CA2300369A1 - Method and kit for hla class i typing dna - Google Patents

Abstract

The present invention relates to methods and materials for determining the HLA Class I type of a subject, wherein group-specific sequences are used to design primer molecules which may be used in amplification protocols which accurately identify the HLA group(s) and/or allele(s) carried by the subject.

Description

WO '99/07883 PCT/CA98/00768 METHOD AND KIT FOR HLA CLASS I TYPING DNA
1. INTRODUCTION
The present invention relates to methods and materials for determining the HLA Class I type of a subject, wherein group-specific sequences are used to design primer molecules which may be used in amplification protocols which accurately identify the HLA groups) and/or alleles) carried by the subject.

2. BACKGROUND OF THE INVENTION
The Histocompatibility Locus Antigen ("HLA") Class I genes comprise three classical genes encoding the major transplantation antigens HLA-A, HLA-B, and HLA-C and seven other Class I genes of which HLA-E, HLA-F and HLA-G are probably functional genes and HLA-H. HLA-I, HLA-K and HLA-L are pseudogenes. The class I genes share a similar structure, which includes, inter alia, 5' -> 3', a 5' untranslated flanking region; a first exon ("exon 1 ") having a length of approximately 73 base pairs ("bp"); a first intron ("intron 1 ") having a length of approximately 130 bp; a second exon ("exon 2"), having a length of approximately 250 bp; a second intron ("intron 2"), having a length of approximately 272 bp;
a third exon ("exon 3"), having a length of approximately 276 bp; a third intron ("intron 3"), having a length of approximately 588 bp; and a fourth exon ("exon 4").
The HLA Class I genes are highly polymorphic among individuals. As of 1996, at least 73 alleles of HLA-A, 126 alleles of HLA-B and 35 alleles of HLA-C
have been identified. This variability is of particular relevance when tissue transplantation between a donor and a host is contemplated. The histocompatibility antigens of donor and host should be as similar as possible to avoid both immune rejection of the transplanted tissue as well as graft-versus-host disease. It is therefore important to accurately identify the HLA types of donor and host. In view of the exigencies implicit in tissue transplantation, it is desirable that the typing be accomplished as efficiently as possible.
Methods for determining alleles of HLA-A, HLA-Band HLA-C in a patient sample have been heavily investigated because of the functional importance of these genes in transplant tissue matching and autoimmune diseases. The first tests developed used immunological methods to identify epitopes expressed by various HLA loci. These tests (e.g., the complement-dependent cytotoxicity assay described in Terasaki and McClelland, Nature, 204:998, (1964)) identified broad serological specificities but were not capable of distinguishing between allelic members of a group, and sometimes mis-identified groups altogether. Unfortunately, even the most accurate of such low resolution assays cannot detect and distinguish all functionally significant transplant antigens (Anasetti et al. Hum. Immunol., 29:70 (1990)).
High resolution tests performed at the nucleic acid level which distinguish among alleles of each group have become the focus of recent research.
Current methods of high resolution typing include the following.
The Sequence Specific Oligonucleotide Probes ("SSOP") technique, as described in United States Patent No. 5,451,512 assigned to Hoffman-La Roche, Inc., uses a reverse dot blot format, wherein HLA-A probes are immobilized on a membrane, and the labelled target (patient sample) DNA is hybridized to the membrane-bound probe (as described in Saiki et al., 1989, Proc. Natl. Acad.
Sci.
86:6230-6234). The pattern of hybridization to the probes on the dot-blot gives information regarding the HLA type of the individual. However, because hybridization is inherently not sufficiently specific to rule out minor differences in sequence between probe and patient sample, there is a possibility that the patient sample may contain an allelic variant which is not accounted for.
Another nucleic acid-based test is the Amplif cation Refractory Mutation System (ARMS) as described in the "HLA Class I SSP ARMS-PCR Typing Kit" Reference Manual, June 1995 edition, published by the Imperial Cancer Research Fund. This assay is based on the need for complementarity (matching) between the 3' end of an amplification primer and a target DNA sequence.
Absent such matching, the primer will not function properly and no fragment will be amplified. Sequence information is deduced by determining, for various pairs of primers acting on target DNA from a patient sample, whether or not a fragment is successfully amplified. The accuracy of the technique is limited by the number of primer pairs tested and by the possibility that allelic variations exist in regions of DNA which lie between the primers.

In order to overcome the foregoing shortcomings, it has been proposed that typing be accomplished by direct DNA sequencing (Santamaria et al., "HLA
Class I Sequence-Based Typing" Hum. Immunol. 37, 39-50 (1993); WO 9219771;
US Pat. 5,424,184). However, while direct sequencing of a patient's Class I
HLA
locus may conceptually be the most accurate, such sequencing may require a time-frame unsuitable for clinical practice. The success of direct sequencing methods may be expected to rely upon the design of efficient protocols and relevant primer sequences.
Prior to the present invention, direct sequencing protocols have exhibited a number of disadvantages. For example, the method of Santamaria et al., supra, fails to provide sufficient information because it focuses on cDNA
(exon) sequences which, in view of exon sequence diversity, offer a very limited selection of conserved primer hybridization sites. In addition, because the Santamaria sequencing primers hybridize within an exon, they do not provide information for DNA
sequence upstream of the primer which is potentially decisive for distinguishing among alleles.
Further, the sites disclosed were determined before the recent discovery of dozens of more alleles that now need to be considered in identifying HLA type.
Intron sequences could provide the preferred hybridization sites for amplification and sequencing primers for the HLA-A, HLA-B and HLA-C genes because they may provide the DNA sequence of the full exon. Intron sequences for an HLA Class I gene were disclosed at least as early as 1985 {Weiss et al Immunobiol 170:367-380, (1985)). Due to their substantial diversity, and the difficulties in sequencing, few intron sequences have been published subsequently.
A number of researchers have made limited use of intron based oligonucleotides for limited aspects of HLA Class I typing.
Blasczyk et al. (Tissue Antigens 1996: 47: 102-110) used exon based amplification primers to determine group specificity. After amplification, universal sequencing primers located in intron 2 were used to sequence the amplified fragment.
The paper does not disclose any intron sequence motifs from intron 1 or 3 or the 5' untranslated region.
Cereb et al. (Tissue Antigens 1995: 45:1-11), undertook the identification of intron sequences useful for locus-specific amplification primer sets for all Class I genes. These primer sets were designed to amplify all alleles of the same locus. No group specific amplification primers were sought or reported.
Further, amplified fragments were characterized by SSOP and not by direct sequencing.
Johnston-Dow et al (Poster Presentation: 1995 ASHI Meeting, Dallas, TX) presented a system for direct sequence determination of HLA-A wherein degenerate exon based primers were used to amplify exons 1 to 5 of the genomic HLA-A DNA sequence. As in Cereb et al., supra, the degenerate primer pool was designed to amplify all alleles of the HLA-A locus. Group specificity was not sought or reported. Further, sequencing of the amplified fragment was obtained using a degenerate primer mix wherein primers hybridize to intron regions flanking exons 2 and 3.
A rational approach to typing of classical HLA Class I loci would provide a simplified series of steps for high resolution typing of each allele of each loci in a patient sample using intron based oligonucleotides. Further, this method would be able to identify new alleles without ambiguities.
An alternative method of intron based HLA Class I typing is the subject of previously filed US Patent Application Serial No. 08/pending (Atty Docket No. VGEN.P-037-US), assigned to an assignee of the present invention.
3. SUMMARY OF THE INVENTION
The present invention relates to materials and methods for high-resolution, nucleic acid-based typing of the three classical HLA Class I genes (comprising the loci HLA-A, HLA-B and HLA-C) in a patient sample. It is based, in part, on the discovery of group-specific sequence motifs, derived from the analysis of numerous patient samples, which include sequences of the 5' flanking region, intron l, intron 2, and intron 3. Such sequence motifs may be used to design amplification primers which may be used to identify the HLA group or type of a subject. The invention is also based, in part, on the determination of numerous allele-specific sequences which may be used to confirm the precise allelic type of a subject.

The present invention provides for substantially purified nucleic acids which are capable of selectively hybridizing with group specific sequence motifs in untranslated regions of the HLA-A, HLA-B or HLA-C gene loci. Such nucleic acids, which may be comprised in a kit, may be used, alone or in conjunction with exon-based primers, to determine the group specificity of HLA-A, HLA-B, or HLA-C
alleles contained in a patient sample and to identify the specific alleles present.
In particular embodiments, the present invention provides for methods of ascertaining the HLA Class I type of a subject which comprise performing a first amplification reaction which identifies the group type of the subject, and a second amplification reaction which produces allele-specific nucleic acids for sequencing.
3.I. DEFINITIONS
"Allele" means one of the alternative forms of the gene in question;
"Amplification" means the process of increasing the relative abundance of one or more specific genes or gene fragments in a reaction mixture with respect to the other genes. A method of amplification which is well known by those skilled in the art is the polymerase chain reaction (PCR) as described in United States Patents Nos. 4,683,194, 4,683,195 and 4,683,202, which are incorporated herein by reference. The PCR process involves the use of pairs of primers, one for each complementary strand of the duplex DNA (wherein the coding strand is referred to as the "sense strand" and its complementary strand is referred to as the "antisense strand"), that will hybridize at a site located near a region of interest in a gene. Chain extension polymerization (without a chain terminating nucleotide) is then carned out in repetitive cycles to increase the number of copies of the region of interest many times. The amplified oligonucleotides are then separated from the reaction mixture and used as the starting sample for the sequencing reaction. Gelfand et al.
have described a thermostable enzyme, "Taq polymerase," derived from the organism Thermus aquaticus, which is useful in this amplification process (see United States Patent Nos. 5,352,600 and 5,079,352 which are incorporated herein by reference);
"Group" as used herein, refers to a subset of alleles of one. loci, all of which share sequence features which distinguish them from other groups. For example, serological group reactivity (in a lymphocytotoxicity assay) is the conventional basis for nomenclature of HLA alleles. The first two digits of an allele refer to the serological group; for example, the designation A*0201, A*0202, A*0217 all are members of the A2 group. Further, typically the nomenclature refers to the serological split group (e.g., A23 and A24 are serological splits of A9;
"Group-specific sequence motif' means a generally short, 1-25 nucleotide ("nt") sequence of nucleic acid which is found only in one or a few groups.
Where a motif is shared by several groups in one region of the HLA locus, group-specific sequence motifs in other regions of the locus may serve as group-distinguishing features. The motif may share one or more nucleotides with the consensus sequence for the region;
"Haplotype" means the allele present on one chromosome;
"Heterozygote" means the presence of at least two different alleles of a gene;
"Homozygote" means the presence of a single species of allele of a gene;
"Locus" means a gene, such as HLA-A, HLA-B or HLA-C;
"Locus specific" means an event or thing associated with only one locus;
"Patient sample" means a sample collected from a patient in need of HLA typing which contains a sufficient amount and quality of nucleic acid (preferably DNA) for the performance of an amplification reaction. A
nonlimiting example of a suitable source is peripheral blood lymphocytes, tissue (including cell cultures derived therefrom, mucosal scrapes, spleen and bone marrow;
"Primer" means a polynucleotide generally of 5-50 nucleotides length which can serve to initiate a chain extension reaction;
"Sequencing" or "DNA sequencing" means the determination of the order of nucleotides in at least a part of a gene. A well known method of sequencing is the "chain termination" method first described by Sanger et al., Proc.
Nat'1 Acad.
Sci. (USA) 74(12): 5463-5467 (1977) (recently elaborated in EP-B1- 655506, and Sequenase 2.0 product literature (Amersham Life Sciences, Cleveland) incorporated herein by reference). Basically, in this process, DNA to be sequenced is isolated, rendered single stranded, and placed into four vessels. In each vessel are the necessary components to replicate the DNA strand, which include a template-dependant DNA polymerase, a short primer molecule complementary to a known region of the DNA to be sequenced, and individual nucleotide triphosphates in a buffer conducive to hybridization between the primer and the DNA to be sequenced and chain extension of the hybridized primer. In addition, each vessel contains a small quantity of one type of optionally detectably labeled dideoxynucleotide triphosphate, e.g., dideoxyadenosine triphosphate ("ddA"), dideoxyguanosine triphosphate ("ddG"), dideoxycytosine triphosphate ("ddC"), or dideoxythymidine triphosphate ("ddT"). In each vessel, each piece of the isolated DNA is hybridized with a primer. The primers are then extended, one base at a time to form a new nucleic acid polymer complementary to the isolated pieces of DNA. When a dideoxynucleotide is incorporated into the extending polymer, this terminates the polymer strand and prevents it from being further extended. Accordingly, in each vessel, a set of extended polymers of specific lengths are formed which are indicative of the positions of the nucleotide corresponding to the dideoxynucleic acid in that vessel. These sets of polymers are then evaluated using gel electrophoresis to determine the sequence.
"Specific hybridization" means hybridization of one strand of a nucleic acid to its complement.
"Target sequence" means the preferred site for specific hybridization of a primer; and "Untransiated region" refers to a portion of an HLA locus which is not transcribed into RNA and eventually translated into protein. Examples of untranslated regions are the 5' and 3' flanking regions and intron sequences. For example, the 5' flanking region is neither transcribed nor translated, and intron sequences are transcribed but not translated.

4. DESCRIPTION OF THE FIGLTRF~
FIGURE 1 is an illustration of the principle for an HLA class I
sequencing strategy. Group-specific primers are used for PCR amplification, and universal primers located in the 2nd intron are used for sequencing, regardless of the amplified group. 5'FR= 5' flanking region; 5' UTR= 5' untranslated region (-1 to -23 from the ATG start codon in exon 1 ).
FIGURE 2A and 2B depict, in schematic form, a method of the invention in which a cocktail of HLA-A group specific primers is used to amplify target DNA contained in a patient sample. The products of amplification are then separated electrophoretically in an agarose gel, allowing the identification, by fragment mobility, of fragments corresponding to groups A2 and A3. Primers specific for groups A2 and A3 are then used to amplify duplicate samples of target DNA
in separate reactions, to produce A2 and A3 fragments which may then be sequenced using universal sequencing primers. FIGURE 2C and 2D depict a strategy wherein group type specificity is determined by reaction of aliquots of genomic DNA in separate reactions with a panel of primer pairs.
FIGURE 3 depicts the nucleic acid sequences of the HLA-A 5' flanking region in various alleles, including a consensus sequence (SEQ ID
NO:1) as well as the sequences for the following alleles: A*O1 O1 (SEQ ID N0:2); A*0301 (SEQ ID N0:3); A* 1101 (SEQ ID N0:4); A* 1102 (SEQ ID NO:S); A*3001 (SEQ ID
N0:6); A*3002 (SEQ ID N0:7); A*3004 (SEQ ID N0:8); A*0201-11 (SEQ ID
N0:9); A*0215 (SEQ ID NO:10); A*0217 (SEQ ID NO:11 ); A*6801 (SEQ ID
N0:12); A*6802 (SEQ ID N0:13); A*6901 (SEQ ID N0:14); A*2301 (SEQ ID
NO:15); A*2402 (SEQ ID N0:16); A*2403 (SEQ ID N0:17); A*2404 (SEQ ID
N0:18); A*2405 (SEQ ID N0:19); A*2407 (SEQ ID N0:20); A*2501 (SEQ ID
N0:21); A*2601 (SEQ ID N0:22); A*3402 (SEQ ID N0:23); A*4301 (SEQ ID
N0:24); A*6601 (SEQ ID N0:25); A*6602 (SEQ ID N0:26); A*6603 (SEQ ID
N0:27); A*2901 (SEQ ID N0:28); A*2902 (SEQ ID N0:29); A*31012 (SEQ ID
N0:30); A*3201 (SEQ ID N0:31); A*3301 (SEQ ID N0:32); A*3303 (SEQ ID
N0:33}; A*7401 (SEQ ID N0:34); A*7402 (SEQ ID N0:36); A*7403 (SEQ ID
N0:37}; and A*8001 (SEQ ID N0:38).

WO 99!07883 PCT/CA98/00768 FIGURE 4 depicts the nucleic acid sequences of HLA-A intron 1 in various alleles, including a consensus sequence (SEQ ID N0:39) as well as the sequences for the following alleles: A*0101 (SEQ ID N0:40);
A*0301 (SEQ
ID

N0:41 ); A* ID N0:42); A* 1102 (SEQ ID N0:43); A*3001 1101 (SEQ (SEQ ID

N0:44); A*3002 ID N0:45); A*3004 (SEQ ID N0:46); A*0201 (SEQ (SEQ ID

N0:47); A*0202 ID N0:44); A*0203 (SEQ ID N0:49); A*0204 (SEQ (SEQ ID

NO:50); a*0205 (SEQ ID NO:51);
A*0206 (SEQ
ID N0:52);
A*0207 (SEQ
ID

N0:53); A*0207 ID N0:54); A*0208 (SEQ ID NO:55); A*0209 (SEQ (SEQ ID

N0:56); A*0210 ID N0:57); A*0211 (SEQ ID N0:58); A*0215 (SEQ (SEQ ID

N0:59); A*0217 ID N0:60}; A*6801 (SEQ ID N0:61); A*6802 (SEQ (SEQ ID

N0:62); A*6901 ID N0:63); A*2301 (SEQ ID N0:64); A*2402 (SEQ (SEQ 1D

N0:65); A*2403 ID N0:66); A*2404 (SEQ ID N0:67); A*2405 (SEQ (SEQ ID

N0:68); a*2407 (SEQ ID N0:69);
A*2501 (SEQ
ID N0:70);
A*2601 (SEQ
ID

N0:71); A*3402 ID N0:72); A*6601 (SEQ ID N0:73}; A*6602 (SEQ (SEQ ID

N0:74) A*6603 (SEQ ID N0:75};
A*4301 (SEQ
ID N0:76);
A*2901 (SEQ
ID

N0:77); A*2902 ID N0:78); A*3101 (SEQ ID N0:79); A*3201 (SEQ (SEQ ID

N0:80); A*3301 ID N0:81); A*3303 (SEQ ID N0:82); A*7401 (SEQ (SEQ ID

N0:83); A*7402 ID N0:84); A*7403 (SEQ ID N0:85); and (SEQ A*8001 (SEQ ID

N0:86).

FIGURE 5 depicts the nucleic acid sequences of HLA-A intron 2 in various alleles, including a consensus sequence (SEQ ID N0:87) as well as sequences for the following alleles: A*OI01 (SEQ ID N0:88); A*0201 (SEQ ID N0:89);
A*0202 (SEQ ID N0:90); A*0203 (SEQ ID N0:91); A*0204 (SEQ ID N0:92);
A*0205 (SEQ ID N0:93); A*0206 (SEQ ID N0:94}; A*0207 (SEQ ID N0:95);
A*0208 (SEQ ID N0:96); A*0209 (SEQ ID N0:97); A*0210 (SEQ ID N0:98);
A*0211 (SEQ ID N0:99); A*0215 (SEQ ID NO:100); A*0217 (SEQ ID NO:101);
A*6801 (SEQ ID N0:102); A*6802 (SEQ ID N0:103); A*6901 (SEQ ID N0:104);
A*2501 (SEQ ID NO:105); A*2601 (SEQ ID N0:106); A*4301 (SEQ ID N0:107);
A*6601 (SEQ ID N0:108); A*6602 (SEQ ID N0:109); A*6603 (SEQ ID NO:110);
A*3402 (SEQ ID NO:111); A*2901 (SEQ ID N0:112}; A*2902 (SEQ ID N0:113);
A*3101 (SEQ ID N0:114); A*3201 (SEQ ID NO:115); A*3301 (SEQ ID N0:116);

A*3303 (SEQ ID N0:117); A*7401 (SEQ ID N0:118); A*7402 (SEQ ID N0:119);
A*7403 (SEQ ID N0:120); A*230I (SEQ ID N0:121); A*2402 (SEQ ID N0:122);
A*2403 (SEQ ID N0:123); A*2404 (SEQ ID N0:124); A*2405 (SEQ ID N0:125);
A*2407 (SEQ ID N0:126); A*0301 (SEQ ID N0:127); A*1101 (SEQ ID N0:128);
A*1102 (SEQ ID N0:129); A*3001 (SEQ ID N0:130); A*3002 (SEQ ID N0:131);
A*3004 (SEQ ID N0:132); and A*8001 (SEQ ID N0:133).
FIGURE 6 depicts the nucleic acid sequences of HLA-A mtron 3 in various alleles, including a consensus sequence (SEQ ID N0:134) as well as sequences for the following alleles:
A*0101 (SEQ
ID N0:135);
A*0301 (SEQ
ID

N0:136); (SEQID N0:137); (SEQ ID N0:138); A*3001 A* 1101 A* 1102 (SEQ ID

N0:139); (SEQID N0:140); (SEQ ID N0:141); A*0201 A*3002 A*3004 (SEQ ID

N0:142); (SEQID N0:143); (SEQ ID N0:144); A*0204 A*0202 A*0203 (SEQ ID

N0:145); (SEQID N0:146); (SEQ ID N0:147); A*0207 A*0205 A*0206 (SEQ ID

N0:148); (SEQID N0:149); (SEQ ID NO:l SO); A*0210 A*0208 A*0209 (SEQ ID

NO:151 ); (SEQID N0:152); (SEQ ID N0:153); A*0217 A*0211 A*0215 (SEQ ID

N0:154); (SEQID NO:155); (SEQ ID N0:156); A*6901 A*6801 A*6802 (SEQ ID

N0:157); (SEQID N0:158); (SEQ ID N0:159); A*2403 A*2301 A*2402 (SEQ ID

N0:160); (SEQID N0:161 ); (SEQ ID N0:162); A*2407 A*2404 A*2405 (SEQ ID

N0:163); (SEQID N0:164); (SEQ ID N0:165); A*3402 A*2501 A*2601 (SEQ ID

N0:166); (SEQID N0:167); (SEQ ID N0:168); A*6602 A*4301 A*6601 (SEQ ID

N0:169); (SEQID N0:170); (SEQ ID NO:I71); A*2902 A*6603 A*2901 (SEQ ID

N0:172); (SEQID N0:173); (SEQ ID N0:174); A*3301 A*3101 A*3201 (SEQ ID

N0:175); (SEQID N0:176); (SEQ ID N0:177); A*7402 A*3303 A*7401 (SEQ ID

N0:178); (SEQID N0:179);
A*7403 and A*8001 (SEQ ID N0:180).

