the vaccine includes several different Msps or may even include all of the Msps. In a preferred embodiment, the vaccine includes Msps 2 (SEQ ID
NO:10), 9 (SEQ ID N0:25) and 11 (SEQ ID N0:29). In other embodiments of the invention, the vaccine may consist of a polypeptide that includes both conserved and variable regions of one or more Msps. For vaccines including the D15/Oma87 homologue, this may be provided by expressing in a suitable host a nucleic acid molecule having the nucleotide sequence as shown in SEQ ID N0:3 or SEQ ID NO:S.
In addition to vaccines for T. p. pallidum, the present invention provides vaccines to protect against yaws, which is caused by the treponeme T. p.
pertetrue.

This vaccine contains an effective amount of at least one isolated Msp capable of inducing a protective immunologic response when administered to a suitable host; and a physiologically acceptable carver as described above. The yaws vaccine includes one or more Msp homologues derived from the T. p. pertertue genome, and may be obtained in isolated form by expressing in a suitable vector one of the nucleic acid sequences shown in SEQ 117 NOS:34, 36, 38 or 40. Other polypeptides useful for yaws vaccines may be identified by applying the RDA method described in Example 5, wherein T. p. pertenue DNA is used as tester DNA. Similarly, polypeptides for a bejel vaccine can be identified by using T. p. endemicum DNA as tester. The efficacy of polypeptides so identified can be tested for their ability to elicit protective immunity by using a rabbit model as described in Example 10 for testing syphilis vaccine candidates.
The invention further encompasses vaccines against bejel, the disease caused by Treponema pallidum subspecies endemicum, and pints, caused by Treponema carateum. T. p. pallidum and T. p. pertenue, the causative agents of jaws and bejel both contain Msp genes related to those present in T. p. pallidum, by analogy, the closely related T. carateum must also contain Msp genes useful for vaccines, and these can be identified and isolated according to the methods disclosed herein. In a further aspect, the invention provides vaccines that provide protective immunity against the T. p. pallidum-related treponemes that cause gingivitis and periodontal disease. The Msp genes of the oral pathogen treponemes are amplified using the primers disclosed herein (e.g., the primers of Table 1), and polypeptides expressed from the resulting amplicons are expressed and tested for their capacity to elicit protective immunity in a suitable animal host.
The subject invention includes methods of inducing a protective immune response against T. p. pallidum that involve administering to a susceptible host an effective amount of any of the aforementioned treponemal vaccines, e.g., the polypeptides whose amino acid sequences are shown in SEQ >D N0:2, SEQ >l7 N0:4, SEQ >D N0:6, SEQ >D NOS:B, 10, 12, 14, 16, 18, 20, 21, 23, 25, 27, 29 and 31, or any polypeptide whose coding region is amplifiable by one or more of the primer pairs of Table 1, or the primer pair 5'-ACCAGTCCTTCCTGTGTGGTTAA 3' (sense) (SEQ m N0:60) and 5'-ACTCCTTGGTTAGATAGGTAGCTC-3' (antisense) (SEQ m N0:61), or functional equivalents thereof. The vaccines may be administered by any of the methods well known to those skilled in the art, e.g., by intramuscular, subcutaneous, intraperitoneal, intravenous injection, orally, or intranasally. Naked DNA encoding the treponemal antigen or the treponemal polypeptide itself may be administered.
The invention further provides a PCR based method for analyzing a sample of treponemal genomic DNA to determine whether it originated from T. p.
subspecies pallidum, T. p. subspecies pertenue or T. p. subspecies e»demicum. To carry out this method, DNA is isolated from the treponeme whose identity is at issue, or Chancre DNA is isolated, and this DNA is amplified using the PCR sense primer 5'-ACCAGTCCTTCCTGTGTGGTTAA 3' (SEQ ID N0:60) and antisense primer 5'-ACTCCTTGGTTAGATAGGTAGCTC-3' (SEQ 117 N0:61), and the size of the resulting DNA fragments, e.g., by gel electrophoresis, or by some other method. It is determined that the treponemal genomic DNA originated from T. p. pallidum if the size analysis of the restriction products reveals a single DNA
fragment having a size of about 1.7 kb, or that the treponemal genomic DNA
originated from T. p. subspecies pertenue if at least two DNA fragments having sizes of about 1.7 and 1.3 kb are detected instead. If no DNA fragments result from amplification using this pair of primers, the treponeme DNA is determined to have originated from T. p. subspecies endemicum. Thus, when a patient presents with a primary lesion that appears to be caused by a treponemal infection, this test can be applied to quickly determine whether the patient suffers from syphilis, yaws, or bejel.
It is disclosed herein that sufficient variation exists within the Msp gene family among various clinical isolates of T. p. pallidum such that restriction fragment length polymorphism (RFLP) analysis can be used to differentiate the clinical isolates, thus providing a useful means for epidemiologic monitoring of cases of syphilis.
The invention provides a method of RFLP analysis for determining whether clinical isolates of T. p. pallidum from different syphilis patients are the same or differenT.
This method utilizes PCR to amplify samples of genomic DNA from the clinical isolates, followed by restriction digestion and subsequent length analysis of the resulting DNA fragments. In an illustrative example of this technique, the variable domains of six alleles of the Msp gene family were amplified using the following primers that bind to two short conserved regions that flank a highly variable region within the central portion of several members of the Msp family (see Example 7). The nucleotide sequences of the primers used in this example were 5'-CGACTCACCCTCGAACCA 3' (sense) (SEQ ID N0:48), and 5'-GGTGAGCAGGTGGGTGTAG 3' (antisense) (SEQ ID N0:49). After amplification of the highly variable region using these primers or other primers that amplify this same DNA region, the amplified DNA is digested with one or more restriction endonucleases that recognize a four-base cleavage site, and the resulting restriction fragments are anaiyzed on a gel.
Experimental results presented below in Example 7 have indicated that the high degree of variability observed in the RFLPs thus obtained is sufficient to distinguish many different individual isolates of T. p. pallia~um. In a preferred embodiment, the restriction endonucleases used for differentiating individual isolates of T. p. pallidum are BstUI, AIuI, HhaI and NTaIII, as these enzymes yielded distinct patterns among 18 tested T. p. pallidum strains. The RFLP method described here can be applied to clinical specimens without any need for the technically difficult and expensive isolation of the organism prior to analysis. Because aggressive contact tracing is relatively effective in the control of syphilis outbreaks, this method can provide a means for a public health entity to be able to identify a single strain of T. p. pallidum as responsible for a high proportion of incident cases versus the multiple strains causing a background level of syphilis in a community, or to trace the parties involved in spreading clusters of the disease.
Moreover, these same PCR primers were found also to amplify DNA
segments from both T. p. pertenue and T. p. endemicum (Example 7). Digestion of these amplified DNAs with restriction enzymes has yielded distinctive patterns that are sufficiently different from the patterns seen for T. p. pallidum to provide a diagnostic test for differentiating these three subspecies of T. p. pallidurn.
Also included in the invention is the nucleic acid molecule whose nucleotide sequence is shown in SEQ ID N0:45, and the polypeptide it encodes which is shown in SEQ ID N0:46. This polypeptide represents the amino terminal portion of the TP 1.6-encoded polypeptide (SEQ ID N0:44) that is described in Example 5, and the portion of the TP 1.6 polypeptide shown in SEQ 117 N0:46 matches a portion of Msp 2 (SEQ ll7 NO:10). It is notable that Msp 2 (SEQ B7 NO:10) lacks a variable region, yet vaccine testing with the polypeptide shown in SEQ ID N0:46 provided protective immunity in rabbits, thus indicating that conserved as well as variable region epitopes of Msp proteins are useful in vaccine compositions.
The invention is further explained by reference to the following examples.
Example 1. Production of Antisera Immune rabbit serum (IRS):

For IRS, antiserum was prepared from rabbits that had been injected with live infectious T. p. pallidum. Sera were collected at various times following infection, and were pooled.
Adsorbed opsonic antiserum (ORS):
Two rabbits infected with T. p. pallidum (Nichols strain) for three months were boosted intraderrnally and intraperitoneally with 2 x 108 T. pallidum one month prior to blood collection. Sera from the two animals were pooled and shown to have opsonic activity. The antisenim was sequentially adsorbed with the following antigens that do not induce opsonizing antibodies or have been shown not to elicit immune protection against syphilis: T. phargedenis, biotype Reiter (Lukehart, S.A., et al., J. Immurtol., 129:833-838, 1982), recombinant 47, 37, 34.5, 33, 30, 17 and 15 kDa molecules (Morris et al., Electrophoresis, 8:77-92, 1987) expressed as maltose-binding protein-fusion peptides in the pMAL system (New England Biolabs, Beverly, MA) and recombinant TROMP 1 (Blanco et al., f Bacteriol., 177:3556-3562, 1995) expressed as a glutathione-S-transferase-fusion peptide (Pharmacia, Piscataway, Nn.
The antiserum was further adsorbed with Venereal Disease Research Laboratory (VDRL) antigen, a lipid complex that has been shown to be the target of some opsonic antibodies (Baker-Zander et al., J. InfecT. Dis , 167:1100-1105, 1993).
These adsorption steps were performed to reduce the number of irrelevant positive clones identified by this antiserum in the expression library screening.
Adsorption was repeated until no antibody reactivity against the adsorbents could be demonstrated by immunofluorescence (Reiter treponeme), immunoblot analysis (recombinant antigens) or serological testing (VDRL). The final antiserum retained significant opsonic activity as measured by our rabbit macrophage phagocytosis assay (Lukehart and Miller, J. Immunol., 121:2014-2024, 1978). This absorbed antiserum is herea8er termed "opsoruc antiserum," or "ORS."
Non-opsonic antiserum (HORS):
Non-opsonic antiserum was prepared by immunization of a seronegative rabbit with 6 x 10' T. p. pallidum, Nichols strain, that had been heated at 63°C for 1 h, followed by two boosts of 2-8 x 10' heat-killed organisms. All immunizations were performed using incomplete Freund's adjuvanT. The resulting antiserum was weakly reactive in the VDRL test, 4+ reactive at 1:1000 dilution in the FTA-ABS test, and non-opsonic in the phagocytosis assay. This antiserum is hereafter termed "non-opsonic antiserum," or "HORS."

Anti-E. coli antibodies present in the opsonic and non-opsonic antisera were removed using standard techniques (Sambrook et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989, which is hereby incorporated by reference in its entirety).
Briefly, eight nitrocellulose filters were incubated with an E. coli lysate prepared from 50 ml of OD 1.0 bacteria , then air dried. Following blocking of non-specific sites, four of the E. coli lysate-impregnated filters were incubated with the antiserum.
A T. p. pallidum lysate was subjected to SDS-PAGE and the separated proteins were tested by immunoblot analysis for reactivity with the T.
pallidum specific ORS. Total T. pallidum lysate was separated by SDS-PAGE, immunoblotted onto nitrocellulose, and exposed to ORS that had not yet been adsorbed, to post-adsorption ORS, or to NORS. Results of these analyses indicated that fifteen molecules with approximate molecular masses of 70, 68, 60, 55, 45, 43, 41, 39, 38, 35, 33, 32, 31, 29 and 13 kDa reacted with the adsorbed ORS. Of these fifteen, those with approximate sizes of 68, 43, 41, 39, 38, 35, 31 and 29 kDa exhibited minimal immunoreactivity with the non-opsonic antiserum, thus seemed likely to encode proteins exposed on the surface of T. pallidum.
Example 2. Construction and Screening with ORS of a T. ,pallidum Expression Library Rabbit macrophages have been shown to efficiently phagocytize T. p. pallidum in vitro using antiserum from T. p. pallidum-infected rabbits, i.e., IRS
as a source of opsonizing antibody (Lukehart and Nlller, J. Immunol., 121:2014-2024, 1978; Baker-Zander and Lukehart, J. InfecT. Dis., 165:69-74, 1992). In contrast, antiserum from rabbits immunized with heat-killed T. p. pallidum fails to opsonize. In addition to its opsonic potential, IRS has been shown to block T. p. pallidum adherence to host cells (Fitzgerald et al., InfecT. Immun., 18:467-478, 1975; Fitzgerald et al., InfecT. Immun., 11:1133-1145, 1975; Hayes et al., InfecT. Immun., 17:174-186, 1977; Wong et al., Br. J Yener. Dis., 59:220-224, 1983) and to provide partial protection against T. p. pallidum infection in passive transfer experiments (Sepetjuan et al., Br. .I. Yener. Dis., 49:335-337, 1973;
Perine et al., InfecT. Immun., 8:787-790, 1973; Turner et al., Johns Hopkins Med J., 133:241-251, 1973; Bishop and Miller, J. Immunol., 117:191-196, 1976;
Weiser et aL, InfecT. Immun., 13:1402-1407, 1976; Graves and Alden, Br. f Yener.
Dis., 55:399-403, 1979; Titus and Weiser, J. InfecT. Dis., 140:904-913, 1979).
As a result, antigens exhibiting reactivity with IRS may have additional functional roles in cytoadherence and immune protection.
Collectively, these observations demonstrate the importance of identifying the target antigens of T. pallidum-specific opsonic antibody. Opsonic antibodies generally recognize bacterial peptidoglycan, 3ipopolysaccharide, capsular polysaccharides or proteins, and since T. pallidum does not have an accessible peptidoglycan layer nor does it contain either lipopolysaccharide or capsular material, the opsonic targets are likely to be surface-exposed outer membrane proteins.
To identify potential opsonuc targets, a treponemal genomic expression library was constructed and differentially screened with ORS and NORS that were prepared as described in Example 1. To prepare the library, T. p. pallidum genomic DNA
was isolated from approximately 101° organisms using the QIAamp Tissue Purification Kit (Qiagen, Chatsworth, CA) and a genomic expression library was constructed using the Lambda ZAP~ II/EcoRI/CIAP cloning kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. Briefly, Z pg of T. pallidum genomic DNA were partially digested with Tsp509I and DNA fragments in the size range of 0.5 to 4.0 kb were gel-purified using standard techniques (Sambrook et al., 1989). One hundred and forty nanograms of the size-selected Tsp509I-digested DNA preparation were ligated to EcoRI predigested Lambda ZAP II vector arms and the ligated DNA was packaged using the Gigapack II packaging extract (Stratagene). The resulting bacteriophage library had a titer of 4.7 x 106 pfu/ml.
E. coli XL-1 Blue (Stratagene, La Jolla, CA) was used as the host strain to plate approximately 50,000 plaques (12,500 pfin/plate) using established methods (Sambrook et al., 1989). The plates were incubated for 5.5 h at 37°C, overlaid with 10 mM isopropylthiogalactopyranoside (IPTG~impregnated nitrocellulose filters and incubated for a fiuther 4 h at 37°C. Duplicate lifts were prepared by removing the filters and overlaying the plates with fresh 1PTG impregnated filters prior to a second overnight incubation at 37°C. Filters were washed in Tris-buffered saline with 0.05%
Tween-20 and stored moist at 4°C until the immunoscreening step.
Immunoblot analysis was performed as previously described (Baker-Zander et al., J. InfecT. Dis., 151:264-272, 1985). For SDS-PAGE gels, a 10 kDa protein ladder (Gibco BRL, Gaithersburg, 11~) was included as a standard. Filters were screened according to the manufacturer's instructions (Stratagene's picoBlue' immunoscreening kit). Briefly, blots were blocked with 3% nonfat milk in Tris-buffered saline and exposed to a 1:100 dilution of the anti-T. pallidum ORS
with the primary plaque lifts and a similar dilution of the NORS with the duplicate plaque lifts.
Immunoreactive plaques were detected with 1 ~Ci of 1~I-labeled protein A/nitrocellulose filter using established methods (Sambrook et al., 1989).
Those clones showing reactivity with the opsonic antiserum but no reactivity with the non-opsonic antiserum were subjected to secondary screening with both the opsonic and non-opsonic antiserum. Clones consistently showing differential reactivity were screened yet again with the opsoruc antiserum.
Cloning and sequencing:
Immunoreactive plaques were converted to pBluescript SK(-) phagemids by in vivo excision in the E. coli host strains XL,-1 Blue and SoIR according to the manufacturer's instructions. Both strands of insert DNA were sequenced by a combination of single-stranded and double-stranded DNA sequencing using the Sequenase' Version 2.0 and the Applied Biosystems dye terminator sequencing kits and the ABI 373A DNA sequencer according to the manufacturer's instructions.
In all cases both universal sequencing primers and internal primers designed from DNA
sequences were used.
Results of Screening:
A Lambda ZAP II T. P. pallidum genomic expression library was constructed and screened in duplicate with the ORS as well as with the NORS. Ten clones were identified that were immunoreactive exclusively with the opsonic antiserum. As discussed in more detail in the examples to follow, nucleotide sequence analysis has been performed for six of these clones.
DNA and protein sequence analysis:
Ten clones that specifically reacted with ORS were selected for DNA
sequence analysis. Of these, four proved to encode the same protein (see Example 3), while one encoded a putative outer membrane protein (see Example 4), and the remaining positive encoded one member of a 12-member gene family (see Example 5). Nucleotide sequences were analyzed using the SeqApp' software (Gilbert, D.G. (1992) SeqApp', which is published electronically on the Internet, and which is available via anonymous ftp from ftp.bio.indiana.edu. ILTBio archive of molecular and general biology software and data). Database searches were performed using the basic local alignment search tool (BLAST) algorithm (Altschul et al., J. Mol. Biol., 215:4673-4680, 1990) and either the BLASTN, BLASTX or BLASTP
programs. Alignments of the protein sequences encoded by the clones were performed using the Clustal W general purpose multiple alignment program (Thompson et al., Nucl. Acids Res., 22:4673-4680, I994). The percentage of positional identity and similarity between sequences was calculated from the number of identical or similar residues, respectively, between aligned sequences, but insertions and deletions were not scored. The molecular mass and pI of the translated product were calculated using the MacProMass' v1.05 software (Beckman Research Institute, Duarte, CA). The Prosite' protein motif database was used to access the signal peptidase I and II cleavage sites.
Example 3 T p yallidum~,r ycerophosnhodiester phosphodiesterase (GydO
The ten ORS-specific plaques described in Example 2 were subjected to tertiary screening to obtain well-isolated plaques and to verify positivity.
Analysis of one of these plaques has been reported previously in Stebeck et al., FEMS
Microbiol.
Letters, 154:303-310, 1997, which is hereby incorporated by reference in its entirety.
In vivo excision of the plaque described in Stebeck et al., 1997, produced a pBluescript phagemid containing a 3. S kb inserT. Nucleotide sequence analysis of the 3.5 kb insert revealed a 1071 by open reading frame (SEQ ID NO:1) encoding a 356 amino acid translated. product (SEQ ID N0:2). Sequence analysis of three more of the ten positive plaques described in Example 2 revealed nucleotide sequences encoding this same 41 kDa protein. The polypeptide shown in SEQ ID
N0:2 has a predicted isoelectric point at pH 9.13 and a predicted molecular mass of 41,014 kDa. Putative -35 (TGCACG) and -10 (TATAA) promoter regions and a ribosome binding site (GAGGAG) were noted in the nucleotide sequence encoding this protein, upstream from the ATG initiation codon.
Analysis indicated that the 41 kDa protein of SEQ 117 N0:2 contains a two amino acid signal peptide characteristic of previously identified prokaryotic membrane lipoproteins, including an amino-terminal basic residue, a hydrophobic core and a putative Leu-Val-Ala-Gly-Cys signal peptidase II cleavage site (Hayashi and Wu, J. Bioenerg. Biomembr., 22:451-471, 1990), strongly indicating that this protein itself is a membrane lipoprotein. Another group of investigators using a different gene isolation approach reported the isolation of a gene encoding this same 356 amino acid protein from T. p. pallidum, but reported that the protein was anchored to the periplasmic leaflet rather than being part of the outer membrane. (Shevchenko et al., InfecT. Immun., 65:4179-4189, 1997).
This predicted molecular mass corresponds with that of the 41 kDa-immunoreactive protein described in Example 1 that reacts specifically with ORS
when this antiserum was used to develop Western blots containing treponeme lysates WO 99/53099 PCT/US99/0'7886 (see Example 1). It was shown previously that a 41 kDa protein is among those that can be detected in treponeme lysates analyzed on Western blots with serum from human syphilis patients (Baker-Zander et al., 1985). As described in more detail below, antibody directed against the subject recombinant 41 kDa protein also reacts with a 41 kDa protein present in treponeme lysates, thus this new gene may correspond to the same protein detected with human syphilis patient sera.
Sequence alignment analyses:
Sequence database analysis of the 356 amino acid translated sequence (SEQ
ID N0:2) identified glycerophosphodiester phosphodiesterase (Gpd) from a variety of bacterial species as the optimal scoring protein, the closest match being with the Gpd of Haemophilus inJlue»zae. The T. p. pallidum Gpd homologue (SEQ D7 N0:2) exhibited about 72.2% sequence similarity with the corresponding H. in, fluerrzae protein (Janson et al., InfecT. Immun., 59:119-125, 1991; Munson and Sasaki, .l. Bacteriol, 175:4569-4571, 1993), as well as 70.5% amino acid sequence homology with an E. coli enzyme having the same activity (Tomrnassen et al., Mol. Gerr.
Genet., 226:321-327, 1991). Homology was found also but to a lesser degree, with the Gpds from Borrelia hermsii (58.4%; Schwan et al., .l. Clin. Microbiol., 34:2483-2492, 1996; Shang et al., J. Bacteriol., 179:2238-2246, 1997) and Bacillus subtilis (37.4%) (Nilsson et al., Microbiol., 140:723-730, 1994). The 41 kDa T. p.
pallidum protein (SEQ ID N0:2) is within the range of masses reported for Gpds from other bacterial species, and closely matches the 40-kDa T. pallidum immunoreactive antigen identified by Shang et al. using rabbit anti B. hermsii glycerophosphodiester phosphodiesterase antiserum (Shang et al., J. Bacteriol., 179:2238-2246, 1997).
Taken together, these results indicated that the 356 amino acid translated sequence ZS (SEQ ID N0:2) is a Gpd encoded by T. p. pallidum.
Example 4. Identification of a T. pallidum D 15/Oma 87 homolostue Another of the immunoreactive lambda clones was subjected to nucleotide sequence analysis, and an open reading frame was found by sequencing the portion of the cloned insert fused with the open reading frame of ~i-galactosidase in pBluescripT. The cloned insert was sequenced as described in Example 2, and an open reading frame was identified that gave a 94 kDa protein, whose amino acid sequence is shown in SEQ ID N0:4. A corresponding full length ORF encoding this 94 kDa protein was identified from the T. p. pallidum genome sequence that was released June 24, 1997, by the Institute for Genomic Research (TIGR), although TIGR predicted a different initiating methionine for the D15/Oma87 homologue.

The amino acid sequence predicted from this cloned insert was found to share sequence similarity with the protective surface-exposed outer membrane antigens D15 of H. influenzae (36.3%) (Flack et al., Gene, 156:97-99, 1995) and Oma87 of Pasteurella multocida (35.7%) (Ruffolo and Alder, Infec. Immun., 64:3161-3167, 1996), as well as with outer membrane proteins from Brucella abortus (37.2%, Genbank accession number U51683) and N. gonorrhoeae (35.2%, Genbank accession number U81959). The open reading frame of this clone was subcloned into expression vectors for further analysis.
The T. pallidum D15/Oma87 homologue (SEQ ID N0:4) is predicted to have a type I cleavable signal sequence (using rules devised by von Heinje, et al.
(Nucleic Acids Res., 14:4683-4690, 1986) and McGeoch, et al. (Virus Res., 3:271-286, 1985).
In addition, the protein was shown to have an 85% probability of being an outer membrane protein by the pSORT program which takes into account hydrophobic domains and secondary structure (see http://psort.nibb.ac.jp~. Moreover, the Borrelia burgdorferi homologue of this clone has been identified from the B. burgdorferi genome project (Vugt et al., Nature, 390:580-586, 1997) and has been classified as a probable outer membrane protein.
As described in Example 10, this protein has been expressed in E. coli and the recombinant protein used to immunize rabbits.
Example 5 Identification of a family of T. pallidum maior sheath protein homolo~tue Another of the ORS-reactive clones described in Example 2 was sequenced, and upon analysis the polypeptide it encoded proved to have 41.5% amino acid sequence similarity with the 53 kDa Treponema denticola major outer membrane sheath protein (Msp) (Egli et al., InfecT. Immun., 61:1694-99, 1993) and, as discussed further below, with a T. pallidum sequence deposited in Genbank (50.1%;
Genbank accession number TPU88957, deposited by Hardham et al., Univ. N.
Carolina, and corresponding to TIGR TprK, or Msp9).
Fragments of another gene related to the T. denticola Msp gene were identified by a separate approach using representational difference analysis (RDA), a subtractive hybridization technique in which one compares two populations of nucleic acid molecules to obtain clones of genes that are present in one population but not in the other (Lisitsyn et al., Science, 259:947-950, 1993; Lisitsyn et al., Nature Genetics, 6:57-63, 1994). For RDA, the DNA that contains the genes of interest is called the "tester," and the reference DNA is the "driver." In essence, sequences present in the tester DNA but absent from the driver DNA are selectively amplified by using PCR. In a first annealing step, an excess of driver DNA is hybridized with a small amount of tester DNA. Tester sequences common to both populations are thus selectively driven into tester-driver hybrids, while unique tester sequences will form only tester-tester hybrids. The unique tester-tester hybrid molecules are separated from tester-driver hybrids as follows. Prior to the first hybridization step, short adapter oligonucleotides are ligated to the tester DNA. After the tester DNA
has been hybridized with the driver DNA, the adapter sequences are annealed with PCR
primers that bind to the protruding adapter sequences, and the tester-tester hybrids are thus selectively amplified.
For the experiments described below, the organisms used were T. p. pallidum, Nichols strain, and T. paraluiscuniculi, Cuniculi A strain. After being propagated in New Zealand white rabbits, the bacteria were extracted from infected rabbit testes in sterile saline, collected in DNAse/RNAse-free 1.7 ml microfuge tubes, and spun immediately in a microfuge at 12,000 X G for 30 minutes at 4°C.
Bacterial pellets were resuspended in 200 ~tl of 1X lysis buffer (10 mM Tris pH 8.0, O.1M EDTA, 0.5% SDS), and DNA was extracted using the Qiagen Kit for genomic DNA
extraction (Qiagen Inc., Chatsworth, CA) using the manufacturer's instructions. The DNA was treated with RNAse A. RDA was carried out using the CLONTECH PCR-Select Subtraction Kit (Clontech, Palo Alto, CA) following the manufacturer's protocol beginning from the section describing the restriction digestion step.
For RDA, DNA from T. p. pallidum served as the tester DNA, and a mixture of Treponema paraluiscuniculi (a rabbit pathogen) plus rabbit genomic DNA
served as the driver. T. paraluiscuniculi was used as a driver DNA because this relative of T. p. pallidum, unlike its virulent cousin, cannot infect humans. Thus, it was surmised that genes present in T. p. pallidum but absent from T. paraluiscuniculi would be involved in pathogenicity, and would provide likely candidates for vaccine testing.
Rabbit genomic DNA was included in the driver to remove any traces of rabbit DNA
that co-purified with the bacterial DNA. This same experimental strategy is applicable to the isolation of genes related to pathogenicity in humans from any species or subspecies of Treponema that infects humans but not rabbits. For example, to isolate pathogenicity-related genes from T. p. pertenue or T. p. endemicum using RDA, one would use tester DNA from one or the other of these bacteria and driver DNA
from T. paraluiscuniculi.
Two separate subtraction libraries were created using the above-described tester and driver DNAs. Briefly, 0.5 p,g of T. p. pallidum genomic DNA (tester DNA) and a pool of 3 pg of T. paraluiscuniculi DNA plus 3 pg of rabbit liver DNA
(driver DNA) were digested to completion with Rsa I. The digestion products were purified by the phenol/chloroform/isoamyl alcohol method and the digested tester was then divided into 2 aliquots (tester-1 and tester-2) and each was ligated to one of two adapters that were to serve as binding sites for PCR primers:
Adapter 1. 5'-TAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGG
CAGGT-3' (SEQ ID N0:62) Adapter 2. 5'-GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCG
AGGT-3' (SEQ ID N0:63) These adapters are sufficiently long to accommodate binding with two different sets of primers to permit "nested PCR" as described below. No adapters were ligated to the driver DNA.
For the first hybridization, two aliquots of tester DNA (tester-1 and tester-2) were heat denatured in separate reaction tubes in the presence of an excess of driver and allowed briefly to reanneal. During this time, low abundance DNA fragments that are unique to the tester remained as single-stranded DNA, and common DNA
fragments annealed with the driver to form double stranded DNA.
For the second hybridization step, both of the first hybridization mixtures were pooled and hybridized again with additional excess denatured driver DNA. This second hybridization step permitted further removal of common sequences, and permitted the single-stranded DNA fragments unique to the tester populations to form hybrids with one another, these latter hybrids including tester-tester duplexes having different adaptors at each end, i.e., tester-1/tester-2 duplexes. At this stage, the adapter sequences were single-stranded, forming overhangs at each end of the duplex molecules. These overhangs were filled in with DNA polymerase, yielding unique double-stranded molecules having different primer binding sites on their 5' and 3' ends adaptor sequences. Primary PCR was then used to amplify these unique tester-tester hybrids, using a PCR primer No. 1, which binds to both adaptors 1 and 2, followed by a nested PCR (nested primer l, 5'-TCGAGCGGCCGCCCGGGCAGGT (SEQ ID
N0:64), and nested primer 2, 5'--AGCGTGGTCGCGGCCGAGGT (SEQ D7 N0:65)), to further enrich unique sequences, to reduce the background, and to increase the specificity of the amplification. Secondary PCR products were then cloned directly into the PCR 3.1 T/A cloning vector (Invitrogen, Sorrento, CA), and the cloned inserts subjected to DNA sequence analysis.

For sequencing, single colonies were selected and plasmid DNA was digested with Eco RI to identify the clones containing inserts. Double-stranded plasmid DNA
was extracted with the Qiagen Plasmid Kit (Qiagen, Chatsworth, CA), and 500 ng of each DNA was used for fully automated sequencing by the dye terminator method (Perkin Elmer, Foster City, CA) according to the manufacturer's instructions but with the addition of 1 pl of molecular grade dimethylsulfoxide (Sigma, ST. Louis, MO) per reaction, giving a final concentration of 5% vol/vol. Cloned DNAs were sequenced in both directions using the T7 and reverse sequencing primers homologous to plasmid regions flanking the cloned inserts. The cloned inserts were found to range in size from 100 by to 500 bp. Two clones of particular interest were obtained, clones 3 and 33, each of which was isolated from an independently constructed subtraction library made as described above.
The sequences obtained from clones 3 and 33 were used to do Blast searches in the nucleotide and protein databases. No significant homologies were found at the nucleotide sequence level, but the predicted amino acid sequences encoded by both clones indicated that these polypeptides were related to the Msp protein of T. denticola, an oral treponeme associated with periodontal disease (Genbank accession No. U29399). Alignment using the Clustal W program indicated that the inserts of clones 3 and 33 aligned, respectively, with regions near the amino and carboxyl ends of the T. denticola Msp protein. These clones were subsequently used as described below for hybridization with Southern blots of the T. p. pallidum genomic DNA, and to design oligonucleotides for PCR amplification of longer pieces of the T.p. pallidum Msp homologue from which they appeared to be derived.
To determine the specificity of the cloned unique sequences for T. p.
pallidum, as well as their hybridization patterns to digested genomic DNA, approximately 3 pg each of T. p. pallidum (Nichols strain) and rabbit DNA were digested with Eco RI, Pst I, and Bam HI, then separated in 1% TBE agarose gels, denatured with 0.5 M
NaOH and transferred to Hybond N membrane (Amersham Laboratories, Arlington Heights, IL). The inserts of clones 3 and 33 were labeled as follows to use as hybridization probes. The inserts were PCR amplified from the cloning vectors using the nested primers described above under the same conditions as for the nested PCR
during the subtraction experiments, and purified using the Qiaquick PCR
Purification Kit (Qiagen, Chattsworth, CA). Fifty ng of the purified amplicons were then labeled by random priming with a-3zP using the Random Priming labeling Kit (Boehringer 3 5 Manheim, Indianapolis, III according to the manufacturer's protocol.

The labeled inserts of clones 3 and 33 were hybridized under high stringency conditions to the above-described Southern blots. Each probe was allowed to bind the PCR products on a separate filter for 12 hours at 37°C in hybridization solution (50% formamide, SX SSC, 50 mM NaP04, 1% SDS, SX Denhardt's solution). The blots were then subjected to stringent washes at 65°C in buffers containing 2X SSPE, 0.1% SDS, and 0.2X SSPE, 0.1% SDS, for 20 minutes each (SSPE: 150 mM NaCI, mM NaP04, 1 mM NaEDTA, p 7.4). Hybridization was detected by autoradiography. No hybridization of these probes with rabbit DNA was observed, indicating that the probes were specific for T. p. pallidum. The results of these 10 Southern blots disclosed several hybridizing DNA fragments, thus suggesting that the cloned genes belonged to a multigene family. The Eco RI digests yielded bands of about 8 and 5 kb, the Pst I digests bands of about 1 kb, 800 bp, and 500 bp, and the Bam HI digests bands of about 8, 5 and 3 kb.
Isolation of TP 1.6 (SEQ ID N0:43):
As explained above, the inserts of clones 3 and 33 were homologous, respectively, to the 5' and 3' ends of the Msp gene of T. denticola, thus primers were designed to amplify that portion of the T. p. pallidum Msp homologue that presumably lay between the two clones. Primers used were the S-3 sense primer corresponding to the 5' end of the insert of clone 3 and having the sequence 5'-ACCAGTCCTTCCTGTGTGGTTAA (SEQ ID N0:66), and the antisense primer As-33, corresponding to the 3' end of the insert of clone 33, and having the sequence 5'-ACTCCTTGGTTAGATAGGTAGCTC (SEQ ID N0:67). A hot start PCR
amplification was performed as described above using as templates approximately 1 pg of genomic DNA of T. p. pallidum, Nichols strain. The DNA was amplified in a total volume of 100 N,1 per tube, each containing 200 l,iM dNTPs, 50 mM TRIS-HCl (pH 9.0 at 200° C), 200 mM ammonium sulfate, 1 p,M each primer and 2.5 units of Taq polymerise (Promega, Madison, WI). MgCl2 beads (Invitrogen, San Diego California) were added giving a final MgCl2 concentration of 1.5 mM. The following cycling conditions were used: an initial step of 4 minutes denaturation at 94°C
followed by 40 cycles at 94°C for 1 minute, 65°C for 2 minutes, 72°C for 1 minute, and a final elongation step of 10 minutes at 72°C. The PCR products were then kept at 4°C and directly cloned into T/A cloning vectors for sequencing and for further analysis on agarose gels. The PCR was repeated several times, and each time yielded one band that proved to contain 1687 by (TP 1.6)(SEQ ID N0:43).

The sequence of TP 1.6 (SEQ ID N0:43) was found later to have high homology with a newly released T. p. pallidum Msp-like sequence in Genbank (TPU88957), and to at least 10 different ORFs that were present in the initial release on June 24, 1997 of the TIGR T. p. pallidum genome project (posted at http://med.uth.tmc.edu/Treponema/tpall.html~. When first posted on the Internet in June, 1997, the TIGR T. p. pallidum sequence was not annotated, i.e., the locations of open reading frames were not indicated. The August 18, 1997 update was annotated, but not until the January 1, 1998 update were all 12 Msp family members (Tprgenes by TIGR Terminology) identified according to their coordinates. It should be noted that all versions of the T. p. pallidum genome posted at the TIGR
site are regarded as preliminary in nature and may contain misassembled genes, mutations and frameshifts, particularly within the Msp family. Nonetheless, comparisons were conducted to determine whether the posted sequences contained any sequences similar or identical to the nucleotide sequence of TP 1.6 (SEQ ID N0:43). A
search located an open reading frame in the posted T. p. pallidum sequence at positions 73,979 - 75,665 (based on the August 18, 1997 version) that is 90.21%
identical to the sequence of TP 1.6 (SEQ ID N0:43). The aligned sequences contained 55 amino acid mismatches spread throughout the 5' end from amino acid positions 1 through 123. Beyond this point to the 3' end, the identity of both amino acid sequences is 100%.
The Msp genes are arranged into five regions on the T. p. pallidum chromosome. There are three major subfamilies of Msps as defined by homology of their predicted amino acid sequences. Subfamily I includes Msps 2 (SEQ ID
N0:9), 4 (SEQ ID N0:13), 5 (SEQ ID NO:15), and 11 (SEQ 117 N0:28), which are highly homologous to one another at their 5' and 3' termini. Msps 4 (SEQ ID N0:13) and 5 (SEQ D7 NO:15) and 11 (SEQ ID N0:28) have central variable regions of about 600 bp, while Msp 2 (SEQ ID N0:9) lacks any variable region. Msp 4 (SEQ
ID N0:13) and 5 (SEQ D7 NO:15) are identical. Subfamily II includes Msps 1 (SEQ
ID N0:7), 3 (SEQ 11? NO:11) and 10 (SEQ ID N0:26), and has larger variable regions of about 1000 bp. This subfamily shares significant homology at the 5' and 3' ends with the Subfamily I. Subfamily III includes Msps 6 (SEQ ID NO: I7), 7 (SEQ
ID N0:19), 8 (SEQ ID N0:22), 9 (SEQ D3 N0:24) and 12 (SEQ ID N0:30), all of whose sequences are comparatively distinct from the two other groups and from one another. Msp 7 (SEQ 117 N0:19) appears to have a premature termination, in that at the termination of ORF A (SEQ ID N0:20), in another reading frame, there is another ORF encoding another 368 amino acids (ORF B (SEQ ID N0:21)) that is homologous to the other Msps.
The TP 1.6 sequence (SEQ ID N0:43} was found by comparison to the TIGR
Tpr sequences to be a hybrid gene. The amino terminus, i.e., the first 152 amino acids, of the TP 1.6 polypeptide (SEQ ID N0:44) matches the amino terminus of Msp 2 (SEQ ID N0:9), and differs in only two amino acids from the amino terminus of Msp 4 (SEQ 117 N0:13) and S (SEQ ID N0:15), while the 410 amino acids at the carboxyl terminus of TP 1.6 (SEQ ID N0:43) match the corresponding portion of Msp 1 (SEQ ID N0:7). The significance of this finding is not presently known.
One Msp gene is predominantly transcribed by T. p. pallidum Nichols strain:
T. p. pallidum Nichols that was isolated on days 5, 7, and 15 after infection transcribes predominantly Msp 9 (SEQ ID N0:24) mRNA, as determined by reverse transcriptase PCR (RT-PCR), a procedure that amplifies cDNA synthesized from total RNA, including mRNA, found in the bacteria, thus reflecting transcribed genes.
To perform RT PCR, a group of oligonucleotide primers were prepared that are specific to the variable regions of Msps 1 (SEQ ID N0:7), 3 (SEQ ID NO:11), 4 (SEQ ID
N0:13), 5 (SEQ ID NO:15), 6 (SEQ ID N0:17), 7 (SEQ ID N0:19), 8 (SEQ ID
N0:22), 9 (SEQ ID N0:24}, 10 (SEQ ID N0:26), 11 (SEQ ID N0:28), and 12 (SEQ
ID N0:30)(see Table 1), thus providing specific amplification of transcripts of those Msps. Using T. p. pallidum RNA extracted from infected rabbit testes, RT-PCR
analysis of the Msp transcription pattern was conducted beginning at day 5 after infection. At day 5, a strong signal for Msp 9 (SEQ ID N0:24) was evident with a weak signal for Msps 6 (SEQ ID N0:17) and 11 (SEQ 117 N0:28). Transcripts from Msps 1 (SEQ ID N0:7) or 12 (SEQ ID N0:30) mRNA were detected, but signals were weak and variable. After 5 more PCR cycles, signal was discernible for all the Msps, indicating that transcripts from all of them were present, but at relatively low levels. The preponderance of Msp 9 (SEQ ID N0:24) product was not due to an overly efficient Msp 9 (SEQ ID N0:24) PCR, because when these same primers were used to amplify T. p. pallidum genome DNA, it was found that the primers for Msp 9 (SEQ ID N0:24) were less efficient than the primers for Msp 7 (SEQ ID N0:19) or 4 (SEQ ID N0:13) or 5 (SEQ ID NO:15). Moreover, the PCR products obtained from the RT-PCR RNA likely reflected mRNA and not contaminating T. p. pallidum genome DNA because the RNA preparation was extensively pre-treated with DNAse before the cDNA synthesis step. Furthermore, omitting reverse transcriptase from the reactions Ied to no producT.

