CA2319703C - Growth differentiation factor-8 - Google Patents

Abstract

A transgenic non-human animal of the species selected from the group consisting of avian, bovine, ovine and porcine having a transgene which results in disrupting the production of and/or activity of growth differentiation factor-8 (GDF-8) chromosomally integrated into the germ cells of the animal is disclosed. Also disclosed are methods for making such animals, and methods of treating animals, including humans, with antibodies or antisense directed to GDF-8. The animals so treated are characterized by increased muscle tissue and bone content.

Description

BACKGROUND OF THE INVENTION
S 1. Field of the Invention The invention relates generally to growth factors and specifically to a new member of the transforming growth factor beta (TGF-(3) superfamily, which is denoted, growth differentiation factor-8 (GDF-8) and methods of use for modulating muscle, bone, kidney and adipose cell and tissue growth.

2. Description of Related Art The transforming growth factor ~3 (TGF-Vii) superfamily encompasses a group of structurally-related proteins which affect a wide range of differentiation processes during embryonic development. The family includes, Mullerian inhibiting substance (MIS), which is required for normal male sex development (Behringer, et al., Nature, 345:167, 1990), Drosophila decapentaplegic (DPP) gene product, which is required for dorsal-ventral axis formation and morphogenesis of the imagina.I disks (Padgett, et al., Nature, 325:81 -84, 1987), the Xenopus Vg-1 gene product, which localizes to the vegetal pole of eggs ((Weeks, et al., Cell, S 1:861-867, 1987), the activins (Mason, et al., Biochem, Biophys. Res. Commun., 135:957-964, 1986), which can induce the formation of mesoderm and anterior structures in Xenopus embryos (Thomsen, et al., Cell, 63:485, 1990}, and the bone morphogenetic proteins (BMPs, osteogenin, OP-1) which can induce de novo cartilage and bone formation (Sampath, et al., J. Biol. Chem., 265:13198, 1990).
The TGF-(3s can influence a variety of differentiation processes, including adipogenesis, myogenesis, chondrogenesis, hematopolesis, and epithelial cell differentiation (for review, see Massague, Cell 49:437, 1987).

The proteins of the TGF-(i family are initially synthesized as a large precursor protein which subsequently undergoes proteolytic cleavage at a cluster of basic residues approximately 110-140 amino acids from the C-terminus. The C-terminal regions, or mature regions, of the proteins are all structurally related and the different family members can be classified into distinct subgroups based on the extent of their homology.
Although the homologies within particular subgroups range from 70% to 90%
amino acid sequence identity, the homologies between subgroups are significantly lower, generally ranging from only 20% to 50%. In each case, the active species appears to be a disulfide-linked dimer of C-terminal fragments. Studies have shown that when the pro-region of a member of the TGF-~3 family is coexpressed with a mature region of another member of the TGF-(3 family, intracellular dimerization and secretion of biologically active homodimers occur (Gray, A. et al., Science, 247:1328, 1990). Additional studies by Hammonds, et al., (Molec. Endocrin. 5:149, 1991) showed that the use of the pro-region combined with the BMP-4 mature region led to dramatically improved 1 S expression of mature BMP-4. For most of the family members that have been studied, the homodimeric species has been found to be biologically active, but for other family members, like the inhibins (Zing, et al., Nature, 321 :779, 1986) and the TGF-his (Cheifetz, et al., Cell, 48:409, 1987), heterodimers have also been detected, and these appear to have different biological properties than the respective homodimers.
In addition it is desirable to produce livestock and game animals, such as cows, sheep, pigs, chicken and turkey, fish which are relatively high in musculature and protein, and low in fat content. Many drug and diet regimens exist which may help increase muscle and protein content and lower undesirably high fat and/or cholesterol levels, but such treatment is generally administered after the fact, and is begun only after significant damage has occurred to the vasculature. Accordingly, it would be desirable to produce animals which are genetically predisposed to having higher muscle and/or bone content, without any ancillary increase in fat levels.

The food industry has put much effort into increasing the amount of muscle and protein in foodstuffs. This quest is relatively simple in the manufacture of synthetic foodstuffs, but has been met with limited success in the preparation of animal foodstuffs.
Attempts have been made, for example, to lower cholesterol levels in beef and poultry products by including cholesterol-lowering drugs in animal feed (see e.g. Elkin and Rogler, J. Agric.
Food Chem. 1990, 38, 1635-1641 ). However, there remains a need for more effective methods of increasing muscle and reducing fat and cholesterol levels in animal food products.
SUMMARY OF THE INVENTION
The present invention provides a cell growth and differentiation factor, GDF-8, a polynucleotide sequence which encodes the factor, and antibodies which are immunore-active with the factor. This factor appears to relate to various cell proliferative disorders, especially those involving muscle, nerve, bone, kidney and adipose tissue In one embodiment, the invention provides a method for detecting a cell proliferative disorder of muscle, nerve, bone, kidney or fat origin and which is associated with GDF-8.
In another embodiment, the invention provides a method for treating a cell proliferative disorder by suppressing or enhancing GDF-8 activity.
In another embodiment, the subject invention provides non-human transgenic animals which are useful as a source of food products with high muscle, bone and protein content, and reduced fat and cholesterol content. The animals have been altered chromosomally in their germ cells and somatic cells so that the production of GDF-8 is produced in reduced amounts, or is completely disrupted, resulting in animals with decreased levels of GDF-8 in their system and higher than normal levels of muscle tissue and bone tissue, such as ribs, preferably without increased fat and/or cholesterol levels.
Accordingly, the present invention also includes food products provided by the animals. Such food products have increased nutritional value because of the increase in muscle tissue and bone content. The transgenic non-human animals of the invention include bovine, porcine, ovine and avian animals, for example.
The subject invention also provides a method of producing animal food products having increased bone content. The method includes modifying the genetic makeup of the germ cells of a pronuclear embryo of the animal, implanting the embryo into the oviduct of a pseudopregnant female thereby allowing the embryo to mature to full term progeny, testing the progeny for presence of the transgene to identify transgene-positive progeny, cross-breeding transgene-positive progeny to obtain further transgene-positive progeny and processing the progeny to obtain foodstuff. The modification of the germ cell comprises altering the genetic composition so as to disrupt or reduce the expression of the naturally occurring gene encoding for production of GDF-8 protein. In a particular embodiment, the transgene comprises antisense polynucleotide sequences to the protein. Alternatively, the transgene may comprise a non-functional sequence which replaces or intervenes in the native GDF-8 gene.
The subject invention also provides a method of producing avian food products having improved muscle and/or bone content. The method includes modifying the genetic makeup of the germ cells of a pronuclear embryo of the avian animal, implanting the embryo into the oviduct of a pseudopregnant female into an embryo of a chicken, culturing the embryo under conditions whereby progeny are hatched, testing the progeny for presence of the genetic alteration to identify transgene-positive progeny, cross breeding transgene-positive progeny and processing the progeny to obtain foodstuff.
The invention also provides a method for treating a muscle, bone, kidney or adipose tissue disorder in a subject. The method includes administering a therapeutically effective amount of a GDF-8 agent to the subject, thereby inhibiting abnormal growth of muscle, bone or adipose tissue. The GDF-8 agent may include an antibody, a antisense molecule or a dominant negative polypeptide, for example. In one aspect, a method for inhibiting the growth regulating actions of GDF-8 by contacting an anti-GDF-8 monoclonal antibody, a GDF-8 antisense molecule or a dominant negative polypeptide (or polynucleotide encoding a dominant negative poiypeptide) with fetal or adult muscle cells, bone cells or progenitor cells is included. These agents can be administered to a patient suffering from a disorder such as muscle wasting disease, neuromuscular disorder, muscle atrophy, osteoporosis, bone degenerative diseases, obesity or other adipocyte cell disorders, and aging, for example. In another aspect of the invention, the agent may be an agonist of GDF-8 activity. In this embodiment, the agonist may be administered to promote kidney cell growth and differentiation in kidney tissue.
The invention also provides a method for identifying a compound that affects activity or gene expression including incubating the compound with GDF-8 polypeptide, or with a recombinant cell expressing GDF-8 under conditions sufficient to allow the compounds to interact and determining the effect of the compound on GDF-8 activity or expression.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE Ia is aNorthern blot showing expression of GDF-8 mRNA in adult tissues.
The probe was a partial murine GDF-8 clone.
FIGURE lb is a Southern blot showing GDF-8 genomic sequences identified in mouse, rat, human, monkey, rabbit, cow, pig, dog and chicken.
FIGURES 2a to 2d show partial nucleotide and predicted amino acid sequences of murine GDF-8(FIGURE 2a; SEQ ID NOS: 5 and 6, respectively), human GDF-8 (FIGURE 2b; SEQ
ID NOS:
7 and 8, respectively), rat GDF-8 (FIGURE 2c; SEQ ID NOS: 32 and 33, respectively) and chicken GDF-8 (FIGURE 2d; SEQ ID NOS:34 and 35, respectively). The putative dibasic processing sites in the murine sequence are boxed.

CA 02919703 2002-0~-14 FIGUR$3a shows the alig~nnne~t of the C-terminal sequences of GDF-8 (amino acid residues 264-375 ~f SEQ ID NO: I4) with other members of the TGF-~ superfamily (SEQ ~
NOS:
36-49, respectively). The corses~wed cystsine residues are boxed. Dashes denote gaps introduced in order to maximize alignment.
FIGURE3bahowstl~aligrun~toftheC-ter'mit~alofGDF-8fmmhtunsn (SEQm NO: 1~, murjne (SBQ ID N0:12), rat (SEQ 1D NO: 33), and chidceri (SBQ ID NO:
35) sequences.
FIGURE 4 shows amino acid homologies among different membars of the TGF
superfanvly. Numbers t pert amino acid identities betv~e~ each pair calculated from the first conserved eysttine to the bus. Boxes rmp~ent homologies among highly-related members within particular ~b~rrnips.
FIGUR&S Sa ~ 5d show the sequ~ce of G1DF-8. Nucleodde sad amino $e~rCea of nmalne FIGURE Sa and Sb) (C#enBanlc accession numbaU840U5; SEQ ID NO:11 and 12, respectively) and human (FIGURE 5c and 5d; SEQ lIy N0:13 and 14, respectively) GDF-8 cDNA
clones are shown. Nunibesa indicate nncieotide position relative to the 5' end. Consensus N-linked ~Y~Y~ahaded. TheputativeRXXR(~QmN0:50)proteolYticc~avagesitea are boned.
FIGURE 6 shows a hydropathicity profile of GDF-8. Average hydrophpbiaty values for mucine (FIGURE 6n) arid hurnati (FIGURE 6b) GDF-8 were calculated using tha method of Kyte and Doolittle (J Mol. Biol;, ,j~Z:IOS-132, 1982). Positive numbers ,indicate increasing hydroghobicity. ~ .
FIGURE 7 shows a omnparison of marine and human GDF-8 amino acid seqiretices (S11.Q ID NOS:12 and 14, respedlvely). The predicted nrurinesequence is shown in the top liras arid the p~redietad human sequence is shown in the bottom liriec. Numbers indicate amino acid position relative to the N-tsnninus. Identities between the two sequences are denoted by a vertical line.

FIGURE 8 shows the expression of GDF-8 in bacteria. BL21 (DE3) (pLysS} cells carrying a pRSETIGDF-8 expression plasmid were induced with isopropylthio-[i-galactoside, and the GDF-8 fusion protein was purified by metal chelate chromatography. Lanes: total=total cell Iysate; soluble=soluble protein fraction;
insoluble=insoluble protein fraction (resuspended in 10 Mm Tris pH 8.0, 50 mM
sodium phosphate, 8 M urea, and 10 mM [i-mercaptoethanol [buffer B]} loaded onto the column, pellet=insoluble protein fraction discarded betore ioaamg zne commas;
flowthrough=proteins not bound by the column; washes=washes carried out in buffer B
at the indicated pH's. Positions of molecular weight standards are shown at the right.
Arrow indicates the position of the GDF-8 fusion protein.
FIGURE 9 shows the expression of GDF-8 in mammalian cells. Chinese hamster ovary cells were transfected with pMSXNDIGDF-8 expression plasmids and selected in 6418.
Conditioned media from 6418-resistant cells (prepared from cells transfected with constructs in which GDF-8 was cloned in either the antisense or sense orientation) were concentrated, electrophoresed under reducing conditions, blotted, and probed with anti-GDF-8 antibodies and ['251]iodoproteinA. Arrow indicates the position of the processed GDF-8 protein.
FIGURES l0a and l Ob show the expression of GDF-8 mRNA. Poly A-selected RNA
(S~.g each) prepared from adult tissues (FIGURE 10a) or placentas and embryos (FIGURE l Ob) at the indicated days of gestation was electrophoresed on formaldehyde gels, blotted, and probed with full length murine GDF-8.
FIGURE 11 shows chromosomal mapping of human GDF-8. DNA samples prepared from human/rodent somatic cell hybrid lines were subjected to PCR, electrophoresed on agarose gels, blotted, and probed. The human chromosome contained in each of the hybrid cell lines is identified at the top of each of the first 24 lanes (1-22, X, and Y). In the lanes designated M, CHO, and H, the starting DNA template was total genomic DNA

from mouse, hamster, and human sources, respectively. In the lane marked Bl, no template DNA was used. Numbers at left indicate the mobilities of DNA
standards.
Figure 12a shows a map of the GDF-8 locus (top line) and targeting construct (second line). The black and stippled boxes represent coding sequences for the pro-and C-terminal regions, respectively. The white boxes represent 5' and 3' untranslated sequences. A probe derived from the region downstream of the 3' homology fragment and upstream of the most distal HindIII site shown hybridizes to an 11.2 kb HindIII
fragment in the GDF-8 gene and a 10.4 kb fragment in an homologously targeted gene.
Abbreviations: H, HindIII; X, Xba I.
Figure 12b shows a Southern blot analysis of offspring derived from a mating of heterozygous mutant mice. The lanes are as follows: DNA prepared from wild type 129 SV/J mice (lane 1), targeted embryonic stem cells (lane 2), F1 heterozygous mice (lanes 3 and 4), and offspring derived from a mating of these mice (lanes 5-13).
FIGURES 13a and 13b show the muscle fiber size distribution in mutant wild type littermates.
FIGURE 13a shows the smallest cross-sectional fiber widths measured for wild type (n =1761) and mutant (n =1052) tibialis cranial. FIGURE 13b shows wild type (n = 900) and mutant (n = 900) gastrocnernius muscles, and fiber sizes were plotted as a percent of total fiber number.
Standard deviations were 9 and l Op,m, respectively, for wild type and mutant tibialis cranial is 11 and 9p.m, respectively, for wild type and mutant gastrocnemius muscles.
Legend: o-o, wild type; _, mutant.
Figure 14a shows the nucleotide and deduced amino acid sequence for baboon GDF-(SEQ ID N0:18 and 19, respectively).
Figure 14b shows the nucleotide and deduced amino acid sequence for bovine GDF-(SEQ ID NO: 20 and 21, respectively).
Figure I4c shows the nucleotide and deduced amino acid sequence for chicken (SEQ TD N0:22 and 23, respectively).

_9_ Figure 14d shows the nucleotide and deduced amino acid sequence for rat GDF-8 (SEQ
ID N0:24 and 25, respectively).
Figure 14e shows the nucleotide and deduced amino acid sequence for turkey GDF-(SEQ ID N0:26 and 27, respectively).
Figure 14f shows the nucleotide and deduced amino acid sequence for porcine (SEQ ID N0:28 and 29, respectively).
Figure 14g shows the nucleotide and deduced amino acid sequence for ovine GDF-(SEQ ID N0:30 and 31, respectively).
Figures 15a and 15b show an alignment between marine, rat, human, porcine, ovine, baboon, bovine, chicken, and turkey GDF-8 amino acid sequences {SEQ ID N0:12, 25, 14, 29, 31, 19, 21, 23 and 27, respectively).
Figure 16 shows the predicted amino acid sequences of marine (SEQ tD N0:52) and human (SEQ ID N0:53) GDF-11 aligned with marine (SEQ ID N0:12) '(McPherron et al., 1997) and human (SEQ ID'NO:14) (McPherron and Lee, 1997) myostatin (MSTN).
Shaded boxes represent amino acid homology with the marine and human GDF-11 sequences. Amino acids are numbered relative to the human GDF-11 sequence. The predicted proteolytic processing sites are located at amino acids 295-298.
Figure 17 shows the construction of GDF-11 null mice by homologous targeting.
a) is a map of the GDF-11 locus (top line) and targeting construct (second line).
The black and stippled boxes represent coding sequences for the pro-and C-terminal regions, respectively. The targeting construct contains a total of 11 kb of homololry with the GDF-11 gene. A probe derived from the region upstream of the 3' homology fragment and downstream of the first EcoRI site shown hybridizes to a 6.5 kb EcoRl fragment in the GDF-11 gene and a 4.8 kb fragment in a homologously targeted gene.
Abbrevia-tions: X, Xbal; E, EcoRl . b) Geneomic Southern of DNA prepared from Fl heterozy-gous mutant mice (lanes 1 and 2) and offspring derived from a mating of these mice (lanes 3-12).
Figure 18 shows kidney abnormalities in GDF-11 knockout mice. Kidneys of newborn animals were examined and classified according to the number of normal sized or small kidneys as shown at the top. Numbers in the table indicate number of animals falling info each classification according to genotype.
Figure 19 shows homeotic transformations in GDF-11 mutant mice. a) Newborn pups with missing (first and second from left) and normal looking tails. b j) Skeleton preparations for newborn wild-type (b, e, h), heterozygous (c, f, I) and homozygous (d, g, j) mutant mice. Whole skeleton preparations (b-d), vertebral columns (e-g), vertebrosternal ribs (h-j) showing transformations and defects in homozygous and heterozygous mutant mice. Numbers indicate thoracic segments.
Figure 20 is a table summarizing the anterior transformations in wild-type, heterozygous and homozygous GDF-11 mice.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a growth and differentiation factor, GDF-8 and a polynucleotide sequence encoding GDF-8. GDF-8 is expressed at highest levels in muscle and at lower levels in adipose tissue.
The animals contemplated for use in the practice of the subject invention are those animals generally regarded as useful for the processing of food stuffs, i. e.
avian such as meat bred and egg laying chicken and turkey, ovine such as lamb, bovine such as beef cattle and milk cows, piscine and porcine. For purposes of the subject invention, these animals are referred to as "transgenic" when such animal has had a heterologous DNA
sequence, or one or more additional DNA sequences normally endogenous to the animal (collectively referred to herein as "transgenes") chromosomally integrated into the germ cells of the animal. The transgenic animal (including its progeny} will also have the transgene integrated into the chromosomes of somatic cells.
The TGF-~i superfamily consists of multifunctional polypeptides that control prolifera-tion, differentiation, and other functions in many cell types. Many of the peptides have regulatory, both positive and negative, effects on other peptide growth factors. The structural homology between the GDF-8 protein of this invention and the members of the TGF-~3 family, indicates that GDF-8 is a new member of the family of growth and differentiation factors. Based on the known activities of many of the other members, it can be expected that GDF-8 will also possess biological activities that will make it useful as a diagnostic and therapeutic reagent.
In particular, certain members of this superfamily have expression patterns or possess activities that relate to the function of the nervous system. For example, the inhibins and activins have been shown to be expressed in the brain (Meunier, et al., Proc.
Natl. Acad.
Sci., USA, 85:247,1988; Sawchenko, et al., Nature, 334:615, 1988), and activin has been shown to be capable of functioning as a nerve cell survival molecule (Schubert, et al., Nature, 344:868, 1990). Another family member, namely, GDF-1, is nervous sys-tem-specific in its expression pattern (Lee, S.J., Proc. Natl. Acad. Sci., USA, 88:4250, 1991), and certain other family members, such as Vgr-I (Lyons, et al., Proc.
Natl. Acad.
Sci., USA, 86:4554, 1989; 3ones, et al., Development, 111:531, 1991), OP-1 (Ozkaynak, et al., J. Biol. Chem., 267:25220, 1992), and BMP-4 {Jones, et al., Development, 111:531, 1991), are also known to be expressed in the nervous system. Because it is known that skeletal muscle produces a factor or factors that promote the survival of motor neurons (Brown, Trends Neurosci., 7:10, 1984), the expression of GDF-8 in muscle suggests that one activity of GDF-8 may be as a trophic factor for neurons. In this regard, GDF-8 may have applications in the treatment of neurodegenerative diseases, such as amyotrophic lateral sclerosis or muscular dystrophy, or in maintaining cells or tissues in culture prior to transplantation.

GDF-8 may also have applications in treating disease processes involving the musculoskeletal system, such as in musculodegenerative diseases, osteoporosis or in tissue repair due to trauma. In this regard, many other members of the TGF-(3 family are also important mediators of tissue repair. TGF-(3 has been shown to have marked effects on the formation of collagen and to cause a striking angiogenic response in the newborn mouse (Roberts, et al., Proc. Natl. Acad. Sci., USA 83:4167, 1986). TGF-(3 has also been shown to inhibit the differentiation of myoblasts in culture (Massague, et al., Proc. Natl.
Acad. Sci., USA 83:8206, 1986). Moreover, because myoblast cells may be used as a vehicle for delivering genes to muscle for gene therapy, the properties of GDF-8 could be exploited for maintaining cells prior to transplantation or for enhancing the efficiency of the fusion. GDF-8 may also have applications in treating disease processes involving the kidney or in kidney repair due to trauma.
The expression of GDF-8 in adipose tissue also raises the possibility of applications for GDF-8 in the treatment of obesity or of disorders related to abnormal proliferation of adipocytes. In this regard, TGF-~i has been shown to be a potent inhibitor of adipocyte differentiation in vitro (Ignotz and Massague, Proc. Natl. Acad. Sci., USA
82:8530, 1985).
Polypeptides Polvnucleotides. Vectors and Host Cells The invention provides substantially pure GDF-8 polypeptide and isolated polynucleo-tides that encode GDF-8. The term "substantially pure" as used herein refers to GDF-8 which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify GDF-8 using standard techniques for protein purification. The substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel. The purity of the GDF-8 polypeptide can also be determined by amino-terminal amino acid sequence analysis. GDF-8 polypeptide includes functional fragments of the polypeptide, as long as the activity of GDF-8 remains. Smaller peptides containing the biological activity of GDF-8 are included in the invention.

The invention provides polynucleotides encoding the GDF-8 protein. These polynucleo-tides include DNA, cDNA and RNA sequences which encode GDF-8. It is understood that all polynucleotides encoding all or a portion of GDF-8 are also included herein, as long as they encode a polypeptide with GDF-8 activity. Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated polynucleotides.
For example, GDF-8 polynucleotide may be subjected to site-directed mutagenesis.
The polynucleotide sequence for GDF8 also includes antisense sequences. The polynucleo-tides of the invention include sequences that are degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon: Therefore, all degenerate nucleotide sequences are included in the invention as long as the amino acid sequence of GDF-8 polypeptide encoded by the nucleotide sequence is functionally unchanged.
Specifically disclosed herein is a genomic DNA sequence containing a portion of the GDF-8 gene. The sequence contains an open reading frame corresponding to the predicted C-terminal region of the GDF-8 precursor protein. The encoded polypeptide is predicted to contain two potential proteolytic processing sites (KR and RR). Cleavage of the precursor at the downstream site would generate a mature biologically active C-terminal fragment of 109 and 103 amino acids for marine and human species, respectively, with a predicted molecular weight of approximately 12,400. Also disclosed are full length marine and human GDF-8 cDNA sequences. The marine pre-pro-GDF-protein is 376 amino acids in length, which is encoded by a 2676 base pair nucleotide sequence, beginning at nucleotide 104 and extending to a TGA stop codon at nucleotide 1232. The human GDF-8 protein is 375 amino acids and is encoded by a 2743 base pair sequence, with the open reading frame beginning at nucleotide 59 and extending to nucleotide 1184. GDF-8 is also capable of forming dimers, or heterodimers, with an expected molecular weight of approximately 23-30KD (see Example 4). For example, GDF-8 may form heterodimers with other family members, such as GDF-11.
Also provided herein are the biologically active C-terminal fragments of chicken (Figure 2c) and rat (Figure 2d) GDF-8. The full length nucleotide and deduced amino acid sequences for baboon, bovine, chicken, rat, ovine, porcine, and turkey are shown in Figures 14a-g and human and marine are shown in Figure 5. As shown in Figure 3b, alignment of the amino acid sequences of human, marine, rat and chicken GDF-8 indicate that the sequences are 100% identical in the C-terminal biologically active fragment. Figure 15 a and 15b also show the alignment of GDF-8 amino acid sequences for marine, rat, human, baboon, porcine, ovine, bovine, chicken and turkey.
Given the extensive conservation of amino acid sequences between species, it would now be routine for one of skill in the art to obtain the GDF-8 nucleic acid and amino acid sequence for GDF-8 from any species, including those provided herein, as well as piscine, for example.
The C-terminal region of GDF-8 following the putative proteolytic processing site shows significant homology to the known members of the TGF-(3 superfamily. The GDF-8 sequence contains most of the residues that are highly conserved in other family members and in other species (see FIGURES 3a and 3b and 15 a and 15b). Like the TGF-(3s and inhibin his, GDF-8 contains an extra pair of cysteine residues in addition to the 7 cysteines found in virtually all other family members. Among the known family members, GDF-8 is most homologous to Vgr-1 (45% sequence identity) (see FIGURE
4).
Minor modifications of the recombinant GDF-8 primary amino acid sequence may result in proteins which have substantially equivalent activity as compared to the polypeptide described herein. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as the biological activity of GDF-8 still exists.
Further, deletion of one or more amino acids can also result in a modification of the structure of the resultant molecule without significantly altering its biological activity.
This can lead to the development of a smaller active molecule which would have broader utility. For example, one can remove amino or carboxy terminal amino acids which are not required for GDF-8 biological activity.