FIGURE 7 depicts a phylogenetic tree of the S' flanking and 5' untranslated regions of HLA-A.
FIGURE 8 depicts a phylogenetic tree of introns 1-3 of the HLA-A
gene.
FIGURE 9 depicts a phylogenetic tree of introns I-3 of the HLA-B
gene.
FIGURE 10 depicts the results of amplification using group-specific *rB

exon region primers to determine HLA-A group type, wherein the group specificity is determined to be 6601 and 3201 (see Table 7).
FIGURE 11 depicts the results of amplification using group-specific exon region primers to determine HLA-A group type, wherein the group specificity is determined to be 020x and 680x (see Table 8).
FIGURE 12 depicts the nucleic acid sequences of the first intron of HLA-B, inlcuding a consensus sequence (SEQ ID N0:246) as well as the sequences for the following alleles: B*0702 (SEQ ID N0:247), B*0801 (SEQ ID
N0:248), B* I302 (SEQ ID B* (SEQ ID N0:250),B* 1402 (SEQ ID N0:251), N0:249), 1401 B*1501 (SEQ ID B*1502(SEQ ID N0:253),B*1505 (SEQ ID N0:254}, N0:252), B*1508 (SEQ ID B*1510(SEQ ID N0:256),B*1512 (SEQ ID N0:251), N0:255), B*1513 (SEQ ID B*1517(SEQ ID N0:259),B*1525 (SEQ ID N0:260), N0:258), B*1532 (SEQ ID B*1801(SEQ ID N0:262),B*I805 (SEQ ID N0:263), N0:261), B*27052 (SEQ ID
N0:264), B*27053 (SEQ ID N0:265}, B*2707 (SEQ ID
N0:266), B*3501 (SEQ ID B*3502(SEQ ID N0:268),B*3503 (SEQ ID N0:269), N0:267), B*3701 (SEQ ID B*3801(SEQ ID N0:271),B*3901 (SEQ ID N0:272), N0:270), B*3903 (SEQ ID B*3906(SEQ ID N0:274),B*4001 (SEQ ID N0:275), N0:273), B*4002 (SEQ ID B*4101(SEQ ID N0:277),B*4102 (SEQ ID N0:278), N0:276), B*4201 (SEQ ID B*4402(SEQ ID N0:280),B*4403 (SEQ ID N0:281), N0:279), B*4501 (SEQ ID B*4601(SEQ ID N0:283),B*4701 (SEQ ID N0:284), N0:282), B*4801 (SEQ ID B*4901(SEQ ID N0:286),B*5001 (SEQ ID N0:287), N0:285), B*5101 (SEQ ID B*5108(SEQ ID N0:289),B*5201 (SEQ ID N0:290), N0:288), B*5301 (SEQ ID B*5401(SEQ ID N0:292),B*5501 (SEQ ID N0:293), N0:291), B*5601 (SEQ ID B*5701(SEQ ID NO:295),B*5801 (SEQ ID
N0:294), N0:296),B*5901 , B*6701 (SEQ ID N0:297) (SEQ ID
N0:298), B*7301 (SEQ
ID

N0:299).

FIGURE 13A-B. depicts the nucleic acid sequences of the second intron of HLA-B, including a consensus sequence (SEQ ID N0:300) as well as the following alleles: B*0702 (SEQ ID N0:301), B*0801 (SEQ ID N0:302), B*1302 (SEQ ID N0:303), B* 1401 (SEQ ID N0:304), B* 1402 (SEQ ID N0:305), B*1501(62) (SEQ ID N0:306), B*1505(62) (SEQ ID N0:307), B*1508(62) (SEQ ID

N0:308),B*1510(71) (SEQ
ID
N0:309), B*1513(77) (SEQ
ID
N0:310), B*1517(63) ID N0:311), *I532(62) (SEQ B*1525(62) (SEQ ID
(SEQ ID
N0:312), B

N0:313),B* (SEQ ID N0:314},B*2702 (SEQ ID B*2704 {SEQ
1801 N0:315), ID

N0:316),B*27052 (SEQ
ID
N0:317), B*27053 (SEQ
ID
N0:318), B*2707 (SEQ
ID

N0:319),B*3501(SEQ ID N0:320),B*3502 (SEQ ID B*3503 (SEQ
N0:321), ID

N0:322),B*3507(SEQ ID N0:323),B*3508 (SEQ ID B*3701 (SEQ
N0:324), ID

N0:325),B*3801(SEQ ID N0:326),B*3901 (SEQ ID B*3903 (SEQ
N0:327), ID

N0:328),B*3906(SEQ ID N0:329),B*4001 (SEQ ID B*4002 (SEQ
N0:330), ID

N0:331),B*4101(SEQ ID N0:332),B*4102 (SEQ ID B*4201 (SEQ
N0:333), ID

N0:334),B*4402(SEQ ID N0:335),B*4403 (SEQ ID B*4501 (SEQ
N0:337), ID

N0:338),B*4601{SEQ ID N0:339),B*4?O1 (SEQ ID B*4801 (SEQ
N0:340), ID

N0:341),B*4901(SEQ ID N0:342),B*5001 (SEQ ID B*5101 (SEQ
N0:343), ID

N0:344),B*5108(SEQ ID N0:345),B*5201 (SEQ ID B*5301 (SEQ
N0:346), ID

N0:347),B*5401(SEQ ID N0:348),B*SSO1 (SEQ ID B*5601 (SEQ
N0:350), ID

N0:351),B*5701(SEQ ID N0:352),B*5801 (SEQ ID B*5901 (SEQ
N0:353), ID

N0:354),B*6701(SEQ ID N0:355),B*7301 (SEQ ID
N0:356).

FIGURE 14A-E. depicts the nucleic acid sequences of the third intron of HLA-B, including a consensus sequence (SEQ ID NO: 357) as well as the following alleles: B*0702 (SEQ ID N0:358),B*0801 (SEQ ID N0:359), B*1302 (SEQ ID N0:360), B* 1401 (SEQ ID N0:361 ), B* 1402 (SEQ ID N0:362), B* 1 S01 (SEQ ID NO:363), B* 1502 (SEQ ID N0:364), B* 1510 (SEQ ID N0:365), B* 1513 (SEQ ID N0:366), B* 1517 (SEQ ID N0:367), B* 1525 (SEQ ID N0:368), B* 1801 (SEQ ID N0:369), B*27052 (SEQ ID N0:370), B*27053 (SEQ ID NO: 371 ), B*3501 (SEQ ID N0:372), B*3502 (SEQ ID N0:373), B*3503 (SEQ ID N0:374), B*3701 (SEQ ID N0:375), B*3801 (SEQ ID N0:376), B*3903 (SEQ ID N0:377), B*3906 (SEQ ID N0:378), B*4001 (SEQ ID N0:379), B*4002 (SEQ ID N0:380), B*4101 (SEQ ID N0:381), B*4102 (SEQ ID N0:382), B*4201 (SEQ ID N0:383), B*4402 (SEQ ID N0:384), B*4403 (SEQ ID N0:385), B*4501 (SEQ ID N0:386}, B*4601 (SEQ ID N0:387), B*4701 (SEQ ID N0:388), B*4901 (SEQ ID N0:389), B*5001 (SEQ ID N0:390), B*5101 (SEQ ID N0:391), B*5108 (SEQ ID N0:392), B*5201 (SEQ ID N0:393), B*5301 (SEQ ID N0:394), B*5401 (SEQ ID N0:39S), B*5501 (SEQ ID N0:396), B*5601 (SEQ ID N0:397).

5. DETAILED DESCRT_PTION OF THE INVENTION
The present invention relates to compositions and methods which may be used to efficiently and accurately determine the HLA Class I type of a patient sample.
The present invention is based, in part, on the determination of group-specific sequence motifs in regions of HLA Class I loci. These motifs may be used to design oligonucleotides which may be used as group-specific primers in nucleic acid amplification reactions. The present invention is also based, in part, on the determination of the sequences of regions of a wide variety of alleles of HLA
Class I
loci; such sequences may be used to distinguish one allele from another.
Sequences of regions including the 5' flanking region of HLA-A and introns 1, 2 and 3 of HLA-A
are provided herein, and are set forth in Figures 3-6.
In general, the methods of the invention may be described as follows.
Comparison of nucleotide sequences of an HLA locus among members of an HLA
Class I group, which lie in either untranslated or exon regions, may be used to identify group-specific motif sequences. Identification of groups may be by establishing serological relationships or using phylogenetic information, as set forth in Figures 7-9. Based on the group-specific motif sequences, oligonucleotide primers may be designed, synthesized, and used to amplify a portion of the HLA locus.
Oligonucleotides used in this manner are referred to herein as "group-specific primers" and, in particular, as "group-specific untranslated region primers"
or "group-specific exon region primers", as the case may be.
In preferred nonlimiting embodiments of the invention, the primers correspond to untranslated regions of the HLA Class I locus ("group-specific untranslated region primers"). Such primers may be used in pairs, wherein each member of the pair hybridizes to an untranslated region lying on either side of at least one exon. For example, but not by way of limitation, primer pairs may be oligonucleotide pairs which hybridize to group-specific motifs in the 5' untranslated region and the first, second, or third intron; the first intron and the second or third intron; or the second and third intron.
The group-specific primers may be used in several different methods according to the invention. In a first series of nonlimiting embodiments, the group-specific primers may be used in a diagnostic manner to identify which allelic groups are present in a patient sample. In a second series of nonlimiting embodiments, the group-specific primers may be used to amplify sufficient amounts of a particular allelic fragment which is then subjected to direct nucleotide sequencing using universal sequencing primers.
According to the first series of embodiments, the present invention provides for a method of determining the HLA Class I group type of a subject comprising (i) combining a group-specific primer pair with a target DNA sample from the subject under conditions such that primer-based amplification of the target DNA
may occur; and (ii) determining whether a nucleic acid product is produced by the amplification; wherein the ability of a primer pair to produce a nucleic acid product is associated with a particular HLA group type. The group-specific primers may be group-specific exon region primers or group-specific untranslated region primers. In related embodiments the present invention provides for a method of determining the HLA Class I group type of a subject comprising (i) combining a plurality of group-specific exon region primer pairs with a target DNA sample from the subject under conditions such that primer-based amplification of the target DNA may occur;
(ii) determining the size of the nucleic acid products of the amplification; and (iii) correlating the size of the product with the predicted size of a fragment associated with a particular HLA group type. The plurality of primers is referred to as an HLA
"cocktail" (see Figures 1 and 2). These first methods may be used to provide useful diagnostic information. For example, group type determination may serve as a first level of comparison for a histocompatibility analysis, even without identification of the specific alleles) involved. For example, if a potential donor and host are being evaluated for tissue transplantation, if it is found that their group types do not match, no further comparison may be necessary. If, alternatively, their types do match, filr-ther analysis, for example by direct sequencing, may be desirable.
According to the second series of embodiments, the present invention provides for a method of determining the HLA Class I allelic type of a subject comprising (i) combining a group-specific oligonucleotide primer pair with a target DNA sample from the subject under conditions such that primer-based amplification of the target DNA may occur; (ii) collecting the nucleic acid product of the amplification; and (iii) determining the nucleic acid sequence of the product.
The group-specific primer pair used may be determined based on the group type of the subject, as determined using the first method, described above. In preferred embodiments of the invention, group-specific untranslated region primers which span a region of the HLA locus containing allele-specific sequence may be utilized.
If a subject is heterozygous, separate amplification reactions are performed for each group identified (e.g., separate reactions to amplify fragment for group A2 and group A3;
see Figure 2). Sequencing may be performed using universal sequencing primers which will operate irrespective of HLA group or allelic type.
A more detailed description of the invention follows. Most alleles of the classical HLA Class I gene loci (consisting of HLA-A, HLA-B and HLA-C) can be distinguished on the basis of exon 2 and 3 alone. In one non-limiting embodi-ments, a method of the invention takes advantage of this fact, and employs the strategy generally described in Figure 2, using the example of HLA-A. A
genomic DNA sample is prepared from a patient sample according to well known techniques.
Aliquots of the genomic DNA may then separately be reacted with a panel of group-specific exon region primer pairs (Figure 2C), wherein the successful amplification of a DNA fragment is associated with a particular group type. Alteratively, as depicted in Figure 2A), part of the sample may be treated with a cocktail of group-specific exon region primer pairs. Each primer pair in the cocktail will amplify only selected allelic groups because they specifically hybridize to group specific intron sequence motifs. Between them, under suitable polymerase chain reaction (PCR) conditions, the cocktail may amplify all known HLA-A groups, with each group specific amplification product having a different length. When reaction products are separated on an agarose gel the groups) present in the patient sample may be identified by length.
Optionally, once the group specificity is determined, the direct sequence of alleles may be determined for precise allelic identification. As illustrated in Figure 2 B), a further part of the patient sample DNA may be treated under PCR
conditions with a pair of primers that are specific for the previously determined group;
preferably such primers are group-specific untranslated region primers, which span greater distances of the locus. If two groups were detected, then two separate reactions are performed. At completion of the second amplification, the reaction products are sequenced using an intron based "universal primer" which hybridizes to an intron sequence which is conserved among all alleles of the locus. Though it is theoretically possible to use a sequencing primer which is specific for the amplified group only, it is found that using a universal primer simplif es the method and the preparation of a kit. Various universal sequencing primers are specifically provided herein (see infra) which hybridize, respectively, to intron sequences flanking the S' end of exon 2, the 3' end of exon 2, the 5' end of exon 3 and the 3' end of exon 3.
The substantial advantage of the method of the invention is that the initial group specific amplification allows a PCR based separation of haplotypes in 95% of patient samples. The separation of the haplotypes is a major achievement of this protocol since it permits the resolution of cis/trans linkages of heterozygote sequencing results which cannot be achieved with other protocols. With the instant invention, a separation of the haplotypes may be achieved in serological heterozygous samples with the sequencing primer mixes ("PMs") described in Table 2 (infra) using group-specific amplification corresponding to the serological families. The selection of the PMs used for sequencing depends on the amplification patterns of the preceding PCR-SSP low-resolution typing. The primers are designed to work with a in a single cycle protocol including, but not limited to, a PCR protocol on a Perkin Elmer System 9600, maintaining typing capacities of the laboratory. All PCR products carry sufficient sequence information for a complete subtyping. This approach is superior to a typing system using a single pair of generic primers followed by direct sequencing or SSO hybridization, even if the amplification strategy is locus-specific.
The substantial advantage of Sequence Based Typing (SBT) is the def nition of the cis/trans linkage of sequence motifs. SBT after generic PCR amplification cannot define the cis/trans linkage of sequence motifs and therefore mimics oligotyping. The rapidly growing number of newly identified alleles confirms that new alleles have arisen mainly from gene conversion events which have usually taken place between different alleles of the same locus. Newly identified alleles are not characterized by new sequence motifs, but by a new combination of already existing sequence motifs.
From this observation it may be concluded that the amount of alleles at each locus may theoretically represent all possible combinations of known sequence motifs. Of course, some of them will fall victim to negative selection. Nevertheless, it can be expected that still an enormous amount of alleles are yet unidentified. PCR-SSP
subtyping strategies using a restricted number of oligonucleotides which do not cover all possible sequence motifs suffer from this limitation. If the cis/trans linkage of the analyzed polymorphic regions is not defined some new alleles may be mistyped as a heterozygous combination of known alleles. This has consequences with respect to SBT strategies. An unambiguous typing result of SBT after generic PCR
amplification is only unambiguous with regard to the presently known HLA
sequence databank. However,. with the detection of new alleles this result can become ambiguous over the course of time. This observation has already been made in PCR
based DRBl typing during the last five years and will probably also occur in PCR
based class I typing. Considering the above points, the idea of the instant SBT
approach is not only to identify the HLA-A, HLA-B and HLA-C subtypes, but to cover as many of the polymorphic sites as possible and to define the cis/trans linkage of the polymorphic sequence motifs. Typing results obtained with this method will remain unambiguous independently of the growing HLA sequence databank.
In general, group-specific primers are desirably designed to facilitate hybridization to their intended targets. It should be taken into account that homology between different groups, and indeed between group-specific motifs, may exist.
Accordingly, in preferred embodiments of the invention, a primer may be designed such that it hybridizes to its group target under relatively stringent conditions. For example, one or more mismatched residues may be engineered into the 3' domain of the molecule. Further, the primer may be designed such that it differs from any naturally occurnng or consensus sequence, but rather has mismatches inserted which serve to further reduce hybridization of the primer to target DNA of a group other than the intended target group. Under certain circumstances, one or more mismatches may be introduced into the 5' end to destabilize internal hairpin loops; such changes are not generally expected to enhance the efficiency of the primer.
The following nucleic acid sequences may be comprised in group-specific untranslated region primers for HLA-A which are specific for the groups as indicated in Table 1. The sequences in Table 1 have the following sequence identifiers: II-210 is SEQ ID N0:35, and the remaining sequences Il-230m through I3-282 have SEQ ID NOS 5:181-202, respectively.
Table 1.
DesignationSequence N Tm SpecificityPosition I1-210m 5' ACC Cgg ggA gCC 18 64C A10 et 73-92 S ggg CCT 3' al.

II-230m 5' ggC Agg TCT CAg 18 60C A*O1, 03, 102-S CgA CTg 3' 11, 119 II-226 5' CTC TgT ggg gAg 19 60C A802 29-47 S AAg CAA C 3' I1-221m11 5' ggg AgC ggC gCC 17 64C A*0301 77-93 S ggg AC 3' II-209 5' gAA gCA Agg ggC 18 64C A10 et 41-58 S CCg CCC 3' al.

I1-214m 5' CgC CTg gCg ggg 18 66C A*2301,24 54-71 S gGg CAA 3' II-223d 5' gTg AgT gCg ggg 18 62C A19 1-19 S TCg Tgg 3' I1-225m 5' gCC ggg Agg Agg 18 64C A*30 85-103 S gAC ggT 3' II-237m14 5' ggC gCg CCC ggC 17 65C A*29 49-65 S ggg gA 3' I1-240 5' ggA ggA ggg TCg 18 64C A*31,33 90-107 S ggC ggA 3' 5'FL-243 5' AgT gTC TTC gCg 19 62C A*I1 53-71 S gTC gCT C 3' 5'FR-257 5' CTC AgA TTC TCC 19 60C A all except6-24 S CCA gAC g 3' A* 11 5'FR-273 5' CATgCC gAg ggT TTC 20 64C A*28, 360-S TCC CA 3' 6602,6603 380 BP202 S 5'CTg gCC CTg ACC CAg 19 64C A*7401,7403Exon ACC A 3' 1, BP203 S 5' GCT gAC CCA gAC 19 64C A*8001 Exon CTg ggC A 3' 1, BP142 AS 5' CAGGTAT CTG CGGAGC 19 64C A*0101/*24227-CCG 3' I3-236 5'gTC TgT CAg gAA gAgTCAgAA21 62C A*non02.28584..+2 AS 3' I3-239 5'gTggAAAATTCTAgTCCCTgA22 62C A*multi, 415-AS A3' not A1,3,11,30,9436 I3-246 5' AgATCT ACA ggC gAT 20 60C A*30 24-43 AS CAg gA 3' I3-247m6 5' gCC AgC CCg ggA 19 62C A*01,11 38-54 gTT CTA T 3' AS

I3-249 5' CAg AgT CACTCTCTggTACAg21 62C All A, 148-AS 3' weak 59,70,92,J,E,G168 ,F

I3-280m18 5' gCg ATC gTC TTC 19 62C A*01,03,11,30221-CCg TCA C 3' I3-282 5' AgAgTCACTCTC Tgg 21 62C A*8001 148-AS TACAgA 3' The present invention provides for nucleic acid molecules comprising regions having the foregoing sequences or their functional equivalents.
"Functional equivalents" of a nucleotide sequence, as defined herein, refers to nucleotide sequences which, when contained in a nucleic acid molecule, retain the specificity of the disclosed sequence and/or hybridize to the complement of the disclosed sequence under stringent hybridization conditions (e.g., .1 x SSC at 65 °C).
In specific nonlimiting examples, oligonucleotides comprising the above sequences, or functional equivalents thereof which retain specificity, may be used in a PCR amplification reaction in the following pairwise combinations to generate group specific fragments of the lengths as indicated in Table 2.

Table 2.
Primer Mix Sense PrimerAntisense Size HLA-A specificity No. Name Primer of Product 1 1.1 I1-230m BP142 785 A*OI
by 2 1.2 S'FR-257 I3-247m6 1068 A*O1 by 3 1.3 I1-230m I3-247m6 870 A*01,11 by 4 2 I1-226 I3-249 1056 A*02 by 3 I1-221m11 I3-280m18 1078 A*03 by 6 11 S'FL-243 I3-249 1229 A* 11 by 7 9 I1-214m I3-249 1033 A*23,24 by 8 10.1 I1-210m I3-236 l4SObpA*10 9 10.2 I1-210m I3-249 1014 A*10,68,69 by 28 S'FR-273 I3-249 t 537 A*68,69,6602,6603 by 11 19.1 I1-223d I3-239 or 1084 A*29,31,32,33,74 I3-249 by 12 19.2 I1-240 I3-249 996 A*31,33 by 13 29 I1-237m14 I3-249 1037 A*29 by 14 30 I1-225m I3-249 1000 A*30 by 1S 74 BP202 (Exon I3-249 1109 A*7401,7403 1) by 16 80 BP203 I3-282 1103 A*8001 (untested) by The following nucleic acid sequences may be comprised in group-specific exon region primers for HLA-A which are specific for the groups as indicated in Table 3 (sense primers) and Table 4 (antisense primers). The sequences in Table 3, primer numbers 85, 118, 120, 123, 127, 129, 134, 137, 140, 160, 167, 175, 193 and 202, have SEQ ID NOS:203-216, respectively. The sequences in Table 4, primer numbers 98, 115, 116, 117, 126, 133, 135, 136, 138, 142, 144, 145, 152, 153, 154, 155, 161, 165, 168, and 180, have SEQ ID NOS:217-236, respectively, and primer number 119 has SEQ ID N0:245. The present invention provides for nucleic acid molecules comprising regions having the foregoing sequences or their functional equivalents. They may, in specific nonlimiting examples, be used in pairs as set forth in Table 5.