The most likely explanation for these results is that a majority of the treponemes express Msp9 (SEQ ID N0:24), and that a minority of them express Msps 1 (SEQ 117 N0:7), 6 (SEQ ID N0:17), 11 (SEQ ll7 N0:28), or 12 (SEQ ID
N0:30). Alternatively, it may be the case that each individual treponeme cell S expresses high amounts of Msp 9 mRNA and lower quantities of Msps 1 (SEQ ID
N0:7), 6 (SEQ ID N0:17), 11 (SEQ ID N0:28), and 12 (SEQ ID N0:30).
Other strains of T. p. pallidum have been similarly analyzed by RT PCR, and proved to express other Msp preferentially, i.e., the pattern of expression appears to be strain-specific.
Identification of an Msp homologue in Treponema pallidum perte~tue:
The primers described above for amplification of TP 1.6 (SEQ ID N0:43) were used to amplify a fragment of DNA from the closely related treponeme, T. p. pertenue, the etiologic agent of yaws. A hot start PCR amplification was performed as described above using as templates approximately 1 pg of genomic DNA of T. p. pallidum, Nichols strain, and T. p. pertenue, Gauthier strain, using the same cycling conditions described in Example 5 for these primers. The PCR
products were then kept at 4°C and directly cloned into T/A cloning vectors for sequencing and for fiuther analysis on agarose gels. PCR amplification with these primers reproducibly yielded the expected 1687 by band using T. p. pallidum DNA, and for the T. p. perterrue DNA, a band of 1705 bp, as well as smaller bands of 1291 bp.
When attempts were made to amplify the DNA of T. p. endemicum with this same primer pair, no DNA fragment was amplified.
Analysis of the T. p. pallidum and T. p. pertenue Msp Homologues:
Sequencing was done by the primer walking approach, using the T7, PCR 3.1 reverse, the INT-S, 5'-GGCTTCCGCTTCTCCTTCG (SEQ ID N0:68), and the INT-As, 5'-GTTTCGAGCTTAAGGAATCC (SEQ ID N0:69). The following clones were sequenced: T. p. pallidum, clones 1,2,4,5,7, and T. p. pertenue, clones 6 and 16 of the larger amplicons (~ 1.7 kb), and clones 2, 3, 5, 7, and 8 of the shorter ampIicons (~1.3 kb).
Automated sequencing of the 1.6 kb amplicon of T. p. pallidum and of the 1.7 kb and 1.3 kb amplicons of T. p. perterrue revealed four different copies in T. p. pertem~e, one 1.6 kb (clones 6 and 16) and three 1.3 kb homologues (homologue l3Ty 238, TyS, and Ty7; from clones 2/3/8, 5 and 7, respectively), and a single DNA sequence in T. p. pallidum (clones 1, 2, 4, 5, and 7) among the 19 clones 3 5 of T. p. pertenue and the five from T. p. pallidum that were examined. The T. p. pallidum DNA fragment (TP 1.6)(SEQ B7 N0:43) has 1687 bp, thus predicting a peptide sequence of 562 amino acids (frame +1).
The long homologue of T. p. pertenue (l7Ty) had a DNA sequence of 1705 bp, and encodes a putative polypeptide of 568 amino acids (SEQ m N0:35).
The shorter amplicons ( 13 Ty 23 8, 13 TyS, and 13 Ty7) all were 1291 by long, and predicted polypeptides having the same length, 438 amino acids, but differing at their carboxyl termini (SEQ m NOS:37, 39 and 41). When the deduced peptide sequences of amplicons identified in both subspecies were aligned, i.e., TP 1.6, 17 Ty and 13 Ty, it was found that the T. p. pertenue Msp homologue, like those of T. p.
pallidum, have highly conserved regions located at the amino and carboxyl terminal ends, separated by a central variable region. For the three 438 amino acid polypeptides, the amino terminal conserved regions extend from amino acid positions 1 through 153, the carboxyl terminal conserved regions from positions 444 through 592, and the internal variable region from positions 154 through 443. As compared with the polypeptide encoded by 17 Ty, the central variable portions of the 438 amino acid polypegtides lack the 161 amino acids present at positions 241 through 400 of the 17 Ty polypeptide.
When the peptides encoded by the three 1.3 kb short fragments of T. p. pertenue were compared, it was found that they are highly conserved in almost their entire length, except at their 3' regions where sequence variation was found in a short region from amino acids 354 through 381.
Based on the differences in their Msp regions, it is clear that PCR using the above described primer pair can differentiate the treponemes responsible for syphilis, yaws, and bejel, as the results for the three treponemes yield DNA fragments that differ in size and number, and of course, nucleotide sequence. As shown in Example 7, this approach has been extended to develop an RFLP-based method for the differentiation of other strains and subspecies of Treponema.
The various subspecies of T. pallidum, including the etiologic agents of human syphilis, yaws, and bejel, possess very small and highly-related genomes, yet all are able to produce lifelong infection in untreated patients. The past inability to differentiate subspecies and strains of T. p. pallidum using serologic methods has led some investigators to hypothesize that these pathogens actually are identical, with only environmental factors dictating different clinical manifestations (Hudson, E.H., Treponematosis Perspectives Bull., WHO 32:735-748, 1965). However, this view is contraindicated, e.g., by differences in the pathogenesis of the infections, and by the co-existence of more than one distinct treponemal disease in some locales.
Moreover, there is experimental evidence for antigenic heterogeneity between subspecies and strains. More specifically, this heterogeneity must lie in the "protective"
antigen or antigens, since hosts infected with one of the strains is only partially resistant to the other strains. To date, the molecular bases for differences in pathogenesis and immunity have not been identified. The present findings provide an additional means of differentiating the strains of T. pallidum responsible for syphilis, yaws and bejel, and moreover may be directly relevant to the antigenic variations that are responsible for the differences in pathogenicity among these treponemes.
Transmembrane Topology Analysis:
Like the protein encoded by the T. p. pallidutn TP 1.6 (SEQ m N0:44), the proteins predicted from all four of the T. p. pertenue DNA fragments described above were found to have significant homology to the Msp protein of T. denticola.
The T. p. pallidum and T. p. pertenue peptide sequences were analyzed for indications of transmembrane topology using the TmPred program (Hofinan and Stoffel, A
Database of Membrane Spanning Protein Segments, Biochem. Hoppe-Seylor 348, 166). For T. p. pallidum, results indicated three possible amphipathic transmembrane helices at amino acid positions 46-65, 389-409, and 415-438. For T. p.
pertenue, three transmembrane helices have were determined for the translate of the 1.7 kb homologue at similar positions, i.e., at amino acids 46-65, 394-412, and 421-444, and two transmembrane regions were found for the short 1.3 kb copies of T. p.
pertenue at amino acid numbers 46-65, and 291-314.
The T. p. pallidum Msp homologue described by another laboratory (GenBank accession number U88957) was similarly analyzed to determine whether it also has a predicted transmembrane topology to the sequences disclosed here.
The three transmembrane regions in the proteins encoded by the 1.6 kb clone of T. p. pallidum and the 1.7 kb clone of T. p. pertenue, and the three in the 1.3 kb homologues of T. p. pertenue were found to overlap extensively with the corresponding predicted transmembrane regions of the GenBank Msp homologue.
Interestingly, the differences found between the syphilis and yaws Msp proteins are located in the variable, middle portion of the protein, which is relatively hydrophilic, and thus may be exposed to the extracellular environmenT.
The pathogenic treponemes are classified based upon the distinct clinical infections they produce, as well as their host specificity and very limited genetic . studies. The syphilis and the yaws treponemes have been classified as subspecies of WO 99/53099 PC'f/US99/07886 T. pallidum based upon saturation reassociation assays, methods of low sensitivity to detect small differences. All attempts to show species or subspecies-specific signatures had failed until it was recently shown that these two organisms differ in the 5' and 3' untranslated regions of their 15 kDa lipoprotein genes. However, the 15 kDa lipoprotein gene is neither a protective antigen or a molecule related to differential pathogenesis because the open reading frame is identical in T. p.
pallidum and in T. p. perterrae. Furthermore, immunization of rabbits with recombinant 15 kDa lipoprotein has failed to provide any evidence of protection against virulent challenge.
The above-described studies on a novel Msp gene family in the Genus Treponema describes for the first time extensive differences in the coding regions of putative outer membrane antigens in two subspecies of T. pallidum. These differences can serve as the basis for the diagnostic differentiation, e.g., using PCR, for determining whether one of these two treponemes, or the treponeme responsible for bejel, is present in a primary lesion.
Attachment and invasion are the first steps for a successful treponemal infection, as in vitro studies have shown that T. p. pallidum penetrates ~zcaryotic cells and localizes to the cytoplasm (J.A. Sykes, et al., Br. J. Yener. Dis., 50:40-44, 1974). The molecules involved in attachment and invasion of eukaryotic cells have not yet been identified, but outer surface proteins are likely to be involved. In T. denticola, an oral spirochete associated with periodontal disease, the Msp antigen has been shown to be involved in cell adhesion, and has porin and extracellular matrix binding activities (Egli et al., In,~'ecT. Immun., 61:1694-9, 1993; Fenno et al., J. Bacteriol., 178:2489-97, 1996). The transmembrane topology analyses {see above) have indicated that there are three overlapping amphipathic regions in the 1.6 kb sequences of T. p. pallidum and T. p. perterrue and two in the 1.3 kb fragments of T. p. pertenue, leaving in both cases a large, intermediate hydrophilic segment that includes part of the conserved region and the whole internal variable region.
These analyses suggest that the Msp homologous proteins of T. p. pallidum identified in this study, as well as the other members of the T. p. pallidum Msp family, probably are membrane-spanning molecules located in the outer sheath, making them likely candidates for cell attachment and invasion, as demonstrated for the Msp of T. denticola, and suggesting that they are useful as vaccine candidates.
It should be noted that no Msp homologue completely identical to the one described here is present in the current version of the Internet-posted T.
pallidum genome sequence, with the best match being the Msp 1 homologue (SEQ ID N0:7), which is only 90.21% identical. As compared with the posted Msp 1, the ORF of TP 1.6 (SEQ m N0:43) has mismatches throughout the 5' end from amino acid position 1 until amino acid 123 and is completely identical in the rest of the sequence.
The present finding that PP 1.6 is a "hybrid" of two of the posted Msp genes, i.e., Msp 1 and 2, may indicate that homologous recombination may be occurring between two homologues so that the 5' region corresponds to one gene in which the downstream portion has been replaced by the corresponding piece of another gene, creating a hybrid molecule with different antigenic characteristics.
Mechanisms of this type have been described in Borrelia (e.g., Zhang et al., Cell, 89:275-85, 1997).
Alternatively, the Msp genes in the current version of the T. pallidum genome may simply be misassembled, or the results described here may have resulted from copying errors during the PCR amplification.
Example 6. PCR Amplification of Msp Homologues in Various Treponemes These same PCR primers used originally to amplify TP I.6 (SEQ m N0:43) were tested also with DNA from several other species and subspecies of the Treponema genus, including genomic DNA from T. pallidum subspecies endemicum, Bosnia A strain, T. paraluiscuniculi, Cuniculi A strain, and a Treponema sp.
Simian strain. As a control, aliquots of the DNAs were amplified using primers specific for a 15 kDa lipoprotein gene common to all treponemal species. Results with these control primers yielded bands for all the DNA templates, thus indicating that suiBcient amounts of DNA for PCR were present in all of the DNA preparations. Using the TP 1.6 primers, no amplification was seen for T. p. endemicum (which causes bejel), Bosnia A strain, or for T. paraluiscuniculi, Cuniculi A strain. Treponema sp, Simian strain, which is capable of infecting humans, yielded two bands of the same sizes as those noted previously when these primers were used to amplify T. p. pertenue DNA, i.e., 1.6 kb, 1.3 kb. Thus, this group of pathogens can be distinguished using PCR
with this primer pair.
Example 7. RFLP Strain Differentiation of T. p, pallidum Infection of rabbits with one strain of T. p. pallidum is completely protective against homologous strain challenge, but only partially protective against heterologous strain challenge (Egli et al., InfecT. Immun., 61:1694-1699, 1993). This may be because treponemal surface proteins vary from strain to strain, possibly due to variation in Msps. Strain variation in the Msp region was investigated by comparing the Msp variable regions from I8 different clinical isolates of T. p.
pallidum, which were isolated from different geographical locations and at different times.
These were as follows: Ba173-1; Bal-2; Bal-3; Bal-5; Bal-6; Bal-7; Bal-8; Bal-9; Chicago;
Mexico A; Nichols; Sea 81-1; Sea 81-2; Sea 81-3; Sea 81-4; Sea 81-8; Sea 83-1;
Sea 83-2; Sea 84-2; Sea 85-1; Sea 86-I; Sea 86-2; Sea 87-1; Sea 87-2; Street 14;
Yobs.
The alignment of the amino acid sequences for Msps 1, 3, 4, 5, I0, and 11 indicated a middle region of high heterogeneity flanked by conserved regions.
Within these conserved regions are short stretches of identity in all of these Msp alleles. The short highly conserved stretches of sequence were used to design the following primers for PCR amplification of the variable regions of these 6 Msps: sense, 5' CGACTCACCCTCGAACCA (SEQ ID N0:48); antisense, 5' GGTGAGCAGGTGGGTGTAG (SEQ ID N0:49) (corresponding to Set 1 in Table 1). The 18 strains of T. p. pallidum were propagated and their DNA extracted.
PCR
was performed using a 100 N,l reaction containing 200 E,iM dNTPs, 50 mM TRIS-HCl (pH 9.0 at 20°C), 1.5 mM MgClz, 200 mM NH4S04, 1 l,iM of each primer, and 2.5 units of Taq polymerase (Promega, Madison, WI). The cycling conditions were as follows: denaturation at 94°C for 3 minutes, then 40 cycles of 94°C for 1 minute, 60°C for 1 minute and 72°C for 1 minute.
Amplicons were purified away from primer-dimers using the QuiaQuick Kit extraction (Qiagen Inc., Chatsworth, CA), and the purified DNAs were quantitated by spectrophotometry. Restriction digests of amplicons were performed with 10 pg of purified PCR product from each treponemal strain, according to the manufacturer's instructions (New England Biolabs, Beverly, MA), using the following 13 restriction endonucleases, all of which recognize four base cleavage sites: BstUI, AIuI, Tsp509I, MseI, NheI, Taq*I, HhaI, IVlaIll, BfaI, RsaI, MspI, MboI, and AciI. The resulting DNA fragments were separated by electrophoresis in 2.5% TBE/ethidium bromide NuSieve agarose gels. PCR amplification was optimized so that no smearing of bands was detected on the gels.
For all T. p. pallidum strains tested, these primers gave bands at about 650 by and 1.1 kb and about 1 kb. After cleavage with the above-listed restriction enzymes, it was apparent that the 650 by and 1.0 kb bands actually were quite heterogeneous.
The restriction digestion patterns could be divided into 15 distinct "RFLP"
patterns.
This degree of polymorphism is remarkable in an organism with a small genome of only 1.2 MB. Each enzyme identified a different number of restriction patterns in the 18 T. p. pallidum strains. Msp I and Nhe I each recognized three groups of organisms that gave the same RFL,P pattern for that enzyme. Mbo I, Rsa I, and Bfa I, each recognized four groups, Taq a I, five; Hha I, Tsp 509 I, BstU I, six; and Alu I
and NLA III, seven groups. Combining the data from these enzyme digests permitted the division of the 18 strains into 15 distinguishable groups, based upon RFLP
differences. Further analysis of the restriction patterns of the T. p.
pallidum strains showed that digestion with only four individual enzymes, BstUI, AIuI, HhaI, and NlaZII, was sufficient to differentiate the 15 groups.
Using these four enzymes, three of the groups were especially easily differentiated from the other strains. These three groups each contain strains that have the same RFLP patterns with these four enzymes. Group I comprises the strains Bal 9, Sea 81-8, and Sea 84-2; group II, Nichols and Yobs strains, and group III
includes the Bal 2 and Bal 8 strains. The strains in each subgroup do not represent unique geographical areas, year of isolation or tissue tropism. Unlike the isolates of these three subgroups, the other 11 T. p. pallidum strains tested showed distinct, specific patterns. Some strains, such as Sea 81-1 and 81-3, were collected in the same city, year, and from the same site in the body, yet showed very different RFLP
profiles. Although three groups were identified with at least two strains each, overall, these results indicate that there is a very high degree of heterogeneity in the variable regions of these Msp homologues of these bacterial isolates.
In summary, the RFLP patterns demonstrate that there is marked heterogeneity in the variable regions of the different strains of T. p.
pallidum.
Table III shows the distribution the variability of Msp variable domains amongst the different strains and restriction enzymes tested to date. One of the strains appeared identical to T. p. pallidum Nichols strain, but the other 16 differed from Nchols in their variable domains. Thus, these results demonstrate that the variable domains differ in different strains of T. p. pallidum and this may be the basis for the lack of complete protection of infected animals after heterologous strain challenge.
Accordingly, a fully effective vaccine may require a combination of several or all of the Msp proteins.
In other experiments, it was found that the above-described PCR primers used for RFLP analysis of T. p. pallidum strains also primed the amplification of Msp genes in T. p. perterrue and in T. p. endemicum, in each case yielding bands of 600 bp, 630 bp, 600 and 1.1 kb. For RFLP analysis, these amplicons were digested with Mbo 1, Rsa 1, Hae III, Alu 1, Nla III, Hha 1, Msp 1, Taq 1(a), and Tsp 509.
The resulting DNA fragment patterns permitted these two subspecies of T. pallidum to be easily distinguished from one another and from T. p. pallidum.

Moreover, the primer pair used to amplify the DNA fragments for these RFLP
analyses, i.e., Set 1 from Table 1, appears to be useful for identifying Msps from many or perhaps all species of Treponema, including pathogens associated with gingivitis and periodontitis. For example, when this primer pair was used with DNA from Treponema denticola (an oral pathogen not reactive with antibodies for the 47 kDa protein of T. p. palliaum; Riviere et al, 1991) or from Treponema phagedenis (not considered a pathogen), bands of about 1 and 0.6 kb were obtained.
Example 8. Expression in E. coli of Recombinant Gpd and D 15 To further characterize the clones described in Example 2, efforts were made to express in E. coli the genes contained in all 10 of the immunoreactive lambda plaques. However, the products these positive lambda plaques proved to be diiBcult to obtain because of apparent toxicity to E. coli of the proteins expressed from these clones. Such toxicity is typical of outer membrane proteins. During the original immunoscreening of the lambda expression library (Example 2), protein expression from the Lambda ZAP protein did not depend upon survival of the E. coli host, thus the toxicity to E. coli of these proteins was not apparent during the initial screening.
However, in order to obtain cloned DNA for nucleotide sequence analysis, the immunoreactive plaques identified in this screen were subsequently subjected to in vivo excision to recover the positives as pBluesctipt phagemids, a process that is strictly dependent upon survival of the E. coli host strain. Of the ten positive plaques, seven were successfully converted to pBluescript phagemids only after several attempts, while the remaining three so far have not been converted successfully. With regard to these last three clones, though their inserts have not yet been identified, it has been shown that they do not encode Gpd because it has not been possible amplify their inserts using PCR primers corresponding to the Gpd sequences. Methods expected to ultimately obtain expression of the remaining clones will involve minimal bacterial growth times to prevent accumulation of the toxic protein, lowering the growth temperature to 30°C instead of the standard 37°C to prevent bacterial overgrowth, immediate purification of recombinant proteins from recently transformed bacterial constructs rather than purification from previously frozen bacterial construct stock cultures, and additional experimental approaches.
In addition to Gpd (SEQ m NO:1), the T. p. pallidum homologue of D15/Oma 87 (SEQ ID N0:3) was expressed in E. coli with the pRSET expression vector system. The expressed D 15 homologue was used to immunize rabbits, as described below in Example 10. Antibodies to this protein are being prepared.

Example 9. Characterization of T. p. pallidum Gpd protein The T. p. pallidum Gpd protein (SEQ ID N0:2) was expressed in E. coli BL21 (DE3) pLysS using the pET-3a expression system by inserting the entire coding region of Gpd (SEQ ID NO:1). This yielded a full-length, 41 kDa recombinant protein molecule.
To verify that the T. p. pallidum Gpd (SEQ 1D N0:2) indeed possessed the predicted enzymatic activity, Gpd activity was measured in crude lysates of E.
coli that were expressing the recombinant molecule. (Larson et al., J. Biol. Chem., 258, 5428-5432, 1983). A glycerophosphodiester phosphodiesterase functions by hydrolyzing glycerophosphodiesters from phospholipid and triglyceride metabolism to glycerol 3-phosphate. The assay used here measures the conversion of the substrate glycerophosphocholine, a glycerophosphodiester, to dihydroxyacetone phosphate (DHAP) via glycerol 3-phosphate with the concomitant reduction of NAD to NADIi.
This reduction of NAD is followed spectophotometrically by measuring the increase in absorbance at 340 nm.
In brief, aliquots of a sonicated lysate of E. coli expressing the recombinant T. p. pallidum Gpd were added to a hydrazine/glycine 0.5 ml assay mixture containing NAD, CaCl2, and gtycerol-3-phosphate dehydrogenase. The substrate glycerophosphocholine was then added to 0.5 p,m. A background control to account for the E. coli intrinsic Gpd activity (a.k.a. "GIpQ") was provided by a sonicated lysate of E. coli transformed with only the pET-3a vector, i.e., the vector with no T. p. pallidum Gpd inserT. A positive assay was considered one in which an increase in absorbance at 340 nm was observed in E. coli expressing the recombinant T. p. pallidum Gpd over the absorbance at 340 nm observed in the background control sample. The results of these assays indicated a three fold increase in absorbance in E. coli transformed with the T. p. pallidum Gpd (SEQ m NO:1).
These assay results thus demonstrated that the recombinant Gpd was enzymatically active and, at least within the context of the enzyme's active site, confoimationally correct, a characteristic important to various manipulations involving the recombinant T. p. pallidum Gpd (SEQ ID NO:1).
Inclusion bodies containing recombinant T. p. pallidum Gpd (SEQ ID N0:2) were recovered from transformed E. coli and used as an immunogen to generate polyclonal antiserum. This antiserum failed to induce opsonization of T. p.
pallidum appreciably compared to nonimmune rabbit serum. One possible reason for this result may be that Gpd is not involved in opsonization, but alternatively, it may be that Gpd is an opsonic target antigen, but that for opsonization to occur addition opsonic target antigens must also be present.
A 1:1000 dilution of the rabbit anti-Gpd antiserum was used to develop Western blots containing lysates of T. p. pallidum before and after washing by centrifugation. The washes are know to partially remove the bacterium's outer membrane. Blots were developed with 1:3000 dilution of goat anti-rabbit IgG
(peroxidase-conjugated Fab fragment, Amersham), using the chemiluminescence protocol provided by Amersham. An immunoreactive band was observed that had a size of 41 kDa, the approximate molecular weight predicted for Gpd from the open reading frame identified in the cloned DNA. The 41 kDa band was not observed in control blots developed with normal rabbit serum collected from the same rabbits prior to immunization. The signal for Gpd was observed in lysates obtained from unwashed, once-washed, and from thrice-washed treponemes, but signal strength diminished noticeably with increasing numbers of washes. These results thus imply that Gpd is associated with the outer membranes of T. p. pallidum.
The polyclonal antiserum to Gpd was used in further studies to analyze the surface disposition of Gpd using a previously described immunoffuorescence assay (Cox et al., Mol. Microbiol., 15:1151-1164, 1995). Because of the fragility of the T. pallidum outer membrane, special precautions to preserve this membrane were employed (Cox et al., 1995) Briefly, virulent T. pallidum were encapsulated in gel microdroplets to preserve the treponemal molecular architecture prior to immunofluorescence analysis, thus ensuring an accurate cellular localization for Gpd within T. pallidum. Preliminary results using the anti-Gpd antiserum showed uniform surface immunoffuorescence on both intact and detergent-treated T. pallidum, as did immune rabbit serum collected from chronically infected rabbits. To ensure that the integrity of the T. pallidum cellular architecture had been maintained despite the experimental manipulations, the level of immunoreactivity was examined for pre-immune serum and serum prepared against the periplasmic 37 kDa endoflagellar sheath protein (Isaacs et al., InfecT. Immun., 57:3403-3411, 1989}. The pre-immune serum lacked immunoreactivity against either the intact or the detergent-treated treponemes, while the anti-37 kDa serum was reactive only against detergent treated treponemes, a finding consistent with its periplasmic location. These studies thus support a cell surface disposition for the T. p. pallidum Gpd.
Because the H. in, fluerrzae Gpd homologue has been reported to have IgG binding capability (Janson et al., InfecT. Immun., 59:119-125, 1991;
Sasaki and Munson, Inf'ecT. Immun., 61:3026-3031, 1993), the immunoglobulin binding capacity of the recombinant T. pallidum Gpd was investigated. To analyze the immunoglobulin binding capability of recombinant T. p. pallidum Gpd, inclusion bodies were purified from E. coli transformants using standard techniques, subjected to SDS-PAGE analysis, and transferred to Immobilon-PVDF. The blots were exposed first to one of several types of immunoglobulin (primary immunoglobulin), washed, and then to the corresponding peroxidase-conjugated secondary antibody, followed by use of the Enhanced Chemiluminescence (ECL) Detection system (Amersham). The antibody pairs used were: (i) human IgA followed by goat F(ab~2 anti-human IgA (a-chain specific); (ii) human IgD followed by goat F(ab'~ anti human IgD (S-chain specific); (iii) human IgG followed by goat F(ab')2 anti-human IgG (y-chain specific}; and (iv) human IgM followed by goat F(ab'~ anti-human IgM
(p,-chain specific). For control blots, the primary incubation was conducted in the absence of any primary immunoglobulin. As expected, no signal was observed for the control blots.
Results of these binding studies showed that the recombinant T. p. pallidum Gpd bound specifically with human immunoglobulins A, D and G but not M. The immunoglobulin binding was specific for the T. p. pallidum Gpd and did not represent spurious binding by a contaminating E. coli protein, as no immunoglobulin binding was observed for similarly prepared inclusion bodies from E. coli expressing the pET-3 a vector alone.
The IgG binding of T. pallidum Gpd was further characterized by IgG
fractionation studies. For these studies, Fab and Fc fragments of human IgG
were prepared by papain digestion, and purified using a standard procedure (Harlow and Lane, Eds., Antibodies: A Laboratory Manual, Cold Spring Harbor, NY, 1988, which is hereby incorporated by reference in its entirety). Immunoblots were incubated with either the Fab or Fc fragment, then developed with horseradish peroxidase/goat anti-human IgG (F(ab')2 fragment) and the Enhanced Chemiluminescense Reagent (Amersham, Cleveland, OIL. Results of binding assays with these IgG fragments revealed that the T. p. pallidum Gpd specifically binds the Fc fragment of human IgG with an intensity similar to that observed for intact IgG, while no binding to either the Fab fragment of human IgG or the secondary antibody was detected. Control lanes containing inclusion bodies prepared from E. coli transformed with the pET-3a vector alone once again did not exhibit binding to intact IgG, IgG Fc and Fab fragments or the secondary antibody.

In H. influenzae, the Gpd homologue has been linked to pathogenesis, as Gpd knockout mutants for that organism have been shown to be 100-fold less virulent in animal models (Janson et al., InfecT. Immun., 62:4848-4854, 1994). Similarly, Gpd may be relevant to the pathogenesis of T. pallidum. It has been proposed that the coating of T. pallidum by host IgG is a factor in long-term treponeme survival in the host (Alderete and Baseman, InfecT. Immun., 26:1048-1056, 1979), a hypothesis that is consistent with the present indications that Gpd is disposed on the treponeme surface and that Gpd avidly binds the Fc region of IgG. The binding of T.
pallidum Gpd to IgA and IgG is significant also because IgA and IgG represent much of the immunoglobulins at mucosal surfaces where syphilis is sometimes transmitted.
Example 10 Induction of Protective Immunity by Gpd. D 15. and MSP
Gpd:
If Gpd contributes to treponemal evasion of the host immune system, the introduction of excess high affinity Gpd-specific antibodies through recombinant Gpd vaccination may provide protective immunity to T. p. pallidum infection. The protection afforded by immunization with Gpd was tested in the rabbit syphilis model in two separate experiments. In the first experiment, one rabbit was immunized with inclusion bodies purified from E. coli expressing the pET-3a-Gpd construct emulsified in RIBI~ adjuvant prior to intradermal challenge. A control rabbit received no prior immunization and served as a comparison animal for intradermal challenge. The test rabbit was immunized intramuscularly, subcutaneously, and intradermally three times at three-week intervals with RIBI adjuvant using 200 ug recombinant Gpd per immunization. One week after the final boost, the immunized and unimmunized control rabbits were challenged intradermally at each of six sites with 103 T.
pallidum Nichols strain per site.
The Gpd immunized rabbit developed atypical pale, flat, slightly-indurated and non-ulcerative lesions within several days of challenge at two out of the six challenge sites, with no lesions observed at the remaining four challenge sites. In contrast, the control rabbit developed typical red, raised, highly-indurated and ulcerative lesions at five of six challenge sites at 12 to 14 days post-challenge.
In a second vaccination trial, the above immunization and challenge protocol was repeated using four rabbits immunized with the pET-3a-Gpd inclusion body preparation prior to intradermal T. pallidum challenge. Four control rabbits were similarly immunized with inclusion bodies purified from E. coli expressing the pET-3 a vector alone. As an additional control, another four rabbits received no prior immunization. After challenge, all eight control rabbits developed typical red, raised, highly-indurated and ulcerative lesions at each of the six challenge sites, while all four of the Gpd-immunized rabbits developed atypical pale, flat, slightly-indurated and non-ulcerative reactions at each of the six challenge sites. In all cases, the reactions in the Gpd-immunized animals resembled delayed type hypersensitivity responses more than typical syphilis chancres and resolved before lesions appeared in the control animals.
This is the first time a defined vaccine has been shown to be protective against T. pallidum challenge, in marked contrast to previous experiments where no protection was observed when rabbits were immunized with a variety of recombinant T. pallidum proteins.
Dark field examination of the challenge sites were performed 31 days following the infection, and revealed treponemes in four of four unimmunized control rabbits and three of four control pET-3 a vector-immunized rabbits. No treponemes were observed in the three pET-3a-Gpd construct-immunized animals. The fourth pET-3 a-Gpd rabbit could not be evaluated at this point, as it had expired.
The absence of treponemes in one of the control rabbits rnay reflect an adjuvant effect and/or animal to animal variability.
In summary, these results indicate that immunization with the Gpd antigen is ZO significantly protective for challenge with T. p. pallidum. Gpd represents the first surface-exposed, immunoprotective antigen reported for T. p. pallidum, and thus is valuable for a human syphilis vaccine.
T. p. pallidum D 15/Oma87 Homologue:
In T. p. pallidum infected rabbits, anti-D15 antibodies were observed to develop between days 13 and 17, and to peak at about day 30 after infection, after which time the level of anti-D 15 activity decreased slightly and plateaued.
Thus the appearance of antibodies to the T. p. pallidum D15 corresponds to the appearance of antibodies that opsonize and block cytoadherence of the organism, and to the time of treponemal clearance from the syphilis lesions in these animals. Thus, immunization with the D15/Oma87 homologue is likely to elicit protective immunity, especially given that D 15 of H. inf luenzae and the Oma87 protein of Pastuerella multocida are protective against infection by those organisms (Flack et al., Gene, 156:97-99, 1995;
Loosmore et al., InfecT. Immun., 65:3161-3167, 1996; Ruffolo and Alder, InfecT. Immun., 64:3161-3167, 1996).