WO 99/40181 PGT/US99/025I i The nucleotide sequence encoding the GDF-8 polypeptide of the invention includes the disclosed sequence and conservative variations thereof. The term "conservative variation" as used herein denotes the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine, and the like. The term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.
DNA sequences of the invention can be obtained by several methods. For example, the DNA can be isolated using hybridization techniques which are well known in the art.
These include, but are not limited to: 1 ) hybridization of genomic or cDNA
libraries with probes to detect homologous nucleotide sequences, 2) polymerise chain reaction (PCR) on genomic DNA or cDNA using primers capable of annealing to the DNA sequence of interest, and 3) antibody screening of expression libraries to detect cloned DNA
fragments with shared structural features.
Preferably the GDF-8 polynucleotide of the invention is derived from a mammalian organism, and most preferably from mouse, rat, cow, pig, or human. GDF-8 polynucleo-tides from chicken, turkey, fish and other species are also included herein.
Screening procedures which rely on nucleic acid hybridization make it possible to isolate any gene sequence from any organism, provided the appropriate probe is available. Given the extensive nucleotide and amino acid homology between species, it would be routine for one of skill in the art to obtain polynucleotides encoding GDF-8 from any species. -Oligonucleotide probes, which correspond to a part of the sequence encoding the protein in question, can be synthesized chemically. This requires that short, oligopeptide stretches of amino acid sequence must be known. The DNA sequence encoding the protein can be deduced from the genetic code, however, the degeneracy of the code must be taken into account. It is possible to perform a mixed addition reaction when the sequence is degenerate. This includes a heterogeneous mixture of denatured dou-ble-stranded DNA. For such screening, hybridization is preferably performed on either single-stranded DNA or denatured double-stranded DNA. Hybridization is particularly useful in the detection of cDNA clones derived from sources where an extremely low amount of mRNA sequences relating to the polypeptide of interest are present.
In other words, by using stringent hybridization conditions directed to avoid non-specific binding, it is possible, for example, to allow the autoradiographic visualization of a specific cDNA
clone by the hybridization of the target DNA to that single probe in the mixture which is its complete complement (Wallace, et al., Nucl. Acid Res. _9:879, 1981).
The development of specific DNA sequences encoding GDF-8 can also be obtained by:
1 ) isolation of double-stranded DNA sequences from the genomic DNA; 2) chemical manufacture of a DNA sequence to provide the necessary codons for the polypeptide of interest; and 3) in vitro synthesis of a doublestranded DNA sequence by reverse transcription of mRNA isolated from a eukaryotic donor cell. In the latter case, a double-stranded DNA complement of mRNA is eventually formed which is generally referred to as cDNA.
Of the three above-noted methods for developing specific DNA sequences for use in recombinant procedures, the isolation of genomic DNA isolates is the least common.
This is especially true when it is desirable to obtain the microbial expression of mammalian polypeptides due to the presence of introns.
The synthesis of DNA sequences is frequently the method of choice when the entire sequence of amino acid residues of the desired polypeptide product is known.
When the entire sequence of amino acid residues of the desired polypeptide is not known, the direct synthesis of DNA sequences is not possible and the method of choice is the synthesis of cDNA sequences. Among the standard procedures for isolating cDNA sequences of interest is the forniation of plasmid- or phage-carrying cDNA libraries which are derived from reverse transcription of mRNA which is abundant in donor cells that have a high level of genetic expression. When used in combination with polymerase chain reaction - 1'7 -technology, even rare expression products can be cloned. In those cases where significant portions of the amino acid sequence of the polypeptide are known, the production of labeled single or double-stranded DNA or RNA probe sequences duplicating a sequence putatively present in the target cDNA may be employed in DNA/DNA hybridization procedures which are carried out on cloned copies of the cDNA which have been denatured into a single-stranded form (Jay, et al., Nucl. Acid Res., 11:2325, 1983).
A cDNA expression library, such as lambda gtl 1, can be screened indirectly for GDF-8 peptides having at least one epitope, using antibodies specific for GDF-8.
Such antibodies can be either polyclonally or monoclonally derived and used to detect expression product indicative of the presence of GDF-8 cDNA.
In nucleic acid hybridization reactions, the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized.
For example, the length, degree of complementarity, nucleotide sequence composition (e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA) of the hybridizing 1 S regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
An example of progressively higher stringency conditions is as follows: 2 x SSC/0.1%
SDS at about mom temperature (hybridization conditions); 0.2 x SSC/0.1 % SDS
at about room temperature (low stringency conditions); 0.2 x SSC/0.1% SDS at about 42°C
(moderate stringency conditions); and 0.1 x SSC at about 68°C (high stringency conditions). Washing can be carried out using only one of these conditions, e.g., high stringency conditions, or each of the conditions can be used, e.g., for 10-15 minutes each, in the order listed above, repeating any or all of the steps listed. However, as mentioned above, optimal conditions will vary, depending on the particular hybridization reaction involved, and can be determined empirically.

DNA sequences encoding GDF-8 can be expressed in vitro by DNA transfer into a suitable host cell. "Host cells" are cells in which a vector can be propagated and its DNA
expressed. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell" is used. Methods of stable transfer, meaning that the foreign DNA is continuously maintained in the host, are known in the art.
In the present invention, the GDF-8 polynucleotide sequences may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the GDF-8 genetic sequences. Such expression vectors contain a promoter sequence which facilitates the efficient transcription of the inserted genetic sequence of the host. The expression vector typically contains an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the trans-formed cells. Vectors suitable for use in the present invention include, but are not limited to the T7-based expression vector for expression in bacteria (Rosenberg, et al., Gene, 56:125, 1987), the pMSXND expression vector for expression in mammalian cells (Lee and Nathans, J. Biol. Chem., 263:3521, 1988) and baculovirus-derived vectors for expression in insect cells. The DNA segment can be present in the vector operably linked to regulatory elements, for example, a promoter (e.g., T7, metallothionein 1, or polyhedrin promoters).
Polynucleotide sequences encoding GDF-8 can be expressed in either prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and mammalian organisms.
Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are well known in the art. Biologically functional viral and plasmid DNA
vectors capable of expression and replication in a host are known in the art.
Such vectors are used to incorporate DNA sequences of the invention. Preferably, the mature C-terminal region of GDF-8 is expressed fram a cDNA clone containing the entire coding sequence of GDF-8. Alternatively, the C-terminal portion of GDF-8 can be expressed as a fusion protein with the pro- region of another member of the TGF-(3 family or co-expressed with another pro-region (see for example, Hammonds, et al., Molec. Endocrin., 5:149,1991; Gray, A., and Mason, A., Science, 247:1328, 1990).
Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art. Where the host is prokaryotic, such as E coli, competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaClz method using procedures well known in the art. Alternatively, MgCl2 or RbCI
can be used. Transformation can also be performed after forming a protoplast of the host cell if desired.
When the host is a eukaryote, such methods of transfection of DNA as calcium phosphate co-precipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or virus vectors may be used. Eukaryotic cells can also be cotransformed with DNA sequences encoding the GDF-8 of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein. (see for example, Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).
Isolation and purification of microbial expressed polypeptide, or fragments thereof, provided by the invention, may be carried out by conventional means including preparative chromatography and immunological separations involving monoclonal or polyclonal antibodies.
GDF 8 Antibodies and Methods of Use The invention includes antibodies immunoreactive with GDF-8 polypeptide or functional fragments thereof. Antibody which consists essentially of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations are provided. Monoclonal antibodies are made from antigen containing fragments of the protein by methods well known to those skilled in the art (Kohler, et al., Nature, 256:495, 1975). The term antibody as used in this invention is meant to include intact molecules as well as fragments thereof, such as Fab and F(ab')2, Fv and SCA
fragments which are capable of binding an epitopic determinant on GDF-8.
(1) An Fab fragment consists of a monovalent antigen-binding fragment of an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain.
(2) An Fab' fragment of an antibody molecule can be obtained by treating a whole antibody molecule with pepsin, followed by reduction, to yield a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab' fragments are obtained per antibody molecule treated in this manner.
(3) An (Fab')2 fragment of an antibody can be obtained by treating a whole antibody 1 S molecule with the enzyme pepsin, without subsequent reduction. A (Fab')2 fragment is a dimer of two Fab' fragments, held together by two disulfide bonds.
(4) An Fv fragment is defined as a genetically engineered fragment containing the variable region of a light chain and the variable region of a heavy chain expressed as two chains.
(5) A single chain antibody ("SCA") is a genetically engineered single chain molecule containing the variable region of a light chain and the variable region of a heavy chain, linked by a suitable, flexible polypeptide linker.
As used in this invention, the term "epitope" refers to an antigenic determinant on an antigen, such as a GDF-8 polypeptide, to which the paratope of an antibody, such as an GDF-8-specific antibody, binds. Antigenic determinants usually consist of chemically WO 99/40181 PC'T/US99/02511 active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three-dimensional structural characteristics, as well as specific charge characteristics.
As is mentioned above, antigens that can be used in producing GDF-8-specific antibodies include GDF-8 polypeptides or GDF-8 polypeptide fragments. The polypeptide or peptide used to immunize an animal can be obtained by standard recombinant, chemical synthetic, or purification methods. As is well known in the art, in order to increase immunogenicity, an antigen can be conjugated to a carrier protein. Commonly used carriers include keyhole limpet hemocyanin (KLl-n, thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid. The coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit). In addition to such Garners, well known adjuvants can be administered with the antigen to facilitate induction of a strong immune response.
The term "cell-proliferative disorder" denotes malignant as well as non-malignant cell populations which often appear to differ from the surrounding tissue both morphologi-cally and genotypically. Malignant cells (i. e. cancer) develop as a result of a multistep process. The GDF-8 polynucleotide that is an antisense molecule or that encodes a dominant negative GDF-8 is useful in treating malignancies of the various organ systems, particularly, for example, cells in muscle, bone, kidney or adipose tissue.
Essentially, any disorder which is etiologically linked to altered expression of GDF-8 could be considered susceptible to treatment with a GDF-8 agent (e.g., a suppressing or enhancing agent).
One such disorder is a malignant cell proliferative disorder, for example.
The invention provides a method for detecting a cell proliferative disorder of muscle, bone, kidney or adipose tissue which comprises contacting an anti-GDF-8 antibody with a cell suspected of having a GDF-8 associated disorder and detecting binding to the antibody. The antibody reactive with GDF-8 is labeled with a compound which allows detection of binding to GDF-8. For purposes of the invention, an antibody specific for GDF-8 polypeptide may be used to detect the level of GDF-8 in biological fluids and tissues. Any specimen containing a detectable amount of antigen can be used.
Preferred samples of this invention include muscle, bone or kidney tissue. The level of GDF-8 in the suspect cell can be compared with the level in a normal cell to determine whether the subject has a GDF-8-associated cell proliferative disorder. Such methods of detection are also useful using nucleic acid hybridization to detect the level of GDF-8 mRNA in a sample or to detect an altered GDF-8 gene. Preferably the subject is human.
The antibodies of the invention can be used in any subject in which it is desirable to administer in vitro or in vivo immunodiagnosis or immunotherapy. The antibodies of the invention are suited for use, for example, in immunoassays in which they can be utilized in liquid phase or bound to a solid phase Garner. In addition, the antibodies in these immunoassays can be detectably labeled in various ways. Examples of types of immunoassays which can utilize antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Examples of such immunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay.
Detection of the antigens using the antibodies of the invention can be done utilizing immunoassays which are run in either the forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation.
The antibodies of the invention can be bound to many different carriers and used to detect the presence of an antigen comprising the polypeptide of the invention.
Examples of well-known can~iers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite. The nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable Garners for binding antibodies, or will be able to ascertain such, using routine experimentation.
There are many different labels and methods of labeling known to those of ordinary skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, phosphorescent compounds, and bioluminescent compounds. 'Those of ordinary skill in the art will know of other suitable labels for binding to the antibody, or will be able to ascertain such, using routine experimentation.
Another technique which may also result in greater sensitivity consists of coupling the antibodies to low molecular weight haptens. These haptens can then be specifically detected by means of a second reaction. For example, it is common to use such haptens as biotin, which reacts with avidin, or dinitrophenyi, puridoxal, and fluorescein, which can react with specific antihapten antibodies.
In using the monoclonal antibodies of the invention for the in vivo detection of antigen, the detestably labeled antibody is given a dose which is diagnostically effective. The term "diagnostically effective" means that the amount of detestably labeled monoclonal antibody is administered in sufficient quantity to enable detection of the site having the antigen comprising a polypeptide of the invention for which the monoclonal antibodies are specific.
15. The concentration of detestably labeled monoclonal antibody which is administered should be sufficient such that the binding to those cells having the polypeptide is detectable compared to the background. Further, it is desirable that the detestably labeled monoclonal antibody be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio.
As a rule, the dosage of detestably labeled monoclonal antibody for in vivo diagnosis will vary depending on such factors as age, sex, and extent of disease of the individual. Such dosages may vary, for example, depending on whether multiple injections are given, antigenic burden, and other factors known to those of skill in the art.
For in vivo diagnostic imaging, the type of detection instnunent available is a major factor in selecting a given radioisotope. The radioisotope chosen must have a type of decay which is detectable for a given type of instrument. Still another important factor in selecting a radioisotope for in vivo diagnosis is that deleterious radiation with respect to the host is minimized. Ideally, a radioisotope used for in vivo imaging will lack a particle emission, but produce a large number of photons in the 140-250 keV
range, which may readily be detected by conventional gamma cameras.
For in vivo diagnosis radioisotopes may be bound to immunoglobulin either directly or indirectly by using an intermediate functional group. intermediate functional groups which often are used to bind radioisotopes which exist as metallic ions to irnmunoglobulins are the bifunctional chelating agents such as diethylenetriaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid (EDTA) and similar molecules. Typical examples of metallic ions which can be bound to the monoclonal antibodies of the invention are "'In,9'Ru,b'Ga,6gGa,'zAs,89Zr and 2°'Tl.
The monoclonal antibodies of the invention can also be labeled with a paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR). In general, any conventional method for visualizing 1 S diagnostic imaging can be utilized. Usually gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRI. Elements which are particularly useful in such techniques include's'Gd,ssMn,'62Dy,szCr, and s6Fe.
The monoclonal antibodies of the invention can be used in vitro and in viva to monitor the course of amelioration of a GDF-8-associated disease in a subject. Thus, for example, by measuring the increase or decrease in the number of cells expressing antigen comprising a polypeptide of the invention or changes in the concentration of such antigen present in various body fluids, it would be possible to determine whether a particular therapeutic regimen aimed at ameliorating the GDF-8-associated disease is effective. The term "ameliorate" denotes a lessening of the detrimental effect of the GDF-8-associated disease in the subject receiving therapy.

Additional Methods of Treatment and Diagnosis The present invention identifies a nucleotide sequence that can be expressed in an altered manner as compared to expression in a normal cell, therefore it is possible to design appropriate therapeutic or diagnostic techniques directed to this sequence.
Treatment includes administration of a reagent which modulates activity. The term "modulate"
envisions the suppression or expression of GDF-8 when it is over-expressed, or augmentation of GDF-8 expression when it is underexpressed. When a muscle or bone-associated disorder is associated with GDF-8 overexpression, such suppressive reagents as antisense GDF-8 polynucleotide sequence, dominant negative sequences or GDF-binding antibody can be introduced into a cell. In addition, an anti-idiotype antibody which binds to a monoclonal antibody which binds GDF-8 of the invention, or an epitope thereof, may also be used in the therapeutic method of the invention.
Alternatively, when a cell proliferative disorder is associated with underexpression or expression of a mutant GDF-8 polypeptide, a sense polynucleotide sequence (the DNA coding strand) or polypeptide can be introduced into the cell. Such muscle or bone-associated disorders include cancer, muscular dystrophy, spinal cord injury, traumatic injury, congestive obstructive pulmonary disease (COPD), AIDS or cachecia. In addition, the method of the invention can be used in the treatment of obesity or of disorders related to abnormal proliferation of adipocytes. One of skill in the art can determine whether or not a particular therapeutic course of treatment is successful by several methods described herein (e.g., muscle fiber analysis or biopsy; determination of fat content).
The present examples demonstrate that the methods of the invention are useful for decreasing fat content, and therefore would be useful in the treatment of obesity and related disorders (e.g., diabetes}. Neurodegenerative disorders are also envisioned as treated by the method of the invention.
Thus, where a cell-proliferative disorder is associated with the expression of GDF-8, nucleic acid sequences that interfere with GDF-8 expression at the translational level can be used. This approach utilizes, for example, antisense nucleic acid and ribozymes to block translation of a specific GDF-8 mRNA, either by masking that mRNA with an antisense nucleic acid or by cleaving it with a ribozyme. Such disorders include neurodegenerative diseases, for example. In addition, dominant-negative GDF-8 mutants would be usefi~l to actively interfere with function of "normal" GDF-8.
Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, Scientific American, 262:40, 1990).
In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double-stranded.
Antisense oligomers of about 15 nucleotides are preferred, since they are easily synthesized and are less likely to cause problems than larger molecules when introduced into the target GDF-8-producing cell. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal. Biochem., 172:289, 1988).
Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases.
Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA
molecule and cleave it (Cech, J. Amer. Med. Assn., 260:3030, 1988). A major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.
There are two basic types of ribozymes namely, tetrahymena-type (Hasselhoff, Nature, 334:585, 1988) and "hammerhead"-type. Tetrahymena-type ribozymes recognize sequences which are four bases in length, while "hammerhead"-type ribozymes recognize base sequences 11-18 bases in length. The longer the recognition sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA
species.
Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating a specific mRNA species and 18-based recognition sequences are preferable to shorter recognition sequences.

In another embodiment of the present invention, a nucleotide sequence encoding a GDF-8 dominant negative protein is provided. For example, a genetic construct that contain such a dominant negative encoding gene may be operably linked to a promoter, such as a tissue-specific promoter. For example, a skeletal muscle specific promoter (e.g., human skeletal muscle a-actin promoter) or developmentally specific promoter (e.g., MyHC 3, which is restricted in skeletal muscle to the embryonic period of development, or an inducible promoter (e.g., the orphan nuclear receptor TIS 1 ).
Such constructs are useful in methods of modulating a subject's skeletal mass.
For example, a method include transforming an organism, tissue, organ or cell with a genetic construct encoding a dominant negative GDF-8 protein and suitable promoter in operable linkage and expressing the dominant negative encoding GDF-8 gene, thereby modulating muscle and/or bone mass by interfering with wild-type GDF-8 activity.
GDF-8 most likely forms dimers, homodimers or heterodimers and may even form heterodimers with other GDF family members, such as GDF-11 (see Example 4).
Hence, while not wanting to be bound by a particular theory, the dominant negative effect described herein may involve the formation of non-functional homodimers or heterodimers of dominant negative and wild-type GDF-8 monomers. More specifically, it is possible that any non-fixnctional homodimer or any heterodimer formed by the dimerization of wild-type and/or dominant negative GDF-8 monomers produces a dominant effect by: 1 ) being synthesized but not processed or secreted; 2) inhibiting the secretion of wild type GDF-8; 3) preventing normal proteolytic cleavage of the preprotein thereby producing a nonfunctional GDF-8 molecule; 4) altering the affinity of the non-functional dimer (e.g., homodimeric or heterodimeric GDF-8) to a receptor or generating an antagonistic form of GDF-8 that binds a receptor without activating it;
or 5) inhibiting the intracellular processing or secretion of GDF-8 related or family proteins.
Non-functional GDF-8 can function to inhibit the growth regulating actions of on muscle and bone cells that include a dominant negative GDF-8 gene. Deletion or missense dominant negative forms of GDF-8 that retain the ability to form dimers with wild- type GDF-8 protein but do not function as wild-type GDF-8 proteins may be used to inhibit the biological activity of endogenous wild- type GDF-8. For example, in one embodiment, the proteolytic processing site of GDF-8 may be altered (e.g., deleted) resulting in a GDF-8 molecule able to undergo subsequent dimerization with endogenous wild-type GDF-8 but unable to undergo further processing into a mature GDF-8 form.
Alternatively, a non-functional GDF-8 can function as a monomeric species to inhibit the growth regulating actions of GDF-8 on muscle or bone cells.
Any genetic recombinant method in the art may be used, for example, recombinant viruses may be engineered to express a dominant negative form of GDF-8 which may be used to inhibit the activity of wild-type GDF-8. Such viruses may be used therapeuti-cally for treatment of diseases resulting from aberrant over-expression or activity of GDF-8 protein, such as in denervation hypertrophy or as a means of controlling expression when treating disease conditions involving the musculoskeletal system, such as in musculodegenerative diseases, osteoporosis or in tissue repair due to trauma or in modulating GDF-8 expression in animal husbandry (e.g., transgenic animals for agricultural purposes}.
The invention provides a method for treating a muscle, bone, kidney (chronic or acute) or adipose tissue disorder in a subject. The method includes administering a therapeuti-cally effective amount of a GDF-8 agent to the subject, thereby inhibiting abnormal growth of muscle, bone, kidney or adipose tissue. The GDF-8 agent may include a GDF-8 antisense molecule or a dominant negative polypeptide, for example. A
"therapeuti-cally effective amount" of a GDF-8 agent is that amount that ameliorates symptoms of the disorder or inhibits GDF-8 induced growth of muscle or bone, for example, as compared with a normal subject.

Gene Theranv The present invention also provides gene therapy for the treatment of cell proliferative or immunologic disorders which are mediated by GDF-8 protein. Such therapy would achieve its therapeutic effect by introduction of the GDF-8 antisense or dominant negative encoding polynucleotide into cells having the proliferative disorder.
Delivery of antisense or dominant negative GDF-8 polynucleotide can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system.
Especially preferred for therapeutic delivery of antisense or dominant negative sequences is the use of targeted liposomes. In contrast, when it is desirable to enhance production, a "sense" GDF-8 polynucleotide or functional equivalent (e.g., the C-term active region) is introduced into the appropriate cell(s).
Various viral vectors which can be utilized for gene therapy as taught herein include adenovirus, herpes virus, vaccinia, or, preferably, an RNA virus such as a retrovirus.
Preferably, the retroviral vector is a derivative of a marine or avian retrovirus. Examples of retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney marine leukemia virus (MoMuLV), Harvey marine sarcoma virus (HaMuSV), marine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV).
A number of additional retroviral vectors can incorporate multiple genes. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated. By inserting a GDF-8 sequence of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target specific. Retroviral vectors can be made target specific by attaching, for example, a sugar, a glycolipid, or a protein. Preferred targeting is accomplished by using an antibody to target the retroviral vector. Those of skill in the art will know of, or can readily ascertain without undue experimentation, specific polynucleotide sequences which can be inserted into the retroviral genome or attached to a viral envelope to allow target specific delivery of the retroviral vector containing the GDF-8 antisense polynucleotide.

