CA2296765A1 - Soluble recombinant botulinum toxin proteins - Google Patents

Soluble recombinant botulinum toxin proteins Download PDF

Info

Publication number
CA2296765A1
CA2296765A1 CA002296765A CA2296765A CA2296765A1 CA 2296765 A1 CA2296765 A1 CA 2296765A1 CA 002296765 A CA002296765 A CA 002296765A CA 2296765 A CA2296765 A CA 2296765A CA 2296765 A1 CA2296765 A1 CA 2296765A1
Authority
CA
Canada
Prior art keywords
toxin
protein
recombinant
antibody
antibodies
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002296765A
Other languages
French (fr)
Inventor
James A. Williams
Bruce S. Thalley
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Allergan Inc
Allergan Botox Ltd
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/704,159 external-priority patent/US6967088B1/en
Application filed by Individual filed Critical Individual
Publication of CA2296765A1 publication Critical patent/CA2296765A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/02—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from eggs
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1267—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria
    • C07K16/1282—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria from Clostridium (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention includes recombinant proteins derived from Clostridium botulinum toxins. In particular, soluble recombinant Clostridium botulinum type A, type B and type E toxin proteins are provided. Methods which allow for the isolation of recombinant proteins free of significant endotoxin contamination are provided. The soluble, endotoxin-free recombinant proteins are used as immunogens for the production of vaccines and antitoxins. These vaccines and antitoxins are useful in the treatment of humans and other animals at risk of intoxication with clostridial toxin.

Description

i CA 02296765 2000-O1-14 ;
..::
DEMANDES OU BREVETS VOLUMINEUX
1~ PRESENTE PARTiE DE CETTE DEMANDE OU CE BREVET
COMPREND PLUS t7'UN TOME.
CECI EST LE TOME ~_ DE
NOTE: Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets THIS SECTION OF THE APPLlCATIONIPATENT CONTAINS MORE
THAN ONE VOLUME
THtS 1S VOLUME ~_ OF _ ~
NOTE. For additional volumes please contact the Canadian Patent Oifice o rcr~us~rns394 MULTIVALENT VACCINE FOR CLOSTRIDIUM BOTULINUM NEUROTOXIN
FIELD OF THE INVENTION
- The present invention relates to the isolation of polypeptides derived from C'lo.s~ridiurn s hrriulinum neurotoxins and the use thereof as immunogens Ibr the production of vaccines.
including multivalent Vaccines. and antitoxins.
BACKGROUND OF THE INVENTION
The genus C'luctridiurn -is comprised of gram-positive, anaerobic. spore-formine bacilli.
1 U The natural habitat of these organisms is the environment and the intestine! tracts of humans and other animals. lndeed, clostridia are ubiquitous: they are commonly found in soil. dust.
sewage. marine sediments. decayins~ vt:getation. and mud. (.See c.,~~.. P.H.A.
Sheath er crl..
"f 'lu.crriclitrnt." l3c~r;t~c~u'.c .hlcrnuctl tt n~ .St'.stcmulic l3crrlerirrln,L~v. Vol. ?. pp. 1 I.ll-1?00.
\~l'illiams ~ \'l'ilkins ( 19861. J Despite the identification of approximately I UU species of Is <'lnsrr-iclirmu. only a small number have been recognized as etiology=is agents of medical and veterinary importance. Nonetheless. these species are associated with very serious diseases.
includint: botulism. tetanus. anaerobic ccllulitis, gas ganLrene. hacteremia.
pst:udorncmbranous colitis. and clostridia) gastroenteritis. Table 1 lists some of the species of medical and veterinary importance and the diseases with which they arc associated. .as virtually all of '?U thaw species have been isolated from fecal samples of apparently healthy persons. some of tllCSt."IVOIQICS Illa1' be transient. rather than permanent residents of the coionic flora.
rAeu: t . ~t....._:.r:..... c.,....:.~ nr tut~dir~l And Veterinan~ Imnortancc' '? species Disease j C'. cunirrrwcrlcrirmn Bacteriuria (preunant women) ('. ur,~,eruim:nce Infected wounds: Baeteremia: botulism:
Infections of amniotic fluid Infected war wounds: Peritonitis: Infectious C'. hco~cuii processes of the eye. ear and prostate C'. heiicrinrkikii Infected wounds i0 c'. hilrrnrcmcrrrv Infected wounds: Abscesses: Gas Gam_rene:
. Bacteremia C'. t,muiinrun Food poisoning: Botulism (wound. food.
infant) lJrinan' tract. lower respiratory tract.
C'. hurrriruat pleural cavity. and abdominal I nfected wounds: Abscesses: Bacteremia infections:

C'. cuclurerir Abscesses: Infected wounds PCTlUS97115394 ('Irr.slrirliunr Species Of Medical And Veterinary Importance' Species Disease ('. ccwni.e Soft tissue infections: Dacteremia C'. chuulwri BIaCkle~, C'. c'Irr.crrriliuJilrrnc r1hdominal, cervical, scrotal, pleural.
and other infections: Septicemia:
Peritonitis; Appendicitis (' crn~lrleru'mm Isolated from human disease processes, hut role in disease unknown.

(.. cli//ic'ilc Antimicrobial-associated diarrhea: t'seudomembranous enterocolitis:
8acteremia: I'voeenic infections (' /rrllrev Soti tissue infections C' ,elurnii Sufi tissue infections (' ~/acwlunun lVound infections: Abscesses: Pcritonis ('. Irrr.rrlru'nrc' Itlfccted war wounds: fiacterernia; Abscesses I(1 ( lrraullrrenrm Infected war wounds: C.ias !_an~!rrnr:
Gingival placfuc isolate (' rrnlrrlr.v C~aslmintestinal tract infections l' irrnrrcurrrrn Gastrointestinal tract Infections: C:nlpycn la t' Irrc,s~ulcu'c Penile lesions <'. I~yuunr Isolated tfnm human disease prUCCSSIS.
but r()Ir in dISeaSI UIIkIIUW'Il.

(' lirltW rrr)r l,atterenlla; I'erltUllltl5: f'111111UI1F11'~
111tCCtIUnS

rrrcrlunrlrnrrrUlflrrlVarIUIIS IIlfeCIIUUS processes Infected mounds: Gas !~an~~rene: 131ackle_.
(' nrmw I3i~_ head lovinrl: Itedwater disease Ihovine) (' rwrrcvrrrr l!rinarv tract infections: Rectal alISCCSSeS

I~cll'tlyllll'I/IC'fllllL3aClCrenlla: PCrIfOnIlll: lIIfCCIOtI
W'(11111d5: AppelldlClllv (ialS ~~ilnrenC: Anaerobic crII1111115:
('. yc'rJrin,ycuzv tntra-abdominal ahsCCSSC',5: 11f11 tissue infections: food poisunill~~: Necrotizin~
pneumonia; f::mpycma:
~4eninl:itis: t3acteremia: lJterine Infections:
Enteritis necrutans: t.amh dvsenterv: Struck: ()vine Enlerotoxemia:

('. Inrrrc'hreic'rre f3acteriuria (Pre~nanl women with hacteremia) ('. lrrrri/iorun Abscesses: Infected wounds: fiacterrmia (' rrrrrrrrvrrrrr Infections of the abdominal cavity. genital tract. lun~_. and hiliary tract:
f3acteremia <' .vcrr'rcrs;u/ru'rrroIsolated from human disease processes.
hut role in disease unknown.

Oas ~.:an~,rene: t3acteremia; Sllpplll'fitll'e _J ('..v~luicorn IIlteCtlUIIS: ~ICCrotilinS:
r cnterocolitis: l3raw ('. virr'clc'llir CiaS !~all~~rCllC: wOtllld IIIfCCII<)I1S:
Peltlle Ie111111$: l3aOCrC1111a:
AhSCCSSeS: AhdUllllnill illld Vill,lllill IIlteCll(1115 . 7 .

TABLE !
('Irr.efr'itlirrm Species of Medical And Veterinary lrnponance' s Species Disease Appendicitis: Bacteremia: L3one and soft tissue infections:

. (' cl,Ircrrrriclc.s lntrapcritoneal infections: infected war wounds: Visceral ~~as gangrene:

Renal abscesses Cias Lan==rene: Bacteremia: Endocarditis:
central nervous sastem and - <'. sl,rrrrmvrc.s plcuropulmonary infections: Penile lesions:
Infected war wounds:

ether pyogenic infections ('. .wrhrerrrnulc' Eiacteremia: Empyema: E3iliary tract.
soft tissue and bane infections c' ."nhirrvm Liver abscesses: E3acteremia: Infections resuitin~s due: to hove( flora Gas ~~anarene: Appendicitis: Brain abscesses:
~ Intestinal tract and soft . It'I'Irllr)r ' ' ( tissue infections: infected war wounds:
i'eriodomitis: Bacteremia Tetanus: Infected gums and teeth: l'nrneal ulccrations: Mastoid and middle ear infections: Intraperitoueal infections: tetanus neonatorum:

(' r~uurrr Postpartum uterine infections: Soft tissue infections. especially related to trauma (includirt~! abrasions and lacerations):
Infections related to use of contaminated needles r' rlumrrn.verce'luu'nhwcurrIsolated Irom human disease processes.
hut role in disease unl:nnwn.

' l-unrpilcd front I'.(i. L~.n~wlkirk cu crl "('lcr.s'.sr/ic~cuirrrr".
J'rincyrlc~.s urrcl l'rcunic'c n/ ('Jirric'crl .~lnucnvrhu 1 () Ilmr n~rvrrlry~n. pp. ,?-?.i. star Publishin'_ C'.u., f3elmont. CA I
199?): .I. vephen and R.n. I'etrowski.
.~luvin.v l!'hic'h li'cwrrwc~ .lle~»rhr'c»n~v a»cl Dcre~,t,'rrlutr ('c~Ilc."
ire Ilcrevc'rrerl l'er.ri».,. ?cl ed., pp. 66.07.
lmcrican Sociey for Microhiolo~y 1 I')8(i): R. E3erkow and A..I. I-irtcltcr tcds.l. "I>rurrrrcrJ I)i.rccrsu~.,."
llcv'c'k ~llr»rrrerl nJ Dicrtvrrr.,r.s a»cl Tlrerup', 16th ed., pp. 1 16-I?G.
Merck Research laboratories. Rahway.
~.J. ( Ic)c)3): and O.II. Si;~mund and C.M. Fraser lcds.). "('Invrriclicrl IrrJcrc'rin».e." .llc~rc'k l u~m~rvnur'n 1 > tier»rnrl. srh ed.. pp. 39(i.~tt)9_ Merck 8: Cc,.. Rahwav. N.J. (1979).
lit Ilt(11t cases. the pathuecnicitv ut~ these organisms is related to the release ul~ p(wcrt~ul rxotuxins etr hi~_hy dcatructim enzvtncs. Indeed, several species (tt~ the genus ( 'lrr.vriclirr» l produce toxins and other en-rvmcs uf~ great medical and veterinary siyiticance. ~C.L..
?() I-lathmav. C'lin. Alicrohiul. Rev. s:66-98 ( 1990).) 1'crhaps hecause ttt~ their significance for human and veterinary medicine, much research has keen conducted (tn these toxins, in particular those ut~ ('.
hrrlrrlinrr»r and ('.
cli~jicilc-.
(.: bnltttiur~m ~evcral strains oh ('Irr.slrrclrrrm hmulinrun produce toxins of aiLniticancc to human and animal health. ~C.l.. 1-lathew'ay. Clin. llicrohiol. Rev. ;:(il-98 ( 199Q)~
The ct~tccts of these twins ranLe from diarrheal diseases that can cause destruction of the colon.
to paralytic etTects that can cause death. Particularly at risk for developine clostridia) diseases arc _ ., _ neonates and humans and animals in poor health (e~.,s,~., those suffering from diseases associated with old age or immunodeficiencv diseases).
('ln.vriclirrm huJUlintrm produces the most poisonous biological toxin known.
'Chc lethal human dose is a mere 10-'' mglkg bodvwcic_:ht fnr toxin in the bloodstream. Botulina!
s toxin blocks nerve transmission to the muxles, resulting in tlaccid paralysis. \~'hen the toxin rcachrs airway and respiratory muscles. it results in respiratory tailure that can cause death.
(5. ~lrnon. .I. Infect. Uis. 14:2()1-?OG (1986)) ('. huurlirrrrm spores are carried by dust and arc found on vcgetahle> taken t~rom tire soil. on ti~esh fruits. and on agricultural products such as honey. t under conditions favorable lt) to the organism. the spores germinate to vegetative: cells which produces toxin. [~. Arnon.
Ann. Rc. Med. ~ I :,41 ( 1 c)8(?11 Botulism disease may he grouped into tour types. based an the method of introduction of I()\111 Illl(1 the bloodstream. Food-borne botulism results t~rum ingesting improperly preserved and inadequately heated food that contains botulinal toxin. ~Ilterr mere s~~ cases of I s I~ooc1-lu~rnc botulism in the t Jnited States between 1 c)76 and 1 c)84. ( K.I.. Mact)onald en crl..
~~m. .I. I~:hiclentiol. 1?~:7~)a (lc)86).J 'The death talc due to hotulinal toxin i, I?'~:« and can he higher in particular risk groups. [('.(). Tacket m crl.. nm. .1. Meet. 7(>:7~)-t ( I ~)H~1), ( V4'ound-induccel hcaufism results ti-om ('. huJrrlirrunr penetrating traumatized tissue and proolucing toxin that is absorbed into the bloodstream. Since Ic)s0. thirm cases of wound hntulism have been '?() reported. ('\1.N. ~wart7.. ".~trtrrcrnhic.5prrr~c-l~~nrmirt,~~ l3crculli T7tu ('lo.wricliu." ph. fp.s-l>~1O. irr I3.D. 1)avis ce crl..teds.). aliurrrhinlr~,L~n. ~tth edition. .I.13.
I.ippincott ('o. (Ic)c)(I).J Inhalmnon hotulisrn results when thr toxin is inhaled. Inhalation botulism hay been reported a, the result cvf~accidental mpetsure in the laboratory (I:. Ilolzer. hleel. );lin. ~1:17;i (I~)(~''IJ .md c:ould arise if the toxin is used as an agent of biological wurtare ( l).lt. (rant rr crl.. in l3rmrlinrrrra curd T incrrrrr.c .\'c~uroJnsinv. B.R. UasCiupta. ed.. I'Icnum i'rcss. Nrw York 1 1 ~)~);1, pp. ~7s-.~76].
Intcetious infant hotufism results from ('. horulinrrnr colonization of the int~ant intestine with production of toxin and its absorption into the bloodstream. It is likely that the bacterium Lams entry when spores arc ingested and suhsequentU g.erminatc. (~. Arnon. .I.
Infect. 1)is.
f S4:?Ol ( I c)86). ( There ltave been i()0 cases rrportcd since it was tirst recognized in I ~)7(~.
;() ( M.N. ~wartz. .wrpru. ( Infant botulism strikes infants who are three weeks to eleven months old (greater than 90% of the cases are infants less than six months). [S. Arnon. .(. Infect.
Uis. 1~:~:201 (198G).]
It is believed that infants are susceptible, due, in large part. to the absence of the full adult complement of intestinal microtlura. The benign microtlora present in the adult intestine provide an acidic elivironment that is not favorable to colonization by ('.
hrur~linrrnr. Infants begin fife with a sterile intestine which is gradually colonized by microtlora. (3ecause of the limited microtlora present in early infancy. the intestinal environment is not as acidic.
atllll'IIIF_' lim ('. Irr)nrlirrrrlrr Spore LertttlttatlOn. growth. and toxin production. tn this regard.
sonic adults who have undergone antibiotic therapy which alters intestinal microtiora become 1l) nturc susceptible to hotuiism.
:fin additional factor accuuntinL fur infant susceptihiliw to infectious hutuiism is the immaturiy of the infant IlttIttUltl'. S1'StCltt. ~I~I1C ntalUfe llttltttllte S~'Stelll 1S SenSItIZCd to harterial antigens and produces prutectiw antibodies. Secreturv t~~A produced in the adult intestine Ilas tltr ahiliW to ag~~lutinate ve~~etative cells of ('.
hruulirrrrnr. (S. Arnun. J. lntcct.
I s I)is. 1 ~-x:'_'(11 t I r)8h). [ Secretary 1L ~1 ntav also act by preventing intestinal bacteria and their products I~l'un1 crosSitlL the cells of the intestine. [~. Arnon. Fpidemiul.
Rev. ;:-is ( 1981 ). [
The inlant 111111t1111C SVSIettl IS l7Ut primed to do this.
('linical Symptoms ol~ infant hotulistn range from ntild paralysis, to moderate and smcryparalysis reciuiring huspitalizatiun. to fulminant paralysis. tending to sudden death. (S.
~U :lrnon. lpidrmiul. Rcv. s:4i t I c)81 ).]
'rhe chicf~ therapy for severe infant botulism is ventilaturv assistance using a ntrchcmi~al respirator and concurrent elimination of toxin and bacteria using cathartics.
enemas. and LaSlCIC la1'QLC. There were G8 hospltaltzattons 111 C'alitornia f'or infant h~tulisnt in a sint!le year with a total cost of over $4 million for treatment. ['t~.l,.
l~ranl:ovich and 5.
:lrnun. V4'cst. .I. f~-led. 1 >4: I Os ( I c)9 I ). [
Different strains of C'lo.srniclirrnr hotulinum each produce antigenicatlv distinct toxin designated by the letters i1-G. ~crotypc n toxin has been intplicatcd in ?G°~o of th c: cases Of ii~oti botulism: types (3. E and F have also been implicated in a smaller percenta~~e of the titod botulism cases (1!. Sugiyama. ;~~icrobioU. Rcv. 44:419 ( 1980)]. Wound botulism has been st) reportedly caused by only types A ur l3 toxins (H. Sugiyama. .~rrpr-cr(.
Nearly all cases of infant botulism have been caused by bacteria producing either type n or type f3 toxin.

( Exceptionally. one New Mexico case was caused by ('!us'rrrclium hnurllnum producing type F
toxin and another by ('lo.sr'riclium hrmrlir7trm producing a type f3-type E=
hybrid.) [S. Arnon.
Epictemiol. Rev. >::15 ( 1981 ). j Tvpe C toxin affects waterfowl, cattle, horses and mink. ~1'yPe I) toxin affects cattle. and type E toxin af~feets both humans and birds.
r1 trivalent antitoxin derived from horse plasma is commercially available from C'unnaus~ht Industries i,td. as a therapy for toxin types A. B. and h.. 1 iowcver. the antitoxin .
has smeral disadvantages. First. extrenteiy large dusa~~es must h a injected intravenously ;lndlor intramuscularly. second. the antitctxin has serious side effects such as acute anaphvlax)s wh)ch call lead to death. and scrum sickness. Finally. the efficacy c)f the I t) antitoxin is uncertain and the treatlnent is costly. jC'.(). ~ ticket n ul.. Am. .I. Mcd. 711:7c)4 ( t ~)8~). ( :1 hcptavalent eyuine botulinal antitoxin which uses only the F(ah')? portion e)f the antihculv mc)lecule has been tested by the L)nited States l~1ilitary. (M.
l3aladv. I~~AMROC' '~imslctmr. 1). O ( Ic)c)1 ).J This was raised against impure toxoicts in tlu)se lar~~r animals and is I s nclt a hi~~h titer preparation.
:~ pentavalent human antitoxin has been collected li-om immunized human subjects fi)r llSe av a ll'latlttelll t()f llttallt h()tU11S11). ~rlt(; Sllppll' ()f 11115 antlll)\I11 lv 111ltlled and eanll(lI he eapectec3 to meet the nerds of all individuals stricken with botulism disease.
In addition.
collection of human sera must involve screening out f I1V and c)ther potentially serious human ?0 pathcyens. ( I'..1. ~chwart, and S.S. Arnon. Western .I. Med. I 56: I c)7 ( I I)~)? ).
infant botulism has been implicated as the cause oi~ mortally 111 solve cases of Sudden Infant I)cath Syndrome (SIDS. also known as crib death). ~lO~ is ol~ticictlly r~co~~ni~rli as Infant death that is sudden and unexpected and that remained unc;xplained ctespite cc)mplete post-nu~rt-rm examination. ~I~hc link of SIDS to inthnt botulism came when fecal or hloacl ?5 specimens taken at autopsy from SIDS infants were t~und m contain ('.
hv~rrlirrunr organisms andlor toxin in 3-4% of cases analyzed. (U.R. Peterson eml.. Rev. infect. Uis.
1:6sU
( Ic)7c)).) In contrast. only 1 of 16() healthy infants (().G%) had C'.
hnlulinrrm orLanisms in the l~ccs and no hotulinal toxin. (~. Arnon m crL, Lancet, pp. 1'_'7;-7(. .tune 17, tc)78.) In developed ce)untries. SIDS is the number one cause of clcath in children henvecn ;() one ntunth and'e)ne year old. (~. Arnon cn ul.. Lancet. pp. 1?70-77. .lone 17. 1()78.) R~lore children die ti~om SIUS in the first year than li-om any other single cause of death in the first ' _ti_ fourteeil years of life. In the United States. there are 8.000-10.000 SIDS
victims annually.
Ici.
Vl.'hat is needed is an effective therapy against 111ta11t botulism that is li'ee of dangerous side effects. is available in large supply at a reasonable price. and can be sate;ly and gently s delivered so that prophylactic application to infants is feasible.
Immunization of subjects with toxin preparations has been done in an attempt to ' induct: immunity against howlinal toxins. A C'. hnntlinrcm vaccine comprisin~_ chemically inactivated (i.c'.. litrlnaldchvde-treated) type A. B. ('. I) alld F: toxin is commercially available lire htllllall tlS:l~C. 1-lowcver. this vaccine preparation has several disadvantages. First. the lU efficacy ot'this vaccine is variable tin particular. only 78% ol~recipients produce protective levels ef anti-type E3 antibodies followins~ administration of the primary seriesl. Second.
immunization is pi1111f111 (deep subcutaneous ln(lCUlatlOn IS I'eCllllrl:d IOC
ad1171nISI1'tltllln), with advcrw reactions hcin;~ common (moderate to severe local rracticlns occur in approximately O'~a al~ 1't.'C11711'.IIIS tllllln II1111aI injection: this number rises to approximately I I'a of individuals I~ who rect:ivc 11t)OStI'.f 1111C(:ll()nS) [Informational Hrochure for the I'entavalent (Af3CDE~.) l3otulinunt l moil. C'enmrs lire Disease (.'ontrol~. ~(~hird. preparation of the vaccine Is tlanLertms as active toxin must he handled by laboratory worl:crs.
Vt'hat is naeded are safe and et'ti:ctive vaccine preparations tar administration to those :It rill; ol~ mposurc to C'. hululinum toxins.
'? () C: clifficilc~
('. cIiJJic~ilr. an or~~anism wllich Lained its name due to dif'licuities encountered 111 Its l~tll:llll)11. h:lv 1't,'la:lltll' ht'e11 prtl~'Cn t(1 h c an etiologic :l~~lllt tlt~ dl:tri'IIC:II tIISI'aSl'.. ( ~Ilf.'alll C'I
ul.. p. I t(,~.). ('. cli/Jicilc' is present in the gastrointestinal tract of approxilnatelv i'% ol' healthy adults. anti 10-_,0% of neonates without adverse effect (W warm. at p.
O44): by other estimates. C'. cliJ)icilc' is a part ot~ the normal gastrointestinal t7ora tlf ?-10'ro ot~ humans. [C.F.
E3rool;s m eel.. (cds. ) "lulcerivn.v' ( 'cr:r.~'ccl ht' : t mterohir I3crc'reriu." .lamer-. rV lc'Inie'k. d .lclelher~ '.~ .1-Icclirul alic'rnhiuln,~~t'. I ()th ed., pp. 257-2C1?, :~ppleton R, Lange. San Matc;o. C'A
( I t791 >. j :1s these organisms are relatively resistant to most commonly' used antimicrohials.
i() ~~'ht.'ll a patient is treated with antibiotics. the other men thers of the normal LQSII'(lllltlSL111a) *rB

vyp ,~glpg~p PCT/US97/15394 flora are suppressed and C'. di/~icile flourishes. producing cvtopathic toxins and enterotoxins.
It has been found in 25% of cases of moderate diarrhea resultinL lt'om treatment with antibiotics. especially the cephalosporins. clindamycin. and ampiciilin. ~M.N.
Swartz at 644.]
Importantly. C'. clif~icile~ is commonly associated with nosocomial inlections. The organism is often present in the hospital and nursing home environments and may be carried c,n the hands and clothing of hospital personnel who care ti,r debilitated and Ilttlttllll()(:11111pro1111Sed pallelltS. As many of these patients arc hcin~~
treated with antimicrohials or other chelnothcrapeutic agents. such transmission of ('.
cli/~icile represents a significant risk factor ti,r disease. (Engelkirk e~ ul.. pp. l0-(,7.) ('. clif~irilc is associated with a range of diarrhetic illness. ranging ti'om diarrhea alone to marked diarrhea and necrosis of the gastrointestinal mucosa with the accumulation of inflammatory ells and fibrin. which ti)rms a pseudomembrane in the affected area. (Brooks c~ml. > It has been found in over 4>°/. of pseudomenthranous enterocolitis cases. t~wartz. at p. l0-4.) his c,eeasionally fatal disease is characterized by (ii,irrhea.
multiple small colonic is plaques. and toxic ntegacolon. (Swartz. at p, h44.) nlthoueh stoi,l cultures are sometimes used ii,r CIIJLIt()SIS. diagnosis is best made by detection oi' the heat labile toxins present in kcal filtrates from patients with enterocotitis due to ('. cli/Jirilr. (W
vartz. at p. h4~1-las: and Brooks rr ul.. at p. ?6U.) ('. cliJ/irile trains are cvtotoxic ii~r tissucicell cultures and cause enterocolitis when in_jectcd intracecalU into hamsters. t~u~arto. at p. 644.) ~U The enterotoxicitv of ('. cli~/irilc is primarily due to the action of two toxins.
llesignated r1 and B. each of approximately x()0.000 In molecular weight. Both arc potent cWotoxins. with toxin A pnSSISSIItL direct enteroc~'touovic activity. jl.vcrlv c-r ol.. Intcrt.
Immun. (,O:~ll3s (199?). Unlike toxin A of (.'. ycrJrinl,~cn.,. an c>r~~anism rarely associated with antimicrohial-associated diarrhea. the toxin of ('. cli/)irilr is nen a spore coat constituent ?s and is nut produced during sporulation. (~wartz, at p. (i~i~4.) ('.
cliJJic'ilc~ toxin A causes hemorrhage. lluid accumulation and mucosal damage in rabbit ilcal loops and appears to increase the uptake of toxin R by thr intestinal mucosa. ~l-u~cin B ll()eS 11 ()l CallSe IIlteStlllai t~llld aCCllllllllatl011. hill Il 1S 1~~~ tlnleS IItOCe IOxIC tltalt l0\In A
l(~ llSSlll' CUlture cells and eaUSeS Illellthralle damage. ~~ttltOll~,h hl)tlt tClxlIlS llt(illl:e 1111111at' C~Illllar efteC,iS SLICK 111 aCll!) sU disaggregation. differences in cell specificity occurs.
_g_ WO 9t~540 PCT/US97115394 Both toxins are important in disease. (Borriello cn «L. Rev. Infect. Dis..
I?(suppl.
?):518 (199U): Lverlv cn crl., Infect. Itnmun.. 17:349 (i98S); and Rolte.
Infect. Immun..
S9:1 ??_s ( 1990). j 'hoxin A is thought to act first by hinding to brush harder receptors.
destroying the outer mucosal layer. then allowing toxin 13 in Lain access to the underlying s tissue. These steps in pathogenesis would indicate that the production of neutralizing antihudirv a;:ainst toxin A tray he sufficient in the prophylactic therapy of cn~~n. !-luwevcr.
ctntihodics aLainst toxin B may he a necessary additional component for an effective therapeutic a;~ainst lacer stage culunic disease. Indeed, it has been reported that animals rccluirc antihodita to both toxin i1 and toxin B to be completely protected against the disease.
I (f ( Ivim and Rol li;. nbstr. Ann. Meet. ~>m. Soc. Microbial.. f9:(2 ( 1987).J
( '. cli/Jioilo leas also been reported to produce other toxins such as an cnterotoxin diffi:rcnt from toxins ~1 and B (Ranno c~r «l.. Rev. Infect. Uis.. O(Suppl.
1:51 I-S?0 ( 1984y[. a Imv molrcufar \1'~SLht l(1\ltl (Rihn rr «/., i3iochcm. liiuphvs. Rcs. ('untm..
l~:l:lo)U-(o)s t 1984)[. a motiliy altering lactur [.lustus e~ crl.. Ciastrocnterul.. 8.s:8sh-84; ( 198'_')(. anti I s perhaps other toxins. Regardless. ( '. rli/~icile gastrointestinal disease is of pritnarv concern.
It 11 vlLlliflt;altl that due to its resistance to most commonly used antimicrohials. ('.
clif)ioilr is assoriatc:d with antimicrohial therapy with virtually all antimicrohial agents (alth(lll~~h 111(1~t Cl)Iltltt()tll\' ampicillin, clittdamycin and cephalosporins). It is also associated with disease in patients under~~oin~~ chemotherapy ltltlt SLICK CUlltpUlllld~
aS Ittl'tlt(1ll'C\atC. ;_ ?(I Iluc~n~uracil. cvciuphosphamidc. and duxurubicin. (S.M. Finegolcl c~r crl.. ('liniwrl (:«icle ~r~
I rr«rrohio ~!7/t'C'll~llT.1'. pp. 88-89. liar I'uhlishing C'o.. Belntont. C:A
( t 9c)?). ( ~l r~atment «f ('. cli/ric~ilc~ ciiseasc is problematic. ~.:iven the I11LI7 reSlStattCt'. l)I' the or~~anism. Oral mctronidazole. hacitracin and vanconwcin have Keen reported to he ci'fcctivc.
(I~ineguld er crl.. p. 89.) f-lowevrr th crc arc problems associated with trcattttcttt utilizin~~ these c:ompuuncis. Vancumvcin is very expensive, some patients arc unable to take oral medication.
and the relapse rate is high (?0-?5°i~), although it may not occur for sweral weeks. lcL
( '. cI1//IC'fIC~ disease would br prevented or treated by neutralizing the effects ul' these toxins in the ~_astrointestinal tract. Thus, what is needed is an effective therapy y~ainst ('.
cli~~ic~ilc~ toxin that is free ol~ dank=eruus side effects, is available in lar~~e supply at a reasunahlc _g_ price. and can be safely delivered so that prophylactic application to patients at risk of developing pseudomembranous enterocolitis can he el~fectivelv treated.
UES(:RII'TInN OF THE I)RAWINt:S
I~igurc I shows the reactivity of~anti-('. hotrrlimrrn IgY by Vvestern blot.
(~i~;urc ? shows the IgY antibody titer to ('. hrmrlinrrm type n toxoid in eggs. measured by E:I.IW ~.
figure .i sltuws the results u1~ ('. clij~irilc~ main :\ neutralization assays.
I=i~!ure ~ SlleWyS II,e reStlllS (,t~ ('. cliJ%ic~ile~ toxin 13 neutralisation assays.
l0 i~irurc s shows the resells of ('. cliJJicile~ toxin I3 neutralization assays.
UiLUre (, is a restriction map of l'. clifjicilc train r1 gene. showin~~
secluences of l,rimrrs I--t (gyp() ID N()~:l-~4).
I~i~_ure ~ Is 1 N%estern blot ot~ ('. cIiJJicile twin ~~ reactive I,rotcin.
hi'~urc li shows ( '. clij)icile toxin A expression constructs.
I s I~ i~:urc ') chows ( ' cli~Jicilc~ twin A expression constructs.
I~i~~urc lU chows the purification ot~ recombinant (' cIiJJicilr toxin i1.
I~i~_urc 1 1 sht,ws the results oi~ ('. cli/jicilc- toxin i~ nrutraliiation assays with antibodies reactive m recombinant toxin A.
I~i~urc 1~ sla,~s the results ti,r a ('. cli/Jicile toxim~ neutralization l,iate.
?l) I-igurc 1s shins the results ti,r a ('. cliJ)icilr toximl neutralioation plate.
l~igurc I-1 shows the results ot~ recombinant ('. cIiJJirilr toxin /~
neutralization assays.
I~ i~urc I ~ shows ( '. cIiJJic~ilo toxin A expression constructs.
f~ i;~urc I (, shows a chronutto~=raph plotting ahsorhancr at ''HU not :ILalt,ll CWentlOn (11111'.
ii,r a h\-1r11~i70-t,BU lgY 1'IV(i preparation.
'_'> I~iLUre 17 shows mo recot3~binant ('. cli/)icilc~ toxin f3 expression constructs.
IiLUre 18 shows ('. cli/Jicile toxin I3 expression constructs.
I~ inure I c) shwys ( '. cli/jirile toxin l3 expression constructs.
l~igurc '_'() shows ('. cli/)icilr toxin f3 expression constructs.
I~i~~ure ?1 is an SC)~-1'I~(iE '~rl showin~~ the nuritication oC rccomhinant ('. cliJ/iole ;() toxin li lilsiun protein.

Figure ?? is an SDS-PAGE gel showing the purification of two histidine-tagged recombinant C'. cliJ~irilc~ toxin B proteins.
Figure '? > shows ('. clif~icile toxin B expression constructs.
Figure 3~ is a Western blot ol~ ('. cliJ~icilc~ toxin E3 rcactivr protein.
s ri'~ure '_'~ shows ('. hmulirrrun type A toxin expression constructs:
constructs used to ltrovidr ('. hnrrrlinum or ('. clijJic!!~~ sequences are also shown.
- Fi~~urr ?6 is nn SDS-PAGE Lel stained with C'oomaisse bloc showinL the purification ol~ rece~mbinant ('. hn~ulrrurnr type A toxin fusion proteins.
Fi~~ure ?7 Sh(1~4'S ('. hrrlulinrrm mpc /\ toxin expression constructs:
constructs used to I () provide ( '. hruulinunr sequences are also shown.
I~i~~urc '_'8 is an SDS-I'A(iC gel stained with C'oomaissc hfue showin~~ the purification of~ pllisE3ut protein usinL the Ni-NTA resin, f~igurc '_'t) is an SDS-1'r\(iE gel stained pith C.'()l)IttalvSe hlLle SftU~t111g Ilte C\preSSl()It (1f~
pllislW o protein in 131.?l(DE3) and BL21(DFi)pl.vsS host Cells.
I~ I~i~~ure ,0 is an SDS-PACiF ~~cl stained with t'c~olnaisse blue showing the purification t~l pl lisl3ot protein using a hatch absorption procedure.
l~i~~ure ,l is an SDS-1':\CiC' ~~el stained with Coomaissc blur sltowin~_ the puriiicaticm u!~ pl-lisf3c~t and pflisl3ot(nativc) proteins using, a ~(i-N'I~:\ column.
I~i~~ure ;? is an SD5-PACif: ~e:l stained with C'017111a15;iC hlUe SltO~1'111!~ the purification ?() ol~ pllisl3otA protein expressed in p111sI3otA(syn) kilt lacl~l T7/pAC'Y('CiroiE3l.?1(E)ES) cells usin~~ an lI)A coftltn.
f~i~~ur~ ;; is an SDS-PACE: gel stained with C'l)(1t17a11S1'. 111t1e Slto41'lltg lltl purification ul~ pl 1is13utr\. pHisI3otl3 anti pEEis(3otE_ proteins ht' IDA
chrctmato~~raphy titllowrd by chrrmtates~=raphy on S-l00 to rcmow t~c~lding chaperones.
l~ i~~urc :~~ is an SDS-PACi(: gel stained with CoOlttalsse bloc showing the extracts derived t~rom plEisE3ot(3 amp T7lacIBL?1(DE31 cells before and after purification on a Ni-N'T~A column.
Fi:'ure i5 is an SDS-I'ACiEeel run under native conditions and stained with ('aomaisse blue showing the removal ol'~t'otding chaperones from IDA-puriiicd fiotE3 protein i0 urine a S-I()() column.

W~ ,~~pg~p PCTIUS97115394 Figure 3G is an SDS-PAGr gel stained with C'oomaisse blue showing proteins that eluted during an imidazole step gradient applied to a IDA column containing a Ivsate of pHisButB kan Iaclq T7/pACYCGru/BL31(DF~) cells.
f~ figure ,7 is an SDS-PAGE Lel run under native conditions and stained with ('uomaissc blue showing IDA-purified ButB protein bcti~re and after ultratiltratiun.
Figure >8 is an SDS-PAGE gel stained with Coomaissc blue showing the purification c,t' (3utE protein using a NiNTA column.
I~ieure 3~) is an SDS-PAGE gel stained with ('uurnaissc bloc showinL extracts derived f~rum hllisE3utA kan ~I'7 lac/13L?1(DE3) pLysS cells grown in fermentation culture.
1() figure ~4U is a chromatogram showing proteins present after 1DA-puritiecl Hot!: protein was ahplied.to a ~-lUU column.
DEFINI'FION~;
I a t'acilitate understanding of the invention, a number ol~ terms arc defined hrlc,w.
1 ~ .~~s used herein. the term "ncutralitinL" is used in reference to antitoxins. par ticulartv antitoxins cumprisin~ antibodies. which have the abilim to prevent the patholpical actions of the toxin against which the antitoxin is directed.
~1s used herein. the term "overproducing" is used in rclercncc to the production of clostridia! toxin polvpeptides in a host cell and indicates that the host cell is hruducing more ?U of the clostridia! twin by virtue of the introduction of nucleic; acid :it'.Clllt'.tl~W eneOC1111L Sartt rlustridial toxin pulypeptidc than would be expressed by said bust rcll absent the introctuction ot~ said nucleic acid sequences. To allow ease ot~ puriticatiun ot~ toxin polvpeptides rroduccd in a bust cell it is preferred that the host cell express or overproduce said toxin polvpelUidc at a Icvel greater than I mg/litcr of bust cell culture.
"A host cell capable ut~ expressing a recombinant protein at a level greater than or equal to ~% of the total cellular protein" is a bust cell in which the recombinant protein represents at !cast ~% ot~ the total cellular protein. ~'o determine what pcrcenta~~c ui~ total cellular rrotcin the recombinant protein represents. the tbllowing steps are tal:cn. ;1 total ut IU ()I),,",~ units of recombinant host culls (e.,sr.. ?UU ttl of cells at ()f),,,H, :i()lrnlt arr removed ;~() tat a timcpoint known to represent the peal: of expression of the desired recombinant protein) to a I .> ml micrutye tube anti peileted for ? min at maximum rpm in a micrutirge. I'hc I?