To determine directly whether D15 is capable of eliciting protective immunity, a sector of the coding region corresponding to base pairs 76-2514 of the D
15/Oma87 homologue (SEQ ID N0:3) that does not include the cleavable signal sequence, was cloned into the pRSET-C expression vector, and was expressed in E. coli BL21 (DE3) pLysS. The amino acid sequence of this portion of the D15/Oma87 homologue is shown in SEQ ID N0:6. The T. p. pallidum recombinant D 15 was purified using Ni-NTA matrices according to the manufacturer's instructions (Qiagen, Valencia, CA).
Using 200 ~g of the recombinant D 15, one rabbit was immunized using the vaccination protocol described above for Gpd. This rabbit will be challenged with T. p. pallidum as described above for Gpd.
Msp:
Because of the methods by which the Msp homologues of T. p. pallidum were here identified, this protein family was thought likely to provide an effective syphilis vaccine.
The 785 by at the 5' end of TP 1.6 (SEQ D7 N0:45), which corresponds to the 5' half of Msp 2 (SEQ ID N0:9), was expressed with a 6-histidine tag in the pRSET system (Knoll et al., DNA & Cell Biol., 12:441-453, 1993) to yield a polypeptide having 261 amino acids (SEQ ID N0:46}. Recombinant protein was purified by nickel chromatography and a rabbit was immunized subcutaneously, intramuscularly and intradermally with RIBI adjuvant and 200 pg recombinant TP
1.6 protein. Injections were given three times at three-week intervals, as for Gpd immunization.
The rabbit that was immunized with the polypeptide corresponding to TP 1.6 (SEQ D7 N0:46) was challenged with 105 T. p. pallidum, Nichols strain, intradermally in eight sites on the back. A control rabbit that was not immunized was also challenged. The TP 1.6-immunized rabbit developed small, slightly indurated patches which cleared in seven days. These lesions were not typical of syphilis chancres, but rather resembled delayed type hypersensitivity responses. The control rabbit developed red, indurated nodules at the sites of inoculation at 5 days.
These persisted and reached a maximum size of 2 cm and ulcerated at approximately 20 days. At 21 days, the VDRL (Venereal Diseases Research Laboratory cardiolipin-antibody test) serology of the TP 1.6-immunized animal remained negative, but the VDRL serology of the control rabbit was positive at a 1:2 dilution. At 28 days, the TP 1.6-immunized animal was sacrificed, and its lymph nodes and testes were minced and extracted for treponemes. Treponemes were found on dark field examination, implying that the TP 1.6 immunization was only partially protective.
This experiment has now been now repeated with 2 additional rabbits and darkfield examination of challenge sites revealed treponemes in only 2 out of 12 sites in immunized rabbits, but in 6 out of 6 sites in unimmunized rabbits. These results indicate that significant protection was achieved with TP 1.6 immunization against an extremely large challenge of T. p. pallidum (the m50 for rabbits is 51 treponemes).
To further explore the ability of Msp polypeptides to elicit protective immunity, PCR primers were devised to specifically amplify the central variable region present in all of the Msps that contain a variable region. Because some of the Msp variable regions share short stretches of identity even within their variable regions, it was possible to amplify all of the variable regions using primers sets shown in Table 1.
The amplified variable region DNAs were prepared from a T. p. pallidum genomic DNA template using the primers in Table 1 to amplify all of the Msps (except for Msp 2), and each of the DNAs thus obtained was expressed in E.
coli, and the recombinant polypeptides recovered in order to test their capacity to induce protective immunity against T. p. pallidum. The nucleotide sequences of these amplified DNA fragments are shown in SEQ m N0:7 and SEQ m NOS:11, 13, 15, 17, 19, 22, 24, 26, 28 and 30, and the amino acid sequence of each of the corresponding variable region recombinant polypeptides are shown in SEQ m N0:8 and SEQ m NOS:12, 14, 16, 18, 20, 21, 23, 25, 27, 29 and 31.
In tests conducted so far, variable region polypeptides corresponding to Msps 1 (SEQ m N0:8), 9 (SEQ m N0:25) and 11 (SEQ m N0:29) have been used to immunize a single rabbit as described above for the first test conducted with the TP 1.6 amino terminus polypeptide (SEQ m N0:46). Upon challenge with T. p. pallidum, immunization with Msp 9 (SEQ m N0:25) and Msp 11 (SEQ m N0:29), but not Msp 1 (SEQ m N0:8), were found to have conferred protective immunity as compared with controls. Although Msp 1 (SEQ m N0:8) failed to yield positive results in this preliminary trial, it cannot be ruled out that the single rabbit inoculated here with Msp 1 (SEQ m N0:8) was unusually susceptible to syphilis, or that Msp 1 (SEQ m N0:8) could contribute to immunity if injected in combination with other Msp antigens.
In other experiments, antiserum was withdrawn from rabbits immunized as described above with Msp polypeptides 1 (SEQ m N0:8), 9 (SEQ m N0:25), 11 (SEQ 117 N0:29), and TP 1.6 (SEQ ID N0:46) and these antisera were tested in an opsonization assay. For this assay, in brief, rabbit macrophages were mixed with the test antiserum, treponemes added, then incubated for 4 hours. At that time, the cells were fixed and stained using an immunofluorescent tag specific for T. p.
pollidum.
Macrophages containing ingested treponemes were scored by microscopy. All four test antisera were found to have promoted opsonization over negative control serum from unimmunized rabbits. IRS provided a positive control. In one such experiment, the 90 percentages of macrophages containing ingested treponemes were:
unimmunized control, 16.9%; IRS, 45.3%; Msp 1 antiserum, 67.9%; Msp 9 antiserum, 47.4%; Msp 11 antiserum, 33.5%; and TP 1.6 32.7%. These values are the averages of triplicate plates for each antiserum.
It is of note that the protection seen after inoculation with the Msp 9 (SEQ
ID
N0:25) polypeptide was more complete than the protection seen after injecting polypeptides corresponding to the variable regions of TP 1.6 (SEQ D7 N0:46) or Msp 11 (SEQ ID N0:29). These results are consistent with other observations indicating that Msp 9 is expressed at relatively high levels during the early stages after infection of rabbits with the Nichols strain of T. p. pallidum (see Example 5). These experiments are being repeated in additional rabbits, and with the remaining Msp variable region polypeptides. This result is in marked contrast to previous experiments in which no protection was observed when rabbits were immunized with a variety of recombinant T. p. pallidum proteins, including Tp47, Tp37, Tp34.5, Tp33, Tp30, Tpl7, TplS, Tp190 (4D), Tp44.5 (TmpA), Tp34 (TmpB), Tp37 (TmpC), Tp 29-3 5 (TpD) (Tp terminology refers to MW consensus according to Norris et al., 54), and TROMP1 (Blanco et al., J. Bacteriol. 178:? 199?).
Clearly, the Msp family provides a group of antigens useful for vaccination against syphilis.
As indicated above (see Examples 6 and 7), experiments have indicated that the pathogens T. p. pertenue and T. p. endemicum each contain several Msp genes.
These are exploited for vaccine production by expressing these Msp homologues using a suitable vector, and the resulting polypeptides are used in combination with a pyhsiologicalty acceptable carrier as vaccines to protect against yaws or bejel. By combining the Msp polypeptides derived from several different subspecies of Treponema pallidum, a vaccine is made whose administration to a suitable animal host confers protective immunity to syphilis, yaws and bejel. Such a vaccine may include the T. p. pallidum Gpd (SEQ ID N0:2) and D 15/Oma87 homologues (SEQ
ID N0:4) disclosed above, and may further include Msp genes from pathogenic spirochetes that cause oral disease. Due to the high degree of relatedness among these subspecies of T. pallidum, and because infection with any one of them has been noted to confer partial immunity against the other two, a vaccine comprising at least one Msp from any one of the three subspecies should confer at least partial protection against infection with either of the other two.
Example 11 Sequence Conservation of Glycero~hosQhodiester Phosphodiesterase Amon~Tr~onema pallidum Strains The suitability of the glycerophosphodiester phosphodiesterase (Gpd) as a potential syphilis vaccine candidate was further investigated by determining the degree of Gpd sequence conservation among pathogenic treponemes.
Bacterial species. The Gpd coding sequence was PCR amplified from genomic DNA isolated from a variety of treponemal strains. All strains were propagated in New Zealand white rabbits as previously described (Lukehart, S.
A., S.
A. Baker-Zander, and S. Sell. 1980. Characterization of lymphocyte responsiveness in early experimental syphilis. I. In vitro response to mitogens and Treponema pallidum antigens. J. Immunol. 124:454-460). T. pallidum subsp. pallidum, Nichols strain, was originally sent to the University of Washington by James N. Miller (University of California, Los Angeles) in 1979, and T. parllidum subsp. pertenue, Gauthier strain, was supplied by Peter Perine (Centers for Disease Control, Atlanta, GA) in 1981.
T. pallidum subsp. pallidum, Bal-3, Bal-7 and Bat 73-1 strains; T.
paraluiscuniculi, Cuniculi A strain; T. pallidum subsp. pertenue, Haiti B strain; T. pallidum subsp.
endemicum, Iraq B strain; and the Simian isolate were supplied by Paul Hardy (John Hopkins University, Baltimore, MD). T. pallidum subsp. pallidum, Sea 81-3 and Sea 83-1 strains, were isolated by Sheila A. Lukehart from the cerebrospinal fluid of untreated syphilis patients.
PCR amplifications. To obtain the entire gpd open reading frame, primers were designed from the 5' (5'-TGCACGGTGACGATCTGTGC-3')(SEQ ID N0:70) and 3' (5'-GGTACCAGGCGACACTGAAC-3')(SEQ ID N0:71) non-coding regions flanking the ~d gene (Eraser, C. M.,et al., 1998, Science 281:375-388). These primers are located 48 by upstream and 51 by downstream, respectively, of the gpd open reading frame. PCR amplification of the gpd gene was performed using a 100 ~,1 reaction containing 200 E.iM dNTP's, 0.25 liM of each primer, lx Taq polymerase buffer (50 mM Tris-HCI, pH 9.0 at 20°C, 1.5 mM MgCl2, 20 mM NH4S04), and 1 pl of genomic DNA containing 5,000-10,000 treponeme equivalents for each strain.
The PCR reaction conditions were 30 cycles of 1 minute denaturation at 94°C, 1 minute annealing at 60°C, and 2 minutes extension at 74°C. For each reaction, "hot start" PCR (Chou, Q., M. Russell, D. E. Birch, J. Raymond, and W. Bloch. 1992.
Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20:1717-1723) was performed by adding 2.5 units of Taq polymerase after the initial denaturation step. Following PCR, the amplification products were cloned into the pGEM-T vector (Promega, Madison, WI) and each insert was sequenced in its entirety in both directions. To reduce the possibility of PCR or sequencing-induced errors, two clones derived from independent PCR amplifications were sequenced for each strain.
Sequence analysis. Double-stranded plasmid DNA was extracted using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth, CA) and both strands of insert DNA
were sequenced using the Applied Biosystems dye terminator sequencing kit (PE
Applied Biosystems, Foster City, CA) and the ABI 373A DNA sequencer in accordance with the manufacturer's instructions. In all cases both universal sequencing primers and internal primers designed from the insert sequence were used.
Nucleotide sequences were translated and analyzed using the SequencherTM
Version 3.1RC4 sequence analysis software (Gene Codes Corporation, Ann Arbor, MI).
Alignment of protein and DNA sequences was performed using the Clustal W
general purpose multiple alignment program (Thompson, J. D., D. G. Higgins, and T. J.
Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680).
Restriction fragment length polymorphism (RFLP) analysis. RFLP analysis was performed on the gpd open reading frame amplified from each treponeme strain.
One microgram of each of the amplified templates was digested with PIeI (New England Biolabs, Beverly, MA) for four hours at 37°C prior to electrophoresis on a 1.5% NuSieve~ (FMC BioProducts, Rockland, ME) agarose gel.
Nucleotide accession numbers. The nucleotide sequences of the gpd genes from the Nichols, Bal-3, Bal-7, Bal 73-1, Sea 81-3, Sea 83-1, Mexico A, Haiti B, Gauthier, Iraq B, Simian, and Cuniculi A strains have been assigned GenBank accession numbers AF004286 and AF127415-AF127425, respectively, each of which nucleotide sequences, accorded the foregoing GenBank accession numbers, are incorporated herein by reference.
As shown in Table 2, all six strains of T. pallidum subsp. pallidum have identical Gpd gene sequences, while the other human subspecies (pertenue and endemicum) and the animal pathogens (Simian strain and T. paraluiscuniculi) have a silent A to G change at base pair 579.
Table 2 Summary of Gpd sequence conservation between T. yallidum subsn.
nallidum (Nichols strain~and various patho e~poneme strains.
Subspecies Strain Se uence Diver ence from Nchols nucleotide amino acid pallidum Bal-3 none none pallidum Bal-7 none none pallidum Bal 73-1 none none pallidum Sea 81-3 none none pallidum Sea 83-1 none none Ilidum Mexico A none none ertenue ? Haiti B none none pertenue Gauthier base pair none 579 A to G

endemicum Iraq B base pair none 579 A to G

? Simian base pair none 579 A to G

paraluiscuniculiCuniculi A base pair residue 88, R to H

263, G to A none base pair none 459, A to G none base pair none 579, A to G none base pair 711, A to G

base pair 960, C to T

base pair 999, G to C

Interestingly, T. paraluiscuniculi (the only different species represented) has 5 additional base pair changes, one of which (base pair 263) results in a conservative amino acid substitution at residue 88. This demonstrates genetic divergence of the nonvenereal treponemal strains and the rabbit pathogen away from the syphilis strains, consistent with their different clinical diseases and host ranges. The Simian strain has been thought to be very closely related (or identical) to the human pertenue subspecies (Felsenfeld, O., and R. H. Wolf 16:294-305(1971); Sepetjian, M., F.
T. Guerraz, D. Salussola, J. Thivolet, and J. C. Monier 40:141-151(1969)), and this study supports this hypothesis.
The base pair change at position 579 in the non-syphilis strains introduces a PIeI restriction site that creates different RFLP patterns between the T.
pallidum subsp. pallidum strains and the other human and animal pathogens. PIeI
digestion of the T. pallidum subsp. pallidum strains generates three restriction fragments of sizes 766, 241 and 163 base pairs. The presence of the additional PIeI site in the non-syphilis strains generates four restriction fragments of sizes 635, 241, 163 and 131 base pairs. These characteristic RFLP patterns provide a means of genetically differentiating between infections caused by the pallidum subspecies and those caused by the various other pathogenic treponemes.
The finding that the Haiti B strain, which is reportedly a T. pallidum subsp.
pertertue strain, shows sequence identity with the pallidum subspecies and not with the non-syphilis strains supports the proposal by Centurion-Lara et al.
(Centurion-Lara, A., C. Castro, R. Castillo, J.M. Shaffer, W. C. Van Voorhis, and S. A.
LukeharT., J. InfecT. Dis. 177:1036-1040(1998)) that this strain is misidentified and should be classified as a T. pallidum subsp. pallidum strain. Similar sequence analyses performed on the tpr K {Centurion-Lara, A., C. Castro, W. C. Van Voorhis, and S. A. LukeharT. Unpublished data) and tp92 (Cameron, C. E., C. Castro, S.
A.
Lukehart, and W. C. Van Voorhis. Unpublished data) sequences from the Haiti B
strain further support its identification as a T. pallidum subsp. pallidum strain.
Homologues of Gpd from other bacterial species also demonstrate remarkable conservation of amino acid sequence. The enzyme from Haemophilus influenzae, designated Protein D, is 98% conserved among eight strains (Song, X., A.
Forsgren, and H. Janson., InfecT. Immun. 63:696-699(1995)). The corresponding molecule from the relapsing fever spirochete Borrelia hermsii, GIpQ, exhibits a range of 96.5%
to 100% amino acid sequence similarity among 26 B. hermsii isolates (Schwas, T. G., and S. F. Porcella. Personal communication). Similarly, results reported here show Gpd is highly conserved among twelve strains that encompass a total of five pathogenic treponemes. The invariant nature of the Gpd, combined with the immunoprotective capability previously described for this molecule in the experimental syphilis model (Cameron, C. E., C. Castro, S. A. Lukehart, and W.
C.
Van Voorhis, InfecT. Immun. 66:5763-5770 (1998)), make it an attractive candidate for inclusion in a universal subunit vaccine against T. pallidum infection.
Example 12 Opsonic Potential Protective CaQacity and Sequence Conservation of the Treno»ema parllidum subsp. pallidum Tn92 The T pallidum D 15/Oma87 homologue protein is referred to as Tp92 in the present example. As discussed more fully herein, Tp92 is protective against challenge with T pallidum. As disclosed more fully herein, the predicted Tp92 amino acid sequence from a variety of different strains of T pallidum is almost identical. This observation suggests that immunization with Tp92 should protect against many strains of syphilis. Additionally, as discussed more fully herein, Tp92 is a target of opsonizing antibodies for T pallidum, and thus Tp92 is likely to be a surface antigen.
Bacterial Strains. All T. pallidum subspecies and strains were propagated in New Zealand white rabbits as previously described (Lukehart, S.A., S.A. Baker Zander, and S. Sell. J. Immunol. 124:454-460 (1980)). E. coli XL-1 Blue, Sollt and BL21 (DE3) pLysS were obtained from Stratagene (La Jolla, CA).
Expression Library Screening. The T. pallidum subsp. pallidum tpa92 gene was identified using the previously published method of differentially screening a T. pallidum genomic expression library (Stebeck, C.E., et al. FEMS Microbiol.
Le#.
154:303-310 (1997)). Briefly, the library was prepared using the Lambda ZAP~
II
cloning kit (Stratagene) according to the manufacturer's instructions.
Approximately 200,000 plaques (12,500 pfu/plate) were plated and duplicate lifts prepared and screened using established methods (Sambrook, J., E.F. Fritsch, and T.
Maniatis.
1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N~. Filters were differentially screened with a T. pallidum-specific immune rabbit serum depleted of activity against the major known treponemal antigens but still retaining its opsonic capacity (termed opsonic rabbit serum; ORS), and a non-opsonic antiserum prepared using heat-killed T. pallidum (termed non-opsonic rabbit serum; NORS). The ORS was prepared by sequential adsorption of pooled syphilitic rabbit serum with T. phagedenis, biotype Reiter, recombinant T. pallidum 47, 37, 34.5, 33, 30, 17 and 15 kDa molecules (as designated in Table 3 in Norris, S.J. et al., Electrophoresis 8:77-92 (1987), incorporated herein by reference) and recombinant Tromp 1 (Blanco, D.R., C.I.
Champion, M.M. Exner, H. Erdjument Bromage, R.E. Hancock, P. Tempst, J.N.

Miller, and M.A. Lovett. 1995. Porin activity and sequence analysis of a 31-kilodalton Treponema pallidum subsp. pallidum rare outer membrane protein (Trompl). J.
Bacteriol. 177:3556-3562). In unpublished studies from our laboratory, antisera raised against electroeluted or recombinant forms of these antigens failed to demonstrate opsoruc function. The antiserum was further adsorbed with VDRL
antigen, a lipid complex that has been shown to be the target of a minor portion of opsonic antibodies (Baker-Zander, S.A., J.M. Shaffer, and S.A. Lukehart. J.
Infect.
Dis. 167:1100-1105 (1993)). These adsorption steps were performed to reduce the number of irrelevant positive clones identified by this antiserum in the expression library screening. Immunoreactive plaques were detected with 1 p,Ci of 1251-labeled protein A on nitrocellulose filters using established methods (Sambrook, J., E.F.
Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N~. Plaques showing reactivity with the ORS but no reactivity with the NORS were subjected to secondary screening with both the ORS and the NORS. Those plaques showing consistent differential reactivity were screened a third time with ORS and converted to pBluescript SK(-) phagemids by in vivo excision in the E. coli strains XL-1 Blue and SoIR according to the manufacturer's instructions.
DNA Sequencing. Double-stranded plasmid DNA was extracted using the Qiagen Plasmid Mini Kit (Qiagen, Chatsworth, CA) and both strands of insert DNA
were sequenced using the Applied Biosystems dye terminator sequencing kit (PE
Applied Biosystems, Foster City, CA) and the ABI 373A DNA sequencer in accordance with the manufacturer's instructions. In all cases both universal sequencing primers and internal primers designed from the insert sequence were used.
DNA and Protein Sequence Analyses. Nucleotide sequences were translated and analyzed using the SequencherTM Version 3.1RC4 sequence analysis software (Gene Codes Corporation, Ann Arbor, MI). Database searches were performed using the basic local alignment search tool (BLAST) algorithm (Altschul, S.F., et al. J. Mol.
Biol. 215:403-410 (1990)) and either the blastn, blastx or blastp programs.
The published T. pallidum genome (http://utmmg.med.uth.tmc.edu/treponema/tpall.html) was used to obtain the complete tpa92 open reading frame and the corresponding non-coding flanking regions. Alignment of protein and DNA sequences was performed using the Clustal W general purpose multiple alignment program (Thompson, J.D. et al. Nucleic Acids Res. 22:4673-4680 (1994)). The percentage of positional identity and similarity between sequences was calculated from the number WO 99/53099 PCTNS99/0'7886 of identical or similar residues, respectively, between aligned sequences;
insertions and deletions were not scored. For the predicted amino acid sequence of Tpa92, the molecular mass was calculated using the Compute pI/MW Tool (http -://www.expasy.ch/ch2d/pi tool.html), transmembrane topology analysis was performed using the TMpred program (http://ukec3.unil.ch/software/TMPItED), and signal sequence and cellular location predictions were performed using the PSORT
program (http://psort.nibb.ac jp:8800).
PCR Amplification of ipa92 from T. pallidum Subspecies and Strains. The Tpa92 coding sequence was PCR amplified from genomic DNA isolated from a variety of T. pallidum subspecies and strains. To obtain the entire open reading frame, primers were designed from the 5' (5'-GGGTGTCGTGGAGTTTTGCG-3')(SEQ I17 N0:72) and 3' (5'-CTTGCCTGGTGGACGCAGC-3')(SEQ m N0:73) non-coding regions flanking the tpa92 gene. These primers are located 55 by upstream and 49 by downstream, respectively, of the tpa92 open reading frame.
PCR
amplification of tpa92 was performed using a 100 l.il reaction containing 200 wM
dNTP's, 0.25 wM of each primer, lx Taq polymerase buffer (50 mM Tris-HCI, pH
9.0 at 20°C, 1.5 mM MgCl2, 20 mM NH4S04), and 1 pl of genomic DNA
containing 5,000-10,000 treponeme equivalents for each T. pallidum subspecies and strain.
The PCR reaction conditions were as follows: 30 cycles of 1 minute denaturation at 94°C, 1 minute annealing at 60°C, 2 minutes extension at 74°C for T.
pallidum Bal 73-1, Bal-3, Bal-7, Sea 81-3, Sea 83-1, Haiti B and Simian templates; 35 cycles of 1 minute denaturation at 94°C, 1 minute annealing at 55°C, 2 minutes and 30 seconds extension at 74°C for the T. pallidum Gauthier template; and 35 cycles of 1 minute denaturation at 94°C, 1 minute annealing at 60°C, and 2 minutes and 30 seconds extension at 74°C for the T. pallidum Cuniculi A template. For each reaction, "hot start" PCR (Chou, Q. et al., Nucleic Acids Res. 20:1717-1723 (1992)) was performed by adding 2.5 units of Taq polymerase after the initial denaturation step.
Following PCR, the amplification products were cloned into the pGEM T vector (Promega, Madison, Wn and each insert was sequenced in its entirety in both directions.
To reduce the possibility of PCR- or sequence-induced errors, two clones derived from independent PCR amplifications were sequenced for each T. pallidum subspecies and strain.
Overexpression Studies. The open reading frame encoding Tpa92 was PCR
amplified from T. pallidum subsp. pallidum (Nichols strain) genomic DNA using primers designed from the 5' (5'-CGGGATCCACAATTGGTACGAGGGAAAGCC

3 ; contains a BamHI site)(SEQ ID N0:74) and 3' (5'-CGGAATTCCTACAAATTATTTACCGTGAACG 3 ; contains an EcoRI site)(SEQ
ID N0:75) ends of the Tpa92 coding region. PCR amplification was performed as outlined above, using 30 cycles of 1 minute denaturation at 94°C, 1 minute annealing at 60°C, and 2 minutes extension at 74°C. To ensure optimal expression of the recombinant molecule within E. coli, the DNA sequence encoding the N-terminal amino acids, which include the predicted signal sequence, were excluded from the primer design and, thus, from the resulting expressed recombinant molecule.
Following PCR, the 2457 by amplification product was digested with BamHI and EcoRI, ligated to a similarly digested pRSETc T7 expression vector (Invitrogen, Carlsbad, CA) and transformed first into E. coli XL,-1 Blue and then into the E. coli expression strain BL21 (DE3) pLysS. The reading frame and sequence of the expression construct was verified by DNA sequencing using the T7 promoter primer (Pharmacia, Piscataway, Nn and internal primers designed from the tpa92 DNA
sequence, the Applied Biosystems dye terminator sequencing kit and the ABI

DNA sequencer according to the manufacturer's instructions. Expression of the recombinant T. pallidum Tpa92 was performed using 500 ml of LB broth seeded with 50 ml of OD 0.6 E. coli transformed with the Tpa92-pRSETc construct. Cells were grown for 3 hours at 30°C prior to induction of protein expression from the T7 promoter by the addition of 0.4 mM IPTG and a further 4 hour incubation at 30°C.
Cells were harvested by centrifugation, and the histidine-tagged recombinant Tpa92 protein was purified from the bacterial pellet according to the manufacturer's instructions (Invitrogen).
Antisera. Immune rabbit serum (IRS) was collected from rabbits that had been chronically infected with T. pallidum for >90 days. Anti-Tpa92 polyclonal antiserum was raised in four New Zealand white rabbits (#5061, #5200, #5202, and #5207) by immunizing three times with 100 ~tg each of the purified recombinant Tpa92 emulsified in the Ribi adjuvant MPL + TDM + CWS (Monophosphoryl lipid A
+ Trehalose dicorynomycolate + Cell wall skeleton; Sigma, St. Louis, MO).
Immunizations were administered intradermally (ID), subcutaneously (SC), intramuscularly (IM) and intraperitoneally (IP) at three week intervals as outlined by the Ribi adjuvant system, and antiserum was collected one week after the final immunization.
Opsonization Assay. IRS, anti-Tpa92 polyclonal antiserum collected from rabbit #5061, and the corresponding control pre-immune serum were tested in three separate experiments with a total number of replicate assays of 9 (lltS), 7 (anti-Tpa92 serum) and 8 (pre-immune serum) for their ability to opsonize T. pallidum using a standard phagocytosis assay as previously described (Shaffer, J.M. et al., Infect. Immun. 61:781-784 (1993)). All antisera were used at a 1:100 dilution and incubated for four hours with rabbit peritoneal macrophages and T. pallidum prior to determination of the percentage of macrophages phagocytosing treponemes.
Statistical analysis was performed using the two-tailed Student t test.
PAGE and Immunoblot Analyses. Sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting were performed as previously described (Baker-Zander, S.A. et al., J. Infect. Dis. 151:264-272 (1985)), except that samples were blotted to Immobilon-PVDF membrane (Millipore Corp., Bedford, MA). Heterologous expression of the recombinant T. pallidum Tpa92 was monitored by SDS PAGE analysis of approximately 5 pg of total bacterial lysate or 2 pg of purified recombinant protein and subsequent staining with Coomassie blue R
250.
The level of immunoreactivity of anti-Tpa92 polyclonal antiserum on purified recombinant Tpa92 was assayed by electrophoresis and blotting of 2 ~g of purified recombinant protein, and probing with a 1:200 dilution of anti-Tpa92 polyclonal rabbit serum followed by a 1:3000 dilution of alkaline phosphatase-labeled goat anti-rabbit IgG (Fc; Promega). For analysis of the level of immunoreactivity of anti-Tpa92 antiserum on washed and unwashed treponemes, T. pallidum was extracted from infected testes as previously described (Lukehart, S.A. et al., J.
Immunol.
121:2014-2024 (1978)) and either immediately resuspended in SDS-PAGE sample buffer (unwashed preparation) or washed one time or three times with lOmM Tris-HCl pH 7.5 by centrifugation (15,000 xg) prior to resuspension of the treponemes in sample buffer. Approximately 1.4 x 107 Z: pallidum were electrophoresed for each sample (unwashed, washed one time, washed three times), blotted and probed with a 1:200 dilution of anti-Tpa92 polyclonal rabbit serum (collected from rabbit #5061) followed by a 1:3000 dilution of alkaline phosphatase-labeled goat anti-rabbit IgG
(Fc). All immunoblots were blocked with 5% milk powder in Tris-buffered saline with 0.1% Tween-20 and developed using BCIP/NBT color substrate detection (Promega). RainbowTM high range molecular weight markers (Amersham, Cleveland, OH) were used as standards.
Protection Experiments. Four New Zealand white rabbits, as designated above, were immunized three times (IM, SC, IP and ID) at three week intervals with the Ribi MPL + TDM + CWS adjuvant and 100 ~tg purified recombinant Tpa92.

Three weeks after administration of the final immunization, the immunized rabbits and two unimmunized control rabbits were intradermally challenged at each of eight sites on their shaved backs with 105 T. pallidum subsp. pallidum (Nichols strain) per site.
The rabbits were examined daily to monitor the development, morphological appearance and progression of lesions appearing at the challenge sites. Lesion development was designated for each individual rabbit as typical if lesions were red, raised, indurated and generally progressed to ulceration, and atypical if lesions were pale, flat, only slightly indurated and generally non-ulcerative. Prior to lesion ulceration on the control animals (19 days post-challenge), lesion aspirates were collected from all challenge sites and examined by darkfield microscopy for viable treponemes. The serological status of all challenged rabbits was determined using the Venereal Disease Research Laboratory (VDRL) and the FTA ABS tests at 4 weeks post-challenge. Statistical analyses were performed using the two-tailed Student t-test and analysis of variance with repeated measures.
Results Identification of T. pallidum subsp. pallidum tpa92.
A Lambda ZAP II T. pallidum subsp. parllidum genomic expression library was constructed and screened with a T. pallidum-specific, antigen-adsorbed opsonic antiserum preparation. As the name implies, immunoreactivity against known T. pallidum antigens had been adsorbed from this preparation, although the opsonic capability of the antiserum was retained as demonstrated by phagocytosis assays (data not shown). To aid in distinguishing plaques specifically reacting with opsonic antibodies from background immunoreactive plaques, duplicate plaque lifts were differentially screened with a T. pallidum-specific non-opsonic antiserum.
Plaques exhibiting consistent immunoreactivity with the opsonic antiserum but no immunoreactivity with the non-opsonic antiserum on the primary and secondary screens were selected for further study and subjected to tertiary screening to obtain well isolated plaques.
In vivo excision of one immunoreactive plaque produced a pBluescript phagemid containing a 3.0 kb insert, as shown by restriction digest analysis (data not shown). Nucleotide sequence analysis of the insert revealed a 2439 by open reading frame encoding an 812 amino acid translated product. Comparison of the insert sequence with an early version (July, 1997) of the released T. pallidum genome sequence (http://utmmg.med.uth.tmc.edu/treponema/tpall.html) identified 75 by at the 5' end of the open reading frame that were missing from the insert sequence of the immunoreactive clone. This DNA sequence was downstream from a putative ribosome binding site and thus was presumed to encode the N-terminal 25 amino acids of the translated protein product. Subsequent release of the completed T. pallidum genome identified the putative open reading frame between base pairs 344,276 and 346,834 of the genome, corresponding to open reading frame TP0326 (genbank accession number AE001212; Fraser, C.M. et al., Science 281:375-388 (1998)). This open reading frame encodes a slightly larger translated protein containing an extra 16 amino acids at the N-terminus, a discrepancy that arises due to the assignment of an alternative initiator methionine.
PSORT analysis (http://psort.nibb.ac jp:8800) performed on the complete 837 residue translated protein predicts a 21 amino acid cleavable N-terminal signal sequence and an 84.6% likelihood that this putative protein is located in the T. pallidum outer membrane. The mature translated protein, lacking the 21 residue signal sequence, has a predicted molecular mass of 92,040 Da. This translated protein was designated Tpa92 (T. pallidum antigen, 92 kDa). The DNA sequence of Tpa92 is incorporated herein by reference and is available from EMBL/Genbank/DDBJ
under accession number AF042789.
Sequence Analyses.
As shown in Table 3, sequence database analysis using the blastp algorithm (Altschul, S.F. et ai., Basic local alignment search tool. J. Mol. Biol.
215:403-410 (1990)) revealed the T. pallidum Tpa92 shares the highest degree of sequence similarity with a putative outer membrane protein identified by genome sequencing of the related spirochete, Borrelia burgdorferi (28.1% identical, 44.7% similar;
Fraser, C.M. et al., Nature 390:580-586 (1997)).

z d ..
° 00 Ov O M
O ~ pMp O p M
r~ N Pr ~ N N N
O o ,~
l~ Oy~ cV d: ~1' o0 l~ N N ~
d' O 00 WD ~G vi ~n Vi vi Vi ~' M M M M M M M M M
r.., p ~ .--~ ~D t~ 00 00 ~O N V1 N N
Ur~-~ N N~ O~ N~NN
o0 v~ '~d', ~ ~ N
M O 00 00 C~ V1 Q~ rr 00 00 00 00 00 00 00 00 00 4r E~ a7 ' n .wO OO N t~ O OO O~ N N N .";
1~ O N N ~, vG 00 01 ~-~ ~ 00 01 Ov Ov g 'm z ~. oo Ov c~ ~ t~ oo c~ ~ e~ ~ t'~ H
O .~ O i '" ° c ~ t3 a 4. ~ .~ .-~ ~ o ~", .~ 00 00 00 00 0 0 °~ o ~ ~ ~ ~ °~' o ~ E ~ E
p, o a. A O O ~1 ~ o a. O O O O

a °' ''~ o ~ ~ 'r 6'0 , 'Zt° ~ ~ ~ '~ c°,~ ~ ~ ~ '~ Ct m a? o. ~ ,p, ~o ;v a ~ ~ ~ ~ ~t o 0 .a ~ .o v a ct ,t ;r a ~ ,Ct ~s ' ova o ~°''~~a"~" ~~'~U

The T. pallidum Tpa92 also shares approximately equal levels of sequence similarity with high molecular weight outer membrane proteins identified from a large variety of bacterial species (18.6-22.1% identical, 35.1-40.9% similar). The observed sequence similarity within this group of bacterial proteins is evenly distributed throughout the coding sequence of Tpa92, with the exception of a stretch of serine residues at the C-terminal end of the translated protein that is unique to the T. pallidum Tpa92. The presence of transmembrane segments within Tpa92 was analyzed using the TMPred program, resulting in the prediction of three transmembrane helices (data not shown). In this putative model, the C-terminal serine-rich stretch of Tpa92 is predicted to be located within an external loop on the outer face of the outer membrane.
Sequence Conservation of Tpa92 Among T. pallidum Subspecies and Strains.
To assess the degree of sequence conservation of Tpa92 among T. pallidum subspecies and strains, the tpa92 open reading frame was PCR amplified and subsequently sequenced from six additional T. pallidum subsp. pallidum strains, two T. pallidum subsp. pertenue strains (causative agent of the disease Yaws), one T. pallidum subsp. paraluiscuniculi strain (causes venereal syphilis in rabbits), and the Simian strain. The sequence divergence observed for each of these strains from the Tpa92 sequence of T. pallidum subsp. pallidum Nichols strain is tabulated in Tables 4-7, and the overall percentage of sequence conservation for each strain compared to the Nichols strain is summarized in Table 8.

o ~s ~

a a ~ r o oMOoMO oMOoMo do d x > a~ x z U vsm z ~ ~
~ o ~ ~ ~ ~ 0 0 0 0 v ~ v~ ~ E-~ P4 m w fxP~

o $' N N M M ~ OO00~0 V1 ~ V1V1 V1 N V1 ;, ~ ~ d c7 d d C7 H d U ~ C7 U U
e~O O O O O O
0 0 0 0 d d C7 H H U d U C'?C7 C7E"' ' ~ y ~ O 1n 1r1n ~ ~ ooonoV1 ~DO~ M M
~ ~k ~1V1h h ~1 z .C m .-.~....-..-.r, ....-..-.~.....-~N N
~

O

N

a~

rn U

G~

viv' O

N
H

M
~i ,~ o i' d x > x x z v r a o 0 a~ a 0 ~ w P4 v ~ ~ ~ ~ ~' Ei P4 ~

U

.-~~ O v1 O et f3~~ 1r ~ M M ~1Y1 N N N M ~''~ ~ ~ 0N0O
V1 V1 V1~ ~., ..Vr z d C7 d t7 d d c7 H d U d c7U U
v 0 0 0 0 0 0 0 0 0 0 0 0 0 ,o $ .~
C7v L7E- E-~U d U t7 C7C7 E-~E-~d d d' v..a' C W1O~ ~ ~ O~ O ~O M ~ O W1 O N
M 00 ~'~f'~n~n t~ o0o0 OvO ~ N d' n p V)~ v1V1 v) v1~ V1vC OvO M m .-.r,r...-,.-~.- m.r, .-~.-..-.N N N

H

M

~' OMO

a b ~

o ~ o N M z oMO o0 c7 z U ,~ w ~ H '~ d a~ r ~ O O O ~i O O

~ . O O _ O ~ p p v d p ~. W w ~

", v G C7 ~ ~l z C7 ~ - , pG

O o .d g" ~ '~.~ ~ ~ ' ~ o o r ~ o '-..~ d ' V ~ 00 n rn O, ~ 4, t~N N 1 V1 ~D ~D~ ~ t ~k N
O~

H ~ U C7 d d L7d U L7c7 d U ~ C7 U

o ~ 0 0 0 0 ~

~ ~ E-~d L7t7 d E~ H d U C5H -o U d a 3 o ~
$"
M

N

O d ~ ~ M 00 00 ~ O WOV1 ~O ~O O
N O ~WO v~t~ .~ t~t~ ooN M
~ V l~ C O O O M M ~ M

v ~ t N ~ M M 7 ~--~v N N N N N N N
~ N t~ o000 ~--~ ~
.a ~k H H

. ~"

H

H

O t~

x x z y ~, a U
O ~ M

. ~ o0 O

o w Z ~ i~

~ ~ ~ ~ -' ~ c~ a ~ c~

w '~ ~ o ~, b o y ~ N N ~ ~ ~ ~ ~ ~

G. b w V 00 ~k 1 N

O~
U E-~~ ~ ~ E-a~ U

0 0 0 0 0 0 0 ~ ~ o, H U C7C7 H U L7 E-~b U

O. N
' O

d ~ ~ 00 OWD VW ~O

N l~ M M t~ O O M M ~!' L 'O .o N M o000 .~ N N N N N

a b .

w a N

' H

H

H

x ~ b ~

, o 4.
G.O N
~

,~ O 00 A
O O O ~ ~

O O O O O O O O O
3 ~ ~ ~ ~ c~~ H w N oo OvM ~ N ~O N M ~ vt w. O ~ ~ M et t~oo Ov ~ - N N N N
~k N M t~ N N N N N M ~ ~1v1 ~1v1 N
O~

H ~ U Q U d C5 ~ U ~ U U U ~ E-~U

0 0 0 o a o o o a H C7H L'7U C7E-~d d E-~L7L7 U C7 a 3 ~ '' ,., z ~ a. ~ M N ~ ~ ~ ~ o ~
~ -.

H .a v1 OvN vGt 0000 00 .

b fi y v .$
O ~

G1, H

H ~ ~ d E~ t~~ U

.~ b a U

04 d 4, O

O

H a ~ w a t~
H ~ x o o w a ~ ~ x a ~ x ...
t~.b ~k N W N N M M ~ eTo0 0o vioo O~
w n ~1 ~n ~1 ~n ~1~n v1 ~D~O vC

~ H a H H H U U a a c~ c~H V a d H c~
O O O O O O O O O O O O O O O O O O
r ~
d U C7d U c7 C7C7 L7C7 d H d t7H L7L7 d ~.