Since recombinant retroviruses are defective, they require assistance in order to produce infectious vector particles. This assistance can be provided, for example, by using helper cell lines that contain plasmids encoding all of the structural genes of the retrovirus under the control of regulatory sequences within the LTR. These plasmids are missing a nucleotide sequence which enables the packaging mechanism to recognize an RNA
transcript for encapsulation. Helper cell lines which have deletions of the packaging signal include, but are not limited to t~r2, PA317 and PA12, for example:
These cell lines produce empty virions, since no genome is packaged. If a retroviral vector is introduced into such cells in which the packaging signal is intact, but the structural genes are replaced by other genes of interest, the vector can be packaged and vector virion produced.
Alternatively, NIH 3T3 or other tissue culture cells can be directly transfected with plasmids encoding the retroviral structural genes gag, pol and env, by conventional calcium phosphate transfection. These cells are then transfected with the vector plasmid containing the genes of interest. The resulting cells release the retroviral vector into the culture medium.
Another targeted delivery system for GDF-8 polynucleotides is a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system of this invention is a liposome. Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 pm can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci., 6:77, 1981). In addition to mammalian cells, Iiposomes have been used for delivery of polynucleotides in plant, yeast and bacterial cells. in order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1) encapsulation of the genes of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Manning, et al., Biotechnigues, 6:682, 1988).
The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used.
The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.
Examples of lipids useful in liposome production include phosphatidyl compounds, such a s phosphatidyiglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine.
The targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries. Active taxgeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.

The surface of the targeted delivery system may be modified in a variety of ways. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand.
Due to the expression of GDF-8 in muscle, bone, kidney and adipose tissue, there are a variety of applications using the polypeptide, polynucleotide, and antibodies of the invention, related to these tissues. Such applications include treatment of cell prolifera-tive disorders involving these and other tissues, such as neural tissue. In addition, GDF-8 may be useful in various gene therapy procedures. In embodiments where GDF-8 polypeptide is administered to a subject, the dosage range is about 0.1 ug/kg to 100 mg/kg; more preferably from about 1 ug/kg to 75 mg/kg and most preferably from about 10 mg/kg to 50 mg/kg.
Chromosomal Location~GDF-8 The data in Example 6 shows that the human GDF-8 gene is located on chromosome 2.
By comparing the chromosomal location of GDF-8 with the map positions of various human disorders, it should be possible to determine whether mutations in the gene are involved in the etiology of human diseases. For example, an autosomal recessive form of juvenile amyotrophic lateral sclerosis has been shown to map to chromosome 2 (Hentati, et al., Neurology, 42 [Suppl.3]:201, 1992). More precise mapping of GDF-8 and analysis of DNA from these patients may indicate that GDF-is, in fact, the gene affected in this disease. In addition, GDF-8 is useful for distinguish-ing chromosome 2 from other chromosomes.
Transgenic Animals and Methods of Making the same Various methods to make the transgenic animals of the subject invention can be employed. Generally speaking, three such methods may be employed. In one such method, an embryo at the pronuclear stage (a "one cell embryo") is harvested from a female and the transgene is microinjected into the embryo, in which case the transgene will be chromosomally integrated into both the germ cells and somatic cells of the resulting mature animal. In another such method, embryonic stem cells are isolated and the transgene incorporated therein by electroporation, plasmid transfection or microinjection, followed by reintroduction of the stem cells into the embryo where they colonize and contribute to the germ line. Methods for microinjection of mammalian species is described in United States Patent No. 4,873,191. In yet another such method, embryonic cells are infected with a retrovirus containing the transgene whereby the germ cells of the embryo have the transgene chromosomally integrated therein. When the animals to be made transgenic are avian, because avian fertilized ova generally go through cell division for the first twenty hours in the oviduct, microinjection into the pronucleus of the fertilized egg is problematic due to the inaccessibility of the pronucleus. Therefore, of the methods to make transgenic animals described generally above, retrovirus infection is preferred for avian species, for example as described in U.S.
5,162,215. If microinjection is to be used with avian species, however, a recently published procedure by Love et al., (Biotechnology, 12, Jan 1994) can be utilized whereby the embryo is obtained from a sacrificed hen approximately two and one-half hours after the laying of the previous laid egg, the transgene is microinjected into the cytoplasm of the germinal disc and the embryo is cultured in a host shell until maturity.
When the animals to be made transgenic are bovine or porcine, microinjection can be hampered by the opacity of the ova thereby making the nuclei difficult to identify by traditional differential interference-contrast microscopy. To overcome this problem, the ova can first be centrifuged to segregate the pronuclei for better visualization.
The "non-human animals" of the invention bovine, porcine, ovine and avian animals (e.g., cow, pig, sheep, chicken, turkey). The "transgenic non-human animals"
of the invention are produced by introducing "transgenes" into the germline of the non-human animal. Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell. The zygote is the best target for micro-injection. The use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host gene before the first cleavage (Brinster et al., Proc. Natl. Acad. Sci. USA 82:4438-4442, 1985). As a consequence, all cells of the transgenic non-human animal will carry the incorporated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene.
The term "transgenic" is used to describe an animal which includes exogenous genetic material within all of its cells. A "transgenic" animal can be produced by cross-breeding two chimeric animals which include exogenous genetic material within cells used in reproduction. Twenty-five percent of the resulting offspring will be transgenic i. e., animals which include the exogenous genetic material within all of their cells in both alleles. 50% of the resulting animals will include the exogenous genetic material within one allele and 25% will include no exogenous genetic material.
In the microinjection method useful in the practice of the subject invention, the transgene is digested and purified free from any vector DNA e.g. by gel electrophoresis.
It is preferred that the transgene include an operatively associated promoter which interacts 1 S with cellular proteins involved in transcription, ultimately resulting in constitutive expression. Promoters useful in this regard include those from cytomegalovirus (CMV), Moloney leukemia virus (MLV), and herpes virus, as well a.s those from the genes encoding metallothionin, skeletal actin, P-enolpyruvate carboxylase {PEPCK), phosphoglycerate (PGK), DHFR, and thymidine kinase. Promoters for viral long terminal repeats (LTRs) such as Rous Sarcoma Virus can also be employed. When the animals to be made transgenic are avian, preferred promoters include those for the chicken ~i-globin gene, chicken lysozyme gene, and avian leukosis virus.
Constructs useful in plasmid transfection of embryonic stem cells will employ additional regulatory elements well known in the art such as enhancer elements to stimulate transcription, splice acceptors, termination and polyadenylation signals, and ribosome binding sites to permit translation.

Retroviral infection can also be used to introduce transgene into a non-human animal, as described above. The developing non-human embryo can be cultwed in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retro viral infection (Jaenich, R., Proc. Natl. Acad. Sci USA 73:1260-1264, 1976). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan, et al. ( 1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). The viral vector system used to introduce the transgene is typically a replication-defective retro virus carrying the transgene (Jahner, et al., Proc.
Natl. Acad. Sci. USA 82:6927-6931, 1985; Van der Putten, et al., Proc. Natl.
Acad. Sci USA 82:6148-6152, 1985). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart, et al., EMBO J. 6:383-388, 1987). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (D.
Jahner et al., Nature 298:623-628, 1982). Most of the founders will be mosaic for the transgene since incorporation occurs only in a subset of the cells which formed the transgenic nonhwnan animal. Further, the founder may contain various retro viral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. In addition, it is also possible to introduce transgenes into the germ line, albeit with low efficiency, by intrauterine retroviral infection of the midgestation embryo (D. Jahner et al., supra).
A third type of target cell for transgene introduction is the embryonal stem cell (ES). ES
cells are obtained from pre-implantation embryos cultwed in vitro and fused with embryos (M. J. Evans et al. Nature 292:154-156, 1981; M.O. Bradley et al., Nature 309:
255-258, 1984; Gossler, et al., Proc. Natl. Acad. Sci USA 83: 9065-9069, 1986;
and Robertson et al., Nature 322:445-448, 1986). Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retro virus-mediated transduction.
Such transformed ES cells can thereafter be combined with blastocysts from a nonhuman animal. The ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal. (For review see Jaenisch, R., Science 240: 1468-1474, 1988).

"Transformed" means a cell into which (or into an ancestor of which) has been introduced, by means of recombinant nucleic acid techniques, a heterologous nucleic acid molecule. "Heterologous" refers to a nucleic acid sequence that either originates from another species or is modified from either its original form or the form primarily expressed in the cell.
"Transgene" means any piece of DNA which is inserted by artifice into a cell, and becomes part of the genome of the organism (i.e., either stably integrated or as a stable extrachromosomal element) which develops from that cell. Such a transgene may include a gene which is partly or entirely heterologous (i.e., foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism.
Included within this definition is a transgene created by the providing of an RNA
sequence which is transcribed into DNA and then incorporated into the genome.
The transgenes of the invention include DNA sequences which encode GDF-8, and include GDF-sense, antisense, dominant negative encoding polynucleotides, which may be expressed in a transgenic non-human animal. The term "transgenic" as used herein additionally includes any organism whose genome has been altered by in vitro manipulation of the early embryo or fertilized egg or by any transgenic technology to induce a specific gene knockout. The term "gene knockout" as used herein, refers to the targeted disruption of a gene in vivo with complete loss of function that has been achieved by any transgenic technology familiar to those in the art. In one embodiment, transgenic animals having gene knockouts are those in which the target gene has been rendered nonfunctional by an insertion targeted to the gene to be rendered non-functional by homologous recombination. As used herein, the term "transgenic" includes any transgenic technology familiar to those in the art which can produce an organism carrying an introduced transgene or one in which an endogenous gene has been rendered non-functional or "knocked out " An example of a transgene used to "knockout"

function in the present Examples is described in Example 8 and FIGURE 12a.
Thus, in another embodiment, the invention provides a transgene wherein the entire mature C-terminal region of GDF-8 is deleted.

The transgene to be used in the practice of the subject invention is a DNA
sequaice oo~np~ a modified GDF-8 coding sequon~. 1n a preferred embodiment, the GDF-8 gene is disrupted by homologous targeting is embryonic stem ells. For example, the entire mature C-terminal region of the GDF-8 gene may be deleted as described in the examples below. Optionally,. the GDF-8 disruption or deletion may be accompanied by insertion of or raplaceme~t with other DNA s~:qt~es, such as a non-functional sequence. In other embodiments, the transgene comprises DNA antisense to the coding sequence for GDF-8. In another eanbodiment, the ttansgcne comprises DNA
encoding an a~'body or rZ peptide soq~oe which is able to bind to l3DF-8. The DNA and _ peptide eoqtrarces of GDF-8 are known in the art, the sequences, localization aad activity have been disclosed in W4 94121681. Where appropriate, DNA sequences that encode proteins having GDF 8 activity but differ in nucleic acid sequence due to the degeneracy of the genetic code may also be used herein, as may truncated forms, allelic variants and interspecies homologues.
The invention also includes animals having heteroaygous mutations in GDF-8 or partial inhibition of GDF-8 function or exptessioa A hctarozygote v~ould exhibit an intermediate increase in murscle and/or bone mass as compared to the hornozygote as shown in Table 4 below. In other words, partial loss of function loads to a partial increase in muscle and bone mass. One of skill in the art would readily be able to detennuue if a psrticu>at mutation or if an antisense molecele was able to poly inhibit GDF-8: For example, ~e vitro testing may be desirable initially by comparison with wild-type or untreated C~DF-8 (e.g., comparison of northern blots to examine a decrease in expression).
Ails an anbryo has boon microinjabed, colonized with transfected embryonic stem cells or infected with a retrovirus containing the transgene (except for practice of the sabject invartion in avian species which is addressed elsewhere herein) the embryo is implanted into the oviduct of a pseudopregnant female. The consequent progeny are tested for incorporation of the transgene by Southern blot analysis of blood samples using transgene specific probes. PCR is particularly useful in this regard. Positive progeny (GO) are crossbred to produce offspring (G1) which are analyzed for transgene expression by Northern blot analysis of tissue samples. To be able to distinguish expression of like-species transgenes from expression of the animals endogenous GDF-8 gene(s), a marker gene fragment can be included in the construct in the 3' untranslated region of the transgene and the Northern probe designed to probe for the marker gene fragment. The serum levels of GDF-8 can also be measured in the transgenic animal to establish appropriate expression. Expression of the GDF-8 transgenes, thereby decreasing the GDF-8 in the tissue and serum levels of the transgenic animals and consequently increasing the muscle tissue or bone tissue content results in the foodstuffs from these animals (i.e. eggs, beef, pork, poultry meat, milk, etc.) having markedly increased muscle and/or bone content, such as ribs, and preferably without increased, and more preferably, reduced levels of fat and cholesterol. By practice of the subject 1 S invention, a statistically significant increase in muscle content, preferably at least a 2%
increase in muscle content (e.g., in chickens), more preferably a 25% increase in muscle content as a percentage of body weight, more preferably greater than 40%
increase in muscle content in these foodstuffs can be obtained. Similarly the subject invention may provide a significant increase in bone content, such as ribs, in these foodstuffs.
Additional Methods of Use Thus, the present invention includes methods for increasing muscle and bone mass in domesticated animals, characterized by inactivation or deletion of the gene encoding growth and differentiation factor-8 (GDF-8). The domesticated animal is preferably selected from the group consisting of ovine, bovine, porcine, piscine and avian. The animal may be treated with an isolated polynucleotide sequence encoding growth and differentiation factor-8 which polynucleotide sequence is also from a domesticated animal selected from the group consisting of ovine, bovine, porcine, piscine and avian.
The present invention includes methods for increasing the muscle and/or bone mass in domesticated animals characterized by administering to a domesticated animal monoclonal antibodies directed to the GDF-8 polypeptide. The antibody may be an anti-GDF-8, and may be either a monoclonal antibody or a polyclonal antibody.
The invention includes methods comprising using an anti-GDF-8 monoclonal antibody, antisense, or dominant negative mutants as a therapeutic agent to inhibit the growth regulating actions of GDF-8 on muscle and bone cells. Muscle and bone cells are defined to include fetal or adult muscle cells, as well as progenitor cells which are capable of differentiation into muscle or bone. The monoclonal antibody may be a humanized (e.g., either fully or a chimeric) monoclonal antibody, of any species origin, such as marine, ovine, bovine, porcine or avian. Methods of producing antibody molecules with various combinations of "humanized" antibodies are well known in the art and include combining marine variable regions with human constant regions (Cabily, et al. Proc.Natl.Acad.Sci. USA, 81:3273, 1984), or by grafting the marine-antibody complementary determining regions (CDRs) onto the human framework (Richmann, et 1 S al., Nature 332:323, 1988). Other general references which teach methods for creating humanized antibodies include Morrison, et al., Science, 229:1202, 1985; Jones, et al., Nature, 321:522,1986; Monroe, et al., Nature 312:779, 1985; Oi, et al., BioTechniques, 4:214,1986; European Patent Application No. 302,620; and U.S. Patent No.
5,024,834.
Therefore, by humanizing the monoclonal antibodies of the invention for in vivo use, an immune response to the antibodies would be greatly reduced.
The monoclonal antibody, GDF-8 polypeptide, or GDF-8 polynucleotide (all "GDF-agents") may have the effect of increasing the development of skeletal muscles and bones, such as ribs. In preferred embodiments of the claimed methods, the GDF-monoclonal antibody, polypeptide, or polynucleotide is administered to a patient suffering from a disorder selected from the group consisting of muscle wasting disease, neuromuscular disorder, muscle atrophy, bone degenerative diseases, osteoporosis, renal disease or aging. The GDF-8 agent may also be administered to a patient suffering from a disorder selected from the group consisting of muscular dystrophy, spinal cord injury, traumatic injury, congestive obstructive pulmonary disease (COPD), AIDS or cachechia.

In a preferred embodiment, the GDF-8 agent is administered to a patient suffereing from any of these diseases by intravenous, intramuscular or subcutaneous injection;
preferably, a monoclonal antibody is administered within a dose range between about 0.1 mg/kg to about 100 mg/kg; more preferably between about 1 ug/kg to 75 mg/kg; most preferably S from about 10 mg/kg to 50 mg/kg. The antibody may be administered, for example, by bolus injunction or by slow infusion. Slow infusion over a period of 30 minutes to 2 hours is preferred. The GDF-8 agent may be formulated in a formulation suitable for administration to a patient. Such formulations are known in the art.
The dosage regimen will be determined by the attending physician considering various factors which modify the action of the GDF-8 protein, e.g. amount of tissue desired to be formed, the site of tissue damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue, the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the types of agent, such as anti-GDF-8 antibodies, to be used in the composition. Generally, systemic or injectable administra-tion, such as intravenous (IV), intramuscular (IIVI~ or subcutaneous (Sub-Q) injection.
Administration will generally be initiated at a dose which is minimally effective, and the dose will be increased over a preselected time course until a positive effect is observed.
Subsequently, incremental increases in dosage will be made limiting such incremental increases to such levels that produce a corresponding increase in effect, while taking into account any adverse affects that may appear. The addition of other known growth factors, such as IGF I (insulin like growth factor I), human, bovine, or chicken growth hormone which may aid in increasing muscle and bone mass, to the final composition, may also affect the dosage. In the embodiment where an anti-GDF-8 antibody is administered, the anti-GDF-8 antibody is generally administered within a dose range of about 0.1 ug/kg to about 100 mg/kg.; more preferably between about 10 mg/kg to mg/kg.

Progress can be monitored by periodic assessment of tissue growth and/or repair. The progress can be monitored, for example, x-rays, histomorphometric determinations and tetracycline labeling.
Screening for GDF-8 Modulatine Compounds In another embodiment, the invention provides a method for identifying a compound or molecule that modulates GDF-8 protein activity yr gene expression. The method includes incubating components comprising the compound, GDF-8 polypeptide or with a recombinant cell expressing GDF-8 polypeptide, under conditions sufficient to allow the components to interact and determining the effect of the compound on GDF-8 activity or expression. The effect of the compound on GDF-8 activity can be measured by a number of assays, and may include measurements before and after incubating in the presence of the compound. Compounds that affect GDF-8 activity or gene expression include peptides, peptidomimetics, polypeptides, chemical compounds and biologic agents. Assays include Northern blot analysis of GDF-8 mRNA (for gene expression), Western blot analysis (for protein level) and muscle fiber analysis {for protein activity).
The above screening assays may be used for detecting the compounds or molecules that bind to the GDF-8 receptor or GDF-8 polypeptide, in isolating molecules that bind to the GDF-8 gene, for measuring the amount of GDF-8 in a sample, either polypeptide or RNA
(mRNA), for identifying molecules that may act as agonists or antagonists, and the like.
For example, GDF-8 antagonists are useful for treatment of muscular and adipose tissue disorders (e.g., obesity).
Incubating includes conditions which allow contact between the test compound and GDF-8 polypeptide or with a recombinant cell expressing GDF-8 polypeptide.
Contacting includes in solution and in solid phase, or in a cell. The test compound may optionally be a combinatorial library for screening a plurality of compounds.
Com-pounds identified in the method of the invention can be further evaluated, detected, cloned, sequenced, and the like, either in solution or after binding to a solid support, by any method usually applied to the detection of a specific DNA sequence such as PCR, oligomer nstridion (Saiki, et al., BiuITecimolagy, x:1008-1012, 1985), allele~pecific oligonucleotida (ASO) probe aaelysis (Corner, et al., 'roc. Natl. Aced Sci.
USA, $Q2?8,1983 oligonuGleotide Landegren, et al., Science, x:1077,1988), and the like.
Mol~ tochniqucs for DNA am~lysis have boon reviewed. (i.aadegra~, et a~, ~'cierxe, x:229-237,1988).
The followicg examples ere iatcnd~ to illu~shate but not limit the inveMioa.
While they are typical of those that might be used, other procedures known to those skilled in the art may alteFnati~ly be used.
~e:~ ~:>-IDFNTIFICATIflN AND ISOLATION OF A NOyEL
TGF-B FAMILY MEM1~ER
To ide~if~r a new member of the TGF-(3 super~mily, deg~ate oligonucleotides were designed which corresponded to two conserved regions among the known family members: one region ~nnmg the two tryptdphan residues conserved in all family members except MIS end the other region spanning the im~iant cysteine residues near the C-terminus. These primers was us«1 for polymerase chain reactions on mouse genomic DNA followed by subcloning the PCR products usiag restriction sites placed at the 5' ends of the primers, piclun~ individual E. coli colonies canying these subcloned inserts, and using a combination of ranc~nn sequencing and hybridization analysis to eliminate known members of the superfamily.
GDF-8 was identified from a mixture of PCR products obtained with the primers SJL141: 5'-CCGGAATTCGGTTGiG(GLCIA~r(G/Aff/CxA/G)A(TlC)TGG(A!G)Ti (A/G)TI(TIG~ICC-3' (SF.Q ID NO:1 ) SJL147:
5'-CCGGAATTC(G/A)CAI(GIC~(GIA~A(Ci/A)CT(GIA/T/C) TCIACI(G/AX'f/C)CAT-3' (SFrQ ID N0:2) PCR using these primers was carried out with 2 ~.g mouse genomic DNA at 94°C for 1 min, 50°C for 2 min, and 72°C for 2 min for 40 cycles.
PCR products of approximately 280 by were gel-purified, digested with Eco Rl, gel-purified again, and subcloned in the Bluescript vector (Stratagene, San Diego, CA).
Bacterial colonies carrying individual subclones were picked into 96 well microtiter plates, and multiple replicas were prepared by plating the cells onto nitrocellulose. The replicate filters were hybridized to probes representing known members of the family, and DNA was prepared from nonhybridizing colonies for sequence analysis.
The primer combination of SJL141 and SJL147, encoding the amino acid sequences GW(H/Q/N/K/D/E)(D/N)W(V/I/N~(V/I/M)(A/S)P (SEQ ID N0:9) and M(V/1/MfT/A)V(D/E)SC(G/A)C (SEQ 1D NO:10), respectively, yielded four previously identified sequences (BMP-4, inhibin,~iB, GDF-3 and GDF-5) and one novel sequence, which was designated GDF-8, among 110 subclones analyzed.
Human GDF-8 was isolated using the primers:
ACM13: 5'-CGCGGATCCAGAGTCAAGGTGACAGACACAC-3' (SEQ ID N0:3); and ACM14: 5'-CGCGGATCCTCCTCATGAGCACCCACAGCGGTC-3' (SEQ IT? N0:4) PCR using these primers was carried out with one ~.g human genomic DNA at 94 °C for 1 min, 58°C fort min, and 72°C for 2 min for 30 cycles. The PCR
product was digested with Bam Hl, gel-purified, and subcloned in the Bluescript vector (Stratagene, San Francisco, CA).

To determine the expression pattern of GDF-8, RNA samples prepared from a variety of adult tissues were screened by Northern analysis. RNA isolation and Northern analysis were carned out as described previously (Lee, S.J., Mol. Endocrinol., 4:1034, 1990) except that hybridization was carried out in SX SSPE, 10% dextran sulfate, 50%
formamide, l % SDS, 200 ~g/ml salmon DNA, and 0.1 % each of bovine serum albumin, ficoll, and polyvinylpyrrolidone. Five micrograms of twice poly A-selected RNA
prepared from each tissue (except for muscle, for which only 2 pg RNA was used) were electrophoresed on formaldehyde gels, blotted, and probed with GDF-8. As shown in FIGURE 1, the GDF-8 probe detected a single mRNA species expressed at highest levels in muscle and at significantly lower levels in adipose tissue.
To obtain a larger segment of the GDF-8 gene, a mouse genomic library was screened with a probe derived from the GDF-8 PCR product. The partial sequence of a GDF-genomic clone is shown in FIGURE 2a. The sequence contains an open reading frame corresponding to the predicted C-terminal region of the GDF-8 precursor protein. The predicted GDF-8 sequence contains two potential proteolytic processing sites, which are boxed. Cleavage of the precursor at the second of these sites would generate a mature C
terminal fragment 109 amino acids in length with a predicted molecular weight of 12,400. The partial sequence of human GDF-8 is shown in FIGURE 2b. Assuming no PCR-induced errors during the isolation of the human clone, the human and mouse amino acid sequences in this region are 100% identical.
The C-terminal region of GDF-8 following the putative proteolytic processing site shows significant homology to the known members of the TGF-(3; superfamily {FIGURE
3).
FIGURE 3 shows the alignment of the C-terminal sequences of GDF-8 with the corresponding regions of human GDF-1 (L.ee, Proc. Natl. Acad. Sci. USA, 88:4250-4254, 1991), human BMP-2 and 4 {Wozney, et al., Science, 242:1528-1534, 1988), human Vgr-1 {Celeste, et al. Proc. Nat1 Acad. Sci. USA, 87:9843-9847, 1990), human (Ozkaynak, et al., EMBO J., 9_:2085-2093, 1990), human BMP-5 (Celeste, et al., Proc.
Natl. Acad. Sci. USA, 87:9843-9847, 1990), human BMP-3 (Wozney, et al., Science, 242:1528-1534, 1988), human MiS (Cate, et al. Cell, 45:685-698,1986), human inhibin alpha, ~iA, and ~3B (Mason, et al., Biochem, Biophys. Res. Commun., 135:957-964, 1986), human TGF-(31 (Derynck, et al., Nature, 316:701 -705, 1985), humanTGF-R2 (deMartin, et al., EMBO J., 6:3673-3677, 1987), and human TGF-(33 (ten Dijke, et al., Proc. Natl.