WO ~ro~ PCTIUS97l15394 pellets are resuspended in 1 ml of ~4 mM NaFIPO~, 0.5 M NaCJ. 4U mM imidazole but'fer t pH 6.8) containing 1 mg/ml lysozyme. T'he samples are incubated for 20 min at room temperature and stored ON at -70°C. Samples are thawed completely at room temperature and sonicated ? X 1 U seconds with a I3ranson Sonifier 4~U microtip probe at #
; power s scttin~~. ~l~hc samples are centrifuged for ~ min. at maximum rpm in a microfuge. An aliquot ('?U Etl) ot'the protein sample is removed to ?0 Ell 2X sample buffer (this represents the total ' protein ewract). The samples are heated to 95°C for ~ min. then cooled and ~ or IU ttl are loaded onto I'?.~°.~, SDS-P.4G~ eels. Eli~~h molecular weight protein markers arc also loaded to allow for estimation of the MW of identified recombinant proteins. After electrophoresis.
I (1 protein is cletecte:d generally by staining with Coomassie blue and the stained ~~el is scanned using a cicnsitomcter to dc1 rmine the percentage of protein present in each hand. In this mannrr. the percentage of protein present in the band corresponding to the recombinant hrc~tcin of interest may he determined. It is not necessary that ('oomassie blue be employed fear the detection of protein. a number of fluorescent dues (e.,~'.. Svpro orange S-CGS 1 I s ( Molecular I'rohcs. L:u~:enc. URA may hc.~ employed and the stained gel scann ed using ~t Iluoruima~.:rr ~~-.<L'.. I~luor Inlager ~I (Molecular Dynamics. Sunnyvalc.
('A)~.
";1 host roll capable of cpressing a recombinant protein as a soluble protein at a level ~.:reatrr than cn- eclual m U.~s°,;~ of the total soluble cellular protein" is a host coil in which the alllt1t1l1I oi~ soluble rcconlhinant protein present represents at least U.?s°i~ of the total cellular ''() I,rotein. ;1:; used herein "total soluble cellular protein" refers to a clarified l'EI Ivsate prepared as described in Example 31(c)(iv). iiriefly. cells arc harvested tallowin~~ induction ol~ expna,ion of rccomhinant protein tat a point e>f maximal ~xprcssionf.
~I~i~r cells are resuspcnded in cell resusprnsion buf'tcr ((~Rf3: ~0 mM Nat'Ua. U.~ M Na(.'l. -l() mM
imidazole. pl i (i.8) to create a '_U% cell SIISpCnSIUl1 (wet weight of cellslvolumc of ('Rl'3) and cell Ivsatcs arc prepared as described in Example 31(c)(iv) (i.e.. sonication or h(1n10LC111ZatlOtl lullowud I,y centrifugation). The cell lysate is then flocculated utilizing polvethvleneimine ( I'E1 ) prior to centrifugation. I'l1 (u ?% solution in di-i,U. pH 7. > with I 1C11 is added to the cell Ivsate to a final concentration of U.?%. and stirred for ?t) min at room temperature prior m centrifugation lB.sUU rpm in .IAIt) rotor (E3eckmanl liar 3U minute:; at =i°('~. This treatment a) removes ItNA. DNA and cell wall components. resulting in a clarified. lom viscosity Ivsate ("I'l:l C'.I~il'ltllCl l~'SfIIV'). '1'hl l'l'lOnlh111at11 protein present in the I'll clarified lvsatr is then _ 13_ purified (c:.,~~., by chromatography on an 1DA column for his-ta~~ged proteins). The amount of purified recombinant protein (i.c~., the eluted protein) is divided by the concentration of protein present in the 1'L:I clarified lysate (typically A mgitnl when using a ?0%, cell suspension as the startinL material) and multiplied by I()() to determine what percentage of total soluhle cellular protein is comprised of the soluble recombinant protein (see t:xample ~:~n).
.~~s used herein. the term "fusion protein" refers to a chimeric protein containing the protein ol' interest (i.r.. ('. hnruiinum toxin A. I3. C. U. E. f~. or (i and fragments thereof) .joined to an eao~:enous protein trapment (the fusion partner which consists of a non-toxin 1() protein). The fusion partner may enhance sotuhilitv of the ('.
l~nrulir7un2 protein as expressed in a host roll. may provide an of"finite tae to allow purification of the recomhinant tuslon protein from the hoa cell or culture supernatant. or hoth. If desired. the fusion protein may 11~ 1'1111(1Vt'.~I fl'c)111 the: protein of" interest (i.e., toxin protein or fra~.!ments thereat') prior to immunization by a uarietv of enzymatic or chemical means known to the art.
I ~ ~~5 ll~(;it heCe111 the term "non-toxin protein" or "nun-toxin protein accluencc" refers t~
that portion of a i'usion protein which comprises a protein or protein seclucncr which is not derived from a bacterial toxin protein.
~I Itc term "protein oi' interest" as used herein refers to the protein ».hosc expression is desired within the fusion protein. In a tltsion protein the protein of interest will h c .joined or _'() fused with another protein or protein domain, the fusion partner. to allow tilt enhanced stability of the protein ol' interest andlor case of purification of the fusion protein.
:~a used herein. the term "maltose binding protein" refers m lhC 117:11t()Sl hI11d111L
protein of I:, urrli. I~ portion of the ntaltosc binding protein may he added to a protein of interest to ~_cneratc a fusion protein: a portion of the maltose hindin~
protein may merely enhance the solubility of the rcsultin~ fusion protein when expressed in a bacterial host. ()n the other hand. a portion of the maltose binding protein may allow affinity purification of the fusion protein on an amylase resin.
:~s used herein. the term "poly-histidine tract" when used in reference to a fusion protein refers to the presence oh' two to ten histidine residues at either lllr amino- or carhoxv-_~() terminus of a protein of interest. ;~ poly-histidine tract of six to ten residues is preferred.
The poly-histidinc tract is also defined functionally as bein~~ a number ol' consecutive histidine ' WO 98/Q$540 PCT/US97I1t5394 residues added to the protein of interest which allows the affinity purification of rite resulting fusion protein on a nickel-chelatc or IDA column.
:\s used herein. the term "purified" or "to purify" refers to the removal of contaminants from a sample. I~or example. antitoxins arc purified by removal of - 5 rc~ntaminating non-immunoglobulin proteins; they are also purified by the removal of immuna~.:lobulin that dues not bind toxin. The removal of nun-immunoglohulin proteins andlur the removal of immunoglohulins that do not bind toxin results in an increase in the percent ui~ toxin-reactive immunoglohulins in the sample. In another example.
recombinant twin polvpcptides arc expressed in bacterial host cells artd the toxin polvpeptides arc purif7ed I t) by flue removal of host cell proteins: the percent of recombinant twin polypeptides is thereby increased in the sample:. Additionally. the recombinant toxin polypeptides arc purified by the renewal ol' host cell components such as lipopolysaccharide (c-.,~~..
endotoxin).
f~l~r term "recombinant UNA molecule" as used herein refers to a UNA molecule which is e:ompriscd o1~ syments of DNA .joined together by means o1~
rnolccular hioloLical 1 > ICChI11c1liCS.
I Ite trim "recombinant protein" or "rccotnhinant polvpeptidc" as used herein refers to a proucin nwlecule which is expressed t~rom a recombinant I)N~\ molecule.
~Chc term "native protein" as used herein refers to a protein mhich is isolated from a natural ,ourcc us opposed to the production of a protein by recombinant rncans.
_'() :~, used herein the term "portion" when in reference tc~ a protein (as in "a portion ol~ a ~~iven hrcUCin") refers to fra~~mcnts csf that protein. The ti~a~~mrnts may range in sire from lour amino arid residues m the entire amino acid sequence minus one amino acid.
:\s used hrrcin "soluble" when in reference to a protein produced by recombinant I)NA tcchnolotty in a host tell is a protein which exists is solution in the cvtoplasnt of the host cell: if' the protein contains a signal sequence the soluble protein is exported to the lcriplasmic space in bacteria busts and is secreted into tits; culture medium in eucarvotic cells capable c~l~ secretion or by bacterial host Itossessing the appropriate genes (i.r.. the kil gene).
In contrast. an insoluble protein is one which exists in denatured form inside cvtoplasmic ~ranul~s tcalled inclusion bodies) in the host cell. l-Iigh level expression (i.r.. Lreater than lU-'() ?0 tt~~~ recombinant proteitt/liter of bacterial culture) of recombinant proteins often results in the expressed protein being found in inclusion bodies in the bacterial host cells. :\ soluble - IS -protean is a protein which is not found in an inclusion body inside the host cell or is found both in the cytoplasm and in inclusion bodies and in this case the protein may be present at high or low levels in the cytoplasm.
A distinction is drawn between a soluble protein (i.r.. a protein which when expressed in a host cell is produced in a sulubfe form) and a "soluhilized" protein. i\n insoluble recombinant protein found inside an inclusion body may he solubilized (i.o..
rendered into a soluhlu form) by treating purified inclusion bodies with denaturants such as guanidine hydrochloride, urea or sodium dodecvl sulfate (SUS). These denaturants must then be removed tram the suluhilioed protein preparation to allow the recovered protein to renature IU (refold). Nut all proteins will refold into an active conformation alter solubilization in a clenaturant and removal of the denaturant. Many proteins precipitate upon removal of the denaturant. BUS may be used to solubilize inclusion bodies and will maintain the proteins in solution at low concentration. liowever. dialysis will not always remove all ul~thc Sl)S ISUS
can form miceilcs which du not dialyze out); tltereforc. Sf)S-suluhilized inclusiim body 1 ~ protein is soluble hut not refolded.
;\ distinction is drawn between proteins which arc soluble ( i.r., dissolved) in a solution devoicf of~ SILItltICanI amounts of ionic detergents (c~.,y.. ~I)~) ur denaturants (c.,~~..
urea. guanidine hydrochloride) and proteins which exist as a suspension cal' insoluble protein molecules cfispcrscd within the solution. A soluble protein will not be removed from a ?U solution containitt~: the protein by ccntrifueation using conditions sufficient to remove bacteria present in a liduid nledtUltl (i.c~., ccntrifutation at I'_'.U()U x ~; for ~-s minutes). for example.
m test whether uvo proteins, protein ~1 and protein L3. F12'e 1l)111171e II1 1()llltt(111, the Uvo proteins arc placed into a solution selceied From the group cunstsnn L uI~ I'EW-Na('I
(1'135 cuntainin=
().i M NaC~I). I'BS-NaC'1 containing U.'?'% 'I'ween ?0. I'f3S. 1'RS captaining U.?°/~ Twcen ?U.
PBS-C' (PISS containing ? mM (.'aC.'I,). PBS-C' containing either U.1 or U.s °/. Twecn ?U. PBS-C' containing either U.1 or 0.~% NP-40. PBS-('. cuntainine either U.I or ().~°ro Triton X-IUU.
Pf3S-C' containing U.I°~o sodium deoxvcholate. 'Che mixture containing proteins :1 and (3 is then centril~us~ed at ~OOO x L for ~ minutes. ~I~hc supernatant and pellet li~rmed by ccntrifugatiun arc then assayed for the presence of protein ~\ and 13. 1I~
protein A is found in 30 the supernatant and not in the pellet (except for minor amounts (r.r.. leas than lU°/,) as a result of trapping]. protein is said to he soluble in the; solution tested. 1f the majority ul' - IO -protein I3 is found in the pellet (i.r.. greater than 90%). then protein B is said to exist as a suspension in the solution tested.
As used herein. tire term "therapeutic amount" refers to that amount of antitoxin rccluired to neutralize the pathologic effects of one ur more clostridia) toxins in a subject.
~I'hc term "pyrugcn" as used herein refers to a fever-producin~~ substance.
I'yrogena now he endogenous to the host (c~.y., prostaglandins) clr may he exogenous compounds (~.~~., bacterial endcl- and exutuxins. nonbacterial CO(rtpOt.lndS SlrCh aS
alttl!'ellS and certain steroid compounds. ctc. ). The presence of pyrueen in a pharmaceutical solution may he detected 1IS11tL the ('.S. I'harmacopeia (IJSP) rabbit fever test (United States Pharmacopeia. Vul. XXIt iU (Ic)c)()) l.!nitccl States Pltarmacupeial C.'onvention. Rucl:villc. MD, p.
151).
fhe term "cndutuxin" as used herein refers to the hi~it nu>lecular wci~ht complexes assoeiamt with the: outer memhrartc of ~~ram-negative bacteria. l!npuriticd endutoxin contains lipieta. proteins and carhultvdrates. l~liehly purified endutoxin dues nut contain protein and is rctcrrcd m as lipupulvsaccharidr (1_I'~). fieeause unpuriti~d endutoxin is of concern in the I s production u1~ pharmaceutical compounds (c-.y., proteins produced in E.
cwli using recombinant I)W tcchncllu~~vl, the tcrrn cndutoxin awsed herein refers to unpurified endcttuxin. E3acterial mdutwin is a well knwvn pyrugen.
~1s used hrrein. the term "endutuxin-free" when used in reference to a cumpusrtlon to he administered parcntcrallv (with the exception of intrathecal administration) to a host means that the cios~ to he delivered contains less than ~ F:l)/l:g body wei~;ltt (I=DA (iuidclincs filr I'urcnmral 1)ru;~s ( l)ccemhcr I ~)H7)j. ;~ssutning a weight of 7U kg tier an adult human. the d<lsc must cclntain Irss than s~U I:L~ to rncet FDA Guidelines tar parcnter~tl administration.
f:ndutwin levels are measured herein using the I.imulus Amchocvtc Lvsatc (L.nl.) test tl.imulus Antchucytc f..ysate I'vruchrumel". Associates ctf'C.'apc C'c>d. lne.
w-uuds Ilule. ~1~1).
~I~u measure endotoxin levels in preparations of recombinant proteins. 0.~ ml elf a sulUtlull cctlnprisin~~ U.s mg of purified recombinant protein in ~0 mM Nal'(),, pIi 7.U. U. iM MaC.'I and 1 ()~/~ glycerol is used in the 1.,~1L assay according to the manufacturer's instructions for the l;lldp()Iltt Cltl'111110~~Lnlc ~IIIhUUt diazo-coupling method (lhC SpeCltlC
(:(tmp(711entS llf the huff'er cclntainin~~ recombinant protein to be anafvzed in the L./1L. test arc not important: any huftcr 3U havin~~ a neutral pII may he employed (see for example. alternative buffers cmptuved in I:;xamples 3~. .lU and ~4s)~. C'umpusitiuns containing less than or cdual trl than ~s0 endutuxin _ 17_ units (EU)Img of purit7ed recombinant protein are herein detined as "substantially endotoxin-t~ree." Pret~erably the composition contains less than or equal to 100. and most preferably Less than i7r edual to (~0. (IU)/mg of purified recombinant protein. Typically, administration of bacterial toxins or toxoids to adult humans for the purpose ut' vaccination involves doses ot~
about 10-i()0 tlg protein/dose, ~fherefore, administration of 10-i00 ttg of a purified rcconthinant prc7tein to a 70 kL human. \vherein said purified recombinant protein preparation contains (70 f:U/ntg protein. results in the introduction ol'on)v 0.6 to >() (:I) (i.e.. 0.? tc7 8.6'%
oi~ the maximum allt,wahle endotoxin burden per parenteral dose).
Administration ot~ 10-50() try e71~ a purified recombinant protein tc7 a 70 k~ )roman. \vhcrein said purified rccomhinant protein preparation contains ?~0 ~U/m~ protein. results in the introduction of only ?.~ tc, 125 f:U (i.r., ().7 te7 3(,°/, c,h the maximum allowable endot«xin burden per parenteral dose).
~fhe 1.:11_. test is acceptecl by the ll.S. FI)A as a means c7t detecting bacterial mtdotcwins (?I ('.I~.R. s' (7(,0.1U(i -IOS). Studies have shc7\wt that the LI\I. test is equivalent c7r superic7r w the 111' rabbit pvru~~en test for the detection c,fendotoxin and thus the l.nl.
test can horsed as a surrogate for pyro~enicity studies in animals ~(~.C'.
('erason. l')rcys,~c~)a.,':
''l7CI'11f7.1'lll.1'. L. (!. lr.clnr,s,~ cute./ lIC'f74'I'(),tt'liull')11.
Marvel l.)ekkcr. ~etv 1''7rk I I ')8~ ). pp. 1 s0-l i~ (.
I~hc IU):1 l3urcau c,t' Biologics accepts the LAL assay in place '7f the ( !~(' rabbit pyr'7t:en test sc7 lost,.: as the L_~1I_ assay utilized is shown to be as sensitive as. e7r ntt7re sensitive as the rabbit mst ~l~rd. Rr~.. _,~. ?hl.i() ( It)8())~.
'() I~hc term "me7novalent" when used in reference tc, a clostridiul vaccine r~f~ers t<7 a vacclltc which is capable ol~ prc7vokin~~ an in tmtlne response in a ht,st animal directed atainst a 1111'~ll' I\'hl' lll~ t'.ll7Slrlttlal tt7x111. 1 t,l' CxaInDIC_ 1t' Itl,n,nnilalimo ml a lt.mr v. nh W 1..,...~:._.....
l1-l,l /~ l'7xilt \'aeCllle 111dUeeS Ltltllhl7dleS )n the 1111 n1t1I11Zed Itt)St \\'hlClt prt7leCl .I;~alnSl It chailt:n_.:e with type n tt7xin but not against challenge with ype f3. C'. U, t:. I~ or (i toxins.
then the ype n vaccine is said to he monovalent. In contrast, a "multivalent"
vaccine provokes an immune response in a host animal directed against several (i.r..
more than c7nc) clostridiai toxins. Fc7r example, ii' immunization c7t' a host with a vaccine comprisinL ('.
hnnrti)ltll)r ype ~1 and E3 toxins induces the production of antibodies which protect the low against a challenge with both type .~1 and f3 toxin, the vaccine is said to he multivalent ( i1t ~(> particular. this hypothetical vaccine is bivalent).
-18_ :~s used herein the term "immunogenically-effective amount" refers to that amount of an immunogen required to invoke the production of protective levels of antibodies in a host upon vaccination.
fhe term "protective level". when used in reference to the level 01~
antibodies induced ' s upon immunization of the frost with an immunogen which comprises a bacterial toxin. means a level of circulating antibodies sufficient to protect the frost i~rom challenge with a lethal dose c,i~ the mvin.
:1a used herein the terms "protein" and "polypcptide" refer to compounds cumprisin~~
amino acids .joined via peptide bonds and are used interchangcablv.
The terms "toxin" and "neurotoxin" when used in reference to toxins produced by members (i.c~.. species and strains) of the genus ('lu.crniclirrm arc used interchangeably and refer t<, the proteins which arc poisonous to nerve tissue.
1'hc mrtn "receptor-binding domain" witch used in reference to a ('.
hrurrlittarm toxin rcirrs m the carhoxv-terminal portion of the heam~ chant (11, or the (' fragment) uf' the twin 1 ~ which is prcsumcci to he responsible for the binding of the active toxin (i.c-.. the derivative tcwin comprisinz the Ci alld 1. chains joined via disulfide hands) to receptors un the surface ul~
avnaptosumcs. 'The inceptor-hindin~ domain for ('. hnrrriirtrrm type A toxin IS tlt'tllted ltt.'Celll as mmprisin'~ amino acid residues 8(,I through 1?c)G of SC~;Q II) N():'_'8.
~f~he rccept«r_ hindin'; Humain for ('. hruulinnnr ype 13 toxin is defined herein as comprising amino acid ?0 residues t;-C!i tltrou~~h 1?91 uf~ SE:Q 1I) N0:40 (strain Eklund 17(31.
'I~hc rrccptor-binding Cll,lttattt t,p ('. I)lJrtlll77rllrl mpc C'I toxin is defined herein as comprisin_~ amino acid residues t(>O thruu'.:h l~~)1 ul~ SC:(? lU N():(~0. -l~ltc receptor-binding domain of' (' hrurrlirurnrmpe C) toxin is delin cd lterCllt as comprising amino acid residues 8s? through 1?7G
oi' ~L:(~ II) N():W,. ~I-hc receptor-binding domain of ('. huurlimna type (toxin is defined herein as cumprisinu amino acid residues 8;5 through I?5(> of ~C:(,) IU NO:~() (E3eluga strain). '('hr receptor-binding domain of ('. hmrrlW arm type F toxin is defined herein as comprisinC= amino acid residues 8i3 through 1?7~ of SEQ ID N0:71. 'hhe receptor-binding domain of t'.
lunrrlirrrrru type (i toxin is defined herein as cuntprisin~ amino acid residues 8ss tltrou~_h 1?97 u1' Sf:Q IC) N():77. Within a ~~ivrn scrotype, small variations in the primary amino acid s0 seduencc ol' the hutulinal toxins isolated from different Slt'altts has been reported [Whelan c~r crl. ( f ~~)2). .srrhrcr and Minton ( l9c)5) Curr. 'Cop. Microhiol. Immunol.
195:161-194). 7hc present invention cuntcmplatcs fusion proteins comprisin~_ the receptor-hindin L domain of C'.
hunrlinum toxins from serutypes A-(i including the variants teund among different strains within a ~~iven scrotvpc. ~1'he receptor-binding domains listed above arc used as the prototype tar each strain within a scrotype. Fusion proteins containing an analogous retion trom a strain mher than the prototype strain are encompassed by the present invention.
Ivsion proteins comprising the receptor binding domain li.c~.. C' fl~arment) of botulinal toxins may include amino acid residues located hevonct the termini ui' the domains defined ahom. Ivr example. the pHisBotf~ protein contains amino acid residues 84h-I?c)1 0l' SE;Q ID
It) .'~l<):~i(): this fusion protein thus comprises the receptor-hindin~
domain !or ('. hruulinrrrrr type f toxin as detincct above li.r.. Ilc-8~8 through (ilu-1?c)I ). ~imilarlv.
pHisE3otL contains amino acid residues X27-I?~? 01' SL:Q 1D N():5() and pllisl3ot(i contains amino acid residues tSS l - l ~r)7 U~ S(:(~ lI) N():77. l~itus. both rHisliotl= and pf-f isf~oU(i fusion proteins contain a Icw amino acids located beyond the N-terminus of the defined receptor-hiu~iin~
domain.
Che terms "native rcnc" or "native gene seyucnces" arc usc;ct tn indicate 1)NA
vellU~lltt.'v ~I1C(1(I111L a particular gene svltich contain the same DNA
seyucnccs as fisund in the ~_cne as isolated Cram nature. In contrast. "synthetic scene scducnccs" arc I)NA aeyuenccs which armscd to replace: the naturally occurring DNA seclucnccs vhcn the naturalf uceurrin~~ sedurnccs cause expression problems iv a given host cell. Ior example. naturallv_ -'(l occurrin~_ DNA seyurnces encoding codons which arc rarclv used in a host cell may he replaced to ~.. by site-directed mutagcncsist such that the synthetic I)NA
seeluencc rrpresents a more i~rec)ucntlv used cotton. ~I~l~c native DNA sequence and the wnthctic I)N;1 sequence will pr~t'rrablv encode the salnc amino acid seclttcncc.
~UMMAItY OF THE 1NVCNTIUN
'l~he present invention relates to the production of polypeptides derived Irom toxins particularly in recombinant host cells. In one embodiment. the present invention pro4~ictes a host cell containing a recombinant expression vector. said vector cncodin~; a protein comprising at least a portion of a ('Io.slricliunr hcrrulirurm toxin, said toxin selected from the ~~roup consisting of mpe f3 toxin and type F toxin. ~I~ht prCSttlt ttll'ellllt)11 15 11l)I limited by the nature of W1~11e11Cf:v CnCOdIIIL portions of the ('. hrrrrrlirrrrrn toxin.
These scduenccs may he WO 98J~540 PCTNS97115394 derived from the native gene sequences or alternatively they may comprise synthetic gene sequences. Synthetic scene sequences are employed when expression of the native gene sequences is problematic in a given host cell (c~.,~~., when the native gene sequences contain sequences resembling yeast transcription termination signals and the desired host cell is a yeast eel I ).
In one embodiment. the lust cell is capable ol' expressin L the recombinant C'.
' hrnulirrrurl toxin protein at a level greater than or equal to ?% to 40% of the total cellular protein and preferably at a level greater than or equal to ~% of the total cellular protein. In another embodiment, tire host cell is capable of expressly the recombinant ('.
hourlumrn I U toxin protein as a soluble protein at a level greater than or equal to 0.25% of the total cellular protein and prclcrahlv at a lccl greater than or equal to ().~~% t~
10°/. of the total cellular IroUcW.
~fhc present invention is not limited by the nature of the host cell employed for the prootuction ut recombinant ('. lmlrrliruuu toxin proteins. In a preferred embodiment. the host I ~ cell is an I: ewli cell. In another preferred embodiment. the host cell is an insect cell:
particularly preferred insect bust cells arc ,5jrnclulrcmor ~rtryilmrclcr (Stt)) cells. In another preferred embodiment. the host cell is a yeast cell: particularly preferred yeast cells arc I'irhicr pu.~lnrl.c cells.
In dumber elllb(ldlltletlt. the invention provides a bust cell cuntainini a 1'ecUll7hlllallt ?1> mpressiun vcctcir. said vector encoding a fusion protein comprisinL a turn-toxin protein sequence and at Fast a portion of a ('ln.clricliunr hnurlilnrnr toxin. said toxin selected from the ;~ruup consisting c>I' type 13 twin and type ~ toxin. 'fhe invention is not limited by the nature al' the pe,rtiun c~l~ the ('lrr.slriclirrnr hmrrlilurln toxin selected. In a preferred embodiment, the portion ol~ the toxin comprises the receptor binding domain (i.e.. the C' l'ragmcnt of the toxin).
The pl'eSl',Ill invention is not limited by the nature of the non-toxin protein sequence employed. In a preferred embodiment. tl7e 11UI1-toxttl prt)ICIII SequCllee c(1111pr1Se1 a poly histidinc tract. .1 number of alternative fusion tans or fu siun partners are known to the art (c-.,y.. l~llil'. (i~T, protein A. ere.) and may be employed for the production of fusion proteins comprisin~_ a portion of a hotulinal toxin.
_21-gyp yg~p PCT/US97115394 The present invention further provides a vaccine comprising a fusion protein, said fusion protein comprising a non-toxin protein sequence and at (cast a portion of a ('lo.cwiclium hr~rrrlinerm toxin. said toxin selected from the group consisting of type B
toxin and type h.
toxin. The vaccine tray be a monovalent vaccine (i.e-., containing only a toxin R fusion protein or a toxin E fusion protein). a bivalent vaccine li.c~.. containing bath a toxin B fusion protein and a toxin E titsion protein) or a trivalent or higher valenev vaccine. In a preferred C;Illh()dllllt:llt. the toxin R fusion protein and/or toxin t: fusion prolellT
IS l:Otl1h111ed with a t~usictn protein comprising a non-toxin protein sequence and at Icast a portion of ('Ims~niclium hrurrlinrrm type A toxin. 'hhe present invention is not limited by the nature of the portion of 1() the ('lo.s~riclirrrn hnrrrlirrann toxin selected. In a preferred embodiment. the portion of the toxin comprises the receptor binding domain (i.e.. the C' fragment of the toxin).
The present invention is not limited by the nature of the non-toxin protein sequence employed. In a preferred embodiment. thc.~ non-toxin protein sccluence comprises a poly-histidine tract. :1 numh~r of~ alternative fusion tags or fusion partners are known to the art (c.
~.. t\-fI3I'. (W'I'.
1 ~ protein ;~. ctc. ) and may he employed fur the generation of fusion proteins comprising vaccines. When a fusion partner ti.r.. the non-toxin protein seclucncel is entploved fc>r the production of a recombinant ('. hmurlinul toxin protein, the fusion partner may he removed from the recombinant ('. hrurrlinul toxin protein ifdcsired (i.~-.. prior to administration ol'the protein to a subject) using a variety of methods known to the art (c~.~..
digestion of fusion :?() proteins containing Ivactor\a or thrombin recognition sites with the appropriate cnzvmef. ~~
numh~r of the pI;THis vectors employed herein provide an N-terminal his-ta~~
ti~ll<wed by a fveteuva c:lcava~~c site tree >rxample ?8a): the hotulinal C' I'ragmcnt secluencrs li~llow the I~aetorXa site anct thus. IvactorXa can be used to remove the his-tai from the hotttlinal fusion protein. In a preferred embodiment. the vaccine is suhstantialU cndotoxin-f~re~.
he present invention is not limited by the method employed t'~r the generation of vaccine comprising fusion proteins comprising a non-toxin protein sequence and at least a portion of a ('lo.~nricliurn hn~rrlimnnr te~xin. Tlte fusion proteins may be produced by recombinant I)NA means usinL either native or synthetic Lone s~yuenccs expressed in a mast cell. ~I'hc present invention is not limited to the production of vaccines urine recornhinant .i(1 host cells: cell free in airrn transcriptionitranslation systems may hr employed for the -WO 98108540 PCTIIJS971ti5394 expression of the nucleic acid constructs encodin~e the fusion proteins of the present invention.
An example of such a cell-free system is the commercially available 'I'nTT'"
Coupled Itcticuluwne Lysate System (I'romega Corporation. Madison. WI). Alternatively, the fusion proteins of the present im~ention may he ~~enerated by synthetic means (i.e., peptide J S1'11111~S1S1.
l~he prcaent invention Further provides a method ui' generatirt~~ antibody directed ' .y~ainst a ('lu.crriclium It()IlllirlrrJlJ toxin comprising: a) providing in any order: i) an antigen (;(trltpl'ISlItS'_ a tirSlOtt protein COrnprISlrtg a non-toxin prOtelll Sl'ClllCnCe and at least a p(trll(trt CtF
a ( 'lrr.vrriclirrrrr hnnrlinrrnr twin, said twin selected from the group consisting ol' W_ pe 13 toxin ltt and yp~ L; toxin. and ii) a host: and b) immunizing the host with the antigen so as to ~.:cneratc an antibody. In a preferred elllb(tdllnent. Lh(; anll!~t'.rt used t(1 tltttllurtl'!.e the host also l()Il(11115 ce tirsiun protein comprisin~~ a non-toxin protein sequence and at frost a portion of ( 'lu.wriciirrrrr hrrlrrlrrrrrm type ;.\ toxin. I~hc present invention is not lintited by the nature of the portimt e~l~ the ('lr~.nriclirrm hmurlinrrrrr toxin selected. In a preterred embodiment. the portion I ~ al~ the toxin comprises the receptor binding domain (i.c~.. the C' fra,~ntent of the toxin). 'I~he prcsrnt invention is not limimd by the nature of the non-toxin protein sequence employed. In a preferred embodiment, tlm nets-toxin protein sequence comprises a poly-histidinc tract. ~1 number ol~ alternative Fusion tags or fusion partners arc known to the art (e.,L.. MI~P. CJST.
Itrotcin ~\. mc.l :utd may he employed for the generation uF Fusion proteins comprising '_(1 vaccines. \\~hen a I~usian partner (i.u.. the non-toxin protein sequence) is employed tits the production of a recombinant (' hrtrrrlincr! toxin protein. the fusion partner may ht removed I~1'cfltt lltt.' r'et;llrtlhlllaltt ('. hurrrlirnrl toxin protein iF desired (i.c~.. prior to administration ot~ the protein m a suhjectt using a variety of methods known to the art Ir.,~~..
digestion uF Fusion proteins rontainin~~ I=actor\a or thronthin recognition sites with the appropriate enzyme).
The present invention is nut limited by the nature of the host employed for the production of the antibodies of the invention. In a preferred embodiment. the host is a ntan tmal. preferably a human. Tlte antibodies of the present invention may he generated using nurt-mammalian hosts such as birds, preferably chickens. In a preferred embodiment thmtcth<t~t of the present invention Further comprised the step r1 uF
cullectin~_ thr antibodies - 7j -WO 981540 PCTNS9'7l15394 from the host. In vet another embodiment, the method of the present invention further comprises the step d1 of purifying the antibodies.
'fhe present invention further provides antibodies raised according to rite above methods.
~t~he present invention further contemplates multivalent vaccines comprising at Ieast avu recombinant ('. hnrrrlinrura toxin proteins derived from the Lroup consisting of C'.
hurrrli»rnrr serotypes i\. I3. C. D. E. I:. and (i. 'hhe invention contemplates bivalent. trivaient, yuadravalent. pmtavalent. ltcptavalent and septivalent vaccines comprising recombinant ( '.
I7I)llllrllrll7l t()xlll proteins. I'referuhlv the recombinant ('. hu»rlinrrnr twin protein comprises I() the receptor binding domain (i.e.. C' twagment) of the toxin.
DFSCItIPTIUN OF Ttl<F INVENTION
~Chc present invention contemplates vaccinating humans anti other animals with putypcptidcs derived from ('. by»rlinunr neurotoxins which arc suhstantiallv cndutuxin-free.
1 ~ T~h~sc hoaulinal peptides are also useful for the production of~
antit<win. :\nti-hcriulinal toxin antitoxin is awful tier the treatment of patients ei'fected by or at risk of svntptoms due to the action ol' (' h»»rlirnrrn toxins. The organisms, toxins and individual steps of the present invcnticm arc described scparatrlv h~lmv.
?0 1. ~.7os~rirlimn 5pecics, ClOStridial Diseases And AssOCiatcd Toxins .~\ preferred embodiment ol' the method of the present invention is directed twvard olUainin~~ alihucii~s a~_ainst ('In.vrriclirmr species. their toxins. rnrvmes car oeh~r metabolic hv_ products. cell wall components. ur svnthctic or recombinant versions of anv of~ these compounds. It is contemplated that these antibodies will he produced by immunization ui' ?s humans ur other animals. It is not intended that the present invention h~
limited to anv particular twin or any species of organism. In one embodiment. tclxins from all ('lr~.,vriclirrnr species arc contemplated as immunugens. L;xamples c~l~ these I(1XII1S
IItCItlde llte Itt.'uCa1111111daSC.' toxin oi~ ('. htrlt~ricurm. ('. .vorclellii toxins HIT and I.~I~. toxins I\.
13. (.'. I). I. I~. and (i of ('.
horrrlinrrm and the numerous ('. p~r/rin,L~en.v toxins. In one prelerrcd emheldlment. toxins f\.