Ov O ~--~N W D l~00 O ~ O ~ t'~1~100 N
"p ~ V'1~!1N ~ ~ V1~1 ~ N ~G ~O~ l~t~ C~O O
.~ ,-..~ ,--m-.~,--~r, '-...~,~ .....~ .~N N

.", .", d .a a b o x A x z w ~, ~ w s ~ s w z x c5 a ~ w o y -' O. '~~ ~k~D v0~O ~D h ~ h h o0 a ..., w d C7C7 d d C7 U H c7 d d 0 0 0 0 0 0 ~ _0 0 0 0 0 c~ v C7 d d U"C7 U ~ E~ U U U U

b N
4.
z ' G. ~ h et ~Dh o0N O M ~O h ~ M N
A b h h 00 000o h C W h ~' d' ~ N N N N N N N O N N N
N

b w .
H

b x z o v, as o o err;o owc O
o4 U

a~
U

O ~ O O~ O O OvO OvM o O ~ O~ Ov ~ ~ Ov~ OvOv Ov G

O
r ...
lid C

O

O

U

~

~ M ~
v' O N M ~ ~ 0000 .,~~ ~
v~ ~ ~ ~ ~ ~ v~ x U

E~

a~

a.
E~iv~

The amino acid sequence of Tpa92 is highly conserved, with a range of 95.5-100% identity and 96.8-100% similarity shared between the Nichols Tpa92 sequence and that of the various other T. pallidum strains. However, several of the amino acid sequence changes that do exist are of particular interest. First, parallel sequence divergence is observed between Bal-2 and Sea 81-3 strains and again with Gauthier and Simian strains, thus suggesting a common strain origin for each of these groups.
Second, and most importantly, a distinctive sequence deletion pattern is present in the Tpa92 sequences from non-T. pallidum subsp. pallidum strains. The tpa92 genes of the Gauthier and Simian strains have base pairs 2336-2350 deleted (data not shown), which corresponds to deletion of the amino acids that comprise the end of the T. pallidum Tpa92 signature serine stretch, residues 780-784. The tpa92 gene sequence of the Cuniculi A strain possesses an additional complexity, in that base pairs 2293-2352, which encode the characteristic serine stretch comprising amino acid residues 765-784, are deleted. This DNA sequence is replaced with 30 base pairs that encode an alternative 10 amino acids that, although serine-rich, represents a minimal serine content compared to that of the same stretch of amino acids in the other T. pallidum strains. All DNA sequence deletions are in-frame and do not introduce premature termination codons into the tpa92 open reading frame.
Overexpression of the T. pallidum Tpa92.
Heterologous expression of the mature 816 residue T. pallidum Tpa92 open reading frame in E. coli BL21 (DE3) pLysS using the IPTG-inducible pRSETc T7 expression system resulted in production of a recombinant molecule with an approximate molecular mass of 70 kDa, as assayed by SDS-PAGE and subsequent Coomassie blue staining. Expression of the 70 kDa recombinant protein was significantly decreased in E. coli lysates in which protein expression from the pRSETc T7 promoter had not been induced by IPTG addition. The 70 kDa molecular mass of the recombinant protein is unexpectedly lower than the 97 kDa molecular mass predicted for the histidine-tagged recombinant molecule (92 kDa for the T.
pallidum Tpa92 plus 5 kDa extra for the N-terminal hexa-histidine tag). This Iow molecular mass is not the result of truncated expression of the tpa92 open reading frame, as sequencing of the tpa92-pRSETc construct verified the entire 2451 by insert encoding the 816 residue open reading frame was present, but likely represents sequence-induced aberrant migration of the recombinant molecule on SDS-PAGE. Nickel resin chromatography performed on E. coli expressing the Tpa92-pRSETc construct allowed purification of the histidine-tagged recombinant molecule away from contaminating E. coli proteins. The recombinant 70 kDa molecule represented the major protein in the resulting preparation (approximately 90% of the total protein).
Proteins of a smaller molecular mass present in the nickel-purified preparation represent breakdown products of the 70 kDa recombinant Tpa92.
The recombinant T. pallidum Tpa92 was used to generate polyclonal antiserum, and subsequent immunoblot analysis showed an immunoreactive 70 kDa protein in both the nickel-purified recombinant protein preparation and lysates of E.
coli expressing the Tpa92-pRSETc construct. No corresponding immunoreactive protein was observed using either control pre-immune serum on the nickel-purified recombinant protein preparation or the anti-Tpa92 antiserum on preparations of E.
coli expressing the pRSETc vector alone.
Characterization of Anti-Tpa92 Imunoreactivity on T. pallidum Lysates.
The level of reactivity of the anti-Tpa92 polyclonal antiserum on lysates of washed and unwashed T. pallidum preparations was investigated by immunoblot analysis. An immunoreactive band corresponding to the 92 kDa T. pallidum Tpa92 was present in lysates of unwashed treponemes extracted directly from infected rabbit testes. In contrast, no immunoreactive 92 kDa bands were observed in equal quantities of lysates prepared from T. pallidum washed one time and three times following extraction from rabbit testes, or in lysates of unwashed treponemes using control pre-immune serum. Previous investigations have demonstrated that the fragile outer membrane is partially removed during washing of T. pallidum by centrifugation (Cox, D. L. et al., Mol. Microbiol. 15:1151-1164 (1995)), and thus the above results suggest concurrent loss of anti-Tpa92 immunoreactivity, and therefore loss of Tpa92 itself, with the treponeme outer membrane during washing.
Opsonic Potential of the T. pallidum Tpa92.
The anti-Tpa92 antiserum was also investigated for its ability to opsonize T. pallidum in three separate experiments using a standard phagocytosis assay.
The anti-Tpa92 polyclonal antiserum was significantly opsonic for the Nichols strain of T. pallidum, as compared with control pre-immune serum (p=0.0089). The level of opsonic activity observed for anti-Tpa92 approximated that observed with serum collected from rabbits chronically infected with T. pallidum (immune rabbit serum;
p<0.0001).
Immunoprotective Capacity of T. pallidum Tpa92.
The protection afforded by immunization with the T. pallidum Tpa92 was tested in the rabbit syphilis model. In these experiments, four rabbits were immunized three times each with the purified recombinant Tpa92 emulsified in Ribi adjuvant.
Rabbit #5061 and #5200 demonstrated approximately equal levels of immunoreactivity against the recombinant Tpa92, while rabbit #5202 showed slightly less anti-Tpa92 immunoreactivity and rabbit #5207 demonstrated no detectable reactivity. No immunoreactivity was observed using control pre-immune sera collected from each of the rabbits prior to immunization.
Three weeks following administration of the final immunization, rabbits were intradermally challenged at eight independent sites with 105 T. pallidum per site.
Two control rabbits received no prior immunization but underwent the same intradermal challenge. Table 9 summarizes the post-challenge analyses performed on the rabbits to determine the degree of protection provided by immunization with the T. pallidum recombinant Tpa92.

a U
N
N
H
H ~ + +
w '. cn v ..
N
H
.d N G.
H
~3 a y ~ ~ 8 o ~ >
z ~.

v °
°
. s z~ ~ ~ o o a a o ... ...
H
°
N o 0 0 0 ~ ;5 O .-a N O N N N
V1 h t!1 ~ V1 N
O~
O O
.a '~ V
H
N N N N °' .a w ~ ~ E~ E~ E~ E~

As shown in the table, the control animals developed typical red, raised and highly-indurated lesions, the majority of which progressed to ulceration. In contrast, the rabbits immunized with the T. pallidum recombinant Tpa92 prior to challenge all demonstrated alteration of lesion development. However, the degree of protection varied amongst the immunized rabbits, with the highest levels of protection observed for those rabbits exhibiting strong anti-Tpa92 immunoreactivity in immunoblot analysis. Significant attenuation of lesion development was observed in rabbits #5061 and #5200, with atypical pale, flat, slightly-indurated and non-ulcerative lesions appearing at the sites of challenge. The lesions of rabbit #5202 also were morphologically atypical, although two of the eight challenge sites progressed to ulceration. This value, however, still represents a statistically significant difference from the occurrence of ulceration in the control unimmunized animals (p=0.0047), and thus these lesions received an atypical designation. In contrast, although rabbit #5207 developed lesions that were paler, flatter and less indurated than those of the control rabbits, all lesions progressed to ulceration and therefore were designated as typical.
The results of darkfield microscopy examination of the challenge sites performed 19 days following infection paralleled the observed range of clinical manifestations of lesion development in the challenged rabbits. Analysis of the control unimmunized rabbits (#5111 and #5228) revealed treponemes in all eight challenge sites. Similarly, analysis of the Tpa92-immunized rabbits #5202 and #5207 showed the presence of treponemes in six out of eight lesions. In contrast, the Tpa92-immunized rabbits that demonstrated the most impressive clinical alteration in lesion development, #5061 and #5200, had significantly lower numbers of lesions containing treponemes (one and three out of eight, respectively). Serological examination of the rabbits four weeks post-challenge revealed a high VDRL and FTA ABS test titer for normal, unimmunized animals compared to significantly reduced titers observed for the Tpa92-immunized rabbits (P< ). Parallel experiments revealed that immunization with an unrelated, non-treponemal recombinant molecule in Ribi adjuvant provided no protection (data not shown), thus demonstrating that the adjuvant did not contribute to the protection observed in the Tpa92-immunized rabbits.
The data reported herein describes the identification and characterization of a 92 kDa T. pallidum protein that shares sequence similarity with outer membrane proteins from a wide range of bacterial species, including the related spirochete B.
burgdorferi and two STD-causing bacterial species, N. gonorrhoeae and C. trachomatis. Although the majority of these proteins have been identified through genome sequencing of the bacterial species in which they are found, and thus are hypothetical, six have been independently isolated using molecular biological or protein immunochemical approaches. These include an unknown protein from E.
coli (genbank accession number P39170), OMP1 from B. abortus (genbank accession number U51683), Omp85 proteins from N. meningitides and N. gonorrhoeae (Manning, D.S., D.K. Reschke, and R.C. Judd. 1998. Omp85 proteins of Neisseria gonorrhoeae and Neisseria meningitides are similar to Haemophilus influenzae D-Ag and Pasteurella multocida Oma87. Microb. Pathog. 25:11-21), Oma87 from P.
multocida (Ruffolo, C.G., and Adler, B. 1996. Cloning, sequencing, expression, and protective capacity of the oma87 gene encoding the Pasteurella multocida 87-kilodalton outer membrane antigen. Infect. Immun. 64:3161-3167) and D15 from H.
influenzae (Flack, F.S., S. Loosmore, P. Chong, and W.R. Thomas. 1995. The sequencing of the 80-kDa D15 protective surface antigen of Haemophilus influenzae.
Gene 156:97-99). Characterization of the latter four proteins confirms they are present on the bacterial surface (Ruffolo, C.G., and Adler, B. 1996. Cloning, sequencing, expression, and protective capacity of the oma87 gene encoding the Pasteurella multocida 87-kilodalton outer membrane antigen. Infect. Immun.
64:3161-3167; Manning, D.S., D.K. Reschke, and R.C. Judd. 1998. Omp85 proteins of Neisseria gonorrhoeae and Neisseria meningitides are similar to Haemophilus influertzae D-15-Ag and Pasteurella multocida Oma87. Microb. Pathog. 25:11-21.;
Thomas, W.R., M.G. Callow, R.J. Dilworth, and A.A. Audesho. 1990. Expression in Escherichia coli of a high molecular weight protective surface antigen found in nontypeable and type b Haemophilus influenzae. Infect Immun. 58:1090-1913), and passive immunization of antiserum against Oma87 and D 15 has been shown in animal models to be protective against P. multocida and H. influenzae challenge, respectively (Ruffolo, C.G., and Adler, B. 1996. Cloning, sequencing, expression, and protective capacity of the oma87 gene encoding the Pasteurella multocida 87-kilodalton outer membrane antigen. Infect. Immun. 64:3161-3167; Thomas, W.R., M.G. Callow, R.J.
Dilworth, and A.A. Audesho. 1990. Expression in Escherichia coli of a high-molecular weight protective surface antigen found in nontypeable and type b Haemophilus influenzae. Infect. Immun. 58:1090-1913; Yang, Y., W.R. Thomas, P.
Chong, S.M. Loosmore, and M.H. Klein. 1998. A 20-kilodalton N-terminal fragment of the D 15 protein contains a protective epitope(s) against Haemophilus influe»zae type a and type b. Infect. Immun. 66:3349-3354; and 32.Loosmore, S.M., Y.
Yang, D.C. Coleman, J.M. Shortreed, D.M. England, and M.H. Klein. 1997. Outer membrane protein D15 is conserved among Haemophilus influenzae species and may represent a universal protective antigen against invasive disease. Infect.
Immun.
65:3701-3707.). Results reported here suggest that Tpa92 is a similar protective outer membrane antigen of T. pallidum.
Evidence for the surface location of Tpa92 in T. pallidum comes from the observation that antibodies directed against Tpa92 have significant opsonic activity for living T. pallidum, thus demonstrating that this protein is accessible on the surface of intact treponemes. Indirect evidence for the presence of Tpa92 in T.
pallidum outer membranes was obtained by immunoblot analysis using the anti-Tpa92 antiserum on T. pallidum lysate preparations. A loss of immunoreactivity was observed in lysates prepared from treponemes whose outer membranes had been partially removed by washing prior to lysis, compared to lysates prepared from unwashed treponemes in which the fragile outer membrane and its constituent proteins remain intact prior to Iysis. Analysis of the amino acid sequence of Tpa92 also provides supporting evidence for the presence of Tpa92 on the bacterial surface.
The first 21 amino acid residues at the N-terminus of Tpa92 comprise a cleavable signal sequence that is characteristic of proteins translocated across the bacterial inner membrane (Von Heijne, G. 1983. Patterns of amino acids near signal-sequence cleavage sites. Eur. J. Immunol. 133:17-21). In addition, analysis reveals the C-terminus of Tpa92 is not a perfect match for the consensus hydrophobicity pattern predicted for bacterial outer membrane proteins of hydrophobic residues at positions 1 (Phe), 3 (preferentially Tyr), 5, 7 and 9 from the C-terminus (Struyve, M., M. Moons, and J. Tommassen. 1991. Carboxy-terminal phenylalanine is essential for the correct assembly of a bacterial outer membrane protein. J. Mol. Biol.
218:141-148.), but does contain hydrophobic residues at positions 1, 5 and 7 from the C-terminus and thus loosely conforms to this pattern. Furthermore, PSORT
analysis predicts an 84.6% probability that Tpa92 resides in the T. pallidum outer membrane, and the TMPred program identified three potential transmembrane helices within the Tpa92 amino acid sequence. These combined results suggest Tpa92 is associated with the T. pallidum outer membrane, and additional biochemical studies are currently underway to investigate the potential cell surface disposition of this molecule.
PCR amplification and subsequent sequence analysis of the Tpa92 open reading frame from twelve T. pallidum strains revealed minimal amino acid sequence divergence between the various strains. Similarly, the D15 antigen is conserved among H. influeniae strains and thus also represents an invariant antigen (Loosmore, S.M., Y. Yang, D.C. Coleman, J.M. Shortreed, D.M. England, and M.H. Klein.
1997.
Outer membrane protein D 15 is conserved among Haemophilus in, f luerrzae species and may represent a universal protective antigen against invasive disease.
Infect.
Immun. 65:3701-3707). Of the divergence that does occur in the Tpa92 sequence, the majority is found in non-T. pallidum subsp. pallidum strains and lies within a serine-rich sequence that is unique to Tpa92. The C-terminal end of this serine stretch is deleted in the Tpa92 sequences from both the Simian strain and the T.
pallidum subsp. pertenue Gauthier strain. Surprisingly, this sequence is not deleted in the Tpa92 sequence from the Haiti B strain, suggesting its classification as a T.
pallidum subsp. pertenue strain is a misnomer. Similar sequence analyses performed on other T. pallidum antigens, including glycerophosphodiester phosphodiesterase (C.E.
Cameron, unpublished observations) and Tpr K (A. Centurion-Lara, unpublished observations), also suggest the Haiti B strain should be re-classified as a T.
pallidum subsp. pallidum strain. It is interesting to note that the entire C-terminal serine-rich sequence has been deleted from the Tpa92 sequence of the rabbit-infective T. pallidum subsp. paraluiscuniculi strain Cuniculi A, although the relevance of this sequence divergence is not known at this time.
The potential significance of the serine-rich sequence present in Tpa92 becomes apparent when one considers similar serine-rich sequence stretches are observed in proteins involved in attachment to cells or cellular substances, including the Saccharomyces cerevisiae A agglutinin attachment subunit precursor (Roy, A. et al., Mol. Cell. Biol. 11:4196-4206 (1991)) and the Candida albicans chitinase precursor (McCreath, K.J. et al., Proc. Natl. Acad Sci. USA. 92:2544-2548 (1995)).
Numerous studies have shown T. parllidum attaches to host cells (Fitzgerald, T.J., J.N.
lVfiller, and J.A. Sykes. Infect. Immun. 11:1133-1140 (1975); Fitzgerald, T.J.
et al., Infect. Immun. 18:467-478 (1977); Hayes, N.S. et al., Infect.lmmun. 17:174-186 (1977); Baseman, J.B., and E.C. Hayes., J. Fxp. Med. 151:573-586 (1980);
Baseman, J.B., and J.F. Alderete, Pathogenesis and immunology of Treponema infections, Vol.
20., (1983), R. Schell and D. Musher, editors. Marcel Dekke, Inc., New York.

239; Wong, G.H.W., B. Steiner, and S. Graves., Br. J. Yener. Dis. 59:220-224 (1983); Fitzgerald, T.J. et al., Br. J. Vener. Dis. 60:357-363 (1984); Rice, M., and T.J. Fitzgerald, Can. J. Microbiol. 31:62-67 (1984); Thomas, D.D. et al., J.
Facp.
Med. 161:514-525 (1985); Thomas, D.D. et al., Proc. Natl. Acaci Sci. USA.
85:3608-3612 (1988)), although the T. pallidum proteins mediating such attachment have not yet been identified. As a putative outer membrane protein, Tpa92 could be hypothesized to constitute one such attachment ligand. In this scenario, the stretch of serine residues present in the C-terminal end of the Tpa92 sequence, which have been predicted to reside within an external loop on the outer face of the outer membrane, could act as potential sites for hydrogen bonding to carbohydrates present on the surface of host cells. In support of this, preliminary investigations conducted in our laboratory show Tpa92-specific antiserum can inhibit T. pallidum attachment to rabbit epithelial cells (E. S. Sun, unpublished observations). Studies are currently underway to fiuther investigate this putative functional role of Tpa92 as a T. pallidum adhesion.
The immunoprotective potential of the T. pallidum Tpa92 was also investigated in this study for several reasons. First, antiserum raised against the analogous proteins Oma87 and D15 from P. multocida and H. influerrzae, respectively, have been shown to induce protection in animal models (Ruffolo, C.G., and Adler, B., Infect. Immure. 64:3161-3167 (1996); Thomas, W.R. et al., Infect.
Immure. 58:1090-1913 (1990); Yang, Y., W.R. et al., Infect. Immure. 66:3349-(1998); Loosmore, S.M. et al., Infect. Immure. 65:3701-3707 (1997)). Second, the invariant nature of Tpa92 among various T. pallidum subspecies and strains makes it an attractive candidate for design of a universal subunit vaccine against T.
pallidum infections. And lastly, the identification of Tpa92 as a target of opsonic antibodies, through both the differential immunologic expression library screen and the phagocytosis assays, combined with the central role opsonization and phagocytosis plays in bacterial clearance, suggests this antigen may have immunoprotective capability. Indeed, immunization of rabbits with the T. pallidum Tpa92 resulted in partial protection from subsequent T. pallidum challenge, with alteration of lesion development at the sites of challenge compared to unimmunized control rabbits.
Not surprisingly, the level of protection achieved strongly corresponded to the antibody response generated in the immunized rabbit, with rabbits exhibiting the highest level of Tpa92-specific immunoreactivity demonstrating significant protection upon challenge.
These rabbits developed atypical small, pale, fiat, slightly indurated and non-ulcerative lesions at the sites of challenge. Darkfield examination of aspirates collected from the sites of challenge in these rabbits showed a lower number of lesions contained viable treponemes compared to control unimmunized animals. Alternative methods of antigen delivery will be investigated in an attempt to generate higher levels of anti Tpa92 reactivity and, correspondingly, more significant protection against T.
pallidum challenge.

In summary, the T. pallidum Tpa92 represents a target of opsonic antibodies and an invariant, immunoprotective antigen. Further studies will be performed to determine whether co-vaccination of Tpa92 with other promising immunoprotective antigens, such as glycerophosphodiester phosphodiesterase (Cameron, C.E., et al., Infect. Immun. 66:5763-5770 (1998)) and Tpr K (Centurion-Lara, A., C., et al., .l. Exp. Mec~ In Press (1999)}, can achieve complete immunity against T.
pallidum challenge.
Example 13 DNA mediated vaccination with a vector expressing Gpd is partially protective a.~ainst challenge with T. palladium.
We have constructed a Gpd DNA vaccine based on the high-expression CMV
promoter vector pCR3.1 (Invitrogen, San Diego, CA) expressing Gpd. We have shown that the rabbit epithelial cell line, Sf 1 Ep (American Type Culture Collection), transfected with pCR3.1-Gpd expresses Gpd detectable by Western blot (data not shown). Intradermal and intramuscular immunization of rabbits with 200 pg of pCR3.1-Gpd performed every three weeks led to easily detectable antibodies to Gpd after 3 injections in 2 of 2 rabbits (data not shown). Twenty one days after the 4th injection of DNA, the two DNA injected rabbits and one control (uninfected) rabbit were challenged intradermally with 105 T. palladium Nichols strain at each of eight separate sites on their shaved backs. Unlike the control rabbit, which developed progressive large chancres that ulcerated by 28 days, the DNA injected rabbits developed only small papules at the sites of challenge which cleared before the control rabbit developed ulcerated lesions.
Darkfield examination of aspirates from the challenge sites on day 21 after challenge demonstrated that 8 of 8 (100%) lesions on the control rabbit contained treponemes but only 2 of 16 (12.5%) of the challenge sites of the two DNA
injected rabbits had demonstrable treponemes. Both DNA injected rabbits seroconverted by day 36 after challenge and were judged infected. Thus, although the DNA-injected rabbits did become infected, lesion development in these animals was drastically altered and treponeme growth was limited. These results demonstrate that DNA
vaccination with a vector expressing Gpd was partially protective against T. palladium challenge.
This is the first time that DNA vaccination has been shown to be protective against challenge with T. pallidum. This mechanism of immunization could be advantageous because DNA vaccination stimulates humoral, CD4 and CD8 immunity.
Both CD4 and CD8 cells have been found in the primary and secondary syphilis WO 99/53099 PCT/US99/0'7886 lesions at the time of treponemal clearance and are probably responsible with production of IFN~y necessary for the activation of macrophages. The results confirm that Gpd is a protective immunogen against challenge with T. palladium using both standard and alternative vaccination approaches.
Example 14 Protection Studies Usinu Recombinant Msn Peptides The variable domains of the msp-homologues have been expressed in E. coli as 6 his-fixsion proteins, purified and used to immunize rabbits before intradermal challenge with 105 T. pallidum per site. Table 10 describes immunizaion of single animals with recombinant variable domains from msp 3, 4/5, 6, 10, and 12; of these, msp 4/5 showed evidence of protection, as measured by lesion appearance and lack of treponemes on darkfield microscopy of lesion aspirates. In addition, the recombinant carboxyl-terminal conserved domain from Subfamily II appears to confer significant protection.

WO 99/53099 PCTNS99/0'7886 _82_ o ~' o ~
y y .~ 8 ° '" o~ o~
w o ''~
U
E
a o 00 $ 00 0 "" 00 o c~ o H
!~. w ~ °~° M °\° o ~ ~.
'i' ;~ ° ° ~ ~ a~

a,~ ooy °y Eo. '~' v C
ed y p e~
00 \ ~ ~.U~
~;
° ~J ~ . ...
a ~v ~a W
.~
a _W _~ g H ''" ~' yo o ~; c~ ° 0 0 ~,°~
y y r ,M ,o U ~ °~°
d b o ~ ,o ~
o .~ ~' ~ .~ J
b o ~ ~ ~ L1 ni .~
-~ ..rs o .~ .. n ~, .a o o. ...
Z~ A~ ~;~ a Because of the expense, we have chosen to immunize and challenge single animals with each of our recombinant peptides as a screening procedure. Those antigens that appear to be protective are then examined using larger groups of animals. For example, msp 9 appeared to be protective in the first animal tested, so we immunized and challenged a group of four additional rabbits, along with four unimmunized controls. The composite results for msp 9 are also shown in Table 10, indicating that msp 9 variable domain induces significant protection against infectious challenge with 105 T. pallidum, Nichols strain.
Example 15 Opsonization of T pallidum Nchols Strain by Antisera to Msu Homologue Variable Domains Opsonization data for antisera raised against recombinant variable domains of msp 1, 9, 11, and 2/1 have akeady been provided. Antisera raised against recombinant variable domains of msp 3, 4/5, 6, and 12 have now been tested. Only antisera to msp 4/5 and 12 have statistically significant opsonic activity against the Nichols strain (p=0.02 and p=0.05, respectively) compared to NRS, but the levels of phagocytosis with these antisera are lower than with IRS and lower than previously seen with antisera to msp 1, 9, 11, and 2/1. These results suggest that several msp-homologues are expressed on the surface of T. pallidum, or on subpopulations of organisms within the Nichols strain suspension, but that the level of expression in the individual cell or in the population may be lower for msp 4/5 and 12 than for the msps tested previously. The failure of anti-msp 3 and 6 to opsonize T. pallidum suggests that these molecules are not expressed on the surface of the target organism.
Example 16 Heterogeneity in Msp 9 (TyrKy Among Strains of T. nalliclum Msp 9 (tpr K) is the gene that is preferentially transcribed and expressed in the Nichols strain (laboratory strain) of T. pallidum. It codes for the msp antigen that is most protective in our studies. To examine its structure in other strains, an issue that is highly relevant to its ability to confer broad protection in a natural setting, we amplified msp 9 genomic DNA in a number of strains from our T. parllidum strain bank. The gene could be amplified in all strains tested, but the amplicons showed significant variability in size compared to the Nichols strain (from which the primer sequences were derived). In addition, many strains had multiple amplicons using these primers.
We are currently exploring msp 9 heterogeneity in other strains by cloning and sequencing the amplicons from selected strains. All strains other than the Nchols strain contain multiple alleles of tpr K, and their sequences differ from the published tpr K sequence. The sequence differences are limited to defined "hypervariable"
regions. Given the nature of the sequence diversity, it is highly unlikely that these differences are due to PCR induced errors. It is particularly interesting that this heterogeneity is seen in msp 9, which is a protective and opsonic antigen in the Nichols strain, and is the msp-homologue that is predominantly transcribed and expressed.
The amino acid sequences of tpr K hypervariable regions from 34 different T. pallidum strains are set forth in: SEQ ID N0:76 (strain 1N); SEQ ID N0:77 (strain 1-n); SEQ ID N0:78 (strain 1-1-Bal2); SEQ II7 N0:79 (strain 2-I-Bal2);
SEQ
ID N0:80 (strain 1-1 Bal3); SEQ ID N0:81 (strain 1-1-Bal7); SEQ ID N0:82 (strain 1-2-Bal7); SEQ ID N0:83 (strain 2-3-Bal7); SEQ ID N0:84 (strain 1-1-BaIB); SEQ
ID N0:85 (strain 1-2 Bal8); SEQ ID N0:86 (strain I-3 BaIB); SEQ 117 N0:87 (strain 1-1-Ba173-1); SEQ ID N0:88 (strain 1-2-Ba173-1); SEQ ID N0:89 (strain 1-3-Ba173-1); SEQ ID N0:90 (strain 2-1-Ba173-1); SEQ ID N0:91 (strain 1-2-sea81-3);
SEQ 117 N0:92 (strain 1-3-sea81-3); SEQ ID N0:93 (strain 1-1-sea81-4); SEQ II7 N0:94 (strain 1-2-sea81-4); SEQ 1D N0:95 (strain I-3-sea81-4); SEQ II? N0:96 (strain 2-1-sea81-4); SEQ ID N0:97 (strain 1-1-sea84-2); SEQ ID N0:98 (strain sea84-2); SEQ ID N0:99 (strain 1-3-sea84-2); SEQ ID NO:100 (strain 1-1-h); SEQ
ID NO:101 (strain 1-2-h); SEQ ID N0:102 (strain 1-4-h); SEQ ID N0:103 (strain 1-h); SEQ ID N0:104 (strain 2-2-h); SEQ ID NO:105 (strain 1-1-ch); SEQ 117 N0:106 (strain 1-2-ch); SEQ ID NO:107 (strain 1-3-ch); SEQ m NO:108 (strain 1-4-ch); SEQ ID N0:109 (strain 1-5-ch).
Example 17 Identification of a New Mss Homologue in Some T. nallidum Strains We have identified a new msp-homologue in approximately 50% of T. pallidum subsp. palltdum strains. Primers targeted to conserved regions of Subfamilies I and II were used to amplify DNA from these two strains, the products were cloned, and inserts were sequenced. A new sequence, called msp 13 or tpr M
(SEQ ID NO:110), was identified. All sequences were identical and this sequence is not found in the Nichols genome. Primers, specific for msp 13 (SEQ ID NO:110), were then designed: sense 5' cactagtcttggggacacgc (SEQ ID NO:111); antisense 5' tacgtgattgcaaccagga (SEQ ID N0:112). Msp 13 appears to be most closely related to msp 4/5 (tpr C/D) in Subfamily II.

WO 99/53099 PGT/US99/0'7886 While the preferred embodiment of the invention has been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention.

SEQUENCE LISTING
<110> Van Voorhis, Wesley C.
Lukehart, Sheila A.
Centurion-Lara, Glaber A.
Cameron, Caroline E. Stebeck <120> Recombinant Proteins of Treponema Pallidum and Their Use for a Syphilis Vaccine <I30> uofw-1-13643 <140>
<141>
<150> 09/058968 <151> 1998-04-10 <160> 112 <170> PatentIn Ver. 2.0 <210> 1 <211> 1159 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (75)..(1145) <223> Amino acid sequence of T. pallidum sub. pallidum Glycerophosphodiester Phosphodiesterase <400> 1 cagtggagat atgcggcgtg ctactatgca cggtgacgat ctgtgcattc tataacaggg 60 gaggagagaa gttt atg cgg gga aca tat tgt gtg acg ctt tgg ggg ggg 110 Met Arg Gly Thr Tyr Cys Val Thr Leu Trp Gly Gly gtg ttt gcg gca ttg gtt gca ggc tgt gcg tcc gaa cgt atg ata gtt 158 Val Phe Ala Ala Leu Val Ala Gly Cys Ala Ser Glu Arg Met Ile Val gcg tat cgg ggc get gca gga tat gtg ccc gag cac acc ttt gcc tcg 206 Ala Tyr Arg Gly Ala Ala Gly Tyr Val Pro Glu His Thr Phe Ala Ser aaa gtt ctt get ttt gca caa gga gca gat tac ctg cag cag gat gtc 254 Lys Val Leu Ala Phe Ala Gln Gly Ala Asp Tyr Leu Gln Gln Asp Val gtg ctt tca aag gat aat cag ctt atc gta gcg caa agc cat att ctg 302 Val Leu Ser Lys Asp Asn Gln Leu Ile Val Ala Gln Ser His Ile Leu gat aat atg act gac gtg gca gaa aaa ttt cca cgc cgg cag cgt gcg 350 Asp Asn Met Thr Asp Val Ala Glu Lys Phe Pro Arg Arg Gln Arg Ala gatgggcat ttctatgtc atagatttt acggtagaagaa ctttcc ctc 398 AspGlyHis PheTyrVal IleAspPhe ThrValGluGlu LeuSer Leu ctccgtgca accaatagt ttctatacg cgcggtaagcga catacg ccg 496 LeuArgAla ThrAsnSer PheTyrThr ArgGlyLysArg HisThr Pro gtgtatggc cagcgcttt cctctttgg aagcctggtttt aggctg cac 494 ValTyrGly GlnArgPhe ProLeuTrp LysProGlyPhe ArgLeu His acttttgaa gaggagttg cagtttatc cgtgggttggaa cagaca acc 542 ThrPheGlu GluGluLeu GlnPheIle ArgGlyLeuGlu GlnThr Thr gggaaaaag attggaatt tactctgaa ataaaggtgccg tggttt cat 590 GlyLysLys IleGlyIle TyrSerGlu IleLysValPro TrpPhe His catcaggaa ggaaaagac atcgcagcg cttaccctcget ctgttg aaa 638 HisGlnGlu GlyLysAsp IleAlaAla LeuThrLeuAla LeuLeu Lys aaatacggt taccaaagt cgatcggat ctagtgtatgtg caaacg tat 686 LysTyrGly TyrGlnSer ArgSerAsp LeuValTyrVal GlnThr Tyr gattttaac gagctgaag cgtatcaaa cgagaactttta ccaaag tac 734 AspPheAsn GluLeuLys ArgIleLys ArgGluLeuLeu ProLys Tyr gaaatgaac gtgaagctg attcagcgt gttgettacaca gatcaa cgt 782 GluMetAsn ValLysLeu IleGlnArg ValAlaTyrThr AspGln Arg gaaacacag gagaaggac tcgcgtggg aaatggataaac tacaat tac 830 GluThrGln GluLysAsp SerArgGly LysTrpIleAsn TyrAsn Tyr aattggatg tttgagccc ggtggtatg cagaaaatagca aaatat gca 878 AsnTrpMet PheGluPro GlyGlyMet GlnLysIleAla LysTyr Ala gacggcgtg ggtcctgac tggaggatg ctcatagagaat gaatgg tcg 926 AspGlyVal GlyProAsp TrpArgMet LeuIleGluAsn GluTrp Ser aaggtgggc getgttcgc ctgagtccg atggtttctgca atccaa gat 974 LysValGly AlaValArg LeuSerPro MetValSerAla IleGln Asp gcgaaattg gaatgtcat gtgcacacg gtacggaaagaa acactg cct 1022 AlaLysLeu GluCysHis ValHisThr ValArgLysGlu ThrLeu Pro agc tac gcg cgc acc atg gac gag atg ttt tcc att ttg ttc aaa cag 1070 Ser Tyr Ala Arg Thr Met Asp Glu Met Phe Ser Ile Leu Phe Lys Gln acg ggc gca aac gtg gtg ctc acg gat ttt cct gat ctt ggg gta aag 1118 Thr Gly Ala Asn Val Val Leu Thr Asp Phe Pro Asp Leu Gly Val Lys ttt ctg ggc aaa ccc gcc cgc tat tga ccggcttctg tgta 1159 Phe Leu Gly Lys Pro Ala Arg Tyr <210>

<211>

<212>
PRT

<213> pallidum Treponema <400>

Met Gly ThrTyrCys ValThrLeu TrpGlyGly ValPheAla Ala Arg Leu Ala GlyCysAla SerGluArg MetIleVal AlaTyrArg Gly Val Ala Gly TyrValPro GluHisThr PheAlaSer LysValLeu Ala Ala Phe Gln GlyAlaAsp TyrLeuGln GlnAspVal ValLeuSer Lys Ala Asp Gln LeuIleVal AlaGlnSer HisIleLeu AspAsnMet Thr Asn Asp Ala GluLysPhe ProArgArg GlnArgAla AspGlyHis Phe Val Tyr Ile AspPheThr ValGluGlu LeuSerLeu LeuArgAla Thr Val Asn Phe TyrThrArg GlyLysArg HisThrPro ValTyrGly Gln Ser Arg Pro LeuTrpLys ProGlyPhe ArgLeuHis ThrPheGlu Glu Phe Glu Gln PheIleArg GlyLeuGlu GlnThrThr GlyLysLys Ile Leu Gly Tyr SerGluIle LysValPro TrpPheHis HisGlnGlu Gly Ile Lys Ile AlaAlaLeu ThrLeuAla LeuLeuLys LysTyrGly Tyr Asp Gln Arg SerAspLeu ValTyrVal GlnThrTyr AspPheAsn Glu Ser WO 99/53099 PCT/US99/0~886 Leu Lys Arg Ile Lys Arg Glu Leu Leu Pro Lys Tyr Glu Met Asn Val Lys Leu Ile Gln Arg Val Ala Tyr Thr Asp Gln Arg Glu Thr Gln Glu Lys Asp Ser Arg Gly Lys Trp Ile Asn Tyr Asn Tyr Asn Trp Met Phe Glu Pro Gly Gly Met Gln Lys Ile Ala Lys Tyr Ala Asp Gly Val Gly Pro Asp Trp Arg Met Leu Ile Glu Asn Glu Trp Ser Lys Val Gly Ala Val Arg Leu Ser Pro Met Val Ser Ala Ile Gln Asp Ala Lys Leu Glu Cys His Val His Thr Val Arg Lys Glu Thr Leu Pro Ser Tyr Ala Arg Thr Met Asp Glu Met Phe Ser Ile Leu Phe Lys Gln Thr Gly Ala Asn Val Val Leu Thr Asp Phe Pro Asp Leu Gly Val Lys Phe Leu Gly Lys Pro Ala Arg Tyr <210> 3 <211> 2514 <212> DNA

<213> Treponema pallidum <220>

<221> CDS

<222> (1)..(2514) <223> Aminoacid Pallidum sequence sub.
of pallidum T.

D15/Oma87 homologue.

<400> 3 atg ctc aaagccagt ttcctaatt gcaagt tgttgtgtg atg 48 aaa gcc Met Leu LysAlaSer PheLeuIle AlaSer CysCysVal Met Lys Ala tcg ctg tgggcacag aacgacaat tggtac gagggaaag cct 96 gcg gca Ser Leu TrpAlaGln AsnAspAsn TrpTyr GluGlyLys Pro Ala Ala atc tct attagtttt gggctcgaa tatatt getcgcggc cag 144 gcg gag Ile Ser IleSerPhe GlyLeuGlu TyrIle AlaArgGly Gln Ala Glu ttg gac attttttct tacaaggga caaaag tggacctat gag 192 acg caa Leu Asp IlePheSer TyrLysGly GlnLys TrpThrTyr Glu Thr Gln ctg tac ctg gag ata ctg caa aag gtc tat gac ctt gag tac ttt tct 240 Leu Tyr Leu Glu Ile Leu Gln Lys Val Tyr Asp Leu Glu Tyr Phe Ser gaa gtt tcg cct aag gcg gtg ccc acc gat ccg gag tat cag tat gtg 288 Glu Val Ser Pro Lys Ala Val Pro Thr Asp Pro Glu Tyr Gln Tyr Val atg cta cag ttc acg gta aag gag cgt cct tcg gtg aag ggc atc aag 336 Met Leu Gln Phe Thr Val Lys Glu Arg Pro Ser Val Lys Gly Ile Lys atg gta ggg aac agc caa atc cgc agt ggg gac ctt ttg tct aaa atc 384 Met Val Gly Asn Ser Gln Ile Arg Ser Gly Asp Leu Leu Ser Lys Ile ctc ctg aaa aag gga gac att tac aat gaa gta aag atg aag gtg gac 432 Leu Leu Lys Lys Gly Asp Ile Tyr Asn Glu Val Lys Met Lys Val Asp caa gag tcg ctc agg cgt cat tac ctg gac cag ggc tat gcg gcg gtt 480 Gln Glu Ser Leu Arg Arg His Tyr Leu Asp Gln Gly Tyr Ala Ala Val aag ata tcc tgc gag gca aaa act gag gcg ggg ggc gtg gtg gta cag 528 Lys Ile Ser Cys Glu Ala Lys Thr Glu Ala Gly Gly Val Val Val Gln ttt acc atc cag gaa ggt aag cag act gtt gtc tcg cgg ata cag ttt 576 Phe Thr Ile Gln Glu Gly Lys Gln Thr Val Val Ser Arg Ile Gln Phe aag gga aat aag gcg ttt acc gag tcg gtg ctc aag aag gtg ctt tcc 624 Lys Gly Asn Lys Ala Phe Thr Glu Ser Val Leu Lys Lys Val Leu Ser acg cag gag gcg cgt ttt ttg acc agt ggg gtg ttc aag gag aat gcg 672 Thr Gln Glu Ala Arg Phe Leu Thr Ser Gly Val Phe Lys Glu Asn Ala ctg gaa gcg gat aag gcg gca gtc cac tca tac tat gca gag agg gga 720 Leu Glu Ala Asp Lys Ala Ala Val His Ser Tyr Tyr Ala Glu Arg Gly tac att gac gcg cgg gta gaa ggc gtg gca aag acg gtt gat aaa aaa 768 Tyr Ile Asp Ala Arg Val Glu Gly Val Ala Lys Thr Val Asp Lys Lys act gac gcc agt cgc aat ctg gtt acg ctt acg tac act gtg gtg gaa 816 Thr Asp Ala Ser Arg Asn Leu Val Thr Leu Thr Tyr Thr Val Val Glu ggt gag cag tac cgc tac ggc ggg gtt acc att gtg ggt aac cag att 864 Gly Glu Gln Tyr Arg Tyr Gly Gly Val Thr Ile Val Gly Asn Gln Ile ttt agc acc gag gag ctg cag gca aaa att agg ctc aag cgc ggg gcc 912 Phe Ser Thr Glu Glu Leu Gln Ala Lys Ile Arg Leu Lys Arg Gly Ala atc atg aat atg gtg gcc ttt gag cag ggc ttt cag gcg ctg gcg gat 960 Ile Met Asn Met Val Ala Phe Glu Gln Gly Phe Gln Ala Leu Ala Asp gcg tat ttt gaa aac gga tac acg tca aat tac ctg aac aaa gaa gaa 1008 Ala Tyr Phe Glu Asn Gly Tyr Thr Ser Aan Tyr Leu Asn Lys Glu Glu cac cgg gac acg gcg gag aaa acg ctt tcg ttt-aag atc acg gtg gtg 1056 His Arg Asp Thr Ala Glu Lys Thr Leu Ser Phe Lys Ile Thr Val Val gag cgc gag cgc agc cac gtc gag cac att atc att aag gga acg aag 1104 Glu Arg Glu Arg Ser His Val Glu His Ile Ile Ile Lys Gly Thr Lys aat aca aaa gac gag gtt atc ctg cgt gaa atg ctg ctg aaa ccg ggg 1152 Asn Thr Lys Asp Glu Val Ile Leu Arg Glu Met Leu Leu Lys Pro Gly gat gtg ttc tct aag tca aag ttt acg gat agc ttg cgc aat ctg ttc 1200 Asp Val Phe Ser Lys Ser Lys Phe Thr Asp Ser Leu Arg Asn Leu Phe aac ctg cgc tat ttc tcg tcg ctg gtg ccg gat gtg cgg ccc ggc tct 1248 Asn Leu Arg Tyr Phe Ser Set Leu Val Pro Asp Val Arg Pro Gly Ser gag cag gac ctg gtg gac att atc ctg aat gtg gag gag cag tcg acg 1296 Glu Gln Asp Leu Val Asp Ile Ile Leu Asn Val Glu Glu Gln Ser Thr gca aac gtg cag ttt ggg gtg acg ttt tct ggg gtg ggg gag gca ggc 1344 Ala Asn Val Gln Phe Gly Val Thr Phe Ser Gly Val Gly Glu Ala Gly acg ttc ccg ctt tcg ctc ttt tgt cag tgg gaa gaa aag aat ttt ttg 1392 Thr Phe Pro Leu Ser Leu Phe Cys Gln Trp Glu Glu Lys Asn Phe Leu gga aaa ggg aat gaa att tca gta aat gca acc ttg ggg tct gag gcg 1440 Gly Lys Gly Asn Glu Ile Ser Val Asn Ala Thr Leu Gly Ser Glu Ala cag agc ctg aag ctc ggg tat gtg gag cgc tgg ttt ctg ggc tct ccg 1488 Gln Ser Leu Lys Leu Gly Tyr Val Glu Arg Trp Phe Leu Gly Ser Pro ctg acg gtg ggc ttt gac ttt gaa ctt acg cac aaa aat ctc ttt gtg 1536 Leu Thr Val Gly Phe Asp Phe Glu Leu Thr His Lys Asn Leu Phe Val tac cgc gcg ggt tca tac ggc aac ggg ctg ccg cac ccg tac acg agc 1584 Tyr Arg Ala Gly Ser Tyr Gly Asn Gly Leu Pro His Pro Tyr Thr Ser -?-agg gag cag tgg get agt tcc cct ggg ctg gca gaa tcg ttt cgc ctc 1632 Arg Glu Gln Trp Ala Ser Ser Pro Gly Leu Ala Glu Ser Phe Arg Leu aag tat tcg cgc ttt gag tcc gcc atc ggc gcg cac acc ggg tac cag 1680 Lys Tyr Ser Arg Phe Glu Ser Ala Ile Gly Ala His Thr Gly Tyr Gln t tat ccg cgc tat gcg gtc att agg gtg aac ggg ggg gtg gac ttt 1728 gg Val Asn Gly Gly Val Asp Phe Trp Tyr Pro Arg Tyr Ala Val Ile Arg cgg gtt gta aag aat ttt tac gat aag gat aac aat cag ccc ttc gac 1776 Arg Val Val Lys Asn Phe Tyr Asp Lys Asp Asn Asn Gln Pro Phe Asp ctg acc gta aaa gag cag ctg aac tgg acc agt atc aat tcg ttt tgg 1824 Leu Thr Val Lys Glu Gln Leu Asn Trp Thr Ser Ile Asn Ser Phe Trp acg agc gtt tcg ttt gac ggg cgt gac ttt gcg tac gac ccg tcc agc 1872 Thr Ser Val Ser Phe Asp Gly Arg Asp Phe Ala Tyr Asp Pro Ser Ser ggc tgg ttt tta gga cag cgc tgt acg ttc aac ggg ctc gtt ccc ttt 1920 Gly Trp Phe Leu Gly Gln Arg Cys Thr Phe Asn Gly Leu Val Pro Phe ctc gaa aaa gag cat tcg ttt cgc tcc gac acc aag gcc gag ttc tac 1968 Leu Glu Lys Glu His Ser Phe Arg Ser Asp Thr Lys Ala Glu Phe Tyr gtt acc ctg ctc aat tat ccg gtc tct gcc gtg tgg aac tta aag ttt 2016 Val Thr Leu Leu Asn Tyr Pro Val Ser Ala Val Trp Asn 67u0 Lys Phe gtc ttg get ttc tac acc ggt gtg tcc gtt caa acg tat tat gga cgg 2064 Val Leu Ala Phe Tyr Thr Gly Val Ser Val Gln Thr Tyr Tyr Gly Arg agg aaa agc gaa aac gga aag ggc aac ggg gtg cgg tcc ggc gcg ctg 2112 Arg Lys Ser Glu Asn Gly Lys Gly Asn Gly Val Arg Ser Gly Ala Leu gta ata gac ggc gtg ctg gta ggg cgc ggg tgg agc gaa gac gca aag 2160 Val Ile Asp Gly Val 7iu0 Val Gly Arg Gly ~i5 Ser Glu Asp ~a ?20 aaa aac acc gga gac ctg ctg ctc cac cac tgg att gag ttc cgc tgg 2208 Lys Asn Thr Gly Asp Leu Leu Leu His His Trp Ile Glu Phe Arg Trp ccg ctg gcg cac ggc att gtg tcc ttt gac ttt ttc ttt gat gcg gca 2256 Pro Leu Ala His Gly Ile Val Ser Phe Asp Phe Phe Phe Asp A1a Ala atg gtg tac aac atc gaa agt cag tcc cca aac ggg tca tcg tcc gcc 2309 _g_ MetValTyr Ile GluSerGlnSer Pro Gly SerSerSer Asn Asn Ala agcagctcc agcagc agcagtagtagt agcagtaga accaccagc tct 2352 SerSerSer SerSer SerSerSerSer SerSerArg Thr,ThrSer Ser gaaggactg tacaaa atgagctacggt ccggggctg cgctttaca ttg 2400 GluGlyLeu TyrLys MetSerTyrGly ProGlyLeu ArgPheThr Leu ccgcaattt ccgtta aaattggcgttc gcaaacacc ttcacgtca ccc 2448 ProGlnPhe ProLeu LysLeuAlaPhe AlaAsnThr PheThrSer Pro ggcggcatc ccaaaa acaaagaaaaat tggaatttt gtgttgtcg ttc 2496 GlyGlyIle ProLys ThrLysLysAsn TrpAsnPhe ValLeuSer Phe acggtaaat aatttg tag ThrValAsn AsnLeu <210> 4 <211> 837 <212> PRT