Table 3.
Primer Localization Sequence Number 85 Exon -14 - 5' CTC CTC gTC CCC Agg 2 5 CTC T 3' 118 Exon 6 - 19 5' TCC ATg Agg TAT TTC
2 TAC ACC 3' 120 Exon -6 - 5' ggC CAg gTT CTC AgA
3 12 CCA 3' 123 Exon 36 - 5' CCC ggC CCg gCA gTg 2 53 gA 3' 127 Exon 1- 20 5' gTT CTC ACA CCA TCC
3 AgA Tg 3' 129 Exon 4 - 25 5' TCA CAC CCT CCA gAT
3 gAT gTT 3' 134 Exon 63 - 5' ggg TAC CAg CAg gAC
3 80 gCT 3' 137 Exon 9 - 29 5' TCC ATg Agg TAT TTC
2 ACC ACA 3' 140 Exon -1 - 5' ggT TCT CAC ACC ATC
3 20 CAg ATA 3' 160 Exon 1 - 20 5' gTT CTC ACA CCA TCC
3 AgA gg 167 Exon 54 - 5' gAg CCC CgC TTC AAC
2 71 gCC 3' 175 Exon 63 - 5' CTT CCT CCg Cgg gTA
3 71 TgA A 3' 193 Exon 167 - 5' gCC ggA gTA TTg ggA
2 184 CCg 3' 202 Exon 49 - 5' CTg gCC CTg ACC CTg 1 67 ACC A 3' Table 4. Antisense Primers Primer Localization Sequence Number 98 Exon 2 226 - 5' gCA ggg TCC CCA ggT
243 CCA 3' 115 Exon 3 195 - 5' CCT CCA ggT Agg CTC
213 TCA A 3' 116 Exon 3 195 - 5' CCT CCA ggT Agg CTC
213 TCC A 3' 117 Exon 3 195 - 5' CCT CCA ggT Agg CTC
213 TCT g 3' 119 Exon 2 184 - 5' CTT CAC ATT CCg TgT
203 CTC CT 3' 126 Exon 3 212 - 5' CCA CTC CAC gCA CgT
230 gCC A 3' 133 Exon 2 229 - 5' ggA gCg CgA TCC gcA
246 ggC 3' 135 Exon 3 2I6 - 5' ggA gCC ACT CCA Cgg 234 ACC g 3' 136 Exon 3 216 - 5' gAg CCA CTC CAC gCA
233 CTC 3' 138 Exon 2 186 - 5' ggC CTT CAC ATT CCg 206 TgT gTT 3' 142 Exon 3 228 - 5' CAg gTA TCT gCg gAg 246 CCC g 3' 144 Exon 2 165 - 5' Tgg TCC CAA TAC TCA
184 ggC CT 3' 145 Exon 2 226 - 5' gCA ggg TCC CCA ggT
243 TCg 3' 152 Exon 3 163 - 5' ggg CCg CCT CCC AgT
179 TgT 3' 153 Exon 2 179 - 5' TCT gTg AgT ggg CCT
197 aCA CA 3' 154 Exon 2 184 - 5' CCT TCA CAT TCC gTg 204 TCT gCA 3' 155 Exon 3 216 - 5' gAg CCA CTC CAC gCA
233 CgT 3' 161 Exon 2 209 - 5' CCA CTC ggT CAg TCT
228 CTg AC 3' 165 Exon 3 105 - 5' gAg CgCA ggT CCT CgT
124 TCA A 3' 168 Exon 2 198 - 5' gTC TgT gAg Tgg gCC
217 aTC AT 3' 180 Exon 2 12 - 31 5' CAg CCA TAC ATC CTC
Agg AC 3' Table 5.
Group-specific exon pairs Primer SenseAntisenseSize HLA-A specificity mix PrimerPrimer of No. Name Product 1 1 140 142 247 A*0101,0102,8001 by 2 2 85 98 256 A*0201-0220 by 3 3 140 126 230 A*0301,0302,0303 by 4 36 167 168 164 A*0101,3601 by 11 118 119 195 A*1101-1103 by 6 23 129 115 209 A*2301 by 7 24 129 116 209 A*2402-2411 + I by 8 10.1 160 135 233 A*2501,2601-2603,2605,4301,6601 by 9 25 118 233 238 A*2501,2502 by 26 118 145 235 A* 2601,2602, 2604,4301 by 11 34 134 155 171 A*3401,3402 by 12 6602 134 136 240 A*6602,6603 by 13 10.2 118 161 222bp A*11,34,6601,6602,68011,6802,6901 14 43 118 154 196 A*4301 by I5 68 120 152 185 A*68011,68012,6802,6803 by 16 69 193 180 375 A*6901 by 17 19 127 165 124 A*2901,2902,31012,3201,3301-3303 by A*7401-7403 18 29 137 145 236 A*2901-2902 by 19 30 175 115 162 A*3001-3004 + 116 by 20 31 167 144 176 A*31012 by 21 32 167 133 159 A*3201,3202,2501,2502 by 22 33 137 138 198 A*3301-3303 by 23 74 202 153 370 A*7401,7403 by 24 80 140 136 234 A*8001 by In general, the foregoing group-specific primers may be modified by addition, deletion, or substitution of bases, to produce functionally equivalent primers with the substantially the same specificity, that is to say, such that the group specific polymorphism(s) are not removed. Such modifications may be constrained by several parameters. First, exact matching at the 3' end is particularly important for primer extension. Preferably, at least 5 nt are complementary to target DNA. When the exactly conserved region is short, for example, less than 10 nt, it is not advisable to change the primer sequences. The primer is preferably less than 50% G or C.
Also, the primers should be designed to avoid specific hybridization with pseudogenes or non-classical HLA Class I loci. In the examples which follow, the meiting temperature of all primers used was about 62C to ensure uniform amplification conditions.
For sequencing purposes, the following nucleic acid sequences are sequences which hybridize to all alleles of the indicated loci, in the locations indicated (and hence are referred to as universal sequencing primers). The primers in Table 6 are assigned consecutively SEQ ID NOS:237-244.

Table 6.
DesignationSequence LocationMelting Temp.

5'-Ex2(Aw3)5' GCG CCG GGA GGA GGG TC Int-1 58-62C
3' 3'-Ex2 5' ATC TCG GAC CCG GAG ACT Int-2 58C
3' 5'-Ex3 5' GTT TCA TTT TCA GTT TAG Int-2 60C
GCC A 3' 3'-Ex3(Aw6}5' CGG GAG ATC TAC AGG CGA Int-3 58-62C
TCA GG 3' 5'-Ex2(Aw3)5'GCG CCG GGA GGA GGG TC Int-1 58-62C
3' 3'-Ex2 5'GTC GTG ACC TGC GCC CC Int-2 58-62C
3' 5'Ex3 5'GGG CGG GGC GGG GCT CGG Int-2 58-62C
G 3' 3'Ex3(Aw6) 5'CGG GAG ATC TAC AGG CGA Int-3 58-62C
TCA GG 3' S'-Ex2 (Aw3)5' GCG CCG GGA GGA GGG TC Int-1 58-62C
3' 3'-Ex2(ABCwI)5' GGT CGT GAC CT(T/C)CGC Int-2 58-62C
CCC 3' 5'-Ex3(ABCw2)5' CCC GGT TTC ATT TTC 3' Int-2 58-62C

3'-Ex2(Aw6)5'CGG GAG ATC TAC AGG CGA Int-3 58-62C
TCA GG 3' The foregoing three groups of primers include 5' and 3' primers for sequencing across exons 2 and 3, respectively.
The selection of suitable universal sequencing primers is constrained by a variety of rules including the following. Sequencing primer hybridization sites must lie within the fragment amplified by the group specific amplification primers.
All primers are desirably selected to provide informative sequence and not start too far downstream of useful sequence. Preferred primers hybridize to conserved sites near the exon/intron boundaries.
Direct sequencing of the 2nd and 3rd exon may be performed from either the 5' or 3' end using the primers of Table 6 supra which are located in conserved regions of the 1st, 2nd and 3rd intron as indicated. These conserved regions were found to be identical in all samples investigated, regardless of the amplified group.
An important issue of direct sequencing for HLA class I genes is the generation of a specific PCR product, which is rather complicated due to the extensive sequence homologies between the different HLA class I loci including several pseudogenes. If an adequate PCR product has been generated, any sequencing chemistry should be applicable.
In the normal case, since group specific amplifications take place before sequencing, only one allele at a time is sequenced, resulting in unambiguous homozygous sequencing results. In these cases alleles are relatively easy to identify, even without software.
However, in about 5% of cases, both alleles come from the same group, but the sequence results show heterozygosity. In practice, when viewed by a fluorescence-detecting system, the sample appears as a normal sequence of bases with, sporadically, two bases at one site, each with half the peak height.
This result flows from the high degree of similarity shared among all alleles of each HLA
gene;
sequence heterozygosity flows from base substitutions. The laborious task of determining which alleles are present in the test sequence may be simplified using computer analysis. A software program called GeneLibrarian developed by Visible Genetics, the assignee of the present application, rapidly compares the test sequence to a database which includes all possible homozygote and heterozygote combinations of the alleles. The program identifies those stored sequences that are closest matched to the test sequence. The operator can then determine which allelic pair is in the test sample. If no allelic pair shows an exact match, the software allows the operator to review the test sequence to determine if errors in base-calling or other artifacts are interfering with the analysis.
The order of sequencing reactions may be selected by the operator.
Each exon of each locus may be sequenced on the sense strand or anti-sense strand. A
preferred method is to obtain sequence from one strand from each exon. If the results contain ambiguities, then the amplicon is re-sequenced using the other primer for the same exon. The availability of both sequencing primers provides redundancy to ensure robust results.
In some cases, it may be advantageous to employ an equimolar mixture of 2 or more oligonucleotide species. Mixtures of oligonucleotides may be selected such that between them they will effectively prime the sequencing reactions for all alleles of the locus at the same site.
In an alternative technique, instead of using dye terminators, a dye-labelled primer may be employed. In this case, the selected sequencing primers is labelled on the S' end with a detectable label, using phosphoramidite or NHS/dye ester techniques well known in the art. The label selected depends on the detection instrument employed. The label for use with an OpenGene System (Visible Genetics Inc., Toronto, ON) is the fluorophore Cy5.5 (Amersham Life Sciences, Cleveland OH). Fluorescein-isothio-cyanate may be used for detection with the ALF
Automated Sequencer (Pharmacia, Piscataway NJ). In this method, which is well known to one skilled in the art, the sequencing reaction mixture is changed slightly to include only one ddNTP per reaction mixture. For detection of reaction products, the sample may be mixed with an equal volume of loading buffer (5% ficoll plus a coloured dye). 1.5 ul of these samples may be loaded per lane of a MicroCel electrophoresis cassette loaded in a MicroGene Blaster automated DNA sequencer (Visible Genetics Inc., Toronto). The sample may be electrophoresed and read.
Results may be displayed and analyzed with GeneObjects software.
The sequence of bases may be determined, and the HLA allele to which the sequence corresponds may then be identified. This process may be performed for each locus (HLA-A, HLA-B, HLA-C) and the results may then be reported to the patient file.
It is well known in the art that different variations of sequencing chemistry may be employed with different automated DNA sequencing instruments.
Single dye instruments, such as the OpenGene System (Visible Genetics Inc., Toronto), the ALF Express (Pharmacia, Uppsala, Sweden) or the Li-Cor 4000L
(Lincoln City, Nebraska) generally use dye-labeled primers. In these systems a single chain termination sequencing reaction mixture is run per Lane.
Mufti-dye sequencers, such as the Prism 377 (applied Biosystems, Inc., Foster City, California) detect multiple dyes in a single lane. This technology conveniently employs dye-terminator chemistry, where the chain-terminating nucleotides are themselves labeled with fluorophores (see United States Patent No.
5,332,666, to Dupont de Nemours and Co.). In this case, the reaction products carrying four different labels may be run in a single lane.

Either single dye or mufti-dye chemistry may be employed according to the present invention, along with other sequencing chemistries. Additional methods for reducing the numbers of reactions required to obtain detailed sequence information from the classical HLA Class I loci are disclosed in commonly owned United States Patent Applications USSN 08/577,858 (for single-track sequencing) and USSN 08/640,672 and 08/684,498 (for single-tube sequencing).
Directly analogous methods may be used to determine the HLA-B type of an individual. As with the HLA-A gene, the second and third exon of the HLA-B
gene are polymorphic, and therefore provide for sequencing based typing strategies.
A list of primers, together with their sequence, length, and localization, is provided in Table 7 below. The primers in Table 7 are assigned consecutively SEQ ID
NOS:398-435.

TABLE

HLA-B
PCR-SBT
primer sequences A. Amplification primers Primer OrientSequence ~ N Tm Localization ~ ~

EI-B121m17S 5' CCA CCT gCT gCT 9 64 Exon 1, CTC ggg A 3' 1 27..45 E1-B129 S 5' CCT CCT gCT gCT 1862 Exon 1, CTC ggC 3' 27..44 E1-B130 S 5' CTg CTg CTC Tgg 1862 Exon 1, ggg gCA 3' 31..48 EI-B136 S 5' gAg ATg Cgg gTC 1860 Exon 1, ACg gCA 3' -3..15 E1-B182 S 5' CTg ACC gAg ACC 1860 Exon 1, Tgg gCT 3' 55..72 I1-B145 S 5' Agg Agg gTC ggg 1862 Intron 1, Cgg gTT 3' 90..108 I1-B154mS 5' ggg TCT CAg CCC I 60 Intron 1, CAC CTT 3' 8 114..121 I1-B167 S 5' gAg ggA AAT ggC 19G2 Intron 1, CTC TgC C 3' 17..35 II-B168 S 5' Cgg ggg CgC Agg 1864 Intron 1, ACC TgA 3' 59..76 II-B169 S 5' gCg CCg ggA ggA 1864 lntron 1, ggg TCT 3' 83..100 I1-B170 S 5' gCC TCT gTg ggg 1860 Intron 1, Agg AgA 3' 27..44 I1-B171 S 5' gCC TCT gTA ggg 1962 Intron 1, Agg AgC A 3' 27..45 I1-B172 S S' gTC ggg Cgg gTC 1862 Intron 1, TCA gCT 3' 97..114 I1-B173 S 5' Cgg ggg ACC gCg 1764 Intron 1, CCg gT 3' 73..90 I1-B174 S 5' ggT CTC AgC CCC 1860 Intron 1, TCC TCA 3' 105..122 I1-B175 S 5' gTg gAg TgC ggg 1860 Intron I, gTC ggC 3' -5..12 I1-B326 S 5' gTg AgT gCg ggg 1760 Intton 1, TCg gC 3' 1..17 II-B331 S 5' gAC CgC Agg Cgg 1762 Intron 1, ggg CT 3' 50..66 II-B346 S 5' TCT CAg CCC CTC 1860 Intron 1, CTC gCT 3' 107..124 I3-B126 AS 5' gCC ATC CCC ggC 1964 Intron 3, gAC CTA T 3' 36..54 I3-B147 AS 5' ggg ACC CCT gAT 1960 Intron 3, CAC TAT C 3' 220..238 I3-B AS 5' ggC CCT CAg Agg 1962 Intron 3, 164 AAA CTC g 3' 134..152 I3-B165 AS 5' Agg CCT gAg Agg 2162 Intron 3, AAA AgT CAT 272..292 3' I3-B166 AS S' Agg CgC TTT gCA 2162 Intron 3, TCT CTC ATA 535..555 3' I3-B187 AS 5' gAT CAg TAT TCT 2160 Intron 3, Agg gAC TgA 209..229 3' I3-B212 AS 5' gAA Tgg ACA ggA 2062 Intron 3, CAC CTg gT 3' 481..500 WO 99/07883 PCTlCA98/00768 TABLE

HLA-B
PCR-SBT
primer sequences A. Amplification primers Primer OrientSequence NaTm Localization I3-B305 AS 5' TCA TgC CAT TCT 2160 Intron 3, CCA TTC AAC 106..126 3' I3-B319 AS 5' CTA ggg ACT gTC 2062 Intron 3, TTC CCC TA 3' 200..219 I3-B320 AS 5' CgC TgA TCC CAT 2060 Intron 3, TTT CCT CT 3' 69..88 I3-B321 AS 5' CAg AgA ACA Agg 2060 Intron 3, CCT gAg AA 3' 282..301 I3-B323 AS 5' AAC CCA gAC ACC 1960 Intron 3, AgC ggA T 3' 443..463 I3-B332 AS S' ggA CTT CTg CTC 2060 Intron 3, CTg ATC TA 3' 363..382 I3-B335 AS 5' gAg gCC ATC CCg 1862 Intron 3, ggC gAT 3' 40-57 I3-B337 AS 5' ggA AAg TTC gAg 2162 Intron 3, TCT CTg AgT 3' 392..412 I3-B342 AS 5' CTC ATg CCA TTC 2060 Intron 3, TCC ATT CC 3' 108..127 I3-B347 AS 5' TgA CCA gCC TgA 1960 Intron 3, gAA Tgg g 3' 494..512 I3-B348 AS 5' AAC Agg gAC TTC i960 Intron 3, TgC TCC C 3' 369..387 I3-B349 AS 5' C CT A A A AAA TC 2062 Intron 3, AC 3' 272..291 Suitable primer mixes for HLA-B typing are set forth in Table 8 below.
TABLE

HLA-B
PCR-SBT
primer mixes PrimerMix Sense AntisenseSize of HLA-B specificity o. primer primer product ame 1 7 I1-B174 I3-B305 943bp 0702-0708,4801-4803,8101 2 8 I1-B167 I3-B323 1368bp 0801-0804,4201 3 13 I1-B175 I3-B319 1145bp 1301-1304 4 14 I1-B145 I3-B321 1132bp 1401,1402 S 15 E1-B121m17I3-B147 1204bp 1501-1537,4601 6 18 II-B154m I3-B164 960bp 1801-1805 7 27 E1-B182 I3-B349 1231bp 2701-2711,4002-4006,4008, 4009, 4701 TABLE

HLA-B
PCR-SBT
primer mixes timer MixSense AntisenseSize of HLA-B specificity o_ primer primer product fame 8 35 II-B168 3-B212 363bp 501-3521,5101-5109,5201, I 1 3 301, 5302,5801,5802,7801, 9 37 I1-B326 3-B165 1213bp 801-1805,3701,3702 16 I1-B167 I3-B320 993bp 3801,3802,3901-3912, 6701, 1401, 1402 11 60 I1-B172 I3-B342 952bp 4001,4007,4010 12 41 I1-B172 I3-B323 1288bp 4101,4102 13 42 I1-B174 13-B323 1280bp 4201,4202 14 44 I 1-B 170 I3-B 126 1323bp 4402,4410 45 I1-B326 I3-B348 1307bp 4501 16 47 I1-B33 I3-B332 1254bp 4701,4702 t 17 48 I1-B174 I3-B332 1199bp 4801-4803 31 49 I1-B326 I3-B337 1332bp 4901 18 50 I1-B326 I3-B187 1155bp 5001,5002 ~19 22 I1-B169 I3-B166 1394bp 5401,5501-5505,5601-5603, 57 I1-B171 I3-B347 1407bp 5701-5704 21 73 I1-B173 I3-B335 909bp 7301 22 78 II-B168 I3-B212 1363bp 7801,7802 X23 82 I1-B346 I3-B126 868bp 8201 24 MultiI1-B326 I3-B126 975bp most 15,1801-1805,2701-2711 I1 4001-4010,4101, 4102,4501,4601, 4901,5001,5002,5701-5704 Multi I1-B167 I3-B126 959bp 0702-0708,0801-I2 0804,1401,1402, 3801, 3802,3901-3912,4201,4202, 4801-4803,6701,7801,8101 .~ ~ __r _____~_ _ _ ...~..

TABLE

HLA-B
PCR-SBT
primer mixes PrimerMix Sense AntisenseSize of HLA-B specificity o, primer primer product ame 26 MultiI1-B168 I3-B126 917bp 0702-0708,0801-I3 0804,1401,1402, 3521,3801,3802,3901-3912, 4201,4202,4801-4803,5101-5109, 5201,5301,5302,5801,5802, 6701, 8101 27 MultiE1-B129 I3-B126 1022bp 0702-0708,0801-E 0804,1401,1402, 3801,3802,3901-3912,4001,4007, 4010,4101,4102,4201,4202,45 O1, 4801-4803,4901,5001,5002,6701 28 MultiE1-B130 I3-B126 1018bp 1301-1304,1801-1805,2701-E2 2711, 3501-3521,3701,3702,4002-4006, 4008,4009,4402-4410,5101-5109, 5201,5301,5302,5701-5704,5801, 5802,7801,7802,8101 29 Multi E1B-182 I3-B126 994bp 1801-1805,2701-E3 2711,3701,3702, 4006,4008,4009,4701 30 Multi E1B-136 I3-B126 1051bp 4001,4007,4010,4101,4102,45 E4 O1, 4901,5001,5002,5401,5501-5505,5601-5603,5701-5704,5901 Sequencing primers suitable for HLA-B typing are set forth in Table 9, below.