*rB

I3. and F ol' C'. haurlirJlJm are contemplated as immunogens. Table ? above lists various ('in.cn'iclilJnl species. their toxins and some antigens associated 4vith disease.
TABLE ?
('lostridial Tnrirw Oreanisnt Toxins and Disease-Associated Antigens ('. hrrlrflMlnll A. B. C,. C,, D. G. F. Ci C'. hllll'I'IC'fflll Nmraminidase .4. B. C-.nterotoxin Inot A nor B), M~tilitv Alterin~~ Factor, Lour A4olecular Wcir_ht 'toxin. Others ( '. pc'I'jl'llT,~'cI),v(x. (3. E. I. %. 0. v. (~. It. )., rt.
ll 1() t:'. .wrclc~llr ( ' j/crnu'Ifluus tlT, l.T. (x. (i, y ( ~. !lrnav u, lf, y. ~i. (:. .r,. \'. () (' W /lllt'lflll C.(. 13. '!, tl (' hr.crmlvlictnu a. (1. '!. r5. E plus additional cnz\'ntcs ( c hrrurrmn (x. (j. ~. 6 It is tun intended that antibodies produced against (me t(txin \viil only he used against that toxin. !t is c(tntemplamd that antihoclics directed against one toxin (e'.,>,r.. ('. I)rrJl'ills,'C'17.1 wpc /1 enteremxiny my hr used as an effective therapeutic against one (tr more toxin(sy ?U hr(tduc:ed by (tther members ed' the genus C'hl.sJriclium or other toxin produeinL organisms (('. ~ . I3WL~illJl.v LO'rLU.c. .~'IcrJ)h1'InWnc~LUr.c lnn'etl.v.
.~'Jre/)JC)curcul.v 11111IC111.1'. .'iC'lIlC'If)I)C!L'Jc'1' L'CIIL'tIllC'L'11L'll.l', h.l'L'lJlllJJ11ll111f.1' C1L'1'llt,'llJll.l'll.
(1t11Cf I1.1'L'11Lh1111111J11.1' Sl7eClt.'S. ete.), !t 15 further c(tntemplatcLl that antibodies dirccteLi a;~ainst the portion eh~ the train which hinds to mammalian membranes tc'.,t.. ('. I)CI'~1'll'lf,'L1T.5' enterotoxin A1 ran also hr used a,.!ainst (uhcr organisms. It is contemplated that these membrane binding domains are produced synthrtically and used as immunoLens.
11. ()htainin~ Antibodies In Nnn-Mammals ~1 prclcrmd embodiment oh' the method of the present invention litr ohtainine antihc,dirs invot'vcs immunization. However, it is also contemplated that antihudies'could he obtained from non-mammals without immunization. !n the case where nu immunisation is WO 98/08640 PCTlUS97I15394 contemplated. the present invention may use non-mammals with preexisting antibodies to toxins as well as non-mammals that have antibodies to whole orLanisms by virtue of reactions with the administered antigen. An example of the latter involves immunization with svllLhcllc peptides car recombinant proteins sharing epitopes with whole or~_anism components.
s In a preferred embodiment. the method of the present invention contemplates immunizing nun-mammals with bacterial toxin(s). It is nut intended that the present invention he limited to any particular toxin. In one embodiment, toxin ti~orn all clustridial bacteria sources I.ve~r Table ?) arc contemplated as immunoLens. I;xatz~ples eh'these toxins are C'.
hrr~Iricunu neuraminidase toxin, toxlllS A. f3. ('. O. I. F. and (i from ( '.
hrrrn!i»rr»r .
('. yc~rJrirr,L~cn.s toxins cx. Vii. F, and t. and ('. .svrclellii toxins lIT
and l..T. In a preferred elllhuC11171t:nt. ('. hwrrlinum toxins A. 13. C'. D. C. and F lur ti~agmcnts thercutl are l()nteltlplated as immunogcns.
:1 particularly prelerrcd embodiment involves the use of~ bacterial toxin protein or t'ras~mcnts e,l' toxin proteins produced by molecular biological means l i r..
recombinant toxin l ~ proteins). In a preferred embodiment. the immunuLen comprises the receptor-hindin~ domain li.c.. the ~ ~() kt) carhoxv-terminal portion of the heavy chain: al,e~
relerrcd m as the C' I'ragmcnt> ul~ ('. hnmli»ur» seroypc A neurutoxin produced by recombinant I)N:1 technology.
In another preferred embodiment. the immunugcn comprises the reccptclr-hindin~_ domain oi' ('. hurrrli»rr»r scrotvpe li neurotoxin produced by recombinant I)N:1 tcchnulu;_v. In vet _'() another preferred embodiment. the imlnunogcn comprises the receptor-binding domain reLion of l '. hrrrrrli»rrm serotypr F neurotuxin produced by recombinant DNA
technoluw. I n vet another prclcrrrd embodiment, the immunugen comprises tltr receptor-hinclin~~
doniailv re';iun ul' l '. hmtrli»rr»r serotvpe C' l ncurotoxin produced by Ceculllhlllalll I)NA
trchnolu~~v. In mt another prcterred embodiment. the imlnunogen comprises the receptor-binding domain region of ('. hnrrrli»r»» serotype C? n curutuxin produced by recombinant UNA
tcChll(llu~=v. In yet another preferred embodiment. the immunogen comprises the receptor-hindinp domain region 01' C'. hnrrrlirnr»I serotvpc D neurotuxin produced by recombinant DNA
technology. In vet another preferred embodiment. the immunuten comprises the receptor-binding domain region ul'('. hmrrlinrrrrr serotvpe F neurutoxin produced by recombinant f)NA
tecinu~ley. In vet :>0 another preferred Clllhodllllellt. the Inlnlull(lLen e(lnlprISeS th v receptor-binding domain region of ('. hrrrnli»tr»r serotypc (J neurutoxin produced by 1'eel)111h111a11t I)NA
technology. In a preferrccl embodiment, the recombinant botulinal toxin proteins arc expressed as fusion proteins (o.,~~.. as histidine-rayed proteins). In a still further preferred embodiment, the -2b-~rp gg~p PCT/US97115394 immurio~~en is a tnultivalent vaccine comprising the receptor-binding domain region of (.'.
hnrcrlinunt toxin ti-om two or more toxins selected from the group consisting of type A, type 13. type C f includinL C' 1 and C?), ype U. type E, and type F toxin.
When immunization is used. the preferred non-mammal is li~om the class .9w.s.
All birds are contemplated (r.,~~., duck, ostrich. emu. turkey. etc.). A preferred bird is a chicken.
Importantly. chicken antibody does not fix mammalian completnent. [.Seer H.N.
Brnson er crl., ' .I. 111111111111)I. 87:616 ( I ~)( 1 ).] Thus. chicken antibody will normally not cause a contplemcnt-dependent reaction. (A.A. I3enedici and K. Yamaea. "Imnrrmns,~lnhulin.~~ crncl ~lruihvcln I'I'l)ClllC'lll)1T !I) :Jvicrn .Sj~e~cie.c." ht ('lllJtfllrr'lllrl'C' lnamtrnrrlu,~w (.I..I. Marehaloni. ed.), pp. ;s5-i() s7s. 131ackwell. (hford (lc)66).] Thus. the preferred antitoxins of the present invention will nc» cxhihit complement-related side effects ohserved with antitoxins known presently.
Vl'hrn hinds arc used. it is contemplated that the antibody will be uhtaincd from either the hind scrum ur the e~:~;. :1 preferred embodiment involves c;ollcctiw~ of the antibody from the c~~'~. I.ayin~_ hens transport immunoglohulin to the e~~~ walk ( "IcY") in concentrations 1 ~ cclual m or cxceedin~ that found in scrum. (.S'c~c~ R. f'atterson et crl..
.1. Immunol. 89:27?
t 19h'?): and 1.f3. C'arroll and I3.U. Stollar. J. I3ioi. Chem. ?~8:?~t (198s).J In addition, the lar~.:r w~lume of~ e~~~: yolk produced vastly exceeds the volume of scrum thcu can hr safely ohtaincd from tire hirer own any given time period. Finally. the antibody li~orn e~~s~s is purer and metre iumwpeneous: there is far IeSS n(ln-11T1t11UIlOLIUhUl111 proorin (as compared to scrum) ?() anti only cme class of immunoglobulin is transported to the yolk.
V~hcn ce,nsicferin~~ immunization with toxins. one may consider modification ol' the main, m reduce the toxicity. In this re~~ard, it is not intruded that the present invention hr limited by immunization with modified toxin. Unmodified t"native"~ toxin is ;,I~~, contctnplatcd as an itomuno~_en.
It is also non intended that the present invention be limited by the type of modification -- if' nu~ditication is used. The present invention contemplates all types of toxin modification.
includin~~ chemicut and heat treatment of the toxin. The preferred modification. however, is lormaldehvdc; treatment.
It is not intended that the present invention he limited to a particular made of ;(f immunization: the present invention contemplates all modes uf' immuniz.~lti~n. including suhcutan coos. intramuscular. intraperitoneal. and intravenous or intravasculur in .jcctic»1. tts well as pr «., administration of immunogen.
7_ ~rp gg/~p PCT/US97115394 ~1'he present invention further contemplates immunization with or without adjuvant.
(Adjuvant is defined as a substance known to increase the immune response to other antigens when administered with other antigens.) If adjuvant is used. it is not intended that the present invention be limited to any particular type of adjuvant -- or that the same ad.juvant. once used.
he used all the time. While the present invention contemplates all types ot~
adjuvant. whether used Stparalelv (lr In C()n1b111at1U11S. the preferred use ot~ adjuvant is IIIe tlsc Ot~ Complete Freund's .~ld_juvant followed sometime later with Incomplete l~reund's Adjuvant. Another preferred use of ad_juvant is the use of Gerbu Adjuvant. -The invention also contemplates the use ul' RIBI fowl adjuvant and (:~uil A adjuvani.
I() When immunization is used. the present invention contemplates a wide variety ot~
immtu~ization schedules. In one embodiment. a chicken is administered toxin(y on day zero and suhscducntlv receives toxin(sl in intervals thereafter. It is not intended that the present invention he limited by the particular intervals or doses. similarly. it is not intended that the presrnt invention he limited to any particular schedule t«r collecting antihocd. ~i'he preferred 1 s collection time is sometime after day 1 UU.
V4'hcrc hirds arc used and collection of antibody is performed by collcctlng r~~~~S. the C:L~!S 117aV' he: stored prior to processing tW antibody. It is preferred that eggs he stored at 4°C
ter Iess than one near.
It is contemplated that chicken antibody produced in this manner can hr huftcr-:'_U cstractcd and used analytically. While unpurified. this preparation can serve as a rcf~erencc t'or activiy of the antibody prior to t~urther manipulations (c.,~..
immtanoaftinitv purification).
tll. Incrcusin~ The Effectiveness ()f Antibodies WhCl1 plIrItIC:AtIOII IS LISI'.d. the present invention contemplates purit'yin~~ to increase the .'.5 effectiveness ui~ hoth non-mammalian antitoxins and mammalian antitoxins.
Specifically. the present Invention contemplates increasing the percent of twin-reactive immunylubulin. ~l~hc prelcrrcd purification approach ii~r avian antibody is polyethylene glycol (Pi::(i) wparatiun.
I'he present invention contemplates that avian antibody he initially purified using SlI11p1C. 111~~Cpf:IISIVt', procedures. In one embodiment. chicken antihodv t'rom rigs is purified ;tl by extraction and precipitation with PEG. PECi purification exploits the differential sutuhilitv ut' lipids (witiclt are abundant in ep.~ yolks) and yolk proteins in high concctZtrations of i'l:(i 8U()t). ~1'IIIS(111 NI ul.. lmmunol. Cotnm. 9:495 ( 1 c)8(1). J ~I'hc technique is rapid. simple. and relatively inexpensive and yields an immunoplohulin fraction that is si~:niticantlv purer in _~g_ terms of contaminating non-imrnunogfobulin proteins than the comparable ammonium sulfate t'ractions c,t' mammalian sera and horse antibodies. The majority of the PEG
is removed tiom the precipitated chicken immunoglobulin by treatment with ethanol. Indeed, PEG-purified antibody is sufficiently pure that the present invention contemplates the use of PEG-purified antitoxins in the passive immunization vi' intoxicated humans and animals.
1 V. '1'rc~tment ~I~Itc present invention contemplates antitoxin therapy for humans and other animals intoxicated by bacterial toxins. a\ preferred method of treaunent is by intravenous l l) administration oh anti-houtlinal antitoxin: oral administration is also contemplated tier other cic>stridial antitoxins.
.A. Dosa~c of Antitoxin It was nc,ted by way of hack~:round that a balance trust he struck N'11111 adn1t11t5tC1'111~~T, ! > mrrcntly avaitahlc antitoxin which is usually produced in large animals such as horses:
aut'ticicnt antitoxin must he administered to neutralize the toxin. but nut so much antitoxin as tc, increase the risk of untcwa,-d side et'Iects. 'l~hese side effects are caused hv: i) patient aensitivitv m torcitn (c-.,s,~. horse) proteins: ii) anaphylactic or immunogenic properties of non-II11117Lt11c1~~IOhllIln proteins: iii) the complement fixing properties ul' mammalian antibodies:
and/or iv) the overall burden ol' foreign protein administered. It is extremely dif'ticult to strike this balance when. awoted above. the degree ot~ intoxication (and hence the )eve! of antimvin therapy needed) can only he approximated.
~I Ite present invcntic,n cnntcmplatcs significantly reducing side; et'fects su that this balance is more easily achieved. Treatment according to the present invention contemplates reducing side et'tects by using PL:G-purified antitoxin tom birds.
In one embodiment, the treatment of the present invention contemplates tllC
else (,t' I'l:O-purified antitoxin from birds. ~l'he use of yolk-derived. PECi-purilicd antibody as antitoxin allows for the administration ol': I) nontmammalion)-complement-fixing. avian antibody: ?) a Icss heterogeneous mixture ol' nUn-InlIl1tI11ULlt7ht11111 proteins: and s) Icss tcltal stt protein to deliver the equivalent weiLht of active antibody present in currently available . antitoxins. The non-man ~nuilian source of the antitoxin makes it uset'ul for treating patients who arc sensitive to horse ur other mammalian sera.
_?c~_ WO 98I~S40 PCTIUS97I15394 I3. Delivery Uf Antitoxin f~IthUll~h It IS not intended to limit the route of delivery. the present invention contemplates a method 1br antitoxin treatment of bacterial IntOxICatl011 111 Wl)1C11 delivery of antitoxin is oral. In one embodiment, antitoxin is delivered in a solid form (ce.,c,~.. tablets). !n an alternative embodiment antitoxin is delivered in an aclucous solution. When an aqueous suluticln is used. the solution has sufficient ionic strength to soluhilize antibody protein. yet is made palatable tile oral administration. The delivery solution may also be buffered (e.y..
carbonate butter pf i c).S) which can neutralize stomach acids and stabilize the antibodies when the antibodies are administered orally. In one embodiment the delivery solution is an aqueous solution. !n another embodiment the delivery solution is a nutritional t<lrmula. I'relerablv.
the delivery SOltltlUll 1S ttltalll tormula. Yct another embodiment (:~111I1Il1plilt~S llle dclivc:rv of lyophilized antibody encapsulated or microencapsulated inside acid-resistant colnpounds.
Methods o1' applying enteric coatings to pharmaceutical compounds are well known to the art ~rumFlanies shecializin~= in the coating of pharmaceutical compclunds arc available: for Is example. ~l'he C'oatin~~ Place (Verona. W!) and AAI (Wilmington. NC')].
l:ntcric cuatinca which are resistant to gastric fluid and whose release (i.r.. dlssolutlon of the ruatin_~ to release tllc pharmaceutical compound) is pFl dependent arc commercially available ~I~ur eaamhlc. the polymetllacrylutes lJudragit.k; I. and f-;udragittii~ ~ (R~hm C.imhl-11].
f=udragia t ~ i:s soluble in intestinal fluid from ptl 7.0: this coating can be used to micruenrapsulatc lyophilized antitoxin '_'() antihmii~s and the particles are suspended in a solution having a pll above or below p!1 7.0 I~or oral administration. The mieropartielcs will remain intact and undissolved until they reached the intestines where the intestinal pH would cause tl1e111 to dlssulvc: thereby releasine the antitoxin.
l he invention contemplates a method of treatment which can he administered tile '_'s treatment ot~ acute intoxication. In one embodiment, antitoxin is administcrect orally in either a delivery solution or in tablet form, in therapeutic dosage, to a subject intclxicatcd by the hacte:rial main which served as immunogen file the antitoxin.
The invention also contemplates a method of treatment which can he administered llrophvlacticallv. In one embodiment. antitoxin is administered orally. in a delivery solution.
s0 in therapeutic dosage, to a subject. to prevent intoxication of the subject by the bacterial toxin which served as immuno~en for the production of antitoxin. In another embodiment.
antitmin is administered orally in solid form such as tablets or as microcncapsulated particles.
Microencapsulation of lyophilized antibody using compounds such as L:udrugit~K~ ( ROI1111 - i (') -Gmbl-il or polyethylene glycol , which dissolve at a wide range of pH units.
allows the oral administration of solid antitoxin in a liquid form (i.e.. a suspension) to recipients unable to tolerate administration of tablets (c~.,s;.. children or patients on feeding tubes). In one preferred embodiment the subject is a child. In another embodiment, antibody raised against whole bacterial organism is administered orally to a subject. in a delivery solution. in therapeutic closa~~e.
Vaccines Against Clostridial Species 'hhe invention contemplates the generation of mono- ;tnd multivalent vaccines for the f() protection of an animal (particularly humans) against several clostridiai species. (7f particular interest arc vaccines which stimulate the production of a humoral immune response to ('.
hmrrlirurm. ( '. tetcrui curl (' cliJ~icilc~ in humans. The antigens comprising the vaccine ~rl:p.l1'~ltl(111 Illa1' he native or recombinantly produced toxin proteins from the clostridial apccies listed above. When toxin proteins are used as immunogens they arc:
generally 1 ~ modified to reduce the toxicity. This modification may be by chemical or genetic (i.c~., rrcomhinant DNA technology) means. In general genetic detoxification (i.r..
the expression «I' nontoxic fragments in a host cell) is preferred as the expression of nontoxic fragments in a host cell prcclucles the presence of intact. active toxin in the final preparation. Ilow~cver.
when chemical modification is desired. the preferred toxin modification is lornlaldehvde ~() treatment.
The invention contemplates that recombinant C'. hcnulinnm toxin proteins he used as anti~cns in mono- and multivalent vaccine preparations. ~e~luble.
substantialfv endotoxin-free rvcomhinant ('. hmurlimrm toxin proteins derived from serotypes f1. I3 and C:
may be used individualy (i.e.. as mono-valcnt vaccines) or in combination (i.e., as a multi-valent vaccine).
In addition. the recombinant t;'. horulirrurrt toxin proteins derived t~on~
scrotpes A. t3 and I:
may be used in conjunction with either recombinant or native toxllls or toxoids from other scrotypes of ('. hruulinrrnr. ('. cIiJJicile and C'. trtuni as antigens for the preparation of these mono- and multivalent vaccines. It is contemplated that. due to the structural similarity of ('.
hntulimrnr and ('. te~lGJ7i toxin proteins. a vaccine comprising C'.
diJ~icilc~ and hntrrlinum toxin s() proteins ( native or recombinant or a mixture thereof be used to stimulate an immune respemse a~!ainst ('. hutulintrm. C'. tetcuTi crnc! ('. c!iJJieilc~.
_;I _ PCTNS9'7/15394 The present invention further contemplates mufti-valent vaccines comprising two or more botulinal toxin proteins selected from the group comprising recombinant C'. butulinum toxin proteins derived from serotypes A. B. C (including C1 and C2). D. E, F
and G.
The adverse consequences of exposure to botulinaE toxin would be avoided by 11n171ttnlZat1011 Uf subjects at risk of exposure to the toxin with nontoxic preparations which confer immunity such as chemically or genetically detoxified toxin.
Vaccines which confer immunity abainst one or more: of the toxin types A. E3, I. 1~
and Ci would be useful as a means of protecting humans ti~otn the deleterious effects vi' those ('. hr~ltrlimrnt tt)xtn$ known to affect man. Indeed as the possibility exists that humans could lU he exposed to any of the seven serotypes of C.'. hv~ulurum toxin (c.~,~..
during biological warfare ctr the production of toxin in a laboratory setting), multivalent vaccines capable of conferring immunity against toxin types A-Ci (including both C'1 and C2 toxins) would be useful tier the protection of humans. Vaccines which confer immunity against one or more of tltc tewill miles C'. D and E would be useful for veterinary applications.
1 > -E-he hotulinal neurotoxin is synthesized as a sinclr polypeptide chain which is processed into a heavy (H: -lUU kD) and a Eight (l.: --iU kI)) chain by clcavacc with protcolytic enzymes: these m~o chains are held together via disulfide hoods 111 the active toxin (referred to as derivative toxin) [B.R. DasGupta and I1. Sugiyama. I310C11C111. lilOp111'S.
Etes. C'ommun.
4R:1 UH ( 1 c)7?): reviewed in B.R. Das(iupta. J. Yhysiol. 84:??U ( 1 ~)9U). I
E. Su~iyama.
?U Microbial. Rev. 44:419 (1980) and C.'.1.. I~athewav. C.'lin. Microhiol.
Rev. _>:(i(~ (1990)[. 'the heavy chain of the active toxin is cleaved by trypsin to produce two lia~_ments trrmcd I 1,.
(also referred to as I-1, nr C') and 11~ (also referred to as I1, nr fi). I he ly. I'ragtnent (-4(~ kD) cumpriscs the carboxv end of the ll chain. 'rhe III Fragment (-~t~) kl)) comprises the aninm end and remains attached to the I_ chain (It,~L). Neither I-!~. or H,,1. is tUxlc. hl~ competes ?> with whole tirrivativc toxin for binding to synaptosomes and therefore 1I~
is said to contain thr receptor hindinr~ site. 'hhc E I~. and 1-i" fragments of hotulinal toxin are analogous to the fragments C' and B of tetanus toxin which are produced by papain cleavage.
~I~hr C' l~ragtnent of tetanus toxin has been shown to he responsible !or the bindin~_ of~ tetanus toxin to purified ~an~liusidcs and neuronal cells [i-Ialpern and Loftus. J. t3iol. C'hcm.
?88:11188 (1~)~)_~)).
3() Antisrra raised aLainst purified preparations of isolated hotulinal E-1 and I_ chains have been shown to protect mtcc against the lethal effects of the toxin: however.
the cFfectivencss of the w~o antisera differ with the anti-II sera being mare patent (II.
~u~iyama. .srrhrul.
While the different hotulinal toxins show structural similarim to one another, the different WO 98JflS540 PCT/(JS97115394 serotypes are reported to be immunologically distinct (i. r., sera raised against one toxin type does not cross-react to a significant degree with other types). Thus, the generation of multivalent vaccines may require the use of more than one type of toxin.
('. hrurrlinrrnr toxin genes from all seven serotypes have heen cloned and sequenced ( Minton ( I 995), .crrnr-cr); in addition. partial amino acid sequence is available for a number of ('. 17(rlrllrrrrrl)1 toxins isolated from different strains within a given serotype. The C'. hcnulinu»r lOxIrtS Ct)r7tar11 ahollt 1?50-1300 amino acid residues. On the DNA level. the overall degree of homology between C'. hruulinu»r serotypes A, E3. C. D and f; toxins averages between SO and (,()% identity with a greater degree of homology being found between I-I chain-encoding 1 U regions than between those encoding L chains [Whelan cu crl. ( 19c)?) Appl. Environ.
~~licrohiol. 58:? 345j. The degree of identity between ('. hrrrrrlinr»rr toxins on the amino acid Icvcl reflects the level of DNA sequence homology. 'Che most divergent area of DNA and amino acid Sc'.qlICIICt: 15 found within the carboxv-terminal area of the various ('. hunrlirTUm U1 chain '~elllS. ~rht1 portion of the toxin (i.e.. lil.or the C fragment) plays a major role in cell 1 s hindin~~. ,~ls toxin from different scrotypes is thought to bind to distinct cell receptor molecules, it is not surprising that the toxins diverc:e significantly over this region.
Within a Liven serotvpc, small variations in the primary amino acid sequence oJ' the b~tulinal toxins isolated ti-cnn different strains has been reported ~ Whelan m ul. ( 199?). .wrhrcr and Minton ( 1995). .wrlrrcrj. The present invention contemplates fusion proteins comprising 2t) horticms of~ C'. hrrlrrlirttr»r toxins from serotypes A-Ci including the variants ibund among different strains within a given serotype. The present invention Provides oligonuclrotide primers whici~ may be used to ampliy the C fragment or receptor-binding re~~ion of the toxin ~~ene i'rum various strains of ('. horulirzunr serotype A, serotvpe 13.
scrotvpe (' (Cl and C2).
srrotvpc I). scrotvpe L, scrotync iv and scrotype G. A large number of different strains of ('.
?5 horrrlinr»rr serotvpe A. scrotvpc L3. serotype C, serotype D serotype E and serotypc F arc available tCUll1 the American Type Culture Collection (ATCC: Rockville. MD).
For example.
the A~I~C'C' provides the followiy: Type A strains: 174 (A'fC:C 3502). 457 (A'l'CC' 17862), and N("rC 7?7? (ATC.'C 19397): Type f3 strains: 34 (A'TCC 4 3c)). G2A (A~l'CC
794R). NC A
13 13 ( ATC'C 7c)49). I 31 I 4 ( ATCC 8083). 31 37 (ATCC 177811). 1347 ( A'1'C:C' 1784 I ). ?U 17 3() (ATC'C 1784;). ??17 (ATCC' 17844). ?'_54 (ATCC 17845) and V1' 1731 (A'fC C
25765);
Type C strains: ?220 (A'fCC 17782), '?'?39 (ATCC 17783), 2?33 (A~TC.'C' 17784:
a type C'-(~
strain: C'-(3 strains produce C2 toxin). 6G2 (ATCC 17849; a type C'-a strain:
C'-a strains produce mainly C l toxin and a small amount of C2 toxin). 2021 (A~1'CC 1785U:
a type C'-a WO 98/08540 PCTIUS97l15394 strain) and VPl 38()3 (ATCC ?57bb); 'Type D strains: ATCC 9633. 2023 (ATCC
17851 ), and VPt 599 (ATCC ?7517); Type 1~ strains: A'fCC 43181. 36208 (A'1'CC 9564), ??31 (ATCC
17786). ''??9 (ATCC 17852). ?279 (ATCC 17854) and 2'_'85 (ATCC 17855) and Type F
strains: '?U2I= (ATCC ?3387). VPI 4404 (ATCC ?5764). VP1 2 383 (ATC'C ?73? 1 ) and Langeland (A'fCC 3~41~). 'Type Ci strain, 11 3130 (NCFB 301?) may be obtained from the National (.'ollection of Food Bacteria (NCFB, AFRO institute of Faod Research.
Reading, Ilnitcd Kingdoml.
Purification methods have been reported for native toxin types A. 13. C'. O.
E. and F
[reviewed in ti. Sakaguchi. t'harmac. T'her. 19:165 (1983)). As the different hotulinal toxins 1 () are structurally related. the invention contemplates the expression of any of the botulinal IUxlIIS (c.,~~.. types A-(i) as soluble recombinant fusion proteins.
In particular, methods for purification of the type A botulinum neurotoxin have been developed [ I...I. Moherg and Iv. Sugiyama. Appl. l:nviron. Microbial. i~:878 ( 1 c)78)[.
Immunisation ol' hens with detoxilied purified protein results in the generation ot~ neutralizing.
Is antihocfics [B.S. 'fhalley rr ul.. in l3vtuli»um a»d 7inunrr.c 11'errrwuuxi».v. fi.R. I)as(iupta. cd..
Plcnunt Press. New York ( 1c)c)3). p. 467).
The currently available ('. hrrlrrli»rrm pentavalent vaccine contprisin~
chemically inactivated (i.u.. titrmaldehvde treated) type A. R. C. D and L: toxins is riot adccluate. The eft3cacv is variable (in particular, only 78% of recipients produce protective levels of anti-type ?U I3 antibodies fcrllowinL administration of the primary series) and immunization is paintirl (deep suhcutan eous inoculation is recluired fur administration), with adverse reactions being common (moderate to severe local reactions occur in approximately 6'% of recipients upon initial injection: this number rises to approximately I 1°/~ of individuals who receive booster injections) [informational Brochure t~tr the Pentavalcnt (ABCDI) L3cttulinum ~l~oxoid, C'c;nters ?s Ior Disease (.'ontrol J. Preparation of this vaccine is dangerous as active toxin must be handled by Iaboratorv workers.
In general. chemical detoxification of bacterial toxins using agents such as f~armalclchvdc. glutaraldchvde or hydrogen peroxide is not optimal tits the veneration of vaccines or antitoxins. A delicate balance must he struck between tan much arid too little stl chemical modification. If the treatment is insufficient. the vaccine may retain residual toxicity. If the treatment is too excessive. the vaccine may lose potency due to destruction of native immunoLCnic determinants. .Another major limitation oC using hotulina) toxoids for the generation of antitoxins or vaccines is the high production expense. Fur the above reasons.
- ,4 -the development of methods for the production of nontoxic but immunogenic C'.
butulinum toxin proteins is desirable.
The (.'. bv~ulinrrrrr and C'. ~ercrnu.s toxin proteins have similar structures [reviewed in I=..1. Schantz and E.A. Johnson. Microbiol. Rev. SG:80 ( 1992)]. The carboxv-terminal 50 kD
t'ragment of the tetanus toxin heavy chain (fragment C) is released by papain cleavage and has been shown to be non-toxic and immunogenic. Recombinant tetanus toxin fragment C has been developed as a vandidate vaccine antigen [A.J. Makoft~ er «L.
l3iol'i'echnolugy 7:1043 ( 1~)8~))I. Mice immunized with recombinant tetanus toxin fragment C were protected tcom challenge with lethal doses of tetanus toxin. No studies have demonstrated that the recombinant tetanus t~agment C' protein confers immunity against other hutulinal toxins such as the (' hrrrrrlin«r» toxins.
Recombinant tetanus ti~agment C has been expressed in L;. calf (A.J. Makoff cr crl..
E?iiuhhcchnolugy. .wrhrcr and Nucleic Acids Res. 17:10191 ( 1989): J.I.. I
lalpern m crl.. Infect.
(ntrnun. sa:lU(1~ (1990)), yeast [M.A. Romanos e~~ ul.. Nucleic: Acids. Res.
i9:1~101 (1991)]
I ~ and haculuvirus ~ I.G. Charles cr crl.. Infect. Immun. 59:1 h27 ( 1991 )).
Synthetic tetanus toxin ~~cnes had to be constructed to facilitate expression in yeast (M.tl. Rumanus m crl.. .supra) and I~'. cwli [f1..1. Makoff cr crl.. Nucleic Acids Rcs., .~~trprcr], due to the high A-'r content of the tetanus twin gene sequences. I IiLh A-~f content is a common feature ul~
clostridia) genes (M.R. I'upohf rr crl.. Infect. lmmun. 59:3673 (i991); H.F. LaPenotiere m crl..
in l3olrrli»rrr» crud _'() Tcn«nar.s .\ rr»wnnxin.v. B. R. DasGupta. eel.. Plenum Press. New York ( 199 ; ), p. 463 ] which creates expression difficulties in L. coh and yeast due primarily to aitcrcd colon usage:
fi~eduenw and liu-tuitous pulvadcnvlatiun sites, respectively.
fhc C' fragment of the C'. horarli»u»z type A neurutoxin heavy chain has been evaluated as a vaccine candidate. 'fhc ('. I7I)rrlhl7rrr17 type A neurotoxin gene has been cloned and sequenced [I).L;. Thompson cu crl.. Eur. J. Biochem. 189:73 (1990)). The C' fragment of the type A twin was expressed as either a fusion protein comprising the hotulina) C t~agment fused Wlth Ihl'. I11a1tOSe binding protein (MBP) or as a native protein ~H.F.
Lal'enotiere cn crl..
( 199;) .cuhrcr. I I.F. LaPcnotierc m eel.. Tuxicon. 33:1 383 ( 1995) and Middlcbrouk and i3rown (1995). C'urr. ~Ii~p. Microbial. Immunol. 195:89-122). Tlte plasmid construct encoding the native protein was reported to he unstable. white the fusion protein was expressed primarily in - inclusion bodies as insoluble protein. Immunization of mice with crudely purified MBP
fusion protein resulted in protection against 1P challenge with 3 LDS" doses of toxin ]l.al'enoticre m «L, ( 1993) and ( 1995), .srrprcr]. However, this recombinant ('. hnrulinrr»r type A toxin C fragment/MBP fusion protein is not a suitable immunogen for the production of vaccines as it is expressed as an insoluble protein in F. calf. Furthermore.
this recombinant (.'. hnnrlinunr type A toxin C fragmentIMBP fusion protein was not shown to be substantially t3~ee of endotoxin contamination. f:xperience with recombinant ('. hnhrlinrrm type A toxin (.' s fragmentIMBP fusion proteins shows that the presence of the MBP on the fusion protein ~rcatly complicates the removal of endotoxin from preparations of the recombinant fusion protein (.we Ex. 24. inJucr). Expression of a synthetic gene encoding C'.
hn~trlinum type A
toxin C ti-agment as a soluble protein excreted from insect cells has been reported [Middlcbraak and Brown ( 1995). .wnhru~; no details regardinL the level of expression achieved ur the presence of endotoxin or other pyrogens were provided, Like the InsoIUbIe protein expressed in L:. cnli. immunization with the recombinant protein produced in insect cells was reported to protect mice from challenge with C'. hnrrrlinum toxin A.
Inclusion body protein must be solubifized prior to purification and/or administration to a host. The harsh treatment of inclusion body protein needed to accomplish this I s solubili-ratiun may reduce the immunoeenicitv of the purified protein.
Ideally, r~cumbinant proteins m he used as vaccines are expressed as soluble proteins at high levels (i.r.. greater than or equal to about 0.75% of total cellular protein) in E. cwli or other host cells (e.~~., yeast. insect cells. ete.). 'This facilitates the production and isolation of sufficient quantities of the imlnunugen in a highly purified form (i.v.. substantially i'rcc ul' endotoxin or other ~0 pyrogen contamination). The ability to express recombinant toxin proteins as soluble proteins in E. orrli is advantageous due to the low cost of growth compared to insect or mammalian tissue culture cells.
The ('. hurrrlinrrrn type B neurutuxin gene has been cloned and sequenced from two strains of ('. hmulinrrm type B [Whelan c~l crl. (1992) Appl. Environ.
Microbial. sli:2 i4s 2s (Danish strain) and Hutson r~ ul. (1994) Curr. Microbiol.'_B:IUI (Eklund 17B strain)). 'Fhe nucleotide sequence of the toxin gene derived from the Eklund 1713 strain (ATCC 25705) is available from the EMB1,1(ienl3ank sequence data banks under the accession number X71346:
the nucleotide sequence of the coding region is listed in SEQ ID NU: i9. The amino acid sequence al' the C'. hnrulinrrm type Ei neurotoxin derived from the strain Eklund 178 is listed 30 in S~Q ID NU:40. 'The nucleotide sequence elf the ('. horrrlinum scrotype 13 toxin gene derived Pram the Danish strain is listed in SEQ ID NC):41. The amino acid sequence of the ('. lro~trlirzrrna type B neurotoxin derived from the Danish strain is fisted in SEQ I>7 N0:42.

The C'. horulinum type B neurotoxin gene is synthesized as a single polypeptide chain which is processed to form a dimer composed of a light and a heavy chain linked via disulfide bonds. The liglu chain is responsible fur pharmacological activity (i.c~.. inhibition of the release of acetylcholine at the neuromuscular junction). The N-terminal portion of the ' s heavy chain is thought to mediate channel formation while the C-terminal portion mediates toxin binding: the type B neurotoxin has been reported to exist as a mixture of predominantly Slllgle C'.halil Wlth S()Ille double chain ( Whelan er crl.. .supra). The ~0 kD carboxv-terminal portion of the heavy chain is referred to as the C' fragment or the Ilc.
domain. 'The present invention reports for the first time. the expression of the C fragment of C'.
hnrulinurn type B
toxin in heterolugous hosts (c~.~J., E. culi).
The C'. hurulinlrm type I: neurotoxin gene has been cloned and sequenced twom a number of different strains [Poulet or ul. (199?) Biochem. Biophys. Res.
('ommun. 183:1()7:
Whelan cr crl. (1992) tour. J. Biochem. ?04:G~7: and Fujii cu crl. (1993) 1.
Gen. ;vticrohiol.
1 3c):7cy. The nucleotide sequence of the type E toxin gene is available from the EMF3L
1 > scduence data bank under accession numbers X62089 (strain Beluga) and X62686 (strain N(.'~fC' 1 1 ? 1 c)): the nucleotide sequence of the coding region (strain Beluga) is listed in SI:Q
It NC):~s. The amino acid sequence of the ('. bnrulinurn type E ncurotoxin derived trom strain l3cluLa is listed in SEQ ID N():4G. The type I: neurotoxin Lent is synthesized as a single lx~lycptide chain which may be converted to a double-chain form (i.r..
a heavy chain _'() and a light chain) by cleavage with trypsin: unlike the type A
neurotoxin. the type E: .
neurotoxin exists essentially only in the single-chain form. The ~0 kD carboxv-terminal portion o!' the: heavy chain is referred to as the C fragment or the Eh.
domain. The present invention reports for the first time, the expression of the C tragmcnt of ('.
hrrrrrlinurn type F
tu~cin in hetcrolo~:ous busts l~.L~.. E. crrli).
T'he ('. hrrrulinrrnr type C'l. D. F and G neurotoxin genes have been cloned and scclucnced. The nuclecftide and amino acid sequences of these genes and toxins are provided herein. ~l'he invention provides methods for the expression of the C fragment from each of these toxin genes in heterologuus hosts and the purification of the resulting recombinant proteins.
The subject invention provides methods which allow the production of soluble ('.
hrnulirrrrm toxin proteins in economical host cells te~.y., L;. c~oli). In addition the subject invention provides methods which allow the production of soluble hutulinal toxin proteins in yeast and insect cells. Further. methods for the isolation of purified soluble ('. hrnrrlinum _37_ toxin proteins which are suitable for immunization of humans and other animals are provided.
'these soluble, purified preparations of C'. bvtulinum toxin proteins provide the basis for improved vaccine preparations and facilitate the production of antitoxin.
When recombinant clostridia( toxin proteins produced in gram-negative bacteria (v.y., s E. reli) arc used as vaccines, they are purified to remove endotoxin prior to administration to a host animal. In order to vaccinate a host, an immunogenically-effective amount of purified Substantially endotoxin-ti~ee recombinant clostridia( toxin protein is administered in any of a number ut' physiologically acceptable carriers known to the art. When administered for the purpose c1f vaccination. the purified substantially endotoxin-tree recombinant clostridia( toxin protein may he used alone or in conjunction with known adjutants. including potassium alum.
aluminum phosphate, aluminum hydroxide. Gerbu adjuvant (GmDP: C'.C. Biotech Corp.).
RIBI adjuvant (MfL; lZIBI Immunochemical Research. Inc.). QS2l (Camhrids~e Bioteclz).
'fh~ alum and aiuminum-based adjutants arc particularly preferred when vaccines arc to be administered to humans: however. any adjuvant approved for use in humans may he 1 ~ employed. 'I~he route of immunization may be nasal. oral. intramuscular.
intraperitoncai or subcutaneous.
~l~lm invention contemplates the use of soluble, substantially endotoxin-free preparations of fusion proteins comprising the C' tcagment of the ('.
lmtrrlinunr type A. 13. C, U. E. F. and (i tux111 as vaccines. In one embodiment. the vaccine comprises the C fragment ?0 of either the ('. hntulinum type A, B. C, D. E. F, or (~ toxin and a poly-histidine tract (also called a histidine tag). In a particularly preferred embodiment. a fusion protein comprising the hISLld1111', tagged C fragment is expressed using the pl:~f series of c~cprcssiol vectors (Nc~yaLrn). The pET expression system utilizes a vector containing the 'f7 promoter which encocds the fusion protein and a host cell which can he induced to express the '1~7 DNA
polymcrase (i.c., a DE3 host strain). The production of C fragment fusion proteins containing a histidine tract is not limited to the use of a particular expression vector and host strain.
Several commercially available expression vectors and bust strains can be used to eaprrss the C ti-a~.:ment protein sequences as a fusion protein containing a histidine tract (Fur example, the pQE series ( pQE-8. 12, 16, 17. l 8. 30. 3 l , 32, 40. 41, 4-_'. SU, ~ t . ~
'. cu anct /U ) of ,U ~xpressic~n vectors (Qiagcn) which are used with the host strains M t S(pRf-:P4[ (Qiagen ) and S(i13~09[pREf4[ (Qia~en) can be used to express fusion prclteins containing six histidine residues at the amino-terminus of the fusion protein). Furthermore a number of commercially available expression vectors which provide a histidine tract also provide a protease cleavage _38_ site between the histidine tract and the protein of interest (c.~;~., botulinal toxin sequences).
C'leava~c of the resulting tilsion protein with the appropriate protease will remove the histidinc ta~~ from the protein of interest (c~.~j., botulinal toxin sequences) (see Example 28a.
infra). Removal «f the histidine tae may be desirable prior to administration of the recombinant hotulinal toxin protein to a subject (c~.~~.. a human).
V1. I)etcction Of Toxin The invention contemplates detecting bacterial toxin in a sample. The term "sample"
in the present specification and claims is used in its broadest sense. On the one hand it is 1(t meant to include a specimen or culture. Un the other hand. it is meant to include both biological and environmental samples.
Biological samples may be animal. including human. fluid. soled (e.~~.. stool) or tissue:
liquid and solid t~m~d products and ingredients such as dairy items.
vegetables. meat and meat hy-products. and ~astc. Environmental samples include environmental material such as i ~ surface ntattcr. soil. water and industrial samples. as well as samples obtained from trod and dairy processin~~ instruments, apparatus. equipment, disposable and non-dispusahl~ items.
l~itrsc ~xamlles are not 1 be construed as IimitinL the sample types appticablc to the present 111~'t I1LIO11.
Thr invention contemplates detecting bacterial toxin by a campetitiw immunoassay ~'() method that utilises recombinant toxin A and toxin I3 proteins.
antibodies raised against .
recombinant bacterial toxin proteins. A fixed amount of the recombinant toxin proteins arc imlzu~hili~rd to a solid support (c-.,L~.. a nticrotiter plate) tbllowed by the addition ol' a biological Salllpll' SLISpCCted of containing a bacterial toxin. The biological sample is first mined with affinity-purified or I'E(i iiactionated antibodies directed against the recombinant toxin prrnein. A reporter reagent is then added which is capable of detecting the presence of antihocl hound to the immobilized toxin protein. The reporter substance may comprise an antihocy with binding specificity for the antitoxin attached to a molecule which is used to identify the presence of the reporter substance. If toxin is present in the sample, this toxin will ce~mpete pith the immobilized recombinant toxin protein !ur binding to the anti-recombinant antibody thereby reducing the signal obtained following the addition ot~ the reporter reagent. A control is employed where the antibody is not mixed with the sample.
This gives the highest (or reference) signal.
_ ; c) _ The invention also contemplates detectinc bacterial toxin by a "sandwich"
immunoassay method that utilizes antibodies directed against recombinant bacterial toxin proteins. Affinity-purified antibodies directed against recombinant bacterial toxin proteins art immobilized to a solid support (c~.~,J.. microtiter plates). l;ioloLical samples suspected of s containing bacterial trains arc then added followed by a washing step to remove substantially all unbound antitoxin. The biological sample is next exposed to the reporter substance. which hind, tc~ antitoxin and is then washed free of substantially all unbound rclortcr substance:.
The reporter substance may comprise an antibody with bindin~~ speciticity t«r the antitoxin attached to a molecule which is used to identify the presence of the reporter substance.
l() Idcntitication of the reporter substance in the biological tissue indicates the presence of the bacterial toxin.
!t Is alstl contemplated that bacterial toxin be detected by Louring liquids (~.~~.. soups and mhcr fluid ti,ods and feeds including nutritional supplements tier humans anti other ,InimaIW over inuoubili~cd antibody which is directed against thr bacterial toxin. It is 1 ~ euntemllatcd that the immobilized antibody will be present in ur on such sullorts as eartrid~~ua. columns, l,rads. ur any other solid SLILL(lrt Illldltlttt. In om emhudintcnt. li~lluwing the ml,asurc «I~ the liduid to the immobiiizcd antibody. unbound toxin is substantially rcmomd Iw washinL. l~h~ cvl,osur~ of the liquid is then ~xpascd to a reporter auhst:utcc which Jctccts the presence of hound toxin. In a preferred embodiment the reporter substance ?0 is all 1117\'lttl'. Iluorcscent dvc. ur radioactive compound attached m an antibody which is directed against the toxin (i.e., in a "sandwich" immunuassavl. It is also contemplated that thr detection system will lm developed as necessary (c.,~~.. the addition ul~
rn7vmc substrate in m7vmr wstcms: observation u~in~ fluorescent liLht ti>r tluurcsccnt dvc wstemx:
and cluantitation ul~ radiuactiviy tar radioactive systems).
,;
F.XPER1MENTAL
~l~hc following c:xamlles serve to illustrate certain Lreferred embodiments and aspects of thr Lrcscnt invention and arc not to be construed as Iimitin L the scale thereof.
In the disclosure which titllows. the following abbreviations alllv:
°C' (eicgrees al i.'enti'~radel: rpm (revolutions Lcr minute): IiBS-l~ween (borate huf'ti:red saline ronttainin~;
~I'weenl: I3~A (bovine scrum albumin): I:I.ISA (l,'111yllll:-1I17hCd tlttlttllltlWOrl,t:ltl aSSa\'): (.'HA
Icumlletc Urcunci's ad.juvant): fl~A (incontllete f~reund~s ad.juvant): ILC~
(immulto~~lohulin <i):
1gY' limmunoglobulin Y): IM (intramuscular}; 11' (intrapcritoncal): 1V
(intravenous or -4()-WO 98108540 Pf"TIUS97/1(5394 intravascular): SC.' (subcutaneous): I~I,O (water): HCI (hydrochloric acid);
LDlrlrt (lethal dose iur I O()% of experimental animals): as (amino acid): EIPLC (high performance liquid chromatography): kD (kilodaltons): grtt (grams): yg (micrograms(: mg (milligrams): ng (nano~~ramsJ: yl (microliters): mi (milfilitcrs): mm (millirnctersl: nm (nanonteters): ).tnt (micrometer): 1~1 (molar): mM (millimolar): MW (molecular weight): sec fseconds):min(s) (minutciminutest; hrls) (hour/hours): MeCI, (magnesium chloride): NaC'I
(sodium chloride);
Na.C'(>: (sodium carhonatc): ()1)_xn (optical densiy at ?8() nm): UD,,~"~
(optical density at 6U() nm): 1'.~ICiL: (polyacrylamidc gel electrophoresis): PBS (phosphate huffercd saline ( 1 i0 mM
NaC'I. IU mM sodium phosphate buffer. pIJ 7.?)J: PL~Ci (polyethylene glycol):
PMSF
1() (phenyimethylsultiyl tluoride): SDS (sodium dodecvl sultatc): Tris (leis(hvclrewmcthyl)aminomethane): l~ItsLlrC~.H> (I-:nsure!t. (toss L.ahoratorics. ('olumbus ()Il):
I:nlamil K Il:ntamilvi. !~~l~ad Johnson): wiv (weight to volume): viv (volume to volume):
:lmicon (:\nticon. Inc.. limcrly. ;1:11: :\ntresco (-\ntresco. Inc.. Solos.
()li): I\~I~C'(' Ir\ntcrican I~ypc ('ulturr ('ollc:ction. Rockville. MD): E3BI. (Baltimore Biologics l.aboratorv.
(a eliuision ol' I3ccton Dickinson). C'ockeysville, A~1D): Becton l7ickinson (Becton L)ickinson I,ahwar~. Lincoln Park. ~'.1): BioRad (l3ioltad. Richmond. (';\): l3iotcch (('-C' (iiotcch ('orp..
I'oway. C':~?: (.'harlcs River (('harlcs River L.ahoratories. VViIlttlngttllt.
M.A): Cocalico (<'or.rlico I3ioly~irals Inc.. IZcamstown. I'A): (:'yRx (('WRx ('orp., Norrross. (it1): I~alron (c-.~. liawcr Ilcalthcarr ('orp.. N1c(iaw ('ark, IL. and Becton f)ickinson):
l~I)A (I~c;c~c;ral Food .md 1)ru;~ :~clministration): fisher BioUech (f=isher Biotech. Spriniticld.
N.I): (;IL;('() ((;rand Islancl (3iulo~_ir (.'ompam°/13RL.. Grand Island. NY): (iihco-BRI, (Life ~I~ccitnologics. Inc..
(iaithorsi~ur_~. \-1l)): Ilarlctn Sprague I)awlcv (I-iarlan Sprague I)avlcv.
Ine.. Madison. 11t'1):
~-1allinckretdt (~t division ol~ Baxter Ilralthcare ('orp.. Mc(iaw Park. IL):
v1ifliporc (Millipore ('urp.. ~larlhoruugh. MA): New I~Il~laltd BlUlitbS (New L:ns~land Biolahs.
Inc.. Rcverly. MA):
NcwaLCn ( Novagcn. In c.. h-tadison. Vv'I ): I'harmacia ( Pharmacia. lnc..
I'iscatawav. N.1); (~iagct~
((~)iagcn. ('hatsworth. CI1): SasCO (Sasco. Umaha. NI:): Showdex (Shown W nko America.
Inc.. Nm 1~'urk. N~'): Sigma (5i~~ma Chemical C'o.. St. Louis. ~~9()):
Sterogette (Sterogene.
inc.. :lrcadia. ('~1): ~I~rch l.ah (~I~rch Lab. Inc.. Blacksbur~_. Vn): and Vaxccll (Vaxcell. In c..
a subsidiary c~f C'yIRX C«rp.. Norcross. (iA).
.sU 1al'hen a recombinant protein is described in the specification it is referred to in a short-hand ntanmr by the amino acids in the toxin sequence present in the recomhinant protein rounded to tltc; nearest I(). F«r e~camplc. the recombinant protein pMI318~0-?3O) et~ntains amino acids 18s? through ?3G? of the ('. cli/~icile~ toxin I3 protein. ~1'hcspecitication gives detailed construction details for all recombinant proteins such that one skilled in the art ~Vlll IC110H' precisely which amino acids are present Ill a L1Ve11 reCOlllbinatll protein.
I;XAMPLr I
Production ()f high-'Liter Antibodies To ('Iv.S'Ir'flllllll7 c!J/Jirilc~
Organisms In n l(en lntibodies to certain pathogenic organisms have brell s110~1n l<l be ef~tcctive in treaties!
diseases caused by those oreanisms. It has not been shown whether antibodies ran be raised.
as:ainst C'lu.clriclituu clijJicile~. which would be effective in treatin~~
infection by this organism.
I(l ;lccordin=ly, C'. c1J//icilc~ was tested as immunogen tier pruduction of hen antibodies.
-1-o determin a the best curse for raising high-titer r~~e antibodies against whole ('.
cli/Jic~ilc- organisms. different immunizing strains and different immunizing concentrations were examined. ~I~hc example involved (a) preparation o(' the bacterial immunoLCn.
(h) immunization. (c) purification ot~ anti-bacterial chicken antibodies. and (ell dmection of 1 ~ anti-bacterial antibodies in the purified IgY preparations.
a) I'rcpars~tion ()f I3actcrial Immuno~cn ('. cli/JirJle strains :l~sic)4 (scrol:roup .A) and ~1:~~)h (seroeroup C') wcrmriginally c~htaincd t~rom the A~L('('. ~l~hcse twc, strains were selected hcrausc they represent two ol~ the ?0 most comntonlv-occurring serogroups isolated from patients with antibioUic-~tssociatce!
pscudomrmbranou s colitis. ( l)clmec el crl.. J. Clin. Vlicrc~hiul.. ~8( I
l)):'_''_' I () ( I c)c)()). J
;~~lditionallv, both of these strains have been previcmslv charactrrired with respect to their virulence in the wrian hamster model tier ('. cliJJicilc~ infection. (I)elmcc r~ crJ.. .I. Mcd Microbial.. W:Bi ( 1990). ( ~h3~e bacterial strains were separately cultured on brain heart infusion agar for 48 hours at 37°(' in a (.ias Pack l0() Jar (f3I31.. C'ockevsville. MDl equipped mith a Cias Pack Plus anaerobic envelope (13131.). Uortv-ci,~ht hour cultures were used because they produce better growth and the organisms have been found to be more cross-reactive with respect to their surface LtIIIlLCl1 prt:Selltiltt(111. ~I~I1C LrCale'.r the degrt:e o1~ cross-rcac;tiviw ol~ our ILK' s() preparations, the better the probability of a broad range oi~ activiy against different strainsJSCrogroups. (Toms e~ crl.. .I. C'lin. Microbial.. ?Gts):4?O (lc)88).( 'hhe resulting or~.:anisms were removed from the a~~ar suri~ace using a sterile dacron-tip swab, and were suspended in a solution containing 0.4% ti~rmaldchvde; in I'1W, pll 7.'_'. This _p_ concentration of formaldehyde has been reported as producing good results for the purpose of preparin~~ whale-organism immunoeen suspensions fur the veneration of polyclonal anti-(', cliJ~ic~ile antisera in rabbits. [Delmee e~l crl.. J. C'lin. Mierobiul., '? I
:323 ( 198$); Davies et crl..
Microbial Path" c):141 ( 199()).] In this manner, two separate hacteriaf suspensions were prepared. one Fur each strain. The two suspensions were then incubated at 4°C tier I hour.
Irliuwing this period uF tormalin-treatment, the suspensions were centrifuged at 4.200 x g for ~'() thin.. and llte I'eSUltlltg pellets were washed twice in normal saline.
The washed pellets.
which rcmtaincd ti~rmalin-treated whole organisms. were resuspcnded in fresh normal saline such that the visual turbidity oi~ e:1C17 SUSpeltSlun cOCCCSpollded to a #7 NlcFarland standard.
11) (~-1.;1.C'. f~delstein. "J'rnce.s.sins,~ (~linicul ,Sj~ecimen.s./rm Anuernhio l3crrtoricr: Ivrrlutiun crncl Iclcrrtilicwtimn l'rric~ecltwc~.s." in S.~'l. Fin could ct crl (cds.)..
Bcrilcy uncl.Srmt'.~~ Dicr,L~nuwic tliorr~hir~lc~,L~a. pp. 477-s07. C'.V. Mushy C'o.. ( 1990). 'hhe preparation of McFarland nrph elometer standards and the corresponding approxintac number of~
c~r~anistm For tacit tube arc described in detail at pp. 17'_'-17, oFthis volume.( Each of the mu #7 suspensions I ~ was then ,pill into two separate volumes. ()ne volume of elicit SIISpeIISIOIt \1'aS 1'llltlltlf:lrlCall_\' ud.justed. by the aclditi~n ui~ saline. to correspond to the visual turhidiw c~f' a # 1 Mcl~arland standard. ( Icl. ( The it ) suspensions contained approximately , x I f)' or~:anisms!mf, and the r7 suspensions cuntainecf approximately ? x l0'' organismsiml. (lcl.( 'f~he tour resulting i'(lllel'.Iltl'atllllt-ild,ItICted suspensions uf~ Ibrmalin-treated ('.
cli~jicilr organisms were considered _'() m he "bacteria) 111111tlIIlULIn SUSpc11S1t)IlS." These suspensions were used immediately after prep,lratiun iin the initial immttnizatiun. (.S'ec~ section (h). J
~l~lzr lilrmalin-treatment procedure did nut result in l0()°/a non-viable bacteria in the Illlllltlnl>'~lll ~tl5~f.'n51()I1S. In order m increase the level of killin~~.
the tlll'lttallll Cn11eC11tralll)It and lrn~~th ol' treatment wore both increased tier subsequent immuno~en prcnarations. as described below in 'fable 3. (Although viability was decreased with the stronger formalin treatment. t ()0'ro inviabiliy of the bacterial immunogcn suspensions was not reached. ) Alsu.
IIt SLIhSCClllelll II171t1tIItOLel1 preparations, the formaiin solutions were prepared in normal saline instead of I'I3S. At day 49, the day of the fifth immunization. the excess volumes of the tine prcviems bacterial immunogen suspensions were stored fiwzcn at -7()°(' fir use durin~_ all s() subsequent innnunizations.

WO 98/08540 PCTlUS97115394 b) Immunization t~or the initial immunization. I.0 ml volumes of each of the Four bacterial immunogen suspensions described shove were separately emulsified in I.'_' ml volumes of ('I':1 (GIE~CO).
For each of the tour emulsified in tmunogen suspensions. owe liner-month old White Lc~~horn hens (pre-laying) were immunized. (lt is not necessary to use pre-laying hens:
actively-laying locus can also he utifizcd.) Each hen received a total volume of approximately l .U mi of a ~IItLIt,' ellllllSIIIed immunogen Suspension via lour injections (mo subcutaneous and nvc) intramuscuiar) ol' approximately ?50 Ell per site. In this manner. a total 01' ti,ur different immunization combinations. using Uvo hens per combination, were initiated for the purpose of IO e~'aIUaIInL hotel the eflect of llttn1u111Zlltg e()ltCentratlOn t)lt eL',g yctlh antibody (lgh') production, and interstrain cross-reactivity of ICY raised against Iteterolo~ous strains. 'hhc lour immunization groups arc summarized in Tahlc s.
~rnttLE 3 Intlntlnization Grtnlns <iruun t>cait!nationImmunizin!~ Strain :lpproximalr Immunirin~' Do~c ~.)~t)~t. R I ( ~. CII~~IC'IIt' I .O v I11~ ()r~'i1111511).S.'I)C11 vlrMln 4:>tc)4 .. I.I) ~ fit) 11r;_it(11SI11S.I1C1 C~t7 ~j 1t)(), ~ ( ~. (II~~IC'IIC' I .1 Y I11~ ur'_imism~.IICi, I ~

4 jS9() Str1ln C~t) ~ ist)(). j'7 .. ..
I .1) Y I1) ~ <)fL'i1n1511).S'.'I,Cn I'hc time point for the first series of immuniratictns was designated .IS
"clay ecru." r111 luhSe(Itlettt IIttItltlnlZallOnS l~tr~ performed as described ahc)ve except that the bacterial tntmuna!_cn suspensions were emulsified using IfW ((ilf~i('()) instead of ('f~:l, and for the later time pc,int Ilnnlunllalloll. llte SIUt'Cd froGelt SUSpe11S1tt11S N'e1'e 115ed instead of frcshU-prepared suspensions. The immunization schedule used is listed in 'I'ahlc ~

TABLE J
Immunization Schedule l)ay (7f ImmunizationFormalin-'freatmcnt Immunogen Prcparacion Used I"~. I hr. Meshly-prepared I-t I".~. ovcrnisht ,. ,.