<213> Treponemapallidum <400> 4 s LysAla Phe LeuIle SerCysCys ValMet t Leu L Ser Ala M Ala y 5 10 15 e Ser Leu TrpAla Asn Asp TyrGluGly LysPro Ala Gln Asn Ala Trp Ile Ser IleSer GluGly LeuGlu IleAlaArg GlyGln Ala Phe Tyr Leu Asp IlePhe GlnTyr LysGly LysTrpThr TyrGlu Thr Ser Gln Leu Tyr GluIle GlnLys ValTyr LeuGluTyr PheSer Leu Leu Asp Glu Val ProLys ValPro ThrAsp GluTyrGln TyrVal Ser Ala Pro Met Leu PheThr LysGlu ArgPro ValLysGly IleLys Gln Val Ser Met Val AsnSer IleArg SerGly LeuLeuSer LysIle Gly Gln Asp Leu Leu LysGly IleTyr AsnGlu LysMetLys ValAsp Lys Asp Val Gln Glu LeuArg HisTyr LeuAsp GlyTyrAla AlaVal Ser Arg Gln Lys Ile Ser Cys Glu Ala Lys Thr Glu Ala Gly Gly Val Val Val Gln Phe Thr Ile Gln Glu Gly Lys Gln Thr Val Val Ser Arg Ile Gln Phe Lys Gly Asn Lys Ala Phe Thr Glu Ser Val Leu Lys Lys Val Leu Ser Thr Gln Glu Ala Arg Phe Leu Thr Ser Gly Val Phe Lys Glu Asn Ala Leu Glu Ala Asp Lys Ala Ala Val His Ser Tyr Tyr Ala Glu Arg Gly Tyr Ile Asp Ala Arg Val Glu Gly Val Ala Lys Thr Val Asp Lys Lys Thr Asp Ala Ser Arg Asn Leu Val Thr Leu Thr Tyr Thr Val Val Glu Gly Glu Gln Tyr Arg Tyr Gly Gly Val Thr Ile Val Gly Asn Gln Ile Phe Ser Thr Glu Glu Leu Gln Ala Lys Ile Arg Leu Lys Arg Gly Ala Ile Met Asn Met Val Ala Phe Glu Gln Gly Phe Gln Ala Leu Ala Asp Ala Tyr Phe Glu Asn Gly Tyr Thr Ser Asn Tyr Leu Asn Lys Glu Glu His Arg Asp Thr Ala Glu Lys Thr Leu Ser Phe Lys Ile Thr Val Val Glu Arg Glu Arg Ser His Val Glu His Ile Ile Ile Lys Gly Thr Lys Asn Thr Lys Asp Glu Val Ile Leu Arg Glu Met Leu Leu Lys Pro Gly Asp Val Phe Ser Lys Ser Lys Phe Thr Asp Ser Leu Arg Asn Leu Phe Asn Leu Arg Tyr Phe Ser Ser Leu Val Pro Asp Val Arg Pro Qis Ser Glu Gln Asp Leu Val Asp Ile Ile Leu Asn Val Glu Glu Gln Ser Thr Ala Asn Val Gln Phe Gly Val Thr Phe Ser Gly Val Gly Glu Ala Gly Thr Phe Pro Leu Ser Leu Phe Cys Gln Trp Glu Glu Lys Asn Phe Leu Gly Lys Gly Asn Glu Ile Ser Val Asn Ala Thr Leu Gly Ser Glu Ala Gln Ser Leu Lys Leu Gly Tyr Val Glu Arg Trp Phe Leu Gly Ser Pro.

Leu Thr Val Gly Phe Asp Phe Glu Leu Thr His Lys Asn Leu Phe Val Tyr Arg Ala Gly Ser Tyr Gly Asn Gly Leu Pro His Pro Tyr Thr Ser Arg Glu Gln Trp Ala Ser Ser Pro Gly Leu Ala Glu Ser Phe Arg Leu Lys Tyr Ser Arg Phe Glu Ser Ala Ile Gly Ala His Thr Gly Tyr Gln Trp Tyr Pro Arg Tyr Ala Val Ile Arg Val Asn Gly Gly Val Asp Phe Arg Val Val Lys Asn Phe Tyr Asp Lys Asp Asn Asn Gln Pro Phe Asp Leu Thr Val Lys Glu Gln Leu Asn Trp Thr Ser Ile Asn Ser Phe Trp Thr Ser Val Ser Phe Asp Gly Arg Asp Phe Ala Tyr Asp Pro Ser Ser Gly Trp Phe Leu Gly Gln Arg Cys Thr Phe Asn Gly Leu Val Pro Phe Leu Glu Lys Glu His Ser Phe Arg Ser Asp Thr Lys Ala Glu Phe Tyr Val Thr Leu Leu Asn Tyr Pro Val Ser Ala Val Trp Asn Leu Lys Phe Val Leu Ala Phe Tyr Thr Gly Val Ser Val Gln Thr Tyr Tyr Gly Arg Arg Lys Ser Glu Asn Gly Lys Gly Asn Gly Val Arg Ser Gly Ala Leu Val Ile Asp Gly Val Leu Val Gly Arg Gly Trp Ser Glu Asp Ala Lys Lys Asn Thr Gly Asp Leu Leu Leu His His Trp Ile Glu Phe Arg Trp Pro Leu Ala His Gly Ile Val Ser Phe Asp Phe Phe Phe Asp Ala Ala Met Val Tyr Asn Ile Glu Ser Gln Ser Pro Asn Gly Ser Ser Ser Ala WO 99!53099 PCT/US99/07886 Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Arg Thr Thr Ser Ser 770 775 ?80 Glu Gly Leu Tyr Lys Met 5er Tyr Gly Pro Gly Leu Arg Phe Thr Leu Pro Gln Phe Pro Leu Lys Leu Ala Phe Ala Asn Thr Phe Thr Ser Pro Gly Gly Ile Pro Lys Thr Lys Lys Asn Trp Asn Phe Val Leu Ser Phe Thr Val Asn Asn Leu <210> 5 <211> 2439 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(2439) <223> Coding region for portion of D15/Gnna87 used in vaccine testing.
<400> 5 aat tgg tac gag gga aag cct atc tct gcg att agt ttt gag ggg ctc 48 Asn Trp Tyr Glu Gly Lys Pro Ile Ser Ala Ile Ser Phe Glu Gly Leu gaa tat att get cgc ggc cag ttg gac acg att ttt tct caa tac aag 96 Glu Tyr Ile Ala Arg Gly Gln Leu Asp Thr Ile Phe Ser Gln Tyr Lys gga caa aag tgg acc tat gag ctg tac ctg gag ata ctg caa aag gtc 144 Gly Gln Lys Trp Thr Tyr Glu Leu Tyr Leu Glu Ile Leu Gln Lys Val tat gac ctt gag tac ttt tct gaa gtt tcg cct aag gcg gtg ccc acc 192 Tyr Asp Leu Glu Tyr Phe Ser Glu Val Ser Pro Lys Ala Val Pro Thr gat ccg gag tat cag tat gtg atg cta cag ttc acg gta aag gag cgt 240 Asp Pro Glu Tyr Gln Tyr Val Met Leu Gln Phe Thr Val Lys Glu Arg cct tcg gtg aag ggc atc aag atg gta ggg aac agc caa atc cgc agt 288 Pro Ser Val Lys Gly Ile Lys Met Val Gly Asn Ser Gln Ile Arg Ser ggg gac ctt ttg tct aaa atc ctc ctg aaa aag gga gac att tac aat 336 Gly Asp Leu Leu Ser Lys Ile Leu Leu Lys Lys Gly Asp Ile Tyr Asn gaa gta aag atg aag gtg gac caa gag tcg ctc agg cgt cat tac ctg 384 Glu Val Lys Met Lys Val Asp Gln Glu Ser Leu Arg Arg His Tyr Leu gaccagggc tatgcggcggtt aagatatcc tgcgaggca aaaact gag 432 AspGlnGly TyrAlaAlaVal LysIleSer CysGluAla LysThr Glu gcggggggc gtggtggtacag tttaccatc caggaaggt aagcag act 480 AlaGlyGly ValValValGln PheThrIle GlnGluGly LysGln Thr gttgtctcg cggatacagttt aagggaaat aaggcgttt accgag tcg 528 ValValSer ArgIleGlnPhe LysGlyAsn LysAlaPhe ThrGlu Ser gtgctcaag aaggtgctttcc acgcaggag gcgcgtttt ttgacc agt 576 ValLeuLys LysValLeuSer ThrGlnGlu AlaArgPhe LeuThr Ser ggggtgttc aaggagaatgcg ctggaagcg gataaggcg gcagtc cac 624 GlyValPhe LysGluAsnAla LeuGluAla AspLysAla AlaVal His tcatactat gcagagagggga tacattgac gcgcgggta gaaggc gtg 672 SerTyrTyr AlaGluArgGly TyrIleAsp AlaArgVal GluGly Val gcaaagacg gttgataaaaaa actgacgcc agtcgcaat ctggtt acg 720 AlaLysThr ValAspLysLys ThrAspAla SerArgAsn LeuVal Thr cttacgtac actgtggtggaa ggtgagcag taccgctac ggcggg gtt 768 LeuThrTyr ThrValValGlu GlyGluGln TyrArgTyr GlyGly Val accattgtg ggtaaccagatt tttagcacc gaggagctg caggca aaa 816 ThrIleVal GlyAsnGlnIle PheSerThr GluGluLeu GlnAla Lys attaggctc aagcgcggggcc atcatgaat atggtggcc tttgag cag 864 IleArgLeu LysArgGlyAla IleMetAsn MetValAla PheGlu Gln ggctttcag gcgctggcggat gcgtatttt gaaaacgga tacacg tca 912 GlyPheGln AlaLeuAlaAsp AlaTyrPhe GluAsnGly TyrThr Ser aattacctg aacaaagaagaa caccgggac acggcggag aaaacg ctt 960 AsnTyrLeu AsnLysGluGlu HisArgAsp ThrAlaGlu LysThr Leu tcgtttaag atcacggtggtg gagcgcgag cgcagccac gtcgag cac 1008 SerPheLys IleThrValVal GluArgGlu ArgSerHis ValGlu His attatcatt aagggaacgaag aatacaaaa gacgaggtt atcctg cgt 1056 IleIleIle LysGlyThrLys AsnThrLys AspGluVal IleLeu Arg gaaatgctg ctgaaaccg ggggatgtg ttctctaag tcaaagttt acg 1104 GluMetLeu LeuLysPro GlyAspVal PheSerLys SerLysPhe Thr gatagcttg cgcaatctg ttcaacctg cgctatttc tcgtcgctg gtg 1152 AspSerLeu ArgAsnLeu PheAsnLeu ArgTyrPhe SerSerLeu Val ccggatgtg cggcccggc tctgagcag gacctggtg gacattatc ctg 1200 ProAspVal ArgProGly SerGluGln AspLeuVal AspIleIle Leu aatgtggag gagcagtcg acggcaaac gtgcagttt ggggtgacg ttt 1248 AsnValGlu GluGlnSer ThrAlaAsn ValGlnPhe GlyValThr Phe tctggggtg ggggaggca ggcacgttc ccgctttcg ctcttttgt cag 1296 SerGlyVal GlyGluAla GlyThrPhe ProLeuSer LeuPheCys Gln tgggaagaa aagaatttt ttgggaaaa gggaatgaa atttcagta aat 1394 TrpGluGlu LysAsnPhe LeuGlyLys GlyAsnGlu IleSerVal Asn gcaaccttg gggtctgag gcgcagagc ctgaagctc gggtatgtg gag 1392 AlaThrLeu GlySerGlu AlaGlnSer LeuLysLeu GlyTyrVal Glu cgctggttt ctgggctct ccgctgacg gtgggcttt gactttgaa ctt 1440 ArgTrpPhe LeuGlySer ProLeuThr ValGlyPhe AspPheGlu Leu acgcacaaa aatctcttt gtgtaccgc gcgggttca tacggcaac ggg 1488 ThrHisLys AsnLeuPhe ValTyrArg AlaGlySer TyrGlyAsn Gly ctgccgcac ccgtacacg agcagggag cagtggget agttcccct ggg 1536 LeuProHis ProTyrThr SerArgGlu GlnTrpAla SerSerPro Gly ctggcagaa tcgtttcgc ctcaagtat tcgcgcttt gagtccgcc atc 1584 LeuAlaGlu SerPheArg LeuLysTyr SerArgPhe GluSerAla Ile ggcgcgcac accgggtac cagtggtat ccgcgctat gcggtcatt agg 1632 GlyAlaHis ThrGlyTyr GlnTrpTyr ProArgTyr AlaValIle Arg gtgaacggg ggggtggac tttcgggtt gtaaagaat ttttacgat aag 1680 ValAsnGly GlyValAsp PheArgVal ValLysAsn PheTyrAsp Lys gataacaat cagcccttc gacctgacc gtaaaagag cagctgaac tgg 1728 AspAsnAsn GlnProPhe AspLeuThr ValLysGlu GlnLeuAsn Trp accagtatc aattcgttt tggacgagc gtttcgttt gacgggcgt gac 1776 ThrSerIle AsnSerPhe TrpThrSer ValSerPhe AspGlyArg Asp tttgcgtac gacccgtcc agcggctgg tttttagga cagcgctgt acg 1824 PheAlaTyr AspProSer SerGlyTrp PheLeuGly GlnArgCys Thr ttcaacggg ctcgttccc tttctcgaa aaagagcat tcgtttcgc tcc 1872 PheAsnGly LeuValPro PheLeuGlu LysGluHis SerPheArg Ser gacaccaag gccgagttc tacgttacc ctgctcaat tatccggtc tct 1920 AspThrLys AlaGluPhe TyrValThr LeuLeuAsn TyrProVal Ser gccgtgtgg aacttaaag tttgtcttg getttctac accggtgtg tcc 1968 AlaValTrp AsnLeuLys PheValLeu AlaPheTyr ThrGlyVal Ser gttcaaacg tattatgga cggaggaaa agcgaaaac ggaaagggc aac 2016 ValGlnThr TyrTyrGly ArgArgLys SerGluAsn GlyLysGly Asn ggggtgcgg tccggcgcg ctggtaata gacggcgtg ctggtaggg cgc 2064 GlyValArg SerGlyAla LeuValIle AspGlyVal LeuValGly Arg gggtggagc gaagacgca aagaaaaac accggagac ctgctgctc cac 2112 GlyTrpSer GluAspAla LysLysAsn ThrGlyAsp LeuLeuLeu His cactggatt gagttccgc tggccgctg gcgcacggc attgtgtcc ttt 2160 HisTrpIle GluPheArg TrpProLeu AlaHisGly IleValSer Phe 705 710 715 ?20 gactttttc tttgatgcg gcaatggtg tacaacatc gaaagtcag tcc 2208 AspPhePhe PheAspAla AlaMetVal TyrAsnIle GluSerGln Ser ccaaacggg tcatcgtcc gccagcagc tccagcagc agcagtagt agt 2256 ProAsnGly SerSerSer AlaSerSer SerSerSer SerSerSer Ser agcagtaga accaccagc tctgaagga ctgtacaaa atgagctac ggt 2304 SerSerArg ThrThrSer SerGluGly LeuTyrLys MetSerTyr Gly ccggggctg cgctttaca ttgccgcaa tttccgtta aaattggcg ttc 2352 ProGlyLeu ArgPheThr LeuProGln PheProLeu LysLeuAla Phe gcaaacacc ttcacgtca cccggcggc atcccaaaa acaaagaaa aat 2400 AlaAsnThr PheThrSer ProGlyGly IleProLys ThrLysLys Asn tggaatttt gtgttgtcg ttcacggta aataatttg tag 2439 TrpAsnPhe ValLeuSer PheThrVal AsnAsnLeu <210> 6 <211> 812 <212> PRT
<213> Treponema pallidum <400> 6 Asn Trp Tyr Glu Gly Lys Pro Ile Ser Ala Ile Ser Phe Glu Gly Leu Glu Tyr Ile Ala Arg Gly Gln Leu Asp Thr Ile Phe Ser Gln Tyr Lys Gly Gln Lys Trp Thr Tyr Glu Leu Tyr Leu Glu Ile Leu Gln Lys Val Tyr Asp Leu Glu Tyr Phe Ser Glu Val Ser Pro Lys Ala Val Pro Thr Asp Pro Glu Tyr Gln Tyr Val Met Leu Gln Phe Thr Val Lys Glu Azg Pro Ser Val Lys Gly Ile Lys Met Val Gly Asn Ser Gln Ile Arg Ser Gly Asp Leu Leu Ser Lys Ile Leu Leu Lys Lys Gly Asp Ile Tyr Asn Glu Val Lys Met Lys Val Asp Gln Glu Ser Leu Arg Arg His Tyr Leu Asp Gln Gly Tyr Ala Ala Val Lys Ile Ser Cys Glu Ala Lys Thr Glu Ala Gly Gly Val Val Val Gln Phe Thr Ile Gln Glu Gly Lys Gln Thr Val Val Ser Arg Ile Gln Phe Lys Gly Asn Lys Ala Phe Thr Glu Ser Val Leu Lys Lys Val Leu Ser Thr Gln Glu Ala Arg Phe Leu Thr Ser Gly Val Phe Lys Glu Asn Ala Leu Glu Ala Asp Lys Ala Ala Val His Ser Tyr Tyr Ala Glu Arg Gly Tyr Ile Asp Ala Arg Val Glu Gly Val Ala Lys Thr Val Asp Lys Lys Thr Asp Ala Ser Arg Asn Leu Val Thr Leu Thr Tyr Thr Val Val Glu Gly Glu Gln Tyr Arg Tyr Gly Gly Val Thr Ile Val Gly Asn Gln Ile Phe Ser Thr Glu Glu Leu Gln Ala Lys Ile Arg Leu Lys Arg Gly Ala Ile Met Asn Met Val Ala Phe Glu Gln Gly Phe Gln Ala Leu Ala Asp Ala Tyr Phe Glu Asn Gly Tyr Thr Ser Asn Tyr Leu Asn Lys Glu Glu His Arg Asp Thr Ala Glu Lys Thr Leu Ser Phe Lys Ile Thr Val Val Glu Arg Glu Arg Ser His Val Glu His Ile Ile Ile Lys Gly Thr Lys Asn Thr Lys Asp Glu Val Ile Leu Arg Glu Met Leu Leu Lys Pro Gly Asp Val Phe Ser Lys Ser Lys Phe Thr Asp Ser Leu Arg Asn Leu Phe Asn Leu Arg Tyr Phe Ser Ser Leu Val Pro Asp Val Arg Pro Gly Ser Glu Gln Asp Leu Val Asp Ile Ile Leu Asn Val Glu Glu Gln Ser Thr Ala Asn Val Gln Phe Gly Val Thr Phe Ser Gly Val Gly Glu Ala Gly Thr Phe Pro Leu Ser Leu Phe Cys Gln Trp Glu Glu Lys Asn Phe Leu Gly Lys Gly Asn Glu Ile Ser Val Asn Ala Thr Leu Gly Ser Glu Ala Gln Ser Leu Lys Leu Gly Tyr Val Glu Arg Trp Phe Leu Gly Ser Pro Leu Thr Val Gly Phe Asp Phe Glu Leu Thr His Lys Asn Leu Phe Val Tyr Arg Ala Gly Ser Tyr Gly Asn Gly Leu Pro His Pro Tyr Thr Ser Arg Glu Gln Trp Ala Ser Ser Pro Gly Leu Ala Glu Ser Phe Arg Leu Lys Tyr Ser Arg Phe Glu Ser Ala Ile Gly Ala His Thr Gly Tyr Gln Trp Tyr Pro Arg Tyr Ala Val Ile Arg Val Asn Gly Gly Val Asp Phe Arg Val Val Lys Asn Phe Tyr Asp Lys Asp Asn Asn Gln Pro Phe Asp Leu Thr Val Lys Glu Gln Leu Asn Trp Thr Ser Ile Asn Ser Phe Trp Thr Ser Val Ser Phe Asp Gly Arg Asp Phe Ala Tyr Asp Pro Ser Ser Gly Trp Phe Leu Gly Gln Arg Cys Thr Phe Asn Gly Leu Val Pro Phe Leu Glu Lys Glu His Ser Phe Arg Ser Asp Thr Lys Ala Glu Phe Tyr Val Thr Leu Leu Asn Tyr Pro Val Ser Ala Val Trp Asn Leu Lys Phe Val Leu Ala Phe Tyr Thr Gly Val Ser Val Gln Thr Tyr Tyr Gly Arg Arg Lys Ser Glu Asn Gly Lys Gly Asn Gly Val Arg Ser Gly Ala Leu Val Ile Asp Gly Val Leu Val Gly Arg Gly Trp Ser Glu Asp Ala Lys Lys Asn Thr Gly Asp Leu Leu Leu His His Tzp ale Glu Phe Arg Trp Pro Leu Ala His Gly Ile Val Ser Phe Asp Phe Phe Phe Asp Ala Ala Met Val Tyr Asn Ile Glu Ser Gln Ser Pro Asn Gly Ser Ser Ser Ala Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Arg Thr Thr Ser Ser Glu Gly Leu Tyr Lys Met Ser Tyr Gly Pro Gly Leu Arg Phe Thr Leu Pro Gln Phe Pro Leu Lys Leu Ala Phe Ala Asn Thr Phe Thr Ser Pro Gly Gly Ile Pro Lys Thr Lys Lys Asn Trp Asn Phe Val Leu Ser Phe Thr Val Asn Asn Leu <210> 7 <211> 1029 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(1029) <223> Mspl <220>
<221> primer bind <222>
(1)..(18) <223> imerS1 binding site PCR
pr <220>

<221> bind primer <222> ((1011). .(1029)) Complement <223> imerAS1binding site PCR
pr <400>

cgactcacc ctcgaaccaggc gccggcttc cgcttctcc ttcgccctc 48 ArgLeuThr LeuGluProGly AlaGlyPhe ArgPheSer PheAlaLeu gacgccggt aaccaacaccag agtgcacag gactttcaa aatcgcaca 96 AspAlaGly AsnGlnHisGln SerAlaGln AspPheGln AsnArgThr cagagggcg cagagtgaactc accgccctc tcaaataac ctcttccag 144 GlnArgAla GlnSerGluLeu ThrAlaLeu SerAsnAsn LeuPheGln ggagaaagt caaaaacaggaa gcctggctg gacgaatat gcaaagaag 192 GlyGluSer GlnLysGlnGlu AlaTrpLeu AspGluTyr AlaLysLys gtgcttgat gccgtaacggca gccaccgaa accgccctt cagtcgagg 240 ValLeuAsp AlaValThrAla AlaThrGlu ThrAlaLeu GlnSerArg ggaaacgcg tacataacggca gtgtcaaac gtaaaagtc acccctccg 288 GlyAsnAla TyrIleThrAla ValSerAsn ValLysVal ThrProPro gtagetgcc acgcttttgacg aacctgaag gtgttcatt accgaccct 336 ValAlaAla ThrLeuLeuThr AsnLeuLys ValPheIle ThrAspPro cctacaccg tcaccgcttccc gcgcttcct gcattttcc ctgatgggg 384 ProThrPro SerProLeuPro AlaLeuPro AlaPheSer LeuMetGly caggttttg ctgcagtacgat gcggagcag gtggtgaag gggtttgag 432 GlnValLeu LeuGlnTyrAsp AlaGluGln ValValLys GlyPheGlu caggtacag acgcaaatcgtt getgaaatt aaccagaaa gtgcaagcg 480 GlnValGln ThrGlnIleVal AlaGluIle AsnGlnLys ValGlnAla getgtgget cagagcaagget gcagcacag gcattcatc aacggtctt 528 AlaValAla GlnSerLysAla AlaAlaGln AlaPheIle AsnGlyLeu accaaggca atagaagacgtg getgatgcg ttgcttgca ccgcataag 576 ThrLys~AlaIleGluAspVal AlaAspAla LeuLeuAla ProHisLys ggaaatccg atgagcctcttc aaccttccg gatcaacaa aaattactg 624 Gly Pro SerLeuPhe LeuPro GlnGln LysLeuLeu Asn Met Asn Asp aaggacgatctc gccgatctt attccaaag cttacgget gaggetaca 672 LysAspAspLeu AlaAspLeu IleProLys LeuThrAla GluAlaThr aagtttttcact gagggtcag acgtttgta accgaagaa gtgaagaag 720 LysPhePheThr GluGlyGln ThrPheVal ThrGluGlu ValLysLys aagacggatgcg ttggacgcg gggcagcag atacgtcag getatacag 768 LysThrAspAla LeuAspAla GlyGlnGln IleArgGln AlaIleGln aacctgcgtgcg tctgcatgg cgtgccttt ctaatggga gtcagcgcc 816 AsnLeuArgAla SerAlaTrp ArgAlaPhe LeuMetGly ValSerAla gtgtgtctgtat cttgacacc tacaatgtc gccttcgat gcgctgttt 864 ValCysLeuTyr LeuAspThr TyrAsnVal AlaPheAsp AlaLeuPhe acggcgcagtgg aagtggctg tcttctggc atatacttt gccacagca 912 ThrAlaGlnTrp LysTrpLeu SerSerGly IleTyrPhe AlaThrAla ccggcaaacgtt tttggcacc agggtgtta gataacacc atcgcaagc 960 ProAlaAsnVal PheGlyThr ArgValLeu AspAsnThr IleAlaSer tgtggcgacttt gccggattc cttaagctc gaaactaag agcggtgac 1008 CysGlyAspPhe AlaGlyPhe LeuLysLeu GluThrLys SerGlyAsp ccc tac acc cac ctg ctc acc 1029 Pro Tyr Thr His Leu Leu Thr <210> 8 <211> 343 <212> PRT
<213> Treponema pallidum <400> 8 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys Lys Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser Arg Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro Pro Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp Pro I00 . 105 110 Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe Glu Gln Val Gln Thr Gln Ile Val Ala Glu Ile Asn Gln Lys Val Gln Ala Ala Val Ala Gln Ser Lys Ala Ala Ala Gln Ala Phe Ile Asn Gly Leu Thr Lys Ala Ile Glu Asp Val Ala Asp Ala Leu Leu Ala Pro His Lys Gly Asn Pro Met Ser Leu Phe Asn Leu Pro Asp Gln Gln Lys Leu Leu Lys Asp Asp Leu Ala Asp Leu Ile Pro Lys Leu Thr Ala Glu Ala Thr Lys Phe Phe Thr Glu Gly Gln Thr Phe Val Thr Glu Glu Val Lys Lys Lys Thr Asp Ala Leu Asp Ala Gly Gln Gln Ile Arg Gln Ala Ile Gln Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val 5er Ala Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr <210> 9 <211> 336 <212> DNA

<213> Treponemapallidum <220>

<221> CDS

<222> (1)..(333) <223> Msp2 <220>

<221> primer bind <222> (1)..(18) <223> PCR S1 bindingsite primer <900> 9 cga ctc acc gaacca ggcgccggcttc cgcttctcc ttcgcc ctc 48 ctc Arg Leu Thr GluPro GlyAlaGlyPhe ArgPheSer PheAla Leu Leu gac gcc ggt caacac caggaccctgcc gatgcaggt aatcgc ctt 96 aac Asp Ala Gly GlnHis GlnAspProAla AspAlaGly AsnArg Leu Asn ctg gca acg agctca cgggagaagttt gacagcgcg ttcgat gcc 144 ggg Leu Ala Thr SerSer ArgGluLysPhe AspSerAla PheAsp Ala Gly ctc agg gtg caatac cgtgtaaaggat aagtatctt gaattt ttg 192 gag Leu Arg Val GlnTyr ArgValLysAsp LysTyrLeu GluPhe Leu Glu ctg gga cag gcggag tcctcgattctc gagcgggtg gggctt gcc 290 atg Leu Gly Gln AlaGlu SerSerIleLeu GluArgVal GlyLeu Ala Met ctc acg ctg gacggt acgctcgtctct acgctgacg aaggtt gcc 288 cag Leu Thr Leu AspGly ThrLeuValSer ThrLeuThr LysVal Ala Gln act gat agt gga get cag cgc cca gtg gga aca ggg ggt get tgc tga 336 Thr Asp Ser Gly Ala Gln Arg Pro Val Gly Thr Gly Gly Ala Cys <210> 10 <211> 111 <212> PRT
<213> Treponema pallidum <400> 10 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Asp Pro Ala Asp Ala Gly Asn Arg Leu Leu Ala Thr Gly Ser Ser Arg Glu Lys Phe Asp Ser Ala Phe Asp Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val Ala Thr Asp Ser Gly Ala Gln Arg Pro Val Gly Thr Gly Gly Ala Cys <210> 11 <211> 1047 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(1047) <223> Msp3 <220>
<221> primer bind <222> (1)..(18) <223> PCR primer S1 binding site <220>
<221> primer bind <222> Complement((1029)..(1047)) <223> PCR primer AS1 binding site <400> 11 cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 48 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu gac gccggt caacaccagagt gaggetacc gcggcgatg aggacc 96 aac Asp AlaGly GlnHisGlnSer GluAlaThr AlaAlaMet ArgThr Asn gaa aggaca gagcgtgcacag gaggttgca ctggcaatt tttacg 194 cgc Glu ArgThr GluArgAlaGln GluValAla LeuAlaIle PheThr Arg cac getgcg gaacaggetaaa caggcgget gatacggtt ggtagc 192 cag His AlaAla GluGlnAlaLys GlnAlaAla AspThrVal GlySer Gln acc atagat tcggtgcaggtg gcaagatca gttattact cagatc 290 aac Thr IleAsp SerValGlnVal AlaArgSer ValIleThr GlnIle Asn get gaagga gtgaagcaggca cacgatcag attaaacgc accaat 288 gcg Ala Glu Gly Ala Val Lys Gln Ala His Asp Gln Ile Lys Arg Thr Asn gga aca caa gta gtg aat att gac gtg acc gtt ccg gtg aac gtc cgg 336 Gly Thr Gln Val Val Asn Ile Asp Val Thr Val Pro Val Asn Val Arg caa agt cct gtt cgg caa cct gac ttg cct tca ctt acc gca atc gca 384 Gln Ser Pro Val Arg Gln Pro Asp Leu Pro Ser Leu Thr Ala Ile Ala gcg caa ttg cca aat gta acc aag ctc ttc ttc ctt agt gcc ggg gcg 432 Ala Gln Leu Pro Asn Val Thr Lys Leu Phe Phe Leu Ser Ala Gly Ala gcc gcc gcg agg ccc att atc ggg cag att act ggc gtg gtg cag aac 480 Ala Ala Ala Arg Pro Ile Ile Gly Gln Ile Thr Gly Val Val Gln Asn gtt atc acc cag cag gta cag gcc cgg gtt gcg cag tcg acc gcg gtt 528 Val Ile Thr Gln Gln Val Gln Ala Arg Val Ala Gln Ser Thr Ala Val gca atc cag caa gtt ctt gtg ttc aac cag caa acc gtc get gca gaa 576 Ala Ile Gln Gln Val Leu Val Phe Asn Gln Gln Thr Val Ala Ala Glu aaa gcg aat acg caa aag cat acg ata aat ggc aag tca tac gcg get 629 Lys Ala Asn Thr Gln Lys His Thr Ile Asn Gly Lys Ser Tyr Ala Ala cat atc ggc tcg ttg gta agt ctc get acc aac agg gcg ctg cct act 672 His Ile Gly Ser Leu Val Ser Leu Ala Thr Asn Arg Ala Leu Pro Thr ata cga cag cgt gtt gag caa get gtt cag gaa aat ata cgg agg atc 720 Ile Arg Gln Arg Val Glu Gln Ala Val Gln Glu Asn Ile Arg Arg Ile aac get gtg gtg cag caa aaa gcg caa acg ctc acc tct tcc cag gaa 768 Asn Ala Val Val Gln Gln Lys Ala Gln Thr Leu Thr Ser Ser Gln Glu ctg gaa aag gca gtg tat tcg ttg ttc gtt ccc acg ttt gaa aac ctg 816 Leu Glu Lys Ala Val Tyr Ser Leu Phe Val Pro Thr Phe Glu Asn Leu gtg ttg ggt gca ggc gcg ctg ctg get ctt ttg gat atg cat cag att 864 Val Leu Gly Ala Gly Ala Leu Leu Ala Leu Leu Asp Met His Gln Ile gcg gtg gac gcg ctg ttt acg gcg cag tgg aag tgg ctg tct tct ggc 912 Ala Val Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly ata tac ttt gcc aca gca ccg gca aac gtt ttt ggc acc agg gtg tta 960 Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu gat aac acc atc gca agc tgt ggc gac ttt gcc gga ttc ctt aag ctc 1008 Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu gaa act aag agc ggt gac ccc tac acc cac ctg ctc acc I04?
Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr <210> 12 <211> 349 <212> PRT

<213> Treponemapallidum <400> 12 Arg Leu Thr GluProGly GlyPhe ArgPheSer PheAlaLeu Leu Ala Asp Ala Gly GlnHisGln GluAla ThrAlaAla MetArgThr Asn Ser Glu Arg Thr GluArgAla GluVal AlaLeuAla IlePheThr Arg Gln His Ala Ala GluGlnAla GlnAla AlaAspThr ValGlySer Gln Lys Thr Ile Asp SerValGln AlaArg SerValIle ThrGlnIle Asn Val Ala Glu Gly ValLysGln HisAsp GlnIleLys ArgThrAsn Ala Ala Gly Thr Gln ValAsnIle ValThr ValProVal AsnValArg Val Asp Gln Ser Pro ArgGlnPro LeuPro SerLeuThr AlaIleAla Val Asp Ala Gln Leu AsnValThr LeuPhe PheLeuSer AlaGlyAla Pro Lys Ala Ala Ala ProIleIle GlnIle ThrGlyVal ValGlnAsn Arg Gly Val Ile Thr GlnValGln ArgVal AlaGlnSer ThrAlaVal Gln Ala Ala Ile Gln ValLeuVal AsnGln GlnThrVal AIaAlaGlu Gln Phe Lys Ala Asn GlnLysHis IleAsn GlyLysSer TyrAlaAla Thr Thr His Ile Gly LeuValSer AlaThr AsnArgAla LeuProThr Ser Leu WO 99/53099 PCT/t3S99/07$$6 IleArgGln Val Gln Ala Gln Glu Ile Ile Arg Glu Val Asn Arg Arg AsnAlaVal Gln Lys Ala Thr LeuThrSer Ser Glu Val Gln Gln Gln LeuGluLys Val Ser Leu Val ProThrPhe Glu Leu Ala Tyr Phe Asn ValLeuGly Gly Leu Leu Leu LeuAspMet His Ile Ala Ala Ala Gln AlaValAsp Leu Thr Ala Trp LysTrpLeu Ser Gly Ala Phe Gln Ser IleTyrPhe Thr Pro Ala Val PheGlyThr Arg Leu Ala Ala Asn Val AspAsnThr Ala Cys Gly Phe AlaGlyPhe Leu Leu Ile Ser Asp Lys GluThrLys Gly Pro Tyr His LeuLeuThr Ser Asp Thr <210> 13 <211> 600 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(600) <223> Msp4 <220>
<221> primer bind <222> (1)..(18) <223> PCR primer S1 binding site <220>
<221> primer bind <222> Complement((582)..(600)) <223> PCR primer AS1 binding site <400> 13 cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 48 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu gac gcc ggt aac caa cac cag agt aac gca cat get cag acc caa gag 96 Asp Ala Gly Asn Gln His Gln Ser Asn Ala His Ala Gln Thr Gln Glu aga get atc ctc aaa gca agg gaa gtg ttt aga cgg gtg gag ggg aaa 144 Arg Ala Ile Leu Lys Ala Arg Glu Val Phe Arg Arg Val Glu Gly Lys ctcgtgcagaac cttcccaat atcatgatg ccaccagga atcaccgaa 192 LeuValGlnAsn LeuProAsn IleMetMet ProProGly IleThrGlu caaaccactctc atagagatg gtaggactt getgetttg attgcagaa 240 GlnThrThrLeu IleGluMet ValGlyLeu AlaAlaLeu IleAlaGlu ggaacgctcggc agcgccatt caaaccgtg ctagccget ggcgcgctc 288 GlyThrLeuGly SerAlaIle GlnThrVal LeuAlaAla GlyAlaLeu gcggcgcttgta tcgcaactt gtaccgaac atagagcaa ggagtacgt 336 AlaAlaLeuVal SerGlnLeu ValProAsn IleGluGln GlyValArg gatgtcttccgc tcttccgat ccaagagtt gtcactget aaacttctc 384 AspValPheArg SerSerAsp ProArgVal ValThrAla LysLeuLeu getttccttgag cgcgcacct atgaacgcg ctcaacata gacgcgctc 432 AlaPheLeuGlu ArgAlaPro MetAsnAla LeuAsnIle AspAlaLeu ctgcgtatgcag tggaagtgg ctctcttct ggcatatac tttgccacc 480 LeuArgMetGln TrpLysTrp LeuSerSer GlyIleTyr PheAlaThr gcaggcactaat atctttggc aaacgcgtc tttgetacc actcgtgcg 528 AlaGlyThrAsn IlePheGly LysArgVal PheAlaThr ThrArgAla cactactttgat tttgccgga ttccttaag ctcgaaacc aaaagcggt 576 HisTyrPheAsp PheAlaGly PheLeuLys LeuGluThr LysSerGly gacccctacacc cacctgctc acc 600 AspProTyrThr HisLeuLeu Thr <210> 14 <211> 200 <212> PRT