B.B. Seauencing primers Bseq2 AS 5' ggA TCT Cgg ACC Cgg AgA CTC g 3' 22 74°C Intron 2, 70..91 Mismatch for B*7301 at Pos. 9 and 10 from 3' end For Sequencing of HLA-B
exon 2 Bseq3 S 5' ACC Cgg TTT CAT TTT CAg TTG 3' 21 60°C Intron 2,153..173 For Sequencing of HLA-B exon 3 Bseq3AB S 5' TTT ACC Cgg TTT CAT TTT CAg TT 3'23 62°C Intron 2,150..172 For Sequencing of HLA-A and B exon Mismatch for B*7301 at Pos. 8 and 9 from 3' end Mismatch for A*8001 at Pos. 19 from 3' end HLAB3X3.SEQ 5'TCC CCA CTG CCC CTG GTA 18 55°C Intron 3, 2-19 (also BC33, 3IN3BC02) No requirement for DEAZA
HLAB5X3.SEQ 5'GGK CCA GGG TCT CAC A 16 55-C Intron 2, 258-(also BC5X3INEX) Exon 3, 9 Requirement for DEAZA
HLAB3X2.SEQ 5'ATC TCG GAC CCG GAG ACT 18 60°C Intron 2, 78-98 (also A seq3) Requirement for DEAZA
HLABSX2.SEQ 5'TCC CAC TCC ATG AGG TAT TTC 21 55°C Exon 2, 3-23 (also ABC25, SPE2, 5PE2) No requirement for DEAZA
The primers in Table 9 are assigned consecutively SEQ ID NOS:436-442.
The protocol described in working example 8, infra, may be used to accomplish HLA-B typing using the foregoing materials.
The nucleic acids described above may be comprised in a kit for use in practicing the methods of the invention. In addition to the group-specific primers and primer pairs disclosed, such kits may further comprise buffers, reagents, and enzymes such as, amplification enzymes including but not limited to, Taq polymerase.
In specific, non-limiting embodiments, the kit may comprise group-specific exon region primers (for example, as a "cocktail" comprising a plurality of primers) as well as group-specific untranslated region primers; such primers may be contained in individual tubes.
In a specific, nonlimiting embodiment of the invention, the following method may be used to perform allele typing, here exemplified for HLA-B but, depending on the choice of primers, applicable to HLA-A as well. The following reagents may be used: 2.5 mM deaza dNTP Mix (2.5 mM dATP, 2.5 mM dCTP, 2.5 mM dTTP, 1.25 mM dGTP, 1.25 mM 7-DEAZA dGTP); 166 mM ammonium sulphate (Sigma BioSciences); 100% DMSO; PCR primers (e.g., pairs selected from Table 8); genomic DNA control (60 ng/pl); Sequencing Buffer (260 mM Tris-HCI, pH 8.3, 39 mM MgCIZ); 300:1 deaza terminators, including deaza A terminator (750 pM dATP, 750 pM dCTP, 560 pM dGTP, 750 ~M dTTP, 190 pM 7-deaza dGTP, 2.5 ~M ddATP), deaza C terminator (750 uM dATP, 750 ~M dCTP, 560 pM dGTP, 750 1rM dTTP, 190 uM 7-deaza dGTP, 2.5 pM ddCTP), deaza G terminator (750 ~M
dATP, 750 pM dCTP, 560 ~.M dGTP, 750 pM dTTP, 190 pM 7-deaza dGTP, 2.5 p.M
ddGTP) and deaza T terminator (750 pM dATP, 750 pM dCTP, 560 pM dGTP, 750 pM dTTP, 190 pM 7-deaza dGTP, 2.5 ~M ddTTP); Sequencing Primers Sx2.seq, 3x2.seq,5x3.seq, 3x3.seq (see, e.g., Table 9); Thermosequencase 32 U ~l (e.g., Thermosequenase cycle sequencing core kit, Amersham LifeScience, Product No.
US
79610); Enzyme Dilution Buffer ( 10 mM Tris-HCI, pH 8, I mM 2-ME, 0.5% (v/v) Tween-20, 0.5% (v/v) NP-40 ; e.g., from Amersham LifeScience); Pink Loading Dye (Amersham); lOX PCR Buffer II (10 mM Tris-HCI, pH 8.3; S00 mM KCl); Taq DNA
polymerase (e.g., Perkin Elmer or Roche); 25 mM MgClz; molecular grade water, and mineral oil (to prevent evaporation if a thermocycler without a heated lid is used).
Apparatus used in the method may include a thermocycler (e.g., PE 9600 or MJ
PTC) wherein the ramping time is adjusted to 1°C/sec, and tubes and trays supplied by the manufacturer of the thermocycler, wherein the use of trays and tubes fabricated from polypropylene rather than polystyrene is preferred.
First, according to the specific embodiment referred to in the preceding paragraph, the following HLA Locus Amplification Protocol may be used.
Reagents (except enzyme) may be thawed at room temperature, vortexed, and microfuged briefly, and placed on ice prior to use. Enzyme may be removed from the freezer when needed. On ice, the following master mix may then be prepared by combining, in the following order, (quantities provide for one 25 pl reaction): molecular grade water 7.75 pl; l OX PCR Buffer II (without MgCl2) 2.5 ~1; 2.5 mM deaza dNTP
Mix 2.0 pl; 25 mM MgCh 1.5 pl; 100% DMSO 2.5 pl; 166 mM Ammonium Sulphate 2.5 pl; PCR primers 1.0 pl; and SU/~l Tag polymerase 0.25 (pipet gently up and down to mix). The master mix (which has a volume of 201} may then be introduced into a labelled 0.2 ml thin-walled amplification tube, and 5 ~l of 60 ng/pl genomic DNA
may be added to produce a final concentration of 300 ng of DNA per reaction.
The resulting reaction mixture may then be subjected to the following cycles in a thermocycler to result in amplification:
( 1 ) denaturation at 94°C for 5 minutes, cycle 1 X with (2) denaturation at 94°C for 30 seconds;
(3) annealing at 63°C for 30 seconds, cycle 35X with (4) extension at 72°C for 60 seconds;
(5) extension at 72°C for 5 minutes, cycle 1X; and (6) soak at 4°C, cycle 1 X.
To analyze the resulting amplification product, a 1% agarose gel containing ethidium bromide may be prepared, and 4 pl of the PCR product may be loaded on the gel. Samples may then be run into the gel electrophoretically, along with size markers, and the size of the fragment may be compared with the size of the expected product (see, for example, Table 8).
The resulting amplification product may then be sequenced as follows.
Four .2 ml thin-walled tubes may be placed on ice and labelled A, C, G and T, respectively. Three microliters each of deaza A, C, G and T terminators may be introduced into the appropriately labeled tube. Thermosequenase enzyme may then be diluted 1/10 in a separate tube by combining 1 pl of thermosequenase with 9 pl of enzyme dilution buffer, on ice. In a separate .5 ml tube, on ice, the following may be combined to form a master sequencing mix: Sequencing Buffer 2.5 p.l;
Sequencing Primer 2.5 pl; 100% DMSO 3.5 wl; amplification product 4.5 pl; molecular grade water 6.0 pl; 1/10 diluted Thermosequenase 3.0 ~1 (TOTAL VOLUME 22 pl). Five microliters of the foregoing master sequencing mix may then be added to each of the four tubes containing the deaza terminators. If necessary, the reaction mixtures may be covered with 8 ~.l of mineral oil and subjected to the following cycle sequence:
( 1 ) denaturation at 94°C for 2 minutes, cycle 1 X with (2) denaturation at 94°C for 30 seconds;
(3) annealing at 55°C for 30 seconds, cycle 35X with ' (4) extension at 70°C for 60 seconds;
(5) extension at 70°C for 2 minutes, cycle 1X; and (6) soak at 4°C.
The reaction products may then be run on a sequencing gel to ascertain the sequence of the amplification product, using standard techniques.
Methods of high resolution typing are detailed in the examples below, which examples are set out to exemplify the method of the invention and not to limit the scope of it in any way.
6.EXAMPLE: DETERMINATION OF HLA-A GRO TYPE
Genomic DNA was prepared from patient samples according to standard methods, such as a standard salting-out procedure (as provided by the Puregene DNA Isolation Kit, Gentra Systems, Inc., Minneapolis) or by detergent and proteinase K treatment (Current Protocols in Molecular Biology, Eds. Ausubel, F.M.
et al, (John Wiley & Sons; 1995)).
All primers were synthesized on a Gene Assembler plus (Pharmacia, Uppsala, Sweden), and purified by fast protein liquid chromatography. The sequence, length, melting temperature (Tm), group specificity localization of the primers are given in Tables 3 (sense primers), 4 (antisense primers) and S (primer pairs).
Internal positive control primers were: 5' primer hGHI 5'GCC TTC CCA ACC ATT CCC
TTA 3', (SEQ ID N0:336) 2lmer, Tm=64°C, nucleotide position 5560-5580; 3' primer hGHI 5' TCC ATG TCC TTC CTG AAG CA 3', (SEQ ID N0:349) 20mer, Tm=60°C, nucleotide position 6614-6633. These control primers amplify a 1074 by fragment of the human growth hormone gene.
Group-specific identification was performed as follows. Aliquots of genomic DNA were separately reacted with a panel of 24 group-specific exon region primer pairs set forth in Table S, supra (see Blasczyk et al., 1995, Tissue Ant. 46:86-9S). An amplification cocktail for pairs of primers was prepared in 10 pl volume using standard lOx Perkin-Ehner buffer (lx buffer: SO mM KCI; 1.5 mM MgClz; 10 mM Tris-Hcl, pH 8.3; 0.001% (w/v) gelatin) supplemented with S% glycerol and 0.1 pl Cresol-red, sodium salt (Cresol-red stock solution:l0 mg/ml). The use of glycerol and cresol red avoids the necessity of using an agarose gel loading buffer.
Additionally, glycerol increases the PCR yield.
The PCR mix for a single SSP tube was as follows:
Genomic DNA 100 ng - 1.00 pl Taq polymerase, 0.4 U - 0.08 ~ 1 dNTPs, 10 mM - 0.80 ~1 Buffer, lOx - 1.00 pl Glycerol - 0.50 pl Cresol red lOmg/ml - 0.10 pl dHzO - 1.52 pl Primer Pair + Control Primer Pair - 5.00 ul Total 10.00 pl The PCR solution was prepared in volumes that would accommodate 30 reactions. The amount of primers used in each 10 pl PCR volume was 3 pmol of each HLA-A primer and 0.8 pmol of each internal control primer.
The reaction mixture was mixed well, then heated in a Thermo-Cycler 9600 (Perkin-Elmer, Inc) and subjected to the following protocol. After an initial denaturation, a first round with 10 two-temperature cycles was followed by 20 three-temperature cycles.
1 ) Initial denaturation at 9S°C for S min.
2) First 10 cycles i) Denaturation at 95°C for 30 sec.
ii) Annealing and extension at 6S°C for SO sec.
3) Last 20 cycles i) Denaturation at 9S°C for 30 sec.

ii) Annealing at 62°C for 50 sec.
iii) Extension at 72°C for 30 sec.
The reaction tube was then cooled on ice. For visualization, 8 ul of the amplification product were run on a 2 % agarose gel prestained with ethidium bromide (0.2 ug/ml). The results were compared to a control lane with known size markers. The reaction products were visualized either as two bands (alleles from different groups) or a single band (alleles from same group). The size of the bands) were determined and group specificity was assigned according to the length assignments in Table 5.
Figures 10 and 1 I show typical gel results, which, as shown in Tables 7 and 8, were interpreted to determine what group specificities were present in genomic DNA samples tested. In Tables 10 and I 1, the column titled "Position"
refers to the primer mix no. of Table 5.
Table 10.
PositionHj,~S_necificitv Kontr. Species ampl. PM

1 A*0101,0102,8001 1 2 A*0201-0217 2 3 A*0301,0302 3 4 A*0101,3601 36 S A*1101,1102 11 6 A*2301 23 7 A*2402-2407 24 8 A*2603,2605,6601 X I0.1 9 A*2501 25 A*2601,2602,2604,4301 26 11 A*3401,3402 34 12 A*6602 6602 13 A*1I01,1I02,3401,3402, X 10.2 6601,6602, A*68011,6802,6901 14 A*4301 43 1 S A*68012,6802,6803 68 16 A*6901 69 17 A*2901,2902,3101,3201 X 19 3301-3303, A*7401 18 A*2901,2902 29 19 A*3001-3004 30 A*3101 31 21 A*3201,250I X 32 Table 11.
PositionHLA Specificity Kontr. ies Amy PM
Spec 1 A*0101,0102,8001 1 2 A*0201-0217 X 2 3 A*0301,0302 3 4 A*0101,3601 36 A* 1 I 01,1102 11 6 A*2301 23 7 A* 2402-2407 24 8 A*2501,2601-2603, 10.1 2605,6601 9 A*2501 25 A*2601,2602,2604,4301 26 11 A*3401,3402 34 12 A*6602 6602 13 A* 11 Ol ,1102,3401,3402 X 10.2 6601,6602, A*68011,6802, 14 A*4301 43 I S A*6801,6802 X 68 16 A*6901 69 I 7 A*2901-2902,3101,3201, 19 3301-3303, A*7401 18 A*2901,2902 29 19 A*3001-3004 30 7. EXAMPLE: DETERMINATION OF GROUP SPECIFICITY USING
A PRIMER COCKTAIL
Group specific low-resolution typing of the patient sample may be performed as follows. First, a stock PCR amplification reaction mixture may be prepared for 30 reactions:

dNTPs IOmM 24 Glycerol 100% 1 S

lOx PCR Buffer* 30 Cresol-red ( l Omg/ml)3.0 final 117 * 1 X PCR Buffer comprises 10 MM Tris-HCl pH 8.3, SO mM KCL, 1.5 mM MgCl2 and 0.001 % (w/v) gelatin.
The stock mixture may be prepared in a large volume and be stored for at least one month at 4°C or be aliquoted (1 I7.0 ~.1) and stored at -30°C for at least six months. Repeated thawing and freezing should be avoided.
A mixture containing all the HLA-A group specific amplification primers listed in Table 5 may be prepared separately (the "Cocktail"). One member of each primer pair is Labelled on the S' end with a fluorescent Label. Final Cocktail concentrations may be designed to provide 3 pmol of each HLA-A primer per S
~.1.
Optionally, an internal control primer may be added (to determine among other things, the success of amplification) in the amount of 0.8 pmol per 5 u1.
Suitable internal control primers amplify a 1074 by fragment of the human growth hormone gene (see supra).
To perform the low resolution amplification reaction, the reaction mixture may be prepared as follows:
Volume Stock Mixture 5 ~1 Cocktail 5 ~l Patient sample DNA 100-250 ng 1 ~l Taq Polymerase Enzyme 0.4 U 0.08 ~l PCR cycle parameters may be adjusted for a Perkin-Elmer System 9600 thermal cycler. After an initial denaturation, a first round with 10 two-temperature cycles may be followed by 20 three-temperature cycles: I ) Initial Denaturation at 95°C for 5 min; 2) First 10 cycles i) Denaturation at 95°C far 30 seconds and ii} Annealing and extension at 65°C for 50 seconds; 3) Last 20 cycles i) Denaturation at 95°C for 30 seconds, ii) Annealing at 62°C for SO seconds and iii) Extension at 72°C for 30 seconds.
The reaction tube may then be cooled on ice. For visualization, 2u1 of the amplification product may be run on a polyacrylamide gel giving single nucleotide length resolution such as in a MicroGene Blaster. The results were compared to a control lane with known size markers. The reaction products may be visualized either as two bands (alleles from different groups) or a single band (alleles from same group). The size of the bands) may be determined and group specificity may be assigned according to the length assignments in Table 5.
8. EXAMPLE: DETER_M_INATION OF ALLELIC TYPE BY SE~L1-ENCING
After determining group type specificity, group specific amplification of a fresh portion of the patient sample may be performed using a single pair of primers specific for the group in question to generate sequencing template. In a pre-ferred, nonlimiting embodiment, amplification primers may be selected from Table 2, supra, which lists group-specific untranslated region primers. This second amplification serves two purposes. First, it confirms, by successful amplification, the group determination of the low resolution test. Second, it generates sequence information which may be used for accurate allele identification. If two groups are identified, two separate reactions may be performed each using a different primer pair.
8.1. PCR PROTOCOL
The same PCR protocol may be used for all primer mixes used for template generation. The PCR amplification may be set up in a total volume of 50u1 in order to produce enough PCR product for more than 10 sequencing reactions.
This ensures that, if anything fails during the sequencing process, sequencing can be repeated without generation of a new template. The high stringency of the PCR
primers and protocol detailed below makes the use of a "hot start approach"
unnecessary. The following PCR reaction mix may be used:
volu~e_ per reaction 5X PCR buffer* 10.01 DMSO 1.O~cl 2.SmM each dNTP S.O,u1 ddH20 27i8u1 Total 43.8,u1 Sense primer** (lOpmol/~1) 1.0/cl Antisense primer**(l0pmol/ul) l.Oul Taq Polymerase (SU/~l) 0.2~c1 Genomic DNA (100ng/~cl) 4.Oul Final Total 50.O~c1 *Composition of SX PCR buffer:75mM (NH4)2S04; l7.SmM MgClz; and 300mM Tris-HCL, pH 9.0 **The pair of group specific amplification primers may be selected from those disclosed in Table 2, supra.
PCR cycle parameters may be adjusted for a Perkin-Elmer System 9600 thermal cycler. After an initial denaturation, a first round with 10 two-temperature cycles may be followed by 20 three-temperature cycles.
1.) Initial Denaturation at 95 C for 5 min 2.) First 10 cycles i) Denaturation at 95 C for 30 seconds ii) Annealing and extension at 65 C for 50 seconds 3.) Last 20 cycles i) Denaturation at 95 C for 30 seconds ii) Annealing at 62 C for SO seconds iii) Extension at 72 C for 30 seconds l0~cl of the PCR product may then be run on a 2 % agarose gel prestained with ethidium bromide (0,2 ~g/ml). A distinct band of the expected size should be seen.
8.2. SEQUENCING REACTION PROTOCOL
The sequencing reactions may be carried out with AmpliTaqTM DNA
Polymerase FS dye terminator cycle sequencing chemistry using the Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit FS (Perkin Ehner Applied Biosystems Division, Foster City, CA) according to the manufacturer's protocol. This Kit contains the four ddNTPs with different fluorescence labels (=Dye Terminators). The PCR
fragments may be used directly for sequencing without any prior purification step.
To simplify the pipetting steps, a master mix may be prepared consisting of the 5'Biotin labeled sequencing primer, ddH20 and the Kit reagents.
This master mix should be prepared immediately prior to use and can be kept at room temperature until use. The sequencing master mix for one reaction may comprise 3.0 ~1 of a lpmol/~1 solution of sequencing primer; 6.0 ~1 ddH20, and 8.0 ul of premixed sequencing reagents; for 36 + 1 reactions, these amounts are increased, respectively, to 111.0 p.l; 222.0 ~1; and 296.0 pl, respectively. The sequencing primer may be selected from the sequencing primers for HLA-A set forth in Table 6, supra.:
The master mix may be aliquoted in a volume of 17,u1 for each sequencing reaction in a 200,u1 PCR tube and 3/cl of the unpurified PCR
product are added. The reaction mixes may then be subjected to 25 cycles in a Perkin Elmer thermal cycler 9600. Each cycle consists of 10 sec 95 C, 5 sec 50 C and 4 min 60 C.
8.3. PURIFICATION OF EXTENSIO~PR_ODUCTS
After the sequencing reaction the extension products are desirably separated fi-om the unincorporated Dye Terminators which would otherwise interfere with the fluorescence-based detection process of the electrophoretically separated sequencing fragments.
For each sequencing reaction, 50 pg (5 p.l) Streptavidin-coated Dynabeads M-280 (Dynal Inc., Oslo, Norway) may be washed in 5 pl of 2x Binding and Washing buffer ("B&W"; 2X B&W buffer: 2M NaCI, lOmM Tris-HCl pH 7.5, 1mM EDTA). The beads may then be resuspended in 20 ~1 of 2x B&W.
To each 201 sequencing reaction, 20~c1 of resuspended beads may be added, and the mixture may be incubated at room temperature (20-25 C) for 15 minutes. The beads may then be immobilized, the supernatant may be removed, and then the beads may be washed once in 70% ethanol by pipetting up and down five times. Then, as much as possible of the ethanol may desirably be removed, because residual ethanol may interfere with electrophoretic gel mobility.
For each sequencing reaction, 4ul of loading buffer (S:1 Formamide-25mM EDTA pH 8.0, SOmg/ml Dextran Blue) may be added.
8.4. ELECTROPHORESIS AND DATA~OLLECTION
Samples prepared by the foregoing methods may be used immediately or be stored at 4 C at least for 24 hours before starting the electrophoretic separation.
Prior to the electrophoretic separation, each reaction may be incubated at 90 C for 2 minutes. 3u1 of each sample may be loaded on a prerun sequencing gel. For an automated ABI 377 sequencer (Applied Biosystems, Foster City, CA) a 0,2mm thick 5% polyacrylamide (acrylamide:bisacrylamide = 29:1) - 7 M urea gel may be used [gel composition: 21.0 g urea, 8.4 ml 30% acrylamide (stock solution: 58g acryl-amide, 2g bisacrylamide in bidistilled water), 6.0 ml TBE buffer (lOx TBE-buffer:
108.0 g tris base, 55.0 g boric acid, 7.4 g Na2EDTA), 15 ul TEMED, 350 ~cl 10%
Ammoniumpersulfate ( 1.0 g Ammoniumpersulfate in 10 ml ddHzO), 20.0 ml ddH2oJ. Electrophoresis may be run at constant 48 watt for 8h. Data collection may be initiated immediately after starting the electrophoresis on the ABI377. Data analyses may be performed thereafter using the ABI analysis software (version 2.1.1).
8.5. DATA INTERPRETATION AND HLA TYPING
After data collection, the chromatograms may be printed and sequences may be compared manually to existing HLA data in the EMBL databank and the sequences compiled by Arnett and Parham. Due to the group-specific amplification and the lack of heterozygous positions, manual analysis is typically very fast. Alternatively, sequences may be checked with the data analysis editor (Sequence NavigatorTM, Applied Biosystems) and aligned with any sequence alignment program.
Various publications are cited herein, the contents of which are hereby incorporated by reference in their entireties.