I"~. overnight ' ;i In.~~. 4g Itrs.

I o. 7? hrs. .. ,.

stored ti~ozen 1() g; .. .. .. ., I (>; .. .. .. ..

c) t'urifiraticrn ()f Anti-E3actcrial C.'hicken Antihodics (iretuhs <tt~ fitur e~~LS wire collected per immunization group hewren days 8U
and R-1 I ~ post-initial immuni~atictn. and chicken immunoglohulin (1gY) was extracted aecordins; to a nwdilicatien ul~ the procedure ot~ /\. I'olson m «l.. Immunol. C'ctmm..
c):4c)i ( 19R()). ~1 Lentle strum cti' distilled water hrctm a scluirt hctttle was used to separate the yolks 1'rctm the whites.
and the ytlks werr broken by arctErltin~~ them through a i~unnri into a ~~raduatrc! calinder. The liter individual vetlks were pooled i'nr each grattp. 'hhe Pooled. hrctken wtlla were blended ''() w ith -t ~ ttluntcs uC eg~L cwraction hut'fcr to imltrovc antibctcH yield (c;g~_ cxtractictn huffrr i, I).U1 !\1 sodium phosphate. U.1 M Na(.'1. pli 7.~. containin~~ 0.()()i~yn thimerosal). and PE:(i R()Ut) (;\mrescct) mas uddcd tct a concentration uh .s.5'~«. when all the I'ICi dissolved. the protein precipitates that turtned were peppered by C~lltflt~tl~atlttll at !s.()U() x ~~ letr IU minutes.
~I he supernatants were decanted and filtered tltrnu~;h cheesecloth to remove the lipid layer.
and the PI:C wars added tct the supernatants to a final concentration ut' I?"i" (the supernatants wore assumed tct contain s.~'%" PEG). After a second eentrif~u~atinn. the supernatants were discarded and the pellets were centr11~11Led a final time to extrude the remaining f'E:<.~. ~l'hese crude 1~~~' Pellets were then dissolved in tfte original yolk volume ctf egg extraction buf~lcr and stored at :l°C'. .~\s an adctitional control. a preimmune lgY solution was prepared as described ,(1 above. usin~~ tags collected from unimmunizcd hens.
_c)j_ WO 98/08540 PCTIUS97l15394 d) Detection Uf Anti-Bacterial Antibodies In The I'uriticd ICY
PrcParations !n order to evaluate the relative levels of specific anti-('. eliJ%ic~ile activity in the IgY
preparations described above, a modified version oi~ the whale-organism t:LISA
procedure of s N.V. I'adhvc er crl.. :I. Clin. Microbial. 29:99-iU; (1990) was used. frozen organisms of hotlt ('. (II~jJC'lJC' strains described above were thawed and diluted to a concentration of :lpproximatclv 1 x I ()' organismslml using PI3S, pl i 7.?. In this way. tw'o separate coating suspensions were prepared, one ti>r each immunising strain. Into the wells of c)O-well microtiter plates (falcon. 1'ro-Bind Assay Plates) were placed 1()U Ell volumes o!~ the coating 1 () ltlSpe11510115. lit tltlS I11a1111tC, eaelt plate well received a total clt~ approximately I x I U"
organisms oi' one strain or the other. The plates were then incubated at ~4°C' overnight. The new nwrnin~. the coating suspensions were decanted. and all wells were washed three times tlSlrtL 1'Ii~. In c~rdcr to block nun-spcciiic h11td111L? SItCS. IUU Ell uf'().s'ri~ (3;~A (~igtna) in !'tW
was then added m each mil, and the plates were incubated lire _' hours at room temperature.
I > ~f~ltc hlockinL solution w;ts decanted. and lUU hl volumes ot~ the I;~1' preparations described above were initially diluted l :s()() with a solution ot~ 0.1 "/" f3~~1 in PIW. and tltrn serially dilutes! in 1:; steps. The titllowins~ dilutions were placed in the wells:
I:iU(). t:'_'.~UU.
1:6?.~0()(). I :s l'_'.s()(). and 1:1.s6?.~UU. 'Che plates were a~.!ain incubated liar '_' buttes at room temperature. IU11I(1\Vlllg IRIS IlteUhiltl()It, the 1gY-cctntainin~, solutions were decanted, and the ?U wells wore washed three times using RCiS-'I'ween (U.I M boric acid. ().U?i ~.1 sodium borate.
I.U M Na('I. ().l'~a Twcen-?U). lollowed by two v4~asites using! I'f3~-Twucn (1).1°... ~I~wccn-?U).
and finally. 1 of vwlshes using I'I3S only. 'ho each well. l0U yl ot~ a 1:71) dilution oh~ rabbit :lltll-C:ItIl:kell Jg(i (whole-molecule)-alkaline phosphatase conjugate (~it:nrt) Idilumd in ll.l'~,~>
(3~n in I'f3S) was added. The plates were again incubated li,r ? lunlrs at room temperature.
The copulate solutions were decanted and the plates were washed as described above.
substituting ~U ntM Na,C'U,, pll 9.~ tar tire P13S in the final wash. The plates were developed by the addition of I UU tcl ot~ a solution containilt~~ I mL~ml para-nitrophenvl pIltlSpltate (~I~=Ills) dissolved in sU ntM Na,C:O;. 10 m~'t 1~'lgC.'I,. pll ~).> to each well. and incuhatin~= the plates at room telnpcraturc in the dark fire as minutes. I~hc ahsorhance ul~ each :,U well w:ls measured at :kIU nln 11S11tL a I)ynatech MR 70(1 plate reader.
In thrs manner. each ol~
the tinlr l~~l' preparations d escrihcd above was tcstccl t'ur reactivity a~~ainst both of the ilttmunizin~_ ('. ch~~lC'lIC Slt'alltS: strain-specific. as well as cross-reactive activity was determined.
* rE~

'fable ~ snows the results of the whole-organism ELISA. All four 1gY
preparations eiem~nstratcd significant levels of activity. to a dilution of 1:~3.SOU or greater against both of the immunizing organism strains. Therefore. antibodies raised against one strain were highly cross-reactive with the other strain. and vice versa. 7~he immunizing concentration of organisms did noU have a siyilicant effect on organism-specific IgY
production. as both concentrations produced approximately equivalent responses. Therefore. the lower immunizin~~ concentration ufapproximately I.~ x I()~ organisms/hen is the preferred inununiiin~~ cunccntraticln of the uvo tested. The prcinununc (c~Y preparation appeared to p«sscvs rclativrly low levels of ('. cli/Jic~ile-reactive activity to a dilution of 1:x()0. probably It) due to prior caposure of the animals to environmental clostridia.
:1n initial vl~Itlll~-()t'~.a111s111 FLISA was perlormed using IgY
preparations made from ainelc ('i) -1:s~)4. # I and ('f) 4 >~9h. a~ f cg~s collected around day ~U
(data not shown 1.
~peciiic titers were fi~und to he ~ to 10-fold lower than these reported in Tahle ~. These results cHnu~nstratc that it is posslhle to hC~111 lnlnlUt11Lt11f, hl'11S
prior to the time that they I ~ heein to lay r~~~s, and t~ obtain hls:h titer specific IgY I'rotn the first eggs ti~at are laid. In cUhcr words. it is n m necessary m wait for the hens t« he=in laving hetore Ihl 1n1111tII11Zatt011 achcdulc is ,farted.

Results Of The Anti-C'. diJ~irilc Whole-()r~~anism EL1SA
I!_Y Preparation Dilution Of 43594-Coated Wells43i9G-Coated IeY Prep Wells I : 500 I .7-t 6 I .801 I :?.500 I .U~)? I .67(1 ('U a isc)), ;:1 1:13.500 U.3U' U.81?

! :62.SUU 0. ! 36 0. ! 7~) I :3 t 2,i0U U.01'_ (1.080 I : I .s63.s1)U().002 U.U2p I :500 I .780 1.771 I :?.70U I .U35 I .U78 or) a .,c)4. ~7 I : I ~.soo o. a ss o.~x~

1:63.500 U.US? p, I;?

I :3 I 3.500 O.U33 O.Ua_, I : I,S63.SU(I(i.U()S ().U24 I :SOU I .36 I .7~)(1 I:?.s()o a s;, I .)77 I : I z.soo a.~a7 n ~ .t;~

( .
I) a;;~)6. '~I

1:62.500 ().U>() U.?a~

1:31?.SUU U.UIU ().U67 i : I .i6?.SUO().UUU t).U:,(, I:;UO 1.7U' I.sUi I :?.>UO U.7U(, 0.866 ' I:!?.50() 0.210 0 ?b?

ll a.ii~)G. r7 .
t I:6?.SUU U.U3~) (l.U7R

I : i I ?.SUU (LOUD l).U I 7 I : I ,j63.>OU1).UUO ().() I 11 1:500 U.14? 0. ;()~) I :2.s00 U.O.i? 0.(177 I :13.SU0 O.UU6 U.U?a I'rcinununc I~;Y

1:62.SOU t>.OU? U.01'_' 1:., I'_.sUO 0.()Ua 1).U I U

I : I . ~(,''.l).i)U? (>.U I 4 ~(Il l t?XAMPLE 2 'Treatment ()I' ('. cli/)icilc~ Infection With Anti-('. c!i/)irile Antihodv In order to determine whether the immune 1~~Y antihodirs raised aeainst whe)lc ('.
eli/%icilo organisms were ca~tthlr c~l~ inhibiting the infection of~ hamsters by ( ~. cli~~icilc~.
I ~ hamsters inlcctcd by these hacteria were utiliied. [ l.verlv cu crl..
Infect. lmmun.. ~l):'?'? 1 ~-'? 1 H ( 1 c)c) I ). ~ ~fhis caam~le im~olved: (a1 determination oh the lethal dose ut' C'. c!i()icilr organisms: and (h) treatment of~ infected animals with immune antihudv or control antihc)dv in nutritional solution.
-4x-:~) Determination Uf The Lethal Dose Of C. diffrcile Organisms Determination of the lethal dose of t'. clij%icilc~ organisms was carried out according to the model described by D.M. Lyerlv e~ cd.. Infect. Immun.. X9;2215-3218 ( 1991 ), (.'. cli~jicile strain ;1-f(.'C' ~l;i9G (scrogroup C. ATCC) was plated on f3H1 a~~ar and grown anacrobicallv ( RRI. (ias 1'ak 1 ()U system I at 7°C Ibr ~4? hours. Organisms were removed trom the agar aurtacc using a sterile dacron-tip swat and suspended in sterile 0.9°/"
MaCI solution to a ' ~Icnaity of 1 ()~ organisms/ml.
In order to determine the lethal close of ('. cIiJJirile- in tire presence o(' control antibody and nutritional lormula. non-immutte eggs were obtained ti~ont unimmunized hens and a 1?%
f'F(i Itrcparation made as described in Example 1(c). This preparation was redissolved in one limrth Lhl (rlglllal yolk volume of vanilla flavor I~nsureat,.
~tartinz on day one. groups of tcmale Golden Syrian hamsters (I~larlan Sprague I)awlyl. ~-~) woks old and wei~~hinL approximately 1()() gm. were orally administered I ml ui' tltc pl'llrtllttlltt(:!I'.IlSlll't' K lormula at time zero. ? hours. ( hours. and I() hours. :lt 1 hour.
I ~ animals were orally administered 3.0 mL clindamycin !~iCl (Sigma) in I ml of water. This ~lru~~ predisposes hamsters to ('. clijJicile infection by altering IIt~
normal tntestrnal flora.. ()n clay mo. the animals were given 1 ml of the preimntune I~~YIEnsure~!s:
ti~rmula at time zero.
hours. (, hours. and I() hours. /1t 1 hour on day Uvo. different groups of animals were inoculatcct orally with saline tcontrol), or 10-'. lUa. 10''. or l0" (' cli~)icilc~ organisms in 1 ml '_'(> of~ saline. l~retrn days ;-1'_'. animals were Liven I ml of the preirnmune Ig~'Il~nsurent~ titrmula three tinms daily and observed rite the onset of diarrhea and death. L:ach alllil7ctl was housed in au individual ca;~r and was oflered limd and water cul lrhuum.
:~elministration cat' 10'' - 10~ organisms resulted in death in ;-.) clays while the lower doses ol' 10~ - Il)' or~~anisms caused death in > days. ~'ccal swabs taken from dead animals indicated the presence of ('. cliJ~icil~~. Given the effectiveness of the lO' dose. this number of ctrr~pnisms was chosen for the following experiment to sec if hvperimmune anti-('. CJI/~irllC' antibody could block inlcction.
h) ~I'rcatment Of lnfectcd Animals With Immune Antibody (>r (.'.ontrol Antibody In Nutritional Formula ~l~hc experiment in (a) was repeated using three groups nl~ seven hamsters each. Group A received no.clindamycin or ('. cli/)icile and was the survival control.
<:iroup 13 received clindamycin. Il)= ('. cli»irilu organisms and preimmunc l~~Y on the santc schedule as the )_ animals in (a) above. Group C.' received clindamycin. 10- ('. cli/Jicilcr organisms. and hyperinttttune anti-C'. eli~Jirilc~ I~Y on the same schedule as (iroup E3.
'I~he anti-(' cli//icile IgY
was prepared as descrihed in Example l except that the I?'%~ I'hCi preparation was dissolved in one lirurth the original vollc voluttte of )rnsureltt;.
All animals were observed for the onset of diarrhea or other disease symptoms and death. C:ach animal was housed in an individual cage and was ohli;red trod and water crcl lihinrrrr. The results are shown in 't'ahlc 6.

The E:I~tect O1~ Oral Feedin!~ ()f' Hvperimmune I~sY Antibody un ( '.
~li/Jic~ilr Infection I Animat Group Time To Diarrhea''time 'fo () ()early' A tire-immune I,.Y only no diarrhea no deaths f3 C'lindamycin. ('. ~li/%ic~ilc. ,(1 hrs .7~) hrs.
prrirnmune I~_Y

(' t'lindamycin. (' c1i/)icilc. immune~.~ I1C5. sG hrs.
I!~Y

i ? Nte:m of seven animals.
I lamsters in the cc>!ntrul ~~roup f1 slid not develop diarrhea and rwtained healthy tlurin_=
the eaperimentai period. hamsters in groups 13 and C' clcvele~peci diarrhcal disease. ;lnti-(.'.
cli/Jicil~~ l;~Y' did not protect the animals from diarrhea or death. all animals succumbed in the same time interval as thc~ animals treated with preimmune ls_Y. Thus. while immunisation ?() with whole ur~~anistns apparently can improve sub-lethal wnnptoms with particular hactcria (sre IJ.S. Patent No. 5.()80.89 to li. Tukc>ro). such an approach clous ncn prays to he productive to protect against the Itahal el'tects of ('. cli//iculr.
CXAMPL(: 3 Production ol' ('. hml~linunr Type l~ AtttItV\IIt In urns i(1 Itt order to determine whether antihodies could be raised against the toxin produced by clostridial pathogens. which would he effective in treatine clostridial diseases, antitoxin to ('.
hrr~ulinrrm type n toxin was produced. This example involrs: la) toxltt nloclllication: fh) immunization: (c) antitoxin collection: td) antigenicim assessment: and (e) assay oi~ antitoxin titer.
->0-Toxin Modification ('. hmulintrrrr type A toxoid was obtained from B. R. DasGupta. From this, the active ype r1 neurotoxin (M.Vf. approximately ISO kD) was purified to greater than 99% purity.
according to published mclhods. [E3.R. DasGupta & V. Sathvamoorthv. Toxicon.
?'':41 ( 1984). J The neurotoxin was detoxified with formaldehyde according to published methods.
~ 13.R. ~ingtt &: fi.R. Das(upta. ~l~oxicon. 27:40; ( 1989). ~
ti) Immunization ( ~ hwtrlhrtrm toxoid for immunization was dissolved in PBS ( 1 ms'iml) and was IU rmulsitietl mith an approximately equal volume of C'FI1 (CiIE3C()) for initial itttlnunization or I1 ~'1 liar hcmster immunization. ()n day iero. two white Ieghorn hens.
«htaincd from local breeders. were each injected at multiple sites (intramuscular and subcutaneous) with l Inl inactivated toxoicl emulsilied in 1 ntl C'F:1. ~ubsequrnt booster IIttItllllll7iltt(tltS ~lCr~ IttaCle :1(:ehl'Cillt;' Ict the 1C11111N'InL :iCltedule tC)r dal' Ctt~ InIeCtl(tn alld t(1x(IICI aItlOUlll: CIa1'5 1-~ :111d ~ l -().; my: clay ! 71 - U.7~ m~~: days .i94. 401. 409 - U.?j mg. t)ne hen received an additional h(x~strr c~i~ U. I sU ntg on day i4-4.
c) .Antitoxin Collection ~I~mal yolk immunogiohulin (l~~y) was extracted as described in Fxantplc 1(c) and the ~() I~'1'' hcllrt was dissol~~cd in the oriLinal yolk volume of PF3S whit thinterctsctl.
cl) :lnti~cnicity Assevsmcnt 1:~';_s were collected t~roln day 4U9 throus!h day 4? i to assess whether the toxoid was sui~licicnllv immunogenir m raise antibocd. L:ggs from the two hens v<crc pcu~lcd and antibody was collected as described in the standard PL:G protocol.
~I~xat11p1C~ l(c).) :~IttILI'.111CI1~' ol' the botulinai Ioxllt was assessed on Western blots. -fhe I ~0 kI) detoxif led type :1 ncuroto xin and unmodified, toxic. ;UU kD hotulinal wpe r1 complex 11(1x111 llscCt tbr Intragastric route administration liar animal gut neutralization experiments:
see E-:xample (i) were separated c>n a SDS-pe~tyacrvlamide reducing gel. The Western hlen technique was pertormecl according to tht: method ctf 'rowhin. [l 1. '1-owhin m ul.. I'roc.
Natl. :lead. Sci.
- l'~.~1. 70:~43iU ( 1979).f 'I~cn Et~~ samples W ('. hnlulirttun cntnplex and toxoicl were dissolved in SDS reducing sample buffer ( I % ~I)S. 0.~% 3-mercaptocthanol. ~0 mMt 'I-ris. pL 1 O.R. I U'%
;:lycrvl. 0.()?5% w/v hromphem'l blue. IU% [3-ntercaptoethanol). heated at ~)5°C tier lU ntin _ jl _ and separated on a I mm thick ~% SDS-polyacrylamide s:el. [ K. Weber and M.
Ushorn."Proteins uncl ,Suclium Uode~cvl .SulJute: Aloleculcw l~l~'c.~i~~Mr DeeermincrtirnT rrn Polvcrcr.vlumiclc (ieLwnul Relcrrccl >'rr~ccclurc~.s." in The I'rnrein.v. 3d Edition (1-I. Neurath ~
R.L. Ilill. eds). pp. 17c)-??a, (Academic Press, NY. 1~)7j).~ fart of the yf was cut oFf and the proteins Were stained with Coumassic l3lu e. ~l~ite proteins in the rcrnainder of the gel were transferred to nitroceilulosc using the Milliblot-SDE electru-blotting system (Millipore) according to manuf'acturer's directions. The nitrocclluluse was temporarily stained with I()'%
I'cmceau ~ [5.13. ('arroll and A. l.aughon. "I'I'rJCIIlL'rl(lr7 Crr9cl I'rrl'I~rC'Urlrll? r)I I'()h'C'hJl7ClI
.~I mihuclic~.s rrr Ihc~ fvnrri,snr .S'c~~~nrcnrr ry ,Q-,ycrluclu.siclcr.se Irtr.viurr I'rrm~in.v. " in DA;-i ( 'lur7ira,sw .~t lU !'rcrrticorl .Ilyruuch. Vol.lll. (D. Glover. ed.), pp. 89-1 1 1. IRL.
Press. Oxford. ( lc)H7)] to visualize th c lanes. then destained by running a gentle stream ctt~ distilled water over the blot for wveral minutes. ~l~hc nitrocellulose was immersed in t'13~ containing i°/~ f3SA overnight at -1°(' m block any rcmainin g protein binding sites.
The blot was cut into strips and each strip was incubated with the appropriate primary is antibody. 'l~hr avian anti-('. hrrtulinunr antibodies [described in Icl) and prr-immune chicken antibody (as control) were diluted (:l'_'~ in 1'135 containin!~ t mgiml 13W1 for ? hours at room temperature. I llc hleris were washed with two chin ges each of large volumes ol~ 1'I3S. I3tiS-~fween and I'R5. successively ( 10 minlwash). Ooat anti-chicken IgCi alkaline phosphatasc cun,jugatcd secondary antibody (fisher L~iutech) was diluted l:sl)() in I'I3~
r(111talttltti 1 mLiml '_'U 131A and incubated with the blot for ? hours at room temperature. -l~he hlcns mere washed with wu changes rash h~ large volumea of PISS and L313S-~I'ween. litllowed by ane chanLe of I'I3S anti U.1 lit Tris-! tt:'I, pli ~).~. Riots were developed in f~rcshlv prepared all:alinc phusphatasc substrate hut'fer t l()U It~_/ml nitrobiue tetrazolium (5irma).
51) Etgiml ~-hronu~-~l-chloro-;-indolvl phosphate (sigma). s mM Mg(:'l, in i() mM Na,('t).. pl-1 c).s).
?~ -I'he Western blots are shown in E~igure I. 'l~he anti-(' honrlinrrm I~~Y
reacted to the toxuid to ~~ive a broad intlnunoreactivc hand at about I~i~-1 ~U kD un the reducing ~~cl. ~I-his tuxoid is rd~ractive to disulfide cleavage by reducing a~ucnts due to litrmalin crosslinking. The immune l;~Y reacted 45'ILIt lltl,' aCtll'e t()x111 (:Untplex. a 97 kU (' hn~trlirarrnr type A heavy chain and a ~s kD light chain. The preimmune: Iglr' was unreactive m th a ('.
hurrrlinrrnr compirx or ;(> toxuicl in the VI%estern blot.
-S?-c) Antitoxin Antibody Titer The tgY antibody titer to C'. hmtrlinlrm type A to~;oid of~ e~~s harvested between day -I()') anti ~4? ; mas evaluated by I:LISA, prepared as tiillows. Ninety-siv-well Falcoli pro-bind plates were coated overnight at ~4°C with lU0 Etl/well toxoid [I3.R.
Singh & R.R. Das Ciupta.
~fmicutt _'7:-tU_; ( 198~))~ at 2.~ ttg/ml in I'IiS, pH 7.~ containing ().005%
thilnerosal. 'the li~llowin;~ day the molls were hlockcd with PI3S containing ( % BSA for 1 hour at 37°C'. The I~~Y from immune or prcimmunc eggs was diluted in PBS containing I"a BSA and 0.05°/.
~1 »mn ?0 and the plates were incubated for 1 hour at i7°C'. 'I he plates were washed three times Svith PISS cctntalnlng 0.0>% Tween 2U and three times with PBS alone.
~111caline lt) phosphatase-conjugated :oat-anti-chicken Ig(i (Fisher t3iotech) was diluted 1:760 in I'I3S
containin~~ I ~~,~~ fiSA and O.Oa°/> T~wen '_'0. added to the platys.
and incubated l hour at 37°C'.
l~hc plates were washed as before, and p-nitrophenvl phosphate (Sigma) at l mg/ml in 0.()5 M
\a,('();. pf-i c).s. If) m~-1 MgC'I, was added.
l~ltr results arc shown in higurc ~. C'Itleketl5 11111t1111t1Zed with the te~xoid generated I ~ hi~~lt tit rs o(~ antihW y to the itnmunogcn. Intportantlv. c~_~s from lltltll 1111111111t1Z.ed IteltS had ai;_nificant anti-imlnuno~mn antibody titers as compared to preimmune umtr«I
eggs. t~hc antl-(' hrmrlirrrrnr I~~l' possessed si~~nificant activity. to a dilution ctl~
1:03.750 c>r greater.
EXAMPLE .t '() I'rcparation ()h Avian L:g~~ Yolk Immunoglobulin In An Urally Administrahlc form In orcler to a(IIttIItIStl:l' avian IgY' antibodies orally !() eXllel'1I11CIllal mice. an et~fcctivr drlivery lormula lur the I~~1~' had to hr determined. The concern was that it' the crude l~_1' was dissolved in I'I3S. the saline in I'BS would dehydrate the mice. which might prove ' Iwrmf~ul over the duration oh the study. Therefore. alternative methods ol' oral administration of I~~Y wore tested. The example involved: (a) isola-lion ot~ immune IgY: (h) soluhilization of 1~~1~' in water or I'BS. includin~~ subsequent dialysis of the IgY-E'BS
solution with water to eliminate or reduce the salts (salt and phosphate) in the hut'f~r: and (c) comparison ot~ the c)uantity and activity of~ recovered IgY' by ahsorhance at ''8() nm and 1'Atif:, and enwmc-;l) linked immtlnoassav (ELISA). .
_ j; _ a) Isolation Of Immune IgY
In order to investigate the must effective delivery formula for lgY, we used IgY which was raised against ('rnrcrlrr.s clrrri.vcrrc mrr-i/icrr.v venom. Three eggs were collected from hens immunized with the ('. chn-i.c.~ur.s rc~rnijicu.s venom and 1gY was extracted from the yolks urine the moctitied ('olson procedure described by Tltallev and ('arroll ~fiio/'I'echnologv_ . 8:r)3~1-9;g ( I~)9())~ as described in Example t(c).
Chc egg yolks were separated from the whites. pooled. and blended whit titer volumes of 1'I3~. I'owolered PECi 8()O() was added to a concentration of 3.>'%a,. The mixture ~~~as centrifuged at l0.()UO rpm tits 10 minutes to pellet the precipitated protein.
and the I() wpernatant was filtered through cheesecloth to rename the lipid layer.
!'owdered PI:G 8f)()U
was added to thr supernatant to bring the: tinai I'ECi concentration to I?'%
(ussunnng a I'FG
concentration oh 3.5'ra in the supernatant). 'hhe 1?% f'fai/l~~l' mixture was divided into two ~cpal w~lunms and centrifuged to pellet the IgY.
h) ~uluhitizatiun ()f The I~;Y In Water ()r 1'B~
()ne pellet was resuspendcd in 1!? the original yolk volumr oi~ I'I3~, anti the utlmr pellW was rrsuspended in I /'' the original yolk vole me of water. -I'he pellrts were then centrifuged to remove any particles ctr insoluble material. ('hc I~~1' in 1'1W
wlutic~n dissctl~ed readily hut the traction rcsuspended in water remained cloudy.
-'() In order to satisfy anticipated sterility requirements fits orally administered antihctdies.
the antibody solution needs to he filter-sterili7cd (as an altcrnativr t« brat sterilization which would cirstrctv the antibodies). I'hc preparation oi' IgY rcsuspended in water mar tcto rlctudv_ m pays throu~_h either a ().? ur ()..~; ym membrane filter. set 1(1 ml e,l~
thr 1'i3~ rrsuspcnded fraction was dialyzed overnight at room temperature against ''st) ml ctl' water. 'I'lte tullcwvin~_ morning: the dialysis chamber was emptied and rclilled with '_s() ml of fresh 11.( ) titr a second dialysis. 'thereafter. the virlcis oi~ soluble antibody were cletcrmined at ()I~_~~~ and arc compared in fable 7.

WO 9810$540 PC'T/US97115394 nNns.n~om.n !1f L.V v:_i_u nr __ __ ..~... .... ..w.cms Fraction Absorbance OC 1:10 Dilution At 380 nm Percent Recoven~

f'I3S cJiasolvecJ

1.149 100io II_(> dissolved 4.746 61ro J'E3~ dissolved:'!-I
O dialyzed : 4.885 77/,.

R esuspcnding _thc pellets in PBS Ibllowed by dialysis against water recovered more antibody than directly resuspendin'~ the pellets in 'eater (77°/"
versus tit%). Lquivalent It) volumes ol~ the l~.:lr' preparation in 1'BS or water 'were compared by PAGE. and these results "err in accordance with the ahsorhanec values (data not shown).
cl :~ctivity ()f I~1' Prepared With Different solvents :1n 1:1.1:1 way perlormed tc~ compare the binding activity ut~ the 1gY
catracted by etch prctccdure described aho'°c. ('. (hrl'r.''.S'lr.S' rerni/ictr.s (('.cl ~. ) venom at ?.i Itgiml in I'!iS
was used t« ecru each well ui' :t ~)(-'yell microtiter plate. ~l~ltc rcntaining protein binding sites were hlocl:ed with I'BS containing ~ ntg/mi BSA. Primary antibody dilutions t in 1'(3~
containing.: 1 mgitnl I3'~~~1 'mre added in duplicate. Alter ? hours of incubation at room temperature. the unbound primary antibodies were removed by 'vashiny the wells with I'BS.
13I3S-T'vcen. and I'I3S. The species specific secondary antibody (goat anti-chicken immunoglohulin alkalim-phosphatasc conjugate (Sigma) was diluted 1:760 in ('BS
containinL
m;;!ml F3S.~ and added to each 'veil of the microtiter plate. After ? hours ul' incubation at' room temperature. the unbound secondary antibody 'vas removed by 'washing the plate as hciitrr. and t~rcshly prepared alkaline phosphatase substrate (Sigma) at 1 cg/tnl in ;0 mIV1 Na,t'(J;. IU mlvl MgC'1,. pIl c).s was added to each well. ~I~Itc color development was measured on a Vynatcch MR 7UU Inicroplate reader using a X12 nm filter. ~I~hc results are S11()1''tl 111 ~I~ablc 8.
'I'hc binding assay re.°sults parallel the recovery values in Table 7.
with 1'135-dissolved t;~Y shmving slightly more activiy than the PBS-dissolvedll I:O dialyed antibody. The water-dissolvcd~ antibody had considerably less binding activity than the other preparations.
-5~-WO 98I~540 PCTlUS97115394 Survival Of Antibody Activity Atter Passage Through The Gastrointestinal Tract In order to determine the feasibility of oral administration of antibody. it was of~
interest to determine whether orally administered If:Y survived passage through the ~_astrointestinal tract. 'rhe example involved: (a) oral administration of specific itntnune antibody mixed with a nutritional formula: and (h) assay ohantihodv activity extracted from i~cces.
TAI3L,E 8 ) () Anti~scn-I3indine Activity Of' I_Y Prepared With f)ilierent lolvrmc Dilution t'reimmune I'EiS DissolvedILO Dissolvedt~HS~I~.() I :5(1(1 (LUUS I .748 I .577 1.7.t?

1 :_'.sU(1 (1.U(14 0.644 !)..i4~J U.G(16 I : I'_.5(l(1(I.UU I U. 14.i U.U54 tLU~)U

I :(,?.5()U U.U01 (LU25 t).UU7 U.UIh I : : I ?,5()(1U.U I 0 U.(IUU I).IIUU U.()U?

:v) Oral Administration Of Antibody hhe I~Y preparations used in this example arc the some 1'IW-dissolved/1-i.(>
dialv~cd ?() antivenom materials obtained in Exampic ~t above. mixed with an equal volume et' 1:11tat1111~sr'.
l~wc, mice were used in this experiment. each roct:ivin~ a dilli:rcnt diet as t~ellwvs:
) > water and ii~o~l as usual:
f immune IzY Preparation dialyzed against water and mixed I : I with lntamil~N
.
(.fhe nlll:e ~~t'.r~ given the corresponding mixture as their only source of li)od and water).
~J
b) Antibody Activity After Ingestion ~ll~tcr both mice had in~csted their respective lluids. each tube vyas refilled with approximately IU ml of the appropriate tluid lirst think in the murnin~. 13v mid-morning there was about ~l to s ml of liquid Icft in each tube. At this point stool samples were sU collected troth each n )ouse. weighed: ~llld dlSSUIVCCI in approximately s0() Etl I'BS per lUU mg stool sample. Une hundred and sixty m~~ of control stools (1u~ antibody) and c)c) m~ of .
experimental stools (specitic antibody) in 1.5 ml micrefut~c tubes were dissolved in 8U() and sUU Etl pEi~. respectively. ~I~hc samples were heated at 37°C for lU
minutes and vortcxed vi~~urouslv. The experimental stools were also broken up with a narroH
spatula. Mach sample -SG-was centrifueed for ~ minutes in a microfuge and the supernatants. presumably containing the antibody extracts. were collected. The pellets were saved at 3-8°C in case future e~ctracts were needed. Because the supernatants were tinted. they were diluted five-leld in I'BS
(a111talnltl~_ I mg/ml 13SA for the lllltla) d11U11011 It1 the eIIZYITIe 11111T1U170dSSa1' (FLISA). The primary ewracts were then diluted five-tbld serially from this initial dilution. 'l~he volume of primary extract added to each well was 190 ~tl. The ELISA was performed exactiv as - ~Icscribtd in Eaatnple -I.

SpecIIlC Allllt)O(tv ACtivitt Allr~r t~wcc~.rN 't'hr.,...,~. TI,., i-.,.....~:.....-. .__~ .~.
1 Dilution 1'reimmune IgY . ...__ ...
t) Control Fecal L:XP. Fecal Extract Extract I : ; t) c l.o()o U.U3..

I:_'s O.UI(> ~ 0 U.UIG

1: I'_; U 0 U.00~) I :6_'; U
f ).OOS U.()1) I

I a .~ i ~: r) t) u.oou ~

-hllere was some active antihc~dy in the fecal extract I'!'Olll the llll)llSe given the specific amihmiy in (~:nfatnil )i: ti~rmula. but it was present at a very low level.
~incc the samples were assayed at an initial I:s dilution, the binding observed could have been higher with Icss dilute ?0 samples. ('onseducntlv. the mice were allowed to continue ingesting either reLUlar li>od and water ur tlm specific 1~'Y' in Enfamil k: li)rmula. as appropriate. so the assay could be repeated.
~\noth~r l~:l.l~n plate was coated overnight with i tlg/ml of ('.cl.r. ICIlOn1 111 I'I3S.
~I~I~r I~uilowin~~ nu~rnine the I::I_lW 1 plate was hlocl:ed with ~ m~~inil (3W \. and tl)e fecal samplrs wrrc extracted as hetbre. except that instead of heating the extracts at ,7°C, the samples were kept on ice to limit proteolysis. The samples were assayed undiluted initially.
and in sX serial dilutions thereafter. Otherwise the assay was carried out as before.

SpCCItIC Antibody SLIrVIVCS Passa«e 7~hrnmnh Tlra r:~crrn:nro~r:....1 T...._.
.. ... ..__.
Dilution t'reimmune IgY Control Extract i:xp. Extract undiluted U tl . 0.379 I : i - () tl U.07I

I :? i O.OOU 0 U.U?7 I : I ?; U.UU3 U.U 17 I :6? i U.U()() tl U.U08 1:31 ? S U.OU3 U.OU_ The experiment confirmed the previous results. with the antibody activity markedly higher. the control fecal extract showed no anti-('.cl r. activity. even undiluted. while the fecal extract t~rom the: anti-('.cl. J. I~;YlFntamilcH:-fed mouse shoNmd considcrahlc anti-('.cl r.
activity. ~fhis experiment (and the previous experiment) clearly demonstrate that active l~sY
I~ antihocly survives passa~~c throu~~h the tnousc digestive tract. a finding mith l;tvorahlc 1111plICal1(lllS tier IhC StICCeSS Ot~ t~~Y antibodies administered orally as a tlzeraprutic or prophylactic.
CXAMPLI? 6 :'-() Ire t~'ian ~ieutrali~ation ()f ~I~vpc ('. hurrrlirrrnn I'vpc A Neurutoxin 13y nvian Antitoxin nntihodv ~t'his example demonstrated the ability oi~ E'E:(.i-purifi~cl antitoxin.
collected as described in Fxampic i. to n eutralizc the lethal el~icct oi~ ('.
hrurrlirrrrnr neurotoxin type ~1 in :'.> mice. ~E~o determine the oral lethal dose (I.DICItl1 al~ toxin n. groups ol' E3.'~1..E3/e mice were ~~iven different doses ot~ toxin per unit body weight (average body weight ot~
'_'-3 ~~rams). l~or oral administration. toxin A complex. which contains the ncurotoxin associated with other non-toxin proteins was used. This complex is markedly more toxic than purified ncurotmin when given by the oral rattle. ~ 1. ()hishi c~J ul.. lntcct. Immun., l 6:1 UO
( I c)77 j. J ( '. hrrJulirrunr :;U toxin type f1 complex. obtained t~n~m Eric .tohnson (llniversitv ()f Vv'isconsin. Mtadisonl was ?~U Etg/ml in :iU mM sodium citrate. pl t >.~. specific toxicity ; x I t)' mouse L.D=,Ilmg with parentcral administration. ilpproximately 4U-~0 ng/gm body Wight vas usually fatal within 48 hours in mice maintained on conventional fiuul and water. When mice vvcre '_iven a diet ucl lihirum of only Enfamil(k) the concentration needed to produce lethality way approximately ?.~ times higher ( 125 ng/gm body weight). Botuiinal toxin concentrations of approximatefv_ ?00 n~:lgm body weight were fatal in mice fed EnfamiiC~ containing preimmune IgY
(resuspended in L;ttfamilu~~ at the original yolk volume).
~T'he oral LDIt", of ('. hvrrrlinnm toxin was also determined in mice that received known a117UllIltS Ol' a mixture of preimmune IgY-Ensure~~t delivered orally through feeding needlrs. t )sing a ?? ~_auge feeding needle, mice were given ?SO )tl each c~f' a preimmunc ' 1~_~'-f:nsure~n mixture (preimmune 1gY dissolved in ll4 original yolk volutnc) I hour before anct I.''_' hour and ~ hours after administering botulinal toxin. ~l'oxin concentrations given orally ranged ti-om approximately 12 to 312 ng/gm body weight (0. ~ to 7.5 ~tg per mouse).
1() liotulinal toxin conttplex concentration of approximately 40 nglgm body weight ( 1 Etg per ntousc ) was lethal in all mice in less than 3( hours.
f wo ,rrULIpS (t I' BALI3/c mice. 1 () per group, were each given orallyl stt7Lie (lose l1(~
y~_ oacl) ul' hmulina! toxin complex in I()0 Etl of ~0 tnM sodium citrate pl-1 i.;. 'fhe mice r~cciveci ?sU )tl treaunents of a mixture of either preimmune or immune l~~Y
in f:nsurc k. ( I!4 I ~ c~ri4=foal wlk molume) 1 hour before and 1!? hour. 4 hours. and 8 hours alter botuiinal toxin administration. The mice received three treatments per day t<tr m'o more days.
The mice wcrr cthscrucd tier ~)(~ hours. The survival and mortality are shown in 'fable 1 1.
TABLf. 1 I
Neutral vat inn ()f IW rulin;rl ~f'~,.~n, n ~~> n;,.,.
I uxin 1)usr nntilx~dy~ Type Number Number ()f' Mice n~ ~~m W f' Mice Alive Dead .1 t .h nun-immune tt ! 0 -ll.t, ;uui-hutuliml Itl toxin :111 mice treated with the preimmune IgY-Fnsureu mixture died within 4O huurs post-toxin administration. The avera~~(: time of death in the nucc w'as J? hours post toxin administration. '(~r(:atments of preitnmune I~;Y-Ensur(:ii3:~ mixture did heft continue: beyond ?4 (tours due to extensive paralysis of the mouth in mice of this group. In contrast, all ten micr treated with the immune anti-botuiinal toxin IgY-Ensureu mixture survived past ~)(~ huurs.
Only 4 mice in this group exhibited symptoms of botulism te)xicity (two ntice about ? days 3() after and two niice ~4 (lays after toxin administration). Tltese mice eventually died ~ and (~
days later. Six at' the mice in this inttnunc group displayed no adverse effects to the toxin and remained alive; and healthy long' term. Thus. the avian anti-botulinal toxin antibody dctnonstrated very good Itrotcciictn froth the lethal cl'tects of the toxin in thr experintcntal mtcc.
-~9-Production Uf An Avian Antitoxin Against ('ln.wriclirrm cliJ~icile Toxin A
Toxin A is a potent cyotoxin secreted by pathoctcnic strains of l '.
cfiJ~icile~. that plays a direct role in damming gastrointestinal tissues. In more severe cases of ('.
clij)icile intoaicati~n. pseudomembranous colitis can develop which may he fatal. 'This would be prcuented by neutralizing the effects of this toxin in the ~!astrointestinal tract. As a first step, antihculies were produced against a portion of the te)xltl. The e~camplc involved: (a) conjugation ol' a synthetic peptide of toxin A to bovine serum albumin: (h) immunization of Itl hs_~ns with the peptide-f3SA conjugate; and (c) detection of antitoxin peptide antibodies by L:I.ISn.
a) Conjugation Of A Synthetic Peptide ()f Toxin A 'fo I3ovinc scrum Albumin is The synth ctic peptide (.'Q'FIDGhItYYFN-Nli, (~I:(~ II) N():8?) was prrpared tunumrciatlv (Multiply Peptide ~ystcms. San DieLC~. ('A) and validated tc~ he -Rtf% pure by hieh-pressure Liquid chromatoLraphy. The eleven amino acids ti~llowivg thewstcinc residue rcpresmt a consensus sequence of a repeated amino acid sequence t'ound in 'I
«xin A. ( Wren cv ul.. Infect. Immun.. s9a I S 1-3165 ( 1991 ). ~ -("he cvsteine was added to facilitate ?() u~n_jyatiem to carrier protein.
In order to prepare the: carrier fir conjugation. 135n (sigma) was dissolved in U.()I M
~iaP(),,. pll 7.U to a final concentration of?U I17L/ll7l and n-maleimidohcniovl-~-hydroxvsuccinimide ester (ME3~: 1'iercc) was dissolved in N.N-dimcthvl ti,rn,~unidc to a c:OIICW tfalti111 t)f i mgiml. Ml3S solution. U.SI ml. was added to s.?5 ml of the E3SA solution and incubated tar i() minutes at room temperature with stirring cwrv >
minutes. The MIiS-activatcd E3~A was then purified by chromatography on a E3io-(iel P-IU column (I3io-Rad: 4U
ml bed w,lume) equilibrated with sU mM NaPU,. pIl 7.U buffer. I'cak fractions were pooled (h.0 mll.
I.y~philizc:d toxin n peptide (?U mL) was added to the activated 1~5A mixture.
stirred ;t) until the peptide dissolved and incubated , hours at room temperature.
Within ?t) tninutcs.
the rcacticm mixture became cloudy and precipitates ti~rmc~l. Al'tcr ; ht~urs.
the reaction mixture was ccntritueed at 1().U()U x g for 10 min and the supernatant unalyicd for promin C(111tCllt. No significant protein could he detected at 28U nm. The copu~.:atc precipitate was - GU -washed three times with PBS and stored at 4°C. A second conjugation was performed with 15 m~_ of activated BSA and 5 mg of peptide and the conjugates pooled and suspended at a peptide cc~nccntration ul' 10 mg/ml in 10 mM Nal'O;. pH 7.?.
b) immunization Of Hcns With Peptide Conjugate 7~wo hens were rich initially immunized on day zero by injection into tmu - suhcutaneuus and w~u intramuscular sites with l mg of peptide; conjugate that was emulsified in C'F:1 (G1BC()), 'hhe hens were boosted on day 1~ and day 21 with 1 mg of peptide conju~,Ite cmulsificcE in IFA ((_iIBC'U).
Detection Of Antitoxin Peptide Antibodies By CLISA
E~~~' wars purified tram two e~.:gs obtained before immunization (pre-immune) and two y_~~s obtained 31 and _,'? days after the initial immunization using PECi E~ractiunatiun as drscrihrcl in E:xamplc I.
Wells of a c)h-well microtiter plate (Falcon 1'ro-Bind Assav Plate) were coated 'wcrlti~~ht at ~i°(' with 1l)() pglml solution ul' the toxin A
synthetic peptide in I'E3S, pH 7.'_ prrparcd I,v dissulvinL I m~! of the peptide in I.U ntl ui' H,U and dilution of 1'IW. 'fhe prc-immunc anti immune IgY preparations were diluted in a live-fold series in a buffer containing I';~r I'IC~ ROOU and 0. I % ~~wecn-?0 (viv) in PE3S, pl-I 7.'_'. The wells were blocked for '_' ?() hours at roam temperature with 1 SO Etl u1' a solution containing :i"/o (vlv) ('arnatiomk: notttat dry milk and 1'% PECi 8000 in PBS. pll 7.'_'. After incubation for ? hours of rnr,r"
temperature. the wells ware washed. secondary rabbit anti-chicken l~C-alkaline phusphatasc I 1:7;(1) ctddcd. the wells washed tlLillll and the color development obtained as described in l~:xampl~ i . ~l~hc results arc shown in '~ahle 1?.