Acad. Sci. USA, 85:4715-4719, 1988). The conserved cysteine residues are boxed.
Dashes denote gaps introduced in order to maximize the alignment.
GDF-8 contains most of the residues that are highly conserved in other family members, including the seven cysteine residues with their characteristic spacing. Like the TGF-his and inhibin his, GDF-8 also contains two additional cysteine residues. In the case of TGF-(32, these two additional cysteine residues are known to form an intramolecular disulfide bond (Daopin, et al., Science, 257:369, 1992; Schlunegger and Grutter, Nature, 358:430, 1992).
FIGURE 4 shows the amino acid homologies among the different members of the TGF-~3 superfamily. Numbers represent percent amino acid identities between each pair calculated from the first conserved cysteine to the C terminus. Boxes represent homologies among highly-related members within particular subgroups. In this region, GDF-8 is most homologous to Vgr-1 (45% sequence identity).

ISOLATION OF cDNA CLONES ENCODING MURINE AND HUMAN GDF-8 In order to isolate full-length cDNA clones encoding marine and human GDF-8, cDNA
libraries were prepared in the lambda ZAP II vector (Stratagene) using RNA
prepared from skeletal muscle. From 5 ~Cg of twice poly A-selected RNA prepared from marine and human muscle, cDNA libraries consisting of 4.4 million and 1.9 million recombinant phage, respectively, were constructed according to the instructions provided by Stratagene. These libraries were screened without amplification. Library screening and characterization of cDNA inserts were carried out as described previously (Lee, Mol.
Endocrinol., 4:1034-1040).
From 2.4 x 106 recombinant phage screened from the marine muscle cDNA library, greater than 280 positive phage were identified using a marine GDF-8 probe derived finm a genomic clone, as described in Example 1. The entire nucleotide sequence of the longest cDNA insert analyzed is shown in FIGURE Sa and Sb and SEQ ID NO:l 1.
The 2676 base pair sequence contains a single long open reading frame beginning with a methionine codon at nucleotide 104 and extending to a TGA stop codon at nucleotide 1232. Upstream of the putative initiating methionine codon is an in-frame stop codon at nucleotide 23. The predicted pre-pro-GDF-8 protein is 76 amino acids in length. The sequence contains a core of hydrophobic amino acids at the N-terminus suggestive of a signal peptide for secretion (FIGURE 6a), one potential N-glycosylation site at asparagine 72, a putative RXXR (SEQ ID NO. 50) proteolytic cleavage site at amino acids 264-267, and a C-terminal region showing significant homology to the known members of the TGF-(3 superfamily. Cleavage of the precursor protein at the putative RXXR (SEQ ID
NO. 50) site would generate a mature C-terminal GDF-8 fragment 109 amino acids in length with a predicted molecular weight of approximately 12,400.
From 1.9 x 106 recombinant phage screened from the human muscle cDNA library, positive phage were identified using a human GDF-8 probe derived by polymerise chain reaction on human genomic DNA. The entire nucleotide sequence of the longest cDNA
insert is shown in FIGURE Sc and 5d and SEQ ID N0:13. The 2743 base pair sequence contains a single long open reading frame beginning with a methionine codon at nucleotide 59 and extending to a TGA stop codon at nucleotide 1184. The predicted pre-pro-GDF-8 protein is 375 amino acids in length. T'he sequence contains a core of hydrophobic amino acids at the N-terminus suggestive of a signal peptide for secretion (FIGURE 6b), one potential N-glycosylation site at asparagine 71, anda putative RXXR (SEQ ID
NO: 50) proteolytic cleavage site at amino acids 263-266. FIGURE 7 shows a comparison of the predicted murine (top)and human (bottom) GDF-8 amino acid sequences. Numbers indicate amino acid position relative to the N-terminus. Identities between the two sequences are denoted by a vertical line. Murine and human GDF-8 are approximately 94% identical in the predicted pro-regions and 100% identical following the predicted RXXR (SEQ ID NO: 50) cleavage sites.

To determine whether the processing signals in the GDF-8 sequence are functional and whether GDF-8 forms dimers like other members of the TGF-13 superfamily, the cDNA was stably expressed in CHO cells. The GDF-8 coding sequence was cloned into the pMSXND expression vector (Lee and Nathans, J. Biol. Chem., 263:3521,(1988) and transfected into CHO cells. Following 6418 selection, the cells were selected in 0.2 ,uM
methotrexate, and conditioned medium from resistant cells was concentrated and electrophoresed on SDS gels. Conditioned medium was prepared by Cell Trends, Inc.
(Middletown, MD). For preparation of anti-GDF-8 serum, the C-terminal region of GDF-8 (amino acids 268 to 376) was expressed in bacteria using the RSET vector (Invitrogen, San Diego, CA), purified using a pickle chelate column, and injected into rabbits. All immunizations were carried out by Spring Valley Labs (Woodbine, MD).
Western analysis using ['ZSI]iodoprotein A was carried out as described (Burnette, W.N., Anal. Biochem.,112:195,1981). Western analysis of conditioned medium prepared from these cells using an antiserum raised against a bacterially-expressed C-terminal fragment of GDF-8 detected two protein species with apparent molecular weights of approximately 52K and 15K under reducing conditions, consistent with unprocessed and processed forms of GDF-8, respectively. No bands were obtained either with preimmune serum or with conditioned medium from CHO cells transfected with an antisense construct. Under non-reducing conditions, the GDF-8 antiserum detected two predominant protein species with apparent molecular weights of approximately 101 K and 25K, consistent with dimeric forms of unprocessed and processed GDF-8, respectively. Hence, like other TGF-B family members, GDF-8 appears to be secreted and proteolytically processed, and the C-terminal region appears to be capable of forming a disulfide-linked dimer.

In order to prepare antibodies against GDF-8, GDF-8 antigen was expressed as a fusion S protein in bacteria. A portion of marine GDF-8 cDNA spanning amino acids 268-(mature region) was inserted into the pRSET vector (Invitrogen) such that the coding sequence was placed in frame with the initiating methionine codon present in the vector; the resulting construct created an open reading frame encoding a fusion protein with a molecular weight of approximately 16,600. The fusion construct was transformed into BL21 (DE3) (pLysS} cells, and expression of the fusion protein was induced by treatment with isopropylthio-(3-galactoside as described (Rosenberg, et al., Gene, 56:125-135). The fusion protein was then purified by metal chelate chromatography according to the instructions provided by Invitrogen. A Coomassie blue-stained geI of unpurified and purified fusion proteins is shown in FIGURE 8.
The purified fusion protein was used to immunize both rabbits and chickens.
Immuniza-tion of rabbits was carried out by Spring Valley Labs (Sykesville, MD), and immuniza-tion of chickens was carned out by HRP, Inc. (Denver, PA). Western analysis of sera both from immunized rabbits and from immunized chickens demonstrated the presence of antibodies directed against the fusion protein.
To express GDF-8 in mammalian cells, the marine GDF-8 cDNA sequence from nucleotides 48-1303 was cloned in both orientations downstream of the metallothionein I promoter in the pMSXND expression vector; this vector contains processing signals derived from SV40, a dihydrofolate reductase gene, and a gene conferring resistance to the antibiotic 6418 (Lee and Nathans, J. Biol. Chem., 263:3521-3527). The resulting constructs were transfected into Chinese hamster ovary cells, and stable tranfectants were selected in the presence of 6418. Two milliliters of conditioned media prepared from the 6418-resistant cells were dialyzed, lyophilized, electrophoresed under denaturing, reducing conditions, transferred to nitrocellulose, and incubated with anti-antibodies (described above) and ['ZSl]iodoproteinA.
As shown in FIGURE 9, the rabbit GDF-8 antibodies (at a 1:500 dilution) detected a protein of approximately the predicted molecular weight for the mature C-terminal fragment of GDF-8 in the conditioned media of cells transfected with a construct in which GDF-8 had been cloned in the correct (sense) orientation with respect to the metallothionein promoter (lane 2); this band was not detected in a similar sample prepared from cells transfected with a control antisense construct (lane 1 ).
Similar results were obtained using antibodies prepared in chickens. Hence, GDF-8 is secreted and proteolytically processed by these transfected mammalian cells.

To determine the pattern of GDF-8, 5 ~,g of twice poly A-selected RNA prepared from a variety of marine tissue sources were subjected to Northern analysis. As shown in FIGURE 10a (and as shown previously in Example 2), the GDF-8 probe detected a single mRNA species present almost exclusively in skeletal muscle among a large number of adult tissues surveyed. On longer exposures of the same blot, significantly lower but detectable levels of GDF-8 mRNA were seen in fat, brain, thymus, heart, and lung.
Hence, these results confirm the high degree of specificity of GDF-8 expression in skeletal muscle. GDF-8 mRNA was also detected in mouse embryos at both gestational ages (day 12.5 and day 18.5 post-coital) examined but not in placentas at various stages of development (FIGURE l Ob).
To further analyze the expression pattern of GDF-8, in situ hybridization was performed on mouse embryos isolated at various stages of development.

For all in situ hybridization experiments, probes corresponding to the C-terminal region of GDF-8 were excluded in order to avoid possible cross-reactivity with other members of the superfamily. Whole mount in situ hybridization analysis was carried out as described (Wilkinson, D.G., In Situ Hybridization, A Practical Approach, pp.
75-83, IRL. Press, Oxford, 1992) except that blocking and antibody incubation steps were carried out as in Knecht et al. (Knecht, et al., Development, 121:1927, 1955).
Alkaline phosphatase reactions were carried out for 3 hours for day 10.5 embryos and overnight for day 9.5 embryos. Hybridization was carried out using digoxigenin-labelled probes spanning nucleotides 8-811 and 1298-2676, which correspond to the pro-region and 3' untranslated regions, respectively. In situ hybridization to sections was carried out as described (Wilkinson, et al., Cell, 50:79, 1987) using 'SS-labelled probes ranging from approximately 100-650 bases in length and spanning nucleotides 8-793 and 1566-2595.
Following hybridization and washing, slides were dipped in NTB-3 photographic emulsion, exposed for 16-19 days, developed and stained with either hematoxylin and eosin or toluidine blue. RNA isolation, poly A selection, and Northern analysis were carried out as described previously (McPherron and Lee, J. Biol. Chem., 268:3444, 1993).
At all stages examined, the expression of GDF-8 mRNA appeared to be restricted to developing skeletal muscle. At early stages, GDF-8 expression was restricted to developing somites. By whole mount in situ hybridization analysis, GDF-8 mRNA
could first be detected as early as day 9.5 post coitum in approximately one-third of the somites. At this stage of development, hybridization appeared to be restricted to the most mature (9 out of 21 in this example), rostral somites. By day 10.5 p.c., GDF-8 expression was clearly evident in almost every somite (28 out of 33 in this example shown). Based on in situ hybridization analysis of sections prepared from day 10.5 p.c.
embryos, the expression of GDF-8 in somites appeared to be localized to the myotome compartment. At later stages of development, GDF-8 expression was detected in a wide range of developing muscles.

GDF-8 continues to be expressed in adult animals as well. By Northern analysis, GDF-8 mRNA expression was seen almost exclusively in skeletal muscle among the different adult tissues examined. A significantly lower though clearly detectable signal was also seen in adipose tissue. Based on Northern analysis of RNA prepared fi~om a large S number of different adult skeletal muscles, GDF-8 expression appeared to be widespread although the expression levels varied among individual muscles.

In order to map the chromosomal location of GDF-8, DNA samples from human/rodent IO somatic cell hybrids (Drwinga, et al., Ge~omics, 16:311-413, 1993; Dubois and Naylor, Genomics, 16:315-319, 1993) were analyzed by polymerase chain reaction followed by Southern blotting. Polymerase chain reaction was carried out using primer #83, 5'-C-GCGGATCCGTGGATCTAAATGAGAACAGTGAGC-3' (SEQ ID NO: 15) and primer #84, S'-CGCGAATTCTCAGGTAATGATTGTITCCGTTGTAGCG-3'(SEQ ID N0:16) 15 for 40 cycles at 94 ° C for 2 minutes, 60 ° C for 1 minute, and 72 ° C for 2 minutes. These primers correspond to nucleotides 119 to 143 (flanked by a Bam H1 recognition sequence), and nucleotides 394 to 418 (flanked by an Eco Rl recognition sequence), respectively, in the human GDF-8 cDNA sequence. PCR products were electrophoresed on agarose gels, blotted, and probed with oligonucleotide #100, 20 5'-ACACTAAATCTTCAAGAATA-3' (SEQ ID N0:17), which corresponds to a sequence internal to the region flanked by primer #83 and #84. Filters were hybridized in 6 X SSC, 1 X Denhardt's solution; 100p,g/ml yeast transfer RNA, and 0.05%
sodium pyrophosphate at 50°C.
As shown in FIGURE 11, the human-specific probe detected a band of the predicted size 25 (approximately 320 base pairs) in the positive control sample (total human genomic DNA) and in a single DNA sample from the human/rodent hybrid panel. This positive signal corresponds to human chromosome 2. The human chromosome contained in each of the hybrid cell lines is identified at the top of each of the first 24 lanes (1-22, X, and Y). In the lanes designated M, CHO, and H, the starting DNA template was total genomic DNA from mouse, hamster, and human sources, respectively. In the lane marked B1, no template DNA was used. Numbers at left indicate the mobilities of DNA
standards. These data show that the human GDF-8 gene is located on chromosome 2.

The GDF-8, we disrupted the GDF-8 gene was disrupted by homologous targeting in embryonic stem cells. To ensure that the resulting mice would be null for GDF-function, the entire mature C-terminal region was deleted and replaced by a neo cassette (Figure 12a). A marine 129 SV/J genomic library was prepared in lambda FIX II
according to the instructions provided by Stratagene (La Jolla, CA). The structure of the GDF-8 gene was deduced from restriction mapping and partial sequencing of phage clones isolated from this library. Vectors for preparing the targeting construct were kindly provided by Philip Soriano and Kirk Thomas University. Rl ES cells were trans-fected with the targeting construct, selected with gancyclovir (2 ,uM) and 6418 (250 ,ug/ml), and analyzed by Southern analysis. Homologously targeted clones were injected into C57BL/6 blastocysts and transferred into pseudopregnant females. Germline transmission of the targeted allele was obtained in a total of 9 male chimeras from 5 independently-derived ES clones. Genomic Southern blots were hybridized at 42°C as described above and washed in 0.2X SSC, 0.1% SDS at 42°C.
For whole leg analysis, legs of 14 week old mice were skinned, treated with 0.2 M EDTA
in PBS at 4°C for 4 weeks followed by 0.5 M sucrose in PBS at 4°C. For fiber number and size analysis, samples were directly mounted and frozen in isopentane as described (Brumback and Leech, Color Atlas of Muscle Histochemistry, pp. 9-33, PSG
Publishing Company, Littleton, MA, 1984). Ten to 30 ,um sections were prepared using a cryostat and stained with hematoxylin and eosin. Muscle fiber numbers were determined from sections taken from the widest part of the tibialis cranialis muscle. Muscle fiber sizes were measured from photographs of sections of tibialis cranialis and gastrocnemius muscles. Fiber type analysis was carned out using the mysosin ATPase assay after anent at pH 435 as descaibed (Cud et af, Color Atlas of l~~rscls Pathology, Pp~ 184-185, 1994) and by inzmunohiatochemistry using an antibody ~irectod against type I myosin (MY32, Sigma) and the Vaxasfain methpd {Vector Labs); in the immunohistochemical o~tpairnrnte, no was seen when t~ paimm~y mm'bodies were IeR out. Carcasses was from shavod mice by removing tire ali of the internal. pagans and as~oc~ed fat aid oo~tiv~ tisane. Fat oontmt of amcasses from 4 month old males was determined as described (heshner, et al., Phys~ol.
Bei~avior, x:281,1972).
For pmteia and DNA analysis, tisane was homo~iud in 150 mM NaCI, 100 mM
EDTA. Protein concentrations were detmmined using the Biorad protein assay.
DNA
was iOd by adding SDS to 1'y4, tt~e~ng with 1 mg/ml pmt~asa K overni~t at 55°C, extracting 3 times with phenol and twice with chlomform, and pnecipitstin8 with ammonium acetate and EtOH. DNA was digesbod with 2 mg~ml lZNase for 1 hour at 37°C, and following ptnteinase K d<gesbon and phenol and chloroform a~
the DNA was precipitated twice with ammonium able and BtOH.
Homologous targeting of he CIDF-8 gene wan seen in 131131 gancyclovir/G418 doubly-resistant FS cell clones. Following irtjoction of these targ~ clones into blestocys<s, we obfaimd ~r~eras fiom S independently-derived ES clorrrs that produced heterozygous peps when cro~od t~ C57BLl6 acs ~gw~e 12b). Genotypic analysis of fi78 o~sporing derived finrn of FI hues showed i 70 +I+ (2~%~ 380 +I (56%~ arid 128 -I (199~e). A.hho>~h the ratio of g~types was clox t~0 !he expected ratio of I :2:1, the smaller than expected number of homozygous mutants appeared to be statistically significant (p<0.001).
Homozygous mutants were viable and futile wi>ar cx~ed to C57BL6 mice and to each other Ha~ygous mubmt eniaaats, however, were app~Cimately 34% lager than their _ heterozygous and wild type littarmates. Zhe did bav~roen mutant and wild type body weights appeared to be relatively constant irrespective of age and sex in adult aniaaals. Adult mutants also displayed an abtronrral body shape, with pronounced shoulders and hips. When the skin was removed fibm animals that had been sacrificed, it was appamnt >hst the muscles of the mutants were much larger than those of wild type aninnals. The increase in skeletal muscle mass appeared to be widespa~ad thsuughourt the body. Individual muscles isolated from homozygous mutant animals weighed approximately 2-3 times more than those isolated from wild type IitGormates.
Although the magnitude of the weight izxrease appearmd to roughly cor<elate with the level of GDF-8 atp~on in the muscles examined. To determine whether the incr~ed muscle mass could account for the entire difference in total body weights between wild typo and mutant animals or yether many tissues were generally larger in the mutants, we compa:ed the total body weights to cmr~s weights. The diff~ce in carcass weights between wild type and mutant animals was comparable to the difference in total body weights. Moreover, because the fat content of mutant and wild type animals was similar; these data are consistent with all of the total body vvaght diffe~x resulting from en incmase in skeletal muscle mass, although wo have not formally ruled out the possibility that differences in bone mass might also contribuf~e to the differences in total body mass.
To determine whether the increase in skeletal muscle mass resulted from hypaplas>a or from hypertrophy, histologic analysis of several different muscle groups was perfonaed.
The mutant muscle appe~ed grmsly normal. No excess connecrave risers; or fat was seen nor were'there auy obvious signs of degeon, such as widely varying fiber sues (see below) or centrally-placed nuclei. Quantitation of the number of muscle fibers showed that at the widest parson of the tibialis cranialis muscle, tlur total cell number was 86°/.
higher in mutant animals compared to wild type littemoetes [mutant = 5470 +l-121 (n = 3), wild type = 2936 +/- 288 (n = 3); p < 0.01]. Consistent with this result was the finding that the amount of DNA extracted from mutant muscle was mughly 50'Y.
higher than from wild type muscle [mutant ~ 350 peg (n = 4), wild type = 233 ,ug (n =
3) from pooled gastmcx~emius, plantaris, triceps brachii, ti'bialis cranialis, and peetoralis muscles;
p = 0.05]. Hence, a large part of the incaease in skeletal muscle mass resulted from muscle cell hyperplasia. However, muscle $ber hypertrophy also appeared to contribute to the overall increase in muscle mass. As shown in Figure 13, the mean fiber diameter of the tibialis cn3nialis muscle and gastrocnemius muscle was 7% and 22%
larger, respectively, in mutant animals cod to wild typo lid, suggesting that the cmssrsectional area of the fibers was increased by approximately 14'/o and 49'/0, respectively. Notably, although the mean fiber diam~r was larger in the mutants, the standard deviation in fiber sizes was similar between mutant and wild type muscle, consistent with the ai~nce of muscle degeneration in mutant animals. The increase in fiber size was also consistent with the finding that the protein to DNA ratio (w/w) was slightly increased in mutant compared to wild type muscle [mutant = 871 +/ 111 (n =
4), wild type = 624 +l- 85 (n ~ 3); p ~ 0.05).
In a comparison between muscle weight (in grams) from wild-type (+/+), heterozyous (+/-) and an homozygous knock-out mice (-/-), it has been demonstrated that the muscle mass is increased in heterozyous as compared to wild-type animals.
Finally, fiber type analysis of various muscles was cairiod out to determine the number of both type I (slow) and type II (fast) frbexs was increased in the mutant animals. In most of the muscles examined, including the tibialis cxaaislis muscle, the vast majority of muscle fibers were type II in both mutant and wild type animals. hence, based on the cell counts discussed above, the absolute number of type Ii fibers were used in the tibialis cranialis muscle. In the coleus muscle, where the number of type I fibers was su~ciently high that we could attempt to quantitate the ratio of fiber types could be quantiatad, the percent of type 1 fibers was decreased by approximately 33% in .
mutant compered to wild type muscle [wild type = 39.2 +/ 8.1 (n = 3), mutant =
26.4 +/-9.3 (n = 4)J; however, the variability in this ratio for both wild type and mutant animals was too high to support any firm conclusions regarding the relative number of fiber In order to isolate rat and chicken GDF-8 cDNA clones, skeletal muscle cDNA
libraries prepared from these species were obtained from Stratagene and screened with a marine GDF-8 probe. Library screening was carried out as described previously (Lee, Mol.
Endocrinol., 4:1034-1040) except that final washes were carried out in 2 X SSC
at 65 ° C.
Partial sequence analysis of hybridizing clones revealed the presence of open reading frames highly related to marine and human GDF-8. Partial sequences of rat and chicken GDF-8 are shown in Figures 2c and 2d, respectively, and an alignment of the predicated rat and chicken GDF-8 amino acid sequences with those of marine and human GDF-are shown in Figure 3b. Full length rat and chicken GDF-8 is shown in Figures 14d and 14c, respectively and sequence alignment between marine, rat, human, baboon, porcine, ovine, bovine, chicken, and turkey sequences is shown in Figures 15a and 15b.
All sequences contain an RSRR (SEQ ID NO: 51) sequence that is likely to represent the proteolytic processing site. Following this RSRR (SEQ ID NO: 51) sequence, the sequences contain a C-terminal region that is 100% conserved among all four species. The absolute conservation of the C-terminal region between species as evolutionary far apart as humans and chickens, and baboons and turkeys, suggests that this region will be highly conserved in many other species as well.
Similar methodology was used to obtain the nucleotide and amino acid sequences for baboon (SEQ ID N0:18 and 19, respectively; Figure 14a); bovine (SEQ ID N0:20 and 21, respectively; Figure 14b); turkey (SEQ ID N0:26 and 27, respectively;
Figure 14e);
porcine (SEQ ID N0:28 and 29, respectively; Figure 14f); and ovine (SEQ ID
N0:30 and 31, respectively; Figure 14g).

The overall homology between GDF-I 1 and GDF-8 based upon their rapxtive amino acid sequence is approximately 9286 (see for example WO 96/01845). Thus, it is expected that animals expressing GDF-8 and GDF-11 will display similar phenotypes. Similarly, animals having a disruption in a GDF-8 or GDF-11 gene will display similar phenotypes. The relationship of GDF-8 to GDF-11 will be farther understood in light of the following examples, in which GDF-11 knoekout~mice were created.
Lake most other TGF-~i family member, QDF-11 also appears to be highly conserved across species. By genomic Southern analysis, homologous sequences were detected in all mammalian species exaaiiaed as well as in chickens and fings (Figure I6).
In most species, the GDF-I 1 probe also detected a second, more faintly hybridizing fragment corresponding to the myostatin gene (McPherron et al., Nature 387:83-90, 1997).
GDS'-11 ICNO('KOUT MICE
To detecnoine the biological function of GDF-I 1, we disrupted the GDF-I 1 gene by homologous tar~ting in embryonic stem cells. A marine 129 SVlJ gnomic library was prepared in lambda FIX1T according to the instructioas provided by Stratagene (La Jolla, CA). The structure of the GDF-11 gene was deducai Erom restriction mapping and partial sequencing of ghage clones isolated from the library. Vectors for ping the targding construct were kindly provided by Philip Soriano and Kirk Thomas. To ensure that the resulting mice would be null for GDF-11 function, the entire mature C-terminal region was deleted and replaced by a neo cassette (Figure l7ab). Rl ES cells were transfer with the targeting cx~nstruct, selected with gancyclovir (2 lttvl) and 6418 ,(250 pg/ml), and analyzed by Southern analysis. Homologous targeting of the GDF-1 I
gene was seen in 8/155 gancyclovirlG418 doubly repeat ES cell clones. Following injection of several targeted clones into CS7BLJ6J blastocysts, we obtained chimeras from one ES
clone that produced heterozygous pups when crossed to both C57BL6J and 129/SvJ

females. Crosses of C57BL/6J/129/SvJ hybrid F1 heterozygotes produced 49 wild-type (34%), 94 heterozygous (66%) and no homozygous mutant adult offspring.
Similarly, there were no adult homozygous null animals seen in the 129/SvJ background (32 wild-type (36%) and 56 heterozygous mutant (64%) animals).
To determine the age at which homozygous mutants were dying, we genotyped litters of embryos isolated at various gestational ages from heterozygous females that had been mated to heterozygous males. At all embryonic stages examined, homozygous mutant embryos were present at approximately the predicted frequency of 25%. Among hybrid newborn mice, the different genotypes were also represented at the expected Mendelian ratio of 1:2:1 (34 +/+ (28%), 61 +/- (50%), and 28 -/- (23%)). Homozygous mutant mice were born alive and were able to breath and nurse. All homozygous mutants died, however, within the first 24 hours after birth. The precise cause of death was unknown, but the lethality may have been related to the fact that the kidneys in homozygous mutants were either severely hypoplastic or completely absent. A summary of the kidney abnormalities in these mice is shown in Figure 18.