SEQUENCE LISTING
<110> BLASCZYK, RAWER
LEUSHNER, JAMES
< 120> METHOD AND KIT FOR CLAS S I HLA TYPING
<130> 30861A
<140> 08/909,290 <141> 1997-08-11 <150> 08/766,189 <151> 1996-12-12 < 160> 442 <170> FastSEQ for Windows Version 3.0 <210> 1 <211 > 450 <212> DNA
<213> homo Sapiens <400> 1 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctcttttg ggagccgtac ccggggcagg gagaggaaag tgaaaagtag ggcattagag 420 acagggactt gacctgaggg actgagggtg 450 <210> 2 <211 > 449 <212> DNA
<213> homo Sapiens <400> 2 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct acttcctggg atgcatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg tcctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gtaatagaga~ 420 cagggacttg acctgaggga ctgagggtg 449 <210> 3 <211> 449 <212> DNA
<213> homo Sapiens <400> 3 gagccgcaga cccctcttag actcagggcc acccacgcac gcccgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct acttcctggg atgcatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgagac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg tcctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gtaatagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 4 <211 > 449 <212> DNA
<213> homo sapiens <400> 4 gagccccaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttctcgctgg 60 cgcttctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct acttcctggg atgcatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgagaaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg tcctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gtaatagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 5 <211> 449 <212> DNA
<213> homo sapiens <400> 5 gagccccaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttctcgctgg 60 cgettctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct acttcctggg atgcatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgagaaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg tcctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gtaatagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 6 <211 > 449 <212> DNA
<213> homo sapiens <400> 6 gagccgcaga cccctcttag actcagggcc acccacgcac gcccgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct acttcctggg atgcatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgacact gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gtaatagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 7 <211> 449 <212> DNA
<213> homo sapiens <400> 7 gagccgcaga cccctcttag actcagggcc acccacgcac gcccgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct acttcctggg atgcatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgacact gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gtaatagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 8 <211 > 449 <212> DNA
<213> homo sapiens <400> 8 gagccgcaga cccctcttag actcagggcc acccacgcac gcccgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct acttcctggg atgcatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgacact gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gtaatagaga 420 cagggacttg acctgaggga ctgagggtg ~ 449 <210> 9 <211> 448 <212> DNA
<213> homo Sapiens <400> 9 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gggggttagg tatgtggcgg aagccccgga 240 ctctgggact ctcggtgcgg accccgggac cctgaagcgg gactggggag acgaagacac 300 ggttcgcgag acagagttac agagggactc agaaccgggt tctcgacaga ctctttgttc 360 cctctttggg agccgtaccc ggggcaggga gaggaaagtg aaaaataggg cattagagac 420 agggacttga cctgagggac tgagggtg 448 <210> 10 <211 > 449 <212> DNA
<213> homo sapiens <400> 10 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 11 <211> 449 <212> DNA
<213> homo Sapiens <400> 11 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 12 <211> 449 <212> DNA
<213> homo sapiens <400> 12 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgta 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 13 <211 > 449 <212> DNA
<213> homo sapiens <400> 13 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgta 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 14 <2I 1> 449 <212> DNA
<213> homo sapiens <400> 14 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgta 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 15 <211> 449 <212> DNA
<213> homo Sapiens <400> 15 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact tagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 16 <211> 449 <212> DNA
<213> homo sapiens <400> 16 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact tagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 17 <211 > 449 <212> DNA
<213> homo Sapiens <400> 17 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact tagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 18 <211 > 449 <212> DNA
<213> homo sapiens <400> 18 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact tagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 19 <211> 449 <212> DNA
<213> homo sapiens <400> 19 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact tagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 20 <2 I 1 > 449 <212> DNA
<213> homo sapiens <400> 20 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttgtcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaagaca 300 cggttcgcga gacagagtta cagagggact tagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 2l <211> 449 <212> DNA
<213> homo sapiens <400> 21 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg GO
cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccgtctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgaga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 22 <211 > 449 <212> DNA
<213> homo sapiens <400> 22 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatatggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 3G0 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 23 <211> 449 <212> DNA
<213> homo sapiens <400> 23 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 24 <211> 449 <212> DNA

<213> homo sapiens <400> 24 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatatggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 25 <211> 449 <212> DNA
<213> homo sapiens <400> 25 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 26 <211> 449 <212> DNA
<213> homo sapiens <400> 2G
gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgta 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 27 <211> 449 <212> DNA
<213> homo sapiens <400> 27 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgta 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaaatagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 28 <211 > 449 <212> DNA
<213> homo sapiens <400> 28 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccgtctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgaga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 29 <211 > 449 <212> DNA
<213> homo sapiens <400> 29 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccgtctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgaga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 30 <211 > 449 <2I2> DNA
<2I3> homo sapiens <400> 30 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180.
acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccatgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gacccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 31 <211> 449 <212> DNA
<213> homo Sapiens <400> 31 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccgtctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 32 <211> 449 <212> DNA
<213> homo Sapiens <400> 32 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag I 20 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg I 80 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccatgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gacccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 33 <211> 449 <212> DNA
<213> homo sapiens <400> 33 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg - 240 actctgggac tctcggtgcg gaccccggga ccatgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gacccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 34 <211 > 449 <212> DNA
<213> homo sapiens <400> 34 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccgtctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 35 <211> 18 <212> DNA
<213> homo Sapiens <400> 3 5 acccgggaag ccgggcct 1 g <210> 36 <211> 449 <212> DNA
<213> homo sapiens <400> 36 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccgtctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 37 <211 > 449 <212> DNA
<213> homo Sapiens <400> 37 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt taccctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccgtctccct cttttctttg 180 acgcctcaac cccttagggg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cggttcgcga gacagagtta cagagggact cagaaccggg ttctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 38 <211 > 449 <212> DNA
<213> homo Sapiens <400> 38 gagccgcaga cccctcttag actcagggcc acccacgcac gcctgaaatc ttggcgctgg 60 cgctgctgtg actaaccgaa gagacctttg ggctgtgggt tatcctcact cttgacccag 120 gcgcagcact cataggtcct tcttcctggg atgtatccaa ccctctccct cttttctttg 180 acgcctcaac cccttagagg ttccgaccct gaggggttag gtatgtggcg gaagccccgg 240 actctgggac tctcggtgcg gaccccggga ccctgaagcg ggactgggga gacgaggaca 300 cgcttcgcga gacagagtta cagagggact cagaaccggg tcctcgacag actctttgtt 360 ccctctttgg gagccgtacc cggggcaggg agaggaaagt gaaaagtagg gcattagaga 420 cagggacttg acctgaggga ctgagggtg 449 <210> 39 <211> 130 <212> DNA
<213> homo sapiens <400> 39 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 40 <211> 130 <2I2> DNA
<213> homo sapiens <400> 40 *rB

gtgagtgcgg ggtcgggagg gaaaccgcct ctgcggggag aagcaagggg ccctcctggc 60 gggggcgcag gaccggggga gccgcgccgg gaggagggtc gggcaggtct cagccactgc 120 tcgcccccag 130 <210> 41 <211> 130 <212> DNA
<213> homo Sapiens <400> 41 gtgagtgcgg ggtcgggagg gaaaccgcct ctgcggggag aagcaagggg ccctcctggc 60 gggggcgcag gaccggggga gccgcgccgg gacgagggtc gggcaggtct cagccactgc 120 tcgcccccag 130 <210> 42 <211> 130 <212> DNA
<213> homo Sapiens <400> 42 gtgagtgcgg ggtcgggagg gaaaccgcct ctgcggggag aagcaagggg ccctcctggc 60 gggggcgcag gaccggggga gccgcgccgg gaggagggtc gggcaggtct cagccactgc 120 tcgcccccag 130 <210> 43 <211> 130 <212> DNA
<213> homo sapiens <400> 43 gtgagtgcgg ggtcgggagg gaaaccgcct ctgcggggag aagcaagggg ccctcctggc 60 gggggcgcag gaccggggga gccgcgccgg gaggagggtc gggcaggtct cagccactgc I20 tcgcccccag 130 <210> 44 <211> 130 <212> DNA
<213> homo Sapiens <400> 44 gtgagtgcgg ggtcgggagg gaaaccgcct ctgcggggag aagcaagggg ccctcctggc 60 gggggcgcag gaccggggga gccgcgccgg gaggagggtc ggtcaggtct cagccactgc 120 tcgcccccag 130 <210> 45 <211> 130 <212> DNA
<213> homo sapiens <400> 45 gtgagtgcgg ggtcgggagg gaaaccgcct ctgcggggag aagcaagggg ccctcctggc 60 gggggcgcag gaccggggga gccgcgccgg gaggagggtc ggtcaggtct cagccactgc 120 tcgcccccag 130 <210> 46 <211> 130 <212> DNA
<213> homo Sapiens <400> 46 gtgagtgcgg ggtcgggagg gaaaccgcct ctgcggggag aagcaagggg ccctcctggc 60 gggggcgcag gaccggggga gccgcgccgg gaggagggtc ggtcaggtct cagccactgc 120 tcgcccccag 130 <210> 47 <211> 130 <212> DNA
<213> homo sapiens <400> 47 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 48 <211> 130 <212> DNA
<213> homo sapiens <400> 48 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 49 <211> 130 <212> DNA
<213> homo Sapiens <400> 49 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 <210> 50 <211> 130 <212> DNA
<213> homo Sapiens <400> 50 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 51 <211> 130 <212> DNA
<213> homo sapiens <400> 51 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 aQggacQcaa aacccgQ~aa accgcgccgg Qaoaagggtc gggcgggtct cagccactcc 120 oa a o a o as a a as tcgtccccag 130 <210> 52 <211> 130 <212> DNA
<213> homo Sapiens <400> 52 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 13 0 <210> 53 _ <211> 130 <212> DNA
<213> homo Sapiens <400> 53 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 54 <211> 130 <212> DNA
<213> homo Sapiens <400> S4 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> SS
<211> I30 <212> DNA
<213> homo sapiens <400> SS
gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> S6 <211> 130 <212> DNA
<2I3> homo Sapiens <400> 56 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> S7 <211> 130 <212> DNA
<213> homo sapiens <400> S 7 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> S8 <211> 130 <212> DNA
<213> homo Sapiens <400> S 8 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> S9 <211> 130 <212> DNA
<213> homo Sapiens <400> 59 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 60 <211> 130 <212> DNA
<213> homo sapiens <400> 60 gtgagtgcgg ggtcgggagg gaaacggcctctgtggggag aagcaacggg cccgcctggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 61 <211> 130 <212> DNA
<213> homo Sapiens <400> 61 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 62 <211> 130 <212> DNA
<213> homo sapiens <400> 62 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 63 <211> 130 <212> DNA
<213> homo Sapiens <400> 63 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag ~ 130 <210> 64 <211> 130 <212> DNA
<213> homo Sapiens <400> 64 gtgagtgcgg ggtcgggagg gaaacggcct ctgcggggag aagcaagggg cccgcctggc 60 gggggcgcaa gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 65 <211> 130 <212> DNA
<213> homo sapiens <400> 65 gtgagtgcgg ggtcgggagg gaaacggcct ctgcggggag aagcaagggg cccgcctggc 60 gggggcgcaa gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 66 <211> 130 <212> DNA
<213> homo Sapiens <400> 66 gtgagtgcgg ggtcgggagg gaaacggcct ctgcggggag aagcaagggg cccgcctggc 60 gggggcgcaa gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 67 <211> 130 <212> DNA
<213> homo Sapiens <400> 67 gtgagtgcgg ggtcgggagg gaaacggcct ctgcggggag aagcaagggg cccgcctggc 60 gggggcgcaa gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 68 <211> 130 <212> DNA

<213> homo Sapiens <400> 68 gtgagtgcgg ggtcgggagg gaaacggcct ctgcggggag aagcaagggg cccgcctggc 60 gggggcgcaa gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 69 <211> 130 <212> DNA
<213> homo Sapiens <400> 69 gtgagtgcgg ggtcgggagg gaaacggcct ctgcggggag aagcaagggg cccgcctggc 60 gggggcgcaa gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgtccccag 130 <210> 70 <211> 129 <212> DNA
<213> homo Sapiens <400> 70 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc ccgcccggcg 60 gggacgcagg acccgggtag ccgcgccggg aggagggtcg ggtgggtctc agccactcct 120 cgcccccag 129 <210> 71 <211> 130 <212> DNA
<213> homo sapiens <400> 71 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 72 <211> 130 <212> DNA
<213> homo sapiens <400> 72 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 PCT/CA98/Ob768 <210> 73 <211> 130 <212> DNA
<213> homo sapiens <400> 73 gtgagtgcgg ggtcgggagg gaaacggcctctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 74 <211> 130 <212> DNA
<213> homo sapiens <400> 74 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 75 <211> 130 <212> DNA
<213> homo sapiens <400> 75 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 76 <211> 130 <212> DNA
<213> homo sapiens <400> 76 gtgagtgcgg ggtcgggagg gaaacggcct ctgtggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgcctg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 77 <211> 129 <212> DNA
<213> homo sapiens <400> 77 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc ccgcccggcg 60 gggacgcagg acccgggtag ccgcgccggg aggagggtcg ggtgggtctc agccactcct 120 cgcccccag I29 <210> 78 <211> 129 <212> DNA
<213> homo Sapiens <400> 78 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc ccgcccggcg 60 gggacgcagg acccgggtag ccgcgccggg aggagggtcg ggtgggtctc agccactcct 120 cgcccccag 129 <210> 79 <211> 129 <212> DNA
<213> homo sapiens <400> 79 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc ccgcccggcg 60 ggggcgcagg acccgggtag ccgcgccggg aggagggtcg ggcggatctc agccactcct 120 cgcccccag 129 <210> 80 <211> 129 <212> DNA
<213> homo sapiens <400> 80 gtgagtgcgg ggtcgtgggg aaaccgcctctgcggggaga agcaaggggc ccgcccggcg 60 ggggcgcagg acccgggtag ccgcgccggg aggagggtcg ggcgggtctc agccactcct 120 cgcccccag 129 <210> 81 <211> 129 <212> DNA
<213> homo Sapiens <400> 81 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc ccgcccggcg 60 ggggcgcagg acccgggtag ccgcgccggg aggagggtcg ggcggatctc agccactcct 120 cgcccccag 129 <210> 82 <211> 129 <212> DNA
<213> homo Sapiens <400> 82 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc ccgcccggcg 60 ggggcgcagg acccgggtag ccgcgccggg aggagggtcg ggcggatctc agccactcct 120 cgcccccag 129 <210> 83 <211> 129 <2I2> DNA
<213> homo sapiens <400> 83 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc ccgcccggcg 60 ggggcgcagg acccgggtag ccgcgccggg aggagggtcg ggcgggtctc agccactcct 120 cgcccccag 129 <210> 84 <211> 129 <212> DNA
<213> homo Sapiens <400> 84 gtgagtgcgg ggtcgtgggg aaaccgcctctgcggggaga agcaaggggc ccgcccggcg 60 ggggcgcagg acccgggtag ccgcgccggg aggagggtcg ggcgggtctc agccactcct 120 cgcccccag 129 <210> 85 <211> 129 <212> DNA
<213> homo Sapiens <400> 85 gtgagtgcgg ggtcgtgggg aaaccgcctc tgcggggaga agcaaggggc tcgcccggcg 60 ggggcgcagg acccgggtag ccgcgccggg aggagggtcg ggcgggtctc agccactcct 120 cgcccccag 129 <210> 86 <211> 130 <212> DNA
<213> homo sapiens <400> 86 gtgagtgcgg ggtcgggagg gaaacggcct ctgcggggag aagcaagggg cccgcccggc 60 gggggcgcag gacccgggaa gccgcgccgg gaggagggtc gggcgggtct cagccactcc 120 tcgcccccag 130 <210> 87 <211> 241 <212> DNA
<213> homo Sapiens <400> 87 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 88 <211> 241 <212> DNA
<213> homo sapiens <400> 88 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggactccg agacccttgt 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 89 <211> 241 <212> DNA
<213> homo sapiens <400> 89 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg GO
tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 90 <211> 241 <212> DNA
<213> homo Sapiens <400> 90 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 91 <211> 241 <212> DNA
<213> homo sapiens <400> 91 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 92 <211> 241 <212> DNA
<213> homo sapiens <400> 92 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 93 <211 > 241 <212> DNA
<213> homo Sapiens <400> 93 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 94 <211> 241 <212> DNA
<213> homo Sapiens <400> 94 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 95 <211> 241 <212> DNA
<213> homo Sapiens <400> 95 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 <210> 96 <211> 241 <212> DNA
<213> homo Sapiens <400> 96 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 97 <211> 241 <212> DNA
<213> homo Sapiens <400> 97 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 98 <211> 241 <212> DNA
<213> homo Sapiens <400> 98 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 99 <211> 241 <212> DNA
<213> homo sapiens <400> 99 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 100 <211> 241 <212> DNA
<213> homo sapiens <400> 100 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 101 <211> 241 <212> DNA
<213> homo sapiens <400> 101 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 102 <211> 241 <212> DNA

<213> homo Sapiens <400> 102 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 <210> 103 <211> 241 <212> DNA
<213> homo Sapiens <400> 103 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 <210> 104 <211> 241 <212> DNA
<213> homo sapiens <400> 104 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccaggttggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtccgggcca 240 g 241 <210> 105 <211> 241 <212> DNA
<213> homo sapiens <400> 105 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 <210> 106 <211> 241 <212> DNA
<213> homo Sapiens <400> 106 gtgagtgacc ccggcccggg gcgcaggtca cgacccctcatcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 <210> 107 <211 > 241 <212> DNA
<213> homo Sapiens <400> 107 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 <210> 108 <211> 241 <212> DNA
<213> homo sapiens <400> 108 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 <210> 109 <211> 241 <212> DNA
<213> homo Sapiens <400> 109 gtgagtgacc ccggcccggg gcgcaggtca cgacccctcatcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 *rB

<210> 110 <211> 241 <212> DNA
<213> homo sapiens <400> 110 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccgc cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 <210> 111 <211> 241 <212> DNA
<213> homo Sapiens <400> 111 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggcgggg cggggctcgg gggaccgggc tgacctcggg gtccgggcca 240 g 241 <210> 112 <211> 241 <212> DNA
<213> homo Sapiens <400> 112 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 113 <211> 241 <212> DNA
<213> homo sapiens <400> 113 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 114 <211> 241 <212> DNA
<213> homo Sapiens <400> 114 gtgagtgacc ccagcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcacccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 115 <211> 241 <212> DNA
<213> homo sapiens <400> 115 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 116 <211> 241 <212> DNA
<213> homo Sapiens <400> 116 gtgagtgacc ccagcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcacccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 117 <211> 241 <212> DNA
<213> homo sapiens <400> 117 gtgagtgacc ccagcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcacccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 118 <211> 241 <212> DNA
<213> homo sapiens <400> 118 gtgagtgacc ccggccgggg gcgcaggtca ggacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> I 19 <211> 241 <212> DNA
<213> homo sapiens <400> 119 gtgagtgacc ccggcccggg gcgcaggtca cgacctctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 120 <211> 241 <212> DNA
<213> homo Sapiens <400> 120 gtgagtgacc ccggccgggg gcgcaggtca ggacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccgga cggggctcgg gggactgggc tgaccgtggg gtcggggcca 240 g 241 <210> 121 <211> 241 <2 i 2> DNA
<213> homo sapiens <400> 121 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc cttaacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 122 <211> 241 <212> DNA
<213> homo sapiens <400> 122 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc cttaacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 123 <211> 241 <212> DNA
<213> homo sapiens <400> 123 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc cttaacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 124 <211> 241 <212> DNA
<213> homo Sapiens <400> 124 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc cttaacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 125 <211> 241 <212> DNA
<213> homo sapiens <400> 125 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc- 120 cccgggagag gcccaggcgc cttaacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 126 <211> 241 <212> DNA
<213> homo sapiens <400> 126 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccggg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc cttaacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 127 <211> 241 <212> DNA
<2I3> homo Sapiens <400> 127 gtgagtgacc ccggccgggg gcgcaggtca ggacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc l 80 ccgggttggt cggggctggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 128 <211> 241 <212> DNA
<213> homo sapiens <400> 128 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tggcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cagggcttgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 129 <211> 241 <212> DNA