Re:fcliviW ~ llf' lov lUnh T'.,..:., n,._.:.i..
_ _...... . _r......
Dilution Uf I'EG Prcp Absorbance At alU
nm Preimmune Immune Anti-I'epcidc t : I o0 0.o I .~ n's I : aoo o.o(Ia cl.u ;~

y() I :~~oo 0.004 u.oo>

Clearly. the immune antibodies contain titers against this repeated epitopc of toxin A.

t'roduction Of Avian Antitoxins Aeainst ('lu.sn'iclitcm cliJJicile Native Toxins n And R
l~o determine whether avian antibodies are ef'f'ective for the neutralization of ('.
eIiJJicilc toxins. hens were immunized using native ('. cliJJicile~ toxins A
and E3. The resulting egg yoil: antibodies were then extracted and assessed for their ability to neutralize toxins A
and 13 in virrn. The Example involved (a) preparation of the toxin immunogens, (h) immuniTation. tc) purification of the antitoxins. and (d) assay of toxin neutralization activity.
a) I'reps>tration Of The Toxin Immuno~;enr l3oth C'. cliJJiril~ native toxins r1 and 13. and ('. cIiJJicilr toxoids.
prepared by the:
treatment of~ the native toxins with formaldehyde. were employed as immunogens. ( ~. diJJirilc~
toxoicls i1 and 13 were prepared by a procedure which was modified ti'om puhtished methods Il;hrich r~ crl.. Infect. lmmun. ''B:lU~1 (1980). separate solutions lin Pfi~) oi'native c' cliJJioile~ toxin ~\ and toxin !3 (Tech Lab) were each adjusted to a concentration of U.?U mgiml.
and formaldehyde was added to a final concentration of 0.4'%. I~he toainitornlalcdhvdc solutions mere then incubated at ,7°C' 1i)r 40 hrs. Uree formalclchvde was then rcmovml From the resulting toxoid solutions by dialysis against I'1W at 4°C'. In previously published reports.
:?() this dialysis step was not performed. Therefore, I~rce formaldehyde must have been present in their toxoid preparations. 'I~he toxoid solutions were conccntraW d. clslllg a C'mtriprcp c:onccntrator unit (Amiconl. to a final toxoid cc)ncentration ul'~.() mginll.
I~h~ uvo r~sultin~_ preparations were designated as toxoid A and toxoid 13.
l '. cliJJirilc~ native toxins were prepared by concentrating stock stlllltl()!ls ol' twin :1 and .''_s toxin 13 l~I~rch L.ab. lne). using ('cntriprcp concentrator units llmicon?. to a final CUlleelttl'atlUll ()f 4.U ntglml.
h) Immunisation .l..llc f first Uvo immunizations were perti)rmed using the toxoid n and toxoid 13 sU immuno;;cns described ahoy e. r1 total of i different immunisation combinations were clnploved. I~or the first immunization group. 0.? m1 of toxoid n was emulsified in an cclual volume of Titer- Max adjuvant (t'vtRW. 'biter ~9at was used in order to conserve the amount Ut' 1111111unUgell llSed. allCi t() ~Illlpllf~' the Inlmllnl7at1U11 prUCedtll'e. TI1I1 1It11t1t11117atIUl1 gt'Ullp _ ()y _ *rB

was designated "CTA." F'or the second immunization group. 0.1 ml of toxoid B
was emulsified in an equal volume of Titer Max ad.juvant. This group was designated "CTB."
For the third immunization group. 0.? ml of toxoid A was first mixed with 0.2 ml of toxoid f3, and the resulting mixture was emulsified in 0.4 ml of Titer Max ad_juvant.
This croup was clcsignatcd "C'TAI3." In this way. three separate immunogcn emulsions were prepared, with eaClt trtllUISIUII COnIaltlln~l, a final concentration of 2.0 mg/ml of toxoid A (CTA) or toxoid B
' (C'TI3) or a mixture Ut~?.0 mg/ml tuxuid A and ?.0 mg/m) toxoid B (C~I~AB).
( )n da>' (). 1~'hite I.eghorn hens, obtained from a local breeder. were immunized as tullowv: Group CTA. l~aur hens were immunized. with each hen receiving ~OOl.tg of toxoid :1. via t«o intramuscular (l.M.) injections of 50y1 of C7'A emulsion in the breast area.
Group CTI3. ()nc hen was immunized with 200ftg of toxoid B, via two l.M.
injections of sOEtl ut~ C~~~I3 emulsion in the breast area. Group CTAB. Four hens were immunized. with each llcn receiving a miwurc containinu 200yg of tuxoid A and ?UUty of toxuid I3. via nsw !.'\1. In.lccaons «t' lOOftl of C'1~AR emulsion in the breast area. The second inununizatiun was t~ prturmccl i weeks later, on clay .i5. esactlv as described for the first immunization above.
!n order to determine vyhcthcr hens previously immunized with ('. clijjirile toxoids could tc,lrrate whseclucnt !master immunizations using native toxins. a singly hen i~rom croup C'~1~;11~ vy;r.s immunized lur a third time. this time using a mixture of the native twin A and Ilatl\'t twin L3 described in section (a) above (these toxins were not formaldehyde-treated. and '-O were us~cl in their active form). This was dam in order to increase the amount (titer) and al~tinitv c,l' snecitic antitoxin antibody produced by the hen over that achieved by It111171.It1IZltlg with tmuids only. ()n day (~?. 0. I ml of a toxin mixture was hrcpared which contained ?O()u~~ of native toxin ,~ and ?OOEt;~ of native toxin Ci. 'l~his toxin mixture was then umulsilicci in ().1 Inl of ~l~itcr A~av adjuyant. /v sin~te C'~('ALi hen was Ihell InlIllUnl7ed will '_5 the rl'Sll11111L Illlnllt110i!ell enll.Il510n. via two I.M. injections of 100y1 each. into the breast area.
~fhis hen was marked with a wine band. and observed fey adverse effects fur a period oi~
alproxitnately I week. after which time the hen appeared to be in ~~oud health.
I3ccause the C~I~AIi hen described above tolerated the booster immunization with native toxins A and (3 with no adverse; effects. it was decided to boost the rcmainine hens with ?() native toxin as well. ()n day 70. booster immunizations were performed as follows: (Group CTA. :\ 0.? ml volume ol~ tire ~4 m~.:iml native toxin A Sl>Illtl()n wilS
1I11lIlSltlcd in an equal volume of Titer Mas adjuyant. f:ach of the ~ hens was then immunized with-'?0()Etg oi' native toxin A. as described for the tuxoid A immunioations above. Group C_'T13. r1 s0~r1 volume WO 98108540 PCTlUS97/15394 of the ~t mg/ml native toxin B solution was emulsified in an equal volume of Titer Max adjuvant. ~I'lte hen was then immunized with ?OUEtg of native trnin E3. as descrihcct for the toxoid R immunisations above. C;soup CTAB. r1 0.1 i mI vulutne of the 4 mg/tnl native toxin A solution was first mixed with a U.15 ml volume the ~1 mg/ml native toxin E3 solution.
The resulting toxin mixture was then emulsified in 0.3 ml of Titer Max adjuvant. T'he .s retnaining hens (tJtc hen with the wing band was nut immunized this time) were then intmuniied with ?UUEtg of native toxin A and 2UOEtg of native toxin ii as described liar tile tuxoid ~1-T tuxoid E3 immunizations (( TAf3) above. ()n day 8~, all hens received a second booster immunization using native toxins, done exactly as described ier the first boost with 1 t) native toxins above.
111 hens tolerated both booster immunizations with native toxins with no adverse ul~fccts. :1s previous literature references describe the use of f<trmalcichvd e-treated tuxoids.
thin is apparently the lirst time that any immunizations have been performed using native ('.
cIiJJic~ilc~ toxins.
I
c) Purification ()f Antitoxins E:~.:;_s were collected from the hen in group ('TR 1 ()- I ? days ti~lluwing the second immuniiatiun with toxoid (day .;~ immunization described in section (h) ahuvel. and i~rom the hms in ~~ruups C'T~1 and C'TAE3 2U-21 days following the second immunization with toxoid.
?U 1-v horsed us a pre-immune (negative) control. eggs Were aIS() C(tIICCted 1ro11t ttlltrttItlLIItIGC(~
hens from the same Clock. E:gg yolk immunoglohulin ( IgY) was extracted t~rctm the ~4 groups ul~ cgzs as described in Example ) (c). and the final Ig~' pellets were suluhilircd in the original yolk volume u1' 1'(3~ without thimcrosal. lmnurtantlv. thimerusal was ewlmi~~~i because it would have been toxic to the ('f-IO cells used in the toxin ncutraliration assays described in section (d) below.
d) Assuy Of Toxin Neutralization Activity l he toxin neutralization activity al' tire IgY solutions prepared in section (c ) above was determined usinL an assay system that was modified from published methods.
~F:hrich m crl..
;() Infect. lmmun. ?8:1U41-lUd; (lc)c)2): and Mc(iec rr «!. Microh. Path.
I_':3;i-;41 (It)t)2).l As additional controls, affinity-purified goat anti-('. cIiJJicilr toxin n (~l~cch I.ah) and affinity- -puritied ~uat anti-('. cIiJJicilo toxin t3 ('Inch Lab) were also assayed tier toxin neutralization activity.

The IgY solutions and goat antibodies were serially diluted using F 12 medium (G113C0) which was supplemented with 2% FCS (GIBCO)(this solution will be referred to as "medium" fir the rct~ainder of this W ample). The resuitiy antibody solutions were then mixecf with a standardized concentration ot~ either native ('. cIiJJirile toxin /\ (Tech L.ab), or native ('. cliJJirile toxin B (-Ccch Labl. at the concentrations indicated below. (=allowing incahation at 37°(.' for 6U min.. l UUErI volumes of the toxin ~
antibody mi~aures were added ro the wells o1' ~)f~-wall microtitcr plates (Falcon Microtest III) which contained ?.S x IUD
('hincsu I'IanlSIl',1' Uvary (C'110) cells per wall (the C'I1(~ cells Nrre plated on the previous da_v m allow them to adhere to tltc plate wells). 'the final concentration of toxin, or dilation of I(1 antihuciy indicated below refers to the final test concentration oi'each reagent present in the respective microtiter plate wells. -hoxin reference wells werr prepared which contained Cl-IO
cells and toxin A ur toxin l3 at the same concentration used for the toxin plus antibody mixtures (these vsclls contained no antibody). Separate control wrlls were also prepared which uuntaincd C'f 1() ells and mcdiutn cmlv. The tISSLI~' plates \Vt:Ce lllerl 111Cllhaled t~(7I' I 8-1 ~ _'-1 hrs. iv a ;7°C'. humidified. ~°~" ('()= incubator. On the toilowinp day. the rc:mainin~
adherent lviclhlcl cells in the plate wells were stained LISI11L U.?"/.
crystal violet (Mallinckrodt) Hissc~lwel in "~;~ ethanol. I«r 1() thin. 1~\eeSS 5111111 11'aS then renulvud by rinsin~~ with water.
and tlm stained culls vvcre sulubilized by adding lUUyl of I",a ~p~
(dissc>Ivcd in water) tc each wall. I~hu absorhance of~ each well was then measured at s7(? nm. and the p~rcrnt 'U cytomvicitv ut~ each test sample or mixture va~as calculated tlslllg flee following formula:
% CHO Cell Cytotoxieity = [ 1 - ( _Abs. Sample )~ X 100 Abs. Control (!nliku previous reports which qaantitatc results visually by counting cell rounding b_v microscopy. this Lxamplu utilized spectrophotometric methods m cluantitate the ('. cliJJicile '_'a toxin bioassay. In order to determine the toxin ~1 neutralirin~~ activity of the ('Tn. C'TAE3.
and pre-immune I~Y preparations. as va~ell as the at~finiy-purified l:oat antitoxin f1 control.
dilutions c~f' these antibodies were reacted against a U. l ly~,~ml concentration of native main f1 (this is the approx. s0"/" cytatoxic ciasu ul~ toxin A in this assay svstcml.
~I~hu results arc shown in Ui~~urc .i.
3O C'ompletc neutralization of to\Irl A occurred with the C~1~A !gY (antitoxin A, above> at cfilutions ol~ 1:8() and lower. while significant neutralization occurred out to the 1:320 dilution.
-(i~-WO 988340 PCTlUS97115394 The CTAB IgY (antitoxin A + toxin B, above) demonstrated complete neutrali-ration at the 1:320-I:IOU and lower dilutions. and significant neutralization occurred out to the 1:128U
dilution. The commercially available affinity-purified goat antitoxin A did nut completely neutralize toxin A at any of the dilutions tested. but demonstrated significant neutralization out to a dilution of 1:1.28U. '1'hc preimmune 1gY did not show any toxin A
neutralizing activiy at arty of the concentrations tested. These results demonstrate that Is~~' purified'from c~=~~s laid by hens immunized with toxin A alone. or simultaneously with toxin A and toxin B.
is an cftectiye toxin A antitoxin.
'hhe lOxllt I3 neutralizing activity of the CTAI3 altd hre-IInmLlIte IgY
preparations, and 1() also the affinity-purified goat antitoxin B control was determined by reacting dilutiuns of these antibodies against a concentration of native toxin I~ of U.1 ng/ml (approximately the St)'%, cyutoxic dose o1~ toxin B in the aSSay SySlent). 'I'lte reS11115 art'.
SIl(tl~.'11 IIt I~ieure a.
('omhlcte neutralization of toxin 13 occurred wth Iltc C' I AI3 Ig~' (antitoxin n ~ toxin Ii. above) at the 1:40 and lower dilutions. and significant neutralization occurred out to the I s I :s'_'U dilution. 'I'hc affinity-purified yat antitoxin f3 demonstrated complete neutralization at Hilutiuns ul' 1:64U and lower, and significant neutralization uc;curred trot to a dilution of I:?.shU. The preimmune IgY did pert show arty toxin I3 neutralizing activity at any of the concentrations tested. These results demonstrate that I~~Y purified from c~~gs laid by hens itttntuni~cd simultaneously with toxin A and CUXIn f3 is an eftectiyc toxin B
antitoxin.
'() )n a separate study. the toxin B ncutraliziy actiyiy of C"I'IB. C"1':113.
and pre-itnmunc I~_Y Itreparatictns was determined by reacting diiutiuns uf~ these antibodies against a native main fi concentration of ().1 ttgiml I approxirnatey I UU'% cytotuxic dose ol' toxin l3 in this assay system). The results are shown in 1=i~ure ~.
~i~~niticant neutralization of toxin B occurred with the C'~fI3 Ig~' (anW uxln I3. above) ?5 at dilutiuns of 1:8U and lower. while the CTAB IgY (antitoxin A I toxin fi.
above) was bound tct hays siyiticant neutralizing activity at dilutiuns of 1:40 and lower.
'I~hc prcimmunc IgY
did not show any toxin B neutralizing activity at any u1' the concentrations tested. 'These results dentunstrate that I~~Y purified front eggs laid by hens immunized with toxin I3 alone.
or simultan c:uuslv with toxin A and toxin B. is an el~fectivc toxin f3 antitoxin.
;() -6(~-In oian Protection Uf Golden Syrian Hamsters From C'. cliJficile Disease Rv Aviatt flntitoxins Against ('. cllJ~icilc Toxins A
And D
The must extensively used animal model to study ('. cllJficilr disease is the hamster.
~Lyrly cn «!.. Infect. Immun. =17:;49-35? (19')2).-) Several other animal models for antihionic-inefuced diarrhea exist. hut nc3ne mimic the human lbrm of the disease as closely as the hilrllSter model. ~R. I-clcetv. ".~lnlnru! rtluclc~!.v nJ,~lnrihlunr-lncluc'cc! ('nli~i.v." iu C). Zalc and M. Sande (eds.). L.:rlrcrimertl«! aloclc~Ls ire .9nlintior'nh!«!
('hento~lremcrJy. Vol. ?. pp.(il-72.
1 () ( I c)XW, ~ In this model. the animals are first predisposed to the disease by the oral administration of an antibiotic, such as clindamvcin. which alters the population of normallv-c>ccurrin__ ~~astrointcstinal flora (Fekey. at 61-7?). Following the oral challenge of these -aninutls with viahlc ('. cllJJlc!!r organisms. the hamsters develop cecitis.
and hemorrhage, trlccratiun. and inllammati«n are evident in the intestinal ntucosa. (I.verlv m crl.. Infect.
Itlln1l1I1. -47:_,4')_;i'? ( Ic)gi),~ ~~hc animals become lethargic. develop severe ciiarrhca. and a higlz pcrccnta~c ot~ them die ti'om the disease. ~Lyerly c~r ml.. infect.
ttnmun. =t7:s4')-;j'?
I t c)Si 1. ~ This model is therefore ideally suited fir the evaluation ol' therapeutic agents ~icsi_~ncd li>r the treatment or prophvlaxis of ('. cli~jicile disease.
The ahilii c,f' the avian ('. cliJJlrlIc~ antitoxins. described in L:xample I
shove, to -'(~ protect hamsters ti'um ( ', cliJJic!!e disease was evaluated using the ~iofden 5vrian hamster nuofel cat' ('. c!i/Jicllr infection. The i:xample involved (a) preparation of the avian ('. c!lJJicile antitoxins. (h) in river protection ol'hamsters fiom ('. cllJJic'ilr disease hv_ treatment with avian antitoxins, anti fc) Iun~__tcrm survival of treated hamsters.
a) I'reparution Of The Avian C. rlifjrcile Antitoxins l:~~gs were collected from hens in groups CTA and C'TAB described in Example 1 (b) shove. ~1 o he used as a pre-immune (negative) control. eggs u~erc: also purchasedfrom a local aupcrmarl:m. I:~~g yoll: immunu~~lohulin (f~:Y) was extracted ti'om the i ~~roups of r~_«s as described in f;xample 1 (e). and the final 1gY pellets were soluhiiizcd in cme fi~urth the ?() original woll: volume ol' Irnsure ~i nutritional formula.

b) Irr vivo Protection Of Hamsters Against C.: difficile Disease By Treatment With Avian Antitoxins -hhe avian C'. c.li~ficile antitoxins prepared in section (a) above were evaluated te,r their ahilit t(, protect hamsters f~roln ('. cliJ~irile disease using an animal model system which was modified t~rom published procedures. [Fekety, at l)1-72: BOrrielio en ul.. J.
Med. Microbiol..
~-I:ss-(o ( i()R71: i~im r~ «L. Int'ect. Inu7lun.. »:29H4-?99'' ( ! ()87):
I3orriello er crl.. J. Med.
1'1icrobiOl.. ?x:1()1-1()() (lc)RR): Dclmee and Avesani. .I. Med. MicrohiOl..
3 >:RS-9U (199U);
and l..yrrly c'r crl.. lnti:ct. Immun.. i():'?? I ~-2218 ( I c)91 ). [ lvr the Study. three soparate experimental ~~roups were used, with each group consisting OI' 7 female ("rOlden wrian f () hamsters ( C.'harles River), approximately 10 weeks old and wci~hine apprOximatelv l UO ams.
oath. ~fhr ihrcc ~~roups were designated "CTA." "C'hAf3" and "I're-immuno."
'I~hese dosignatiOns corresponded to the anutOxin preparations with which the animals in each group were trcatod. ~ctcal animal was housed in an individual caLC. and was e,i~fered ti,od and water cul lihinrm throu~:h the entire length eh~ the study. ()n day I. each animal was orally l ~ administered 1.0 ml e)C one Oh the three antitoxin preparations (prepared in section (a) above) at tho ii,llmvin~; timepoints: (t hrs., =t hrs.. and R hrs. ()n etav ?. the day i trcatrnent was ropeated. ( )n city 3, at the () hr, timepoint. each animal was al:ain administorod antitoxin, as descrihod ahow. :1t I Ilr.. each animal was orally administered .s.(> 111g (11~ ciind;lmvcin-1ICI
(~iunlal in 1 ml Of water. ~l'his treaullent predisposed the animals t<, infection with ('.
Ch~~l(.'lI~'. ;1S a cUllLrc)! 1(,r pUSSlble CIldUgeIlUllS ('. cliffrCll(' e()IU1117aI1U11. :lll addlllUllal a111111a1 1'1'(1111 the value Slllptllellt (UIILrCated) W'aS aISU adnllnlStered >.() I11L (,t~ Clllldally'CI11-I'l~~l 111 tile same manner. This clindamycin control animal was loft untreated (an(t uninfoctod) for the 1'elllalll(ler <,1~ the study. :>t the ~I hr. anct 8 hr. tinlepuints. the animals were administered antitoxin as described above. ()n day ~t. at the U hr. timepOint. each animal was a~!ain administered antitoxin as described above. At 1 hr.. each animal was orally challnged with 1 ml (lt~ C'. cliJ/iculc inoculum. which contained approx. 100 ('. cliJ/icile strain ~t3j9(, organisms in sterile saline. ('. cJi~)icilc strain ~s59(i. which is a serOgroup (' strain. was chosen because it is representative ot~ one ot~ the most t~requetltlv-Occurring scrOtroups isolated from patients with antibiotic-associated pseudomemhranous colitis. [I)cltnee c~t crl.. .I.
Clin. MicrohiOl..
,U '_'8:22 I U-?'' I ~4 ( I c)Ri). ~ In addition. this strain has been provicuslv elemonstrated t(l he virulent in the I1a11111e1' model oi~ infection. ~I)eimee and Auesani. .I. Mo(l.
~~licrobiol.. .;;:85-c)() ' ( 1 ()c)U). ~ ;lt the 4 hr. and 8 hr. tinlepoints. the animals were administered antitoxin as descrihccl above. ()n day's ; throus~h t s. tile animals were administered antitoxin 3x per day -(~R-as described for day 1 above. and observed for the onset of diarrhea and death. ()n the mornin~~ of day 14. the final results of the study were tabulated. These results are shown in 'fable 1 s.
Representative animals from those that died in the Pre-Immune and ('TA groups were ~ nccropsicd. Viable ('. clij~ic~ilc~ organisms were cultured tom the ceca of these animals. and the gr(WS patholoLy of the gastrointestinal tracts of tlleSe a171111aIS waS
CanSIStl:nt 11'Ith that ' cxpcctcct for ('. clij~icile~ disease (inflamed. distended, Ivemorrhagie cccum, filled with watery diarrhea-li(;e material). In addition. the clindamycin control animal remained healthy throu~~lwut the entire study period. thcrrtore indicating that the hamsters used in the.studv had It) ncn previously been colonized with endogenous ('. cliJjicilr organisms prior to the start of the study. I ollowin~~ the final antitoxin treatment nn day 13. a singly surviving animal ti~om the ("C:1 _~Jwup. and also from the C'~I~.Af3 group. was sacrificed and necropsicd. >Vcr pathology wars nmrd in either animal.

~('.~ ~ n......i...
Treatment CiruuP Nn. Animals lVo. Animals Surviving Dcad I're-Immune t <'TA (Antitoxin A only ; ., C'1'Af3 (Antitoxin n - Antitoxin7 ~0 13) l~r~atmrnt of hamsters with orally-administered toxin f~ and toxin t3 antitoxin Igroup ('~1'~1I3) aocccssfully protected 7 tort crf7 (I()0°/~) ol'thc animals from ('. cIiJJioilc~ disease.
~I~rcatn~cnt ol~ hamsters with orally-administered toxin A antitoxin (group U'T~11 protected i out ol' 7 (71'a) of these animals tram ('. clijJiciie disease. Treatment usinL
pre-immune IrY
was nut protective against ('. cliJjicilr disease. as only I out ol' 7 ( 14'ro) of Ihesc animals survived. These results demonstrate that the avian toxin A antitoxin and the avian toxin A -~
toxin E3 antitoxin effectively protected the hamsters t~otn ('. cli/jticile cliscasc. 'fhcsc results ~tIW1 1lt'~'~~11 that allhallgh the neutralization of toxin A alune confers some dct~ree of protection a~~ainst ('. cli~~icilc~ disease, in order to achieve maximal protectionsimultaneous ?() ~lntJll1~J11 ~1 and antitoxin I3 activity is lleCeSSar1'.
cl Long-Term ~un~ival ()f Treated H:~msters It haS been previously reported in the literature that hamsters treated with orally-adtninistcrcd bovine antitoxin l~~(i concentrate arc protected from ('.
cliJ%icilc disease as long -(~9-WO 9810834(1 PCTIUS97115394 as the treatment is continued. but when the treatment is stopped, the animals develop diarrhea and subsequently die within 72 hrs. [Lyeriy e~ ell.. Infect. Inttnun..
X9(6):?? t S_2318 ( 1991 ). J
In order to determine w~hethrr treatment of ('. cliJ)ici!e disease using avian antitoxins prOllll)te1 lOlll~-terln Sllt'VIVaI 1011(114'lllg the discontinuation ol~
treatment. the 4 survivittg animals in group C.'T'A. and the (i surviving animals in group C"hAI3 w°ere observed for a pericul of I 1 davs (?64 hrs.) foflowin~! the discontinuation of antitoxin treatment described in section ( h? abewc. All hamsters remained hcalthv through the entire post-treatment period.
This result demonstrates that not onlv does treatment with avian antitoxin protect against the onset of ('. cli/~ic~ile disease (i.e~., it is ei~fective as a prophylactic).
it also promotes Icing-term 1 (? survival hevctnd the treatment period. and thus provides a lasting cure.
EXAMPLE 1 (1 In vinn ~l~rcatmcnt ()I' L;stahlished ('. c!i/~iri!o Inti:ctiun In (~oldcn wrian IlanlSlefS ~1~1117 /~\'I~tll Atltlt()~tl7S AgaltlSl ('. cli//irilc~
l~uxins :\ ~\nd 13 l hhe ahilitv ot~ the avian ('. cli/Jici!~ antitoxins, described in Example !i above, to treat an established ('. cli~jicilc~ infection vas evaluated using the (~c>Iden 'ivrian !talllSter 111UdeI.
The Ixamplc involved (a) preparation of the avian C'. cli~)irilc antitoxins.
(h) 111 win treatment c~f~ hamsters with established ('. clij)icilo infection. and (cl histulotic cvaluaticln of cecal IISSUe.
?U
I'rcpar:>Ition ()f The Avian C: rliffrcile Antitoxins C:r~_s were collected from hens in group C'~I~AL3 described in l~:vamplc H th) above.
which were inttnttnized with ( '. cli»irilo toxoids and native toxins ;~ and E3. f~=gs purchased from a local supermarket were used as a pre-immune (negative) mmtroi. 1~.~.:g yolk ~5 inununeylohulin (IgY) was extracted from the ? groups of eggs as described in Example 1 fc). and the final 1gY pellets were soiuhiliccd in one-fourth the original volk volume of I~IlSll1'~'.k' nutritional formula.
b) Ire nivo Treatment ()T Hamsters With fstablisite~ C: rliffici!c~
1 nfection The avian ('. cliJ~icile antitmins prepared in section (al above were evaluated for the ahilitv to treat established ('. cli;!/ic~ile infection in hamsters uvng an ':1t11lnal nu~del system v which was modified from the procedure which was described for the hamster protection study in Example 8(b) above. ~ ' For the study, tour separate experimental groups were used, with each group consisting ul~ 7 female Golden Syrian hamsters (C'harles River). approx. 10 weeks old.
weighing approximately ! 00 gms. each. Each animal was housed separately. and was offered food and water crcl lihinrn~ through the entire length of the study.
C)n day 1 of the study. the animals in all four groups were each predisposed to ('.
cli/~ioilc- infection by the oral administration n1' i.0 mg of clindamvcin-I
IC"I (Sigma) in 1 ml of water.
I() O)n day ?. each animal in all (our groups was orally challenged with 1 ml of ('. cli//ioilo inoculum. which contained approximately Il)() ('. cIiJJicilc~
strain ~ i59(~ organisms in sterile saline. (', cli/)ic~iie strain ~4;a96 was clZOSen because it is representative of one of the mast l~rc:e~uent)v-occurrin~~ scrogroups isolated from patients with antibiotic-associated pscudomctnbranous colitis. [Deltnee en crl.. .1. Clin. Microhiol.. '_'8:2210-221~t (Ic)9()),J In addition. as this was the same ('. clillic'iJo strain used in ~tll of the Previous E~.~camplrs above. it was a~uin uacd in order to provide experimental continuity.
()t~ R.r)~ ~ of the study (?.t hrs. post-infection), treatment was started i~or men of the lour groups ui~ aninrtls. Each animal of one ~!roup was orally administered I
.0 ml of the C'TnI3 l~~l~' preparation (prepared in section (a) above) at the following timepoints: 0 hrs.. 4 -'() hrs.. and H hrs. The animals in this group were designated "CTAB-24." The animals in the second group were each orally administered I.() ml of the pre-immune I~:Y
preparation (also hrcpared in section tal above) :1t the Satlle timepoints as for the C'~InlI3 group. flicse animals were elesignated "1'rc-?-1." 1i()I11111L \1'v1S done to the remaining tvo ~=roups ol~ animals un clay '-? ( )n day ~I. ~l8 hrs. post-infection. the treatment described for day 3 above was repeated for the C'T~1I3-2~t and I're-2~ groups. and was initiated for the remaining:
Uvo groups at the same timepoints. 'f~he final two Lroups of animals were designated "("I~f~I3-48" and "I're-~18"
respectively.
()n days ; through ~). the animals in all four groupswcrc adminiacrcd antitoxin ur ;() pre:-immune I~Y. W per day. as described for day 4 above. l~he fimr experimental groups are summarized in Cable l ~4.
_71 _ WO 9810$540 PGTIUS97115394 Exoerimentat '1'reatmrnr csrnnnc C_iroup DesignatiunExperimental Treatment CTAf3-24 Infected. treatment wlantitoxin I;~Y started rin 24 hrs. post-infect ion.

I're-24 Infected. treatment wlpre-immune l~_Y started !ii? ~d hrs. post-infection.

C'TA13-4ti Infected, treatment wiantitoxin I~~Y stm~ted rir~ 48 hrs. post-infection.

I're-48 infected. treatment wlpre-immune !Y started ~rr~ 4A hrs. post-infection.

.411 animals were ohscrved for the onset of diarrhea and death through the conclusion 1 U of the study on the morniy of day 1 (). 'The results ol~ this study arc displayed in Table 1 ~.
TABLE IS
f:xnerimental Uutcom~--t)av tn f-rcatment Group No. Animals Survivin Nu. AnIntals Dead C' fAf;-24 6 t I're-?.1 p C"TA (3-4 H 4 ;

Pre-4 H

Ei~~hty-six percent of the animals which began rcceivin~ treatment with antitoxin 1~~' _'() at 24 hrs. post-infection (CTAfi-24 above) survived, while s7°%
oh~ the animals treated with antitoxin I~~Y nartin~ ~8 hrs. post-infection (CTAB-48 abovcl survival. In contrast. none oi' the animals receiving pre-immune 1~Y starting 24 1)rs. post-infection (l're-?-l ahovel survived.
and only '?9°/, of the animals which bean receiving treatment with pre-immum I~:Y at 4R
hrs. post-infection (I're-48 above) survived through the conclusion of the study. These results demonstrate that avian antitorins raised ct~ainst ('. efiJJicilr toxins A and l3 arc capable of successfully treating established (.'. c!iJ)icilo infections in vitro.
c) Histologic Lvaluation Of Cecal Tissue In order to t~urthcr evaluate the: ability of tl)e yY preparations tested in this study to ;() treat cstahlisftec~ ('. clijJicile infection. histologic evaluations ~erc performed c,n cecal tissue specimens obtained from ri~presentative animals from the study described in section (h) ahove.
Immediately i~ollowiy death. cecal tissue specimens mrc rt:momd i~rc)m animals which died in the 1're-?~ and I'rc-~8 groups. Following the completion ol~ the study. a rrprcscntativr surviving animal was sacrificed and cccal tissue specimens were removed team the CT'AB-24 and CTAB-48 groups. A single untreated animal from the same shipment as those used in the study was also sacrificed and a cecal tissue specimen was removed as a normal control. A11 tissue specimens were fixed overnight at 4°C in 14%
buttered formalin.
The fixed tissues were paraf'tin-embedded. sectioned. and mounted on glass microscope slides.
The tissue sections were then stained using hematoxytin and eosin (Il and 1;
stain), and were examined by light microscopy.
' l upon examination. the tissues obtained f'rorn the: CTAB-?4 and CTAB-48 animals ahoweci no pathology. and were indistinguishable tr~om the normal control.
This observation provides further evidence tbr the ability of avian antitoxins raised against ('. cliJjicile~ toxins A
1(Wand Ii to ct'fcctiyely treat established ('. clijJicilc~ infection. and to prevent the pathologic consequences which normally occur as a result of C', clij)icile disease.
In contrast. characteristic substantial mucosai dama~c and destruction was observed in the tissues c~l'the animals tram the I're-?4 and 1're-~i8 groups which died ti~om C'. cliJJicilc~
disease. Formal tissue architecture was obliterated in these two preparations.
as most ot~ the mucosal !aver was observed to have sloughed away. and there were numerous larec:
hcmnrrhaLic areas containing massive numbers ot~ erythrocytes.
EXAMPLE: I 1 Cloning And Expression Uf C'. cliJJicile 'hoxin A f~ra~ments ?0 I-I~c toxin A Lene has been cloned and sequenced, and shown to encode a protein oi' predicted A~IUb' of ;08 kd. ~l7ove ce ul.. Infect. Immun.. ~8:48tf-4H8 (Ic)c)0).~ (liven the expense and difficulty <H~ isolating native toxin A protein. it would he advantageous to use srmplc and inexpensive pre~caryotic expression systems to produce and purify high levels of recombinant toxin A protein fbr immunization purposes. Ideally, the isolated recombinant protein would he soluble in order to preserve native antipenicity. since sofuhilizcd inclusion body proteins often do not told into native conformations. 'I'o allow ease of purificaticm, the recombinant protein should he expressed to levels greater than 1 mL/liter ot~
E. cwli culture.
~l~u determine whether high levels of recombinant toxin A protein can be produced in l:. cull. f'raLnu~nts of the toxin A scene were cloned into various prokaryotic expression vectors. and assessed t«r the ability to express recombinant toxin A protein in E. cwli. 7'hrcc prokaryotic expression systems were utilized. 'these systems were chosen because they drive expression of either titsion (pMAI,c and pGI:X2.'I') or native (pL:T? ia-c) protein to hi~!h levels . 7; _ in >'. cwli. and allow affinity purification of the expressed protein on a iigand containing column. Fusion proteins expressed from pGEX vectors bind glutathione agarose beads. and are eluted with reduced glutathione. pMAL fusion proteins bind amylase resin, and are eluted with maltose. A poly-histidine tae is present at either the N-terminal (pF'!'16b) or C-terminal (pET? 3a-c1 end of pET fusion proteins. 'This sequence specifically binds Ni,~
chelate columns, and is eluted with imidazole salts. L:xtensive descriptions o1' these vectors arc available [Vl'illiams el ell. ( 19c)S) U~V9 C'lunin,~~ ?: Exprc~.ss~im7 ,S'vsremu.s.
Glover and I lames. eds. IRL
Press. (>xford, pp. I S-~8J, and will not be discussed in detail here. The Example involved (a) cloning of tire toxin A uene. (b) expression of large fragments of toxin A in various I U prokaryotic expression systems. (c) identification of smaller toxin A gene fragmems that express efficiently in l:. rnli. (d) purification of recombinant toxin A
protein by affinity chromatography, and (e) demonstration of functional activity of a recombinant fragment. of tire toxin A ~enc.
15 a) C.'lunin~ Uf The Toxin A Gene ~\ restriction map of the toxin A gene is shown in Figurr O. 'I-he encoded protein contains a carhoxy terminal ligand binding region. containing multiply repeats of a carbohydrate hindinn domain. (yon Eicltel-Streihcr and Saucrborn. Gene ~)h:tU7-f 13 (lc)90).]
The toxin ,A gene was cloned in three pieces, by using either the polvmerasc chain reaction ?0 (PCR) to amplify specific regions. (regions 1 and ?. (inure 6) or by screenins~ a constructed ~.:rnomic library for a specific toxin A nene ttanment (region s. Figure U).
~I he sequences of the utilized l'C.'R primers are fI: i' (iCiAAA'1°f TA(i("I'(iC'n(iC'~1~1~C"I~(inC.' ;' (~I;(~ 1I) N().:l ): P'_': s. TCTAGCAAA'fT('CiC'TTrT Ci'I°TCiAA >' (SFQ IO
N().:?): I'3; 'i.
(.'T('(iC'A~I'A'f/1<iC'ATTAGA(.'C .;' (SL:Q ID N0.:3): and P4: ~.
2~ C'I'A'1'C'TACiCiCC'TAAACiTAT 3' (SEQ ID N0.:4). These regions were cloned into prokaryotic expression vectors that express either titsion (pMAl.c and pCiEX?'1') or native (pI:T?sa-c) protein to high levels in L'. rnli. and allow affinity purification of the expressed protein on a ligand containing column.
C'Il).SII'IChi1l17 CIIf,IC'll~' VPI strain 10463 was obtained Pram the A'I'C'C' (nTC'C' It4i25i) 30 and grown under anaerobic conditions in brain-heart infusion medium ((3BL).
Hinh molecular-weight C'. cli~ficilc DNA was isolated essentially as described by Wren and 'I'ahaqchali ( 1987) .I. Clin. Microbial.. ?~:?40'?, except protcinase K and sodium dodecvl sulfate (5DS) was used to disrupt the bacteria. and cctvltrimethylammoniunt bromide - 74 .
*rB