Homozygous mutant animals were easily recognizable by their severely shortened or absent tails (Figure 19a). To further characterize the tail defects in these homozygous mutant animals, we examined their skeletons to determine the degree of disruption of the caudal vertebrae. A comparison of wild-type and mutant skeleton preparations of late stage embryos and newborn mice, however, revealed differences not only in the caudal region of the animals but in many other regions as well. In nearly every case where differences were noted, the abnormalities appeared to represent homeotic transformations of vertebral segments in which particular segments appeared to have a morphology typical of more anterior segments. These transformations, which are summarized in Figure 20, were evident throughout the axial skeleton extending from the cervical region to the caudal region. Except for the defects seen in the axial skeleton, the rest of the skeleton, such as the cranium and limb bones, appeared normal.

Anterior transformations of the vertebrae in mutant newborn animals were most readily apparent in the thoracic region, where there was a dramatic increase in the number of thoracic (T) segments. All wild-type mice examined showed the typical pattern of 13 thoracic vertebrae each with its associated pair of ribs (Figure 19(b,e)). In contrast, homozygous mutant mice showed a striking increase in the number of thoracic vertebrae.
All homozygous mutants examined had 4 to 5 extra pairs of ribs for a total of 17 to 18 (Figure 19(d,g)) although in over 1 /3 of these animals, the 18th rib appeared to be rudimentary. Hence, segments that would normally correspond to lumbar (L) segments L 1 to L4 or LS appeared to have been transformed into thoracic segments in mutant animals.
Moreover, transformations within the thoracic region in which one thoracic vertebra had a morphology characteristic of another thoracic vertebra were also evident.
For example, in wild-type mice, the first 7 pairs of ribs attach to the sternum, and the remaining 6 are unattached or free (Figure 19(e,h)). In homozygous mutants, there was an increase in the number of both attached and free pairs of ribs to 10-11 and 7-8, respectively (Figure 19(gj)). Therefore, thoracic segments T8, T9, T10, and in some cases even Tl l, which all have free ribs in wild-type animals, were transformed in mutant animals to have a characteristic typical of more anterior thoracic segments, namely, the presence of ribs attached to the sternum. Consistent with this fording; the transitional spinous process and transitional articular processes which are normally found on T10 in wild-type animals were instead found on T13 in homozygous mutants (data not shown). Additional transformations within the thoracic region were also noted in certain mutant animals. For example, in wild-type mice, the ribs derived from T1 normally touch the top of the sternum. However, in 2/23 hybrid and 2/3 129/SvJ homozygous mutant mice examined, T2 appeared to have been transformed to have a morphology resembling that of T1; that is, in these animals, the ribs derived from T2 extended to touch the top of the sternum.
In these cases, the ribs derived from T1 appeared to fuse to the second pair of ribs.
Finally, in 82% of homozygous mutants, the long spinous process normally present on T2 was shifted to the position of T3. In certain other homozygous mutants, asymmetric fusion of a pair of vertebrosternal ribs was seen at other thoracic levels.

The anterior transformations were not restricted to the thoracic region. The anterior most transformation that we observed was at the level of the 6th cervical vertebra (C6). In wild-type mice, C6 is readily identifiable by the presence of two anterior tuberculi on the ventral side. In several homozygous mutant mice, although one of these two anterior tuberculi was present on C6, the other was present at the position of C7 instead. Hence, in these mice, C7 appeared to have been partially transformed to have a morphology resembling that of C6. One other homozygous mutant had 2 anterior tuberculi on C7 but retained one on C6 for a complete C7 to C6 transformation but a partial C6 to CS
transformation.
Transformations of the axial skeleton also extended into the lumbar region.
Whereas wild-type animals normally have only 6 lumbar vertebrae, homozygous mutants had 8-9.
At least 6 of the lumbar vertebrae in the mutants must have derived from segments that would normally have given rise to sacral and caudal vertebrae as the data described above suggest that 4 to 5 lumbar segments were transformed into thoracic segments.
Hence, homozygous mutant mice had a total of 33-34 presacral vertebrae compared to 26 presacral vertebrae normally present in wild-type mice. The most common presacral vertebral patterns were C7/T18/L8 and C7/T18/L9 for mutant mice compared to C7/T13/L6 for wild-type mice. The presence of additional presacral vertebrae in mutant animals was obvious even without detailed examination of the skeletons as the position of the hindlimbs relative to the forelimbs was displaced posteriorly by 7-8 segments.
Although the sacral and caudal vertebrae were also affected in homozygous mutant mice, the exact nature of each transformation was not as readily identifiable. In wild-type mice, sacral segments S 1 and S2 typically have broad transverse processes compared to S3 and S4. In the mutants, there did not appear to be an identifiable S 1 or S2 vertebra.
Instead, mutant animals had several vertebrae that appeared to have morphology similar to S3. In addition, the transverse processes of all 4 sacral vertebrae are normally fused to each other although in newborns often only fusions of the first 3 vertebrae are seen.
In homozygous mutants, however, the transverse processes of the sacral vertebrae were usually unfused. In the caudalmost region, all mutant animals also had severely malformed vertebrae with extensive fusions of cartilage. Although the severity of the fusions made it difficult to count the total number of vertebrae in the caudal region, we were able to count up to 15 transverse processes in several animals. We were unable to determine whether these represented sacral or caudal vertebrae in the mutants because we could not establish morphologic criteria for distinguishing S4 from caudal vertebrae even in wild-type newborn animals. Regardless of their identities, the total number of vertebrae in this region was significantly reduced from the normal number of approxi-mately 30. Hence, although the mutants had significantly more thoracic and lumber vertebrae than wild-type mice, the total number of segments was reduced in the mutants due to the truncation of the tails.
Heterozygous mice also showed abnormalities in the axial skeleton although the phenotype was much milder than in homozygous mice. The most obvious abnormality in heterozygous mice was the presence of an additional thoracic segment with an associated pair of ribs (Figure 19(c,f)). This transformation was present in every heterozygous animal examined, and in every case, the additional pair of ribs was attached to the sternum (Figure 19(i)). Hence, T8, whose associated rib normally does not touch the sternum, appeared to have been transformed to a morphology characteristic of a more anterior thoracic vertebra, and L1 appeared to have been transformed to a morphology characteristic of a posterior thoracic vertebra. Other abnormalities indicative of anterior transformations were also seen to varying degrees in heterozygous mice. These included a shift of the long spinous process characteristic of T2 by one segment to T3, a shift of the articular and spinous processes from T10 to T11, a shift of the anterior tuberculus on C6 to C7, and transformation of T2 to Tl where the rib associated with T2 touched the top of the sternum.
In order to understand the basis for the abnormalities in axial patterning seen in GDF-11 mutant mice, we examined mutant embryos isolated at various stages of development and compared them to wild-type embryos. By gross morphological examination, homozy-gous mutant embryos isolated up to day 9.5 of gestation were not readily distinguishable from corresponding wild-type embryos. In particular, the number of somites present at any given developmental age was identical between mutant and wild-type embryos, suggesting that the rate of somite formation was unaltered in the mutants. By day 10.5-I 1.5 p.c., mutant embryos could be easily distinguished from wild-type embryos by the posterior displacement of the hindlimb by 7-8 somites. The abnormalities in tail development were also readily apparent at this stage. Taken together, these data suggest that the abnormalities observed in the mutant skeletons represented true transformations of segment identities rather than the insertion of additional segments, for example, by an enhanced rate of somitogenesis.
Alterations in expression of homeobox containing genes are known to cause transforma-- 10 tions in Drosophila and in vertebrates. To see if the expression patterns of Hox genes (the vertebrate homeobox containing genes) were altered in GDF-11 null mutants we determined the expression pattern of 3 representative Hox genes, Hoxc-6, Hoxc-8 and Hoxc-11, in day 12.5 p.c. wild-type, heterozygous and homozygous mutant embryos by whole mount in situ hybridization. The expression pattern of Hoxc-6 in wild-type embryos spanned prevertebrae 8-15 which correspond to thoracic segments Tl-T8.
In homozygous mutants, however, the Hoxc-6 expression pattern was shifted posteriorly and expanded to prevertebrae 9-18 (T2-Tl 1). A similar shift was seen with the Hoxc-8 probe. In wild-type embryos, Hoxc-8 was expressed in prevertebrae 13-18 (T6-T11) but, in homozygous mutant embryos, Hoxc-8 was expressed in prevertebrae 14-22 (T7-Tl 5).
Finally, Hoxc-11 expression was also shifted posteriorly in that the anterior boundary of expression changed from prevertebrae 28 tin wild-type embryos to prevertebrae 36 in mutant embryos. (Note that because the position of the hindlimb is also shifted posteriorly in mutant embryos, the Hoxc-11 expression patterns in wild-type and mutant appeared similar relative to the hindlimbs). These data provide further evidence that the skeletal abnormalities seen in mutant animals represent homeotic transformations.
The phenotype of GDF-11 mice suggested that GDF-11 acts early during embryogenesis as a global regulator of axial patterning. To begin to examine the mechanism by which GDF-11 exerts its effects, we determined the expression pattern of GDF-1I in early mouse embryos by whole mount in situ hybridization. At these stages the primary sites of GDF-11 expression correlated precisely with the known sites at which mesodermal cells are generated. Expression of GDF-11 was first detected at day 8.25-8.5 p.c. (8-10 somites) in the primitive streak region, which is the site at which ingressing cells form the mesoderm of the developing embryo. Expression was maintained in the primitive streak at day 8.75, but by day 9.5 p.c., when the tail bud replaces the primitive streak as the source of new mesodermal cells, expression of GDF-11 shifted to the tail bud. Hence at these early stages, GDF-11 appears to be synthesized in the region of the developing embryo where new mesodermal cells arise and presumably acquire their positional identity.
The phenotype of GDF-11 knockout mice in several respects resembles the phenotype of mice carrying a deletion of a receptor for some members of the TGF-~3 superfamily, the activin type IIB receptor (ActRIlB). As in the case of GDF-11 knockout mice, the ActRIIB knockout mice have extra pairs of ribs and a spectrum of kidney defects ranging from hypoplastic kidneys to complete absence of kidneys. The similarity in the phenotypes of these mice raises the possibility that ActRIIB may be a receptor for GDF-11. However, Act RIIB cannot be the sole receptor for GDF-11 because the phenotype of GDF-11 knockout mice is more severe than the phenotype of ActRIIB
mice. For example, whereas the GDF-11 knockout animals have 4-5 extra pairs of ribs and show homeotic transformations throughout the axial skeleton, the ActRIIB
knockout animals have only 3 extra pairs of ribs and do not show transformations at other axial levels. In addition, the data indicate that the kidney defects in the GDF-11 knockout mice are also more severe than those in ActRIIB knockout mice. The ActRIIB
knockout mice show defects in leftlright axis formation, such as lung isomerixm and a range of heart defects that we have not yet observed in GDF-11 knockout mice. ActRIIB
can bind the activins and certain BMPs, although none of the knockout mice generated for these ligands show defects in left/right axis formation.
If GDF-11 does act directly on mesodenmal cells to establish positional identity, the data presented here would be consistent with either short range or morphogen models for GDF-11 action. That is, GDF-11 may act on mesodermal precursors to establish patterns of Hox gene expression as these cells are being generated at the site of GDF-expression, or alternatively, GDF-11 produced at the posterior end of the embryo may diffuse to form a morphogen gradient. Whatever the mechanism of action of GDF-may be, the fact that gross anterior/posterior patterning still does occur in knockout animals suggests that GDF-11 may not be the sole regulator of ante-rior/posterior specification. Nevertheless, it is clear that GDF-11 plays an important role as a global regulator of axial patterning and that further study of this molecule will lead to important new insights into how positional identity along the anterior/posterior axis is established in the vertebrate embryo.
Similar phenotypes are expected in GDF-8 knockout animals. For example, GDF-8 knockout animals are expected to have increased number of ribs, kidney defects and anatomical differences when compared to wild-type.
Although the invention has been described with reference to the presently preferred embodiment, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

i:

SEQUENCE LISTING
<110> Johns Hopkins University School of Medicine <120> Growth Differentiation Factor-8 <130> 581-195 <140> 2,319,703 <141> 1999-02-05 <150> US 09/019,070 <151> 1998-02-05 <150> US 09/124,180 <151> 1998-07-28 <160> 53 <170> PatentIn version 3.0 <210> 1 <211> 35 <212> DNA
<213> Artificial <220>
<223> Primer <220>
<221> misc_feature <222> (1) . (35) <223> n = A, T, G, or C; v = A, G, or C, not T; r = G
or A; y = T or C: k = T or G
<220>
<221> misc_feature <222> (1). (35) <223> 12,27,30,33 n = inosine <400> 1 ccggaattcg gntggvanra ytggrtnrtn kcncc 35 <210> 2 <211> 33 <212> DNA
<213> Artificial <220>
<223> Primer <220>
<221> misc_feature <222> (1). (33) <223> 13,25,28 n = inosine ' 2 <220>
<221> misc_feature <222> (1) . (33) <223> n = A, T, G, or C; r = A or G; y = C or T; s = G or C
<400> 2 ccggaattcr canscrcarc tntcnacnry cat 33 <210> 3 <211> 31 <212> DNA
<213> Artificial ' <220>
<223> primer <400> 3 cgcggatcca gagtcaaggt gacagacaca c 31 <210> 4 <211> 33 <212> DNA
<213> Artificial <220>
<223> primer <400> 4 cgcggatcct cctcatgagc acccacagcg gtc 33 <210> 5 <211> 550 <212> DNA
<213> Mus musculus <220>
<221> CDS
<222> (59) . . (436) <400> 5 ttaaggtagg aaggatttca ggctctattt acataattgt tctttccttt tcacacag 58 aat ccc ttt tta gaa gtc aag gtg aca gac aca ccc aag agg tcc cgg 106 Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro :Lys Arg Ser Arg aga gac ttt ggg ctt gac tgc gat gag cac tcc acg ~gaa tcc cgg tgc 154 Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr ~Glu Ser Arg Cys tgc cgc tac ccc ctc acg gtc gat ttt gaa gcc ttt ~gga tgg gac tgg 202 Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe ~GIy Trp Asp Trp att atc gca ccc aaa aga tat aag gcc aat tac tgc tca gga gag tgt 250 Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys i, gaa ttt gtg ttt tta caa aaa tat ccg cat act cat ctt gtg cac caa 298 Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln gca aac ccc aga ggc tca gca ggc cct tgc tgc act ccg aca aaa atg 346 Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met tct ccc att aat atg cta tat ttt aat ggc aaa gaa caa ata ata tat 394 Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr ggg aaa att cca gcc atg gta gta gac cgc tgt ggg tgc tca 436 Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser tgagctttgc attaggttag aaacttccca agtcatggaa ggtcttcccc tcaatttcga 496 aactgtgaat tcctgcagcc cgggggatcc actagttcta gagcggccgc cacc 550 <210> 6 <211> 126 <212> PRT
<213> Mus musculus <400> 6 Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro :Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr (ilu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe (31y Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His heu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr F?ro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu CTln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly C:ys Ser 115 12 0 1.2 5 <210> 7 <211> 326 <212> DNA

<213> Homosap iens <220>

<221> CDS

<222> (3). 6) . (32 <400> 7 ca agatcc agaagggat tttggtctt gactgtchatgagcactca 47 aaa Lys ArgSer Arg Asp PheGlyLeu CysAsp HisSer Arg Asp Glu aca tcacga tgctgtcgt taccctcta actgtggat tttgaaget 95 gaa Thr SerArg CysCysArg TyrProLeu ThrValAsp PheGluAla Glu ttt tgggat tggattatc getcctaaa agatataag gccaattac 143 gga Phe TrpAsp TrpIleIle AlaProLys ArgTyrLys AlaAsnTyr Gly tgc ggagag tgtgaattt gtattttta caaaaatat cctcatact 191 tct Cys GlyGlu CysGluPhe ValPheLeu GlnLysTyr ProHisThr Ser cat gtacac caagcaaac cccagaggt tcagcaggc ccttgctgt 239 ctg His ValHis GlnAlaAsn ProArgGly SerAlaGly ProCysCys Leu act acaaag atgtctcca attaatatg ctatatttt aatggcaaa 287 ccc Thr ThrLys MetSerPro IleAsnMet LeuTyrPhe AsnGlyLys Pro gaa ataata tatgggaaa attccagcg atggtagta 326 caa Glu IleIle TyrGlyLys IleProAia MetValVal Gln 100 ~ 105 <210> 8 <211> 108 <212> PRT
<213> Homo Sapiens <400> 8 Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys .Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His S
Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile IIe Tyr Gly Lys Ile Pro Ala Met Val Val <210> 9 <211> 9 <212> FRT
<213> Artificial <220>
<223> amino acid encoded by oligonucleotide for PCR
<220>
<221> VARIANT
<222> (3) .. (3) <223> Xaa = His, Gln, Asn, Lys, Asp, Glu <220>
<221> VARIANT
<222> (4) . . (4) <223> Xaa = Asp, Asn <220>
<221> VARIANT
<222> (6) . . (7) <223> Xaa = Val, Ile, Met <220>
<221> VARIANT
<222> (8) . . (8) <223> Xaa = Ala, Ser <400> 9 Gly Trp Xaa Xaa Trp Xaa Xaa Xaa Pro <210> 10 <211> 8 <212> PRT
<213> Artificial <220>
<223> amino acid encoded by oligonucleotide for PCR
<220>
<221> VARIANT
_. »a>.~. _.__~___ ~.:~ .,~~_------.~ ,~

° ~ 6 <222> {2) . . (2) <223> Xaa = Val, Ile, Met, Thr, Ala <220>
<221> VARIANT
<222> (4) . . {4) <223> Xaa = Asp, Glu <220>
<221> VARIANT
<222> (7) . . (7) <223> Xaa = Gly, Ala <400> 10 Met Xaa Val Xaa Ser Cys Xaa Cys <210> 11 <211> 2676 <212> DNA
<213> Mus musculus <220>

<221>CDS

<222>{104)..'(1231) <400>11 gtctctcgga cggtacatgc cacttggcat tactcaaaag caaaaagaag actaatattt aaataagaac aagggaaaaa gctgattttt aaaatg atgcaa aaa 115 aaaagattgt Met MetGln Lys :1 ctg atg tat tat att ctg atgctgatt getget ggc 163 caa gtt tac ttc Leu Met Tyr Tyr Ile Leu MetLeu:CleAlaAla Gly Gln Val Tyr Phe cca gat cta gag ggc gag gaagaa<~.atgtggaa aaa 211 gtg aat agt aga Pro Asp Leu Glu Gly Glu GluGluAsn ValGlu Lys Val Asn Ser Arg gag ggg ctg tgt aat gca tgt gcg tgg aga caa aac acg agg tac tcc 259 Glu Gly Leu Cys Asn Ala Cys Ala Trp Arg Gln Asn '.Chr Arg Tyr Ser aga ata gaa gcc ata aaa att caa atc ctc agt aag cag cgc ctg gaa 307 Arg Ile Glu Ala Ile Lys Ile G1n Ile Leu Ser Lys I~eu Arg Leu Glu 55 60 fi5 aca get cct aac atc agc aaa gat get ata aga caa cat ctg cca aga 355 Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln heu Leu Pro Arg gcg cct cca ctc cgg gaa ctg atc gat cag tac gac dtc cag agg gat 403 Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp ~~~ _. _._-____..~...,. ~a - i,.-.

gacagc agtgatggc tctttg gaagatgac gattatcac getaccacg 45I

AspSer SerAspGly SerLeu GluAspAsp AspTyrHis AlaThrThr gaaaca atcattacc atgcct acagagtct gactttcta atgcaagcg 499 GluThr IleIleThr MetPro ThrGluSer AspPheLeu MetGlnAla gatggc aagcccaaa tgttgc ttttttaaa tttagctct aaaatacag 547 AspGly LysProLys CysCys PhePheLys PheSerSer LysIleGln tacaac aaagtagta aaagcc caactgtgg atatatctc agacccgtc 595 TyrAsn LysValVal LysAla GlnLeuTrp IleTyrLeu ArgProVal aagact cctacaaca gtgttt gtgcaaatc ctgagactc atcaaaccc 643 LysThr ProThrThr ValPhe ValGlnIle LeuArgLeu IleLysPro atgaaa gacggtaca aggtat actggaatc cgatctctg aaacttgac 691 MetLys AspGlyThr ArgTyr ThrGlyIle ArgSerLeu LysLeuAsp atgagc ccaggcact ggtatt tggcagagt attgatgtg aagacagtg 739 MetSer ProGlyThr GlyIle TrpGlnSer IleAspVal LysThrVal ttgcaa aattggctc aaacag cctgaatcc aacttaggc attgaaatc 787 LeuGln AsnTrpLeu LysGln ProGluSer AsnLeuGly IleGluIle aaaget ttggatgag aatggc catgatctt getgtaacc ttcccagga 835 LysAla LeuAspGlu AsnGly HisAspLeu AlaValThr PheProGly ccagga gaagatggg ctgaat cccttttta gaagtcaag gtgacagac 883 ProGly GluAspGly LeuAsn ProPheLeu GluValLys ValThrAsp acaccc aagaggtcc cggaga gactttggg cttgactgcgat gagcac 931 ThrPro LysArgSer ArgArg AspPheGly LeuAspCysAsp GluHis tccacg gaatcccgg tgctgc cgctacccc ctcacggtcgat tttgaa 979 SerThr GluSerArg CysCys ArgTyrPro LeuThrValAsp PheGlu gccttt ggatgggac tggatt atcgcaccc aaaagatataag gccaat 1027 AlaPhe GlyTrpAsp TrpIle IleAlaPro LysArgTyrLys AlaAsn tactgc tcaggagag tgtgaa tttgtgttt ttacaaaaatat ccgcat 1075 TyrCys SerGlyGlu CysGlu PheValPhe LeuGlnLysTyr ProHis actcat cttgtgcac caagca aaccccaga ggctcagcaggc ccttgc 1123 ThrHis LeuValHis GlnAla AsnProArg GlySerAlaGly ProCys tgc act ccg aca aaa atg tct ccc att aat atg cta tat ttt aat ggc 1171 c Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly aaa gaa caa ata ata tat ggg aaa att cca gcc atg gta gta gac cgc 1219 Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg tgt ggg tgc tca tgagctttgc attaggttag aaacttccca agtcatggaa 1271 Cys Gly Cys Ser ggtcttcccc tcaatttcga aactgtgaat tcaagcacca caggctgtag gccttgagta 1331 tgctctagta acgtaagcac aagctacagt gtatgaacta aaagagagaa tagatgcaat 1391 ggttggcatt caaccaccaa aataaaccat actataggat gttgtatgat ttccagagtt 1451 tttgaaatag atggagatca aattacattt atgtccatat atgtatatta caactacaat 1511 ctaggcaagg aagtgagagc acatcttgtg gtctgetgag ttaggagggt atgattaaaa 1571 ggtaaagtct tatttcctaa cagtttcact taatatttac agaa~gaatct atatgtagcc 1631 tttgtaaagt gtaggattgt tatcatttaa aaacatcatg tacacttata tttgtattgt 1691 atacttggta agataaaatt ccacaaagta ggaatggggc ctcacataca cattgccatt 1751 cctattataa ttggacaatc caccacggtg ctaatgcagt gctg~aatggc tcctactgga 1811 cctctcgata gaacactcta caaagtacga gtctctctct cccttccagg tgcatctcca 1871 cacacacagc actaagtgtt caatgcattt tctttaagga aaga~agaatc tttttttcta 1931 gaggtcaact ttcagtcaac tctagcacag cgggagtgac tgctgcatct taaaaggcag 1991 ccaaacagta ttcatttttt aatctaaatt tcaaaatcac tgtcitgcctt tatcacatgg 2051 caattttgtg gtaaaataat ggaaatgact ggttctatca atatitgtata aaagactctg 2111 aaacaattac atttatataa tatgtataca atattgtttt gtaaataagt gtctcctttt 2171 atatttactt tggtatattt ttacactaat gaaatttcaa atcat:.taaag tacaaagaca 2231 tgtcatgtat cacaaaaaag gtgactgctt ctatttcaga gtgaattagc agattcaata 2291 gtggtcttaa aactctgtat gttaagatta gaaggttata ttacaatcaa tttatgtatt 2351 ttttacatta tcaacttatg gtttcatggt ggctgtatct atgaatgtgg ctcccagtca 2411 aatttcaatg ccccaccatt ttaaaaatta caagcattac taaa<:atacc aacatgtatc 2471 taaagaaata caaatatggt atctcaataa cagctacttt tttat=tttat aatttgacaa 2531 tgaatacatt tcttttattt acttcagttt tataaattgg aacttagttt atcaaatgta 2591 ttgtactcat agctaaatga aattatttct tacataaaaa tgtgt:agaaa ctataaatta 2651 aagtgttttc acatttttga aaggc 2676 <210> 12 <211> 376 <212> PRT
<213> Mus musculus <400> 12 Met Met Gln Lys Leu Gln Met Tyr Val Tyr Ile Tyr Leu Phe Met Leu Ile Ala Ala Gly Pro Val Asp Leu Asn Glu Gly Ser Glu Arg Glu Glu Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Ala Trp Arg Gln Asn Thr Arg Tyr Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp .Ala Ile Arg Gln Leu Leu Pro Arg Ala Pro Pro Leu Arg Glu Leu Ile .Asp Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu :~lsp Asp Asp Tyr 100 105 ~ 110 His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe 115 12 0 :12 5 Leu Met Gln Aia Asp Gly Lys Pro Lys Cys Cys Phe 7?he Lys Phe Ser Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Pro Val Lys Thr Pro Thr Thr Val Phe Val C~ln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Cily Ile Arg Ser Leu Lys Leu Asp Met Ser Pro Gly Thr Gly Ile Trp CTln Ser Ile Asp 195 200 x;05 Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro C:lu Ser Asn Leu Gly Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Gly Pro Gly GIu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 13 <211> 2743 <212> DNA
<213> Homo Sapiens <220>
<221> CDS
<222> (59)-.(1183) <400> 13 aagaaaagta aaaggaagaa acaagaacaa gaaaaaagat tata,ttgatt ttaaaatc 58 atg caa aaa ctg caa ctc tgt gtt tat att tac ctg ttt atg ctg att 106 Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile gtt get ggt cca gtg gat cta aat gag aac agt gag caa aaa gaa aat 154 Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn .~-_- m~~