<213> Treponemapallidum <400> 14 Arg Leu Thr Glu Pro Gly Ala Gly Phe Arg PheAla Leu Phe Ser Leu Asp Ala Gly Gln His Gln Ser Asn Ala His ThrGln Asn Ala Gln Glu Arg Ala Ile Lys Ala Arg Glu Val Phe Arg GluGly Leu Arg Val Lys Leu Val Gln Asn Leu Pro Asn Ile Met Met Pro Pro Gly Ile Thr Glu Gln Thr Thr Leu Ile Glu Met Val Gly Leu Ala Ala Leu Ile Ala Glu Gly Thr Leu Gly Ser Ala Ile Gln Thr Val Leu Ala Ala Gly Ala Leu Ala Ala Leu Val Ser Gln Leu Val Pro Asn Ile Glu Gln Gly Val Arg Asp Val Phe Arg Ser Ser Asp Pro Arg Val Val Thr Ala Lys Leu Leu Ala Phe Leu Glu Arg Ala Pro Met Asn Ala Leu Asn Ile Asp Ala Leu Leu Arg Met Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr Ala Gly Thr Asn Ile Phe Gly Lys Arg Val Phe Ala Thr Thr Arg Ala His Tyr Phe Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr <210> 15 <211> 600 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(600) <223> MspS
<220>
<221> primer bind <222> (1)..(18) <223> PCR primer S1 binding site <220>
<221> primer bind <222> Complement((582)..(600)) <223> PCR primer AS1 binding site <400> 15 cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 48 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu gac gcc ggt aac caa cac cag agt aac gca cat get cag acc caa gag 96 Asp Ala Gly Asn Gln His Gln Ser Asn Ala His Ala Gln Thr Gln Glu WO 99/53099 PC'TNS99/07886 aga atcctcaaa gcaagggaa gtgtttaga cgggtggag gggaaa 194 get Arg IleLeuLys AlaArgGlu ValPheArg ArgValGlu GlyLys Ala ctc cagaacctt cccaatatc atgatgcca ccaggaatc accgaa 192 gtg Leu GlnAsnLeu ProAsnIle MetMetPro ProGlyIle ThrGlu Val caa actctcata gagatggta ggacttget getttgatt gcagaa 240 acc Gln ThrLeuIle GluMetVal GlyLeuAla AlaLeuIle AlaGlu Thr gga ctcggcagc gccattcaa accgtgcta gccgetggc gcgctc 288 acg Gly LeuGlySer AlaIleGln ThrValLeu AlaAlaGly AlaLeu Thr gcg cttgtatcg caacttgta ccgaacata gagcaagga gtacgt 336 gcg Ala LeuValSer GlnLeuVal ProAsnIle GluGlnGly ValArg Ala gat ttccgctct tccgatcca agagttgtc actgetaaa cttctc 384 gtc Asp Ph.eArgSer SerAspPro ArgValVal ThrAlaLys LeuLeu Val get cttgagcgc gcacctatg aacgcgctc aacatagac gcgctc 432 ttc Ala LeuGluArg AlaProMet AsnAlaLeu AsnIleAsp AlaLeu Phe ctg atgcagtgg aagtggctc tcttctggc atatacttt gccacc 980 cgt Leu MetGlnTrp LysTrpLeu SerSerGly IleTyrPhe AlaThr Arg gca actaatatc tttggcaaa cgcgtcttt getaccact cgtgcg 528 ggc Ala ThrAsnIle PheGlyLys ArgValPhe AlaThrThr ArgAla Gly cac tttgatttt gccggattc cttaagctc gaaaccaaa agcggt 576 tac His PheAspPhe AlaGlyPhe LeuLysLeu GluThrLys SerGly Tyr gac tacacccac ctgctcacc 600 ccc Asp TyrThrHis LeuLeuThr Pro <210>

<211>

<212>
PRT

<213> pallidum Treponema <400> 16 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala His Ala Gln Thr Gln Glu Arg Ala Ile Leu Lys Ala Arg Glu Val Phe Arg Arg Val Glu Gly Lys Leu Val Gln Asn Leu Pro Asn Ile Met Met Pro Pro Gly Ile Thr Glu Gln Thr Thr Leu Ile Glu Met Val Gly Leu Ala Ala Leu Ile Ala Glu Gly Thr Leu Gly Ser Ala Ile Gln Thr Val Leu Ala Ala Gly Ala Leu Ala Ala Leu Val Ser Gln Leu Val Pro Asn Ile Glu Gln Gly Val Arg Asp Val Phe Arg Ser Ser Asp Pro Arg Val Val Thr Ala Lys Leu Leu Ala Phe Leu Glu Arg Ala Pro Met Asn Ala Leu Asn Ile Asp Ala Leu Leu Arg Met Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr A1a Gly Thr Asn Ile Phe Gly Lys Arg Val Phe Ala Thr Thr Arg Ala His Tyr Phe Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr <210> 17 <211> 585 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (3)..(584) <223> Msp6 <220>
<221> primer bind <222> (1)..(20) <223> PCR primer S6 binding site <220>
<221> primer bind <222> Complement((563)..(585)) <223> PCR primer AS6 binding site <400> 17 cg cgt ttg acg ctt tcc ccg gga gca gga ttc aag atc gtg tgt gcc 47 Arg Leu Thr Leu Ser Pro Gly Ala Gly Phe Lys Ile Val Cys Ala WO 99/53099 PC'f/US99/07886 ttcgatget gggacaccgtac aagaagggt gccgcgagg gagtccctc 95 PheAspAla GlyThrProTyr LysLysGly AlaAlaArg GluSerLeu getgaaacg cttgcggcacag cgtggttgt aatcgtttt gacaccgcg 143 AlaGluThr LeuAlaAlaGln ArgGlyCys AsnArgPhe AspThrAla ctcatgcac gcgcttgggtta cttgttget getgcgaag acacgcaat 191 LeuMetHis AlaLeuGlyLeu LeuValAla AlaAlaLys ThrArgAsn gaactcgcc gcacagatgcga tcgcagtca ccaccaggt gtgtgggaa 239 GluLeuAla AlaGlnMetArg SerGlnSer ProProGly ValTrpGlu aaatttgaa caggcggtgcaa tcgttacct cctataacg cagggaaag 287 LysPheGlu GlnAlaValGln SerLeuPro ProIleThr GlnGlyLys cctggcgtc gttggggcggag gtccgcccg ggtacgatg tggatggaa 335 ProGlyVal ValGlyAlaGlu ValArgPro GlyThrMet TrpMetGlu ctttccccg gtaaggaaagca cttgtcgat gtactttct gtacttgag 383 LeuSerPro ValArgLysAla LeuValAsp ValLeuSer ValLeuGlu cagggtggt tttgatcgtgtc gcctttgac gcattgctg attgtgcaa 431 GlnGlyGly PheAspArgVal AlaPheAsp AlaLeuLeu IleValGln tggcgctgg atttcgctggga gcatacgta gcaagtget cctaccaat 479 TrpArgTrp IleSerLeuGly AlaTyrVal AlaSerAla ProThrAsn gtgtttggc tcaatgcttttt ccgcgtggg agtagtgac cattttgac 527 ValPheGly SerMetLeuPhe ProArgGly SerSerAsp HisPheAsp tgtgccgca ttcgtgcgggtg gaaagtaag tggtacgat tctctttct 575 CysAlaAla PheValArgVal GluSerLys TrpTyrAsp SerLeuSer aagcttgtg t 585 LysLeuVal <210> 8 <211> 94 I

<212>
PRT

<213> reponema pallidum T

<400> 18 Arg Leu Thr Leu Ser Pro Gly Ala Gly Phe Lys Ile Val Cys Ala Phe Asp Ala Gly Thr Pro Tyr Lys Lys Gly Ala Ala Arg Glu Ser Leu Ala Glu Thr Leu Ala Ala Gln Arg Gly Cys Asn Arg Phe Asp Thr Ala Leu Met His Ala Leu Gly Leu Leu Val Ala Ala Ala Lys Thr Arg Asn Glu Leu Ala Ala Gln Met Arg Ser Gln Ser Pro Pro Gly Val Trp Glu Lys Phe Glu Gln Ala Val Gln Ser Leu Pro Pro Ile Thr Gln Gly Lys Pro Gly Val Val Gly Ala Glu Val Arg Pro Gly Thr Met Trp Met Glu Leu Ser Pro Val Arg Lys Ala Leu Val Asp Val Leu Ser Val Leu Glu Gln Gly Gly Phe Asp Arg Val Ala Phe Asp Ala Leu Leu Ile Val Gln Trp Arg Trp Ile Ser Leu Gly Ala Tyr Val Ala Ser Ala Pro Thr Asn Val Phe Gly Ser Met Leu Phe Pro Arg Gly Ser Ser Asp His Phe Asp Cys Ala Ala Phe Val Arg Val Glu Ser Lys Trp Tyr Asp Ser Leu Ser Lys Leu Val <210> 19 <211> 1062 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (2)..(514) <223> Msp7A
<220>
<221> CDS
<222> (515)..(1060) <223> MspB
<220>
<221> primer bind <222> (1)..(22) <223> PCR primer S7 binding site <220>
<221> primer bind <222> Complement((1042)..(1062)) <223> PCR primer AS7 binding site <400> 19 c ttt ttc tcg ctg acg ctt tgt cca ccg aaa act cgg tcg aat ctg cat 49 Phe Phe Ser Leu Thr Leu Cys Pro Pro Lys Thr Arg Ser Asn Leu His aaa agc agc ggt gtg tat gca gaa atc ctg tta agg aac cta gag tgt 97 Lys Ser Ser Gly Val Tyr Ala Glu Ile Leu Leu Arg Asn Leu Glu Cys gcg ctc ccc ctc ggt tcc tta tct ggt gag get tta ggc gaa ctc acg 145 Ala Leu Pro Leu Gly Ser Leu Ser Gly Glu Ala Leu Gly Glu Leu Thr ccc aca gaa aaa caa agc ttc tcc gta gaa gcg acc ctt cgc ttc tac 193 Pro Thr Glu Lys Gln Ser Phe Ser Val Glu Ala Thr Leu Arg Phe Tyr ggc gca tat ctc act att gga aaa aat ccg acc ttt tct aaa aat ttt 241 Gly Ala Tyr Leu Thr Ile Gly Lys Asn Pro Thr Phe Ser Lys Asn Phe gcc aaa ttg tgg ccc ccg ttc atc acc aca cga tac aag gaa gca gac 289 Ala Lys Leu Trp Pro Pro Phe Ile Thr Thr Arg Tyr Lys Glu Ala Aap acc caa tac gcc cct ggc ttt ggg ggt tat gga ggg aag att ggt tac 337 Thr Gln Tyr Ala Pro Gly Phe Gly Gly Tyr Gly Gly Lys Ile Gly Tyr cgc gta gaa gac gtc ggg aat tcc ggg cta ggt ttt gac ttt ggg ttc 385 Arg Val Glu Asp Val Gly Asn Ser Gly Leu Gly Phe Asp Phe Gly Phe ctt tcc ttc get tca aac ggc gac tgg agc acg agc ggg act agc cat 433 Leu Ser Phe Ala Ser Asn Gly Asp Trp Ser Thr Ser Gly Thr Ser His agc aaa tat ggg ttt ggt agt gac ctc tct atg gta caa gag aaa caa 481 Ser Lys Tyr Gly Phe Gly Ser Asp Leu Ser Met Val Gln Glu Lys Gln gaa get gtt ttt aac tgt gga act cgc cgg taa atg ggt ttg gta gtg 529 Glu Ala Val Phe Asn Cys Gly Thr Arg Arg Met Gly Leu Val Val acc tct cta tgg tac aag aga aac aag aag ctg ttt tta act gtg gaa 577 Thr Ser Leu Trp Tyr Lys Arg Asn Lys Lys Leu Phe Leu Thr Val Glu ctc gcc ggt aat get acc ctc cag gag ggt tat gcc acg tta get cca 625 Leu Ala Gly Asn Ala Thr Leu Gln Glu Gly Tyr Ala Thr Leu Ala Pro acattttcg ggagcaccc aacaacaaacgg gcatcccac gcgctctta 673 ThrPheSer GlyAlaPro AsnAsnLysArg AlaSerHis AlaLeuLeu tggagtgtg ggagggcgt ctttcgatcatg c.ctggtgca ggattccgc 721 TrpSerVal GlyGlyArg LeuSerIleMet ProGlyAla GlyPheArg ttcatttta getacggat gccggaaatacc taccgggat acgaacagt 769 PheIleLeu AlaThrAsp AlaGlyAsnThr TyrArgAsp ThrAsnSer gcgagagca cgtgtcgtc gaacaggcacta gaactcgcg gagaagacg 817 AlaArgAla ArgValVal GluGlnAlaLeu GluLeuAla GluLysThr tatccgtca ttacggacg gtgcgtcgtata ttcagctgg atggtacag 865 TyrProSer LeuArgThr ValArgArgIle PheSerTrp MetValGln cacgtggac tcattaggc atagacgcgctg gttacagcg cagtggcgt 913 HisValAsp SerLeuGly IleAspAlaLeu ValThrAla GlnTrpArg tggctttca ggaggtgta tacggcgcaaca ggggcggcg tctgttttt 961 TrpLeuSer GlyGlyVal TyrGlyAlaThr GlyAlaAla SerValPhe gggagtggt ccctttgta aagtcaactttt caatacacg gactttget 1009 GlySerGly ProPheVal LysSerThrPhe GlnTyrThr AspPheAla gcgtttctc agactagaa actcgttcggga gatgattac acccatgcc 1057 AlaPheLeu ArgLeuGlu ThrArgSerGly AspAspTyr ThrHisAla ttgca 1062 Leu <210>

<211>

<212>
PRT

<213> pallidum Treponema <400>

Phe Phe Leu Thr Leu ProProLys Thr Arg Ser Leu Ser Cys Asn His Lys Ser Gly Val Tyr GluIleLeu Leu Arg Asn Glu Ser Ala Leu Cys Ala Leu Leu Gly Ser SerGlyGlu Ala Leu Gly Leu Pro Leu Glu Thr Pro Thr Glu Lys Gln Ser Phe Ser Val Glu Ala Thr Leu Arg Phe Tyr Gly Ala Tyr Leu Thr Ile Gly Lys Asn Pro Thr Phe Ser Lys Asn Phe Ala Lys Leu Trp Pro Pro Phe Ile Thr Thr Arg Tyr Lys Glu Ala Asp Thr Gln Tyr Ala Pro Gly Phe Gly Gly Tyr Gly Gly Lys Ile Gly Tyr Arg Val Glu Asp Val Gly Asn Ser Gly Leu Gly Phe Asp Phe Gly Phe Leu Ser Phe Ala Ser Asn Gly Asp Trp Ser Thr Ser Gly Thr Ser His Ser Lys Tyr Gly Phe Gly Ser Asp Leu Ser Met Val Gln Glu Lys Gln Glu Ala Val Phe Asn Cys Gly Thr Arg Arg <210> 21 <211> 182 <212> PRT

<213> Treponemapallidum <400> 21 Met Gly Leu ValThr SerLeuTrp LysArg Asn Lys Leu Val Tyr Lys Phe Leu Thr GluLeu AlaGlyAsn ThrLeu Gln Gly Tyr Val Ala Glu Ala Thr Leu ProThr PheSerGly ProAsn Asn Arg Ala Ala Ala Lys Ser His Ala LeuTrp SerValGly ArgLeu Ser Met Pro Leu Gly Ile Gly Ala Gly ArgPhe IleLeuAla AspAla Gly Thr Tyr Phe Thr Asn Arg Asp Thr SerAla ArgAlaArg ValGlu Gln Leu Glu Asn Val Ala Leu Ala Glu ThrTyr ProSerLeu ThrVal Arg Ile Phe Lys Arg Arg Ser Trp Met GlnHis ValAspSer GlyIle Asp Leu Val Val Leu Ala Thr Ala Gln ArgTrp LeuSerGly ValTyr Gly Thr Gly Trp Gly Ala Ala Ala Ser PheGly SerGlyPro ValLys Ser Phe Gln Val Phe Thr Tyr Thr Asp Phe Ala Ala Phe Leu Arg Leu Glu Thr Arg Ser Gly Asp Asp Tyr Thr His Ala Leu <210> 22 <211> 537 <212> DNA

<213> Treponemapallidum <220>

<221> CDS

<222> (1)..(537) <223> MspB

<220>

<221> primer bind <222> (1)..(18) <223> PCR bindingsite primer S8 <220>

<221> primer bind <222> Complement((516).. (531)) <223> PCR binding site primer AS8 <400> 22 cgg ctg acg accccg gggtacggg tttcggctc gtgctggcg ctt 48 ctg Arg Leu Thr ThrPro GlyTyrGly PheArgLeu ValLeuAla Leu Leu gat gtg gga attcac cggagcgac gcggatata gggaagacg gta 96 aac Asp Val Gly IleHis ArgSerAsp AlaAspIle GlyLysThr Val Asn aac gtg cag aaggcg gcagaagcc gtaagtgca gcggtaacc gaa I44 gcc Asn Val Gln LysAla AlaGluAla ValSerAla AlaValThr Glu Ala ttt tgg gca gtggcc cagataatg gccaacggt ggcgtcgga gag 192 caa Phe Trp Ala ValAla GlnIleMet AlaAsnGly GlyValGly Glu Gln ttt ttt gtc aaagtg cggggcget gccctcata gcgcaagtg gca 240 aaa Phe Phe Val LysVal ArgGlyAla AlaLeuIle AlaGlnVal Ala Lys ctg gtg gtt catttg gaaggaaaa ctctccaat ctacttcag agc 288 tcc Leu Val Val HisLeu GluGlyLys LeuSerAsn LeuLeuGln Ser Ser aca ctg ggc ggagcg gtggtaaac cagctcacc cagggattc gcc 336 ctg Thr Leu Gly GlyAla ValValAsn GlnLeuThr GlnGlyPhe.pla Leu gagctcctt aaaaagccggac ccggccatt gcgctcgtc acgttc ttt 384 GluLeuLeu LysLysProAsp ProAlaIle AlaLeuVal ThrPhe Phe gcgtggctg caccgcctgcac gtgcacgag ttgggcget gacgcc ttg 432 AlaTrpLeu HisArgLeuHis ValHisGlu LeuGlyAla AspAla Leu ctgagcatg cagtggaagtgg ctttcttcc ggcgcgtat tttgcc acc 480 LeuSerMet GlnTrpLysTrp LeuSerSer GlyAlaTyr PheAla Thr gccggcgcc aatatgtttggc aagcgcgtc ttttccagg cagctt aca 528 AlaGlyAla AsnMetPheGly LysArgVal PheSerArg GlnLeu Thr gactacttg 537 AspTyrLeu <210> 23 <211> 179 <212> PRT

<213> Treponema pallidum <400> 23 Arg Leu LeuThrPro GlyTyrGly ArgLeu LeuAla Leu Thr Phe Val Asp Val AsnIleHis ArgSerAsp AspIle LysThr Val Gly Ala Gly Asn Val AlaLysAla AlaGluAla SerAla ValThr Glu Gln Val Ala Phe Trp GlnValAla GlnIleMet AsnGly ValGly Glu Ala Ala Gly Phe Phe LysLysVal ArgGlyAla LeuIle GlnVal Ala Val Ala Ala Leu Val SerHisLeu GluGlyLys SerAsn LeuGln Ser Val Leu Leu Thr Leu LeuGlyAla ValValAsn LeuThr GlyPhe Ala Gly Gln Gln Glu Leu LysLysPro AspProAla AlaLeu ThrPhe Phe Leu Ile Val Ala Trp HisArgLeu HisValHis LeuGly AspAla Leu Leu Glu Ala Leu Ser GlnTrpLys TrpLeuSer GlyAla PheAla Thr Met Ser Tyr Ala Gly AsnMetPhe GlyLysArg PheSer GlnLeu Thr Ala Val Arg Asp Tyr Leu <210> 24 <211> 94B

<212> DNA

<213> Treponema pallidum <220>

<221> CDS

<222> (3)..(997) <223> Msp9 <220>

<221> primer bind <222> (1)..(23) <223> PCR primer S9 binding site <220>

<221> primer bind <222> Complement((927)..(948)) <223> PCR primer AS9 binding site <220>

<221> misc feature _ <222> (40) <223> DNA sequence uncertain <220>

<221> misc feature _ <222> (41) <223> DNA sequence uncertain <220>

<221> misc feature _ <222> (45) <223> DNA sequence uncertain <220>

<221> misc feature _ <222> (51) <223> DNA sequence uncertain <220>

<221> misc feature <222> (831) <223> DNA sequence uncertain <400> 24 at att gaa ggc tat gcg gag ctg ggc att gca tnn gaa nat gcc tgg 47 Ile Glu Gly Tyr Ala Glu Leu Ala Gly Ile Ala Xaa Glu Xaa Trp ggt ngc gcc gga aac ctc aag cat aag act act act gat ttt gga ttt 95 Gly Xaa Ala Gly Asn Leu Lys His Lys Thr Thr Thr Asp Phe Gly Phe aag att gtg ttc ccc att gtg gca aag aag gat ttc aag tac cgc ggt 143 Lys Ile Val Phe Pro Ile Val Ala Lys Lys Asp Phe Lys Tyr Arg Gly gag ggg aat gtc tat gcg gaa att aat gtt aaa gcg ttg aag ttg agt 191 Glu Gly Asn Val Tyr Ala Glu Ile Asn Val Lys Ala Leu Lys Leu Ser tta gag tca aat ggt gga gca aag ttt gac acg aag ggt tct gca aag 239 Leu Glu Ser Asn Gly Gly Ala Lys Phe Asp Thr Lys Gly Ser Ala Lys acg ata gag gca acc ctg cac tgt tat ggg gcc tac ctg acc att ggg 287 Thr Ile Glu Ala Thr Leu His Cys Tyr Gly Ala Tyr Leu Thr Ile Gly aag aat cct gat ttt aag tca acg ttt get gtt ttg tgg gag ccg tgg 335 Lys Asn Pro Asp Phe Lys Ser Thr Phe Ala Val Leu Trp Glu Pro Trp acc gcg aat ggg gat tat aag tct aag gga gat aag ccg gtg tat gag 383 Thr Ala Asn Gly Asp Tyr Lys Ser Lys Gly Asp Lys Pro Val Tyr Glu ccg ggg ttt gag gga gcc ggg gga aag tta ggg tat aaa cag act gac 431 Pro Gly Phe Glu Gly Ala Gly Gly Lys Leu Gly Tyr Lys Gln Thr Asp atc gcc ggc acg ggg ctc acg ttt gat att gcg ttt aag ttt gcg tct 479 Ile Ala Gly Thr Gly Leu Thr Phe Asp Ile Ala Phe Lys Phe Ala Ser aac acc gac tgg gag ggc aaa gac agc aag ggc aac gtc cca gca gga 52?
Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val Pro Ala Gly gta acc ccc agc aag tat gga ttg ggg gga gat att ttg ttc ggc tgg 575 Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp gag cgt acg cgt gaa gat ggc gtg cag gaa tac att aaa gtg gag ctc 623 Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu acc ggc aac tcc aca ctg tct agc gac tat gcc caa gcc cga gcc ctg 671 Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala Arg Ala Leu gca gcc ggg get aag gtg agt atg aag ctt tgg ggt ctg tgt get ctg 719 Ala Ala Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu get get aca gac gtg ggg cat aag aaa aac gga gcg cag ggc acc gta 767 Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val ggcgcagatgcg ttgttgacg ttggggtat cgttggttc tcggcggga 815 GlyAlaAspAla LeuLeuThr LeuGlyTyr ArgTrpPhe SerAlaGly ggatatttcgca tcgnaggcc agcaatgta ttcggggga gtatttctc 863 GlyTyrPheAla SerXaaAla SerAsnVal PheGlyGly ValPheLeu aacatggccatg cgagagcac gactgtget gcctatatt aagctcgaa 911 AsnMetAlaMet ArgGluHis AspCysAla AlaTyrIle LysLeuGlu accaaggggtct gatcctgat acttctttc cttgagg 948 ThrLysGlySer AspProAsp ThrSerPhe LeuGlu <210> 25 <211> 315 <212> PRT
<213> Treponema pallidum <220>
<221> Unsure <222> (13) <223> DNA sequence uncertain <220>
<221> Unsure <222> (15) <223> DNA sequence uncertain <220>
<221> Unsure <222> (17) <223> DNA sequence uncertain <220>
<221> Unsure <222> (277) <223> DNA sequence uncertain <400> 25 Ile Glu Gly Tyr Ala Glu Leu Ala Trp Gly Ile Ala Xaa Glu Xaa Gly Xaa Ala Gly Asn Leu Lys His Gly Phe Lys Thr Thr Thr Asp Phe Lys Ile Val Phe Pro Ile Val Ala Lys Lys Asp Phe Lys Tyr Arg Gly Glu Gly Asn Val Tyr Ala Glu Ile Asn Val Lys Ala Leu Lys Leu Ser Leu Glu Ser Asn Gly Gly Ala Lys Phe Asp Thr Lys Gly Ser Ala Lys Thr Ile Glu Ala Thr Leu His Cys Tyr Gly Ala Tyr Leu Thr Ile Gly Lys Asn Pro Asp Phe Lys Ser Thr Phe Ala Val Leu Trp Glu Pro Trp Thr Ala Asn Gly Asp Tyr Lys Ser Lys Gly Asp Lys Pro Val Tyr Glu Pro Gly Phe Glu Gly Ala Gly Gly Lys Leu Gly Tyr Lys Gln Thr Asp Ile Ala Gly Thr Gly Leu Thr Phe Asp Ile Ala Phe Lys Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala Arg Ala Leu Ala Ala Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Xaa Ala Ser Asn Val Phe Gly Gly Val Phe Leu Asn Met Ala Met Arg Glu His Asp Cys Ala Ala Tyr Ile Lys Leu Glu Thr Lys Gly Ser Asp Pro Asp Thr Ser Phe Leu Glu <210> 26 <211> 1035 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(1035) <223> MsplO
<220>

<221> primer bind <222> (1)..(18) <223> PCR primer S1 binding site <220>
<221> primer bind <222> Complement((1017)..(1035)) <223> PCR primer AS1 binding site <400> 26 cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc ctc 98 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu gac gcc ggt aac caa cac cag agt gca cag gac ttt caa aat cgc aca 96 Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr cag agg gcg cag agt gaa ctc acc gcc ctc tca aat aac ctc ttc cag 144 Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln gga gaa agt caa aaa cag gaa gcc tgg gta acc cag gta gtg caa cag 192 Gly Glu Ser Gln Lys Gln Glu Ala Trp Val Thr Gln Val Val Gln Gln gcg acg cag aca gta acg get gga gtt cga agc gcg ctg gaa tct cgg 240 Ala Thr Gln Thr Val Thr Ala Gly Val Arg Ser Ala Leu Glu Ser Arg ggg act acg tac ata aac gcg cta gag gca gtt cag cct aat cct get 288 Gly Thr Thr Tyr Ile Asn Ala Leu Glu Ala Val Gln Pro Asn Pro Ala aaa cct acc ggt aag gtt gtg caa aat ctt cac acc ccg cag gga agt 336 Lys Pro Thr Gly Lys Val Val Gln Asn Leu His Thr Pro Gln Gly Ser ccg ccg aac ctg ccg ccg ctt cct gca ctt cct gca ttt tcc ctg atg 384 Pro Pro Asn Leu Pro Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met ggg cag gtt ttg ctg cag tac gat gcg gag cag gtg gtg aag ggg ttt 432 Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe gag cag gta cag acg caa atc gtc act gaa att aat cag aaa gtg caa 480 Glu Gln Val Gln Thr Gln Ile Val Thr Glu Ile Asn Gln Lys Val Gln 145 150 155. 160 gcg get gtg gca aaa aat aat gca aac atg caa gcg gtc ggg ggt agt 528 Ala Ala Val Ala Lys Asn Asn Ala Asn Met Gln Ala Val Gly Gly Ser cta ggc gat act gcg aga atg gta ggc gaa gcg ctc att aag cag caa 576 Leu Gly Asp Thr Ala Arg Met Val Gly Glu Ala Leu Ile Lys Gln Gln ctatcacgtaag cagaacagcatt ctgaccatg gtgagcgtg caagat 624 LeuSerArgLys GlnAsnSerIle LeuThrMet ValSerVal GlnAsp gaggtgaaacag gatctggcagat ttagtgccg atgatgcga acggaa 672 GluValLysGln AspLeuAlaAsp LeuValPro MetMetArg ThrGlu ataacggcgttt ttcgcgagtgtc cagcaacac ataaccgaa gaagtg 720 IleThrAlaPhe PheAlaSerVal GlnGlnHis IleThrGlu GluVal aagaagaagacg gatgcgttgaat gcggggcag cagatacgt cagget 768 LysLysLysThr AspAlaLeuAsn AlaGlyGln GlnIleArg GlnAla atacagaacctg cgtgcgtctgca tggcgtgcc tttctaatg ggagtc 816 IleGlnAsnLeu ArgAlaSerAla TrpArgAla PheLeuMet GlyVal agcgccgtgtgt ctgtatcttgac acctacaat gtcgccttc gatgcg 864 SerAlaValCys LeuTyrLeuAsp ThrTyrAsn ValAlaPhe AspAla ctgtttacggcg cagtggaagtgg ctgtcttct ggcatatac tttgcc 912 LeuPheThrAla GlnTrpLysTrp LeuSerSer GlyIleTyr PheAla acagcaccggca aacgtttttggc accagggtg ttagataac accatc 960 ThrAlaProAla AsnValPheGly ThrArgVal LeuAspAsn ThrIle gcaagctgtggc gactttgccgga ttccttaag ctcgaaact aagagc 1008 AlaSerCysGly AspPheAlaGly PheLeuLys LeuGluThr LysSer ggtgacccctac acccacctgctc acc 1035 GlyAspProTyr ThrHisLeuLeu Thr <210> 27 <211> 345 <212> PRT
<213> Treponema pallidum <400> 27 Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr Gln Arg AIa Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Val Thr Gln Val Val Gln Gln Ala Thr Gln Thr Val Thr Ala Gly Val Arg Ser Ala Leu Glu Ser Arg Gly Thr Thr Tyr Ile Asn Ala Leu Glu Ala Val Gln Pro Asn Pro Ala Lys Pro Thr Gly Lys Val Val Gln Asn Leu His Thr Pro Gln Gly Ser Pro Pro Asn Leu Pro Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe Glu Gln Val Gln Thr Gln Ile Val Thr Glu Ile Asn Gln Lys Val Gln Ala Ala Val Ala Lys Asn Asn Ala Asn Met Gln Ala Val Gly Gly Ser Leu Gly Asp Thr Ala Arg Met Val Gly Glu Ala Leu Ile Lys Gln Gln Leu Ser Arg Lys Gln Asn Ser Ile Leu Thr Met Val Ser Val Gln Asp Glu Val Lys Gln Asp Leu Ala Asp Leu Val Pro Met Met Arg Thr Glu Ile Thr Ala Phe Phe Ala Ser Val Gln Gln His Ile Thr Glu Glu Val Lys Lys Lys Thr Asp Ala Leu Asn Ala Gly Gln Gln Ile Arg Gln Ala Ile Gln Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val Ser Ala Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr <210> 28 WO 99/53099 PCT/US99/0?886 <211> 633 <212> DNA

<213> Treponema pallidum <220>

<221> CDS

<222> (ly..(633) <223> Mspll <220>

<221> primer bind <222> (1)..(18y <223> PCR primerbinding site <220>

<221> primer bind <222> Complement((615)..(633 )) <223> PCR primer site AS1 binding <400> 28 cga ctc acc ctc ccaggc gccggcttc cgcttc tccttcgcc ctc 48 gaa Arg Leu Thr Leu ProGly AlaGlyPhe ArgPhe SerPheAla Leu Glu gac gcc ggt aac caccag gaccctgcc gatgca ggtaatcgc ctt 96 caa Asp Ala Gly Asn HisGln AspProAla AspAla GlyAsnArg Leu Gln ctg gca acg ggg tcacgg gagaagttt gacagc gcgttcgat gcc 144 agc Leu Ala Thr Gly SerArg GluLysPhe AspSer AlaPheAsp Ala Ser ctc agg gtg gag taccgt gtaaaggat aagtat cttgaattt ttg 192 caa Leu Arg Val Glu TyrArg ValLysAsp LysTyr LeuGluPhe Leu Gln ctg gga cag atg gagtcc tcgattctc gagcgg gtggggctt gcc 240 gcg Leu Gly Gln Met GluSer SerIleLeu GluArg ValGlyLeu Ala Ala 65 ?0 75 80 ctc acg ctg cag ggtacg ctcgtctct acgctg acgaaggtt gcc 288 gac Leu Thr Leu Gln GlyThr LeuValSer ThrLeu ThrLysVal Ala Asp act gat agt gga cggttt atccaaatg gcgttg gtaaaactc ttg 336 gat Thr Asp Ser Gly ArgPhe IleGlnMet AlaLeu ValLysLeu Leu Asp ccc cag agg gcg gcggag cagagacta caggag attgtggcg ccg 384 cag Pro Gln Arg Ala AlaGlu GlnArgLeu GlnGlu IleValAla Pro Gln agt cag tcg gac gtgctt atcatgctg ctaacc tggcttgag cgt 432 atc Ser Gln Ser Asp ValLeu IleMetLeu LeuThr TrpLeuGlu Arg Ile gca cgg ctg gac ttcaat getgatgcg ctgctt acggcgcag tgg 480 cgg Ala Arg Leu Asp PheAsn AlaAspAla LeuLeu ThrAlaGln Trp Arg WO 99!53099 PCTNS99/07886 acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat gta 528 Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn Val ttt ggt aag cgc gtg ctg cct gcg ctg cgg tcc tgg cat ttt gat ttt 576 Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp Phe gcc gga ttc ctc aaa ctc gaa acc aaa agc ggt gac ccc tac acc cac 624 Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His ctg ctc acc 633 Leu Leu Thr <210> 29 <211> 211 <212> PRT

<213> Treponema pallidum <400> 29 Rrg Leu Thr Leu Pro AlaGly ArgPhe SerPhe Ala Glu Gly Phe Leu Asp Ala Gly Asn His AspPro AspAla GlyAsn Arg Gln Gln Ala Leu Leu Ala Thr Gly Ser GluLys AspSer AlaPhe Asp Ser Arg Phe Ala Leu Arg Val Glu Tyr ValLys LysTyr LeuGlu Phe Gln Arg Asp Leu Leu Gly Gln Met Glu SerIle GluArg ValGly Leu Ala Ser Leu Ala Leu Thr Leu Gln Gly LeuVal ThrLeu ThrLys Val Asp Thr Ser Ala Thr Asp Ser Gly Arg IleGln AlaLeu ValLys Leu Asp Phe Met Leu Pro Gln Arg Ala Ala GlnArg GlnGlu IleVal Ala Gln Glu Leu Pro Ser Gln Ser Asp Val IleMet LeuThr TrpLeu Glu Ile Leu Leu Arg Ala Arg Leu Asp Phe AlaAsp LeuLeu ThrAla Gln Arg Asn Ala Trp Thr Tyr Val Ser Gly TyrGly ThrAla GlyThr Asn Ala Leu Ala Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr <210> 30 <211> 542 <212> DNA

<213> Treponema pallidum <220>

<221> CDS

<222> (3)..(542) <223> Mspl2 <220>

<221> primer bind <222> (1)..(19) <223> PCR primer S12 binding site <220>

<221> primer bind <222> Complement((521)..(542)) <223> PCR primer AS12 binding site <400> 30 cg cgc ata acg ctc act 47 cct ctt tcg gac ttc aag gtg gtg ttg get Arg Ile Thr Leu Thr Pro Leu Ser Asp Phe Lys Val Val Leu Ala ctg gac atg ggt aac cat ggtcgg aaaacg ctcgactat ctt 95 tat gca Leu Asp Met Gly Asn His GlyArg LysThr LeuAspTyr Leu Tyr Ala gcc ccg atc ctt atc gat aaaacc aaggtc acccccgga ggg 143 atg gaa Ala Pro Ile Leu Ile Asp LysThr LysVal ThrProGly Gly Met Glu ccg gtg gcg tat gcc att cgcgtg ttgcag ctgcctgag tac 191 gca cag Pro Val Ala Tyr Ala Ile ArgVal LeuGln LeuProGlu Tyr Ala Gln gcg cag aag ctc gat agt aacgga atgtcc getaacgga tcc 239 gtc aag Ala Gln Lys Leu Asp Ser AsnGly MetSer AlaAsnGly Ser Val Lys tct gtg cgg gat att gca atcgta caagca gaacagacg aac 287 acc aaa Ser Val Arg Asp Ile Ala IleVal GlnAla GluGlnThr Asn Thr Lys gp 85 90 95 ccg aca gtt agt tca aac cttgca gcgctg ttgacagtg ctc 335 ccc ttg Pro Thr Val Ser Ser Asn LeuAla AlaLeu LeuThrVal Leu Pro Leu tgg caa caa gcg ctg gac acc tac gcg ctc gat gca ctc ctg act ctg 383 Trp Gln Gln Ala Leu Asp Thr Tyr Ala Leu Asp Ala Leu Leu Thr Leu caa tgg cgc tgg ttt gcc tgc ggc gtg tac gtg gcc act get cct gca 431 Gln Trp Arg Trp Phe Ala Cys Gly Val Tyr Val Ala Thr Ala Pro Ala agc gtg ttt ggg gcc atg gtc ttt cct acg tat ggg agc aca cac acg 479 Ser Val Phe Gly Ala Met Val Phe Pro Thr Tyr Gly Ser Thr Hia Thr gac ggc ggc ggc ttt ctg cgg gta gaa acc aaa gcg gga gac gcg tat 527 Asp Gly Gly Gly Phe Leu Arg Val Glu Thr Lys Ala Gly Asp Ala Tyr aca cac ctt ata gac 542 Thr His Leu Ile Asp <210> 31 <211> 180 <212> PRT