precipitation [as described in Ausubel et al., Current Protncols~ in Mvleculcrr Bivloy ( 1989)]
was used to remove carbohydrates from the cleared lysate. The integrity and yield of genomic DNA was assessed by comparison with a serial dilution of uncut lambda DNA
after electrophoresis on an agarose gel.
Fragments I and 2 were cloned by PCR. utilizing a proofreading thermostable DNA
polymerise (native /yr polymerise; Stratagene). The high fidelity of this po)vmerase reduces the mutation problems associated with amplifcation by error prone polymerises (e.~~., 7ag polymerise). PCR amplification was performed using the indicated PCR primers (Figure O) in 50 pl reactions containinL 10 ntM Tris-EiCI(8.3), 5U mM KCI. 1.5 mM MgCI.,, ?OU ttM
Il) each dNZ'P. U.2 tW1 each primer. and 50 ng C'. cJif~icile~ genomic DNA.
Reactions were cwcrlaid with 100 yl mineral oil. heated to 94°C for 4 min. 0.5 yl native p/rr paiymerase (~tratageneJ added. and the reaction cycled 30x at 94°C for I min.
50°C.' for 1 min. 72°(_' for -t min. followed by 1 () rnin at 7?°C'. Duplicate reactions were pooled. chloroform extracted.
and ethanol precipitated. After washing in 70% ethanol. the pellets were resuspended in 50 yl 15 TI: butler [ 1 U ntM 'hris-HCL. 1 mM EDTA pH B.OJ. Aliquots of l Opl each were restriction cli~~estcd with either ~cuRllllitrcli (fragment 1) or EcvRIll'.stl (fragment ?). and the appropriate restriction fragments were gel purified using the Prep-A-Gene kit (BioR adl, and ligated to either l:ruRlLSnrcrl-restricted p(iEX2T (Pharmacia) vector (fragment 1 >. or the L:cwRlll'.~~tl PMAIc (New England I3iolabs) vector (fragment ?). E3oth clones are predicted to ?() produce in-Irime fusions with either the glutathione-S-transterase protein (pGFX vector) or the maltose binding protein (pMAL, vector). Recombinant clones were isolated.
and ce~nfirmed by restriction digestion. using standard recombinant molecular biuloy techniques.
~5ambrool: ur crl.. :llulccurltrr ('lorrin,~~. ,~1 l.ubrrrmur.n ;hlcrnucrl ( 1989). and designated pGA3U-Oh0 and pMAWoO-11()0. respectively (.vee Uigure O for description o!'thc clone designations).[
Fragment 3 was cloned Irom a genomic library of size selected P.stl digested ('. clifficilc- Lcnomic DNA, using standard molecular biology techniques (Sambrook et ul.).
(liven that the fragment 3 internal I'.st( site is protected from cleavage in C'. cliJjicile genomic DNA [Price rr crl.. C.'urr. Microbiol.. 16:5-C~0 (1987)], a 4.7 kb t~agrnent from P.stl restricted ('. cllJftC'ilC' gcnomic DNA was Lel purified. and ligated to l'.stl restricted, phosphatase treated
3(J p()Cr) UNA. The resulting genomic library was screened with a uligonuclcotidc primer - specific to fragment 3, and multiple independent clones w ere isolated. The presence Of ti-agment 3 in several of these clones was confirmed by restriction digestion.
and a clone ol' - the indicated orientation (Figure 6) was restricted with I3crrnl~llNirrclIII. the released fraement purified by gel electrophoresis. and ligated into similarly restricted pE:T?3c expression vector DNA (Novagen). Recombinant clones were isolated, and confirmed by restriction digestion.
This construct is predicted to create both a predicted in frame fusion with the pE'T protein leader sequence. as well as a predicted C.'-terminal poly-histidinc affinity tag. and is designated pI'A1 i00-?b8U (see E~igure 6 fbr the clone designation).
h) Expression t)f Large Fragments ()f Toxin A In C call Protein expression i~rom the three expression constructs made in (a) was induced. and analyzed by Western blot analysis with an affinity purified. goat polyclona) antiserum directed against the toxin A toxoid ('Tech L,ah). The procedures utilized for protein induction. SDS-I'AGL;. and V1~'cstern blot analysis arc described in detail in 1~'illiatns em! (Ic)c)5). .sr,l~,-cr. In brief. i ml ?X Y'1' (16 L tryptonc. )0 g yeast extract, s ~. NaCI per liter, pII 7.; +- 1()0 ttgjml ampicillin were added to cultures of bacteria (E3L?1 fbr pMAI and p(iE:X
plasmids, and f3L?1(DE~:s)I.vs~ tier pL:'T plasmids) containing the appropriate recombinant clone which were I ~ induced t« express recombinant protein by addition of IPT(i to 1 mM.
C'ultures were grown at s7°C'. and induced when the cell density reached 0.5 017,,,~~~.
Induced protein ~vas allowed to accumulate fbr two hrs alter induction. Protein samples were prepared by pclleting 1 ml aliduots of bacteria by crntritttgation ( I min in a microfuge). and resuspcnsion oh' the pcllcted bacteria in 150 Etl ol' '?x SDS-PAGE sample buffi:r [ Williams cn crl. ( lc)c)5)_ .crr~mu[. The ?1) samples were heated to 95°C fur ~ mitt. the cooled and ~ or 10 ftl aliquots loaded on 7.5%
SDS-I'A(~1:; ~:cls. I3ioRad high molecular weight protein markers were also loaded. to allow l'.Slllllatt()Il ()f the MW of identified fusion proteins. After electrophoresis. protein was dciected either ~~enerally by staining gels with C'oomassic bloc. or specifically. by hlottine to nitrocellulose liar Western blot detection of specific immunoreactive protein.
N'cstern blots.
(performed as described in E:xamplc s) which detect toxin A reactive protein in cell lvsates of induced protein I~om the three expression constructs are shown in Higure 7. fn this figure.
lanes 1- ; contain ccl l lysates prepared from !:, cwli strains containing pl'A 1 100-28(U in f31?I(I)Ea)lwf~; cells: lanes ~l-6 contain cell lysatcs prepared from !:. cwli strains containins~
pI'A 1 I ()()-?8(U in I31? 1 (DL:3)IvsS cells: lanes 7-~) contain cell Ivsates prepareel from I:~. cv~li .;0 strains cuntainin~~ pMA30-66U: lanes 10-12 contain cell lysates prcparecl ii-om L:. cwli strains containin~~ pMA660-1 1()0. The lanes were probed with an af'finitv puriiieei ~~oat antitoxin A
polycional antih~~dy ('Tech I,ab). C'untrol iysates from uninduced cells (lanes I. 7. and 10) contain very little immunorcactive material compared to the induced samples in the remaining WO ~/~~ PGT/US97115394 lanes. The highest molecular weight band observed for each clone is consistent with the predicted size of the full length fusion protein.
Each construct directs expression of high molecular weight (HMW} protein that is reactive with the toxin A antibody. The size of the largest immunoreactive bands from each sample is consistent with predictions of the estimated MW of the intact fusion proteins. This demonstrates that the three fusions arc in-tTame. and that none of the ClotleS-c017ta1t1 CIUI11I1g ' artifacts that disrupt the integrity of the encoded fusion protein. I
lowever, the Western blot demonstrates that fusion protein ti~om the two larger constructs (pC;A3U-b64 and pPAI 100-?CiRO) arc highly dc~traded. Also, expression levels of toxin A proteins from these two 1 () constructs are low, since induced protein bands are not visible by C'oomassic staining (not shown ). ~;evcral other expression constructs that fuse large sub-regions of the toxin A gene to either pI~IAI_c or pE'f?3a-c expression vcetors, were constructed and tested for protein induction. These constructs were made by mixing gel purified restriction fragments. derived i~rom the expression constructs shown in Figure b. witf~ appropriately cleaved expression vectors, li~.:ating. and selecting recombinant clones in which the toxin A
restriction t'ragments lord li~~ated tcr~e;ther and into the expression vector as predicted for in-t'ramr fllslonS. The expressed toxin A interval lvltl1111 Il7t'St CnnStrUCIS arC Show'll In Figure 8. as well as the internal restriction sites utilized to make these constructs.
As used herein. the term "interval" refers to any portion (i.c'.. any se~:ment of the toxin '-() which is less than the whole toxin molecule) of a clostridiai toxin. In a preferred tlllhl)ctIr7lCIlI. "interval" Peters to portic)ns of C'. cli/j'icilo toxins such as toxin ~1 ur toxin E~. It is alsc) contemplated that these intervals will correspond to epitopes oi' II111111111<)IU_L1C
llllp()t'(aIICC. SLIClI aS alltILCIIS (1r t1n111U110~e11S a~alt7Si wltlCl7 a ncutrallilng allllhOdV CLSpOtISe lS
H'fcctcd. It is not intended that the present invention be limited to the particular intervals or seducnces described in these Irxamples. It is also contemplated that sub-portions of intervals (c'.,L~.. an epitope contained within one interval or which bridges multiple intervals) be used as compositions and in the methods of the present invention.
In all cases. Vl~'cstern blot analysis of each of these constructs with goat antitoxin A
antihodv (Tech Lab) detected FIMW tilsion protein of the predicted size (not shown). 'hhis confirms that the reading frame of each of these clones is not prematurely terminated. and is . tilscd in the correct frame wlth the titsion partner. I-lowever. the Western blot analysis resealed that in all cases, the induced protein is highly deguded, and. as assessed by the absence of identitiahle induced protein hands by Coomassic Blue staining, are expressed only _77_ WO 98108540 PC'T/US97115394 at low levels. These results suggest that expression of high levels of intact toxin A
recombinant protein is not possible when lame regions of the toxin A gene are expressed in F.. cvli using these expression vectors.
c) High Level Expression Uf Small Toxin A Protein Fusions In E. call Experience indicates that expression difficulties are olten encountered when large (greater than 100 kcl) fragments are expressed in l:. cwli. ,~1 number of expression constructs contninin~~ smaller hagments of the toxin A gene were constructed, to determine if small regions of~ the gene can be expressed to high levels without extensive protein degradation. A
summary of~ these expression constructs arc shown in figure 9. All were constructed by in-framc flrS1l7r1S Of' convenient toxin A restriction fragments to either the pMAI,c or plrT?3a-c vectors. Protein preparations frorn induced cultures of each oi' these constructs were analyzed by hoah C'oomassie Blue staining and Western analysis as in (hl above, In all cases. higher 1 ~ levels of intact. full length fusion proteins were observed than with the larger recombinants from section (h).
dl Purification Uf Recombinant Toxin A Protein Lame scale (SUO ml) cultures of each recombinant from (c) were grown. induced.
and ?U soluble and insoluble protein fractions were isolated. The soluble protein extracts were affinity chromatographed to isolate recombinant fusion protein. us described ( Williams c-r crl.
( 19c)4). .~rrpru]. In brief. extracts containing tagged pf:'h fusicms were ci~rumatcy_raphed un a nickel chclate column, and eluted using imidazolc salts as described by the distributor (NovaLen). L:xtracts containing soluble pMAI_ fusion protein were prepared and chromatographed I11 CUlllllln buffer ( lU mM NaPO" U.SM NaCI. lU 111M (i-mercaptoethanol.
pt-1 7.?) over an amylase resin column (New England Biolahs). and eluted with column buffer containing IU mM maltose as described [Witliams r~ crl. ( 1995).
.vupr~cr]. Vlrhen the expressed protein was found to he predominantly insoluble. insoluble protein c:xtracta were prepared by the method described in U.xamplc 17, in~i~cr. The results arc summarised in 'hahle 3U IO. I~iLUre 10 shows the sample purifications of recombinant toxin A
protein. )n this figure.
lanes I and ? contain MRI' l~usiun protein purified by affinity purification o1~ soluble protein.
_78_ WO 98108540 PCTIUS971i5394 Puriticatinn of t~nrnrnhinn.W'.,..:., w n-_._:-_ ,"-Clone '~" Protein Yield Affinity/ Intact Soluble . purified Soluble Yield Intact Solubility ~,, Fusion Protein''Insoluble Protein Fusion Protein pMA30-270 Soluble 4 mg1500 mls t0% NA

1'MA30-300 Soluble 4 mg/500 mIs S-10% NA

pMA300-660 Insoluble NA 10 me/500 ml pMAO60-I 100 Soluble 4.i ntg/500 SO.~ NA
mls pMA 1 100- Soluble I 8 mg/S00 10% NA
I G 10 mls pMA 1610-I fioth 22 mg1500 90% 2U mgUO ml R70 mls I() pMAl4>0-IR70 insoluble ..-._ NA 0.2 m~;~50U
ml pl' Soluble A 90% NA
I I(10-14>0 (l.l mg1500 mis pPA I I (l0- Soluble 0.03 meI500 90~ h A
I 870 mls pMA I R7(l-2(iR(L
(loth 12 mg!500 80% NA
mls rt'aIR70-368()Insoluble __-.. NA 10 mgi500 I ml ''" pP = pf-_T?3 vector. pM-pMAl.c vector, A=toxin A.
"" R,rsed on I.i OD,", - I m~~ho! (extinction coefficient of MIiP).
''' Iatimatcd tit' Cuumassic stainin_; of SDS-PAGE xcls.
Lanes s and 4 contain M$N fusion protein purified by solubilization of insoluble inclusion '-() bodies. The puriticd fusion protein samples are pMA I 870-2h80 (lane 1 ).
pMA6G0- I I ()() (lane '). pMA 30U-G00 (lane s) and pMAI450-1870 (lane 4).
Poor yields of affinity purified protein were obtained when poly-histidinc ta~~gcd plT
vectors ~~et'e used to drive expression (pPAI 100-140, pI t 10()-1870).
However, signiticant protein yields wore obtained from pMAI, expression constructs spanning the entire toxin A
gene. and yields of full-Icn gth soluble fusion protein ranged from an estimated 200-400 Etg/500 ml culture (pMA30-300) to greater than 20 mg/500 ml culture (pMA16i0-1870).
only one interval was expressed to high levels as strictly insoluble protein (pMA300-GGO).
-I~hus, although high level expression was not observed when using large expression constructs ti-om the toxin A gene. usable levels of recombinant protein spanning the entire toxin A gene were obtainable by isolating induced protein from a series of smaller PMAI.
expression constructs that span the entire toxin A tene. This is the first dr:monstration of the t~asLbLI(t_V
- of exprNSSin~~ recombinant toxin A protein to high levels in !~. cwli.
_7 c) Ncmagglutination Assay Using The Toxin A Recombinant Proteins '('he carboxy terminal end C(111S15t1t1~ of the repeatin~~ units contains the hema~;~lutinatiol, activity or binding domain of C'. cliJ~icilc- toxin n. 'fo determine whether the expressed toxin n recombinants retain functional activity.
hema~glutination assays were Icrtitrmeei. Two toxin A recombinant proteins. one contuinin~ the binding domain as either ,uluhle at~tinitv puritied protein (pMA 1870-268()) or SDS solubilized inclusion body protein (pI'A187f1-2680) and soluble protein frc,m one region outside tltat domain (pMAI 100-1010) \Yere tt.'Sled USI11'~ a described procedure. (FLC.'. hrivan el. crl.. Inlcct.
lmmun.. x;:573 ( 1986). C'itrated rabbit red blood cells (RIZI3C.')(Cocalicol were washed several times with ~fris-hol'i'er ( 0.1 M Tris attd s0 mM NaCI ) by centrifugation at 4~0 x g )i~r 10 minutes at 4°
C'. n 1 '!a RRI3(' suspension was made ti~ottt the paclccd cells and resuspended in ~Cris-hut'fer.
l)ilutiow oh~ the recombinant proteins and native toxin ~1 ('l~ech l.ahs) were ntadc in the ~l~ris-huf~tcr and added in duplicate to a round-bottomed ~O-well microtiter plate in a tinal volume 1 s h~ 1 ()() X11. ~l~o each well. >0 pl of the 1 % RR13C' suspcnsie~n was added. mixed by gentle tappin~~. and incubated at 4°C' tits i-~ Jt(,IICS. SILnttleanl h~ma~~lutinatirm occurred curly in the recctmhinant proteins containinL the binding domain IpMA 1870-?(,80) and native toxin :1. The recombinant protein outside the binding domain (pMA I 1(>0-161()) displayed no hrma~'~lutination activity. ( )sing eeluivalent protein concentrations. the hemae~iutination titer 2(l t'or main .~1 was 1:''iG. while titers tier tits soluble and insoluble r~ceunhinant proteins ut~ the bindinL domain were 1:?~(i and about 1:1000. C.'Icarly. the reromhinant proteins tested retain ed functional activity and were able to bind RRI3C's.

Ivnctional Activity C)T IgY Reactive Against 'Toxin n Recombinants ~i~hc expression eH~ recombinant toxin A protein as multiple i~ra~:ments in l:.cwli has c(cn tonstratcd the feasibility oC generating toxin A antigen throu!_h use of~
recombinant methodologies ( Example I 1 ). The isolation oi~ these recombinant proteins allows the s0 immunoreactiyity ol~ each individual subregion of the toxin A prcaeilt to he determined ( r. r..
in a antibody pool directed aLainst the native toxin r1 protein). This identifies the re~ictns (iT
any) tier which little' or no antibody response is elicited when the vyhole protein is used as a inunmuycn. ~lntibodi~s directed against specific lra~ments cri' the train A
protein can be -8()-WO 9t~/08540 PCT/US97/15394 purified by affinity chromatography against recombinant toxin A protein. and tested for neutralization ability. This identifies any toxin A subregions that are essential tier producinc neutralizing antibodies. Comparison with the levels of immune response directed against these intervals when native toxin is used as an itnmunogen predicts whether potentially higher titers of ncutraliziy antibodies can be produced by using recombinant protein directed against a individual region. rather than the entire protein. hinally, since it is unknown whether untihodies reactive to the recombinant toxin A proteins produced in Example l 1 neutralize toxin ~1 as effectively as antibodies raised against native toxin A ()examples ~) and l(J). the protcctivc ability ol~ a pool of antibodies affinity purified against recombinant toxin f\
1 tJ t~ragments was assessed for its ability to neutralize toxin A.
this (:xamplr involved (a) epitopc mapping of the toxin i1 protein to determine the titre uf~ specific antibodies directed against individual subrcgions of the toxin A protein when native tewin :\ prcncin is used as an immunogen. (h) at'tiniy purification of IgY reactive .y~ainst recombinant proncins spanning the toxin A gene. (c) toxin A
neutralization assays with 1> ul'tinity purified I~~Y reactive m recombinant toxin A protein to idcntif:v suhrcgions of the main .t protein that induce the production of neutralizing antibodies. and determination of mhcthcn rcnnplete neutralization of toxin A can be elicited with a mixture oi~
antibodies rcactrvc to rcconthinant toxin a1 protein.
~~) E:pitopc M~ppinl; Uf The Toxin A Gene i'hc affinity purification ol~ recombinant toxin A protein specific m defined intervals ol' tlm W vin :1 protein allows cpitope mapping o1' antibody pool, directed against native toxin A.
This has nc,t previously been possible. since previous expression ol' twin A
recombinants i~as h een assessed only by UVestern blot analysis, without knowlccigc of the expression levels c,f' ~> the rotcin c.~ _ p [ ~,t,.. won l:ichcl-~treihcr m crl. J. Cicn. Microbial.. 135:jj_~,4 ( Ic)g~))). 'Thus. hi«h c,r low reactivity of recombinant toxin A protein on Western blots may reflect protein mpression level dit7ercnccs. not immunorcactivim differences, (liven that the purified rccomhinunt protein generated in L:xamplc 1 1 have bccll duantrtatcd, the issue oi' relative immunorractivitv of individual regions of the toxin n protein was precisely addressed.
.,lJ hoe the purposes of this f:xamplc. the toxin A protein was subdivided into h intervals ( 1-6), numbered liom the amino (interval 1) to the carboxyl (interval 6) termini.
The recombinant proteins corresponding to tlzese intervals were from expression clones - (see I:xatnple I 1(d) for clone designations) pMA30-300 (irtterval 1 ).
pMAS(JO-GCO (interval _ gl _ ~). pMA6G0-1100 (interval 3), pPA1100-1450 (interval 4), pMA1450-1870 (interval S) and pMA 1870-2680 (interval (~). These C clones were selected because they span the entire protein fi~om amino acids numbered 30 through 2680, and subdivide the protein into 6 small intervals. Also, the carbohydrate binding repeat interval is contained spcciiicallv in one interval (interval G). alluwin~ evaluation of'the immune response specifically directed against this rc:~_ion. Vdestcrn blots o1' 7.5"i° SDS-PAGE gels. loaded and electrophorcsed lNlth defined cluantities ut' each recombinant protein. were probed with either goat antitoxin A poiyclonal antibody ('I'rch t.ah) or chicken antitoxin A polyclonai antibody [pC."I~~1 ICY. l~:xamplr 8(c)].
The hl«ts were )trcparcd and developed with alkaline phosphatase as previously described [ Wiliiams r~ «l. ( I c)95). .strpr«[. r1t Least c)0% of all reactivity. in either goat or chicken antibody pools, was teund to he ciirecicd against the ligand hindin~ domain ( interval 6), The rrmainin~_ imntunoreactivitv was directed against all five remaining intervals. and was similar in both antihoctv cools. except that the chicken antibody showed a much lower reactivity ct!sainst interval ? than the goat antibody.
1 ? This clearly demonstrates that when native toxin A is used aS an IlttntllnUil'tl IIt LUiIIS
c>r chickens. the bull: of~ the irnmunc response is directed a~ainU the li~ancf hinetin~ clnmain of the promin. with the re:nlainin~ response distrihtlted throughout the romainirn~ '!:> elf' the hrotcln.
'-(> h) Affinity Purification ()f IgY Reactive Against Recombinant 'Toxin A Protein :1t'tinitv columns. containing recombinant toxin A protein from the O defined intervals in (a) chow. mere made and used to (if at'finity puritw antihcuiies reactive to each individual interval t'rom the C'~l~A I'~Y preparation [l:xamplc 8(c)[. and (ii) deplete interval specific untibadics from the C"hA t~~Y preparation. Aftiniy columns were made by coupling I ml 01' I'f3S-washed Actigel resin (Sterogcne) with region specilic protein and 1/1() final volume of Ald-cuuplin~ solution (1M SlldIUll1 C\'altOhOCOhydrICfl',1. ~1'he total t'citolt spccllie protein added to each reaction mixture was 2.7 nt~ (interval I). ? IttL (intervals ?
and ). 0.1 m~
(interval 4). 0.? mg (interval i) and 4 mg (interval G). I'rotcin tier intervals 1. .i. and b was 30 ut~tiniw purified pMAI litsion lrotrin in column but~fcr (see L.xatnplc I I
). lntcrval 4 was at'iinitv purified poly-histidine containinL pCT titsion in I'R~: intervals ?
and ; were loom inclusion body preparations of insoluble pMAI, fusion protein. ciiatv~cd extcwivcly in P13S.
Alicluots eh' the supernatants from the coupling reactions. bclurc and alter coupling. were _g~-assessed by Coomassie staining of 7.5% SDS-PAGE gels. based on protein band intensities.
in all cases greater than SU% coupling efficiencies were estimated. The resins were poured into ~ ml E3ioRad columns. washed extensively with PF3S, and stored at
4°C.
.~IIqLIOIS Uf the C'T~1 IgY polvclonai antibody preparation were depleted for each individual region as described below. A ?U ml sample uf~ the CTA IgY
preparation [Example Hlc)~ was dialyzed extensively against 3 changes of !'BS ( ! liter for each dialysis). quantitated ' by .Ihsc~rbance at OD_~", and stored at =t°C. Six i ml aliquots of the dialyzed'IgY preparation ~~crc removed. and depleted individually for each of the six intervals. h;ach 1 ml aliquot was passed aver the appropriate aft3niy column, and the eiuatc twice reapplied to the column.
I U ~I~hc eluatc was collected. and pooled with a 1 ml PBS vyash. Bound antibody was eluted i'rnm thr column by washin~~ with ~ column volumes of ~ M Ciuanidinc-EICI (in 10 mA~! ~I~ris-I IC'l. pl l R.()). The column was reequilibrated in PRS, and the depleted antibody stock reapplied as dcscrihrd above. The eluate was collected. pooled with a 1 ml PfiS wash.
cluantitated by ahsorhance at ()1)"",. and stored at 4° <'. !n this manner. 6 aliquots of the CTA
) ~ I~~Y preparation vycrc individually depleted for each of the ( to~:in A
intervals. by two rounds ol' al'iiniy depletion. The spcciticiw of each depleted stock was tested by 1~'estern blot analysis. ~.1ultiplc 7.5"% SDS-PAGE gels were loaded vyith protein samples corresponding to all h train ~1 suhre~;ions. .~ftcr clcctrophorcsis, the gels were plotted. and protein transfer confirmed by I'onceau ~ staining [protocols described in llvilliams er «l.
(Ic)c)5). ,~~i,hr«[. After ?l) E~locking the blots 1 hr at ?U°C in I'E3S+ ().l% 7~ween 20 (1'f3S'h) containinL ~'% milk (as a h)ewkin~_ hut'tcr). ~4 mi ol' either a I!SUO dilution of tl3e dialyzed CTA !gY
preparation in hlcxkin,~ Uut'tcr. or an equivalent amount of the six depleted antibody stocks (uslnL OI)=~,~ to standardlzc antibody concentration) vyere added and the blots incubated a further 1 hr at room temperature. The plots vsure vyashed and developed with alkaline phosphatasc (using a rabbit '' anti-chicken alkaline phosphate conjugate as a secondary antibody) as previously described [ Williams c~W 1. ( 19c)5), .v«pr«J. In all cases, only tire target interval was depleted for antibody reactivity. and at Icast 9()% of the reactivity to the tarLet intervals was specifically depleted.
Region specific antibody pools wrre isolated by affinity chromatography as described h clovy. l~cn mls ui' the dialyzed ('TA tgY preparation were applied sequentially to each 3U aftiniy column. such that a single lU ml aliquot was used to isolate recion specific antibodies specific to each of the six suhrcgions. 'I-he columns Here sequentially washed with 1() volumes ol' PL3S. 6 volumes of I3IiS-Tween, 10 vollllncs of T(3S. and elated vyith ~ ml nctiscp elution media (Sterogenc). The eluate was dialpcd extensively against several _g;_ *rB

PCT/US9~/15394 changes of PBS. and the affinity purified antibody collected and stored at 4°C. The volumes of the eluate increased to greater than 10 mls during dialysis in each case.
due to the high viscosity of the ~lctisep elution media. Aliquots of each sample were 20x concentrated usinlr (.'cntricon 30 microconcentrators (Amieon> and stored at 4°('. 'fhe specificity of each region' specific antibody pool was tested. relative to the dialyzed C'~I~A IgY
preparation. by Western blot analvsls. exactly as described above. except that ~ ml samples of blocking buf~ter ce~ntainin~~ It)U pl region specific antibody (unconcentrated) were; used instead of the depleted C'~l~A I~_~' preparations. Each affinity purified antibody preparation was specific to the defined interval. crept that samples purified against intervals 1-i also reacted with interval G. This may he ctue to nun-specific binding to the interval 6 protein, since this protein contains the repetitive lirand binding domain which has been sho~s~n to bind antibodies nonspecifically.
) Lvcrlv c~~ ul.. C.'urr. Microbiol.. 19:303-306 ( 1989). ) I~h~ reactivity c~f each affinity purified antibody preparation tn the correspondin_;
proteins was appro~cimatrly the same as the reactivity of the l/i()t) cliluted dialylcd C'T'A IgY
I ~ preparation standard. (liven that the specilic antibody stocks were diluted 1!=t(), this would indicate that the unconcentrated at'finity purified antibody stocks contain I/IU-1/2U the concentration of specilic antibodies relative to the startin~~ ("TA tcY
preparation.
c) 'Toxin A Neutralization Assay lJsing Antibodies Reactive '-t) Toward Recombinant Toxin A Protein 1'he ('l IU toxin neutralization assay (Example 8(ct)) was used to assess the ahiliw_ of the ctepleted ur enriched samples generated in (h) ahoae to ncutraliie the cwmuxicitv ul toxin :1. 'I he general ability o1' aftiniW purified antibodies to neutralize toxin A was assessed by mixin~~ tey~cther aliquots of al! 6 concentrated stocks o1' the 6 affinity purified samples ~~enerated in (h) above. and testing the ability of this mixture to neutralize a toxin A
concentration of 0.1 ftg/ml. 'The results. shown in Figure 1 1. demonstrate almost complete neutralization of toxin n using: the affinity purified (Af) mix. Sumc epttopes 4wthtn the recombinant proteins utilized fir affinity purification were probably lost wh en the proteins were denatured before af~finiy purification )hy Guanidine-!f('I treatment in th) above). 'Thus.
3U the neutralization ability of antibodies directed against recombinant protein is probably underestimated using these af~tinit~~ purified antihoclv pools. 'This cvperintent demonstrates that antibodies reactive to recombinant toxin A can neutralize cvtotoxicity, suggesting that _ 8,~ _ WO 98/08540 PCTIUS97/l5394 ncutralizine antibodies may be generated by using recombinant toxin A protein as immunoeen.
In view of the observation that the recombinant repression clones of the twin A gen c divide the protein into O suhregions. the neutralizing abilim of antibodies directed against each individual reLion was assessed. The neutralizing ahilitv of antihadies directed al:ainst the ligand hindinr domain of toxin A was determined first.
In the toxin neutralization experiment shown in Flgtlre 11. interval (~
specific antihoctius ( interval 6 contains the ligand hinding domain 1 were depleted ti~om the dialyzed I'hCi preparation. and the et~I~ct on toxin neutralization assayed. Interval 6 antibodies. were lO depleW d either by utilizing the interval 6 depleted C:TI\ IgY preparation t~ont (h) ahovc ("-6 aCl~. cdpleted" in I~iLUrc: 1 1 ), or by addition of interval O protein to the C'T~1 ILK' preparation tcstimated m he a I () ii~ld It101i1C exCeSS ()1'er alttl-Itttcf~'aI C) In1117U17UglOlllllllt present in this prrparatinnf W competitively cnmpete for interval 6 protein ("-h prot depleted" in Figure I 1).
lit l1<1111 iltSlattee5, rrnuwal cof interval O SpeeltlC altLlb(1(ilc'.S
rcdUCCS tlt~ llelltl'alllat1011 W'ticicncy relative to the starting CT.'\ lgY preparation. 'This dcnulnstratcs that antihodies directed a~_ctinst interval (i cuntrihute to toxin neutralization. since interval (~ corresponds tc~
the Ii;_~tnci hindin~~ domain ot~ the protein, these results demonstrate that antibodies directed a~~ainst thin re~~ion in the Pf.:(i preparation contrihute to the neutralization ol~ toxin A in this assay, l Imcvcr. it is significant flan alter removal of these antibodies. the I'1~(i preparation '_(1 retains aiLniticant ahiliy to neutralise toxin A (Figure I 1 ). This Iteutralization is probahly due to the ~tlll(lit ()t~ anllb(ICIIIS SpceItlC to other regions of the toxin A protein. since at Icast ~)()'.'~~ ol~ the IILaIICI hllldllt;~ rr<_ion reactive antibodies mere rcmcwed in tlm depleted son tple prepared in th) above. This conclusicm was supported by comparison of~thc toxin ncutraiization oi~ the at'tiniW purified f1l'1 mix comparcct to af~iinity purified intewal l>
antihncly alone. ~\Ithou~,~h some neutralization ability was ohservcd with A(' interval 6 antihoclies alone, the neutralization was significantly less than that ohserved with the mixture at~ all (~ :\I' antibody stctcla (not shown).
Crl1'en tltal Ilte J711x Ol~all six affinity purified samples almost contplctelv neutrali~cd the cyutoxiciy' ol~ toxin r1 (lvigure 1 ! ). the relative importance of antibodies dirceted as!ainst train f\ intervals 1-s within the mixture was determined. This was assessed in Uvo ways.
First, samples cuntainine affinity purified antihodies rcprcsentin4~ s of the O internals were prepared, such. that each individual region was depleted from one sample.
Figure 1?
dernonstrates a sample neutralization curve. comparing the n eutralization ability uC at'tinitv _8j_ WO 98/(ISS40 PCTIUS9'f/ti5394 purified antibody mixes without interval 4 (-4) or ~ (-5) specific antibodies.
relative to the mix oi~ all to affinity purified antibody stocks (positive control). While the removal of interval spcci(ic antibodies had no ctfcct on toxin neutralization (or intervals I-;.
not shown). the loss 0l' interval d specific antibodies significantly reduced toxin neutralization tEigure 1?).
Similar results were seen in a second experiment. in which affinity purified antibodies.
directed a~_ainst a single region. mere added to interval (, specific antibodies. and the effects on toxin neutralization assessed. Only interval a specific antibodies si~~nificantlv enhanced neutralization when added Eo interval C specific antibodies (figure Is). These results demonstrate that antibodies directed against interval ~l (corresponding to clone pl'A1 lUU-1450 in I~i~~ure ~)) are important for neutralization of cvtotoxicitv in this assay. I:pitope mapping has shown that only iovv levels oi~ antibodies reactive to this region arelgeneratcct wh-rn native toxin ~\ is used as an immunogcn [E:xamplc 1?(a)~. It is hypothesized that intmunization with rccc,mhinant protein specific to this interval will elicit higher titers ol' nt;utralizin~~ antibodies, In summ.u. . this a11a1\'SIS has identified two critical regions ol~ the toxin ,~ prc,tein a!~ainst v1'111CI1 Itl,'Ult'allLltt~.'. itlltlbpdleS are produced. as assayed by the C.'t10 neutralization assay.
FXAMPLI~: 13 Production i\nd Evaluation ()I~ Avian Antitoxin Against ('. CII~~IC'IIL Recombinant Toxin A I'olvpcptidc ?() In Ivampl~ 1''. we demonstrated neutralization of toxin i\ mediated cvtotoxicitv by al~tinim purified antibodies reactive to recombinant toxin A protein. ~I-o determine whether antibodies raised as~ainst a recombinant polypeptidc fragment c,l~ ('.
cIiJJicile~ toxin A may hr cl'tcctiw in trcatin= clostridial diseases. antibodies to recombinant toxin A
protein representing the bindin_; domain were generated. Two toxin A hindinL domain recombinant poypeptides, e~pressin~~ the binding domain in either the pMAl..c (pMA187U-2O8U) or pL:T
'_'~(pl'A187U-_'h8U> vrctor. were used :1S IntlllllttU~T.CI1S. The pMAI. protein was af'tinitv puriticef as a soluble product )I~xample 1'_'(d)) and the pE'i~ protein was isolated a5 1115<,Itlhle IItC1lI51l,tt bodies )Example I'_'(d)) and solubilized to an immunologicallv active protein using a proprietary ;() metltos_i described in a pending patent application ((I.S. Patent Application Serial No. _ ()8/I?c).U?7). This L:xampie involves (a) immunization. (h) antitoxin collection. (c) .
determination of antitoxin antibody titer, (d) anti-recombinant toxin ~\
neutralization of toxin i1 henta~~~~lutination activity in ri~rn. and (e) assay of in ni~ro toxin i\
ncutralirin~ activiy.
-8h-Immunization The soluble and the inclusion body preparations each were used separately to ilnmunizc hens. Both purified toxin A polvpeptidcs were diluted in YBS and emulsified with approximately equal volumes of CFA for the initial immunization or !FA for subsequent hoostrr immunizations. On day zero. filr each ot~ tile recombinant preparations. W ~o egg layng white Leghorn hens (obtained from local brcedcrl were each itl.jected at multiplC sites ( intramuscular and Sltbct1ta11eUl1S) with 1 m! ot~ rt',COtllblnallt ad_tU~'allt nllxtule c'.Ulltaltllnl_' apllfU\Illlittt'.11' ().> f0 I .J nl~!~ (1t' CCCUlllhtllant IOxlll /~.
f30011Cr 1111n1U111T,allUClS (11' I.() 111 were '~ivrn nn days l~l a,ld dVV ?8.
h) Antitoxin C.'ollcciion I~oUal yolk immune 1g7' was extracted as described in tile standard Pf:(i protocol (as in I~:xamplr 1 > and the final f~~~' pellet w,ls dlssoIVCd in sterile 1'fW at the ori~!inal yolk volume.
i~his material is cicsi~~natcd "ilnmunC recombinant I~~1'~~ or "immune l~~Y."
1;
C) ,lntitoxin ~1ntil>,odv 'Titer ~(~a c(mcrmine if the recombinant toxin A protein was sut'ticicntlv immunogellic to raise antibodies in hens. tilt antihocd titer of a recombinant toxin A polrpcptidc was determined by f~(.I~A. 1:~_~~s ti-otll both hens were coIIcCtcd nn day 3'_'. the yolks pooled and the antibody _ -'() was iwlatcd using 1'F(i as described. The immune recombinant 1gY antibody titer mas _ dctermimd I~c~r the soluble recombinant protein containin g the maltose bindin~~ protein t~USIUtl ~mllcratcd in p-Mal (pMA1870-?(18()l. 'Vinetv-six well Falcon I'ro-hind plates were coated omrni~_ht at ~4°(' with lt)U Etl iwcll cli~ toxin A rccomhlnant at ?.~
Elg /l.ll in !'13S containing t).Uj'~,' tllimcrosal. ,~lnclther plate was also Coated with maltose binding protein (MI31'I at the same concentration. to permit Comparison ot~ antibody reactivity to the Cusion partner. The next day. the wells were blocked with I'fW Containing I"a bovine serum albumin (13~A) ter 1 hour at ;7°('. IgY isolated from immune or preimmunc c~_g's was diluted in antibody diluent ( l'f3~ ec111talllillg I ".% BSA and U.(l;~ ~ Tween-2U), and added to the blocked wells and incubated tier I'hour at >7°C' . The plates were washed three times mith PI-W with U.Ui°~~
a) ~fvveml-_'U. thCn three III11LS l4IIh PB~. Alkaline phosphatase Conjugated rabbit anti-Chicken lgCi (~i,'nlct) diluted I:IUUU in antibody diluent was added to the'plate.
anti incubated for 1 hour at ,7°C. '1"he plates were washed as before and substrate was added. [p-nitrophcnyl hhosphatc (~igma)~ at I tllL/1111 in ().l)iM N;I_[();, hl.) 9.> and 1() mM
MgC'l,. 'fhe plates . 87 _ WO 98/08540 PCT/IlS97I15394 were evaluated quantitatively on a Dynatech MR 300 Micro I:PA plate reader at 410 nm about 10 minutes after the addition of substrate.
Based on these ELISA results. high antibody titers were raised in chickens immunized with the toxin A recombinant poiypeptide. 'The recombinant appeared to be highly immunogenic. as it was able to generate high antibody titers relatively cluickly with few immuni:cations. lmtnune IgY titer directed speciticallv to the toxin A portion of the recombinant was higher than the immune IgY titer to its fusion partner. the maltose hindins;
protein. and significantly higher than the prcimmune lgY. LI.,ISA titers (reciprocal of the ' highest dilution of IgY generating a signal) in the prcimmune IgY to the MI3P
or the lU recombinant was <1:3U while the immune IgY titers to ML3I' and the toxin A
recombinant were i :18710 and :~ 1:93750 respectively. Importantly. the anti-recombinant antibody titers ~.:enerated in the hens against the recombinant polypeptide is much higher, compared to antibodies to that region raised using native toxin A. l'he recombinant antibody titer to rc~.ion 1870-268() in the C~l'A antibody preparation is at least tier-told Icw~er compared to the 1 ~ recombinant generated antibodies ( 1:18750 versus -1:9 370). Thus, it appcan a better immune response can he generated against a specific recombinant usin;~ that recombinant as the immunogen compared to the native toxin A.
This observation is significant. as it shows that because recombinant portions stimulate the production of antibodies. it is not necessary to use native toxin molecules to produce '_U antitoxin preparations. 'Thus. the problems associated with the toxicity of the native toxin arc avoided and large-scale antitoxin production is lhcilitated.
d) Anti-Recombinant Toxin A Neutralization ()f Toxin A
Hemagglutination Activity Irr Vilro ?? ~1'oxin A has hemagglutinatim; activity besides cytotoxic and cnterotoxin properties.
Specifically. toxin A ag6lutinates rabbit erythrocytes by binding to a trisaccharide (gal 1-3I31-4(ileNAc) on the cell surface. (H. Krivan c~ crl.. Infect. Imrnun.. >s:s7~-S81 (l~)gb).~ We examined whether the anti-recombinant toxin A (immune I~zY. antibodies raised against the insoluble product expressed in pE'T) can neutralize the hema~_~_lutination activity oh' toxin A in 3(1 vitro. 'fhc hemaLglutination assay procedure used was cicscrihcd by Il.t'.
Krivan er crl.
Polyethylene glycol-fractionated immune or preimmune IgY ware pre-absorbed with citrated rabbit erythrocytes prior to performin~~ the hemagglutination assay because we have found that lgY alone can agglutinate red blood cells. Citratcd rabbit red blood cells (RRI3C's)(Cocaiico) were washed twice by centrifugation at 450 x g with isotonic buffer (0.1 M
Tris-I-iC.'I. 0.05 M
NaCI. pl-I 7.''). RRI3C-reactive antibodies in the IgY were removed by preparing a 10%
RRI3C' suspension (made by addin~~ packed cells to immune or prcimmune ELY) and incubating the mixture te,r I hour at 37°C. The RRBC's were then removed by centrifugation.
'veutraiization c~t~ the hemagglutination activity ot~ toxin A by antibody was tested in round-hottomed c)(,-moll microtiter plates. Twenty-fire yl of toxin ;\ ( il Etg /ml) (Tech L.ab) in isotonic huhttr was mixed N ith an equal volume of dit~ferent dilutiona of immune or preimmunc I;~l' in isotonic buffer. and incubated for I~ minutes at room tc:mperaturc. 'I~hen, i!) Ell ul~ a I'.i> RRf3C' lUSpertSll)It Irt IS<ltOltre butler was added and the mixture was incubated 1() li,r ~ hours at =1°('. l~llSllll~ Cc)Itlrcll wells containing the final concenlratlUn (1t' ~) Fy/ml of toxin :1 ,Il~trr dilution without l~~l' were also included. liemagglutination activity was asscswl visually. with a ciii'fusc matrix of RRB("s coating the bottom ot~ the well rcl,rrsmtin~~ a positive hcnta,.:~~lutination reaction and a tiLht button of RRE3("s at the hc,ttont «t~ the wall rrl,rrsentin~~ a nca!ativc reaction. ~I~hr anti-recombinant immune IgY' ncutraliLCd toxin :1 Itrnta'~~;lutination activity. ;~ivinL a ncutraliration titer ot~
1:li. l towcvcr. prcinttnunc 1~~~' was unahlv to ncutralirc the hcnta~.;~~lutination ahiliW ol~ toxin f1.
r) lvxay ()f' lu 6 itr« Toxin A Neutrali~in~ Activity l hu ability of the anti-reromhinant toxin n Is~Y (immune l~~Y alltlh(1d1e5 1'alSed aeainst ~'t) I,~~1:1 I t;7t)-?(,fit), the soluble recombinant bindin~~ domain protein expressed in pMi\L.
Wsi!~namcl ;IS rlnti-toy. :\-? in hiLUrc I-t . and referred to as recombinant re~~ion p attd prr-ilmttutto i~_1~. prepared as dearrihed in F~xantple 8(c) ahoye. m ncutrali~e the'cwotoxic activity ~,I~ tclxin :\ was assessed in ri~rn using the C'f iC) cell cytcttoxicitv assay. and toxin ~\ l~I rclt l.ah) at a concentration ol~(l.lEy~ml. a, clscrihed in L:xamplr !3(d) al,ovc.
:\s additional controls. the anti-native toxin A 1~~~' ((.'T~\) and pre-immune I~.:Y
preparations described in Lxample S(y above were also tested. The results are shown in Tieurc I~I.
l~lte anti-recombinant toxin ;\ IgY demonstrated only partial nrutrali~ation of the ryotoxic activiy ot~ toxin n. while the pre-immune 1gY did not demonstrate any significant neutralizilt;~ actiyitv.
,1) EXAMPLE l~t In vian Neutralization Of (', cIiJJiciIr ~I~o~cin A
The ability e7i~ avian antibodies (!~Y) raised aLainst recombinant toxin ;1 binding CI()171a111 Ill IICUIt'illlZC the enterotoxin activity ol' (', cliJ~icilc~
toxin A was evaluated irr vinn using Cic7ldcn Syrian hamsters. 'fhe Example involved: (a) rrcparation of the avian anti-1'<'Cl)117h117a11t t0\In A 1~Y tar oral administration: (h) in oinu prc)tectiun oi' hamsters ti-om c'.
cli//icilc~ toxin A cnterotc)xicity ht' treatment ot~ toxin A with avian anti-recombinant toxin A
1~;Y: and (c) histulcyic evaluation of hamster ceca.
:~) !'reparation Of The Avinn Anti-Itecombin:mt 'Toxin A 1);1 ('or <)ral Administration L;_~~s were cc)Ilertcd t'rom he n5 Nllll:l7 Il~id t7~e11 1111171t11117.1',d with tile rcec7mhinant <' cli//ic~ilc~ train r1 I~ra~ment pMA I 87()-2680 (described in L;xan7ple I s.
above I. .1 second group ul~c~~_s purchased at a local supermarket was used as a pre-immune (ne~ativet control. L:L
y)Ik imnlune)~_lc)hulin (I~Y1 was ewractcd ht' 1'FCi From the hv(1 groups (>f e~~~~s as described in L:xampic Htcl. and the final I~~Y pcIIWs were soittbili7ed in unc-ti)urth the ori~~inal v_ olk w)lunle using (). I ~9 carhc)nate buffer (miwure c7t~ NaI IC'(), and 1\a,('();). pll () ;. f~he basic carbonate hut~icr was used in order to protect the toxin ~1 from the acidic pl I ul~ the stomach ~() ~Ill'If()11117CI1t.
h) In vine 1'r0tcction ()f Hamsters A);ainst C: ~lifjicil~~ Toxin A
1~:nterotoxicity By Treatment Of Toxin A With Avian Anti-rccomhinant Toxin A 1gY
In order to :ISSI:SS the ability ol' the avian allll-re(:(7177h111a11I l()\1l7 n I~Y. prvparcd in s~ctiun (a) ahc)ve to neutralize the in ni)~~u enterotoxin activity c)f toxin A. an in oi)v~ toxin ncutralizatie)n model Has developed usiny~e)ldcn Syrian hamsters. This nu)del was based un published values tile the minimum amount of toxin A required to elicit diarrhea (Q.()8 mr toxin A'hz body wt. ) and death ((). I C) mg tc)xin f~il~~ hc)dv wt. l in l7alllsters when () administered orally (I.verlv en crl. Infect. Immun.. ~17:;4c)-:s? ( lc)8s).
hoe the study. lour separate experimental groups wrrmscd. with each Lroup consistit7_~
ot~ 7 tcmal~ (~()Iden Syrian hamsters (C'harics River). al7prox. three and c)ne-hatf~ weeks ofd.
-9()-WO 98!08540 PCT/US97/15394 weighing approx. ~0 gms each. The animals were housed as groups of 3 and 4, and were offered trod and water ucl lihimm through the entire length of the study.
Ivr each animal. a mixture containing either lOEtg of toxin A (0.2 mg/Kg) or ;O~tg of main i\ ((>.b meiKg) (('. cli//icilc~ toxin ~\ was obtained from 'i~ech Lah and 1 ml of either the anti-recombinant toxin A IgY or pre-inttnune IgY (from section (a) above) was prepared.
These miwures were incubated at ,7°C for 60 min, anei wore thin administered to the animals I» (I)~ oral room. 7~hc animals wrrc then observed for the onset of diarrhea anct death for a periml of ?.t hrs. lollowin!~ the administration of the toxin ~1+-1'~Y
mixtures. at the end ot~
which time. the following results mere tabulated and shown In -(~ahle ( 7:
rnB~E t7 Study Outcome At ?4 f lours Study Outcome at ?4 Hours tixpcrimental Group ,.--,_ t-lealtft>r Diarrhea= Dead' y Twin A - :\ntitoxrn A«ainst interval G 7 1) 0 ,r) ry~ fuxiu .1 - Antitoxin Against Interval G ; () tt l() y Toxin ~\ ~ I're-lrnmunc Scrum t) ?() u~; -toxin ~ ~ I're-Immune () i ' :\nimals rrmained healthy throu!_h the entire ?4 hour study peri<xi.
nmmalv developed diarrhea, but did nat die.
Animals developed diarrhea. and subsequently died.
1'retrcatment u!~ toxin A at hoth doses tested, using.: the anti-rccomhinant toxin ~\ Igl'.
prevented all overt SvnlptOtttS ()h dtSeaSe ttt hamsters. Therefore.
pretreatntcnt of C'. cli//irilc' tetxin r\. using the anti-rccomhinant toxin A 1~~~'. rtcutralized the in t~irci enterotoxin activity e~f' the toxin ;1. In contrast. all animals from the two groups which received toxin f\ which had hccn pretreated usin~~ pre-in tmune 1gY developed disease symptoms which ranged tram diarrhea to death. The diarrhea which developed in the ~ animals which did not die in each of thr mo pre-immune ~_roups, spontaneously resolved by the end of the 24 hr.
study period.
c) liistoio~ic !:valuation Oi Hamster Ceca '(1 In order to titrtl)er assess the ability of anti-rccornbinant toxin A i~_Y
to protect hamsters ti'om the entcrotoxin activity of toxin A. histologic evaluations were performed oft _ the coca of hamsters from the study described in section (h) above.
Three groups of animals were sacrificed in order to prepare histolugical specimens.
T7re first group consisted of a single representative animal taken from each of the ~I ~~roups of _91 _ surviving hamsters at the conclusion of the study described in section (b) above. These animals represented the ?4 hr. timepoint of the study.
The second group consisted of two animals which were not part of the study described above. hut \vere separately treated with the same toxin A f pre-immune I~~Y
mixtures as clrscrihed for the animals in section (b) above, Both of these hamsters developed diarrhea.
and \vcrc sacrificed 8 hrs. at'tcr the hnti; Ut' ad1171n1StraLlUl1 l7 t' the main A + Pre-immune 1gY
mixtures. ~1t the time ut~ sacrifice. both animals were presenting symptoms of diarrhea.
TItCSI', a1111tta1S rl'prCSl.'111t'.d the acute phase ul' the study.
I~hr final s~ruup consisted of a single untreated hamster ti'(lltt fltC
SFllttc'. 1111ptttelll C)t 1() animals as those used fir the t\vo previous groups. This animal served as the normal control.
samples eh' cecal tissue were removed from the 7 animals eirscrihed ahc>ve:.
and were lixed overnight at =I°C' using 10°/, hul'fcred tormalin. ~Citc fixed tissues wore parat'tin-cnthccicled. sectioned. and mounted on glass micrclscope slides. 1'lte tlSStll Sl(;tI1111S 1t'l'rC then ,taincd using hcmatoylin and eosin (II and F stain 1. and \vcre cxantincd by li~~ht microscopy, 1 ' ~f'hc tissues obtained i~rom the two ?=t hr. animals which rcciivrcl mixtures rontainina uithrr I(>EI,; yr sUtcg c>i~ toxin A and anti-recombinant toxin ~1 IgY' \1'c'1't Illlll~IlllLIIISItFtf)ll' from the normal control. both in terms ol~ ~~ross pathulous. as well as at the microscopic level.
'I'hcsc observations provide t'urthcr evidence ictr the ahiliy ul~ anti-rc:comhinant toxin A IeY to et'I'ectivcly neutralize the in niw~ enterotoxin aetiviy of ('. cliJ/ic'ile toxin ;~. and thus its abilitv_ ?t) to prevent acute ur lasting toxin j~-induced patholuLV.
In contrast. the tissues from the t\vo ?4 hr. animals \vhich received the toxin .~ + pre-immunc f~~l~' mixtures cHmclnstraW d sib=niticant pathology. In both ol~ thm ~~ruups. the ntucosal layer \vas observed to he Il'.11 organized than in thmurmal control tissm. I h~
cytoplasm ul' the epithelial cells had a vacuolated appearance. anct Laps \verc prevent between the epithelium and the underlyin~~ cell laycn. The lamina prupria was largely absent.
Intestinal villi and crypts \vrrc signiiicantlv diminished. and appeared to have been overgrown It\' ~l 111a11a1' la\'trr (1t~ lpltllC1t~11 CCIIS and tibrohlasts.
l~flt'1'Ct01'l. .11I111)LI~!h tlttSl' ~111t111a15 tt1'CI'tl\' appeared to recover i~ront the acute symptoms of toxin ~~ intoxication.
lasting pathologic alterations to tltc cecal mucosa had occurred.
;() ~l'he tissues ohtaincct from the t\vo acute animals which received mixtures of train A
and pre-immune IgY dentonstratcd the most significant pathology. :1t the gross pathological level. both animals were observed m have severely distended coca which w ere tilled with watery. diarrhea-like material. ~~t the microscopic Irvel, the animal that was ~:iven the WO 981t~8540 PCT/US97/1i5394 nuxture containing lOEtg of toxin A and pre-immune )gY was found to stave a mucosal !aver which had a ragged. dammed appearance. and a disorganized. compacted duality.
The crypts were lar~~elv absent. and numerous breaks in the epithelium had occurred.
There was also an intlux ol~ erythrocytes into spaces helvecn the epithelial layer and the underl)'ing tissue:. The animal mhich had received the mixture containing 3()Elg of toxin f1 and pre-immune IgY
ctcntonstratcd the most severe patholctLy. 'The cecal tissue tlt~ this anlrnal had an appearance vrry similar m that observed in animals which had died ti~om C'. cliJJicile disease. Widespread ~lcstructiun ul' the rnucosa was noted. and the epithelial layer had sloughed.
I Iemorrhagic areas containing Large numbers ot~ erythrocytes Here very prevalent. All semblance' of normal I() tissur architecture was absent t~rom this specimen. In terms of the presentation of~ pathologic mcnts. this in lim hamster model u1~ toxin A-intoxication cctrretates very closely with the patholey~ic mnscduences ut~ ('. cli/Jicile disease in hamsters. 'hhc results presented in this l~:vampu dmtonstrate that while anti-recombinant toxin .A (interval () IgY iv capable oh~~nlv lrlrtiallv Il~llt!'LIIIGIIIL the cvtotoxic activity ott~ ('. eliJ%ic~ilo toxin A. the same antihctd_v .
~t~tcctiwly neutralizes I()()% of tire in rime enterotetxin activity of the toxin. Vl~'Itile it is not intended that this invention he limited to this mechanism. this may he dur to the cvtotoxicitv anti muromvicitv c,l' ('. cli/Jicilu ~I~uxin ~1 as tvo sc:paratc and distinct hicloeical t'unctiuns. ' FaAMPLt? 1;
In t 'inn Neutralization OI' ('. UiJJicilo ~I~uxin .~ E3v rlntihoolics ;l~~ainst IW c:omhinant Toxin A I'olvpc~ptidcs ~fhc ahiliy ot~ avian antibodies directed against the recombinant ('.
cli~Jioilc- toxin i1 I~ra~=ntent I 87f)-?(>80 (as cxpressect by hMA 1870-?68(): sec ~xampic I s >
tc, neutralize the cntcrc,tc,vic activity ot~ toxin n was demonstrated in Example 14. The abiliy ol~ avian antibodies ( I);Ys) directed aiainst other recombinant toxin A epitopes to neutralize: native toxin .1 in uvu was next evaluated. Tltis example invnlvcd: (al the preparation ut' tg~'s a~~ainst rcc;omhinant toxin /1 pulypepiidcs: (hl ire non protection ot~
Italttslers against toxin n by treatment with alai-recombinant t<txin ~1 IgYs and (cj ctuantiticatiun ot'spccific antibody re,ncentratiult in CT:1 and Interval (, I~~Y t'EG preparations.
_ 'bite nucleotide seducncc ot~ the coding region oh the entire train .~1 protein is listed in ~L:Q lI) N():i. The amino acid sectuence of the entire toxin A protein is listed in SL:Q II) N<):h. ~i~he amino acid SC; CIl1e11Cf; CIItISISIIn~! ot~ amino acid residues I
87() through ?O8() of _ c), _ toxin :\ is listed in SFQ fD N0:7. The amino acid sequence consisting of amino acid I'eS1d1.1eS I R70 thrott~h 19(,0 of toxin A is listed in SEQ II) N():R.
:1) Preparation Of 1gY's Against Recombinant Toxin A
Polvpeptidcs f:~~~s were collected t'rom I.eghorn hens which have been immunized with recombinant ( '. cli~~ic~ilc~ toxin ~1 polypcptide fragments encompassing the entire toxin I1 protein. 'fhe pnlypcptide ira~menis used as imrnunogens were: i ) pMA IR70-?G80 (Interval l>). ?) p1'A
1 1 ()()- I ~4s1) (Interval ~ ). and i) a mixture of fragments consistine of pMA 30-;00 ( Interval I ), It) pMn s0U-6h0 (interval ?), pM~1 h(~()-1100 (Interval ;) and pMn 14>0-1R70 (Interval 5).
This mixture ot~ immunogens is referred to as Interval I?_ss. ~I~hc location of each interval within thr toxin ~~ ntOleCllle 1S 511014'11 ttt higurc 1 ~;~. In I~i~;urc l gin. the fi~llcvin~.~
abbreviations are used: pi' reters to the p1;-r?3 vcct~r lNew l:n~,:land L3ioLahs): pM refers m the p~~1~11.'s-~ vector (New l:n~~lattd fiiol.ahs): .~ refers to toxin .~: thr numbers refer tc> the 1 ~ amino aciei interval exprcsscd in the clone. (For example. the designation pMA;()-;00 indicates that the rmomhinant clone encodes amino acids :U-;()() uf~ toxin ,~1 ,end the vct:tor used was pMAl.m'_e).
~I~Im recombinant prow ins were ~eneratect as ctcscrihcd in E'.xaltlple 1 I.
i~hr I~Ys were cxtrac;md and soluhiliicd in 0. I M carbonate buffer pl l c).5 li,r oral administration :1s described '_'() in Example l.~(a). -hhe IgY reactivities against each indiviclual recombinant interval was maluamd by L~LISA us described in I:xamplc 1 ;(c).
h) !rt ~ivn Protection Vf Hamsters Against Toxin A lay Treatment With Anti-Recombinant Toxin A Antibodies 'i~he ahiliy of antibodies raised against recombinant toxin i\ polypeptides to provide in ai~~n prmcction against the cnterotoxic activity of toxin i1 was examined in the hamster model system. l~his assay was performed as described in hxamplc I~(h). t3ricllv. for carp ~l0-s0 <~ram tcmalc Golden wrian hamster (('harles River). 1 ml ol' I~~Y ~lX (i.o..
rcsuspended in II4 of the l)t'1~_tllil yolk volume) I'f:(i prep aLa111St Interval 6. interval ~
c?r Itltcrval I'_'3> was ,U mixed with ,0 Et~ (I.I)"", oral dose) ol' ('. cli~ficilv toxin A S heck I.ah). I'reimmune l~Y
mixed with toxin A served as a negative control. nntihodies raised against ( '. clij)ioilo toxoid :1 (Example R) mined with toxin /~ (CTA) served as a positive control. 'l~he miwurc was incubated for I hour at 37°C' then orally administered to li~htlv etherizcd hamsters usinL all WO 98108540 PCT/US9711i5394 I 8G ieedin~ needic. The animals were then observed for the onset of diarrhea and death for a period of approximately '_'4 hours. The results are shown in Table 18.