gtggaaaaa ggg tgtaatgca act tgg aac 202 gag ctg tgt aga act caa ValGluLysGlu Gly CysAsnAla Thr TrpArg Asn Leu Cys Gln Thr aaatcttcaaga atagaa gccattaag atacaa atcctcagt aaactt 250 LysSerSerArg IleGlu AlaIleLys IleGln IleLeuSer LysLeu cgtctggaaaca getcct aacatcagc aaagat gttataaga caactt 298 ArgLeuGluThr AlaPro AsnIleSer LysAsp ValIleArg GlnLeu ttacccaaaget cctcca ctccgggaa ctgatt gatcagtat gatgtc 346 LeuProLysAla ProPro LeuArgGlu LeuIle AspGlnTyr AspVal cagagggatgac agcagc gatggctct ttggaa gatgacgat tatcac 394 GlnArgAspAsp SerSer AspGlySer LeuGlu AspAspAsp TyrHis getacaacggaa acaatc attaccatg cctaca gagtctgat tttcta 442 AlaThrThrGlu ThrIle IleThrMet ProThr GluSerAsp PheLeu atgcaagtggat ggaaaa cccaaatgt tgcttc tttaaattt agctct 490 MetGlnValAsp GlyLys ProLysCys CysPhe PheLysPhe SerSer aaaatacaatac aataaa gtagtaaag gcccaa ctatggata tatttg 538 LysIleGlnTyr AsnLys ValValLys AlaGln LeuTrpIle TyrLeu agacccgtcgag actcct acaacagtg tttgtg caaatcctg agactc 586 ArgProValGlu ThrPro ThrThrVal PheVal GlnIleLeu ArgLeu atcaaacctatg aaagac ggtacaagg tatact gga;atccga tctctg 634 IleLysProMet LysAsp GlyThrArg TyrThr Gly:IleArg SerLeu aaacttgacatg aaccca ggcactggt atttgg cagagcatt gatgtg 682 LysLeuAspMet AsnPro GlyThrGly IleTrp GlnSerIle AspVal 195 200 ;Z05 aagacagtgttg caaaat tggctcaaa caacct gaat aac ttaggc 730 cc LysThrValLeu GlnAsn TrpLeuLys GlnPro GluSerAsn LeuGly attgaaataaaa gettta gatgagaat ggtcat gat<atget gtaacc 778 IleGluIleLys AlaLeu AspGluAsn GlyHis AspI~euAla ValThr ttcccaggacca ggagaa gatgggctg aatccg ttttaagag gtcaag 826 PheProGlyPro GlyGlu AspGlyLeu AsnPro PheheuGlu ValLys gtaacagacaca ccaaaa agatccaga agggat tttdgtctt gactgt 874 ValThrAspThr ProLys ArgSer Arg PheLilyLeu AspCys Arg Asp gatgagcactca acagaa tcacgatgc tgtcgt tacc:ctcta actgtg 922 ,,,..~...~~ ___..
____.~____.~
__..
,~m~~.~~..
~~"_ T ~~

Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val gat ttt gaa get ttt gga tgg gat tgg att atc get cct aaa aga tat 970 Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr aag gcc aat tac tgc tct gga gag tgt gaa ttt gta ttt tta caa aaa 1018 Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys tat cct cat act cat ctg gta cac caa gca aac ccc aga ggt tca gca 1066 Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala ggc cct tgc tgt act ccc aca aag atg tct cca att aat atg cta tat 1114 Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr ttt aat ggc aaa gaa caa ata ata tat ggg aaa att cca gcg atg gta 1162 Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val gta gac cgc tgt ggg tgc tca tgagatttat attaagcgta cataacttcc 1213 Val Asp Arg Cys Gly Cys Ser taaaacatgg aaggttttcc cctcaacaat tttgaagctg tgaa~attaag taccacaggc 1273 tataggccta gagtatgcta cagtcactta agcataagct acag~tatgta aactaaaagg 1333 gggaatatat gcaatggttg gcatttaacc atccaaacaa atca.tacaag aaagttttat 1393 gatttccaga gtttttgagc tagaaggaga tcaaattaca tttatgttcc tatatattac 1453 aacatcggcg aggaaatgaa agcgattctc cttgagttct gatgaattaa aggagtatgc 1513 tttaaagtct atttctttaa agttttgttt aatatttaca gaaaaatcca catacagtat 1573 tggtaaaatg caggattgtt atataccatc attcgaatca tccttaaaca cttgaattta 1633 tattgtatgg tagtatactt ggtaagataa aattccacaa aaatagggat ggtgcagcat 1693 atgcaatttc cattcctatt ataattgaca cagtacatta acaatccatg ccaacggtgc 1753 taatacgata ggctgaatgt ctgaggctac caggtttatc acat~aaaaaa cattcagtaa 1813 aatagtaagt ttctcttttc ttcaggtgca ttttcctaca cctccaaatg aggaatggat 1873 tttctttaat gtaagaagaa tcatttttct agaggttggc tttc<~attct gtagcatact 1933 tggagaaact gcattatctt aaaaggcagt caaatggtgt ttgti~tttat caaaatgtca 1993 aaataacata cttggagaag tatgtaattt tgtctttgga aaattacaac actgcctttg 2053 caacactgca gtttttatgg taaaataata gaaatgatcg actct:atcaa tattgtataa 2113 aaagactgaa acaatgcatt tatataatat gtatacaata ttgttatgta aataagtgtc 2173 tcctttttta tttactttgg tatattttta cactaaggac atttc:aaatt aagtactaag 2233 gcacaaagac atgtcatgca tcacagaaaa gcaactactt atat~ttcaga gcaaattagc 2293 agattaaatagtggtcttaaaactccatatgttaatgattagat;ggttatattacaatca2353 ttttatatttttttacatgattaacattcacttatggattcatc~atggctgtataaagtg2413 aatttgaaatttcaatggtttactgtcattgtgtttaaatctcaacgttccattatttta2473 atacttgcaaaaacattactaagtataccaaaataattgactct:attatctgaaatgaag2533 aataaactgatgctatctcaacaataactgttacttttatttta~taatttgataatgaat2593 atatttctgc atttatttac ttctgttttg taaattggga tttt.gttaat caaatttatt 2653 gtactatgac taaatgaaat tatttcttac atctaatttg taga.aacagt ataagttata 2713 ttaaagtgtt ttcacatttt tttgaaagac 2743 <210> 14 <211> 375 <212> PRT
<213> Homo sapiens <400> 14 Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Thr Trp .Arg Gln Asn Thr Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile :Leu Ser Lys Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Val :Ile Arg Gln Leu Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp i~sp Asp Tyr His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu :>er Asp Phe Leu Met Gln Val Asp Gly Lys Pro Lys Cys Cys Phe Phe hys Phe Ser Ser ,~___.
.,.~..~- -_-_ . I

' 14 Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Pro Val Glu Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 15 <211> 34 <212> DNA
<213> Artificial <220>
<223> oligonucleotide for PCR
<400> 15 cgcggatccg tggatctaaa tgagaacagt gagc 34 <210> 16 <211> 37 <212> DNA
<213> Artificial <220>
<223> oligonucleotide for PCR
<400> 16 cgcgaattct caggtaatga ttgtttccgt tgtagcg 37 <210> 17 <211> 20 <212> DNA
<213> Artificial <220>
<223> oligonucleotide for PCR
<400> 17 acactaaatc ttcaagaata <210> 18 <211> 1128 <212> DNA
<213> Papio hamadryas <220>
<221> CDS
<222> (1) . . (1125) <400> 18 atg caa aaa ctg caa ctc tgt gtt tat att tac ctg ttt atg ctg att 48 Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile gtt .gct ggt cca gtg gat cta aat gag aac agt gag caa aaa gaa aat 96 Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn gtg gaa aaa gag ggg ctg tgt aat gca tgt act tc~g aga caa aac act 144 Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Thr Trp Arg Gln Asn Thr aaa tct tca aga ata gaa gcc att aaa ata caa at:c ctc agt aaa ctt 192 Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln I7_e Leu Ser Lys Leu ' 16 t aa acagetcct atc agcaaa getataaga caactt 240 aac gat cgtg g A Ile SerLysAsp Ala:IleArg GlnLeu c ArgLeuGlu ThrAlaPro sn 80 t cc aaa getcctcca ctccgg gaactgatt gatcagtat gatgtc 288 a c o LeuArg GluLeuIle Asp~GlnTyr AspVal t P

LeuProLys AlaPror 95 c c gatggc tctttggaa gatgacgat tatcac 336 a cagagggat gacag g L Glu AspAspAsp TyrHis GlnArgAsp AspSerSer AspGly Sereu 100. 105 110 atc attacc atgcctaca gagtctgat ttttta 384 getacaacg gaaaca Il Thr MetProThr GluSerAsp PheLeu AlaThrThr GluThrIle e aa cccaaa tgttgcttc tttaaattt agctct 432 atgcaagtg gatggaa C Phe PheLysPhe SerSer MetGlnVal AspGlyLys ProLys Cysys at aaa gtggta aaggcccaa ctatggata tatttg 480 aaaatacaa taca ValVal LysAlaGln LeuTrpIle TyrLeu LysIleGln TyrAsnLys 160 actcct acaaca gtgtttgtg caaatcctg agactc 528 agaccc gag ThrThr ValPheVal Gln Leu ArgLeu gtc Ile ArgProVal GluThrPro 175 atcaaacct atgaaagac ggtaca tatactgga atccga.tct ctg 576 IleLysPro MetLysAsp Glyagg TyrThrGly IleArgSer Leu 180 Thr 190 Arg aaacttgac atgaaccca ggcactggt atttggcag agcattgat gtg 624 LysLeuAsp MetAsnPro GlyThrGly IleTrpGln.SerIleAsp Val aagacagtg ttgcaaaat tggctcaaa caacctgaa,tccaactta ggc 672 LysThrVal LeuGlnAsn TrpLeuLys GlnProGlu SerAsnLeu Gly attgaaata aaagettta gatgagaat ggtcatgat:cttgetgta acc 720 IleGluIle LysAlaLeu AspGluAsn GlyHisAsp LeuAlaVal Thr ttcccagga ccaggagaa gatgggctg aatccctti~ttagaggtc aag 768 PheProGly ProGlyGlu AspGlyLeu AsnProPhc~LeuGluVal Lys gta.aca gac aca cca aaa aga tcc aga agg gat ttt ggt ctt gac tgt 816 Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Ph~e Gly Leu Asp Cys gat gag cac tca aca gaa tcg cga tgc tgt cgt tac cct cta act gtg 864 Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val gat ttt gaa get ctt gga tgg gat tgg att atc get cct aaa aga tat 912 Asp Phe Glu Ala Leu Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr aag gcc aat tac tgc tct gga gag tgt gaa ttt gta ttt tta caa aaa 960 Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys tat cct cat act cat ctg gta cac caa gca aac ccc aga ggt tca gca 1008 Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala ggccct tgt actccc aagatgtct ccaatt atg tat 1056 Glytgc Cys Thraca LysMetSer Proaat cta Tyr Pro 340 Pro 345 Ile Met Cys Thr Asn Leu tttaat aaa gaacaa atatatggg aaaatt gcc gta 1104 Pheggc Lys Gluata IleTyrGly Lyscca atg Val Asn Gln 360 Ile Ala Gly Ile Pro Met gta gac cgc tgc ggg tgc tca tga Val Asp Arg Cys Gly Cys Ser <210> 19 <211> 375 <212> PRT
<213> Papio hamadryas <400> 19 Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu. Gln Lys Glu Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Thr Tr~> Arg Gln Asn Thr Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln I'le: Leu Ser Lys Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Al<~ Ile Arg Gln Leu Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile As;p Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu Met Gln Val Asp Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Pro Val Glu Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe: Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyi- Pro Leu Thr Val Asp Phe Glu Ala Leu Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Va:l Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Il.e Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 20 <211> 1128 <212> DNA
<213> Bos taurus <220>
<221> CDS
<222> (1)..(1125) <400> 20 atg caa aaa ctg caa tat att 48 atc tct gtt tac cta Met Gln Lys Leu Gln ttt atg Ile Ser Val ctg att 1 5 Tyr Ile Tyr Leu Phe Met Leu Ile gtt get ggc cca gtg ctg gag aac aag gaa aat 96 gat aat agc gag. Lys Glu Asn Val Ala Gly Pro Val Leu cag 30 Asp Asn Glu Asn 20 Ser Glu.
Gln gaa aaa gag ggg ctg tgt gca tgt tgc~ gaa aac act 144 gtg aat ttg agg Glu Asn Thr Val Glu Lys Glu Gly Cys Ala Cys -Leu Asn Leu Trp 35 40 Arg aca tcc tca aga cta gcc aaa atc atc: agt aaa ctt 192 gaa ata caa ctc Ser Lys Leu Thr Ser Ser Arg Leu Ala Lys Ile Ile:
Glu Ile Gln Leu cgc ctg gaa aca get aac agc aaa gct: aga caa ctt 240 cct atc gat atc Arg Gln Leu Arg Leu Glu Thr Ala Asn Ser Lys Ala 80 Pro Ile Asp Ile ttg cce aag get cct ctc gaa ctg gait ttc gat gtc 288 eca ctg att cag Phe Asp Val Leu Pro Lys Ala Pro Leu Glu Leu Asp 95 Pro Leu Ile Gln 85 gp cag aga gat gcc agc gac tcc ttg gac gac tac cac 336 agt ggc gaa gat Asp Tyr His Gln Arg Asp Ala Ser Asp Ser Leu As:p 110 Ser Gly Glu Asp gcc agg acg gaa acg att atg ccc gag gat ctt cta 384 gtc acc acg tct Asp Leu Leu Ala Arg Thr Glu Thr Ile Met Pro Glu Val Thr Thr Ser acg caa gtg gaa gga ccc tgt tgc ttt ttt agc tct 432 aaa aaa ttc aaa Phe Ser Ser Thr Gln Val Glu Gly Pro Cys Cys Ph.e Lys Lys Phe Lys aag ata caa tac aat cta ct:g ata tat ctg 480 aaa gta tgg Ile Tyr Leu Lys.Ile Gln Tyr Asn aag Le:u Lys gcc Trp 160 caa 150 Leu 145 Val Lys Ala Gln agg cct gtc aag act caa ctg aga ctc 528 cct gcg aca gtg atc Leu Arg Leu ttt gtg G7_n 175 Arg Pro Val Lys Thr Ile Pro Ala Thr Val.Phe Val atc aaa ccc atg aaa 576 gac ggt aca agg tat act gga atc cga tct ctg Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr G:Ly Ile Arg Ser Leu aaa ctt gac atg aac 624 cca ggc act ggt att tgg c<~g agc att gat gtg ' 20 Lys Leu Asp Met IleTrp GlnSerIle Asn Pro Gly 205Asp Thr Gly Val aag aca gtg ttg aac tgg ctc caacct gaatcc ttaggc 672 cag aaa GlnPro Gluaac LeuGly Lys Thr Val Leu Asn Trp Leu 220Ser Gln Lys Asn att gaa atc aaa tta gat gag ggccat gatcttget gtaacc 720 get aat GlyHis AspLeuAla ValThr Ile Glu Ile Lys Leu Asp Glu Ala Asn 235 240 ttc cca gaa cca gaa gat gga actcct tttttagaa gtcaag 768 Phe Pro Glu gga ctg ThrPro PheLeuGlu ValLys Pro Glu Asp Gly 250 255 Gly Leu gta aca gac aca aaa aga tct agagat tttgggctt gattgt 816 Val Thr Asp cca agg ArgAsp PheGlyLeu AspCys Thr Lys Arg Ser 270 Pro Arg gat gaa cac tcc gaa tct cga tgtcgt taccctcta actgtg 864 Asp Glu His aca tgc CysArg TyrProLeu ThrVal 275 Ser Glu Ser Arg 285 Thr Cys gat ttt gaa get gga tgg gat attatt gcacctaaa agatat 912 Asp Phe Glu ttt tgg IleIle AlaProLys ArgTyr 290 Ala Gly Trp Asp 300' Phe Trp aag gcc aat tac tct gga gaa gaattt gtatttttg caaaag 960 Lys Ala Asn tgc tgt GluPhe ValPheLeu GlnLys 305 Tyr Ser Gly Glu Cys Cys 315 320 tat cct cat acc ctt gtg cac gcaaac cccagaggt tcagcc 1008 Tyr Pro His cat caa AlaAsn ProArgGly SerAla Thr Leu Val His 330 335 His Gln ggc ccc tgc tgt cct aca aag tct aatatg ctatat 1056 Gly Pro Cys act atg cca : Met LeuTyr Cys Pro Thr Lys att Asn350 Thr Met Ser 340 345 Pro Ile ttt aat ggc gaa gcc gta 1104 Phe Asn Gly gga atg Val 355 caa Ala ata Met ata tac ggg aag att:
cca Glu Gly Gln Ile Ile Tyr Gly Lys Ile:
Pro gta gat cgc tgt 1128 ggg tgt tca tga Val Asp Arg Cys Gly Cys Ser <210> 21 <211> 375 <212> PRT

<213> Bos taurus <400> 21 Met Gln Lys Leu Gln Ile Ser Val Tyr Ile Tyr Leu Phe Met Leu Ile Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Leu Trp Arg Glu Asn Thr Thr Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu so 55 so Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu Leu Pro Lys Ala Pro Pro Leu Leu Glu Leu Ile Asp Gln Phe Asp Val Gln Arg Asp Ala Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His Ala Arg Thr Glu Thr Val Ile Thr Met Pro Thr Glu Ser Asp Leu Leu Thr Gln Val Glu Gly Lys Pro Lys Cys Cys Phe Phe: Lys Phe Ser Ser Lys Ile Gln Tyr Asn Lys Leu Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Pro Val Lys Thr Pro Ala Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly 210 215 22~D
Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His As:p Leu Ala Val Thr Phe Pro Glu Pro Gly Glu Asp Gly Leu Thr Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr f Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Glu Gly Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 22 <211> 1128 <212> DNA
<213> Callus gallus <220>
<221> CDS
<222> (1) . . (1125) <400>
22 ctaca gtctatgtt tatatttac ctc~ttcatg cagatc 48 at caaaag L g Valg Val TyrIleTyr LemPheMet GlnIle l L u Ala Tyr Metn ys e G

gcggttgat ccggtg getctggat ggcagtagt cac~cccaca gagaac 96 -AlaValAsp ProVal AlaLeuAsp GlySerSer GlnProThr GluAsn getgaaaaa gacgga ctgtgcaat gettgtacg tgc~agacag aataca 144 -AlaGluLys AspGly LeuCysAsn AlaCysThr TrpArgGln AsnThr aaatcctcd agaata gaagccata aaaattcaa atcctcagc aaactg 192 LysSerSer ArgIle GluAlaIle LysIleGln IlELeuSer LysLeu cgcctggaa caagca cctaacatt agcagggac gttattaag cagett 240 ArgLeuGlu GlnAla ProAsnIle SerArgAsp Va.lIleLys GlnLeu ttacccaaa getcct ccactgcag gaactgatt gatcagtat gatgtc 288 LeuProLys AlaPro ProLeuGln GluLeuIle As;pGlnTyr AspVal cag tat 336 agg cat gac gac agt agc gat ggc tct ttg gaa gac gat gac Gln Tyr Arg His Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp gcc aca cct acg gatttt 384 aca atg gag ctt acc tct gag acg att atc Ala Thr Pro Thr Ser AspPhe Thr Met Glu Leu Thr Glu Thr Ile Ile gtacaa aaa tgc ttctttaag tttagc 432 atg tgt tct gag gga aaa cca Val Lys Cys PhePheLys PheSer Ser Gln Cys Met Glu Gly Lys Pro aaaata tat aacaaa gta gca caattatgg atatac ttg 480 caa gta aag LysIle Tyr Lys Val Ala GlnLeuTrp IleTyr Leu Gln Asn Val Lys aggcaa caa aaacct acg ttt gtgcagatc ctgaga ctc 528 gtc aca gtg ArgGln Gln LysPro Thr Phe ValGlnIle LeuArg Leu Val Thr Val attaag atg aaagac aca tat actggaatt cgatct ttg 576 ccc ggt aga IleLys Met LysAsp Thr Tyr ThrGlyIle ArgSer Leu Pro Gly Arg aaactt atg aaccca act atc tggcagagt attgat gtg 624 gac ggc ggt LysLeu Met AsnPro Thr Ile TrpGln.Ser IieAsp Val Asp Gly Gly aagaca ctg caaaat ctc cag cctgaa.tcc aattta ggc 672 gtg tgg aaa LysThr Leu GlnAsn Leu Gln ProGluSer AsnLeu Gly Val Trp Lys atcgaa aaa getttt gag gga cgagat;ctt getgtc aca 720 ata gat act IleGlu Lys AlaPhe Glu Gly ArgAsF>Leu AlaVal Thr Ile Asp Thr ttccca ccg ggtgaa gga aac ccattt:tta gaggtc aga 768 gga gat ttg PhePro Pro GlyGlu Gly Asn ProPhe:Leu GluVal Arg Gly Asp Leu gttaca aca ccgaaa tcc aga gatttt~ggc cttgac tgt 816 gac cgg cgc ValThr Thr ProLys Ser Arg AspPh<sGly LeuAsp Cys Asp Arg Arg gatgag tca acggaa cga tgt cgctacccg ctg gtg 864 cac tcc tgt aca AspGlu Ser ThrGlu Arg Cys ArgTy:rPro Leu Val His Ser Cys Thr gatttc get tttgga gac att atagc.acet aaa tac 912 gaa tgg tgg aga AspPhe Ala PheGly Asp Ile IleAl~aPro Lys Tyr Glu Trp Trp Arg aaagcc tac tgctcc gaa gbgttt aaa 960 aat gga ttt cta gaa cag tgc LysAla Tyr CysSer Glu ValPhe Lys Asn Gly Phe Leu Glu Gln Cys tacccg act cacctg ccc gca 1008 cac gta aga cac ggc caa tca gca aat Tyr Thr HisLeu Ala Pro Val His His Gln Ala Asn Pro Arg Gly Ser ' 24 ggc cct tgc tgc aca ccc acc aag atg tcc cct ata aac atg ctg tat 1056 Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr ttc aat gga aaa gaa caa ata ata tat gga aag ata cca gcc atg gtt 1104 Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val gta gat cgt tgc ggg tgc tca tga 1128 Val Asp Arg Cys Gly Cys Ser <210> 23 <211> 375 <212> PRT
<213> Callus gallus <400> 23 Met Gln Lys Leu Ala Val Tyr Val Tyr Ile Tyr Leu Phe Met Gln Ile Ala Val Asp Pro Val Ala Leu Asp Gly Ser Ser Gln. Pro Thr Glu Asn Ala Glu Lys Asp Gly Leu Cys Asn Ala Cys Thr Trp~ Arg Gln Asn Thr Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile: Leu Ser Lys Leu Arg Leu Glu Gln Ala Pro Asn Ile Ser Arg Asp Val. Ile Lys Gln Leu Leu Pro Lys Ala Pro Pro Leu Gln Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu Val Gln Met Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser 13 0 13 5 14 ~D
Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Gln Val Gln Lys Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu. Ser Asn Leu Gly Ile Glu Ile Lys Ala Phe Asp Glu Thr Giy Arg Asp Leu Ala Val Thr Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe: Leu Glu Val Arg Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe: Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Va:L Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Il~e Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 24 <211> 1131 <212> DNA
<213> Rattus norvegiCUs Y

<220>

<221>
CDS

<222> (1128) (1)..