<213> homo sapiens <400> 129 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tggcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggttggt cggggccggg cagggcttgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 130 <211> 241 <212> DNA
<213> homo Sapiens <400> 130 gtgagtgacc ccggccgggg gcgcaggtca cgacccctcatcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttga 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaattccc 180 ccgggttggt cggggctggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 131 <211> 241 <212> DNA
<213> homo Sapiens <400> 131 gtgagtgacc ccgcccgggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttga 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaattccc 180 ccgggttggt cggggctggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 132 <211> 241 <212> DNA
<213> homo Sapiens <400> 132 gtgagtgacc ccggccgggg gcgcaggtca cgacccctca tcccccacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttga 120 cccgggagag gcccaggcgc ctttacccgg tttcattttc agtttaggcc aaaaattccc 180 ccgggttggt cggggctggg cggggctcgg gggactgggc tgaccgcggg gtcggggcca 240 g 241 <210> 133 <211> 241 <212> DNA
<213> homo sapiens <400> 133 gtgagtgacc ccggcccggg gcgcaggtca cgacccctca tcccctacgg acgggccagg 60 tcgcccacag tctccgggtc cgagatccac cccgaagccg cgggaccccg agacccttgc 120 cccgggagag gcccaggcgc ctttagccgg tttcattttc agtttaggcc aaaaatcccc 180 ccgggtgggt cggggcgggg cggggctcgg gggaccgggc tgaccgcggg gtcggggcca 240 g 241 <210> 134 <211 > 602 <212> DNA
<2I3> homo sapiens <400> 134 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgag cacaattaag ggataaaaat ctctgaagga atgacgggaa gacgatccct 240 cgaatactga tgagtggttc cctttgacac acaccggcag cagccttggg cccgtgactt 300 ttcctctcag gccttgttct ctgcttcaca ctcaatgtgt gtgggggtct gagtccagca 360 cttctgagtc cctcagcctc cactcaggtc aggaccagaa gtcgctgttc cctcttcagg 420 gactagaatt ttccacggaa taggagatta tcccaggtgc ctgtgtccag gctggtgtct 480 gggttctgtg ctcccttccc catcccaggt gtcctgtcca ttctcaagat agccacatgt 540 gtgctggagg agtgtcccat gacagatgca aaatgcctga atgttctgac tcttcctgac 600 ag 602 <210> 135 <211> 579 <212> DNA
<213> homo sapiens <400> 13 5 gtaccagggg ccacggggcg cctccctgat cgcctataga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggagt gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacaccg gcagcagcct tgggcccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtctctcag cctccactca ggtcaggacc agaagtcgct gttcccttct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcgtg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 136 <211> 578 <212> DNA
<213> homo Sapiens <400> 136 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttc cagatcctgt accagagagt gactctgagg ttccgccctg 180 ctctctgaca caattaaggg ataaaatctc tgaaggagtg acgggaagac gatccctcga 240 atactgatga gtggttccct ttgacaccgg cagcagcctt gggcccgtga cttttcctct 300 caggccttgt tctctgcttc acactcaatg tgtgtggggg tctgagtcca gcacttctga 360 gtccctcagc ctccactcag gtcaggacca gaagtcgctg ttcccttctc agggaataga 420 agattatccc aggtgcctgt gtccaggctg gtgtctgggt tctgtgctct cttccccatc 480 ccgggtgtcc tgtccattct caagatggcc acatgcgtgc tggtggagtg tcccatgaca 540 gatgcaaaat gcctgaattt tctgactctt cccgtcag $7g <210> 137 <211> 579 <212> DNA
<213> homo Sapiens <400> 137 gtaccagggg ccacggggcg cctccctgat cgcctataga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggagt gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacaccg gcagcagcct tgggcccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtctctcag cctccactca ggtcaggacc agaagtcgct gttcccttct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcgtg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 138 <211> 579 <212> DNA
<213> homo Sapiens <400> 138 gtaccagggg ccacggggcg cctccctgat cgcctataga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggagt gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacaccg gcagcagcct tgggcccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtctctcag cctccactca ggtcaggacc agaagtcgct gttcccttct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ~ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcgtg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 139 <211> 579 <212> DNA
<213> homo sapiens <400> 139 gtaccagggg ccacggggcg ccttcctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggagt gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacaccg gcagcagcct tgggcccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttcccttct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcgtg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 140 <211> 579 <212> DNA
<213> homo sapiens <400> 140 gtaccagggg ccacggggcg ccttcctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac tcaattaagg gataaaatct ctgaaggagt gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacaccg gcagcagcct tgggcccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttcccttct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcgtg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 141 <211> 579 <212> DNA
<213> homo sapiens <400> 141 gtaccagggg ccacggggcg ccttcctgat cgcctgtaga tctcccgggc tggcctccca 60 *rB

caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg faccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggagt gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacaccg gcagcagcct tgggcccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttcccttct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcgtg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 142 <211 > 600 <212> DNA
<213> homo Sapiens <400> 142 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 143 <211 > 600 <212> DNA
<2I3> homo Sapiens <400> 143 gtaccagggg ccacggggcg cctccctgat cgcctgtaga 60 tctcccgggc tggcctccca caaggagggg agacaattgg gaccaacact agaatatcgc 120 cctccctctg gtcctgaggg agaggaatcc tcctgggttt ccagatcctg taccagagag 180 tgactctgag gttccgccct gctctctgac acaattaagg gataaaatct ctgaaggaat 240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac acaggcagca 300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt 60 gggggtctga gtccagcact 3 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt 420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct 480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat 600 gatctgactc ttcctgacag <210> 144 <211 > 600 <212> DNA
<213> homo Sapiens <400> 144 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 145 <2I I > 600 <212> DNA
<213> homo Sapiens <400> 145 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 146 <211 > 600 <212> DNA
<213> homo Sapiens <400> 146 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 147 <211> 600 <212> DNA
<213> homo Sapiens <400> 147 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 148 <211 > 600 <212> DNA
<213> homo Sapiens <400> 148 gtaccagggg ccacggggcg cctccctgat cgcctgtaga60 tctcccgggc tggcctccca caaggagggg agacaattgg gaccaacact agaatatcgc120 cctccctctg gtcctgaggg agaggaatcc tcctgggttt ccagatcctg taccagagag180 tgactctgag gttccgccct gctctctgac acaattaagg gataaaatct ctgaaggaat240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac acaggcagca300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt60 gggggtctga gtccagcact 3 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat600 gatctgactc ttcctgacag <210> 149 <211 > 600 <212> DNA
<213> homo sapiens <400> 149 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac acaggcagca300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt360 gggggtctga gtccagcact tctgagtcct tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat600 gatctgactc ttcctgacag <210> 150 <211 > 600 <212> DNA
<213> homo sapiens <400> 150 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 151 <211 > 600 <212> DNA
<213> homo sapiens <400> 151 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 152 <211 > 600 <2I2> DNA
<213> homo sapiens <400> 152 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg - 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 153 <211 > 600 <212> DNA
<213> homo sapiens <400> 153 gtaccagggg ccacggggcg cctccctgat cgcctgtaga60 tctcccgggc tggcctccca caaggagggg agacaattgg gaccaacact agaatatcgc120 cctccctctg gtcctgaggg agaggaatcc tcctgggttt ccagatcctg taccagagag180 tgactctgag gttccgccct gctctctgac acaattaagg gataaaatct ctgaaggaat240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac acaggcagca300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt60 gggggtctga gtccagcact 3 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat600 gatctgactc ttcctgacag <210> 154 <211 > 600 <212> DNA
<213> homo sapiens <400> 154 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 155 <211 > 600 <212> DNA
<213> homo sapiens <400> 155 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 156 <211> 600 <212> DNA
<213> homo sapiens <400> 1 S 6 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 157 <211> 600 <212> DNA
<213> homo sapiens <400> 157 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg I20 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac acaggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtcct tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gatctgactc ttcctgacag 600 <210> 158 <211> 579 <212> DNA
<213> homo Sapiens <400> 158 gtaccagggg ccacggggcg cctacctgat cgcctgtagg tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgacggaat gacggaaaga cgatccctcg 240 aatactgatg actggttccc tttgacaccg gcagcagcct tgggaccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttccctcct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcatg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 159 <211> 579 <212> DNA
<213> homo sapiens <400> 159 gtaccagggg ccacggggcg cctacctgat cgcctgtagg tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgacggaat gacggaaaga cgatccctcg 240 aatactgatg actggttccc tttgacaccg gcagcagcct tgggaccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttccctcct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcatg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 160 <211> 579 <212> DNA
<213> homo Sapiens <400> 160 gtaccagggg ccacggggcg cctacctgat cgcctgtagg tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag180 tgactctgag gttccgccct gctctctgac acaattaagg gataaaatct ctgacggaat240 gacggaaaga cgatccctcg aatactgatg actggttccc tttgacaccg gcagcagcct300 tgggaccgtg acttttcctc tcaggccttg ttctctgctt cacactcaat gtgtgtgggg360 gtctgagtcc agcacttctg agtccctcag cctccactca ggtcaggacc agaagtcgct420 gttccctcct cagggaatag aagattatcc caggtgcctg tgtccaggct ggtgtctggg480 ttctgtgctc tcttccccat cccgggtgtc ctgtccattc tcaagatggc cacatgcatg540 ctggtggagt gtcccatgac agatgcaaaa tgcctgaatt ttctgactct tcccgtcag <210> 161 <211> 579 <212> DNA
<213> homo sapiens <400> 161 gtaccagggg ccacggggcg cctacctgat cgcctgtagg tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgacggaat gacggaaaga cgatccctcg 240 aatactgatg actggttccc tttgacaccg gcagcagcct tgggaccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttccctcct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcatg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 162 <211> 579 <212> DNA
<213> homo sapiens <400> 162 gtaccagggg ccacggggcg cctacctgat cgcctgtagg tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgacggaat gacggaaaga cgatccctcg 240 aatactgatg actggttccc tttgacaccg gcagcagcct tgggaccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttccctcct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcatg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 579 <210> 163 <211> 579 <212> DNA
<213> homo Sapiens <400> 163 gtaccagggg ccacggggcg cctacctgat cgcctgtagg tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgacggaat gacggaaaga cgatccctcg 240 aatactgatg actggttccc tttgacaccg gcagcagcct tgggaccgtg acttttcctc 300 tcaggccttg ttctctgctt cacactcaat gtgtgtgggg gtctgagtcc agcacttctg 360 agtccctcag cctccactca ggtcaggacc agaagtcgct gttccctcct cagggaatag 420 aagattatcc caggtgcctg tgtccaggct ggtgtctggg ttctgtgctc tcttccccat 480 cccgggtgtc ctgtccattc tcaagatggc cacatgcatg ctggtggagt gtcccatgac 540 agatgcaaaa tgcctgaatt ttctgactct tcccgtcag 5'79 <210> 164 <211 > 600 <212> DNA
<213> homo sapiens <400> 164 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 165 <211> 600 <212> DNA
<213> homo sapiens <400> 165 gtaccagggg ccacggggcg cctccctgat cgcctgtaga60 tctcccgggc tggcctccca caaggagggg agacaattgg gaccaacact agaatatcgc120 cctccctctg gtcctgaggg agaggaatcc tcctgggttt ccagatcctg taccagagag180 tgactctgag gttccgccct gctctctgac acaattaagg gataaaatct ctgaaggaat240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac accggcagca300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt60 gggggtctga gtccagcact 3 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 166 <211 > 600 <212> DNA
<213> homo Sapiens <400> 166 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 167 <211 > 600 <212> DNA
<213> homo sapiens <400> 167 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 168 <211 > 600 <212> DNA
<213> homo Sapiens <400> 168 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt360 gggggtctga gtccagcact tctgagtccc tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt540 ctcaagatag ccacatgtgt gctggaggag tgtcccatga cagatgcaaa atgcctgaat600 gttctgactc ttcctgacag <210> 169 <211 > 600 <212> DNA
<213> homo sapiens <400> 169 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 170 <211 > 600 <212> DNA
<213> homo Sapiens <400> 170 gtaccagggg ccacggggcg cctccctgat cgcctgtaga60 tctcccgggc tggcctccca caaggagggg agacaattgg gaccaacact agaatatcgc120 cctccctctg gtcctgaggg agaggaatcc tcctgggttt ccagatcctg taccagagag180 tgactctgag gttccgccct gctctctgac acaattaagg gataaaatct ctgaaggaat240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac accggcagca300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt60 gggggtctga gtccagcact 3 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat600 gttctgactc ttcctgacag <210> 171 <211> 600 <212> DNA
<213> homo Sapiens <400> 171 gtaccggggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 172 <211 > 600 <212> DNA
<213> homo Sapiens <400> 172 gtaccggggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 173 <211 > 600 <212> DNA
<213> homo sapiens <400> 173 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctgtgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatta cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 174 <211> 600 <212> DNA
<213> homo sapiens <400> 174 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 175 <211 > 600 <212> DNA
<213> homo sapiens <400> 175 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctgtgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatta cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 176 <211 > 600 <212> DNA
<213> homo sapiens <400> 176 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcac cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctgtgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatta cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <2I0> 177 <211 > 600 <212> DNA
<213> homo Sapiens <400> 177 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgcct gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 178 <211> 600 <212> DNA
<213> homo Sapiens <400> 178 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg taccagagag tgactctgag gttccgccct 180 gctctctgac acaattaagg gataaaatct ctgaaggaat gacgggaaga cgatccctcg 240 aatactgatg agtggttccc tttgacacac accggcagca gccttgggcc cgtgactttt 300 cctctcaggc cttgttctct gcttcacact caatgtgtgt gggggtctga gtccagcact 360 tctgagtccc tcagcctcca ctcaggtcag gaccagaagt cgctgttccc tcttcaggga 420 ctagaatttt ccacggaata ggagattatc ccaggtgctt gtgtccaggc tggtgtctgg 480 gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat gttctgactc ttcctgacag 600 <210> 179 <211 > 600 <212> DNA
<213> homo Sapiens <400> 179 gtaccagggg ccacggggcg cctccctgat cgcctgtaga tctcccgggc tggcctccca 60 *rB

caaggagggg agacaattgg gaccaacact agaatatcgc cctccctctg gtcctgaggg 120 agaggaatcc tcctgggttt ccagatcctg faccagagag180 tgactctgag gttccgccct gctctctgac acaattaagg gataaaatct ctgaaggaat240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac accggcagca300 gccttgggcc cgtgactttt cctctcaggc cttgttctct gcttcacact caatgtgtgt360 gggggtctga gtccagcact tctgagtccc tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcttcaggga ctagaatttt ccacggaata ggagattatc ccaggtgcct480 gtgtccaggc tggtgtctgg gttctgtgct cccttcccca tcccaggtgt cctgtccatt ctcaagatag ccacatgtgt 540 gctggaggag tgtcccatga cagatgcaaa atgcctgaat600 gttctgactc ttcctgacag <210> 180 <211> 583 <212> DNA
<213> homo sapiens <400> 180 gtaccagggg ccacggggcg ccttcctgat cgcctgtaga60 tctcccgggc tggcctccca caaggagggg agacaattgg gaccaacact agatatcacc120 ctccctctgc tcctgaggga gaggaatcct cctgggtttc cagattctgt accagagagt180 gactctgagg ttccgccctg ctctctgaca caattaaggg ataaaaatct ctgaaggaat240 gacgggaaga cgatccctcg aatactgatg agtggttccc tttgacacac accggcggca300 gccttgggcc cgtgactttt cctctcaggc cctgttctct gcttcacact caatatgtgt gggggtctga gtccagcact 360 tctgagtctc tcagcctcca ctcaggtcag gaccagaagt420 cgctgttccc tcgtcaggga atagaagatt atcccaggtg cctgtgtcca ggctggtgtc tgggttctgt gctctcttcc 480 ccatcccagg tgtcctgtcc atcctcaaaa tggccacatg540 cgtgctggtg gagtgtccca tgacagatgc aaaatggctg aattttctga ctcttcccgt cag 583 <210> 181 <211> 18 <212> DNA
<213> homo sapiens <400> 181 ggcaggtctc agcgactg 1 g <210> 182 <211> 19 <212> DNA
<213> homo sapiens <400> 182 ctctgtgggg agaagcaac 19 <210> 183 <211> 17 <212> DNA

<213> homo sapiens <400> 183 gggagcggcg ccgggac 17 ' <210> 184 <211> 18 <212> DNA
<213> homo Sapiens <400> 184 gaagcaaggg gcccgccc lg <210> 185 <211> 18 <212> DNA
<213> homo sapiens <400> 185 cgcctggcgg gggggcaa 1 g <210> 186 <211> 18 <212> DNA
<213> homo sapiens <400> 186 gtgagtgcgg ggtcgtgg 1 g <210> 187 <211> 18 <212> DNA
<213> homo Sapiens <400> 187 gccgggagga gggacggt lg <210> 188 <211> 17 <212> DNA
<213> homo Sapiens <400> 188 ggcgcgcccg gcgggga 17 <210> 189 <211> 18 <212> DNA
<213> homo Sapiens <400> 189 ggaggagg~ cgggcgga 18 <210> 190 <211> 19 <212> DNA
<213> homo Sapiens <400> 190 agtgtcttcg cggtcgctc 19 <210> 191 <211> 19 <212> DNA
<213> homo Sapiens <400> 191 ctcagattct ccccagacg 19 <210> 192 <211> 20 <212> DNA
<213> homo Sapiens <400> 192 catgccgagg gtttctccca 20 <210> 193 <211> 19 <212> DNA
<213> homo Sapiens <400> 193 ctggccctga cccagacca 19 <210> 194 <211> 19 <212> DNA
<213> homo Sapiens <400> 194 cctgacccag acctgggca 19 <210> 195 <211> 19 <212> DNA
<213> homo Sapiens <400> 195 caggtatctg cggagcccg 19 <210> 196 <211> 21 <212> DNA
<2I3> homo Sapiens <400> 196 gtctgtcagg aagagtcaga a 21 <210> 197 <21 I > 22 <212> DNA
<213> homo Sapiens <400> 197 gtggaaaatt ctagtccctg as 22 <210> 198 <211> 20 <212> DNA
<213> homo Sapiens <400> 198 agatctacag gcgatcagga 20 <210> 199 <2I I> 19 <2I2> DNA
<213> homo Sapiens <400> 199 gccagcccgg gagttctat 19 <210> 200 <211> Z1 <212> DNA
<213> homo sapiens <400> 200 cagagtcact ctctggtaca g 21 <210> 201 <211> 19 <212> DNA
<213> homo Sapiens <400> 201 gcgatcgtct tcccgtcac 19 <210> 202 <211> 21 <212> DNA
<213> homo Sapiens <400> 202 agagtcactc tctggtacag a 21 <210> 203 <211> 19 <212> DNA
<213> homo Sapiens <400> 203 ctcctcgtcc ccaggctct 19 <210> 204 <211> 21 <212> DNA
<213> homo Sapiens <400> 204 tccatgaggt atttctacac c 21 <210> 205 <211> 18 <212> DNA
<213> homo Sapiens <400> 205 ggccaggttc tcagacca 1 g <210> 206 <211> 17 <212> DNA
<213> homo sapiens <400> 206 cccggcccgg cagtgga ~ 17 <210> 207 <211> 20 ' <212> DNA
<213> homo Sapiens <400> 207 gttctcacac catccagatg 20 <210> 208 ' <211> 21 <212> DNA
<213> homo Sapiens <400> 208 tcacaccctc cagatgatgt t 21 <210> 209 <211> 18 <212> DNA
<213> homo sapiens <400> 209 gggtaccagc aggacgct 1 g <210> 210 <211> 21 <212> DNA
<213> homo Sapiens <400> 210 tccatgaggt atttcaccac a 21 <210> 211 <211> 21 <212> DNA
<213> homo sapiens <400> 211 ggttctcaca ccatccagat a 21 <210> 212 <211> 20 <212> DNA

<213> homo sapiens <400> 212 gttctcacac catccagagg 20 ' <210> 213 <211> 18 <212> DNA
<213> homo sapiens <400> 213 gagccccgct tcaacgcc 1 g <210> 214 <211> 19 <212> DNA
<213> homo Sapiens <400> 214 cttcctccgc gggtatgaa 19 <210> 215 <211> 18 <212> DNA
<213> homo sapiens <400> 215 gccggagtat tgggaccg 1 g <210> 216 <211> 19 <212> DNA
<213> homo sapiens <400> 216 ctggccctga ccctgacca 19 <210> 217 <211> 18 <212> DNA
<213> homo sapiens <400> 217 gcagggtccc caggtcca 1 g <210> 218 <21I> 19 <212> DNA
<213> horilo sapiens <400> 2I8 ' cctccaggta ggctctcaa 19 <210> 219 <211> 19 <212> DNA
<213> homo sapiens <400> 219 cctccaggta ggctctcca 19 <210> 220 <211> 19 <2I2> DNA
<213> homo sapiens <400> 220 cctccaggta ggctctctg 19 <210> 221 <211> 19 <212> DNA
<213> homo sapiens <400> 221 ccactccacg cacgtgcca 19 <210> 222 <211> 18 <212> DNA
<213> homo sapiens <400> 222 ggagcgcgat ccgcaggc 1 g <210> 223 <211> 19 <212> DNA
<2I3> homo sapiens <400> 223 ggagccactc cacggaccg 19 <210> 224 <211> 18 <212> DNA
<213> homo Sapiens <400> 224 gagccactcc acgcactc 1 g <210> 225 <211> 21 <212> DNA
<2I3> homo Sapiens <400> 225 ggccttcaca ttccgtgtgt t 21 <210> 226 <211> 19 <212> DNA
<213> homo Sapiens <400> 226 caggtatctg cggagcccg 19 <210> 227 <211> 20 <212> DNA
<213> homo Sapiens <400> 227 tggtcccaat actcaggcct 20 <210> 228 <211> 18 <212> DNA
<213> homo Sapiens <400> 228 gcagggtccc caggttcg 1 g <210> 229 <211> 18 <212> DNA
<213> homo Sapiens <400> 229 gggccgcctc ccagttgt 1 g <210> 230 <211> 20 <212> DNA
<213> homo Sapiens <400> 230 tctgtgagtg ggcctacaca 20 <210> 231 <211> 21 <212> DNA
<213> homo Sapiens <400> 231 ccttcacatt ccgtgtctgc a 21 <210> 232 <211> 18 <212> DNA
<213> homo Sapiens <400> 232 gagccactcc acgcacgt 1 g <210> 233 <211> 20 <212> DNA
<213> homo sapiens <400> 233 ccactcggtc agtctctgac 20 <210> 234 <211> 20 <212> DNA
<213> homo Sapiens <400> 234 gagcgcaggt cctcgttcaa 20 <2I0> 235 <211> 20 <212> DNA
<213> homo Sapiens <400> 235 gtctgtgagt gggccatcat ~ 20 <210> 236 <211> 20 <212> DNA
<213> homo Sapiens <400> 236 cagccataca tcctcaggac 20 <210> 237 <211> 17 <212> DNA
<213> homo Sapiens <400> 237 gcgccgggag gagggtc 17 <210> 238 <211> 18 <212> DNA
<213> homo sapiens <400> 238 atctcggacc cggagact 1 g <210> 239 <211> 22 <212> DNA
<213> homo Sapiens <400> 239 gtttcatttt cagtttaggc ca 22 <210> 240 <211> 23 <212> DNA
<213> homo Sapiens <400> 240 cgggagatct acaggcgatc agg 23 <210> 241 <211> 17 <212> DNA