<213> Treponemapallidum <400> 31 Arg Ile Thr Thr LeuSer Asp LysValVal LeuAlaLeu Leu Pro Phe Asp Met Gly His AlaGly Arg ThrLeuAsp TyrLeuAla Asn Tyr Lys Pro Ile Leu Asp GluLys Thr ValThrPro GlyGlyPro Ile Met Lys Val Ala Tyr Ile GlnArg Val GlnLeuPro GluTyrAla Ala Ala Leu Gln Lys Leu Ser LysAsn Gly 5erAlaAsn GlySerSer Asp Val Met Val Arg Asp Ala LysIle Val AlaGluGln ThrAsnPro Ile Thr Gln Thr Val Ser Asn LeuLeu Ala LeuLeuThr ValLeuTrp Ser Pro Ala Gln Gln Ala Asp TyrAla Leu A1aLeuLeu ThrLeuGln Leu Thr Asp Trp Arg Trp Ala GlyVal Tyr AlaThrAla ProAlaSer Phe Cys Val Val Phe Gly Met PhePro Thr GlySerThr HisThrAsp Ala Val Tyr Gly Gly Gly Phe Leu Arg Val Glu Thr Lys Ala Gly Asp Ala Tyr Thr His Leu Ile Asp <210> 32 <211> 26 <212> PRT
<213> Treponema pallidum <220>
<221> DOMAIN
<222> (1)..(26) <223> Highly conserved amino acid motif of T. pallidum sub. pallidum Msp genes.
<400> 32 Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln <210> 33 <211> 78 <212> DNA
<213> Treponema pallidum <220>
<221> misc_feature <222> (1). (78) <223> Nucleotide sequence encoding conserved T.
pallidum sub. pallidum Msp motif.
<400> 33 gtaggaggcc gactcaccct cgaaccaggc gccggcttcc gcttctcctt cgccctcgac 60 gccggtaacc aacaccag 78 <210> 34 <211> 1705 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(1704) <223> T. pallidum sub. pertenue Msp homolgue <400> 34 acc agt cct tcc tgt gtg gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe gtcacccgtgcctat tcagaaaag gacactcgc tatgcccct ggtttc 96 ValThrArgAlaTyr SerGluLys AspThrArg TyrAlaPro GlyPhe tccggctccggggca aaactcggc taccaggcc cacaatgtg ggaaac 144 SerGlySerGlyAla LysLeuGly TyrGlnAla HisAsnVal GlyAsn agcggagtagatgtg gacatcggt ttcctctcc ttcctttcc aatggt 192 SerGlyValAspVal AspIleGly PheLeuSer PheLeuSer AsnGly gcctgggatagtact gacaccacg cacagcaag tatggcttc ggggcc 240 AlaTrpAspSerThr AspThrThr HisSerLys TyrGlyPhe GlyAla gatgcaacgctt tcctatggc gtcgaccgt cagcggctg cttacgttg 288 AspAlaThrLeu SerTyrGly ValAspArg GlnArgLeu LeuThrLeu e5 90 9s gagctggcaggg aatgccaca ctggagcag cactaccgt aagggtacc 336 GluLeuAlaGly AsnAlaThr LeuGluGln HisTyrArg LysGlyThr gaagactccacg aacgaaaac aaaacagca ctcctgtgg ggagtagga 384 GluAspSerThr AsnGluAsn LysThrAla LeuLeuTrp GlyValGly ggccgactcacc ctcgaacca ggcgccggc ttccgcttc tccttcgcc 432 GlyArgLeuThr LeuGluPro GlyAlaGly PheArgPhe SexPheAla ctcgacgccggt taccaacac cagagtgag getaccgcg gcggtgagg 480 LeuAspAlaGly TyrGlnHis GlnSerGlu AlaThrAla AlaValArg accgaaaggaca cgcgagcgt gcacaggag gttgcactg gcaattttt 528 ThrGluArgThr ArgGluArg AlaGlnGlu ValAlaLeu AlaIlePhe acgcacgetgcg caggaacag getaaacag gcggetgat acggttggt 576 ThrHisAlaAla GlnGluGln AlaLysGln AlaAlaAsp ThrValGly agcaccatagat aactcggtg caggtggca agatcagtt attactcag 624 SerThrIleAsp AsnSerVal GlnValAla ArgSerVal IleThrGln atcgetgaagga gcggtgaag caggcacac gatcagatt aaacgcacc 672 IleAlaGluGly AlaValLys GlnAlaHis AspGlnIle LysArgThr aatggaacacaa gtagtgaat attgacgtg accgttccg gtgaacgtc 720 AsnGlyThrGln ValValAsn IleAspVal ThrValPro ValAsnVal WO 99/53b99 PCTNS99107886 cgg caa agt cct gtt cgg caa cct gac ttg cct tca ctt acc gca atc 768 Arg Gln Ser Pro Val Arg Gln Pro Asp Leu Pro Ser Leu Thr Ala Ile gca gcg caa ttg cca aat gta acc aag ctc ttc ttc ctt agt gcc ggg 816 Ala Ala Gln Leu Pro Asn Val Thr Lys Leu Phe Phe Leu Ser Ala Gly gcg ccc gcc gcg agg ccc att atc ggg cag att act ggc gtg gtg cag 864 Ala Pro Ala Ala Arg Pro Ile Ile Gly Gln Ile Thr Gly Val Val Gln aac gtt atc acc cag cag gta cag gcc cgg gtt gcg cag tcg acc gcg 912 Asn Val Ile Thr Gln Gln Val Gln Ala Arg Val Ala Gln Ser Thr Ala gtt gca atc cag caa gtt tct gtg ttc aac cag caa acc gtc get gca 960 Val Ala Ile Gln Gln Val Ser Val Phe Asn Gln Gln Thr Val Ala Ala gaa aaa gcg aat acg caa aag cat acg ata aat ggc aag tca tac gcg 1008 Glu Lys Ala Asn Thr Gln Lys His Thr Ile Asn Gly Lys Ser Tyr Ala get cat atc ggc tcg ttg gta agt ctc get acc aac agg gcg ctg cct 1056 Ala His Ile Gly Ser Leu Val Ser Leu Ala Thr Asn Arg Ala Leu Pro act ata caa cag cgt gtt aag caa get gtt cag gaa aat ata cgg agg 1104 Thr Ile Gln Gln Arg Val Lys Gln Ala Val Gln Glu Asn Ile Arg Arg atc aac get gtg gtg cag caa aaa gcg caa acg ctc acc tct tcc cag 1152 Ile Asn Ala Val Val Gln Gln Lys Ala Gln Thr Leu Thr Ser Ser Gln gaa ctg gaa aag gca gtg tat tcg ttg ttc gtt ccc acg ttt gaa aac 1200 Glu Leu Glu Lys Ala Val Tyr Ser Leu Phe Val Pro Thr Phe Glu Asn ctg gtg ttg ggt gca ggc gcg ctg ctg get ctt ttg gat atg cgt cag 1248 Leu Val Leu Gly Ala Gly Ala Leu Leu Ala Leu Leu Asp Met Arg Gln att gcg gtg gac gcg ctg ttt aca gcg cag tgg aag tgg ctg tct tct 1296 Ile Ala Val Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser ggc ata tac ttt gcc aca gca ccg gca aac gtt ttt ggc acc agg gtg 1344 Gly Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val tta gat aac acc att gca agc tgt ggc gac ttt gcc gga ttc ctt aag 1392 Leu Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys ctc gaa act aag agc ggt gac ccc tac acc cac ctg ctc acc ggc ttg 1440 LeuGluThrLys SerGly Pro TyrThrHis LeuLeu ThrGlyLeu Asp gacgccggcgtt gaaacacgcatg tacatcccc ctcacc tatgcgcta 1488 AspAlaGlyVal GluThrArgMet TyrIlePro LeuThr TyrAlaLeu tacaaaaataac ggggggacgget gtgcgtggc attcag gaaaaggag 1536 TyrLysAsnAsn GlyGlyThrAla ValArgGly IleGln GluLysGlu tatatccgtcca ccggtggtgggg aaggcgtgg tgtagc tatcgcatc 1589 TyrIleArgPro ProValValGly LysAlaTrp CysSer TyrArgIle ccggtgcaggat tacggctgggtg aagccaagc gttacg gtccatgcc 1632 ProValGlnAsp TyrGlyTrpVal LysProSer ValThr ValHisAla tctaccaaccgt gcacacctgaat gcccctget gcaggc ggagcagta 1680 SerThrAsnArg AlaHisLeuAsn AlaProAla AlaGly GlyAlaVal ggagetacctat ctaaccaaggag t 1705 GlyAlaThrTyr LeuThrLysGlu <210> 35 <211> 568 <212> PRT
<213> Treponema pallidum <400> 35 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Tyr Gln His Gln Ser Glu Ala Thr Ala Ala Val Arg Thr Glu Arg Thr Arg Glu Arg Ala Gln Glu Val Ala Leu Ala Ile Phe Thr His Ala Ala Gln Glu Gln Ala Lys Gln Ala Ala Asp Thr Val Gly Ser Thr Ile Asp Asn Ser Val Gln Val Ala Arg Ser Val Ile Thr Gln Ile Ala Glu Gly Ala Val Lys Gln Ala His Asp Gln Ile Lys Arg Thr Asn Gly Thr Gln Val Val Asn Ile Asp Val Thr Val Pro Val Asn Val Arg Gln Ser Pro Val Arg Gln Pro Asp Leu Pro Ser Leu Thr Ala Ile Ala Ala Gln Leu Pro Asn Val Thr Lys Leu Phe Phe Leu Ser Ala Gly Ala Pro Ala Ala Arg Pro Ile Ile Gly Gln Ile Thr Gly Val Val Gln Asn Val Ile Thr Gln Gln Val Gln Ala Arg Val Ala Gln Ser Thr Ala Val Ala Ile Gln Gln Val Ser Val Phe Asn Gln Gln Thr Val Ala Ala Glu Lys Ala Asn Thr Gln Lys His Thr Ile Asn Gly Lys Ser Tyr Ala Ala His Ile Gly Ser Leu Val Ser Leu Ala Thr Asn Arg Ala Leu Pro Thr Ile Gln Gln Arg Val Lys Gln Ala Val Gln Glu Asn Ile Arg Arg Ile Asn Ala Val Val Gln Gln Lys Ala Gln Thr Leu Thr Ser Ser Gln Glu Leu Glu Lys Ala Val Tyr Ser Leu Phe Val Pro Thr Phe Glu Asn Leu Val Leu Gly Ala Gly Ala Leu Leu Ala Leu Leu Asp Met Arg Gln Ile Ala Val Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser GlyIleTyr Thr Pro PheGly Thr Phe Ala Ala Arg Ala Asn Val Val LeuAspAsn IleAlaSer CysGly PheAlaGly Phe Lys Thr Asp Leu LeuGluThr SerGlyAsp ProTyr HisLeuLeu Thr Leu Lys Thr Gly AspAlaGly GluThrArg MetTyr ProLeuThr Tyr Leu Val Ile Ala TyrLysAsn GlyGlyThr AlaVal GlyIleGln Glu Glu Asn Arg Lys TyrIleArg ProValVal GlyLys TrpCysSer Tyr Ile Pro Ala Arg ProValGln TyrGlyTrp ValLys SerValThr Val Ala Asp Pro His SerThrAsn AlaHisLeu AsnAla AlaAlaGly Gly Val Arg Pro Ala Gly~u Thr LeuThrLys Glu Tyr <210> 36 <211> 1291 <212> DNA

<213> Treponemapallidum <220>

<221> CDS

<222> (1)..(1290) <223> T, Msphomologue pallidum encoded sub. pertenue by 1.3(1) KB fragment.

<900> 36 acc agt cct tgt gttaac tttgcccag ctgtggaaa cccttt 48 tcc gtg Thr Ser Pro Cys ValAsn PheAlaGln LeuTrpLys ProPhe Ser Val gtc acc cgt tat gaaaag gacactcgc tatgcccct ggtttc 96 gcc tca Val Thr Arg Tyr GluLys AspThrArg TyrAlaPro GlyPhe Ala Ser tcc ggc tcc gca ctcggc taccaggcc cacaatgtg ggaaac 144 ggg aaa Ser Gly Ser Ala LeuGly TyrGlnAla HisAsnVal GlyAsn Gly Lys agc gga gta gtg atcggt ttcctctcc ttcctttcc aatggt 192 gat gac Ser Gly Val Val IleGly PheLeuSer PheLeuSer AsnGly Asp Asp gcc tgg gat act accacg cacagcaag tatggcttc ggggcc 240 agt gac Ala Trp Asp Thr ThrThr HisSerLys TyrGlyPhe GlyAla Ser Asp gat gca acg ctt tcc tat ggc gtc gac cgt cag cgg ctg ctt acg ttg 288 Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu gag ctg gca ggg aat gcc aca ctg gag cag cac tac cgt aag ggt acc 336 Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr gaa gac tcc acg aac gaa aac aaa aca gca ctc ctg tgg gga gta gga 384 Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly ggc cga ctc acc ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc 432 Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala ctc gac gcc ggt aac caa cac cag agt aac gca gat gca gac tgt cgc 480 Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg ctt ccg gca acg ggg aac tca cgg gag aag ttt gac agg gcg ttc gat 528 Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp gcc ctc agg gtg gag caa tac cgt gta aag gat aag tat ctt gaa ttt 576 Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe le0 185 190 ttg ctg gga cag atg gcg gag tcc tcg att ctc gag cgg gtg ggg ctt 624 Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu gcc ctc acg ctg cag gac ggt acg ctc gtc tct acg ctg acg aag gtt 672 Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val gtc act gat agt gga gat cgg ttt atc caa atg gcg ttg gta aaa ctc 720 Val Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu ttg ccc cag agg gcg caa gcg gag cag ggc cta cgg gag att gtg gcg 768 Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala cgg agt cag tcg gac atc gtg ctt atc atg ctg cta acc tgg ctt gag 816 Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu cgt gca cgg ctg gac cgg ttc aat get gat gcg ctg ctt acg gcg cag 869 Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln tgg acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat 912 Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn WO 99/53099 PCT/'US99/07886 gtatttggt aagcgcgtg ctgcctgcgctg cggtcctgg catttt gat 960 ValPheGly LysArgVal LeuProAlaLeu ArgSerTrp HisPhe Asp tttgetgga ttccttaag ctcgaaactaag agcggtgac ccctac acc 1008 PheAlaGly PheLeuLys LeuGluThrLys SerGlyAsp ProTyr Thr cacctgctc accggcctg gacgccggcgtt gaaacacgc gtgtac atc 1056 HisLeuLeu ThrGlyLeu AspAlaGlyVal GluThrArg ValTyr Ile cccctcacc catgacctg tacaaaaataat aacgggaac cctctc cct 1104 ProLeuThr HisAspLeu TyrLysAsnAsn AsnGlyAsn ProLeu Pro tccggcggt tcctcaggg cacattggcctg ccggtggtg gggaag gcg 1152 SerGlyGly SerSerGly HisIleGlyLeu ProValVal GlyLys Ala tggtgtagc tatcgcatc ccggtgcaggat tacggctgg gtgaag cca 1200 TrpCysSer TyrArgIle ProValGlnAsp TyrGlyTrp ValLys Pro agcgttacg gtccatgcc tctaccaaccgt gcacacctg aatgcc cct 1248 SerValThr ValHisAla SerThrAsnArg AlaHisLeu AsnAla Pro getgcaggt ggagcagta ggagetacctat ctaaccaag gagt 1291 AlaAlaGly GlyAlaVal GlyAlaThrTyr LeuThrLys Glu <210> 37 <211> 430 <212> PRT
<213> Treponema pallidum <400> 37 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val Val Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu Arg Ala Arg Leu Asp Arg Phe ~n ~a Asp Ala Leu Leu Thr Ala Gln Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr Arg Val Tyr Ile Pro Leu Thr His Asp Leu Tyr Lys Asn Asn Asn Gly ~n Pro Leu Pro Ser Gly Gly Ser Ser Gly His Ile Gly Leu Pro Val Val Gly Lys Ala Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu <210> 38 <211> 1291 <212> DNA

<213> Treponema pallidum <220>

<221> CDS

<222> (1)..(1290) tenue Msp homologue encoded by <223> T. pallidum sub. per 1.3(2) KB DNA fragment.

<400> 38 gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48 t t t g g g acc agt cct tcc l Asn Phe Ala Gln Leu Trp Lys Pro Phe l V

a Thr Ser Pro Ser Cys Va tat tca gaa aag gac act cgc tat gcc cct ggt ttc 96 gtc acc cgt gcc Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe S

er Val Thr Arg Ala Tyr aaa ctc ggc tac cag gcc cac aat gtg gga aac 144 tcc ggc tcc ggg gca Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Ser Gly Ala Lys c atc ggt ttc ctc tcc ttc ctt tcc aat ggt 192 agc gga gta gat gtg ga Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ser Gly Val Asp Val Asp t act gac acc acg cac agc aag tat ggc ttc ggg gcc 240 t a l g a gcc tgg ga Thr Thr His Ser Lys Tyr Gly Phe Gly A

Ala Trp Asp Ser Thr Asp t tcc tat ggc gtc gac cgt cag cgg ctg ctt acg ttg 288 gat gca acg ct Val Asp Arg Gln Arg Leu Leu Thr Leu r Gl T

y y Asp Ala Thr Leu Ser c aca ctg gag cag cac tac cgt aag ggt acc 336 gag ctg gca ggg aat gc Glu Gln His Tyr Arg Lys Gly Thr Glu Leu Ala Gly Asn Ala Thr Leu aac gaa aac aaa aca gca ctc ctg tgg gga gta gga 384 gaa gac tcc acg s Thr Ala Leu Leu Trp Gly Val Gly Rsn L
Gl y u Glu Asp Ser Thr Asn c ctc gaa cca ggc gcc ggc ttc cgc ttc tcc ttc gcc 432 ggc cga ctc ac Ala Gly Phe Arg Phe Ser Phe Ala o Gl P

y r Gly Arg Leu Thr Leu Glu a cac cag agt aac gca gat gca gac tgt cgc 480 ctc gac gcc ggt aac ca G1n Ser Asn Ala Asp Ala Asp Cys Arg Hi s Leu Asp Ala Gly Asn Gln WO 99/53099 PC'T/US99/07886 ctt ccg gca acg ggg aac tca cgg gag aag ttt gac agg gcg ttc gat 528 Leu Pro Ala Thr Gly Asn Ser.Arg Glu Lys Phe Asp Arg Ala Phe Asp gcc ctc agg gtg gag caa tac cgt gta aag gat aag tat ctt gaa ttt 576 Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe ttg ctg gga cag atg gcg gag tcc tcg att ctc gag cgg gtg ggg ctt 624 Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu gcc ctc acg ctg cag gac ggt acg ctc gtc tct acg ctg acg aag gtt 672 Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val gcc act gat agt gga gat cgg ttt atc caa atg gcg ttg gta aaa ctc 720 Ala Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu ttg ccc cag agg gcg caa gcg gag cag ggc cta cgg gag att gtg gcg 768 Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala cgg agt cag tcg gac atc gtg ctt atc atg ctg cta acc tgg ctt gag 816 Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu cgt gca cgg ctg gac cgg ttc aat get gat gcg ctg ctt acg gcg cag 864 Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln tgg acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat 912 Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn gta ttt ggt aag cgc gtg ctg cct gcg ctg cgg tcc tgg cat ttt gat 960 Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp ttt get gga ttc ctt aag ctc gaa act aag agc ggt gac ccc tac acc 1008 Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr cac ctg ctc acc ggc ctg gac gcc ggc gtt gaa aca cgc atg tac atc 1056 His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr Arg Met Tyr Ile ccc ctc act tat gcg cta tac aaa aat aac ggg ggg acg get gtg cgt 1104 Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly Thr Ala Val Arg ggc att cag gaa aag gag tat atc cgt cca ccg gtg gtg ggg aag gcg 1152 Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val Val Gly Lys Ala tgg tgt agc tat cgc atc ccg gtg cag gat tac ggc tgg gtg aag cca 1200 Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro agc gtt acg gtc cat gcc tct acc aac cgt gca cac ctg aat gcc cct 1248 Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro get gca ggc gga gca gta gga get acc tat cta acc aag gag t 1291 Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu <210> 39 <211> 430 <212> PRT
<213> Treponema pallidum <400> 39 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val _6p_ Ala Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr Gly Leu Asp ~a 345 Val Glu Thr Arg Met Tyr Ile Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly Thr Ala Val Arg Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val Val Gly Lys Ala Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr G1y Trp Val Lys Pro Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu <210> 40 <211> 1291 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(1290) <223> T. pallidum sub. pertenue Msp homologue encoded by 1.3(3) KB DNA fragment.
<400> 40 acc agt cct tcc tgt gtg gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe c tat tca gaa aag gac act cgc tat gcc cct ggt ttc 96 gtc acc cgt gc r Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe S

e Val Thr Arg Ala Tyr aaa ctc ggc tac cag gcc cac aat gtg gga aac 149 tcc ggc tcc ggg gca Tyr Gln Ala His Asn Val Gly Asn Leu Gl y Ser Gly Ser Gly Ala Lys ac atc ggt ttc ctc tcc ttc ctt tcc aat ggt 192 t g g agc gga gta gat g Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ser Gly Val Asp Val Asp t act gac acc acg cac agc aag tat ggc ttc ggg gcc 240 t a l g a gcc tgg ga Thr Thr His Ser Lys Tyr Gly Phe Gly A

Ala Trp Asp Ser Thr Asp 75 eo 6s 70 c tat ggc gtc gac cgt cag cgg ctg ctt acg ttg 288 t t c gat gca acg ct Val Asp Arg Gln Arg Leu Leu Thr Leu r Gl T

y y Asp Ala Thr Leu Ser c aca ctg gag cag cac tac cgt aag ggt acc 336 t gc gag ctg gca ggg aa Leu Glu Gln His Tyr Arg Lys Gly Thr Th r Glu Leu Ala Gly Asn Ala aac gaa aac aaa aca gca ctc ctg tgg gga gta gga 384 gaa gac tcc acg s Thr Ala Leu Leu Trp Gly Val Gly n L
A
l y s u Glu Asp Ser Thr Asn G

a cca ggc gcc ggc ttc cgc ttc tcc ttc gcc 432 ggc cga ctc acc ctc ga Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala l u Gly Arg Leu Thr Leu G

a cac cag agt aac gca gat gca gac tgt cgc 480 ctc gac gcc ggt aac ca Ser Asn Ala Asp Ala Asp Cys Arg Gl n Leu Asp Ala Gly Asn Gln His ac tca cgg gag aag ttt gac agg gcg ttc gat 528 ctt ccg gca acg ggg a Glu Lys Phe Asp Arg A1a Phe Asp A

rg Leu Pro Ala Thr Gly Asn Ser aa tac cgt gta aag gat aag tat ctt gaa ttt 576 gcc ctc agg gtg gag c r Arg Val Lys Asp Lys Tyr Leu Glu Phe T
Gl y n Ala Leu Arg Val Glu tcc tcg att ctc gag cgg gtg ggg ctt 624 a g ttg ctg gga cag atg gcg g Ile Leu Glu Arg Val Gly Leu Leu Leu Gly Gln Met Ala Glu Ser Ser ac ggt acg ctc gtc tct acg ctg acg aag gtt 672 gcc ctc acg ctg cag g Gly Thr Leu Val Ser Thr Leu Thr Lys Val A
l sp n Ala Leu Thr Leu G

ttt atc caa atg gcg ttg gta aaa ctc 720 gcc act gat agt gga gat cgg Gln Met Ala Leu Val Lys Leu Il e Ala Thr Asp Ser Gly Asp Arg Phe caa gcg gag cag ggc cta cgg gag att gtg gcg 768 ttg ccc cag agg gcg Gln Gly Leu Arg Glu Ile Val Ala Gl u Leu Pro Gln Arg Ala Gln Ala PC'TNS99/07886 cgg agt cag tcg gac atc gtg ctt atc atg ctg cta acc tgg ctt gag 816 Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu cgt gca cgg ctg gac cgg ttc aat get gat gcg ctg ctt acg gcg cag 864 Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln tgg acc tat gtg tcg get gga ctg tat ggg gcg acg gcg ggt acc aat 912 Trp Thr Tyr Val Ser Ala Gly Leu Tyr Gly Ala Thr Ala Gly Thr Asn gta ttt ggt aag cgc gtg ctg cct gcg ctg cgg tcc tgg cat ttt gat 960 Val Phe Gly Lys Arg Val Leu Pro Ala Leu Arg Ser Trp His Phe Asp ttt get gga ttc ctt aag ctc gaa act aag agc ggt gac ccc tac acc 1008 Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr cac ctg ctc acc ggc ctg aac gcc ggc gtc gaa gca cgc gtg tac atc 1056 His Leu Leu Thr Gly Leu Asn Ala Gly Val Glu Ala Arg Val Tyr Iie ccc ctc acc tac atc cgt tac aga aat aac gga ggg tac cca ctg aat 1104 Pro Leu Thr Tyr Ile Arg Tyr Arg Asn Asn Gly Gly Tyr Pro Leu Asn gga gtt gtg ccc cct ggg act atc aat atg ccg att ttg ggg aag gcg 1152 Gly Val Val Pro Pro Gly Thr Ile Asn Met Pro Ile Leu Gly Lys Ala tgg tgt agc tat cgc atc ccg gtg cag gat tac ggc tgg gtg aag cca 1200 Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro agc gtt acg gtc cat gcc tct acc aac cgt gca cac ctg aat gcc cct 1248 Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro get gca ggc gga gca gta gga get acc tat cta acc aag gag t 1291 Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu <210> 41 <211> 430 <212> PRT
<213> Treponema pallidum <400> 41 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Asn Ala Asp Ala Asp Cys Arg Leu Pro Ala Thr Gly Asn Ser Arg Glu Lys Phe Asp Arg Ala Phe Asp Ala Leu Arg Val Glu Gln Tyr Arg Val Lys Asp Lys Tyr Leu Glu Phe Leu Leu Gly Gln Met Ala Glu Ser Ser Ile Leu Glu Arg Val Gly Leu Ala Leu Thr Leu Gln Asp Gly Thr Leu Val Ser Thr Leu Thr Lys Val Ala Thr Asp Ser Gly Asp Arg Phe Ile Gln Met Ala Leu Val Lys Leu Leu Pro Gln Arg Ala Gln Ala Glu Gln Gly Leu Arg Glu Ile Val Ala Arg Ser Gln Ser Asp Ile Val Leu Ile Met Leu Leu Thr Trp Leu Glu Arg Ala Arg Leu Asp Arg Phe Asn Ala Asp Ala Leu Leu Thr Ala Gln Trp Thr Tyr Ser GlyLeu Tyr Gly Thr Ala Thr Val Ala Ala Gly Asn Val Phe Gly Arg LeuPro Ala Leu Ser Trp Phe Lys Val Arg His Asp Phe Ala Gly Leu LeuGlu Thr Lys Gly Asp Tyr Phe Lys Ser Pro Thr WO 99/53099 PC'T/US99/07886 His Leu Leu Thr Gly Leu Asn Ala Gly Val Glu Ala Arg Val Tyr Ile Pro Leu Thr Tyr Ile Arg Tyr Arg Asn Asn Gly Gly Tyr Pro Leu Asn Gly Val Val Pro Pro Gly Thr Ile Asn Met Pro Ile Leu Gly Lys Ala Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu <210> 42 <211> 418 <212> PRT
<213> ~~reponema pallidum <220>
<221> DOMAIN
<222> (121)..(148) <223> Highly conserved amino acid motif found in the Msp genes of T. pallidum sub. pallidum.
<900> 42 Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln Asp Cys Leu Pro Ala Gln Ser Arg Thr Asn Ala Asp Ala Gly Asn LysPhe Ala Phe Leu Arg Ser Arg Asp Asp Val Glu Arg Ala Glu Gln LysAsp Lys Leu Glu Leu Leu Gly Tyr Arg Tyr Phe Gln Val Met Ala Ser LeuGlu Arg Gly Leu Leu Thr Leu Glu Ile Val Ala Gln Asp Gly Leu SerThr Leu Lys Val Thr Asp Ser Thr Val Thr Val Gly Asp Arg Ile MetAla Leu Lys Leu Pro Gln Arg Phe Gln Val Leu Ala Gln Ala Gln ArgGlu Ile Ala Arg Gln Ser Asp Glu Gly Val Ser Ile Val Leu Met LeuThr Trp Glu Arg Arg Leu Asp Ile Leu Leu Ala Arg Phe Asn Asp LeuLeu Thr Gln Trp Tyr Val Ser Ala Ala Ala Thr Ala Gly Leu Gly ThrThr Asn Phe Gly Arg Val Leu Tyr Ala Val Lys Pro Ala Leu Ser HisPhe Asp Ala Gly Leu Lys Leu Arg Trp Phe Phe Glu Thr Lys Gly ProTyr Thr Leu Leu Gly Leu Asp Ser Asp His Thr Ala Gly Val Thr ValIle Leu His Asp Tyr Lys Asn Glu Arg Thr Leu Asn Asn Gly Pro ProSer Gly 5er Ser His Ile Gly Asn Leu Gly Gly Leu Pro Val Gly AlaTrp Cys Tyr Arg Pro Val Gln Val Lys Ser Ile Asp Tyr Gly Val ProVal Thr Ala Ser Asn Arg Ala Trp Lys His Thr His Leu Asn Pro AlaGly Gly Val Gly Thr Tyr Leu Ala Ala Ala Ala Thr Lys Glu <210> 43 <211> 1687 WO 99/53099 PCT/US99/0'f886 <212>
DNA

<213> pallidum Treponema <220>

<221>
CDS

<222>
(1)..(1686) <223> pallidum Msp homologue T. sub. encoded pallidum by TP
1.6.

<900>

acc agtcct tcctgtgtggtt aacttt gcccagctgtgg aaaccc ttt 48 Thr SerPro SerCysValVal AsnPhe AlaGlnLeuTrp LysPro Phe gtc acccgt gcctattcagaa aaggac actcgctatgcc cctggt ttc 96 Val ThrArg AlaTyrSerGlu LysAsp ThrArgTyrAla ProGly Phe tcc ggctcc ggggcaaaactc ggctac caggcccacaat gtggga aac 144 Ser GlySer GlyAlaLysLeu GlyTyr GlnAlaHisAsn ValGly Asn agc ggagta gatgtggac~atcggtttc ctctccttcctt tccaat ggt 192 Ser GlyVal AspValAspIle GlyPhe LeuSerPheLeu SerAsn Gly gcc tgggat agtactgacacc acgcac agcaagtatggc ttcggg gcc 240 Ala TrpAsp SerThrAspThr ThrHis SerLysTyrGly PheGly Ala gat gcaacg ctttcctatggc gtcgac cgtcagcggctg cttacg ttg 288 Asp AlaThr LeuSerTyrGly ValAsp ArgGlnArgLeu LeuThr Leu gag ctggca gggaatgccaca ctggag cagcactaccgt aagggt acc 336 Glu LeuAla GlyAsnAlaThr LeuGlu GlnHisTyrArg LysGly Thr gaa gactcc acgaacgaaaac aaaaca gcactcctgtgg ggagta gga 384 Glu AspSer ThrAsnGluAsn LysThr AlaLeuLeuTrp GlyVal Gly ggc cgactc accctcgaacca ggcgcc ggcttccgcttc tccttc gcc 432 Gly ArgLeu ThrLeuGluPro GlyAla GlyPheArgPhe SerPhe Ala ctc gacgcc ggtaaccaacac cagagt gcacaggacttt caaaat cgc 480 Leu AspAla GlyAsnGlnHis GlnSer AlaGlnAspPhe GlnAsn Arg aca cagagg gcgcagagtgaa ctcacc gccctctcaaat aacctc ttc 528 Thr GlnArg AlaGlnSerGlu LeuThr AlaLeuSerAsn AsnLeu Phe cag ggagaa agtcaaaaacag gaagcc tggctggacgaa tatgca aag 576 Gln GlyGlu SerGlnLysGln GluAla TrpLeuAspGlu TyrAla Lys aaggtg cttgatgcc gtaacggca gccaccgaa accgccctt cagtcg 624 LysVal LeuAspAla ValThrAla AlaThrGlu ThrAlaLeu GlnSer agggga aacgcgtac ataacggca gtgtcaaac gtaaaagtc acccct 672 ArgGly AsnAlaTyr IleThrAla ValSerAsn ValLysVal ThrPro ccggta getgccacg cttttgacg aacctgaag gtgttcatt accgac 720 ProVal AlaAlaThr LeuLeuThr AsnLeuLys ValPheIle ThrAsp cctcct acaccgtca ccgcttccc gcgcttcct gcattttcc ctgatg 768 ProPro ThrProSer ProLeuPro AlaLeuPro AlaPheSer LeuMet gggcag gttttgctg cagtacgat gcggagcag gtggtgaag gggttt 816 GlyGln ValLeuLeu GlnTyrAsp AlaGluGln ValValLys GlyPhe gagcag gtacagacg caaatcgtt getgaaatt aaccagaaa gtgcaa 864 GluGln ValGlnThr GlnIleVal AlaGluIle AsnGlnLys ValGln gcgget gtggetcag agcaagget gcagcacag gcattcatc aacggt 912 AlaAla ValAlaGln SerLysAla AlaAlaGln AlaPheIle AsnGly cttacc aaggcaata gaagacgtg getgatgcg ttgcttgca ccgcat 960 LeuThr LysAlaIle GluAspVal AlaAspAla LeuLeuAla ProHis aaggga aatccgatg agcctcttc aaccttccg gatcaacaa aaatta 1008 LysGly AsnProMet SerLeuPhe AsnLeuPro AspGlnGln LysLeu ctgaag gacgatctc gccgatctt attccaaag cttacgget gagget 1056 LeuLys AspAspLeu AlaAspLeu IleProLys LeuThrAla GluAla acaaag tttttcact gagggtcag acgtttgta accgaagaa gtgaag 1104 ThrLys PhePheThr GluGlyGln ThrPheVal ThrGluGlu ValLys aagaag acggatgcg ttggacgcg gggcagcag atacgtcag getata 1152 LysLys ThrAspAla LeuAspAla GlyGlnGln IleArgGln AlaIle cagaac ctgcgtgcg tctgcatgg cgtgccttt ctaatggga gtcagc 1200 GlnAsn LeuArgAla SerAlaTrp ArgAlaPhe LeuMetGly ValSer gccgtg tgtctgtat cttgacacc tacaatgtc gccttcgat gcgctg 1248 AlaVal CysLeuTyr LeuAspThr TyrAsnVal AlaPheAsp AlaLeu tttacg gcgcagtgg aagtggctg tcttctggc atatacttt gccaca 1296 PheThr AlaGlnTrp LysTrpLeu SerSerGly IleTyrPhe AlaThr gcaccg gcaaacgtt tttggcaccagg gtgttagat aacacc atcgca 1344 AlaPro AlaAsnVal PheGlyThrArg ValLeuAsp AsnThr IleAla agctgt ggcgacttt gccggattcctt aagctcgaa actaag agcggt 1392 SerCys GlyAspPhe AlaGlyPheLeu LysLeuGlu ThrLys SerGly gacccc tacacccac ctgctcaccggc ctggacgcc ggcgtt gaaaca 1440 AspPro TyrThrHis LeuLeuThrGly LeuAspAla GlyVal GluThr cgcgtg tacatcccc ctcacctatgcg ctatacaaa aataac gggggg 1988 ArgVal TyrIlePro LeuThrTyrA1a LeuTyrLys AsnAsn GlyGly acgget gtgcgtggc attcaggaaaag gagtatatc cgtcca ccggtg 1536 ThrAla ValArgGly IleGlnGluLys GluTyrIle ArgPro ProVal gtgggg aaggcgtgg tgtagctatcgc atcccggtg caggat tacggc 1584 ValGly LysAlaTrp CysSerTyrArg IleProVal GlnAsp TyrGly tgggtg aagccaagc gttacggtccat gcctctacc aaccgt gcacac 1632 TrpVal LysProSer ValThrValHis AlaSerThr AsnArg AlaHis ctgaat gcccctget gcaggtggagca gtaggaget acctat ctaacc 1680 LeuAsn AlaProAla AlaGlyGlyAla ValGlyAla ThrTyr LeuThr aaggag t 1687 LysGlu <210> 94 <211> 562 <212> PRT
<213> Treponema pallidum <400> 44 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys Lys Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser Arg Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro Pro Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp Pro Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe Glu Gln Val Gln Thr Gln Ile Val Ala Glu Ile Asn Gln Lys Val Gln Ala Ala Val Ala Gln Ser Lys Ala Ala Ala Gln Ala Phe Ile Asn Gly Leu Thr Lys Ala Ile Glu Asp Val Ala Asp Ala Leu Leu Ala Pro His Lys Gly Asn Pro Met Ser Leu Phe Asn Leu Pro Asp Gln Gln Lys Leu Leu Lys Asp Asp Leu Ala Asp Leu Ile Pro Lys Leu Thr Ala Glu Ala Thr Lys Phe Phe Thr Glu Gly Gln Thr Phe Val Thr Glu Glu Val Lys Lys Lys Thr Asp Ala Leu Asp Ala Gly Gln Gln Ile Arg Gln Ala Ile Gln Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val Ser Ala Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr Arg Val Tyr Ile Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly Thr Ala Val Arg Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val Val Gly Lys Ala Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu <210> 45 <211> 785 <212> DNA
<213> Treponema pallidum <220>
<221> CDS
<222> (1)..(783) <223> Amino acid sequence of Msp peptide encoded by 5' half of TP 1.6 for vaccine trial <400> 45 acc agt cct tcc tgt gtg gtt aac ttt gcc cag ctg tgg aaa ccc ttt 48 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe gtc acc cgt gcc tat tca gaa aag gac act cgc tat gcc cct ggt ttc 96 Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe WO 99/53099 PCf/US99/07886 tccggc tccggggca aaactcggc taccaggcc cacaatgtg ggaaac 144 SerGly SerGlyAla LysLeuGly TyrGlnAla HisAsnVal GlyAsn agcgga gtagatgtg gacatcggt ttcctctcc ttcctttcc aatggt 192 SerGly ValAspVal AspIleGly PheLeuSer PheLeuSer AsnGly gcctgg gatagtact gacaccacg cacagcaag tatggcttc ggggcc 240 AlaTrp AspSerThr AspThrThr HisSerLys TyrGlyPhe GlyAla gatgca acgctttcc tatggcgtc gaccgtcag cggctgctt acgttg 288 AspAla ThrLeuSer TyrGlyVal AspArgGln ArgLeuLeu ThrLeu gagctg gcagggaat gccacactg gagcagcac taccgtaag ggtacc 336 GluLeu AlaGlyAsn AlaThrLeu GluGlnHis TyrArgLys GlyThr gaagac tccacgaac gaaaacaaa acagcactc ctgtgggqa gtagga 384 GluAsp SerThrAsn GluAsnLys ThrAlaLeu LeuTrpGly ValGly ggccga ctcaccctc gaaccaggc gccggcttc cgcttctcc ttcgcc 432 GlyArg LeuThrLeu GluProGly AlaGlyPhe ArgPheSer PheAla ctcgac gccggtaac caacaccag agtgcacag gactttcaa aatcgc 480 LeuAsp AlaGlyAsn GlnHisGln SerAlaGln AspPheGln AsnArg acacag agggcgcag agtgaactc accgccctc tcaaataac ctcttc 528 ThrGln ArgAlaGln SerGluLeu ThrAlaLeu SerAsnAsn LeuPhe caggga gaaagtcaa aaacaggaa gcctggctg gacgaatat gcaaag 576 GlnGly GluSerGln LysGlnGlu AlaTrpLeu AspGluTyr AlaLys aaggtg cttgatgcc gtaacggca gccaccgaa accgccctt cagtcg 624 LysVal LeuAspAla ValThrAla AlaThrGlu ThrAlaLeu GlnSer agggga aacgcgtac ataacggca gtgtcaaac gtaaaagtc acccct 672 ArgGly AsnAlaTyr IleThrAla ValSerAsn ValLysVal ThrPro ccggta getgccacg cttttgacg aacctgaag gtgttcatt accgac 720 ProVal AlaAlaThr LeuLeuThr AsnLeuLys ValPheIle ThrAsp cctcct acaccgtca ccgcttccc gcgcttcct gcattttcc ctgatg 768 ProPro ThrProSer ProLeuPro AlaLeuPro AlaPheSer LeuMet gggcag gttttgctg ca 785 GlyGln ValLeuLeu -'72-<210> 46 <211> 261 <212> PRT
<213> Treponema pallidum <400> 46 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys Lys Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser Arg Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro Pro Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp Pro Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met Gly Gln Val Leu Leu <210> 47 <211> 562 <212> PRT
<213> Treponema pallidum <220>
<221> DOMAIN
<222> (127)..(152) <223> Highly conserved amono acid motif found in the Msp genes of T. pallidum sub. pallidum.
<220>
<221> DOMAIN
<222> (1)..(152) <223> The amino acids in this region are identical to the amino terminal portions of Msps 2 and 11.
<400> 47 Thr Ser Pro Ser Cys Val Val Asn Phe Ala Gln Leu Trp Lys Pro Phe Val Thr Arg Ala Tyr Ser Glu Lys Asp Thr Arg Tyr Ala Pro Gly Phe Ser Gly Ser Gly Ala Lys Leu Gly Tyr Gln Ala His Asn Val Gly Asn Ser Gly Val Asp Val Asp Ile Gly Phe Leu Ser Phe Leu Ser Asn Gly Ala Trp Asp Ser Thr Asp Thr Thr His Ser Lys Tyr Gly Phe Gly Ala Asp Ala Thr Leu Ser Tyr Gly Val Asp Arg Gln Arg Leu Leu Thr Leu Glu Leu Ala Gly Asn Ala Thr Leu Glu Gln His Tyr Arg Lys Gly Thr Glu Asp Ser Thr Asn Glu Asn Lys Thr Ala Leu Leu Trp Gly Val Gly Gly Arg Leu Thr Leu Glu Pro Gly Ala Gly Phe Arg Phe Ser Phe Ala Leu Asp Ala Gly Asn Gln His Gln Ser Ala Gln Asp Phe Gln Asn Arg Thr Gln Arg Ala Gln Ser Glu Leu Thr Ala Leu Ser Asn Asn Leu Phe Gln Gly Glu Ser Gln Lys Gln Glu Ala Trp Leu Asp Glu Tyr Ala Lys Lys Val Leu Asp Ala Val Thr Ala Ala Thr Glu Thr Ala Leu Gln Ser Arg Gly Asn Ala Tyr Ile Thr Ala Val Ser Asn Val Lys Val Thr Pro Pro Val Ala Ala Thr Leu Leu Thr Asn Leu Lys Val Phe Ile Thr Asp Pro Pro Thr Pro Ser Pro Leu Pro Ala Leu Pro Ala Phe Ser Leu Met Gly Gln Val Leu Leu Gln Tyr Asp Ala Glu Gln Val Val Lys Gly Phe Glu Gln Val Gln Thr Gln Ile Val Ala Glu Ile Asn Gln Lys Val Gln Ala Ala Val Ala Gln Ser Lys Ala Ala Ala Gln Ala Phe Ile Asn Gly Leu Thr Lys Ala Ile Glu Asp Val Ala Asp Ala Leu Leu Ala Pro His Lys Gly Asn Pro Met Ser Leu Phe Asn Leu Pro Asp Gln Gln Lys Leu Leu Lys Asp Asp Leu Ala Asp Leu Ile Pro Lys Leu Thr Ala Glu Ala Thr Lys Phe Phe Thr Glu Gly Gln Thr Phe Val Thr Glu Glu Val Lys Lys Lys Thr Asp Ala Leu Asp Ala Gly Gln Gln Ile Arg Gln Ala Ile Gln Asn Leu Arg Ala Ser Ala Trp Arg Ala Phe Leu Met Gly Val Ser Ala Val Cys Leu Tyr Leu Asp Thr Tyr Asn Val Ala Phe Asp Ala Leu Phe Thr Ala Gln Trp Lys Trp Leu Ser Ser Gly Ile Tyr Phe Ala Thr Ala Pro Ala Asn Val Phe Gly Thr Arg Val Leu Asp Asn Thr Ile Ala Ser Cys Gly Asp Phe Ala Gly Phe Leu Lys Leu Glu Thr Lys Ser Gly Asp Pro Tyr Thr His Leu Leu Thr Gly Leu Asp Ala Gly Val Glu Thr Arg Val Tyr Ile Pro Leu Thr Tyr Ala Leu Tyr Lys Asn Asn Gly Gly Thr Ala Val Arg Gly Ile Gln Glu Lys Glu Tyr Ile Arg Pro Pro Val -'75-Val Gly Lys Ala Trp Cys Ser Tyr Arg Ile Pro Val Gln Asp Tyr Gly Trp Val Lys Pro Ser Val Thr Val His Ala Ser Thr Asn Arg Ala His Leu Asn Ala Pro Ala Ala Gly Gly Ala Val Gly Ala Thr Tyr Leu Thr Lys Glu <210> 48 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer S1 for amplification of Msps 1, 3, 4, 5, 10, 11.
<220>
<221> misc_feature <222> (1) . (18) <223> Oligonucleotide used for PCR amplification_of Msps 1, 3, 4, 5, 10, 11.
<400> 48 cgactcaccc tcgaacca 18 <210> 49 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer AS1 for use in amplification of Msps 1, 3, 4, 5, 10, 11.
<220>
<221> misc_feature <222> (1). (19) <223> Oligonucleotide used for PCR amplification of Msps 1, 3, 9, 5, 10, 11.
<400> 49 ggtgagcagg tgggtgtag 19 <210> 50 <211> 20 <212> DNA
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: PCR primer S6 for use in amplification of Msp6.
<220>
<221> misc_feature <222> (1) . (20) <223> Oligonucleotide used for PCR amplification of Msp6.
<400> 50 cgcgtttgac gctttccccg 20 <210> 51 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer AS6 for amplification of Msp6.
<220>
<221> mi.sc_feature <222> (1). (23) <223> Oligonucleotide used for PCR amplification of Msp6.
<400> 51 acacaagctt agaaagagaa tcg 23 <210> 52 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence S7 for use in amplification of Msp7.
<220>
<221> misc_feature <222> (1)..(22) <223> Oligonucleotide used for PCR amplification of Msp7.
<400> 52 ctttttctcg ctgacgcttt gt 22 <210> 53 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence AS7 for the amlification of Msp7.
<220>