<400>
24 aaa caaatg tat tat atttacctg tttgtgctg 48 tt cc gtt atga caa g MetIle Lys ProGlnMet Tyr Tyr IleTyr PheValLeu Gln Val Leu attget getggc ccagtggat ctaaatgag gacagtgag agagaggcg 96 IleAla AlaGly ProValAsp Leu Glu AspSerGlu ArgGluAla Asn aatgtg gaaaaa gaggggctg tgtaatgcg tgtgcgtgg agacaaaac 144 AsnVal GluLys GluGlyLeu CysAsnAla CysAlaTrp ArgGlnAsn acaagg tactcc agaatagaa gccataaaa attcaaatc ctcagtaaa 192 ThrArg TyrSer ArgIleGlu AlaIleLys IleGlnIle LeuSerLys ctccgc ctggaa acagcgcct aacatcagc aaagatget ataagacaa 240 LeuArg LeuGlu ThrAlaPro AsnIleSer LysAspAla IleArgGln cttctg cccaga gcgcctcca ctccgggaa ctgatcgat cagtacgac 288 LeuLeu ProArg AlaProPro LeuArgGlu LeuIleAsp GlnTyrAsp gtccag agggat gacagcagt gacggctct ttggaagat gacgattat 336 ValGln ArgAsp AspSerSer AspGlySer LeuGluAsp AspAspTyr cacget accacg gaaacaatc attaccatg cctacc:gag tctgacttt 384 HisAla ThrThr GluThrIle IleThrMet ProThrGlu SerAspPhe ctaatg caagcg gatggaaag cccaaatgt tgcttt:ttt aaatttagc 432 LeuMet GlnAla AspGlyLys ProLysCys CysPhe:Phe LysPheSer tctaaa atacag tacaacaaa gtggtaaag gcccac~ctg tggatatat 480 SerLys IleGln TyrAsnLys ValValLys AlaGlnLeu TrpIleTyr ctgaga gccgtc aagactcct acaacagtg tttgtc~caa atcctgaga 528 LeuArg AlaVal LysThrPro ThrThrVal PheVa7LGln IleLeuArg ctcatc aaaccc atgaaagac ggtacaagg tatacc:gga atccgatct 576 LeuIle LysPro MetLysAsp GlyThrArg TyrTh~_~Gly IleArgSer ct aaa cttgac atgagccca ggcactggt atttggcag agtattgat 624 g LeuLys LeuAsp MetSerPro GlyThrGly IleTrpGln SerIleAsp gtg acagtg ttgcaa tggctcaaa cag gaa tcc tta 672 aag aat cc't aac ValLys Thr LeuGln TrpLeuLys Gln Glu Ser Leu Val Asn Pro Asn ' ~ 27 ggcatt gaaatcaaa getttggat gagaatggg catgat cttgetgta 720 GlyIle GluIleLys AlaLeuAsp GluAsnGly HisAsp LeuAlaVal accttc ccaggacca ggagaagat gggctgaat cccttt ttagaagtc 768 ThrPhe ProGlyPro GlyGluAsp GIyLeuAsn ProPhe LeuGluVal aaagta acagacaca cccaagagg tcccggaga gacttt gggcttgac 816 LysVal ThrAspThr ProLysArg SerArgArg AspPhe GlyLeuAsp tgtgat gaacactcc acggaatcg cggtgctgt cgctac cccctcacg 864 CysAsp GluHisSer ThrGluSer ArgCysCys ArgTyr ProLeuThr gtcgat ttcgaagcc tttggatgg gactggatt attgca cccaaaaga 912 ValAsp PheGluAla PheGlyTrp AspTrpIle IleAla ProLysArg tataag getaattac tgctctgga gagtgtgaa ttt.gtg ttcttacaa 960 TyrLys AlaAsnTyr CysSerGly GluCysGlu Phe:Val PheLeuGln aaatat ccgcatact catcttgtg caccaagca aac:ccc agaggctcg 1008 LysTyr ProHisThr HisLeuVal HisGlnAla AsnPro ArgGlySer gcaggc ccttgctgc acgccaaca aaaatgtct ccc;att aatatgcta 1056 AlaGly ProCysCys ThrProThr LysMetSer ProIle AsnMetLeu tatttt aatggcaaa gaacaaata atatatggg aaaatt ccagccatg 1104 TyrPhe AsnGlyLys GluGlnIle IleTyrGly LysIle ProAlaMet gtagta gaccggtgt gggtgctcg tga 1131 ValVal AspArgCys GlyCysSer <210> 25 <211> 376 <212> PRT

<213> Rattus gicus norve <400> 25 Met Ile Gln Lys Pro Gln Met Tyr Val Tyr Ile Tyr Leu Phe Val Leu Ile Ala Ala Gly Pro Val Asp Leu Asn Glu Asp Ser Glu Arg Glu Ala Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Ala Trp Arg G1n Asn Thr Arg Tyr Ser Arg Ile Glu Ala Ile Lys Ile Gl.n Ile Leu Ser Lys Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu Leu Pro Arg Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu Met Gln Ala Asp Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Ala Val Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Ser Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly Hi~~ Asp Leu Ala Val Thr Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg_ Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg ~ ' 29 Tyr Lys Ala Asn Tyr Cys Ser Giy Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser 325 ~ 330 335 Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 26 <211> 1128 <212> DNA
<213> Meleagris gallopavo <220>
<221> CDS
<222> (1) . . (1125) <400>

atgcaaaag ctagcagtc tatgtt tatatttac ctgttcatg cagatt 48 MetGlnLys LeuAlaVal TyrVal TyrIleTyr LeuPheMet GlnIle ttagttcat ccggtgget cttgat ggcagtagt cagcccaca gagaac 96 LeuValHis ProValAla LeuAsp GlySerSer GlnProThr GluAsn getgaaaaa gacggactg tgcaat gettgcacg tggagacag aatact 144 AlaGluLys AspGlyLeu CysAsn AlaCysThr TrpArgGln AsnThr aaatcctcc agaatagaa gccata aaaattcaa atcctcagc aaactg 192 LysSerSer ArgIleGlu AlaIle LysIleGin IleLeuSer LysLeu cgcctggaa caagcacct aacatt agcagggac gttattaaa caactt 240 ArgLeuGlu GlnAlaPro AsnIle SerArgAsp ValIleLys GlnLeu ttacccaaa getcctccg ctgcag gaactgatt gatcagtat gacgtc 288 LeuProLys AlaProPro LeuGln GluLeuIle AspGlnTyr AspVal cagagagac gacagtagc gatggc tctttggaa gacgatgac tatcat 336 GlnArgAsp AspSerSer AspGly SerLeuGlu AspAspAsp TyrHis gccacaacc gaaacgatt atcaca atgcctacg gac~tatgat tttctt 384 Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu gta atg aaacca aaatgttgc tttaag tttagctct 432 caa gag ttc gga Val Met LysPro LysCysCys PhePheLys PheSerSer Gln Glu Gly aaa atacaatat aacaaagta gtaaaggca caattatgg atatacttg 480 Lys IleGlnTyr AsnLysVal ValLysAla GlnLeuTrp IleTyrLeu agg caagtccaa aaacctaca acggtgttt gtgcagatc ctgagactc 528 Arg GlnValGln LysProThr ThrValPhe ValGlnIle LeuArgLeu att aaacccatg aaagacggt acaagatat actggaatt cgatctttg 576 Ile LysProMet LysAspGly ThrArgTyr ThrGlyIle ArgSerLeu ~

aaa cttgacatg aacccaggc actggtatc tggcagagt attgatgtg 624 Lys LeuAspMet AsnProGly ThrGlyIle TrpGlnSer IleAspVal aag acagtgttg caaaattgg ctcaaacag cctgaatcc aatttaggc 672 Lys ThrValLeu GlnAsnTrp LeuLysGln ProGluSer AsnLeuGly ate gaaataaaa gettttgat gagaatgga cgagatctt getgtaaca 720 Ile GluIleLys AlaPheAsp GluAsnGly ArgAspLeu AlaValThr ttc ccaggacca ggtgaagat ggactgaac ccattttta gaggtcaga 768 Phe ProGlyPro GlyGluAsp GlyLeuAsn ProPheLeu GluValArg gtt acagacaca ccaaaacgg tcccgcaga gattttggc cttgactgc 816 Val ThrAspThr ProLysArg SerArgArg AspPhe;Gly LeuAspCys gac gagcactca acggaatct cgatgttgt cgctacoccg ctgacagtg 864 Asp GluHisSer ThrGluSer ArgCysCys ArgTyrPro LeuThrVal gat tttgaaget tttggatgg gactggatt atagCc'LCCt aaaagatac 912 Asp PheGluAla PheGlyTrp AspTrpIle IleAlaPro LysArgTyr aaa gccaattac tgctctgga gaatgtgaa ttcgtattt ctacagaaa 960 Lys AlaAsnTyr CysSerGly GluCysGlu PheVa7LPhe LeuGlnLys tac ccgcacact cacctggta caccaagca aatcca~aga ggctcagca 1008 Tyr ProHisThr HisLeuVal HisGlnAla AsnProArg SerAla Gly ggc ccttgctgc aca acc aagatg cctata ctg 1056 ccc tcc aac tat atg Gly Cys Thr Thr LysMetSer ProIle Leu Pro Pro Asn Tyr Cys Met ttc aat aaa ata tat aag atg 1104 gga gaa ata gga at;a gtt caa cca gcc Phe Glu Ile Tyr Il~
Asn Gln Ile Gly Pro Gly Lys Ala Lys Met Val gta gat cgt tgc ggg tgc tca tga 1128 Val Asp Arg Cys Gly Cys Ser <210> 27 <211> 375 <212> PRT
<213> Meleagris gallopavo <400> 27 Met Gln Lys Leu Ala Val Tyr Val Tyr Ile Tyr Leu Phe Met Gln Ile 1 5 lp 15 Leu Val His Pro Val Ala Leu Asp Gly Ser Ser Gln Pro Thr Glu Asn Ala Glu Lys Asp Gly Leu Cys Asn Ala Cys Thr Trp Arg Gln Asn Thr Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu Arg Leu Glu Gln Ala Pro Asn Ile Ser Arg Asp Val Ile Lys Gln Leu Leu Pro Lys Ala Pro Pro Leu Gln Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu Val Gln Met Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu. Trp Ile Tyr Leu Arg Gln Val Gln Lys Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu IIe Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys Ala Phe Asp Glu Asn Gly Arg Asp Leu Ala Val Thr Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Arg Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile: Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile: Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 28 <211> 1128 <212> DNA
<213> Sus scrofa <220>
<221> CDS
<222> (1) . . (1125) <400> 28 atg caa aaa ctg caa atc tat gtt tat att tac ctg ttt atg ctg att 48 Met Gln Lys Leu Gln Ile Tyr Val Tyr Ile Tyr Leu Phe Met Leu Ile _-___. .--.-__ _... _ ' ' 33 gttgetggt ccc gatctgaat gagaacagc gagcaaaag gaaaat 96 gtg ValAlaGly Pro AspLeuAsn GluAsnSer GluGlnLys GluAsn Val gtggaaaaa gagggg ctgtgtaat gcatgtatg tggagacaa aacact 144 ValGluLys GluGly LeuCysAsn AlaCysMet TrpArgGln AsnThr aaatcttca agacta gaagccata aaaattcaa atcctcagt aaactt 192 LysSerSer ArgLeu GluAlaIle LysIleGln IleLeuSer LysLeu cgcctggaa acaget cctaacatt agcaaagat getataaga caactt 240 ArgLeuGlu ThrAla ProAsnIle SerLysAsp AlaIleArg GlnLeu ttgcccaaa getcct ccactccgg gaactgatt gatcagtac gatgtc 288 LeuProLys AlaPro ProLeuArg GluLeuIle AspGlnTyr AspVal cagagagat gacagc agtgatggc tccttggaa gatgatgat tatcac 336 GlnArgAsp AspSer SerAspGly SerLeuGlu AspAspAsp TyrHis getacgacg gaaacg atcattacc atgcctaca gagtctgat cttcta 384 AlaThrThr GluThr IleIleThr MetProThr GluSerAsp LeuLeu atgcaagtg gaagga aaacccaaa tgctgcttc tttaaattt agctct 432 MetGlnVal GluGly LysProLys CysCysPhe PheLysPhe SerSer aaaatacaa tacaat aaagtagta aaggcccaa ctgtggata tatctg 480 LysIleGln TyrAsn LysValVal LysAlaGln LeuTrpIle TyrLeu agacccgtc aagact cctacaaca gtgtttgtg caaatcctg agactc 528 ArgProVal LysThr ProThrThr ValPheVal GlnIleLeu ArgLeu atcaaaccc atgaaa gacggtaca aggtatact ggaatccga tctctg 576 IleLysPro MetLys AspGlyThr ArgTyrThr GlyIleArg SerLeu aaacttgac atgaac ccaggcact ggtatttgg cagagcatt gatgtg 624 LysLeuAsp MetAsn ProGlyThr GlyIleTrp GlnSerIle AspVal aagacagtg ttgcaa aattggctc aaacaacct gaatccaac ttaggc 672 LysThrVal LeuGln AsnTrpLeu LysGlnPro GluSerAsn LeuGly attgaaatc aaaget ttagatgag aatggtcat gatcttget gtaacc 720 IleGluIle LysAla LeuAspGlu AsnGlyHis AspLeuAla ValThr ttcccagga ccagga gaagatggg ctgaatccc ttt.ttagaa gtcaag 768 Phe Gly Gly GIuAspGly AsnPro LeuGlu Lys Pro Pro Leu Phe: Val ' v 34 gtaaca gacacacca aaaagatcc aggagagat tttggactc gactgt 816 ValThr AspThrPro LysArgSer ArgArgAsp PheGlyLeu AspCys gatgag cactcaaca gaatctcga tgctgtcgt taccctcta actgtg 864 AspGlu HisSerThr GluSerArg CysCysArg TyrProLeu ThrVal gatttt gaagetttt ggatgggac tggattatt gcacccaaa agatat 912 AspPhe GluAlaPhe GlyTrpAsp TrpIleIle AlaProLys ArgTyr aaggcc aattactgc tctggagag tgtgaattt gtattttta caaaaa 960 LysAla AsnTyrCys SerGlyGlu CysGluPhe ValPheLeu GlnLys taccct cacactcat cttgtgcac caagcaaac cccagaggt tcagca 1008 TyrPro HisThrHis LeuValHis GlnAlaAsn ProArgGly SerAla ggcccc tgctgtact cccacaaag atgtctcca atcaatatg ctatat 1056 GlyPro CysCysThr ProThrLys MetSerPro IleAsnMet LeuTyr tttaat ggcaaagaa caaataata tatgggaaa attccagcc atggta 1104 PheAsn GlyLysGlu GlnIleIle TyrGlyLys IleProAla MetVal gtagat cgctgtggg tgctcatga 1128 ValAsp ArgCysGly CysSer <210> 29 <211> 375 <212> PRT

<213> Susscrofa <400> 29 Met Gln Lys Leu Gln Ile Tyr Val Tyr Ile Tyr Leu Phe Met Leu Ile Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Met Trp Arg Gln Asn Thr Lys Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala. Ile Arg Gln Leu Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Leu Leu Met Gln Val Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Pro Val Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Gly Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val_ Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala -.____..~~,~., ka..~.~---- - _~..

' ~ 36 Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 30 <211> 1128 <212> DNA
<213> Ovis aries <220>
<221> CDS
<222> (1) . . (1125) <400>

atgcaaaaa ctgcaa atctttgtt tatatttac ctatttatg ctgctt 48 MetGlnLys LeuGln IlePheVal TyrIleTyr LeuPheMet LeuLeu gt getggc ccagtg gatctgaat gagaacagc gac~cagaag gaaaat 96 t ValAlaGly ProVal AspLeuAsn GluAsnSer GluGlnys GluAsn L

gtggaaaaa aagggg ctgtgtaat gcatgcttg tg<~agacaa aacaat 144 ValGluLys LysGly LeuCysAsn AlaCysLeu TrpArgGln AsnAsn 35 40 ~ 45 aaatcctca agacta gaagccata aaaatccaa atcctcagt aagctt 192 LysSerSer ArgLeu GluAlaIle LysIleGln I1<:LeuSer LysLeu cg ctggaa acaget cctaacatc agcaaagat getataaga caactt 240 c ArgLeuGlu ThrAla ProAsnIle SerLysAsp AlaIleArg GlnLeu ttgcccaag getcct ccactccgg gaactgatt gatcagtac gatgtc 288 LeuProLys AlaPro ProLeuArg GluLeuIle AspGlnTyr AspVal cagagagat gacagc agcgacggc tccttggaa gacgatgac taccac 336 GlnArgAsp AspSer SerAspGly SerLeuGlu As;pAspAsp TyrHis gttacgacg gaaacg gtcattacc atgcccacg gagtctgat cttcta 384 ValThrThr GluThr ValIleThr MetProThr GluSerAsp LeuLeu gcagaagtg caagaa aaacccaaa tgttgcttc tttaaattt agctct 432 AlaGluVal GlnGlu LysProLys CysCysPhe PheLysPhe SerSer __-- _~_ _ __ I

aag aaa caactgtgg atatatctg 480 ata gta caa gta cac aag aat gcc Lys Lys Leu IleTyrLeu Ile Vai Trp Gln Val His Lys Asn Ala Gln aag cct aca ttt gtgcaaatc ctgagactc 528 act aca gtg a cct gtc a _ Pro Thr Phe ValGlnIle LeuArgLeu g Thr Val Arg Pro Val Lys Thr atcaaa ccc gac aca tat actggaatc cgatctctg 576 atg aaa ggt agg IleLys Pro Asp Thr Tyr ThrGlyIle ArgSerLeu Met Lys G1y Arg aaactt gac aaccca act att tggcagagc attgatgtg 624 atg ggc ggt LysLeu Asp AsnPro Thr Ile TrpGlnSer IleAspVal Met Gly Gly aagaca gtg caaaac ctc caa cctgaatcc aacttaggc 672 ttg tgg aaa LysThr Val GlnAsn Leu Gln ProGluSer AsnLeuGly Leu Trp Lys attgaa atc gettta gag ggt catgatctt getgtaacc 720 aaa gat aat IleGlu Ile AlaLeu Glu Gly HisAspLeu AlaValThr Lys Asp Asn ttccca gaa ggagaa gga aat cctttttta gaagtcaag 768 cca gaa ctg PhePro Glu GlyGlu Gly Asn ProPheLeu GluValLys Pro Glu Leu gtaaca gac ccaaaa tct aga gattttggg cttgattgt 816 aca aga agg ValThr Asp ProLys Ser Arg AspPheGly LeuAspCys Thr Arg Arg gatgag cac acagaa cga tgt cgttaccct ctaactgtg 864 tcc tct tgc AspGlu His ThrGlu Arg Cys ArgTyrPro LeuThrVal Ser Ser Cys gatttt gaa tttgga gat att attgca,cct aaaagatat 912 get tgg tgg AspPhe Glu PheGly Asp Ile IleAla.Pro LysArgTyr Ala Trp Trp 0~

aaggcc aat tgctct gaa gaa tttttattt ttgcaaaag 960 tac gga tgt LysAla Asn CysSer Glu Glu PheLeuPhe LeuGlnLys Tyr Gly Cys tatcct cat catctt cac gca aacccc;aaa ggttcagcc 1008 acc gtg caa TyrPro His HisLeu His Ala Asn Lys GlySerAla Thr Val Gln Pro c cct tgc act aag tct cca aat atgcta 1056 tgt cct atg att: tat aca gg Pro Cys Thr Lys Ser Pro Asn Leu GlyCys Pro Met Ile: Met Tyr Thr tttaat ggc gaa ata ggg cca atg 1104 aaa caa tat aag ggc gta ata att PheAsn Gly Glu Ile Pro Lys Gln Tyr Gly Ile Gly Met Lys Val Ile gta ggg 1128 gat tgc cgc tca tgt tga Val Gly Asp Cys Arg Ser Cys <210> 31 <211> 375 <212> PRT
<213> Ovis aries <400> 31 Met Gln Lys Leu Gln Ile Phe Val Tyr Ile Tyr Leu Phe Met Leu Leu Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn Val Glu Lys Lys Gly Leu Cys Asn Ala Cys Leu Trp Arg Gln Asn Asn Lys Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His Val Thr Thr Glu Thr Val Ile Thr Met Pro Thr Glu Ser Asp Leu Leu Ala Glu Val Gln Glu Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser Lys Ile Gln His Asn Lys Val Val Lys Ala Gln Leu. Trp Ile Tyr Leu Arg Pro Val Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val lg5 200 205 Lys Thr Val Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly r ' 39 Ile Glu Ile Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Glu Pro Gly Glu Glu Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Leu Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Lys Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Gly Met Val Val Asp Arg Cys Gly Cys Ser <210> 32 <211> 480 <212> DNA
<213> Rattus norvegicus <220>
<221> CDS
<222> (1) . . (390) <400> 32 gaa gat ggg ctg aat ccc ttt tta gaa gtc aaa gta. aca gac aca ccc 48 Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val. Thr Asp Thr Pro aag agg tcc cgg aga gac ttt ggg ctt gac tgt gat: gaa cac tcc acg 96 Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr gaa tcg cgg tgc tgt cgc tac ccc ctc acg gtc gat: ttc gaa gcc ttt 144 GluSerArg CysCysArg TyrProLeu ThrValAsp PheGluAla Phe a tgggac tggattatt gcacccaaa agatataag getaattac tgc 192 gg TrpAsp TrpIleIle AlaProLys ArgTyrLys AlaAsnTyr Cys Gly tctggagag tgtgaattt gtgttctta caaaaatat ccgcatact cat 240 SerGlyGlu CysGluPhe ValPheLeu GlnLysTyr ProHisThr His cttgtgcac caagcaaac cccagaggc tcggcaggc ccttgctgc acg 288 LeuValHis GlnAlaAsn ProArgGly SerAlaGly ProCysCys Thr ccaacaaaa atgtctccc attaatatg ctatatttt aatggcaaa gaa 336 ProThrLys MetSerPro IleAsnMet LeuTyrPhe AsnGlyLys Glu caaataata tatgggaaa attccagcc atggtagta gaccggtgt ggg 384 GlnIleIle TyrGlyLys IleProAla MetValVal AspArgCys Gly tgctcgtga gctttgcattagctt ta tccca ggaaggtcttcccc 440 aaatt aatcgt.