<213> homo sapiens <400> 241 gtcgtgacctgcgcccc 17 <210> 242 <211> 19 <212> DNA
<213> homo Sapiens <400> 242 gggcggggcg gggctcggg 19 <210> 243 <211> 19 <212> DNA
<213> homo sapiens <400> 243 ggtcgtgacc ttccgcccc 19 <210> 244 <211> 15 <212> DNA
<213> homo Sapiens <400> 244 cccggtttca ttttc 1 S
<210> 245 <211> 20 <212> DNA
<213> homo sapiens <400> 245 cttcacattc cgtgtctcct 20 <210> 246 <211> 129 <212> DNA
<213> homo Sapiens <400> 246 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 247 <211> 128 <212> DNA
<213> homo Sapiens <400> 247 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 acccccag 128 <210> 248 <211> 128 <212> DNA
<213> homo Sapiens <400> 248 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 249 <211> 129 <212> DNA
<213> homo Sapiens <400> 249 gtgagtgcgg gatcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtct ggcgggtctc agcccctcct 120 ggcccccag 129 <210> 250 <21I> 128 <212> DNA
<213> homo sapiens <400> 250 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtttca gcccctcctc 120 gcccccag 128 <210> 251 <211> 128 <212> DNA
<213> homo Sapiens <400> 251 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtttca gcccctcctc 120 gcccccag 128 <210> 252 <211> 129 <212> DNA
<213> homo sapiens <400> 252 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 253 <211> 128 <212> DNA
<213> homo Sapiens <400> 253 gtgagtgcgg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 254 <211> 129 <212> DNA
<213> homo Sapiens <400> 254 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 255 <211> 129 <212> DNA
<213> homo sapiens <400> 255 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 256 <211> 129 <212> DNA
<213> homo Sapiens <400> 256 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 257 <211> 129 <2I2> DNA
<213> homo Sapiens <400> 257 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 258 <2I 1> 128 <212> DNA
<213> homo Sapiens <400> 258 gtgagtgcgg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 259 <211> 128 <212> DNA
<213> homo sapiens <400> 259 gtgagtgcgg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 260 <211> 128 <212> DNA
<213> homo Sapiens <400> 260 gtgagtgcgg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 261 <211> 129 <212> DNA
<213> homo Sapiens <400> 261 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 262 <211> 129 <212> DNA
<213> homo sapiens <400> 262 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 tgcccccag 129 <210> 263 <211> 129 <212> DNA
<213> homo Sapiens <400> 263 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 tgcccccag 129 <210> 264 <211> 129 <212> DNA
<213> homo sapiens <400> 264 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 265 <211> 129 <212> DNA
<213> homo Sapiens <400> 265 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 266 <211> 129 <212> DNA
<213> homo Sapiens <400> 266 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 267 <2I1> 129 <212> DNA
<213> homo Sapiens <400> 267 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 268 <211> 129 <212> DNA
<213> homo sapiens <400> 268 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 269 <211> 129 <212> DNA
<213> homo Sapiens <400> 269 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 270 *rB

<211> 129 <212> DNA
<213> homo Sapiens <400> 270 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 271 <211> 128 <212> DNA
<213> homo sapiens <400> 271 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 272 <211> 128 <212> DNA
<213> homo Sapiens <400> 272 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 273 <211> 128 <212> DNA
<213> homo sapiens <400> 273 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 274 <211> 128 <212> DNA
<213> homo Sapiens <400> 274 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 WO 99/0?883 PCT/CA98/00?68 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 275 <211> 128 <212> DNA
<213> homo sapiens <400> 275 gtgagtgcgg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gctcctcctc 120 gcccccag 128 <210> 276 <211> 129 <212> DNA
<213> homo sapiens <400> 276 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 277 <211> 128 <212> DNA
<213> homo sapiens <400> 277 gtgagtgcgg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gctcctcctc I20 gcccccag 128 <210> 278 <211> I28 <212> DNA
<213> homo sapiens <400> 278 gtgagtgcgg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gctcctcctc I20 gcccccag 128 <210> 279 <211> 128 <212> DNA

<213> homo Sapiens <400> 279 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc I20 acccccag 128 <210> 280 <211> I29 <212> DNA
<213> homo Sapiens <400> 280 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagagagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct I20 cgcccccag 129 <210> 281 <211> 129 <212> DNA
<213> homo sapiens <400> 281 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagagagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 282 <211> 128 <212> DNA
<213> homo Sapiens <400> 282 gtgagtgcgg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 283 <211> 129 <212> DNA
<213> homo sapiens <400> 283 gtgagtgcgg ggtcggcagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 284 <211> 129 <212> DNA
<213> homo sapiens <400> 284 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggctcagg acccggggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 285 <211> 128 <212> DNA
<213> homo sapiens <400> 285 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 acccccag 128 <210> 286 <211> 128 <212> DNA
<213> homo Sapiens <400> 286 gtgagtgcgg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc I20 gcccccag 128 <210> 287 <211> 128 <212> DNA
<213> homo Sapiens <400> 287 gtgagtgcgg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 288 <211> 129 <212> DNA
<213> homo sapiens <400> 288 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 289 <211> 129 <212> DNA
<213> homo Sapiens <400> 289 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 290 <211> 129 <212> DNA
<213> homo sapiens <400> 290 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 291 <211> 129 <212> DNA
<213> homo sapiens <400> 291 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 292 <211> 128 <212> DNA
<213> homo sapiens <400> 292 gtgagtgcgg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtctg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 293 <211> 128 <212> DNA
<213> homo sapiens <400> 293 gtgagtgegg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtctg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 294 <2I 1> 128 <212> DNA
<213> homo sapiens <400> 294 gtgagtgcgg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtctg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 295 <211> 128 <212> DNA
<213> homo Sapiens <400> 295 gtgagtgcgg gtcggcaggg aaatggcctc tgtagggagg agcaagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 296 <211> 129 <212> DNA
<213> homo sapiens <400> 296 gtgagtgcgg ggtcgggagg gaaatggcct ctgtggggag gagcgagggg accgcaggcg 60 ggggcgcagg acctgaggag ccgcgccggg aggagggtcg ggcgggtctc agcccctcct 120 cgcccccag 129 <210> 297 <211> 128 <212> DNA
<213> homo sapiens <400> 297 gtgagtgcgg gtcgggaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggga ggagggtctg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 298 <211> 128 <212> DNA
<2I3> homo Sapiens <400> 298 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cctgaggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 299 <211> 128 <212> DNA
<213> homo Sapiens <400> 299 gtgagtgcgg gtcgggaggg aaatggcctc tgccgggagg agcgagggga ccgcaggcgg 60 gggcgcagga cccggggagc cgcgccggta ggagggtcgg gcgggtctca gcccctcctc 120 gcccccag 128 <210> 300 <211 > 245 <212> DNA
<213> homo Sapiens <400> 300 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggtcggg 240 gccag 245 <210> 301 <211> 245 <212> DNA
<2I3> homo Sapiens <400> 301 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccgga 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggact gggctgaccg cggggccggg 240 gccag 245 <210> 302 <211> 246 <212> DNA
<213> homo Sapiens <400> 302 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgg acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcggggggac ggggctgacc gcggggccgg 240 ggccag 24G
<210> 303 <211> 245 <212> DNA
<213> homo Sapiens <400> 303 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgg acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 304 <211> 246 <212> DNA
<213> homo Sapiens <400> 304 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgg acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac tgggctgacc gcgggggcgg 240 ggccag 246 <210> 305 <211> 246 <212> DNA
<213> homo Sapiens <400> 305 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgg acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tgggcggggc ggggcggggc tcggggggac tgggctgacc gcgggggcgg 240 ggccag 246 <210> 306 <211 > 246 <212> DNA
<213> homo sapiens <400> 306 gtgagtgacc ccggcctggg gcgcaggtca cgactccccatcccccacgtacggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggcctg 240 ggccag 246 <210> 307 <211> 245 <212> DNA
<213> homo sapiens <400> 307 gtgagtgacc ccggcctggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggcctgg 240 gccag 245 <210> 308 <211> 245 <212> DNA
<213> homo sapiens <400> 308 gtgagtgacc ccggcctggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggcctgg 240 gccag 245 <210> 309 <211> 245 <212> DNA
<213> homo sapiens <400> 309 gtgagtgacc ccggcctggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggcctgg 240 gccag 245 <210> 310 <211> 245 <212> DNA
<213> homo sapiens <400> 310 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 311 <211> 245 <212> DNA
<213> homo Sapiens <400> 311 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggcctgg 240 gccag 245 <210> 312 <211 > 246 <212> DNA
<213> homo Sapiens <400> 312 gtgagtgacc ccggcctggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggcctg 240 ggccag 246 <210> 313 <211 > 246 <212> DNA
<213> homo Sapiens <400> 313 <212> DNA
<213> homo Sapiens <400> 303 gtgagtgacc ccggcctggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggcctg 240 ggccag 246 <210> 314 <211 > 246 <212> DNA
<213> homo Sapiens <400> 314 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 315 <211 > 243 <212> DNA
<213> homo Sapiens <400> 315 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagcccaggc gcgtttaccc ggtttcattt tcagttgagg ccaaaatccc 180 cgcgggttgg tcggggcggg gcggggctcg gggggacggg gctgaccgcg ggggcggggc 240 cag 243 <210> 316 <211> 244 <212> DNA
<213> homo Sapiens <400> 316 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc 180 ccgcgggttg gtcggggcgg ggcggggctc ggggggacgg ggctgaccgc gggggcgggg 240 ccag 244 <210> 317 <211> 244 <212> DNA
<213> homo Sapiens <400> 317 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc 180 ccgcgggttg gtcggggcgg ggcggggctc ggggggacgg ggctgaccgc gggggcgggg 240 ccag 244 <210> 318 <211 > 244 <212> DNA
<213> homo sapiens <400> 318 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc 180 ccgcgggttg gtcggggcgg ggcggggctc ggggggacgg ggctgaccgc gggggcgggg 240 ccag 244 <210> 319 <2 I 1 > 244 <212> DNA
<213> homo sapiens <400> 319 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc 180 ccgcgggttg gtcggggcgg ggcggggctc ggggggacgg ggctgaccgc ggggccgggg 240 ccag 244 <210> 320 <211 > 245 <212> DNA
<213> homo sapiens <400> 320 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 321 <211> 245 <212> DNA

<213> homo Sapiens <400> 321 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 322 <2I 1 > 245 <212> DNA
<213> homo sapiens <400> 322 gtgagtgacc ccggcccggg gcgcaggtca cgactccccatcccccacgtacggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 323 <211> 245 <212> DNA
<213> homo sapiens <400> 323 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat I 80 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 324 <211> 245 <2I2> DNA
<213> homo Sapiens <400> 324 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 325 WO 99/07883 PCTlCA98/00768 <211> 246 <212> DNA
<213> homo sapiens <400> 325 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 326 <211> 246 <212> DNA
<213> homo sapiens <400> 326 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 327 <211> 246 <212> DNA
<213> homo sapiens <400> 327 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 328 <211> 246 <212> DNA
<213> homo sapiens <400> 328 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 329 <211> 246 <212> DNA
<213> homo sapiens <400> 329 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 330 <211> 245 <212> DNA
<213> homo sapiens <400> 330 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccaa ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggact gggctgaccg cggggccggg 240 gccag 245 <210> 331 <211> 244 <212> DNA
<213> homo Sapiens <400> 331 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccgc ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc 180 ccgcgggttg gtcggggcgg ggcggggctc ggggggacgg ggctgaccgc ggggccgggg 240 ccag 244 <210> 332 <211 > 246 <212> DNA
<213> homo Sapiens <400> 332 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgg acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggcctg 240 ggccag 246 <210> 333 <211> 246 <212> DNA
<213> homo Sapiens <400> 333 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 334 <211> 246 <212> DNA
<213> homo Sapiens <400> 334 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgg acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 335 <211> 243 <212> DNA
<213> homo Sapiens <400> 335 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc 180 ccgcgggttg gtcggggcgg ggcggggctc gggggacggg gctgaccgcg gggccggggc 240 cag 243 <210> 336 <211> 21 <212> DNA
<213> homo Sapiens <400> 336 gccttcccaa ccattccctt a 21 <210> 337 <211 > 243 <212> DNA
<213> homo Sapiens <400> 337 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc 180 ccgcgggttg gtcggggcgg ggcggggctc gggggacggg gctgaccgcg gggccggggc 240 cag 243 <210> 338 <211> 245 <212> DNA
<213> homo Sapiens <400> 338 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggcctgg 240 gccag 245 <210> 339 <211 > 245 <212> DNA
<213> homo Sapiens <400> 339 gtgagtgacc ccggcctggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccaaacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggcctgg 240 gccag 245 <210> 340 <211 > 243 <212> DNA
<213> homo sapiens <400> 340 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccgaggcc gcgggacccg cccagaccct 120 cgaccggcga gagcccaggc gcgtttaccc ggtttcattt tcagttgagg ccaaaatccc 180 cgcgggttgg tcggggcggg gcggggctcg gggggacggg gctgaccgcg gggcctgggc 240 cag 243 <210> 341 <211> 245 <212> DNA
<213> homo sapiens <400> 341 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggact gggctgaccg cggggccggg 240 gccag 245 <210> 342 <211> 244 <212> DNA
<213> homo Sapiens <400> 342 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccag gcgcgtttac ccggtttcat tttcagttga ggccaaaatc 180 cccgcgggtt ggtcggggcg gggcggggct cgggggacgg ggctgaccgc ggggcctggg 240 ccag 244 <210> 343 <211 > 245 <212> DNA
<213> homo sapiens <400> 343 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccgc ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggcctgg 240 gccag 245 <210> 344 <211> 246 <212> DNA
<213> homo Sapiens <400> 344 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagaggcccc aggcgcgttt acccggtttc attttcagtt gaggccaaaa I80 tccccgcggg ttggtcgggg cggggcgggg ctcgggggac ggtgctgacc gcggggccgg 240 ggccag 246 <210> 345 <211> 245 <212> DNA
<213> homo Sapiens <400> 345 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gtgctgaccg cggggccggg 240 gccag 245 <210> 346 <211 > 245 <212> DNA
<2I3> homo Sapiens <400> 346 gtgagtgacc ccggcccggg gcgcaggtca cgactccccatcccccacgtacggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gtgctgaccg cggggccggg 240 gccag 245 <210> 347 <211> 245 <212> DNA
<213> homo sapiens <400> 347 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 348 <211 > 244 <212> DNA
<213> homo Sapiens <400> 348 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagaccccag gcgcgtttac ccggtttcat tttcagttga ggccaaaatc 180 cccgcgggtt ggtcggggcg gggcggggct cgggggacgg ggctgaccgc ggggccgggg 240 ccag 244 <210> 349 <211> 20 <212> DNA
<213> homo sapiens <400> 349 tccatgtccttcctgaagca 20 <210> 350 <211 > 245 <212> DNA
<213> homo sapiens <400> 350 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 351 <211> 245 <212> DNA
<213> homo sapiens <400> 351 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggt tggtcggggc ggggcggggc tcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 352 <211> 246 <212> DNA
<213> homo sapiens <400> 352 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ccccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcagggc ggggcggggctcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 353 <211> 245 <212> DNA
<213> homo Sapiens <400> 353 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 354 <211> 245 <212> DNA
<213> homo Sapiens <400> 354 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcgggggacg gggctgaccg cggggccggg 240 gccag 245 <210> 355 <211 > 246 <212> DNA
<213> homo sapiens <400> 355 gtgagtgacc ccggcccggg gcgcaggtca cgactcccca tcccccacgt acggcccggg 60 tcgccccgag tctccgggtc cgagatccac ctccctgagg ccgcgggacc cgcccagacc 120 ctcgaccggc gagagcccca ggcgcgttta cccggtttca ttttcagttg aggccaaaat 180 ccccgcgggttggtcggggc ggggcggggctcggggggac ggggctgacc gcggggccgg 240 ggccag 246 <210> 356 <211 > 246 <212> DNA
<213> homo Sapiens <400> 356 gtgagtgacc ccggcctggg gcgcaggtca cgacccctcc ccaaccccga cgtacggccc 60 gggtctcctc gagtctctag gtccgagatc oaccccgagg ccgcgggacc cgcccagaac 120 ctcgaccgca gagagcccca ggcgacttta cccggtttca ttttcagttg aggtcaaaat i 80 ccccgcgggt tggtcggggc ggggcggggc tcggggggac ggggctgacc gcgaggcctg 240 ggccag 246 <210> 357 <2I1> 575 <212> DNA
<213> homo sapiens <400> 357 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 358 <211> 574 <212> DNA
<213> homo sapiens <400> 358 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctccgttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctagaca attaaggaat 180 gacgtctctg aggaaatgga ggggaagaca gtccctagaa tactgatcag gggtcccctt 240 tgacccctgc agcagccttg ggaaccgtga cttttcctct caggccttgt tctctgcctc 300 acactcagtg tgtttggggc tctgattcca gcacttctga gtcactttac ctccactcag 360 atcaggagca gaagtccctg ttccccgctc agagactcga actttccaat gaataggaga 420 ttatcccagg tgcctgcgtc caggctggtg tctgggttct gtgccccttc cccaccccag 480 gtgtcctgtc cattctcagg ctggtcacat gggtggtcct agggtgtccc atgaaagatg 540 caaagcgcct gaattttctg actcttccca tcag 574 <2I0> 359 <211> 572 <212> DNA
<213> homo Sapiens <400> 359 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctagaca attaagggat 180 gacgtctctg aggaaatgga ggggaagaca gtccctagaa tactgatcag gggtcccctt 240 tgacccctgc agcagccttg ggaaccgtga cttttcctct caggccttgt tctctgcctc 300 acactcagtg tgtttggggc tctgattcca gcacttctga gtcactttac ctccactcag 360 atcaggagca gaagtccctg ttccccgctc agagactcga actttccaat gaataggaga 420 ttatcccagg tgcctgcatc cgctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggcgtgccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 360 <211> 575 <212> DNA
<213> homo Sapiens <400> 360 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgt aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 361 <211> 572 <212> DNA
<2I3> homo Sapiens <400> 361 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagaag aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccatg acttttcttc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtctct gttccccgct cagagactcg aactttccaa tgaatagatt 420 atcccaggtg cctgcgtcca ggctggtgtc tgggttctgt gtcccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtcccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 362 <211> 572 <212> DNA
<213> homo Sapiens <400> 362 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagaag aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccatg acttttcttc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtctct gttccccgct cagagactcg aactttccaa tgaatagatt 420 atcccaggtg cctgcgtcca ggctggtgtc tgggttctgt gtcccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtcccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 363 <211> 575 <212> DNA
<213> horno Sapiens <400> 363 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 364 <211> 575 <212> DNA
<213> homo sapiens <400> 364 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat S40 gcaaagcgcc tgaattttct gactcttccc atcag S7S
<210> 36S
<211> S7S
<212> DNA
<213> homo sapiens <400> 365 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat S40 gcaaagcgcc tgaattttct gactcttccc atcag S7S
<210> 366 <211> S7S
<212> DNA
<213> homo sapiens <400> 366 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat S40 gcaaagcgcc tgaattttct gactcttccc atcag S7S
<210> 367 <211> S7S
<212> DNA
<213> homo sapiens <400> 367 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagao agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 368 <211> 575 <212> DNA
<213> homo Sapiens <400> 368 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 369 <211> 572 <212> DNA
<2I3> homo Sapiens <400> 369 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccatg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtctct gttccccgct cagagactcg aactttccaa tgaatagatt 420 atcccaggtg cctgcgtcca ggctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtcccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 370 <211> 575 <212> DNA