Stndv ()ulcnntc~ AftNr ~d W nme 'hrcatmcnt group f-Icalthy' Diarrhea- Dead' 1'rcimmunc () ( ) . ~..t.~ ~ () () Interval (, ~, , mtr~.,l .t o I r, I () Interval i?3s () t) 7 ' -1nimal shoos nn ai~_n of illness.
Animal developed diarrhea. trot did not die.
nninrn developed diarrhea and died.
I're-treatment (,I' t(txin A with Iph's against Interval 6 prevented diarrhea in (, of 7 ltamxmrs anal cc,mplctelv prevented death in al! 7. In contrast. as with preimmune I'; Y'. I~~'s a;~ainst Interval -1 unci Interval I?:_', had no effect cot the (Inset (tf diarrhea and death in ihc hamsters.
'() c) (~>uantitication ()f Specific Antibody Concentration In (:"I':1 :lnd Interval 6 18Y Pf:G Preparations lu, determine the purity (,f I~~Y PECi preparations. an aliduot ofa pMAI1170-?68() (Interval (t) I~~1' I'I~.(i ltrcparatiun mas chrctmatographcd usiy llpl.t' and a I~\~'-~i(>; sirinL
column (~It(,dcW. f hr rcsultin g profile of absorbance at ?80 nm is shown in I~ipurc Ih. '-1'he ,in~_ic lar~m peak cc,rrespands to the pmciicted MW' ol' Izl'. Intcrratien c,f' the .Irca under the ainile Ittr~sc peak showed that greater than ~)5% of tltc protein eluted from the ce,lumn was present in this single peak. This result demonstrated that the majority (=w)5'%) of the material absarbin~ at ?80 not in the PECi preparation corresponds to Irl'. '1-heretore.
ahs(trbance at ?80 not cart be used to determine the total antibody concentration in l'L(i preparations.
;() I o dcaermine the concentrati(tn of Interval 6-spcctUc anttbodtes (expressed as percent c,h total antibody within the CTA and pMr11870-?(,80 (Inten~al G) f'I-'.Ci preparations. defined duantities ctl~ these antibody preparations wer(.~ aftiniy purified un a pI'A
187()-?(t80(l i) (shc,wn schenttttically in f~i~ure lsl3) af~iiniw column and the specilic antihctdics were yuantificd. In t~irurc ist3 the titllowin~ abbreviations arc used: pI' refers to tire p(~'I'?3 vctaor (New Ett~land i3iol.ahs): pM refers to the pMAI.'"-c vector (New l:ngiand (3ioL.abs): pV
refers to the pCiEX
_c~5-vector (Pharmacia): pB refers to the I'inPoint'"'' Xa vector (1'romega): A
refers tct toxin A: the numbers refer to the amino acid interval expressed in the clone. 'fhe solid black ovals represent the ME3P: tltc hatched ovals represent glutathionc ~-transfcrase:
the hatched circles represent the hicnin tag: and Fif II-I represents the poly-histidinc tai.;.
nn affinity column containing recombinant toxin A repeat protein was made as follows. l~e~ur ntl of PE3~-washed .~cti~:el resin (Sterogenel was coupled with s-IU mg of pl'A 1 R7t)-?Ct8U inclusion body protein prepared as described in L:xample ( 17) and dialyzed inlet 1'I3~~ in a l; ml tube (Faiconl containing 1/10 final yetlurtte ,~Id-eouplinL solution ( 1 M
sodium cyancthctrcthydride). Alidu<ns ctf the supernatant ti~otn the coupling:, rcacticms. helore I11 and after couplins~, were assessed by C'oomassie ,twining ctf' 7.S°.~~ ~t)~-I'n(;f: gels. Based upon pre»ein hand intensities. greater than b mg ol' recombinant prcttcin vyas coupled to the resin. The resin was poured into a IU ml column t(3ictRad). washed extensively with I'f3S.
pre-eluted with ~ M guanidine-F~C1 (in 1() ntM ~I~ris-I~C'I, pll fl.U:
U.UUi~,. thimerosal) and rr-ccluilihratcd with I'IW. ~I~hc cctlurnn was stored at 4~C'.
1 ~ ,Aliquots of a pMA187U-?G81) (Interval h) or a (.'TA IgY pctlycional antibody preparation (1'I;(i prep) were ai~tittiy purilicd on the ahctyc al~liniW
column as titlluws. ~I~hc column v,ls attached to an ( ~V monitor I1SC'()) and washeJ with 1'Li~. Iutr pMn I87U-2680 !gl' puriticatic»t. a ?X I'I(i prep (liltcr sicrilitcd using a U.~li tl liltcr: appntximatcl_y >UU me total IiY) was applied. The column was washed with PI3~ until the baseline was re-~0 cstahlishccf I the column flow-tlu~ou~~h vyas saved), washed with l3fi~~l~wuen m elute nunsprciticallv binding antibodies and re-equilibrated vyith 1'E3'i. E3uund antihctdy was eluted from tltc column in ~I M Luanic(inc-f ICl ( in I U mM 'Kris-f IC'l. pl ( f;.(): 1).U()ia," thimerosal ).
~I~hc entire elution peak mas cctllcctcd in a Is ml tube Il~alcanl. Il~c column w,rs rc-equilihrated anJ the column eluatc was rc-chromato«raphrd as dcsrrihed above.
The antihuc(y_ prcparatietn was quantified by ('V ahsorhance (the elution huffi:r was used m iero the spectrctphcttctmetcr). 'fcual purified antibody was approximately ') m~~ and 1 mss t~rctm the first and second chromatcyraphy passes. respectively. 'l~hc low yield f~rum the second pass indicatcc( that most specific antibodies were removed by the first round ct1' chromatography.
The estimated percentage ~tt~ Interval (~ specitic antibodies in floe pfVIA187U-?(tRU PI:Ci prep is :;U approxintatcly '"%u.
~I~hc percentage ctl~ Interval 6 specific antibodies in the ("I':1 f')~(i prep was determined (LII111'l.IItL the same column and methodctlugv described above) let he approximately U.~'a of total l~l''.

PtrT/US97I15394 A 4X PCG prep contains approximately ?0 tngiml I~~Y. Thus in b) above.
approximately 4t)0 Et~ specific antibody in the Interval G I'CG prep neutralioed 30 Etg toxin A
117 Vll'fl.
EXAMPLE IG
In 1'iru ~freattnent Ot' ('. cli/Jirilr Disease In Hamsters By Recombinant internal h Antibodies fhe ahiliy of antihocties directed against rccumhinant interval G ot~ toxin A
to protect 1() hamsters in oiml from l'. cli»icile disease was examined. T~fis example involved: (a) I,ro(,hylactic treatment of ('. cliJJic~ile~ disease alld (h) therapeutic treatment ol~ ('. cli/Jicilu ciiaeas~.
~r) Prophylactic Treatment ()f G difficilc~ Disease I~his mperimcnt was Itertormcd as described in Exantplr c)(h). 7~hree Lroups each cansistin~~ uf~ 7 female I ()() ;_ram Syrian hamsters (C'harles River) were prophylacticallv treated with either prcimmutze I;~Y's. lgYs against native toxin n and f3 (C'1'nI3:
sec Example H (a) and (h)~ ~,r l~~l's atainst Interval h. I~~Ys mere prepared as -iX PI:Ci preparations as ~iescrihed in I-:xantl,lr ~)(a).
-'() i~hu ~tninutls were orally dosed ; times daily. rouLhl_v at ~l hour intervals. li,r I'_' days with 1 ml antibcxl preparations diluted in Ensure~ai;. 1.!sing lSltIltaIlS
()t~ SI,<:C:ItIC ailtlt70d~, .
cvncmtration t~rum Iv:vample I ~(c; I. each dune of the Interval ( antihodv prep contained al,Proxitnatcly -i()U ~t~ ut specific antibocy. ()n day ? each hamster was predisposed to (..'.
cliJ)ic~ilc~ infection by the ora) administration of~ ;.() mg ul~ C'lindamyrin-11C'I (Si~tma> in I ml ol~ water. (>n clay i the 11a111SI1'fS ~ll'I'C Orally challenged with I ml ol' ('. cli//ic~ilc~ inuculum strain ATC'(' -ISj9G in sterile saline containing approvimateiv 1()0 organisms. ~1'Ite aninrtls were then ohscrved fi,r the onset of diarrhea and suhsequcnt.dcath during the treatment period. ~fhe results arc shown in Table I ~).
_c)7_ ~rp gglpg~p PCTIUS97115394 I.cthalitv After 12 Davs Of l'rcatmem Treatment Group Number Animals Alive Number Animals Dead f Prcimmunc 0 7 C'1'A I3 6 I

Imerval 6 7 t1 Treatment ol' hamsters with orally-administered IgYs against Interval h auccessf'ullv protected 7 trot ol' 7 ( 10()'%) ol' the animals from ( '. cliJJicilr disease.
()ne of the hamsters in I () this group presented witlt diarrhea which subseduentlv resolved during the course of treatment. ;~s shown previously in L:xample ~). antibodies to native toxin f\
and toxin I3 were highly protective. In this I~.wmple. 6 trot ot~ 7 animals survived in the C'~I'A13 treatment Lroup.
:111 ot~ the hamsters treated with preimmune sera came clown with diarrh ea and died. -I hr ,urviw~r, io both the C'T.~13 and Interval 6 groups remained healthy thruu!~Ite,ut a I ~ clay pust-I s trcatmmt period. In particular. (i out of 7 Interval 6-treated hamsters survived at Icast weeks all~r termination ol' treatment which suggests that these antihndies provide a lun~:-lastin~ cure. I'itcsc results represent the first demonstration that antibodies generated aialllsL a 1'e(:()Itth111a111 ry~ion ol' toxin n can prevent C'l)t1I) when aclminiUercd passively to animals.
l~hcsc results also indicate that antibodies raised against interval U alon a may hr suhlicicnt to ''() protect alltlttalS from ('. cli/Jirilc disease when adminisUrrd prophvlacticallv.
I'rrviuuslv others had raised antibodies against toxin :1 h~ actively 11111ttt11111t1t~~
h~lnlS(~1'v a~~ainst a recombinant polvpeptidc located within the Interval l>
rcLion ~I.verlv.
I).M.. r~ crl. ( l Nc)U) C'urr. Microhiol. ? I :?c)J. higure 17 shows achmtaticallv the iocatitm of the l.vcrlv. er crl. infra-Interval t recombinant protein (cloned into the pl!C' vector) in comparison with the complete Interval 6 construct (pMAl87()-?O8()) used herein to generate ncutrali~in~~ antibodies directed against toxin A. In higure I7. the solid black oval represents the 1~1I3P which is bused to the toxin A interval G in pMA1870-2680.
l h~ Lvcrlv. ur crl. antibodies (infra-Interval h) wore only able to partially protect hamsters a~_ainst ('. clij)icilr infection in terms ctt' survival (=4 out c~(' 8 animals survived) and ,s(I furthermore. these antibodies did not prevent diarrhea in any u(~ the animals. ~ldditicmalU.
an111taIS treated with the infra-Interval h antibodies [I.vcrlv. n ul. ( Ic)c)()). .,y~rcr) died when treatment w as removed.
In contrast. the cxp criment shown above demonstrates that passive administration oi~
anti-Interval (~ alttihodies prevented diarrhea in (, out of 7 animals and completely prevented death due to CDAI~, furthermore. as discussed above. passive administration ctf tire anti-Interval (, antibodies provides a lone lasting cure (i.e~.. treatment could be withdrawn without incident 1.
h) Therapeutic Treatment Uf C. ~(iJfrcile Disease: Ire Vivo Treatment Uf An Cstablished C. ~lifftcile infection In ' Hamsters With Recombinant Inten~al G Antibodies Tltc ability ot- antibodies against recombinant interval G of toxin .~ to thcrapeuticaliy treat ('. ~liJ)ic~ilc~ disease was examined. -fhe experiment was performed essentially as I U clcscrihed in E:xamplc 1 U(h). -Three groups, each containing seven to eight female Golden Syrian hamsters ( 1 ()U E~ each: C.'harfes River) were treated with either prcimmunc 1gY', IgYs a;~aittst native toxin ;1 and toxin t3 (C.'-frlE3) and lgYs against Interval 1. -The antibodies were hrep.lrcd as dcacrihcd above as ciX PIOi preparations.
fhc hamsters were first predisposed to ('. cli/~icilc~ infection with a 3 mg dose oi' I ~ (.'linciantwin-fiC'I (Si~~ma) aClIttIItISter-ed orally in I ml W' water.
;lpproximatclv 24 hrs later, the animals were orally challenged mith 1 ml of ('. cliJ%icilc~ strain A'fC'C' .)s5<)h in sterile Sallllt ec)IttaltllltL approximately ?Ul) ur__anisms. One day after infection, the presence of toxin n anti li wus determined in the ti:ces of the hamsters using a commercial intmunoassa_v kit ((~yuclunr ~~-l3 hPA. C.'ambridLC l3iotcch) to verify estabiishntrnt of infection. I~aur '_U ntc:mhcrs W~ each group were randomly selected and tested. feces from an uninfected hamster was tested as cl negative control. .~11I infected animals tested positive tar the presence of- toxin aecnrelin~_ tc> the manulacturer's procedure. -The initiation of- treatment then started approximately ?.~ hr P,~st-inti:etion.
I~hr animals wore dosed daily at roughly 4 hr intervals with 1 ml antibody preparation diluted in i.:nsure li ( Ross (_ahs). -1'hc amount of specific antibodies given per dose tdctermined by aftinim purification) was estimated to he about ~LUU pg of anti-Interval G igY
(for animals in the Interval 6 group) and 1UO Erg and 7U Elg of anti-toxin A
(Interval O-speciticl and anti-toxin 13 (Interval s-specific: see fixample 19), respectively. 1'or the C'T-Afi preparation. fltc animals were treated fir 9 dais and that observed file an additional :l d,.lvs sU tier the presence ot- diarrhea and death. Z-he results indicating the number ol~ survivors and the - nunthcr of dead 4 days post-infection arc shown in 'fable '_'().

In a)m ~fherapeutic Treatment With Interval 6 Antihodiet Treatment Group Number Animals AliveNumber Animals Dead f'rcimmune ~4 ;

CTAf3 R (1 Interval 6 8 a Antiho(iies directed against both Interval () and C'TnI3 successiullv prevented death from ( '. cli~/i('ile when therapeutically administered 24 hr after infection.
'This result is IU significant since matte investigators hcgin therapeutic treatment ot~
11a111Ster5 w'ltlt exlSlltlg CII'lli~ (c'.~.. \'allC()111yC1n, phcneltamyclns. IiaCUnll(:1115. llC.) H !tr 1711 t-Ilttet'11011 ~~\4'a1111)Il. c'/
ccl. ( I c)c) I ) Ilntimicrahial Agents and Chemotherapy 35:1 I U8 and 1 f 9X()) .I. Antibiotics 42:94 ~.
forty-t\vc) prrcrnt of hamsters treated with prcimmune l~.Y' died rr()n1 (.'I)AI). While the anti-Interval 6 antibodies prevcnte(i death in the treated hamsters. they did nut eliminate 1 ~ all svmptc)ms ut~ C'DAD as 3 vnimals presented with slight diarrhea. In addition. unc ('~1-AH-treated and e)nc prcimmunc-treate(t animal also had diarrlt~tt 1 ~ (lavs post-inlcction. These I'l,'SIIIIS 111dICat~ that anti-Interval (> antihodies provide an et~dctivc means c)t~ therapy' I'c)r C'I)t11).
?() EXAMPLE 17 Induction ()1' Toxin A Neutralizin~~ :Yntibodies Re(luirrs ~e)fuhlc Interval 6 Protein :1s shown in I~.xamplcs 1 I (d1 and 1 ~. CxpreSSll)It (1t~ rC'.C()Ittblllalll proteins in L:. c'c~li now result in the production oh either soluble c)r insc)lublr protein. It' insoluble prc)tein is pre)duced. the recombinant protein is sc)luhilized prior tc) immuniratiun ut~
anltnals. ~I~e determine \\helher. one or both of the soluble or insoluble recombinant pre)teins could horsed to gcnrratc neutraiiring antibodies to toxin A, the foll()\vin~_ experiment was perfbrmcd. This example invulve(1 a) expression of the luxtn A repeats and subl~ras~tttcnta ()t~ th ese repeats in F..
c~c~li wing a variety ot~ expression vectors: b) identification e)f rece)mbinant toxin A repeats and 3U sub-res_ions tc) which neutralizing antibodies hind: and c) determination ut~ the n eutralizatic)n ahilitv ot~ antihc)dics raised aLainst soluble and ins~luhle tc)xin i~
I'epl.'ttl 1111m11I1()LCI7.

:~) Expression Of The Toxin A Repeats And Subfra~ments Of These Repeats In E. cnli Using A Variety Of Cxpression Vectors The In terval G immuno~en utilized in tramples i ~ and i G was the pMA 1870-prcttcin, in which the toxin A repeats arc expressed as a soluble fusion protein with the MBP
(clcscrihed in Example 1 1 ). (nterestin~ly. expression of this region (from the ,SpI site to the rnd of~ the repeats. see FiLUre i ~B) in three other expression ccmstructs, as either native (1~1'.~I1i70-2680). poly-llis ta~~ed (pPA1870-2680 (1-I)) or hiotin-ta~~8ed (pf3A1870-2680) proteins resulted in completely insoluble protein upon induction of the hacterial host (see hi~,:urc I ~l3). ~f ite host strain 13i.?I (Novagcn) was used for expression ctf pI3A1870-2Ggp and lutst strain fit.? 1 ( UI: i ) ( Nova~~ett) was used for expression ctf' pl'A
1870-2680 and pPA I 870-?(>80t I t ). These insoluble proteins accumulated to high If'~'~1S 111 IItCIUSicllt hodies. Expression ul~ rec<Imhinant (tIaSIttIdS 111 F.. orrli host cells grown in ?X 1'T
Iltedlullt lvaS performed as dcscrihed [1~'illiants. m crl. (199s1..wrpncr~.
I' ;\, summarioeci in figure I~t3. e~cpression of f~agntents of the toxin A
repeats (as either ~.tcrminal .~p~1-I:c~uRl ti~aLments. or C-terminal l:crrRl-end fragments) also yielded high lccls e~f~ insoluhlr protein usilt~ p(ihX (p(iA 1870-? 1 c)0). Pinpoint'"-Xa ( pBA I 870-21 c)() attd pI3:\??s0-?(,g0) and plT expression systems (pl'A1870-'?(c)()). I~hc pC~IX and pE'T
expression ystcms are described in Example 11. 'I~hc Pinl'oint'"-?~a expression system drives _'0 the cpressiun ul~ fusion proUCins in L'. cwli. Ivsion proteins fi~c~m 1'inI'ointl"-Xa vectors contain a biotin tai.: at the amino-terminal end and can he affinity purified Sttftl.inl<'~' Sctfi IZeIcaW .llldllt t'('~Ilt tf'romc~a) 1111deC Ittlld denalUl'InL cOltdlllt)1tS
(; ml\~1 hiotinJ.
~I~Itc sultlhility uf~~xprcsscd prcncins from the pl'Ci187()-21c)0 and pl'A187()-2190 cprcssion cclnstructs was determined af~tcr induction of~ recombinant protein expression under conditions reported to enhance protein solubility (These conditions comprise <~roWh o1' th r host at reduced temperature (30°C) and the utilization of high ( 1 mM
IP'f(i) or low (0. I mM
11'~f(.i) rctncentrations oh inducer [VVilliams c°~ u/. ( lc)95).
.vtrprcrJ. ;111 expressed recombinant toxin ~\ )trotein was insoluble under these conditions. Thus. expression of these t~ra~~ments oC
the Iclxin ~\ repeats in pt~~T and pCiI:X capression vectors results in the production of insoluble 1'ccomhinant protein even when the host cells are grown at reduced temperature and urine I«~~cr concentrations of the induccr_ Althouih expression of these fragments in pMal vectors yi~ldeet affinity puritiable soluble thsion protein. the protein was either predominantly insoluble (pMA1870-21c)0) or unstable (pMA2250-2650), Attempts to solubilize expressed - lUl -protein ti~om the pMA I 870-2190 expression construct using reduced temperature or lower induces concentration (as described above) did not improve fusion protein solubility.
C'ollcctivelv. these results demonstrate that expression of the toxin A repeat region in E. C'(~Il 1'eSUItS Ill the production of insoluble recombinant protein. when expressed as either large (aa 1870-2080) or small (aa 1870-?190 or as ??~0-2(80) fragments. in a variety of expression vectors (native or poly-his tagged pE'T. pGL:X or f'in1'oint'"'-Xa,vectors), utilizing ~.row-th conditions shown to enhance protein solubility. The exception to this rule were 1'usions with the Mfil'. which enhanced protein solubility. either partially (pMA1870-2190) or tllllv t I,!~-1.11870-2080).
h) Identification Of Recombinant TOxin A Itepexts And ~ub-Rc~~ions '1'o Which Ncutralizinl; Antibodies l3ind ~Imin A rrprat regions to which neutralizing antibodies hind were identified by utilizin~~ recombinant toxin !1 repeat region proteins cvpresscd as soluble ur insoluble I,rcnrins 1 s to deplete proUcctivc antihociics from a polvclonat pool of antibodies against native C'. cli/Jicilc~
toxin :1. :\n in W m ItSSitv \1'aS developed to evaluate proteins ter the ability t« hind ncutralirin~~ antibodies.
The rational tier this assay is as ti~l)ows. ltccomblnant proteins were first pre-mixed with antii,odics n_~ainst native toxin A (C'TA antibody: generated in I:xamplc 8) and allowed ?0 to tract. W hsccluentlv. ('. cli/Jicile toxin A was added at a concentration lethal te, hamsters and the miwurc was administered to hamsters via IP injection. li'thc recombinant protein contains mutraii~inL epitopes. the C"i~A antibodies would lose their ability m hind toxin A
resultin<.: in cliarrhea andior death of the hamsters.
1'he ttssav was pertermed as follows. The lethal dose of toxin A when cleliverect orally to nine ~tI) tee s0 g Golden Syrian hamsters (Sasco) was determined to he 10 to .i0 )tg. ~I~hc I'f:(i-purified C"1~A antibody preparation was diluted to O.sX concentration ti.e.. the antibodies were diluted at twice the original yolk volume) in 0.1 M carbonate hutti:r. pH
~).~. l'hc antibodies were diluted in carbonate butter to protect them from acid degradation in the stomach. I~hc concentration of O.~X was used becausr it was Iiluncl to he the lowest effective st) concentration against toxin A. 'hhc concentration of Interval 6-specific antibodies in the O.~X
C"1'A prep was estimated to he l0-IS Et~ItW (estimated using the mcti~od described in -hxample 1 S).

The inclusion body preparation (insoluble Interval 6 protein: pPA1870-?680(H)) and the soluble Interval G protein [pMA1870-2680; see Figure 1~~ were both compared for their ability to hind to neutralizing antibodies against C'. diJjicile toxin A
(CTA). Specifically. t to tn,.: ct(~ recombinant protein was mixed with ~ ml of a O,SX CTA antibody prep (estintated tel contain h(T-7() Ey of~ Interval (-specilic antibody'). rafter incubation for 1 hr at 37°C', CTA
(-l~rch I.abl at a final concentration of ,U Ltglml was added and incubated for another 1 hr at s7°C'. ()ne ml ctf this mixture containing: i0 Etg of toxin A (and 10-IS ttg of Interval C~-specitic antihc)cty was administered c)rally tet 40-j0 g (ioldcn Syrian hamsters (Sasco).
IW cclmhinant proteins that result in the loss of neutralizinf: capacity of the CTA antibody I () would indicate that those proteins contain neutralizing epitopcs.
Preimmune and CTA -antihcteties thctth at O.sX) without the addition of any recombinant protein served as negative and positive cuntrclls. respectively.
t ~~~1 other inclusion body preparations, hclth expressed as insoluble products in the p1:~1~ vector. ,verc tasted: one containin~~ a different insert (toxin t~
fragment) other titan I ~ Interval (1 called pPB 18>0-''U7() (see !=inure 1 ti) which serves as a contrcll tile insoluble Interval (. the cltlter was a truncated version of the Interval to region called pl'A I 87()-? I c)0 ( W a (~ i~~tlrr I _i13 ). ~t~he results of this experiment arc shown in ~l~ahlc ? I .

t31ttd111!_ ()1~ IVrlItralILllll AtltlbOdlcc Rv Snlmhl.. Inrnrv.,l /
O.~..r":., e....~.. r~...__.__ __ .. ..._... .....,.~rw _-, Treatment Group' Nealthv' .".""",. rumrs Diarrhea' Deud' E'reinlnnmc Ah () ; , <.' T'.1 r1 h :T I U

<'~I~A Ah - Int b (.soluble!I , , rwrA Ah !rat h (insoluble)s r) U

C'~T'A Ah + pP81850-3070 5 () C'TA Ah - pPA I R7U-2190 > 1) U

(' rlrJ/lrilc toxin A (CTA) eras added to each group.
Animals showed no si~~ns ell' illness.
'() Animals <tevetoprd diarrhea but did not die.
' Animals developed diarrhea and died.
1'rcimmune antibody was ineffective against toxin A. while anti-C'~I~.1 antlbodtes al a clilute O.~X concentration almost completely protected the hamster against the enterotoxic effects of C'TA. ~~he addition oi' recombinant proteins pPF3l 8iU-2070 or p1'A
1870-? I ~)0 to the anti-('TA antibod\' had no effect upon its protective ability, indicating that these recomhtnant proteins do nett hind tc) neutraltzlng antibodies. (>n the ctthcr hand. recombinant - 10, -Interval 6 protein was able to bind to neutralizing anti-CTA antibodies and neutralized the in riw~ protective effect of the anti-CTA antibodies. Four out of five animals in the group treated with anti-CTA antibodies mined with soluble lnterva! 6 protein exhibited toxin associated toxicity (diarrhea and death). Moreover. the results showed that Interval O protein 1111ISI he eaprcsscd as a soluble product in order I<Ir it to bind to neutralizing alai-C'hA
.11111h()dleS SInCC', the addition of insoluble Interval O protein had n~
effect on the nculrallzltlL
capacity o1' the C"rA antibody prep.
c) Determination Of Neutralization Ability Uf Antibodies Raised Against soluble And Insoluble 'Toxin A Repeat Immuno~cn l'u determine it' neutrafizin~~ antibodies are induced against soluhilizcd inclusion l,cuiies. insoluble toxin :1 repeat protein vas solubili~ed and specific antibodies were raised in cltickcns. Insoluble pl'A1870-?G8U protein was soluhilired usiy the method describccl in 1 ~ Vl,'illiam:; rml. ( 199s). .ctcprcr. I3rictlv. induced cultures (>()(> ml) were pcllctcd by ucntril~uzation at .i.()UO X g tim IU min at 4°('. 'The cell pellets were resusp cncicd thorouLltlv in IU ml elf inclusion hctdv sonication buffer ('_~ mM HI:PES pli 7.7. lt)U mM
KC'l. 1?., mM
MgC~I.. _'()'~,;~ Llvcerol. 0.1°/~ (viv) Nonidct I'-40. I mM I)T'I~).
T~It~ StlSpe1t51()II llvtS transferred tct a iU tttl non-glass centrifuge tube. Dive hundred EIl of ! () mgiml lvsowme was added and ?() the tubes were incubated on ice for 30 min. The suspension was then froien at -70°(' I'or at Fast I hr. ~l'hc suspension was thawed rapidly in a water bath at room W
ntpcrature and then placed on ice. The suspension was thrn sonicatcd using at least eight 1 s sec bursts of the microprobe (l3ranson Sonicator \lodel i~iu. ~4st.)) «ith intermittent cuoliry~
on ice.
The sunicatecl suspension was transferred to a 3> ml ()akrict~m tube and ccntril'ugcd at '_'j 0.000 X ~~ tier 10 min at ~t°(' to pellet the inclusion bodies.
The pellet was \vashed ? times by pipcttin~~ or vortexing in fresh. ice-cold RIPA buffer ~U.1% SUB. 1°.a>
Triton X-10(). 1°~~
,odium dcoxvcholatc in TE3S ('~ mM 'Iris-C1 pI-1 7.~. 1s0 mM Na('1)~. 'fhe inclusion bodies were reccntriftlged after cash wash. 'I'hc inclusion bodies were dried and transicrrcd using a small metal spatula to a l > ml tube ( Falconl. (>nc ml of 10'%~ BUS was added and the pellet ;(1 was soluhilircd by gently pipcttin~_ the solution up and down using a l ml micropipcttctr. 'I~hc SItIIIhIII'/.iltlUll w'LlS facilitated by beatify the sample to c)s°(' when necessary.
()nee the inclusion bodies were in solution. the samples were diluted with ~) volun tes of 1'(3S. ~I~hc protein solutions were dialyzed ovcrniLht against a 1 t)U-tiUd volume of I'13S
- lOcl -contaitiin~.: U.OS"/o SDS at room temperature. The dialysis buffer was then changed to PBS
containing U.O1'%" SDS and the samples were dialyzed for scvera) hours to overnight at room temperature. The samples w'cre stored at 4°C until used. Prior to further use. the sarnplcs were \varnted to room temperature to allow any precipitated S()~ to go back into solution.
~l~l)t' IItC'.IllSlOIt hodv preparation ~e'as Used to immunize hens. The protein was diai_vzed into I'135 and emulsified with approximately equal volumes of C(:A fitr the initial !tt)11tt1111La11C)It l)1' II~A for suhscCluent hooster immunizations. ()n day zero. for each of the recombinant recombinant preparations. l 'o egg laving white l.cehorn hens were each injected at multiple sites (IM and SC) with I mt of recombinant protein-acf.juvant mixture containing I() approximately U:a-1.~ mg oh recombinant protein. Booster immunizations of I.0 mg were ~~iv'rn oi~ days I-1 and day ?R. (ggs were collected on day i'? and the antibody isolated urine ('l:O as duacrihvCt in (:xample I~(a). Ilith titers of toxin'A specific antibodies were present' las assayed by I:l.l~,~. tISIItL lltl' Ittellt()d deSCrlheCl in F:vample 131.
'(~iters were detcrtttined file h<ah anti bodies against recombinant polypcptidcs pPn187()-?(t8U and pM/1187(1-?(t8U and 1 s were litund tc> h(: comparable at .~ ! :(?.a()0.
:lntihodi~s a;~ainU soluble Interval 6 (pMA 1870-?G8U) and insoluble interval () ~(inclttsion body). pl'i11870-?hBU~ were tested for ncutralizin~ abifitv against toxin A using the in nim assay described in (:xample 1>(h). frcimmune antibodies and atltlh(tdlel aLatltSl lU\llt :~ (('~1:'~) SeI'1'l:Cf ilv lleLalll\'e attd p(1SILIVe COnlr(tlS.
reSpCCt1\'el\'. ~lte 1'eStIltS a!'e SIt()41'It -~() Ilt hal,ll ~lllltl'~lill:lilllll ()t t~(1\I11 n (j\ /~Itllb(1(IIr'V Aminet Cnlmhl..
I~r"r.~..l ~ n..~...:.. m..,.i_ , _ _ ._.__... ...m rmcr Antibody it'eaunent Group h(ealth\' ..... .....v :-r IIVIIrS
t)iarrhcu~ Dead' I'reinununc I () :( CTn () 0 tnterv~ll 6 (Soluble)' ; () () Interval 6 (Insoluble) () , _ ;

AItInIiIIS Sh()wed no sign of illness.
?() ,animal developed diarrhea but did nltt die.
' /lnintal devcl«ped diarrhea and. die(l.
-l()(1 urn ml.
Antibodies raised against native toxin A were protective while prcimmune antibodies had little rffcct. r1s found usiy the in oi~ro C'HO assa\' [described in Example 8(d)j where antibodies raised against the soluble Interval O could partially itcutraliic the effects of~ toxin A.
here thry \verc able to completrly neutralize toxin A in virll. In contrast.
the antibodies raised against the insoluble Interval G was unable to neutralize the effects of toxin A in viva as shown above (Table ??) and In ri~rn as shown in the CHO assay described in Example 8(d) J.
These results demonstrate that soltthle toxin A repeat in7tnunogcn is necessary to induce the production of neutralizing antibodies in chickens. and that the generation of such soluble immunogen is obtained only with a specific expression vector (pMal) containing the tc)xin ~1 ry_ion spanning as 187U-3()8U. ~I~itat is to say. insoluble prUll'II7 tllal IS 51t171('C~UI:ItII~' W )IIIhIIILICI CtUCS 17l)I rcSUII ill a IUxln A an tigcn that -Ill elicll a IlellIralIZlltg allllt7UdV.