_77_ <221> misc_feature <222> (1). (21) <223> Oligonucleotide used for PCR amplification of Msp7.
<400> 53 tgcaaggcat gggtgtaatc a 21 <210> 54 <211> 18 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence S8 for the amplification of Msp8.
<220>
<221> misc_feature <222> (1). (18) <223> Oligonucleotide used for PCR amplification of MspB.
<400> 54 cggctgacgc tgaccccg 18 <210> 55 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence AS8 for the amplification of Msp8.
<220>
<221> misc_feature <222> (1). (22) <223> Oligonucleotide used for PCR amplification of MspB.
<400> 55 caagtagtct gtaagctgcc tg 22 <210> 56 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence S9 for use in amplification of Msp9.
<220>
<221> misc_feature <222> (1). (23) <223> Oligonucleotide used for PCR amplification of Msp9.

_78_ <400> 56 atattgaagg ctatgcggag ctg 23 <210> 57 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence AS9 for amplification of Msp9.
<220>
<221> misc_feature <222> (1). (22) <223> Oligonucleotide used for PCR amplification of Msp9.
<400> 57 cctcaaggaa agaagtatca gg 22 <210> 58 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence S12 for amplification of Mspl2.
<220>
<221> misc_feature <222> (1). (19) <223> Oligonucleotide used for PCR amplification of Mspl2.
<400> 58 cgcgcataac gctcactcc 19 <210> 59 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence AS12 for amplification of Mspl2.
<220>
<221> misc_feature <222> (1) . (22) <223> Oligonucleotide used for PCR amplification of Mspl2.
<400> 59 gtctataagg tgtgtatacg cg 22 <210> 60 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence 51.6 for amplification of Msp-TP1.6.
<220>
<221> misc_feature <222> (1). (23) <223> Oligonucleotide used for PCR amplification of Msp-TP1.6.
<400> 60 accagtcctt cctgtgtggt taa 23 <210> 61 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence AS1.6 for amplification of Msp-TP1.6.
<220>
<221> misc_feature <222> (1). (24) <223> Oligonucleotide used for PCR amplification of Msp-TP1.6.
<400> 61 actccttggt tagataggta gctc 24 <210> 62 <211> 43 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Cloning adapter 1, to permit "nested PCR" using multiple PCR primers.
<220>
<221> misc_feature <222> (1). (43) <223> Oligonucleotide used as cloning adaptor.
<400> 62 taatacgact cactataggg ctcgagcggc cgcccgggca ggt 43 <210> 63 <211> 42 <212> DNA

<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Cloning adaptor 2, to permit "nested PCR" using multiple PCR primers.
<220>
<221> misc_feature <222> (1)..(42) <223> Oligonucleotide used as cloning adaptor.
<400> 63 gtaatacgac tcactatagg gcagcgtggt cgcggccgag gt 42 <210> 64 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Nested primer 1, which hybridizes to both adapter 1 and adapter 2.
<220>
<221> misc_feature <222> (1). (22) <223> Oligonucleotide used for "nested PCR."
<400> 64 tcgagcggcc gcccgggcag gt 22 <210> 65 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Nested primer 2, which hybridizes with adapter 1 and adapter 2.
<220>
<221> misc_feature <222> (1). (20) <223> Oligonucleotide used for "nested PCR."
<400> 65 agcgtggtcg cggccgaggt 20 <210> 66 <211> 23 <212> DNA
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: PCR primer sequence S3.
<220>
<221> misc_feature <222> (1). (23) <223> Oligonucleotide used for amplification of Msp3.
<400> 66 accagtcctt cctgtgtggt taa 23 <210> 67 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer sequence AS33.
<220>
<221> misc_feature <222> (1) . (24) <223> Gligonucleotide used for amplification of Msp33.
<400> 67 actccttggt tagataggta gctc 24 <210> 68 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: T7, PCR3.1 <220>
<221> misc_feature <222> (1). (19) <223> Oligonucleotide used for DNA sequencing.
<400> 68 ggcttccgct tctccttcg 19 <210> 69 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: INT-AS
sequencing primer.
<220>

<221> misc_feature <222> (1). (20) <223> Oligonucleotide used for DNA sequencing.
<400> 69 gtttcgagct taaggaatcc 20 <210> 70 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer <220>
<221> misc_feature <222> (1). (20) <223> PCR primer designed to 5' end of gpd open reading frame <400> 70 tgcacggtga cgatctgtgc 20 <210> 71 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer <220>
<221> misc_feature <222> (1). (20) <223> PCR primer designed to 3' end of gpd open reading frame <400> 71 ggtaccaggc gacactgaac 20 <210> ?2 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer <220>
<221> misc_feature <222> (1). (20) <223> PCR primer designed to the 5' end of the tpa92 gene <400> 72 gggtgtcgtg gagttttgcg 20 <210> 73 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer <220>
<221> misc_feature <222> (1). (19) <223> PCR primer designed to 3' end of tpa92 gene <400> 73 cttgcctggt ggacgcagc 19 <210> 79 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer <220>
<221> misc_feature <222> (1). (30) <223> PCR primer designed to 5' end of tpa92 open reading frame <400> 79 cgggatccac aattggtacg agggaaagcc 30 <210> 75 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer <220>
<221> misc_feature <222> (1). (31) <223> PCR primer designed to 3' end of tpa92 open reading frame <400> 75 cggaattcct acaaattatt taccgtgaac g 31 <210> 76 <211> 136 <212> PRT
<213> Treponema pallidum <400> 76 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala Arg Ala Leu Ala Ala Gly ALa Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Xaa Ala Ser Asn Val Phe Gly Gly Val Phe Leu Asn Met Ala Met Arg <210> 77 <211> 136 <212> PRT
<213> Treponema pallidum <400> 77 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Gln Ala Arg Ala Leu Ala Ala Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gly Gly Val Phe Leu Asn Met Ala Met Arg <210> 78 <211> 138 <212> PRT
<213> Treponema pallidum <400> 78 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Asp Tyr Ala Arg Ala Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 79 <211> 141 <212> PRT

<213> Treponemapallidum <400> 79 Phe Ala Ser Thr TrpGlu GlyLysAsp Ser Gly LysAla Asn Asp Gln Pro Gly Ala Pro LysTyr GlyLeuGly Gly Ile LeuPhe Thr Ser Asp Gly Trp Glu Thr GluAsp GlyValGln Glu Ile LysVal Arg Arg Tyr Glu Leu Thr Asn ThrLeu SerSerGly Tyr Gln AlaAla Gly Ser Ala Arg Ala Pro Asn LeuTrp AspValGly Ala Val SerMet Ala Ile Lys Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 80 <211> 140 <212> PRT
<213> Treponema pallidum <400> 80 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Gln Gly Lys Ala Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Pro Ala Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Asn Gly Gly Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 81 <211> 152 <212> PRT
<213> Treponema pallidum <400> 81 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Ala Pro Ala Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu _87_ Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Thr Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala Gly Ala Ala Ala Gly Val Pro Ala Ala Ala Asp Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Glu Asn Ala Ala Asn Val Asn Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 82 <211> 147 <212> PRT
<213> Treponema pallidum <400> 82 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg Ala Gln Leu Pro Ala Val Ala Pro Ala Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly Arg Lys Lys Asp Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met _88_ Ala Met Arg <210> 83 <211> 145 <212> PRT
<213> Treponema pallidum <400> 83 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala Ala Ala Ala Ala Ala Val Asn Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly Arg Lys Lys Asp Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 84 <211> 143 <212> PRT
<213> Treponema pallidum <400> 84 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Ala Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala _89_ ProAla Pro Asn AlaIle LeuTrp Asp Gly LysVal Ala Asn Val Ala SerMet Lys Trp LeuCys AlaLeu Ala Thr ValGly Leu Gly Ala Asp ArgLys Lys Gly GlnGly ThrVal Gly Asp LeuLeu Asp Ala Ala Ala ThrLeu Gly Arg PheSer AlaGly Gly Phe SerGln Tyr Trp Tyr Ala AlaSer Asn Phe GlyVal PheLeu Asn Ala Arg Val Gln Met Met <210> 85 <211> 194 <212> PRT

<213> Treponemapallidum <400> 85 Phe Ala Ser Thr TrpGlu GlyLysSer ThrGly Pro Asn Asp Asn Ala Ala Gly Val Pro LysTyr GlyLeuGly AspIle Phe Thr Ser Gly Leu Gly Trp Glu Thr GluAsp GlyValGln TyrIle Val Arg Arg Glu Lys Glu Leu Thr Asn ThrLeu SerSerGly AlaGln Ala Gly Ser Tyr Ala Gly Ala Ala Asn AsnPhe ProValTrp ValGly Lys Ala Ile Asp Ala Val Ser Met Leu GlyLeu CysAlaLeu AlaThr Val Lys Trp Ala Asp Gly Arg Lys Asp AlaGln GlyThrVal AlaAsp Leu Lys Gly Gly Ala Leu Thr Leu Tyr TrpPhe SerAlaGly TyrPhe Ser Gly Arg Gly Ala Lys Ala Ser Val GlnGly ValPheLeu MetAla Arg Asn Phe Asn Met <210> 86 <211> 140 <212> PRT

_9Q_ <213> Treponemapallidum <400> 86 Phe Ala Ser Thr TrpGlu Lys Ser ThrGly AlaPro Asn Asp Gly Asn Ala Gly Val Pro LysTyr Leu Gly AspIle LeuPhe Thr Ser Gly Gly Gly Trp Glu Thr GluAsp Val Gln TyrIle LysVal Arg Arg Gly Glu Glu Leu Thr Asn ThrLeu Ser Gly AlaPro AlaPro Gly Ser Ser Tyr Ala Asn Asn Ile TrpAsp Gly Ala ValSer MetLys Ala Leu Val Lys Leu Trp Gly Cys LeuAla Thr Asp GlyArg LysLys Leu Ala Ala Val Asp Gly Ala Gly ValGly Asp Ala LeuThr LeuGly Gln Thr Ala Leu Tyr Arg Trp Ser GlyGly Phe Ala LysAla SerAsn Phe Ala Tyr Ser Val Phe Gln Val PheAsn Ala Met Gly Phe Met Arg <210> 87 <211> 141 <212> PRT

<213> Treponemapallidum <400> 87 Phe Ala Ser Thr TrpGluGly Pro Asn Asn Pro Asn Asp Lys Gly Val Ala Giy Val Pro LysTyrGly Gly Gly Ile Phe Thr Ser Leu Asp Leu Gly Trp Glu Thr GluAspGly Gln Glu Ile Val Arg Arg Val Tyr Lys Glu Leu Thr Asn ThrLeuSer Gly Tyr Gln Ala Gly Ser Ser Ala Ala Ala Val Asn Asp LeuTrpAsp Gly Ala Val Met Asn Ile Val Lys Ser 65 70 ?5 80 Lys Leu Trp Leu AlaLeuAla Thr Asp Gly Lys Gly Cys Ala Val Arg Lys Asp Gly Gln ThrValGly Asp Ala Leu Leu Ala Gly Ala Leu Thr Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 88 <211> 148 <212> PRT
<213> Treponema pallidum <400> 88 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala Ala Ala Ala Ala Ala Ala Ala Val Asn Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Arg Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly Arg Lys Lys Asp Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 89 <211> 143 <212> PRT
<213> Treponema pallidum <400> 89 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Pro Ala Gln Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Glu Asn Ala Ala Asn Val Asn Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 90 <211> 142 <212> PRT
<213> Treponema pallidum <400> 90 Phe Ala Ser Asn Pro Asp Trp Glu Gly Lys Asp Ser Gln Gly Lys Ala Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln A1a Ala Ala Val Asn Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly Arg Lys Lys Asp Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 91 <211> 140 <212> PRT
<213> Treponema pallidum <400> 91 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Gly Gly Tyr Ala Thr Ala Pro Ala Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 92 <211> 143 <212> PRT

<213> Treponema pallidum <400> 92 Phe Ala AsnThr Asp Glu Lys Ser Lys Val Val Ser Trp Gly Asp Gly Gln Ala AlaAsn His Lys Gly Gly Gly Ile Leu Gly Ser Tyr Leu Asp Phe Gly GluArg Thr GIu Gly Gln Glu Ile Lys Trp Arg Asp Val Tyr Val Glu ThrGly Asn Thr Ser Gly Tyr Gln Ala Leu Ser Leu Ser Ala Ala Gly ProAla Asn Ile Trp Val Gly Lys Val Ala Asp Leu Asp Ala Ser Met LeuTrp Gly Cys Leu Ala Thr Val Gly Lys Leu Ala Ala Asp Arg Lys AspGly Ala Gly Val Ala Asp Leu Leu Lys Gln Thr Gly Ala Thr Leu TyrArg Trp Ser Gly Tyr Phe Ser Gln Gly Phe Ala Gly Ala Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 93 <211> 139 <212> PRT
<213> Treponema pallidum <400> 93 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala Gly Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 94 <211> 140 <212> PRT
<213> Treponema pallidum <400> 94 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Ala Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Pro Ala Gln Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Asn~Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 95 <211> 141 <212> PRT
<213> Treponema pallidum <900> 95 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Pro Ala Pro Ala Asn Asn Ala Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 96 <211> 141 <212> PRT
<213> Treponema pallidum <400> 96 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Asp Ser Lys Gly Val Val Gln Gly His Lys Tyr Leu Gly IleLeu Ala Ala Ser Gly Gly Asp Asn PheGly TrpGlu Thr Glu Asp Val GluTyr IleLys Arg Arg Gly Gln ValGlu LeuThr Asn Thr Leu Ser TyrAla ThrAla Gly Ser Ser Gly ProAla AlaAla Ile Trp Asp Gly LysVal SerMet Asn Leu Val Ala LysLeu TrpGly Cys Leu Ala Thr ValGly HisLys Leu Ala Ala Asp LysAsn GlyAla Gly Ile Gly Asp LeuLeu ThrLeu Asn Asp Ala Ala GlyTyr ArgTrp Ser Gly Gly Phe SerGln AlaSer Phe Ala Tyr Ala AsnVal PheGln Val Leu Asn Ala Arg Gly Phe Met Met <210> 97 <211> 140 <212> PRT

<213> Treponemapallidum <400> 97 Phe Ala Ser Thr Trp GlyLys SerGlnGly LysAla Asn Asp Glu Asp Pro Ala Gly Pro Lys GlyLeu GlyAspIle LeuPhe Thr Ser Tyr Gly Gly Trp Glu Thr Glu GlyVal GlyTyrIle LysVal Arg Arg Asp Gln Glu Leu Thr Asn Thr SerGly TyrAlaArg AlaGln Gly Ser Leu Asp Pro Pro Ala Ile Trp ValGly LysValSer MetLys Asn Leu Asp Ala Leu Trp Gly Cys Leu AlaThr ValGlyArg LysLys Leu Ala Ala Asp Asp Gly Ala Gly Val AlaAsp LeuLeuThr LeuGly Gln Thr Gly Ala Tyr Arg Trp Ser Gly TyrPhe SerLysAla SerAsn Phe Ala Gly Ala Val Phe Gln Val Leu MetAla Arg Gly Phe Asn Met <210> 98 <211> 141 <212> PRT

<213> Treponemapallidum <400> 98 Phe Ala Ser Thr Asp Glu LysAsp Lys Gly Val Asn Trp Gly Ser Val Gln Ala Gly Asn His Lys GlyLeu Gly Asp Leu Ala Ser Tyr Gly Ile Phe Gly Trp Arg Thr Glu GlyVal Glu Tyr Lys Glu Arg Asp Gln Ile Val Glu Leu Gly Rsn Thr SerGly Tyr Ala Ala Thr Ser Leu Asp Arg Gln Pro Pro Asn Ile Trp ValGly Lys Val Met Ala Leu Asp Ala Ser Lys Leu Tip Leu Cys Leu AlaThr Val Gly Lys Gly Ala Ala Asp Arg Lys Asp Gly Gln Gly Val AlaAsp Leu Leu Leu Ala Thr Gly Ala Thr Gly Tyr Arg Phe Ser Gly TyrPhe Ser Gln Ser Trp Ala Gly Ala Ala Asn Val Phe Gly Val Leu MetAla Arg Gln Phe Asn Met <210> 99 <211> 139 <212> PRT

<213> Treponemapallidum <400> 99 Phe Ala Ser Thr Asp GluGly Ser Thr Ala Pro Asn Trp Lys Asn Gly Ala Gly Thr Ser Lys GlyLeu Gly Ile Phe Gly Pro Tyr Gly Asp Leu Trp Glu Arg Arg Glu GlyVal Glu Ile Val Glu Thr Asp Gln Tyr Lys Leu Thr Gly Ser Thr SerGly Tyr Arg Gln Pro Asn Leu Asp Ala Ala Pro Ala Asn Leu Trp ValGly Lys Ser Lys Leu Ile Asp Ala Val Met Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn _98_ e5 90 95 Gly Ala Asn Gly Asp Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Lys Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 100 <211> 196 <212> PRT
<213> Treponema pallidum <400> 100 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Ala Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Ala Ala Pro Ala Ala Val Asn Asn Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Glu Asn Ala Ala Asn Val Asn Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Rla Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 101 <211> 141 <212> PRT
<213> Treponema pallidum <400> 101 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Val Val Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Ala Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Gln Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 102 <211> 139 <212> PRT
<213> Treponema pallidum <400> 102 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Lys Ala Pro Ala Gly Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg Ala Gly Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210>

<211>

<212>
PRT

<213> pallidum Treponema <400>

Phe Ala Asn Thr Trp GluGlyLys Pro Gly ValPro Ser Asp Asn Asn Ala Gly Thr Pro Lys TyrGlyLeu Gly Asp LeuPhe Val Ser Gly Ile Gly Trp Arg Thr Glu AspGlyVal Gln Tyr LysVal Ala Arg Glu Ile Glu Leu Gly Asn Thr LeuSerSer Gly Ala AlaAla Thr Ser Tyr Gln Gly Ala Val Asn Asp IleLeuTrp Asp Gly LysVal Ala Asn Val Ala Ser Met Leu Trp Leu CysAlaLeu Ala Thr ValGly Lys Gly Ala Asp His Lys Asn Gly Gln GlyThrVal Gly Asp LeuLeu Lys Ala Ala Ala Thr Leu Tyr Arg Phe SerAlaGly Gly Phe SerLys Gly Trp Tyr Ala Ala Ser Val Phe Gly ValPheLeu Asn Ala Arg Asn Gln Met Met <210> 104 <211> 141 <212> PRT
<213> Treponema pallidum <400> 104 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Ser Asn Thr Gly Val Val Gln Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu 20 25 30' Phe Gly Trp Ala Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Gln Pro Pro Ala Asn Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Leu Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 105 <211> 140 <212> PRT
<213> Treponema pallidum <400> 105 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg Ala Gly Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Ala Ala Pro Asp Gly Ile Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 106 <211> 139 <212> PRT
<213> Treponema pallidum <400> 106 Phe Ala Ser Asn Thr Asp Trp Glu GIy Lys Asp Ser Lys Gly Val Val Gln Ala Gly Ala Asn His Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Gln Pzo Pro Asn IleLeuTrp Asp Gly LysVal MetLys Leu Ala Val Ala Ser Trp Leu CysAlaLeu Ala Thr ValGly LysLys Asp Gly Ala Asp Arg Gly Gln GlyThrVal Gly Asp LeuLeu LeuGly Tyr Ala Ala Ala Thr Arg Phe SerAlaGly Gly Phe SerGln SerAsn Val Trp Tyr Ala Ala Phe Gly ValPheLeu Asn Ala Arg Gln Met Met <210> 107 <211> 140 <222> PRT
<2I3> Treponema pallidum <400> 107 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Glu Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Arg Ala Gly Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 108 <211> 140 <212> PRT

<213> Treponema pallidum <400> 108 Phe Ala Ser Asn Thr Asp Trp Glu Gly Lys Pro Asn Gly Asn Val Pro Ala Gly Val Thr Pro Ser Lys Tyr Gly Leu Gly Gly Asp Ile Leu Phe Gly Trp Xaa Arg Thr Arg Glu Asp Gly Val Gln Glu Tyr Ile Lys Val Glu Leu Thr Gly Asn Ser Thr Leu Ser Ser Gly Tyr Ala Thr Ala Gln Pro Pro Ala Asp Ile Leu Trp Asp Val Gly Ala Lys Val Ser Met Lys Leu Trp Gly Leu Cys Ala Leu Ala Ala Thr Asp Val Gly His Lys Lys Asn Gly Ala Gln Gly Thr Val Gly Ala Asp Ala Leu Leu Thr Leu Gly Tyr Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 109 <211> 139 <212> PRT

<213> Treponema pallidum <400> 109 Phe Ala AsnThr Asp GluGly Pro GlyLysAla Pro Ser Trp Lys Asn Ala Gly ProSer Lys GlyLeu Gly IleLeuPhe Gly Thr Tyr Gly Asp Trp Glu ThrArg Glu GlyVal Glu IleLysVal Glu Arg Asp Gln Tyr Leu Thr AsnSer Thr SerSer Tyr ThrAlaArg Ala Gly Leu Gly Ala Gly Ala IleLeu Trp ValGly Lys SerMetLys Leu Asp Asp Ala Val Trp Gly CysAIa Leu AlaThr Val HisLysLys Asn Leu Ala Asp Gly Gly Ala GlyThr Val AlaAsp Leu ThrLeuGly Tyr Gln Gly Ala Leu WO 99/53099 PC1'/US99/07886 Arg Trp Phe Ser Ala Gly Gly Tyr Phe Ala Ser Gln Ala Ser Asn Val Phe Gln Gly Val Phe Leu Asn Met Ala Met Arg <210> 110 <211> 1645 <212> DNA
<213> Treponema pallidum <400> 110 tatgcaggcg tactcactcc gcaggtcagt ggcacagccc agctccagtg gggcattgcg 60 ttccagaaga atccacgcac tggcccgggc aagcacaccc atgggtttcg cactaccaat 120 agtctgacta tttccctgcc gttggtgtca aagcacaccc acacccgccg aggggaggca 180 cgctcagggg tgtgggcaca gctgcagctg aaggacctgg cagtagagct tgcgtcttct 240 aaaagctcaa cggccctgtc ctttaccaaa cctaccgctt ccttccaggc aaccctgcac 300 tgttatgggg cctacctgac agtgggtacc agtccttcct gtgtggttaa ctttgcccag 360 ctgtggaaac cctttgtcac ccgtgcctat tcagaaaagg acactcgcta tgcccctggt 420 ttctccggct ccggggcaaa actcggctac caggcccaca atgtgggaaa cagcggagta 480 gatgtggaca tcggtttcct ctccttcctt tccaatggtg cctgggatag tactgacacc 540 acgcacagca agtatggctt cggggccgat gcaacgcttt cctatggcgt cgaccgtcag 600 cggctgctta cgttggagct ggcagggaat gccacactgg accagaacta cgttaagggt 660 accgaagact ccaagaacga aaacaaaaca gcactcctgt ggggagtagg aggccgactc 720 gccctcgaac caggcgccgg cttccgcttc tccttcgccc tcgacgccgg taaccaacac 780 cagagtaacg cacaattcta cgctagaatg gctccctcac agagggtcca tgaagtcatc 840 actagtcttg gggacacgct gctgacctcc ccgcaacaag atgttgtttc attctttgtg 900 caagaactga gcaaaggcag tcttctggag aaagctggct tagtaacgct cttggcgcag 960 cgcaccatcg tcggcttagc gtcaagcggt ggttacctaa gacatctgaa tggcaaaggc 1020 ctagaaataa acatgaggct catagagcag cagaagaatc ctgacgcgcg gatgcggaca 1080 gcactcttta tttcctggtt gcaattcacg tacaccaaaa cgctcaacat agacgcgctc 1140 ctgcgtatgc agtggaggtg gctctcttct ggcatatact ttgccaccgc aggcactaat 1200 atctttggag aacgtgtttt ctttaagaat caagcaaatc actttgattt tgccggattc 1260 ctcaaactcg aaaccaaaag cggtgacccc tacacccacc tgctcaccgg cctgaacgcc 1320 ggcgtcgaag cacgcgtgta catccccctc acctacacct tttacataaa taacggaggt 1380 gcgcagtaca agggaagtaa ttcggacggc gtcatcaaca cgcctatctt gagcaaagcg 1440 tggtgcagct atcgcatccc cctcggttcc cacgcctggc ttgcaccaca cacatccgtg 1500 ctatgggcaa caaaccgctt caaccacaac cagagcgggg atgcgctcct gcgtgagcac 1560 gcgctccagt accaggtggg actgacgttc agtcccttcg agaaggtgga gctcagcgcc 1620 cagtgggaac agggggtgct tgctg 1645 <210> 111 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer designed to 5' end of mspl3 <220>
<221> misc_feature <222> (1). (20) <223> Oligonucleotide used for PCR.
<400> 111 WO 99/53099 PCT/US99/0788b cactagtcttggggacacgc 20 <210> 112 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer designed to 3' end of mspl3 <220>
<221> misc_feature <222> (1). (19) <223> Oligonucleotide used for PCR.
<400> 112 tacgtgattgcaaccagga 19

Claims (21)

The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:

1. An isolated nucleic acid molecule that encodes a polypeptide having an amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 23, 25, 27, 29, 31, 32, 35, 37, 39, 41, 44 and 46.

2. An isolated nucleic acid molecule according to Claim 1, selected from the group consisting of the nucleotide sequences of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 22, 24, 26, 28, 30, 33, 34, 36, 38, 40, 43 and 45.

3. A pair of PCR primers comprising two nucleic acid molecules selected from the group consisting of one of the following sets of two nucleic acid molecules:
Set 1: ~5'-CGACTCACCCTCGAACCA-3' (SEQ ID NO:48) (sense) 5'-GGTGAGCAGGTGGGTGTAG-3' (SEQ ID NO:49) (antisense) Set 2 ~5'-CGCGTTTGACGCTTTCCCCG-3' (SEQ ID NO:50) (sense) 5'-ACACAAGCTTAGAAAGAGAATCG-3' (SEQ ID NO:51) (antisense) Set 3 ~5'-CTTTTTCTCGCTGACGCTTTGT-3' (SEQ ID NO:52) (sense) 5'-TGCAAGGCATGGGTGTAATCA-3' (SEQ ID NO:53) (antisense) Set 4 ~5'-CGGCTGACGCTGACCCCG-3' (SEQ ID NO:54) (sense) 5'-CAAGTAGTCTGTAAGCTGCCTG-3' (SEQ ID NO:55) (antisense) Set 5 ~5'-ATATTGAAGGCTATGCGGAGCTG-3' (SEQ ID NO:56) (sense) 5'-CCTCAAGGAAAGAAGTATCAGG-3' (SEQ ID NO:57) (antisense) Set 6 ~5'-CGCGCATAACGCTCACTCC-3' (SEQ ID NO:58) (sense) 5'-GTCTATAAGGTGTGTATACGCG-3' (SEQ ID NO:59) (antisense) Set 7 ~5'-ACCAGTCCTTCCTGTGTGGTTAA-3' (SEQ ID NO:60) (sense) 5'-ACTCCTTGGTTAGATAGGTAGCTC-3' (SEQ ID NO:61) (antisense)

4. An isolated polypeptide encoded by a nucleic acid molecule according to Claim 1, and functional equivalents thereof.

5. An isolated polypeptide capable of inducing a protective immunologic response to T.p. pallidum, T.p. pertenue, or T.p. endemicum when administered in an effective amount to an animal host.

6. A vaccine comprising:
an effective amount of an isolated polypeptide according to Claim 5; and a physiologically acceptable carrier.

7. A vaccine according to Claim 6, wherein the isolated polypeptide is a polypeptide of Claim 4.

8. A method of identifying a T.p. pallidum vaccine candidate comprising the steps:
identifying a T.p. pallialum protein that is immunologically reactive with an opsonizing serum against T.p. pallidum but that is immunologically unreactive with a non-opsonizing serum against T.p. pallidum;
testing said protein to determine whether it is capable of eliciting in an animal host an immune response that is protective against challenge with T.p.
pallidum; and determining that said protein is a vaccine candidate if test results indicate that it elicits in said host an immune response that is protective against challenge with T.p. pallidum.

9. A vaccine comprising:
a vaccine candidate identified according to the method of Claim 8; and a physiologically acceptable carrier.

10. A method of identifying a T.pallidum vaccine candidate comprising the steps:
identifying a protein that is expressed by a gene that is present in the genome of T.pallidum but that is not present in the genome of Treponema paraluiscuniculi;
testing said protein to determine whether it is capable of eliciting in a suitable host an immune response that is protective against challenge with T. pallidum;
and determining that said protein is a vaccine candidate if test results indicate that it elicits in said host an immune response that is protective against challenge with T.pallidum.

11. A vaccine comprising:

a vaccine candidate of Claim 10; and a physiologically acceptable carrier.

12. The vaccine of Claim 11, wherein the vaccine candidate is capable of eliciting in a suitable host an immune response that is protective against challenge with T.p. pallidum, T.p. pertenue, and T.p. endemicum.

13. A vaccine according to Claim 7, which comprises at least two different T.p. pallidum Msp polypeptides.

14. A vaccine according to Claim 7, which comprises:
an isolated T.p. pallidum glycerophosphodiester phosphodiesterase polypeptide; and an effective amount of at least one isolated T.p. pallidum Msp polypeptide.

15. A vaccine according to Claim 14, which further comprises an effective amount of an isolated T.p. pallidum D15/Oma87 homologue.

16. A method of inducing a protective immune response against T. pallidum comprising administering to a host a vaccine of Claim 6.

17. A method of inducing a protective immune response against T. pallidum comprising administering to a host a vaccine of Claim 9.

18. A method of inducing a protective immune response against T. pallidum comprising administering to a host a vaccine of Claim 11.

19. A method for analyzing a sample of DNA to determine whether it originated from T.p. subspecies pallidum, T.p. subspecies pertenue or T.p. subspecies endemicum, comprising the steps:
amplifying the DNA with the PCR sense primers 5'-ACCAGTCCTTCCTGTGTGGTTAA-3' (SEQ ID NO:60) (sense) and 5'-ACTCCTTGGTTAGATAGGTAGCTC-3' (SEQ ID NO:61) (antisense);
analyzing the size of the resulting DNA fragments; and determining that the DNA originated from T.p. pallidum if a single DNA
fragment having a size of about 1.7 kb is detected, and that the DNA
originated from T.p. subspecies pertenue if at least two DNA fragments are detected, one having a size of about 1.7 and the other having a size of about 1.3 kb, and that the DNA
originated from T.p. subspecies endemicum if no DNA fragment is detected.

20. A method of determining whether a first and a second clinical isolate of T.p. pallidum are the same or different comprising:
amplifying a first sample of genomic DNA from the first clinical isolate and a second sample of DNA from the second isolate using the PCR primers 5'-CGACTCACCCTCGAACCA-3' (SEQ ID NO:48) (sense), and 5'-GGTGAGCAGGTGGGTGTAG-3' (SEQ ID NO:49) (anti-sense);
digesting the first and the second amplified DNAs with a restriction endonuclease that recognizes a four-base cleavage site;
analyzing the size of the DNA products in the first and the second amplified DNAs; and determining that the first and the second clinical isolates are different if the DNA fragments produced by restriction digestion of the first and the second DNA
samples are not the same.

21. The method of Claim 20, wherein the genomic DNA of the first and second clinical isolates are digested with the restriction endonucleases BstUI, AluI, HhaI and NlaIII.