<213> homo sapiens <400> 370 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 371 <211> 575 <212> DNA
<213> homo sapiens <400> 371 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcccgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 372 <211> 575 <212> DNA
<213> homo sapiens <400> 372 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacacca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 373 <211> 575 <212> DNA
<213> homo sapiens <400> 373 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca GO
cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacacca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 374 <211> 575 <212> DNA
<213> homo Sapiens <400> 374 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacacca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 375 <211> 572 <212> DNA
<213> homo sapiens <400> 375 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccatg acttttcctc300 tcaggccttg ttctctgcct cacactcagt gtgtttgggg ctctgattcc agcacttctg360 agtcacttta cctccactca gatcaggagc agaagtctct gttccccgct cagagactcg420 aactttccaa tgaatagatt atcccaggtg cctgcgtcca ggctggtgtc tgggttctgt480 gccccttccc caccccaggt gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag540 ggtgtcccat gagagatgca aagcgcctga attttctgac tcttcccatc ag 572 <210> 376 <211> 572 <212> DNA
<213> homo Sapiens <400> 376 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccaa 60 cgagaagaag aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccatg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtctct gttccccgct cagagactcg aactttccaa tgaatagatt 420 atcccaggtg cctgcgtcca ggctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtcccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 377 <211> 572 <212> DNA
<213> homo Sapiens <400> 377 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagaag aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccatg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtctct gttccccgct cagagactcg aactttccaa tgaatagatt 420 atcccaggtg cctgcgtcca ggctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtcccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 378 <211> 572 <212> DNA
<213> homo Sapiens <400> 378 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccaa 60 cgagaagaag aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccatg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtctct gttccccgct cagagactcg aactttccaa tgaatagatt 420 atcccaggtg cctgcgtcca ggctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtcccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 379 <211> 574 <212> DNA
<213> homo sapiens <400> 379 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctccgtgga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctagaca attaaggaat 180 gacgtctctg aggaaatgga ggggaagaca gtccctagaa tactgatcag gggtcccctt 240 tgacccctgc agcagccttg ggaaccgtga cttttcctct caggccttgt tctctgcctc 300 acactcagtg tgtttggggc tctgattcca gcacttctga gtcactttac ctccactcag 360 atcaggagca gaagtccctg ttccccgctc agagactcga actttccaat gaataggaga 420 ttatcccagg tgcctgcgtc caggctggtg tctgggttct gtgccccttc cccaccccag 480 gtgtcctgtc cattctcagg ctggtcacat gggtggtcct agggtgtccc atgaaagatg 540 caaagcgcct gaattttctg actcttccca tcag 574 <210> 380 <211> 575 <212> DNA
<213> homo sapiens <400> 380 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 381 <211> 572 <212> DNA
<213> homo sapiens <400> 381 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctagaca attaagggat 180 gacgtctctg aggaaatgga ggggaagaca gtccctagaa tactgatcag gggtcccctt 240 tgacccctgc agcagccttg ggaaccgtga cttttcctct caggccttgt tctctgcctc 300 acactcagtg tgtttggggc tctgattcca gcacttctga gtcactttac ctccactcag 360 atcaggagca gaagtccctg ttccccgctc agagactcga actttccaat gaataggaga 420 ttatcccagg tgcctgcatc cgctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtgccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 382 <211> 572 <212> DNA
<213> homo sapiens <400> 382 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctagaca attaaggaat 180 gacgtctctg aggaaatgga ggggaagaca gtccctagaa tactgatcag gggtcccctt 240 tgacccctgc agcagccttg ggaaccgtga cttttcctct caggccttgt tctctgcctc 300 acactcagtg tgtttggggc tctgattcca gcacttctga gtcactttac ctccactcag 360 atcaggagca gaagtccctg ttccccgctc agagactcga actttccaat gaataggaga 420 ttatcccagg tgcctgcatc cgctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtgccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 383 <211> 572 <212> DNA
<213> homo Sapiens <400> 383 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctagaca attaagggat 180 gacgtctctg aggaaatgga ggggaagaca gtccctagaa tactgatcag gggtcccctt 240 tgacccctgc agcagccttg ggaaccgtga cttttcctct caggccttgt tctctgcctc 300 acactcagtg tgtttggggc tctgattcca gcacttctga gtcactttac ctccactcag 360 atcaggagca gaagtccctg ttccccgctc agagactcga actttccaat gaataggaga 420 ttatcccagg tgcctgcatc cgctggtgtc tgggttctgt gccccttccc caccccaggt 480 gtcctgtcca ttctcaggct ggtcacatgg gtggtcctag ggtgtgccat gagagatgca 540 aagcgcctga attttctgac tcttcccatc ag 572 <210> 384 <211> 575 <212> DNA
<213> homo sapiens <400> 384 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 385 <211> 575 <212> DNA
<213> homo Sapiens <400> 385 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 386 <211> 573 <212> DNA
<213> homo sapiens <400> 386 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctagaca attaagggat 180 gacgtctctg aggaaatgga ggggaagaca gtccctagaa tactgatcag gggtcccctt 240 tgacccctgc agcagccttg ggaaccgtga ctttcctctc aggccttgtt ctctgcctca 300 cactcagtgt gtttggggct ctgattccag cacttctgag tcactttacc tccactcaga 360 tcgggagcag aagtccctgt tccccgctca gagactcgaa ctttccaatg aataggagat 420 tatcccaggt gcctgcgtcc aggctggtgt ctgggttctg tgccccttcc ccaccccagg 480 tgtcctgtcc attctcaggc tggtcacatg ggtggtccta gggtgtccca tgagagatgc 540 aaagcgcctg aattttctga ctcttcccat cag 573 <210> 387 <211> 575 <212> DNA
<213> homo Sapiens <400> 387 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctagg atagtgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 388 <211> 575 <212> DNA
<2I3> homo sapiens <400> 388 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactta 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 389 <211> 575 <212> DNA
<213> homo sapiens <400> 389 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccact cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 390 <211> 576 <212> DNA
<213> homo Sapiens <400> 390 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagtc agtccctagg aatagtgatc aggggtcccc 240 tttgacccct gcagcagcct tgggaaccgt gacttttcct ctcaggcctt gttctctgcc 300 tcacactcag tgtgtttggg gctctgattc cagcacttct gagtcacttt acctccactc 360 agatcaggag cagaagtccc tgttccccgc tcagagactc gaactttcca atgaatagga 420 gattatccca ggtgcctgcg tccaggctgg tgtctgggtt ctgtgcccct tccccacccc 480 aggtgtcctg tccattctca ggctggtcac atgggtggtc ctagggtgtc ccatgagaga 540 tgcaaagcgc ctgaattttc tgactcttcc catcag 576 <210> 391 <211> 575 <212> DNA
<213> homo sapiens <400> 391 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacacca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 392 <211> 575 <212> DNA
<213> homo sapiens <400> 392 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacacca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 393 <211> 575 <212> DNA
<213> homo Sapiens <400> 393 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagtc agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacacca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 394 <211> 575 <212> DNA
<213> homo sapiens <400> 394 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacacca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc catgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 395 <211> 575 <212> DNA
<213> homo Sapiens <400> 395 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcctct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc tatgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 396 <21I> 575 <212> DNA
<213> homo Sapiens <400> 396 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcccct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc tatgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 397 <211> 575 <212> DNA
<213> homo sapiens <400> 397 gtaccagggg cagtggggag ccttccccat ctcctatagg tcgccgggga tggcctccca 60 cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc cctcccttga atggagaatg 120 gcatgagttt tcctgagttt cctctgaggg ccccctcttc tctctaggac aattaaggga 180 tgacgtctct gaggaaatgg aggggaagac agtccctaga atactgatca ggggtcctct 240 ttgacccctg cagcagcctt gggaaccgtg acttttcctc tcaggccttg ttctctgcct 300 cacactcagt gtgtttgggg ctctgattcc agcacttctg agtcacttta cctccactca 360 gatcaggagc agaagtccct gttccccgct cagagactcg aactttccaa tgaataggag 420 attatcccag gtgcctgcgt ccaggctggt gtctgggttc tgtgcccctt ccccacccca 480 ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc tagggtgtcc tatgagagat 540 gcaaagcgcc tgaattttct gactcttccc atcag 575 <210> 398 <211> 19 <212> DNA
<213> homo Sapiens <400> 398 ccacctgctg ctctcggga 19 <210> 399 <211> 17 <212> DNA
<213> homo sapiens <400> 399 ctcctgctgc tctcggc 17 <210> 400 <211> 18 <212> DNA
<213> homo Sapiens <400> 400 ctgctgctct ggggggca 1 g <210> 401 <211> 18 <212> DNA
<213> homo Sapiens <400> 401 gagatgcggg tcacggca 1 g <210> 402 <211> 18 <212> DNA
<213> homo sapiens <400> 402 ctgaccgaga cctgggct 1 g <210> 403 <211> 18 <212> DNA
<213> homo Sapiens <400> 403 aggagggtcg ggcgggtt 1 g <210> 404 <211> 18 <212> DNA
<213> homo Sapiens <400> 404 gggtctcagc cccacctt 1 g <210> 405 <211> 19 <212> DNA
<213> homo Sapiens <400> 405 gagggaaatg gcctctgcc 1 ~
<210> 406 <211> 18 <2I2> DNA
<213> homo Sapiens <400> 406 cgggggcgca ggacctga 1 g <210> 407 <211> 18 <212> DNA
<213> homo Sapiens <400> 407 gcgccgggag gagggtct 1 g <210> 408 <211> 18 <212> DNA
<213> homo sapiens <400> 408 gcctctgtgg ggaggaga 1 g <210> 409 <211> 19 <212> DNA
<213> homo sapiens <400> 409 gcctctgtag ggaggagca 19 <210> 410 <211> 18 <212> DNA
<213> homo Sapiens <400> 410 gtcgggcggg tctcagct 1 g <210> 411 <211> 17 <2I2> DNA
<213> homo sapiens <400> 411 cgggggaccg cgccggt 17 <2I0> 412 <211> 18 <212> DNA
<213> homo sapiens <400> 412 ggtctcagcc cctcctca 1 g <210> 413 <211> 18 <212> DNA
<213> homo sapiens <400> 413 gtggagtgcg gggtcggc 1 g <210> 414 <211> 17 <212> DNA
' <213> homo sapiens <400> 414 gtgagtgcgg ggtcggc 17 <210> 415 <211> 17 <212> DNA
<213> homo sapiens <400> 415 gaccgcaggc gggggct 17 <210> 416 <211> 18 <212> DNA
<213> homo Sapiens <400> 416 tctcagcccc tcctcgct 1 g <210> 417 <211> 19 <212> DNA
<213> homo Sapiens <400> 417 gccatccccg gcgacctat 19 <210> 418 <211> 19 <212> DNA
<213> homo sapiens <400> 418 gggacccctg atcactatc 19 <210> 419 <211> 19 <212> DNA
<213> homo sapiens <400> 419 ggccctcaga ggaaactcg ~ 19 <210> 420 <211> 21 <212> DNA
<213> homo Sapiens <400> 420 aggcctgaga ggaaaagtca t 21 <210> 421 <211> 21 <212> DNA
<213> homo Sapiens <400> 421 aggcgctttg catctctcat a 21 <210> 422 <211> 21 <212> DNA
<213> homo Sapiens <400> 422 gatcagtatt ctagggactg a 21 <210> 423 <2 I 1 > 20 <212> DNA
<213> homo sapiens <400> 423 gaatggacag gacacctggt 20 <210> 424 <211> 21 <212> DNA
<213> homo Sapiens <400> 424 tcatgccatt ctccattcaa c 21 <210> 425 <211> 20 <212> DNA

<213> homo Sapiens <400> 425 ctagggactg tcttccccta 20 ' <210> 426 <211> 20 <212> DNA
<213> homo sapiens <400> 42G
cgctgatccc attttcctct 20 <210> 427 <211> 20 <212> DNA
<213> homo sapiens <400> 427 cagagaacaa ggcctgagaa 20 <210> 428 <211> 19 <212> DNA
<213> homo sapiens <400> 428 aacccagaca ccagcggat 19 <210> 429 <211> 20 <212> DNA
<213> homo Sapiens <400> 429 ggacttctgc tcctgatcta 20 <210> 430 <211> 18 <212> DNA
<213> homo Sapiens <400> 430 gaggccatcc cgggcgat 1 g <210> 431 <211> 21 <212> DNA
<213> homo sapiens <400> 431 ' ggaaagttcg agtctctgag t 21 <210> 432 <211> 20 <212> DNA
<213> homo Sapiens <400> 432 ctcatgccat tctccattcc 20 <210> 433 <211> 19 <212> DNA
<213> homo Sapiens <400> 433 tgaccagcct gagaatggg 19 <210> 434 <211> 19 <212> DNA
<213> homo Sapiens <400> 434 aacagggact tctgctccc 19 <210> 435 <211> 20 <212> DNA
<213> homo sapiens <400> 435 ggcctgagag gaaaagtcac 20 <210> 436 <211> 21 <212> DNA
<213> homo Sapiens <400> 436 ggatctcgga cccggagact c 21 <210> 437 <211> 21 <212> DNA
<213> homo sapiens <400> 437 acccggtttc attttcagtt g 21 <210> 438 <211> 23 <212> DNA
<213> homo Sapiens <400> 438 tttacccggt ttcattttca gtt 23 <210> 439 <211> 18 <212> DNA
<213> homo sapiens <400> 439 tccccactgc ccctggta 1 g <210> 440 <211> 15 <212> DNA
<213> homo Sapiens <400> 440 ggccagggtc tcaca 15 <210> 441 <211> 18 <212> DNA
<213> homo sapiens <400> 441 atctcggacc cggagact 1 g <210> 442 <211> 21 <212> DNA
<213> homo Sapiens <400> 442 tcccactcca tgaggtattt c 21

Claims (14)

WHAT IS CLAIMED IS:

1. A method of determining the HLA-B Class I group type of a subject comprising the following steps:
(i) combining a group-specific untranslated region primer pair with a target DNA sample from the subject under conditions such that primer-based amplification of the target DNA may occur; and (ii) determining whether a nucleic acid product is produced by the amplification;
wherein the ability of the primer pair to produce a nucleic acid product is associated with a particular HLA group type.

2. The method of claim 1, further comprising the step of (iii) determining the nucleic acid sequence of the nucleic acid product of step (ii).

3. The method of claim 1, wherein the primer pair comprises one or more oligonucleotide primers selected from the group consisting of E1-B121m17, E1-B129, E1-B130, E1-B136, E1-B182, I1-B145, I1-B154m, I1-B167, I1-B168, I1-B169, I1-B170, I1-B171, I1-B172, I1-B173, I1-B174, I1-B175, I1-B326, I1-B331, I1-B346, I3-B126, I3-B147, I3-B164, I3-B165, I3-B166, I3-B187, I3-B212, I3-B305, I3-B319, I3-B320, I3-B321, I3-8323, I3-B332, I3-B335, I3-B337, I3-B342, I3-B347, I3-B348, and I3-B349.

4. The method of claim 1, wherein the primer pair is selected from the group of pairs consisting of I1-B174 and I3-B305; I1-B167 and I3-B323; I1-B175 and I3-B319; I1-B145 and I3-B321; E1-B121m17 and I3-B147; I1-B154m and I3-B164;
E1-B182 and I3-B349; II-B168 and I3-B212; I1-B326 and I3-B165; I1-B167 and 13-B320; I1-B172 and I3-B342; I1-B172 and I3-B323; I1-B174 and I3-B323; I1-and I3-B126; I1-B326 and I3-B348;I1-B331 and I3-B332; I1-B326 and I3-B337;
I1-B326 and I3-B187; I1-B169 and I3-B166; I1-B171 and I3-B347; I1-B173 and I3-B335; I1-B168 and I3-B212; I1-B346 and I3-B126; I3-B326 and I3-B126; I1-and I3-B126; I1-B168 and 13-B126 E1-B129 and I3-B126; E1-B130 and I3-B126;
E1B-182 and I3-B126; and E1B-136 and I3-B126.

5. A method of determining the HLA-B Class I allele type of a subject, wherein the group type of the subject is known, comprising the following steps:

(i) combining a group-specific untranslated region primer pair corresponding to the group type of the subject with a target DNA sample from the subject under conditions such that primer-based amplification of the target DNA may occur and a second nucleic acid product is produced; and (ii) determining the nucleic acid sequence of the second nucleic acid product collected in step (i).

6. The method of claim 5, wherein the group-specific untranslated region primer pair used in step (i) comprises one or more oligonucleotide primers selected from the group consisting of E1-B121m17, E1-B129, E1-B130, E1-B136, E1-B182, I1-B145, II-B154m, I1-B167, I1-B168, I1-B169, I1-B170, I1-B171, I1-B172, I1-B173, I1-B174, I1-B175, I1-B326, I1-B331, I1-B346, I3-B126, I3-B147, I3-B164, I3-B165, I3-B166, I3-B187, I3-B212, I3-B305, I3-B319, I3-B320, I3-B321, I3-B323, I3-B332, I3-B335, I3-B337, I3-B342, I3-B347, I3-B348, and I3-B349.

7. The method of claim 5, wherein the group-specific untranslated region primer pair used in step (i) is selected from the group of oligonucleotide primer pairs consisting of I1-B174 and I3-B305; I1-B167 and I3-B323; II-B175 and I3-B319; Il-B145 and I3-B321; E1-B121m17 and I3-B147; I1-B154m and I3-B164;
E1-B182 and I3-B349; I1-B168 and I3-B212; II-B326 and I3-B165; I1-B167 and 13-B320; I1-B172 and I3-B342; I1-B172 and I3-B323; I1-B174 and I3-B323; I1-and I3-B126; I1-B326 and I3-B348;I1-B331 and I3-B332; I1-B326 and I3-B337;
I1-B326 and I3-B 187; I1-B169 and I3-B166; I1-B171 and I3-B347; I1-B173 and I3-B335; I1-B168 and I3-B212; I1-B346 and I3-B126; I3-B326 and I3-B126; I1-and I3-B126; I1-B168 and 13-B126 E1-B129 and I3-B126; E1-B130 and I3-B126;
E1B-182 and I3-B126; and E1B-136 and I3-B126.

8. A composition comprising a plurality of oligonucleotide primer pairs comprising one or more primers selected from the group consisting of E1-B121m17, E1-B129, E1-B130, E1-B136, E1-B182, I1-B145, I1-B154m, I1-B167, I1-B168, I1-B169, I1-B170, I1-B171, I1-B172, I1-B173, I1-B174, I1-B175, I1-B326, I1-B331, I1-B346, I3-B126, I3-B147, I3-B164, I3-B165, I3-B166, I3-B187, I3-B212, I3-B305, I3-B319, I3-B320, I3-B321, I3-B323, I3-B332, I3-B335, I3-B337, I3-B342, I3-B347, I3-B348, and I3-B349.

9. A composition comprising an oligonucleotide primer selected from the group consisting of E1-B121m17, E1-B129, E1-B130, E1-B136, E1-B182, I1-B145, I1-B154m, I1-B167, I1-B168, I1-B169, I1-B170, I1-B171, I1-B172, I1-B173, I1-B174, I1-B175, I1-B326, I1-B331, I1-B346, I3-B126, I3-B147, I3-B164, I3-B165, I3-B166, I3-B187, I3-B212, I3-B305, I3-B319, I3-B320, I3-B321, I3-B323, I3-B332, I3-B335, I3-B337, I3-B342, I3-B347, I3-B348, and I3-B349.

10. A composition comprising an oligonucleotide primer pair selected from the group consisting of I1-B174 and I3-B305; I1-B167 and I3-B323; I1-B175 and I3-B319; I1-B145 and I3-B321; E1-B121m17 and I3-B147; I1-B154m and I3-B164; E1-B182 and I3-B349; I1-B168 and I3-B212; I1-B326 and I3-B165; I1-and 13-B320; I1-B172 and I3-B342; I1-B172 and I3-B323; I1-B174 and I3-B323;
I1-B170 and I3-B126; I1-B326 and I3-B348;I1-B331 and I3-B332; I1-B326 and I3-B337; I1-B326 and I3-B187; I1-B169 and I3-B166; I1-B171 and I3-B347; I1-and I3-B335; Il-B168 and I3-B212; I1-B346 and I3-B126; I3-B326 and I3-B126;
I1-B167 and I3-B126; I1-B168 and 13-B126 E1-B 129 and I3-B 126; E1-B130 and I3-B126; E1B-182 and I3-B126; and E1B-136 and I3-B126.

11. A kit comprising:
(a) a plurality of oligonucleotide group-specific untranslated region primer pairs comprising one or more primers selected from the group consisting of E1-B121m17, E1-B129, E1-B130, E1-B136, E1-B182, I1-B145, I1-B154m, I1-B167, I1-B168, I1-B169, I1-B170, I1-B171, I1-B172, I1-B173, I1-B174, I1-B175, I1-B326, I1-B331, I1-B346, I3-B126, I3-B147, I3-B164, I3-B165, I3-B166, I3-B187, I3-B212, I3-B305, I3-B319, I3-B320, I3-B321, I3-B323, I3-B332, I3-B335, I3-B337, I3-B342, I3-B347, I3-B348, and I3-B349;
and (b) an enzyme for nucleotide chain extension.

12. A kit comprising:
(a) an oligonucleotide group-specific untranslated region primer selected from the group consisting of E1-B121m17, E1-B129, E1-B130, E1-B136, E1-B182, I1-B145, I1-B154m, I1-B167, I1-B168, I1-B169, I1-B170, I1-B171, I1-B172, II-B173, I1-B174, I1-B175, I1-B326, I1-B33I, I1-B346, I3-B126, I3-B147, I3-B164, I3-B165, I3-B166, I3-B187, I3-B212, I3-B305, I3-B319, I3-B320, I3-B321, I3-B323, I3-B332, I3-B335, I3-B337, I3-B342, I3-B347, I3-B348, and I3-B349 ;
and (b) an enzyme for nucleotide chain extension.

13. A kit comprising:
(a) an oligonucleotide primer pair selected from the group consisting of I1-B174 and I3-B305; I1-B167 and I3-B323; I1-B175 and I3-B319; I1-B145 and I3-B321; E1-B121m17 and I3-B147; I1-B154m and I3-B164; E1-B182 and I3-B349;
I1-B168 and I3-B212; I1-B326 and I3-B165; I1-B167 and 13-B320; I1-B172 and I3-B342; II-B172 and I3-B323; I1-B174 and I3-B323; I1-B170 and I3-B126; I1-and I3-B348;I1-B331 and I3-B332; I1-B326 and I3-B337; I1-B326 and I3-B187;
I1-B169 and I3-B166; I1-B171 and I3-B347; II-B173 and I3-B335; I1-B168 and I3-B212; I1-B346 and I3-B126; I3-B326 and I3-B126; I1-B167 and I3-B126; I1-and I3-B126 E1-B129 and I3-B126; E1-B130 and I3-B126; E1B-182 and I3-B126;
and E1B-136 and I3-B126; and (b) an enzyme for nucleotide chain extension.

14. The kit of claim 13, further comprising:
(d) a sequencing primer selected from the group consisting of GGA
TCT CGG ACC CGG AGA CTC G (SEQ ID NO:436); ACC CGG TTT CAT TTT
CAG TTG (SEQ ID NO:437); TTT ACC CGG TTT CAT TTT CAG TT (SEQ ID
NO:438); TCC CCA CTG CCC CTG GTA (SEQ ID NO:439); GGK CCA GGG TCT
CAC A (SEQ ID NO:440); ATC TCG GAC CCG GAG ACT (SEQ ID NO:441); and TCC CAC TCC ATG AGG TAT TTC (SEQ ID NO:442).