CysSer tcgatttcga aactgtgaat tatgtacca 480 t caggctgtag <210> 33 <211> 130 <212> PRT

<213> Rattus norvegicus <400> 33 Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Va:l Thr Asp Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val As:p Phe Glu Ala Phe Gly.Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gl.y Pro Cys Cys Thr Y
° 41 Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser <210> 34 <211> 790 <212> DNA
<213> Gallus gallus <220>
<221> CDS
<222> (1) . . (678) <400>

ttagtagta aaggca caattatgg atatacttg aggfcaagtc caaaaa 48 LeuValVal LysAla GlnLeuTrp IleTyrLeu Aro~GlnVal GlnLys cctacaacg gtgttt gtgcagatc ctgagactc att;aagccc atgaaa 96 ProThrThr ValPhe ValGlnIle LeuArgLeu Ile:LysPro MetLys gacggtaca agatat actggaatt ggatctttg aaacttgac atgaac 144 AspGlyThr ArgTyr ThrGlyIle GlySerLeu Ly:>LeuAsp MetAsn 35 40 ' 45 ccaggcact ggtatc tggcagagt attgatgtg aac~acagtg ctgcaa 192 -ProGlyThr GlyIle TrpGlnSer IleAspVal Ly:~ThrVal LeuGln aattggctc aaacag cctgaatcc aatttaggc atcgaaata aaaget 240 AsnTrpLeu LysGln ProGluSer AsnLeuGly Ile:GluIle LysAla tttgatgag actgga cgagatett getgtcaca ttcccagga ccgggt 288 PheAspGlu ThrGly ArgAspLeu AlaValThr PheProGly ProGly gaagatgga ttgaac ccattttta gaggtcaga gtttacagac acaccg 336 GluAspGly LeuAsn ProPheLeu GluValArg Va.1ThrAsp ThrPro aaacggtcc cgcaga gattttggc cttgactgt gatgagcac tcaacg 384 LysArgSer ArgArg AspPheGly LeuAspCys As;pGluHis SerThr gaatcccga tgttgt cgctacccg ctgacagtg gatttcgaa getttt 432 GluSerArg CysCys ArgTyrPro LeuThrVal As;pPheGlu AlaPhe ggatgggac tggatt atagcacct aaaagatac aaagccaat tactgc 480 GlyTrpAsp TrpIle IleAlaPro LysArgTyr LysAlaAsn TyrCys P
d tccggagaatgc gaatttgtg tttctacag aaatac ccgcacact cac 528 SerGlyGluCys GluPheVal PheLeuGln LysTyr ProHisThr His ctggtacaccaa gcaaatccc agaggctca gcaggc ccttgctgc aca 576 LeuValHisGln AlaAsnPro ArgGlySer AlaGly ProCys.CysThr cccaccaagatg tcccctata aacatgctg tatttc aatggaaaa gaa 624 ProThrLysMet SerProIle AsnMetLeu TyrPhe AsnGlyLys Glu caaataatatat ggaaagata ccagccatg gttgta gatcgttgc ggg 672 GlnIleIleTyr GlyLysI1e ProAlaMet ValVal AspArgCys Gly tgctcatgaggctgtc gtgagatcca gccaccaaaa 728 ccattcgata aattgtc~gaa _ CysSer aaaaaagcta tatcccct ca attacgtacg etaggcattg tccatctttg aaactgtgaa cc <210> 35 <211> 226 <212> PRT
<213> Gallus gallus <400> 35 Leu Val Val Lys Ala Gln Leu Trp Ile Tyr Leu Arg Gln Val Gln Lys Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Gly Ser Leu Lys Leu Asp Met Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu Gln Asn.Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys Ala Phe Asp Glu Thr Gly Arg Asp Leu Ala Val Thr Phe Pro Gly Pro Gly g5 g0 95 Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Arg Val Thr Asp Thr Pro _-._~.__._ ~* _. r_ ' ~ 43 Lys Arg Ser Arg Arg Asp Phe Giy Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe: Asn Gly Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Va7L Asp Arg Cys Gly Cys Ser <210> 36 <211> 123 <212> PRT
<213> Homo Sapiens <400> 36 Arg Pro Arg Arg Asp Ala Glu Pro Val Leu Gly Gly Gly Pro Gly Gly Ala Cys Arg Ala Arg Arg Leu Tyr Val Ser Phe Arg Glu Val Gly Trp His Arg Trp Val Ile Ala Pro Arg Gly Phe Leu Ala Asn Tyr Cys Gln Gly Gln Cys Ala Leu Pro Val Ala Leu Ser Gly Ser Gly Gly Pro Pro Ala Leu Asn His Ala Val Leu Arg Ala Leu Met His Ala Ala Ala Pro Gly Ala Ala Asp Leu Pro Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Val Leu Phe Phe Asp Asn Ser Asp Asn Val Val Leu Arg Gln Tyr Glu Asp Met Val Val Asp Glu Cys Gly Cys Arg <210> 37 <211> 118 <212> PRT
<213> Homo Sapiens <400> 37 Arg Glu Lys Arg Gln Ala Lys His Lys Gln Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala. Pro Pro Gly Tyr His Ala Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Ser Lys Ile Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala Ile Ser Met Leu Tyr Leu Asp Glu Asn Glu Lys Val Val Leu Lys Asn Tyr Gln Asp Met Val Val Glu Gly Cys Gly Cys Arg <210> 38 <211> 118 <212> PRT
<213> Homo sapiens <400> 38 Lys Arg Ser Pro Lys His His Ser Gln Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr Gln Ala. Phe Tyr Cys His Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Sex' Ser Ile Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala Ile Sex: Met Leu Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gln Glu Met Val Val Glu Gly Cys Gly Cys Arg <210> 39 <211> 119 <212> PRT
<2I3> Homo Sapiens <400> 39 Ser Arg Gly Ser Gly Ser Ser Asp Tyr Asn Gly Ser Glu Leu Lys Thr Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Gln Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Pro Lys Gly Tyr Ala Ala Asn Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His Ala Ile Val Gln Thr Leu Val His Leu Met Asn Pro Glu Tyr Val Pro Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala Ile Ser Val Leu Tyr Phe Asp Asp Asn Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ala Cys Gly Cys His <210> 40 <211> 119 <212> PRT
<213> Homo Sapiens <400> 40 Leu Arg Met Ala Asn Val Ala Glu Asn Ser Ser Ser Asp Gln Arg Gln Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Ar<~ Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Pro Glu Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly Glu Cys Ala Phe Pro Leu Asn Ser Tyr Met Assn Ala Thr Asn His Ala Ile Val Gln Thr Leu Val His Phe Ile Asn Pro Glu Thr Val Pro Lys Pro Cys Cys Ala Pro Thr Gln Leu Asn Ala Ile Ser Val Leu Tyr Phe Asp Asp Ser Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Val r Val Arg Ala Cys Gly Cys His <210> 41 <211> 119 <212> PRT
<213> Homo Sapiens <400> 41 Ser Arg Met Ser Ser Val Gly Asp Tyr Asn Thr Ser Glu Gln Lys Gln Ala Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Pro Glu Gly Tyr Ala Ala Phe Tyr Cys Asp Gly Glu Cys Ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His Ala Ile Val Gln Thr Leu Val His Leu Met Phe Pro Asp His Val Pro Lys Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala Ile Ser Val Leu Tyr Phe Asp Asp Ser Ser Asn Val Ile Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ser Cys Gly Cys His <210> 42 <211> 120 <212> PRT
<213> Homo Sapiens <400> 42 Glu Gln Thr Leu Lys Lys Ala Arg Arg Lys Gln Trp Ile Glu Pro Arg 1 5 . 10 15 Asn Cys Ala Arg Arg Tyr Leu Lys Val Asp Phe Ala Asp Ile Gly Trp Ser Glu Trp Ile Ile Ser Pro Lys Ser Phe Asp Ala Tyr Tyr Cys Ser Gly Ala Cys Gln Phe Pro Met Pro Lys Ser Leu Ly,a Pro Ser Asn His Ala Thr Ile Gln Ser Ile Val Arg Ala Val Gly Val Val Pro Gly Ile Pro Glu Pro Cys Cys Val Pro Glu Lys Met Ser Ser Leu Ser Ile Leu Phe Phe Asp Glu Asn Lys Asn Val Val Leu Lys Val Tyr Pro Asn Met i r Thr Val Glu Ser Cys Ala Cys Arg <210> 43 <211> 116 <212> PRT
<213> Homo Sapiens <400> 43 G1y Pro Gly Arg Ala Gln Arg Ser Ala Gly Ala Thr Ala Ala Asp Gly Pro Cys Ala Leu Arg Glu Leu Ser Val Asp Leu Arg Ala Glu Arg Ser Val Leu Ile Pro Glu Thr Tyr Gln Ala Asn Asn Cys Gln Gly Val Cys Gly Trp Pro Gln Ser Asp Arg Asn Pro Arg Tyr Gly Asn His Val Val Leu Leu Leu Lys Met Gln Ala Arg Gly Ala Ala Leu Ala Arg Pro Pro Cys Cys Val Pro Thr Ala Tyr Ala Gly Lys Leu Leu Ile Ser Leu Ser Glu Glu Arg Ile Ser Ala His His Val Pro Asn Met Val Ala Thr Glu Cys Gly Cys Arg <210> 44 <211> 122 <212> PRT
<213> Homo Sapiens <400> 44 Ala Leu Arg Leu Leu Gln Arg Pro Pro Glu Glu Pro Ala Ala His Ala Asn Cys His Arg Val Ala Leu Asn Ile Ser Phe Gln Glu Leu Gly Trp Glu Arg Trp Ile Val Tyr Pro Pro Ser Phe Ile Phe His Tyr Cys His Gly Gly Cys Gly Leu His Ile Pro Pro Asn Leu Ser Leu Pro Val Pro Gly Ala Pro Pro Thr Pro Ala Gln Pro Tyr Ser Leu Leu Pro Gly Ala Gln Pro Cys Cys Ala Ala Leu Pro Gly Thr Met Arg Pro Leu His Val w Arg Thr Thr Ser Asp Gly Gly Tyr Ser Phe Lys Tyr Glu Thr Val Pro Asn Leu Leu Thr Gln His Cys Aia Cys Ile <210> 45 <211> 122 <212> PRT
<213> Homo Sapiens <400> 45 His Arg Arg Arg Arg Arg Gly Leu Glu Cys Asp Gly Lys Val Asn Ile Cys Cys Lys Lys Gln Phe Phe Val Ser Phe Lys Asp Ile Gly Trp Asn Asp Trp Ile Ile Ala Pro Ser Gly Tyr His Ala Asn. Tyr Cys Glu Gly Glu Cys Pro Ser His Ile Ala Gly Thr Ser Gly Ser Ser Leu Ser Phe His Ser Thr Val Ile Asn His Tyr Arg Met Arg Gly His Ser Pro Phe Ala Asn Leu Lys Ser Cys Cys Val Pro Thr Lys Leu Arg Pro Met Ser Met Leu Tyr Tyr Asp Asp Gly Gln Asn Ile Ile Lys Lys Asp Ile Gln Asn Met Ile VaT Glu Glu Cys Gly Cys Ser <210> 46 <211> 121 <212> PRT
<213> Homo Sapiens <400> 46 His Arg Ile Arg Lys Arg Gly Leu Glu Cys Asp G1~~ Arg Thr Asn Leu Cys Cys Arg Gln Gln Phe Phe Ile Asp Phe Arg Leu Ile Gly Trp Asn Asp Trp Ile Ile Ala Pro Thr Gly Tyr Tyr Gly Assn Tyr Cys Glu Gly Ser Cys Pro Ala Tyr Leu Ala Gly Val Pro Gly Ser Ala Ser Ser Phe His Thr Ala Val Val Asn Gln Tyr Arg Met Arg Gly Leu Asn Pro Gly Thr Val Asn Ser Cys Cys Ile Fro Thr Lys Leu Ser Thr Met Ser Met Leu Tyr Phe Asp Asp Glu Tyr Asn Ile Val Lys Arg Asp Val Pro Asn Met Ile Val Glu Glu Cys Gly Cys Ala <210> 47 <211> 115 <212> PRT
<213> Homo sapiens <400> 47 His Arg Arg Ala Leu Asp Thr Asn Tyr Cys Phe Ser Ser Thr Glu Lys Asn Cys Cys Val Arg Gln Leu Tyr Ile Asp Phe Arch Lys Asp Leu Gly Trp Lys Trp Ile His Glu Pro Lys Gly Tyr His Ala Asn Phe Cys Leu Gly Pro Cys Pro Tyr Ile Trp Ser Leu Asp Thr Gln Tyr Ser Lys Val Leu Ala Leu Tyr Asn Gln His Asn Pro Gly Ala Ser Ala Ala Pro Cys Cys Val Pro Gln Ala Leu Glu Pro Leu Pro Ile Val Tyr Tyr Val Gly Arg Lys Pro Lys Val Glu Gln Leu Ser Asn Met Ile Val Arg Ser Cys Lys Cys Ser <210> 48 <211> 115 <212> PRT
<213> Homo sapiens <400> 48 Lys Lys Arg Ala Leu Asp Ala Ala Tyr Cys Phe Arg Asn Val Gln Asp Asn Cys Cys Leu Arg Pro Leu Tyr Ile Asp Phe Lys Arg Asp Leu Gly Trp Lys Trp Ile His Glu Pro Lys Gly Tyr Asn Ala Asn Phe Cys Ala Gly Ala Cys Pro Tyr Leu Trp Ser Ser Asp Thr Gl.n His Ser Arg Val 50 55 60~
Leu Ser Leu Tyr Asn Thr Ile Asn Pro Glu Ala Se:r Ala Ser Pro Cys Cys Val Ser Gln Asp Leu Glu Pro Leu Thr Ile Le:u Tyr Tyr Ile Gly Lys Thr Pro Lys Ile Glu Gln Leu Ser Asn Met Ile Val Lys Ser Cys Lys Cys Ser <210> 49 <211> 115 <212> PRT
<213> Homo Sapiens <400> 49 Lys Lys Arg Ala Leu Asp Thr Asn Tyr Cys Phe Arg Asn Leu Glu Glu Asn Cys Cys Val Arg Pro Leu Tyr Ile Asp Phe Arg Gln Asp Leu Gly Trp Lys Trp Val His Glu Pro Lys Gly Tyr Tyr Ala Asn Phe Cys Ser Gly Pro Cys Pro Tyr Leu Arg Ser Ala Asp Thr Thr His Ser Thr Val Leu Gly Leu Tyr Asn Thr Leu Asn Pro Glu Ala Ser Ala Ser Pro Cys Cys Val Pro Gln Asp Leu Glu Pro Leu Thr Ile Leu Tyr Tyr Val Gly Arg Thr Pro Lys Val Glu Gln Leu Ser Asn Met Val Val Lys Ser Cys Leu Cys Ser <210> 50 <211> 4 <212> PRT
<213> Artificial <220>
<223> proteolytic cleavage site <220>
<221> VARIANT
<222> {1) . . (4) <223> Xaa = Any Amino Acid <400> 50 Arg Xaa Xaa Arg <210> 51 <211> 4 <212> PRT

I;

SI
<213> Artificial <220>
<223> Eukaryotic- proteolytic processing site <400> 51 Arg Ser Arg Arg <210> 52 <211> 405 <212> PRT
<213> Mus musculus <400> 52 Met Val Leu Ala Ala Pro Leu Leu Leu Gly Phe Leu Leu Leu Ala Leu Glu Leu Arg Pro Arg Gly Glu Ala Ala Glu Gly Prcr Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Gly Val Gly Gly Glu Arg Ser Ser Arg Pro Ala Pro Ser Ala Pro Pro Glu Pro Asp Gly Cy~o Pro Val Cys Val Trp Arg Gln His Ser Arg Glu Leu Arg Leu Glu Ser Ile Lys Ser Gln Ile Leu Ser Lys Leu Arg Leu Lys Glu Ala Pro Asn Ile Ser Arg Glu Val Val Lys Gln Leu Leu Pro Lys Ala Pro Pro Leu Gln Gln Ile Leu Asp Leu His Asp Phe Gln Gly Asp Ala Leu Gln Pro Glu Asp Phe Leu Glu Glu Asp Glu Tyr His Ala Thr Thr Glu Thr Val Ile Ser Met Ala Gln Glu Thr Asp Pro Ala Val Gln Thr Asp Gly Ser Pro Leu Cys Cys His Phe His Phe Ser Pro Lys Val Met Phe Asn Lys Val Leu Lys Ala Gln Leu Trp Val Tyr Leu Arg Pro Val Pro Arg Pro Ala Thr Val Tyr Leu Gln Ile Leu Arg Leu Lys Pro Leu Thr Gly Glu Gly Thr Ala Gly Gly Gly Gly Gly Gly Arg Arg His Ile Arg Ile Arg Ser Leu Lys Ile Glu Leu His Ser Arg Ser Gly His Trp Gln Ser Il~e Asp Phe Lys Gln ca Val Leu His Ser Trp Phe Arg Gln Pro Gln Ser Asn Trp Gly Ile Glu Ile Asn Ala Phe Asp Pro Ser Gly Thr Asp Leu Ala Val Thr Ser Leu Gly Pro Gly Ala Glu Gly Leu His Pro Phe Met Glu Leu Arg Val Leu Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly Leu Asp Cys Asp Glu His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Gln Cys Glu Tyr Met Phe Met Gln Lys Tyr Pro His Thr His Leu Val Gln Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Asp Lys Gln Gln Ile Ile Tyr Gly Lys Ile Pro Gly Met Val Val Asp Arg Cys Gly Cys Ser <210> 53 <211> 407 <212> PRT
<213> Homo Sapiens <400> 53 Met Val Leu Ala Ala Pro Leu Leu Leu Gly Phe Leu Leu Leu Ala Leu Glu Leu Arg Pro Arg Gly Glu Ala Ala Glu Gly Pro Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Gly Val Gly Gly Giu Arg Ser Ser Arg Pro Ala Pro Ser Val Ala Pro Glu Pro Asp Gly Cys Pro Val Cys Val Trp Arg Gln His Ser Arg Glu Leu Arg Leu Glu Ser Ile Lys Ser Gln Ile Leu Ser Lys Leu Arg Leu Lys Glu Ala Pro Asn Ile Ser Arg Glu Val Val Lys Gln Leu Leu Pro Lys Ala Pro Pro Leu Gln Gln Ile Leu Asp Leu His Asp Phe Gln Gly Asp Ala Leu Gln Pro Glu Asp Phe Leu Glu Glu Asp Glu Tyr His Ala Thr Thr Glu Thr Val Ile Ser Met Ala Gln Glu Thr Asp Pro Ala Val Gln Thr Asp Gly Ser Pro Leu Cys Cys His Phe His Phe Ser Pro Lys Val Met Phe Thr Lys Val Leu Lys Ala Gln Leu Trp Val Tyr Leu Arg Pro Val Pro Arg Pro Ala Thr Val Tyr Leu Gln Ile Leu Arg Leu Lys Pro Leu Thr Gly Glu Gly Thr Ala Gly Gly Gly Gly Gly Gly Arg Arg His Ile Arg Ile Arg Ser Leu Lys Ile Glu Leu His Ser Arg Ser Gly His Trp Gln Ser Ile Asp Phe Lys Gln Val Leu His Ser Trp Phe Arg Gln Pro Gln Ser Asn Trp Gly Ile Glu Ile Asn Ala Phe Asp Pro Ser Gly Thr Asp Leu Ala Val Thr Ser Leu Gly Pro Gly Ala Glu Gly Leu His Pro Phe Met Glu Leu Arg Val Leu Glu Asn Thr Lys Arg Ser Arg Arg Asn Leu Gly Leu Asp Cys Asp Glu His Ser Ser Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Gln Cys Glu Tyr Met Phe Met Gln Lys Tyr Pro His Thr His Leu Val Gln Gln Ala Asn Pro Arg Gly Ser Ala Gly_Pro Cys Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Asp Lys Gln Gln Ile Ile Tyr Gly Lys Ile Pro Gly Met Val Val Asp Arg Cys Gly Cys Ser

Claims (14)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:

1. A method of producing transgenic non-human mammalian animals having increased muscle mass for the preparation of food products, the method comprising:
a) introducing a transgene disrupting or interfering with expression of growth differentiation factor-8 (GDF-8) into an embryo or into germ cells of a pronuclear embryo of the animal;
b) implanting the embryo into the oviduct of a pseudopregnant female thereby allowing the embryo to mature to full term progeny;
c) testing the progeny for presence of the transgene to identify transgene-positive progeny;
d) cross breeding transgene-positive progeny to obtain further transgene-positive progeny;
e) identifying transgene-positive progeny having disrupted or reduced expression or activity of GDF-8 and increased muscle mass; and f) processing transgene-positive progeny having disrupted or reduced expression or activity of GDF-8 and increased muscle mass to obtain food products.

2. The method of claim 1, wherein the transgene comprises GDF-8 antisense polynucleotides.

3. The method of claim 1, wherein the transgene comprises a gene encoding a dominant negative GDF-8 polypeptide.

4. A method of producing transgenic avian species for the preparation of food products, comprising:
a) introducing a transgene disrupting or interfering with expression of growth differentiation factor-8 (GDF-8) into an embryo of an avian animal;

b) culturing the embryo under conditions whereby progeny are hatched;
c) testing the progeny for presence of the transgene to identify transgene-positive progeny;
d) cross-breeding transgene-positive progeny;
e) identifying transgene-positive progeny having disrupted or reduced expression or activity of GDF-8 and increased muscle mass; and f) processing transgene-positive progeny having disrupted or reduced expression or activity of GDF-8 and increased muscle mass to obtain food products:

5. The method of claim 4, wherein the transgene comprises GDF-8 antisense polynucleotides.

6. The method of claim 4, wherein the transgene comprises a gene encoding a dominant negative GDF-8 polypeptide.

7. A method of producing transgenic avian, porcine or bovine species for the preparation of food products, comprising:
a) introducing a transgene disrupting or interfering with expression of growth differentiation factor-8 (GDF-8) into an embryo of an avian, porcine or bovine animal;
b) implanting the embryo into an oviduct of a pseudopregnant female, under conditions whereby progeny develop from the embryo;
c) testing the progeny for presence of the transgene to identify transgene-positive progeny;
d) cross-breeding transgene-positive progeny;
e) identifying transgene-positive progeny having disrupted or reduced expression or activity of GDF-8 and increased muscle mass; and f) processing transgene-positive progeny having disrupted or reduced expression or activity of GDF-8 and increased muscle mass to obtain food products.

8. The method of claim 7, wherein the transgene comprises a gene encoding a dominant negative GDF-8 polypeptide.

9. A transgenic non-human mammalian or avian animal cell comprising a transgene comprising a growth differentiation factor-8 (GDF-8) polynucleotide sequence, wherein said transgene encodes a truncated GDF-8 polypeptide.

10. The transgenic non-human animal cell of claim 9, wherein said transgenic cell is avian, bovine or porcine.

11. The transgenic non-human animal cell of claim 9 or 10, wherein said transgenic non-human animal cell is germ cell, a somatic cell, an embryonic cell, or an embryonic stem cell.

12. A method of producing transgenic non-human mammalian animals having increased muscle mass, the method comprising:
a) introducing a transgene comprising a polynucleotide encoding a truncated growth differentiation factor-8 (GDF-8) into an embryo or into germ cells of a pronuclear embryo of the animal;
b) implanting the embryo into the oviduct of a pseudopregnant female thereby allowing the embryo to mature to full term progeny;
c) testing the progeny for presence of the transgene to identify transgene-positive progeny;
d) cross breeding transgene-positive progeny to obtain further transgene-positive progeny;
e) identifying transgene-positive progeny having disrupted or reduced activity of GDF-8 and increased muscle mass; and f) processing transgene-positive progeny having increased muscle mass.

13. A method of producing transgenic avian species, comprising:
a) introducing a transgene comprising a polynucleotide encoding a truncated growth differentiation factor-8 (GDF-8) into an embryo of an avian animal;
b) culturing the embryo under conditions whereby progeny are hatched;
c) testing the progeny for presence of the transgene to identify transgene-positive progeny;
d) cross-breeding transgene-positive progeny;
e) identifying transgene-positive progeny having disrupted or reduced activity of GDF-8 and increased muscle mass; and f) processing transgene-positive progeny having disrupted or reduced activity of GDF-8 and increased muscle mass.

14. A method of producing transgenic avian, porcine or bovine species for the preparation of food products, comprising:
a) introducing a transgene comprising a polynucleotide encoding a truncated growth differentiation factor-8 (GDF-8) into an embryo of an avian, porcine or bovine animal;
b) implanting the embryo into an oviduct of a pseudopregnant female, under conditions whereby progeny develop from the embryo;
c) testing the progeny for presence of the transgene to identify transgene-positive progeny;
d) cross-breeding transgene-positive progeny;
e) identifying transgene-positive progeny having disrupted or reduced activity of GDF-8 and increased muscle mass; and f) processing transgene-positive progeny having disrupted or reduced expression or activity of GDF-8 and increased muscle mass.