Cloning And Expression C>f The ('. cliJ)ioilr Toxin E3 (i'ene ~fhr toxin 13 gene has been cloned and sedue.~nced: the amino acid seduencc deduced t~rl)m the cle)ncd nuclcuticle seclucncc predicts a MVI~' ol' ?6c).7 I:I) li)r tcwin )3 ~ I3arroso m crl..
L; Vucl. ;lcicts I~es. 18:4U()4 (Ic)9U)). The nucleotide sectuence of the ec)dinl! rr'~ic)n e)f the entire twin f3 ~_rm is listed in SEQ 1D N():9. The amino acid sequence u1~ the entire toxin f3 protein Is listed in ~Ia? ID NO: l0. The amino acid seclucnce consisting of amino acid residues 1 tt~U through ?,()U of toxin f3 is (istcd in ~if:() lU N():l 1. ~I
he amino acid secluencc ce)nsistin~_ c)I~ amino acid residues 1750 through ?sGU of toxin f3 is listed in ~f:(,> IU N():l?.
'U (iiwn the expense and difficulty e)l~isolating native toxin B protein. it would he advanta~~ce>us to use simple and inexpensive prucarvotic expression systems to prc)ducc and ruril'v hi~~lt levels ut~ r~cc)mhinant toxin ii protein I~c)r immunization pureosca. I~leallv. the isolated 1't,'L'()111hltlalll prUlellt 14UU1(t hl S(tl11171C Ill UI'der to preserve native antigenicity. since solubili~rd inclusion body prc)teins otters du not ti)Id into native cclnt'ormations. indeed as shown in L.xam171c 17. neutralizing antihoctics against rrcctmhinant main A
were only obtained when sc)tuhie rccomhinant toxin A polypeptides were used as tile immunogcn.
~l~u allow case oh' purification. the rccomhinant protein should be expressed te) Imuls ~~reater than I mglliter of I:'. w~li culture.
fo clctermine whether bleb levels c)f recombinant toxin I3 protein ce)uld he l7roduced in () l.. onli. 1'ra<.:ments of the toxin I3 gene were clone=d into various prokaryotic c~cpressiott vectors. and aW(:SSCd tell' the ability to express recombinant tct~in 13 protein in I:. cc~li. 'l~his I'xample involved (a) cloning of the toxin E3 gene and (h) expression c)f the toxin I3 gene in I:. c~uli.

Cloning Of The Toxin B Gene The toxin B gene N~as cloned using PCR amplifecation from C'. cli~~icilc ~~enomic DNA.
Initially. the gene was cloned in twc~ overlapping tcagments. using primer pairs I'S/P6 and f'7/I'8. ~I~hr location of these primers along the toxin I3 gene is shown schematically in Figure i H. -t~ltc sequence of~ each of these primers is: I'>: ~' TAGA.AAAAATGGCAr'\tITG'I~ s' (SF;Q
II) N():1 I ): 1'(; s' TT'1'CATCTTCiTA GAGTCAAAG s' (SEQ ID NO:1?):
I'7: s' (~~11~(~CCAC'AAGA'fOA'I'TTAGTG ;' (SEQ 1D NO:I ,): and 1'8: ~' ('~fAA~fTGAGC'TGTA'1'C'AGGATC 3' (SEQ ID NC>:14).
Fipurc I R aISO SJt()1~'S the location of the followin~~ primers aloll~ the toxin f3 hem: I'9 Il) vyhich consists of the sequencr i' ('(iGAATTCCTA(iAAAAAA'f(:i(iCAA A~fCi s' (SIrQ ID
N():I~): I'lU which consists ot~the sequence ~' CiCI~C'TAGAATOA
C'C:ATAA<iC:T:\C.iCCr1 ~' (~I:Q 1U N(>:I6): I'1 1 l4ltlCll C(lllSIStS (tf the sequence s' ('(i(ir\~1~1"I'(.'(ii\C'rT'f(iCi~fACiAAA(iCiTGGA i' I~I~Q lU N():17): PI i vy111Ch C(111SIStS Ot tire srcluenc~ s' ('(:r(iAA'I"fC'CiC~TI~ATT'ATCT'I'AA(iGATCi 3' (51:Q 1D
N():18): and I'14 I s which consists of the sequence s' C'(iCiAATTCTTGATAf\CTGGA~f TTGT'GAC' >' (SF:Q ID
V(): I ~)). ~l~hc amino acid scclucncc consisting of amino acid residues I R52 throuLh ? iO? ol' toxin L3 is listed in SfQ IU NO:?U. l~he amino acid sequence consisting ctf amino acid residues 17ss through ? i6'? of toxin 13 is listed in SEQ fU N():?l .
('lo.clriclirrnr cliJ~ioile~ VPI strain IU4G; was obtained t'rctnt ihc r\merican Type Culture ?(1 ('ollcction li\'fC'C' -l;?;i) and ~~rovyn under anaerobic; conditiow in hrain-heart int~usiun medium (Becton Uicl:iltsonl. Hi~_h molecular-weight ('. cliJ~icile DNA vyas isolated esSe11t1aIIV
as drscrihecl [ ~4'ren and Tahaclchali ( 1 c)R7) .f. C lip. ~~licrohiol..
'?s:?4()'' J. except I ) 1 ()U EtI:/ml protrinasr h in t).s",~s SDS Ovals used to disrupt the bacteria and 2) cetytrilnethylammonlum hrotnidc (('~I~AIi) precipitation Jas described by Ausuhcl e~ crl.. (=ds..
('rrrrern I'rvnncols irr .1-lulerulcw I3imln,~t~, Vol. ? ( 1980) ('urrent I'rotoculs) was used to remove carbohydrates from the cleared lysatc. l3rietly. atier disruption of the hacteria with protcinasc K and SDS. the solution is adjusted to approximately 0.7 M NaCI by the addition of a II7 volume of SM
NaC:I. :\ 1110 yoiun tc o1' CTAI3/NaCI ( 10% C:'I'A13 in U.7 M NaC.'I) solution was added and the sulttti~n was mixed thorou~_hlv and incubated 10 min at 65°C'. An tclual yolultt~ of c:hlon~lorlmisoamyl alcohol (?q:l l vyas added and the phases were thoroughly mixed. The or~~anic and aqueous phases were syarated by centrifugation in a nticrof'uec for i min. '1-hc aqueous supernatant was renewed and ewracted with phenol/chlorotorm/ isoamyl alcohol l'~:?~: I ). The phases were separated by centrifugation in a microt'us~c for > min. The WO 981x8540 PCT/US97115394 supernatant was transferred to a fresh tube and the DNA was precipitated with isopropanol.
'Che DNA precipitate was pelleted by brief centrifugation in a microtilgc. The DNA pellet was washed with 70~/> ethanol to re111oVe residual C~I'llL3. The DNA pellet was then dried and redissulved in TI: buffer ( 1(I mM Tris-FOCI pFIB.U. I mM IDTA). The integrity anti yield c>1~ renotnic DNA was assessed by comparison whit a serial dilution c)f uncut lambda UNA alter electruphuresis on an agarose gel.
'fovin I3 I'ragmcnts were cloned by 1'CR utilizing a prouf~rcadittg thermustahle UNA
lulymcrasc ~nativc l'/ir pulvmerasc (~tratagene)). 'I'hc hi~~h lidcliw c)f this polvmcrase reduces the mutation prl>h1tI17S aSSOClated with amplilicatiun by e:rrc)r prune pulvmerascs (c~.,c,~., I () 7irc) pc)lymerascl. 1'CR amplification was performed using the 1'('R
primer pairs I'> (SI:(,) IU
N(~:I I 1 with I'G (St:Q In N():1?) and I'7 (SI:Q ID i~():13) with I'8 (~l:Q
ID N():14) in ~0 )Il reactions cuntainin~~ I() mM Tris-I1('1 pH8.3. >U mM KC'I. 1.; ntM1 1~I~~C'I,. ?UO EtM c)f' rash d\'1~P. ().? EIM caclt primer. and .iU n~: ('. cli//ioilr ~~enumic I)NA, IW actic)ns were overlaid with IU() Itl mineral oil. heated to 94°C li)r d min. l).>Itl native I'lir pulvmerase 1 ~ (Strata«cnrl was added. and the reactions were cycled 30 11111cs at ~)4°(' li)r t min. S()°(' fi)r I
rain. 7''°C' (? min fi)r each kh c)1'scctuencc to he arttpliticd).
fi)llumed by I(1 min at 7?°C'.
1)upficate reactions were pooled. chlurutitrm c~ctractcd. and ethanol precipitated. otter washin~_ in 7(>"/« Uhanul. the prllets wrr~ rcsuspcndcd in s(1 Itl 'fl~.
huf'ler ( 1 () m~1 1'ris-f lC'I
pl~R.(l. 1 n1M rU'1'A).
'_() 'I'hc I';IPI) ampiificatietn product was cloned into p(!('Ic) as outlined below. lUyl aliyuots <)I' UNA were gel purified using the Prep-a-(ienc kit (f3iuRaH). and Il;~ate:d to .~'mcrl restricted plJ(' 1 ~) vector. Itecc)mhinant clones were isolated and coot firmed by restriction ~fi~_estiun usin!~ standard rccumhinant molecular hiuluev techniques (~arnhruok cn crl.. Ic)89).
Inserts flotm twct independent isolates were identified I11 WIIICh II)e 111\111 13 insrrt was oriented '_'i arch that the vector l3crrrrlll and .5'crrl sites were ~~ anct s' c)ricntrd. respcctivelv (pl~(.'Rl()-1 i iU). The insert-containing l3crrol-IILScre~l fragment way cloned into similarly cut ph'f?3a-vector DNA, and protein expressi<)n was induced in small scale cultures I s ml ) of identif ied l:lt)lleS.
-IU)tal protein extracts were isolated. resolved on ~U~-I'A(iL ~_els. and toxin 13 protein ;() identilied by V~'cstern analysis utilizing a goat anti-toxin l~ a1'tinitv purified antihctdv (Tech l.ab). Procedures ibr protein induction. SI)~-PA(ib;. and WcsW rn blot analysis were perti)rmed as described in Vv'illiams ur crl. ( 1990. .srrl)rcr. In brief. s ml cultures of bacteria grown in ?XYT containing I UU Etgiml ampicillin containin~~ the appropriate recumhinant clone WO 9$/08540 PCT/US97/15394 were induced to express recombinant protein by addition of IPTG to f mM. The ~. cvli hosts used were: BL21(DES) or BL21(DE3)LysS (Nova~!en) for pET plasmids.
(.'allures were induced by the addition of IPTCT to a tinal concentration of I
.0 mM
when the cell density reached 0.~ OD,,,H,. and induced protein was allowed to accumulate for two hrs alter induction. Protein samples were prepared by pelletin g 1 1111 aliquots of bacteria by centritit~~ation ( 1 min in microfuge). and resuspension of the petleted bacteria in I50 f.tl of ' '_'~ SOS-I'ACiC sample buffer (0.12 mM Tris-HCI pH G.8. '_' mM ED'rA. ~'%
SI)S. 20%
gfyccrcll. ().0?S'% hromophenol blue; (3-mercaptoethanol is added to i% hetore use). The samples were boated to ~)>°C for ~ min, then cooled and s or IO ~t(s loaded on 7.S% SDS-lU PA(iL gels. high molecular weiLht protein markers (BioRad) were also loaded. to allow estimation ut' the MVV «t~ identified tilsion proteins. After electrophoresis.
protein was detected either Lcnerallv by stainine the gels with C.'oc»nassie Blue. or specifically. by blotting t« nitroccllulos~ tier Western blot detection of specific inttounoreactive protein. The MW et' induc:cd twin li rcaclivr protein allowed the integrity ut' the toxin I3 reading ti-ame to he 1~ determined.
The pl:~I~?:h recombinant (pI'B1U-I~30) expressed hiLh MVv' recombinant toxin Q
reactive hrmein. ccmsistent with predicted values. 'hhis confirmed that ti~ame tcnninatin~
errors had not occurred durin~_ I'C'R amplification. :~ ph;T'? ~h expression clone containing the I()-17s()aa interval uf~ the toxin F3 gene was constructed. by fLlsloll of the F.cmItV-,Syel t'ra~~mrnt of the I'7!1'8 amplification product to the l'>-L~w~RV interval c~f the ('~!I'G
amplification product Isee I~i~~ure 18) in pl'BI()-ISSU. The inteLritv oflhls clone lpPRl()-17;0) m,ls confirmed by restriction mapping. and Western hint detection of~
expressed recc>mhinant toxin E3 nr<nein. !_cvels of induced protein li~nm both pPI310-li;() and pPBlO-17>() were teu~ low to facilitate purification of usable amounts ol~
recombinant toxin I3 protein.
'I~hc remainin~~ 1760-2 iO0 as interval was directly cloned lllto pMAI_ or pl;T expression vectors ti'(1111 the I'7/('H amplification product as described below.
b) I:xprcssiun Of The Toxin t3 C:ene i) ()vervicw ()f Expression Metlmdulo~ies fragments of the torin E3 gene were expressed as eitlZer native or fuSll)Il pr(7te111S Ill E.
cwli. Native prcUCins were expressed in either the pT_'r?sa-c or plTlOh expression vectors (Nova~~en). T'Ite pl:T?i vectors contain an extensive polylinker sequence in all three reading ii~amcs (a-r vectors) followed by a C.'-terminal poly-histidinc repeat. The pl:TlGh vector WO 98/08540 PCTIUS97/t5394 contains a N-terminal poly-histidine sequence immediately ~' to a small potylinker. The poly-histidine sequence binds to Ni-Chelate columns and allows affinity purification of tagged tarLet proteins (Williams m ul. ( 1995). .s:rprcr(. '1'hcse affinity tags arc small ( 10 as for pETICh. ( as tbr pET2s) allowing the expression and affinity purification oi~
native proteins s with only limited amounts of foreign sequences.
An N-terminal histidine-tagged derivative of pL'l~l(b containing an extensive cloning cassette was constructed to facilitate cloning of N-terminal poly-histidine tagged toxin 13 expressing constructs. This was aceompiished by replacement of the promoter region oi' the pl.'f?3a and h vectors with that of the pETIGb expression vector. I~,ach vector was restricted I() with 13,i,~111 and r1'd~~l. and cite reactions resolved on a 1.2 % agarosc gel. The pE:Tl6b promoter region (contained in a 200 by I3,s,~1I1-l~'cle~l fragment) and the promoter-Icss pET?3 a or h vectors were cut from the gel. mixed and Prep-A-Cicn c (RioRad) purified.
The eluted DNA gas ligated. and transtbnnants screened for promoter replacement by ;\mr!
digestion «1~
purified plasmid DNA (the pETIGh promoter contains this sltc. the pE'r':
pr~mater does l s not). -these clones (denoted pETI-Iisa or b) contain the pL~f 1Gh promoter (consisting ol~ a p~I~7-lac promoter. rihosome binding site and poly-histidinc ( I()aa) sequence) fused at the ~Vdc~l site to tlm cWensive pE'f2 i polylinker.
All Mi3P fusion proteins were constructed and expressed in the pMAI.'"-c or pMAI.'"-h? vectors (New England E3iolahs) in which the protein of interest is expressed as a ?f) C.'-terminal fusion with MC3f. All pET plasmids u-crc expressed in either the R1.?1(I)ES) or RL? l ( I)lr s )I,yS repression hosts, while pMal plasmids were expressed in the 131.? I host.
f.ar~_o scale (s()t) mls to i liter) cultures of each recombinant were grown in ?~ ~"(' heath. induced. and soluble protein fractions were isolated as described ( Wiiliams. et al.
( 1995). .wrhrcr). 'I"hc soluble protein extracts were aftiniy chromatographed to isolate ?5 recombinant tilsion protein,. as described (Wiltiams et ul.. ( 1995) .srrpr-u(. In hrief~. extracts containin~~ tagged pE'1' fusions were chromatographed on a nickel chclatc coiunm, and eluted using imidazole salts or low pEl (pll 4.()) as described by the distributor (NovaLCn or (~iagen).
E~:xtracts containing soluble pMAI, fusion protein were prepared and chrornatc>s~raphcd in 1'R~
huffier over an amvlose resin (New f=ngland Riolahs) column. and eluted with Pf3S containin~_ ;() 10 mM maltose as described ( Williams er ul. ( 199i). .srq~ru~.

ii) Overview Of Toxin B Expression in both large expression constructs described in (a) above. only low level (i.e., less than 1 mg/liter oC intact or nondegraded recombinant protein) expression oC
recombinant protein was detected. A number of expression constructs containing smaller fragments of the toxin F3 gene were then constructed. to determine if small regions of the gene can be expressed tn high levels (i.e.. ~~reater than 1 mg/liter intact protein) without extensive protein ' clcgradation. ;111 were constructed by in frame fusions of convenient toxin Q restriction !'ragmenis to either the pMAL-r. pL:T?3a-c, pL:Tl6h or pCTIlisa-b expression vectors. or b_v engineering restriction sites at specific locations using PCR amplification [using the same l() conditions described in (a) ahove[. In all cases. clones were verified by restriction mapping.
and. where indicated. DNA scquencin~;.
Protein preparations from induced cultures of each ol' these constructs were analyzed.
by ~I)~-1'i1(il~:. W estimate protein stahilitv (C:oomassic lilac staining) and immunc~reactiviw_ against anti-toxin 13 spccilic antiserum t Western analysist. higher levels of intact (i.r., ru>ndcgradcd). t'ull Icn~~th !'union proteins were observed with the smaller constructs as compared with the larger recombinants, and a series of exprcssiun constructs spanning the entire toxin l3 gene were constructed ( Figures I $. 19 and ?() and 1'ablr ?
3).
(.'onstructs that expressed significant levels of recombinant toxin !3 protein (greater than I ntgilitcr intact recomhinant protein) in I'. cwli were identified and a series of these clones that spans the toxin B gene arc shown in Figure t c) and summarised in '!'ably ? 3.
-I'hesr c:luncs were utilized W isolate pure toxin B recombinant preUcin f'rorn the entire totin L3 gem. ~i'~niticant protein yields were obtained from pM.4L. mpression constructs spanning the mtirc toxin l3 gene. and yields of f'trll length soluble fusion protein ranted ti-om an estimated I m!,:ilitcr culture (pMfil 1()()-1 ~_;0) to greater than ''() mgilitcr culture (pMB17~0-?36U).
Representative purifications of MBP and poly-histidine-tagged toxin E3 recombinants are shown in figures '?1 and '_'~. l~igurc ?1 shows a C'oomassie Blue stained 7.s".% SDS-PlUlL: ~.:ul on which various protein scunples extracted fi~om hactcria harboring ph-111$i()-36(t were rlectrophoresed. ~ampics were loaded as follows: lane i : protein extracted from uninctuced culture: l_anc ?: induced culture protein: lane ;: total protein t'rom induced cultttrc 3() lll~ter S()111CalrUn: Lane ~4: soluble protein: and Lane ~: eluted affinity purified protein. Fi~~ure ?? depicts the purification ol' recombinant proteins expressed in bacteria harboring either pPB I 8~()-3301 ( Lanes 1-3 ) or pPB 1760-2 3b0 ( Lanes 4-O). Samples were loaded as fol lows:
uninduced total protein ( Lanes 1 and 4): induced total protein ( Lanes '_' and ~): and eluted aftiniy purified protein (Lanes 3 and G). The broad ranLe molecular weiLht protein markers (Bioltad) are shown in Lane 7.
thus. although high level expression was not attained using large expression constructs from the toxin B gene. usable levels of recombinant protein w~cre obtained by isolating induced protein from a series of smaller pMAL expression constructs that span the entire toxin I3 gene.
Thcsc results represent the first demonstration of the feasibility of expressing recombinant toxin B protein to high levels in E. culr. :\s well_ mpression ol' Slllall t'eglUilS Uf the putative ligand binding domain (repeat region) of toxin B as native protein yielded 1() insoluble protein, while large constructs. or fusions to MBI' were soluble (ligurc 19), demonstrating that specific methodologies arc necessary to produce soluble fusion protein t~rom this interval.
iii) Clone Construction And Cxpression Details 1 ~ .~\ portion of the toxin Ii acne containing the toxin B repeat region ~aminu :ICid residues 1X~2_?362 of toxin f3 (SI:Q IU N():2U)~ was isolated by I'C:R
ampliticaticm of this interval of the toxin B gene from ('. cliJ~irile renomic UNfI. The scyuencr, and location within the toxin Ii gene, of the m~o I'C'R primers ~P7 (~t(~ fU N():l ;) and I'ti (S1-:Q It) N():1~)~ used to amplify this red=ion arc shown in figure l~.
?() UNA From the I'C.'R amplification was purified by chloroform extraction and ethanol precipitation as described above. The UNA was restricted with .\prl. and the cleaved U'Vn was resolved by agarose gel electrophoresis. 'I~he restriction di~.:esti~m with .~prl cleaved the s.b kb amplitication pmduet into a 1.8 kb doublet band. This dcrublm band was cut from the gtl and mixed with appropriately cut. gel puritied pMALc or pFT?.pb vector.
These vectors '_'~ were prepared by digestion vyith flincIIlI. tilling in the overhanging ends using the Klenow enzyme. and cleaving with .t7xrl (pMllLc) or NhcU Ipp.T?~b). 'fhe gel purified UNA
I~ragmcnta were purified using the Prep-A-Ciene kit (E3ioRad) and the i)NA was ligated.
transformed and putative recombinant clones analyzccl by restriction mappin~~.
pf:~l~ and pMal clop cs containing the toxin B repeat insert (aa interval 17sU-2 36t) of s() tr~xin t3) were verified by restriction mapping. using enzymes that cleaved specific sites within the toxin (3 region. In both cases fusion of the toxin t3 .~pe~l site with either the compatible l7orl site (pMa.l) or compatible .\'hc~l site (pET) is predicted to create an in frame fusion. This was cuntirmed in the case of the pMB175U-2360 clone by 1)NA scyuencing of the clone _ I I? _ a PCT/US97115394 ,junction and 5' end of the toxin Li insert using a MBP specific primer (New England Biolabs). In the case of the pET construct. the fusion of the blunt ended toxin I3 3' end to the tilled NincIIII site should create an in-frame fusion with the C-terminal poly-histidine sequence in this vector. The pPB 1750-2360 clone selected had lust. as predicted. the Hirrcllll site at this clone ,junction: this eliminated the possibility that an additional adenosine residue was added to the s' end of the PCR product by a terminal transferase activity of the PJir ' polymerise. since fusion of this adenosine residue to the tilled Hiracl(II
site would regenerate the restriction site (and was ohserved in several clones).
()nc liter cultures of each expression construct were grown. and fusion protein puriticd 1() by af'tiniy rhromatoeraphy cm either an amylase resin column (pMAI.
constructs: resin supplied by New L:ngland L3iolabs) or Ni-chelate column (pE~f constructs:
resin supplied hs~
(>iagcn or Ncwagen) as descrihcd (VJilliams c~ ul. (199~)..srrlr-crj. The integrity and purity of the fusion proteins were determined by C'uomassie stainin g of SUS-1'A(if~
protein gels as well as Vl'estern hlm analysis with either an affinity puriticd goat polvclonal antiserum ('fcch L.ab).
1 ~ ur .c chicken polvclunal I'E(i prep. raised against the toxin Ii protein (CTI3) as described ahoy in I:aamplc 8. In both cases. affinity purification resulted in yields in excess of 2() m~~
protein per liter culture. of which greater than c)U% was estimated to hc;
lull-lell~_th recomhinant protein. It should he noted that the poly-histidine afliniW tagged prmein was released ti~c~m the (~iaem Ni-NTA resin at low imidaTOle concentration ((O) mM).
neccssitatinL the uw ol~ a ~l0 mM imidazule rather than a 60 mM imidazole wash step during purification.
:1 periplasmicallv secreted version of pMI31750-? 360 was constructed by replacement ot~ the promoter and MI31' cc~ctin~~ rc~=ion ot~ this construct with that from a related vector (pMill.~v-p'': Nmv l~yland l3iolabs) in which a signal seduenec is present at the N-terminus of the Mt31'. such that fusion protein is exported. This was accomplished by substitutine a I3,L~lI1-l:cwRV promoter fragment from pMAL.-p~ into pM131750-2 36(). The yields of secreted.
affiniy purified protein (recovered from osmotic shock extracts as described by ftiggs in ( 'rrurc-nr I'rrnucvrlv in A~Ir)IeL'irllrr' I3inlrr,~~u. Vol. 2. Ausubel. cn crl.. Lids. ( 1989). C.'urrcnt Protocols. pp. I 0.6.1 - 16.6.14] tt'om this vector (pML3p1750-? 36()) were 6.5 mg/liter culture.
;() of which ;()°/. was estimated to be lull-length fusion protein, _ ~I~hc interval was also expressed in two non-overlapping t~ra~;rnents.
pMI31750-lc)7() was cc~nstructcd by introduction of a t~ameshift into pMfi 1750-2 360. by rcstricaion with llincllll. tilling in the overhanging ends and rcligation of the plasmid.
Recombinant clones were selected by IUSS Ut' the HinclIlI site, and further restriction map analysis. Recombinant protein expression t'rom this vector was more than 20 mglliter ol' greater than 90% pure protein.
The complementary region was expressed in pMB 1970-2360. 'This construct was created by removal of the 170-1970 interval at' pMR 17>U-23OU. This was accomplished by restriction of this plasmid with EewRI (in the pMalc pulylinker ~' to the insert) and III, tilling in the overhanging ends. and religation of the plasmid. The resultant plasmid.
pMB 1 c)7U-2360, was made using both intracellularly and secreted versions of the p~ti31750-2 3(iU vector.
No fusion protein was secreted in the pMBp197U-2360 version. perhaps due to a 1l) ~onti~rmational constraint that prevents export of the t'USIOIl protein. l lowever, the intracellularly expressed vector produced greater than ~4Umg/(iter ot~ greater than 90°/, full-length t'usic~n protein.
('unstructs to precisely express the toxin t3 repeats in either pMalc (pMBl8S()-2 3(iU) or pl:~I~ l Oh ( pl'I318s0-? 3GU) were constructed as follows. The I)N~ interval includinL the toxin I ~ B repeats was I'CR amplified as described above utilizing t'C'f2 primers f 14 (~i-:~) II) N():19) and I'R (~I-:(~ IU Nt>:I~t). I'rirner f'14 adds a F,'cwRl site inunediatelv tlanking the surrt uf'the toxin fi rcprats.
The amplified t~ragment was cloned into the FiI'7 Blue I-vector (Novagen) and l'CC()Illblllflllt clones in which single copies ot~ the PCR tragment were inserted in either 't) orientation were selected (p~l'71850-2 36U) and confirmed by restriction mapping. ~1'he insert was mined t'rom nvo appropriately oriented independently isolated p'I'71830-2300 plasmlds.
with I~W~ItI (s' end of repeats) and I'.vtl lin the t7anking polvlinker ot~
the vector). and cloned into i:cwRl/I'.wl cleaved pMalc vector. The resulting construct (pMB1850-23OU) was confirmed by restriction analysis. and yielded ?U mg/l of soluble tilsion protein [greater titan 9U% intact (i.e.. nondes!raded)J after af'tinity chromatography. Restriction uf' this plasmid with l-lif~cllll and religation of the vector resulted in the removal of the 1 c)70-33OU interval. The resultant construct (pMB185U-lc)70) expressed greater than 7U mg/liter ot'c)Uc ~~ lilll length ('union hrutein.

The pPB1850-2360 construct was made by cloning a EroR1 (filled with Klenow)-l3crmHI fragment from a pT71850-2360 vector (opposite orientation to that used in the pMF31850-2360 construction) into Vilc~I (filled)/l3umH1 cleaved pETl6b vector.
Yields of affinity purif7cd soluble fusion protein were 15 mg/[iter. 01' greater than 90% full length f~USIUII protein.
Several smaller expression constructs from tl~e 1750-2070 interval were also ' constructed in Ills-tagged pET vectors. but expression of these plasmids in the BL21 (DE3) host resulted in the production of high levels of mostly insoluble protein (see Table 23 and Figure l ')). These constructs were made as follows.
pPB1850=1970 was constructed by cloning a B,~lI1-HincIlIl fragment of pPB1850-into I3,~~III,'IfirxJIlI cleaved pl:T236 vector. pPB185U-2070 was constructed by cloning a R,t,~/Il-I'mUl fragment of pPB 1850-?3G0 into B~~IIIIHincll cleaved pI:T2 3h vector. pPB [ 750-1')70(c1 was constructed by removal of the internal Hincl<I1 fragment ofa pPR1750-3360 vector in which the vector HincIlll site was regenerated during cloning (presumably by the 1 ? addition of~ an A residue to the amplified I'(.'R product by terminal transterase activity of I'Jir l~olvmerase). The pPB1750-1970(n) construct was made by insertion ol'the insert containing the ;~~clc I-fliucJ111 fragment of pPB! 750-2 3C0 into identically cleaved pETHish vector. All constructs were confirmed by restriction digestion.
An expression construct that directs expression of the 10-470 as interval of toxin Ii -20 was constructed in the pM ale vector as follows. A Nlre~1 (a site 5' to the insert in the pf:T2 3 vectors-,-1/IIl (filled) fragment of the toxin B gene fram pPBIU-[SS0 was cloned into ,.L?~crl tc:cuopatihlc with a1'hc~1)IHincllll (filled) pMalc vector. The integrity of the construct tpMRlO--l7(l) was verified by restriction mapping and DNA sequencing of the 5' clone .junction using a MBP specific DNA primer (New England Biolabs). Ilowever. all expressed protein was 25 degraded to the MBP monomer MW.
A second construct spartnins~ this interval (aa 10-470) was constructed by cloning the I'C:R amplification product from a reaction containing the Pc) (SEQ ID NUNS}
and P10 (SI:(~
Il) N():l6) primers (Figure IR) into the pETI-Iisa vector. This was accomplished by cloning the P('R product as an F.'caRl-blunt fragment into F.coRl-Hir~rll restricted vector DNA;
30 recombinant clones were verified by restriction mapping. Although this construct (pPBlO-
5?0) allowed expression and purification (utilizing the N-terminal polyhistidine affinity tag) of intact fusion protein, yields were estimated at less than 500 ftg per liter culture.

Higher yield of recombinant protein from this interval (aa 1 ()-~?0) were obtained by expression of the interval in two overlapping, clones. The 10-330aa interval was cloned in both pE~.THisa and pMalc vectors. using the l3umHl-.~1~I(I1 (filled) DNA
fragment ti'om pI'R10-~?0. l'his fragment was cloned into Buml-11-Nincllll (filled) restricted pMalc or l3unrHl-llincll restricted pL:THisa vector. Recombinant clones were verified by restriction mapping. f Iigh level exprcwion of either insoluble (pL;7~) or soluble (pMal) lilsion protein was ohtained. 'total yields ef fusion protein li'om the pMBlO-33U construct (Figure lIi) were 20'mg/litcr culture.
eh which 1 ()'% was estimated to be full-length fusion protein. :~Ithoug.h yields of this interval were hie:her and -()0% full-length recombinant protein produced when expressed from the 11) pFT construct. the pMal fusion was utilized since the expressed protein \vas sotublc and thus n~orc likely to have the native conformation.
The pMB260-520 clone was constructed by cloning l:ruRl-.l~hcrt cleaved amplified I)NA t'rom a I'CR reaction containing the !'11 (SE:Q li) N():17) and 1'IU
(~I=Q ID N():1h) f)NA primers (Figure 18) into similarly restricted pMalc vector. Yields ol~afiinitv purified I s protein were I0 mg/liter. of which approximately 50% was estimated to hr full-length recombinant protein.
'hhc aai 10-1 1 1 U interval was expressed as described below. This entire interval was expressed as a pMal fusion by cloning the rVhrl-IlincIlll fragment ef pllClilO-153() into ,t7or1-Ilinclfll cleaved pMalc vector. The integrity of the construct (pME3510-111()) was verified by 20 restricti(In mapping and DNA scquencin g of the ~' clone junction using a MBI' specific 1)N.~
primer. The yield o1' affinity purified protein was ?~ mglliter culture. oi~
which ~':~, was estimated u~ he tilll-length lilsion protein ( i 111g/lltel'I.
l~t) altelllpt t(7 l7hlilln 111L11er \'IrldS. this m~ion \.vas expressed II1 I\\() ti'agmrnts (aaJ 10-820. and !~?0-1 110) in the pMalc vector. ~fhe pME3510-820 clone was cnnstructed by insertion of a .S'crc'1 (in the pMalc polylinker s' to the insert)-Illul L)NA
fragment from pMB5l0-1 1 10 into .S'crclhSlrrl restricted pMalc vector. The pME382(1-t 1 IO
vector was constructed by insertion of the llpui-llincllll fragment el~ pll(.'R10-I i;0 into I3crrnHl (filled) Ilinclfll cleaved pMalc vector. ~l'he integrity of these constructs were verified by restriction mapping and DNA sequencing of the ~' clone ,lLIlleIl()Il LISIIIL a MIiP
specific DNA pritncr.
s0 Recombinant protein expressed from the pME3510-820 vector \~~as highly unstable.
Ilowcvcr. high levels (20 mg/liter) of =~()0'% Dull-tengtls fusion preucin w~rrc e~btaincd i'rom the pMBf320-1105 construct. The combination of partially degraded pMB51(1-111() protein WO 9t310t3540 PCTIUS97115394 (enriched for the S 10-820 interval) with the pMB820-1 1 ! 0 protein provides usable amounts oC
recombinant antigen from this interval.
The aa1100-1750 interval was expressed as described below. The entire interval was expressed in the pMalc vector tcom a construct in which the ,4ccl(filled)-.Sjwl fragment of pPBlO-1750 was inserted into .S~arl/.lhcrl (Xhal is compatible with .Sj~el:
.Surf and filled Acct sites are both blunt ended) restricted pMalc. The integrity of this construct (pMBI 100-1750) was verified by restriction mapping and DNA sequencing of the clone .junction using a MBP
specific DNA primer. Although IS mg/liter of affinity purified protein was isolated from cells harborin~~ this construct, the protein was greater titan 99"/, degraded to MI3P monomer size.
I() A smaller derivative ofpMB110()-1750 was constructed by restriction ofpMBI100-1750 with ,4j11I and .Serif (in the pMalc pofylinker ;' to the insert).
filling in the overhanging ends. and rclieating the plasmid. The resultant clone (verified by restriction digestion and 1)NA arc.luencing) has deleted the aal 5,0-1750 interval. wls designated pM131 100-1 S >0.
pnlti 1 1 UO- I 530 expressed recombinant protein at a yield of greater than ~0 tnglliter. of which I ' ;°i~> was ~stimate~i to b~ full-length fusion protein.
-hhrec constructs were made to express the remaining interval. Initially. a L3.~pHI
(tilled)-.~p-I twagmcnt from pl'B10-1750 was cloned into EcnRl(lilled)L~hcr1 cleaved pMalc vector. 1'he integrity of this construct (pMB157U-1750) ~,~as verified by restriction mapping and DNA scqucncine of the 5' clone.junction usinL a MBI' specific DNA primer.
Erpression 'O ot~ recomhinant protein from this plasmid was very low. approximately i mg affinity purified protein per liter. and most was degraded to MBP monomer site. This region was subscducntly expressed from a I'('R amplified DNA fragment. :1 I'CR reaction utilizing primers 1'IS ~SEQ ID N():18: Pls was engineered to introduce an EcoR1 site s' to amplified t«xin 13 scducnceaj and 1'8 (S1:(,~ ID N():14) was performed on ('. clijjicilc-penomic I)NA as -'S described ahoy. The amplified tcagment was cleaved with EcwRI and .SJ~cp.
and cloned into f:cwRi/.17m1 cleaved pMalc vector. The resultant clone (pMB1530-1710) was verified by restriction map analysts, and recombinant protein was expressed and purified.
~l~hc yield was ~~rcatcr than ?0 mg protein per liter culture and it was estimated that 25"/"
was full-Iens_th fusion protein: this was a significantly higher yield than the ori~!in.~l pMi3157()-1750 Clottc.
e(1 The insert of'pMf31S30-1750 (in a EcnRl-Scrll fragment) was transferred to fife pLTfiisa vector (Ec~oRll.i'lrul cleaved. .l?ml and .ScrlI ends are compatible). No detectable fusion protein was purified on Ni-Chelate columns from soluble lysates ol' cells induced to express fusion protein from this construct.

Summary Of Toxin B Expression Constructs'' Clone Affinity 'fagYield (mglliter) "
,~ hull Length pPBlO-17j0 none low (estimated , from Western plot hyh.) pPBlO-I5;0 none low (as above) ~

pMB 10-t70 MBP I smyl ' 0,0 pl'B I ll-52U poly-his O.sm'el ''0/"

I,('t110-330 poly-his ~20m'ml (insoluble)90i~

Ir:lll3 / r)-j3rlA4L3P ? rl nr,tvl I rl'.'6, I 0 lnt~l3?fil!-~3U A1BP l unr,x~l lrAll35I0- I A4f3P '.inr,~vl j ,;;
l 111 pMl3s 10-830 MBP degraded (bv Western blot h~~bl h t 113,~~'rl-! ,1llJl' 'rlnr,sel 'NJ.~,.
t I r) pMBI 100-17;0 MBP I~mg~l 0"r I J lr.lll3lll)I)-Ij3l)A4BP .lumt~l j;;, IMBIi70-)7i0 MBP 3nterl ' ;"i~

pl'BIS.iO-1760 poly-his no purified protein detected y t1131 s;rl-l ~L1I3P ?r)nrs,'il -ill h l lt~ l;a- A~l~h ~ ~n~rr,,.,;1 ~ no~i, ~.~r a ?() i,Mf3p17;0-?3G0 MBP 6.smail (secreted) pl'B 1710-336() poly-his .'_Om;~il ~90%

pM B I 7s0- I M BP .,(hn", I
c)70 [,Mfi I X70-23fi0MBI' 4(hngi I v)0iu pMBplc)70-33GU MLIf' (no secretion) NA

pMf1 t Ai0-?360 MBP ''Om~ll ~90/.

pPB I 850-?360 polyh is I ~nr'~ I ,~)0%

rMB I HSO- I MBP 70ma~1 ~90/~

pPt318>0-1970 poly-his ~IOmt:'I (insoluhlt:)~c)0.;, pPBi8~0-2070 poly-his ~IOtn,;il (insoluble)~)0'~~

?() p('B17s0-Ic)70(c)poly-his Illm,.rl (insoluble)c)0/.

pl'Bl7s()-1970(n)poly-his ~IOmg.l tinsoluhlelv)U%

C.'lones in italics are clonea currently utilized to purify reconthinant protein from each selected interval.
ij Identification. I'uritication And Induction ()f Neutralizin g Antibodies Against Recombinant C'. clif~icilc~ Toxin B Protein ~t~o determine whether recombinant toxin B polvpeptide tcagments can ~~enerate neutralizing antibodies, ypically animals would first be immunized with recombinant proteins and anti-recombinant antibodies are ~rnerated. These anti-recombinant protein antibodies arc then tested for neutralizing ability in aiuu or irt airr«. f)cpendin~ on the intmunogenic nature of the mcomhinant polypcptide. the Leneration of high-titer antibodies against that protein IU may take several months. To accelerate this process and identify which recombinant Itolypeptide(s) may he the best candidate to generate neutralizing alltlbodles. dr_~pleticm studies wcr~ Imrformecf. ~peciticallv. recomhinant toxin B polypeptide were pre-screened by testinc vyhcthcr they have the ability to bind to protective antibodies from a C.'TB
antibody preparation attd Ilellee deplete those antibodies of their neutralizing capacity. ~f'hose I ~ recombinant polvpcptidcs ti~und to hind C TI3, were then utilized to ~.;eneratc neutralizing antihodies. This Example involved: a) identification of recombinant suh-regions within toxin ti to which ncutraiizin~: antibodies bind; b) identification oi' toxin 13 sub-recion specific antibodies that neutralize toxin f3 in riw: and c) generation and eyaluaticm of antibodies reactive to recombinant toxin t3 polypeptides.
~U
a) Identiiicatiun Uf Recombinant Sub-Regions Within Toxin B
'To Which Neutralirin~ Antibodies Bind ~uh-I'ILIOI1S ~~'tthln t0\111 B to vyhich neutralizing antihodies hind vyere ictentitied by utilizins~ recombinant toxin R proteins to deplete protective antibodies froth a polyclonal pool of antibodies against native ('. cli~Jicile toxin B. An in viro assay was developed to evaluate protein preparations for the ability to hind neutralizing antibodies.
Itecomhinant proteins were first pre-mixed with antihodics directed against native toxin 13 (C.'~1 I3 antibody: sec f:xample 8) atld allowed to react fete one hour at ;7°C'. Subsequently. C'.
cli//iril~~ toxin t3 (C'ff3; Tech I.ab) vyas added at a concentration lethal to hamsters and incubated i~or another hour at 37°C'..
s(1 Alter incubation tltis mixture vyas injected intraperitoneally (Il') into hatosters. ll' the recombinant polypeptide contains n eutrafizing epitopes, the ('Tf3 antibodies will lose its ahility to protect the hamsters against death from CTB. if partial or complete protection _ 1 1 c) _ occurs with the CTB antibody-recombinant mixture, that recombinant contains only weak or non-neutralizing epitopes of toxin B. This assay was performed as follows.
Antibodies against CTB were generated in egg laying Leghorn hens as described in Example 8. 'fhc lethal dosage (LU "",) of ('. cli~%icilo toxin B when delivered I.P. into 4Ue female Golden Syrian hamsters (Charles River) was determined to be ?.~ to ~
Ftg. Antibodies generated against C TB and purified by 1'L:G precipitation could completely protect the hamsters at the 1.1'. dosage determined above. The minimal amount of CTB
antibody needed to al'fitrd good protection against ~ l.tg of C:TB when injected I.P. into hamsters was also cletermined ( 1 X PE(i prep). These experiments defined the parameters needed to test whether IU a given recombinant protein could deplete protective C'fB antibodies.
The cloned regions tested for neutralizing ability cower the entire to~cin B
gene and were designated as Intervals (INT ) I through 5 (see Figure f ~)).
Approximately equivalent final concentrations ot~ each recombinant polypeptide were tested. The tbllowing recombinant pulypeptldcs were used: 1 ) a mixture of intervals 1 and 2 (INT-I. ?); '') a mixture of 1 ~ Intervals ~4 and ~ (INT-4. ~) and 3) Interval 3 (IN'I'-;). Recombinant proteins (each at about 1 ntg total protein) were first prcincuhated with a final C~I~Ei antibody concentration of 1X
~i.r.. pellet dissolved in original yolk volume as described in Example 1(r)) in a tinal volume of ~ mls lire I hour at 37°(.'. Twenty-five Ftg of CTB (at a concentration of ~ Ftg/ml). enough C"1'B to kill 5 hamsters. was then added and the mixture was then incubated for 1 hour at -?0 ;7°C. Five. ~4Ug female hamsters (Charles River) in each treatment group were then each LIYCII 1 ml of the mixture I.1'. using a tuberculin syringe with a ?7 gauge needle. The results of this experiment are shown in Table 24.
TABLE 1d t'31T1d1f1f3 ()t~ NPl~rrnls~~n" ent~iw~l;.... O., rwm -_._.._.__._.. .,.. ....",,m ' _ f reaunent (;roup Number Of' Animals Number Of' Animals Alive Dead CT13 antibodies C.'TB antibodies INT1.3 C.'TI3 antibodies , C"TI3 antibodies + p .0 .

('. rli/Jicilr toxin B fCTE3) was added to each group.
As shown in Table 24, the addition of recombinant proteins from IN'f-1. 2 or INT-4, 5 had no effect on the In 1'lv!) protective ability of the C.TF3 antibody preparation compared to the C'TB antibody preparation alone. In contrast. INT-3 recombinant polypcptidc was able to remove all of the toxin B neutralizing ability of the CTB antibodies as demonstrated by the death of all the hamsters in that group.
The above experiment was repeated. using two smaller expressed fragntents (pMI3 170-1970 and pMB 1970-2360, set Figure l9) comprising the IN'f-3 domain to determine if that domain could he further subdivided into smaller neutralizing epitopes. In addition. titli-lcngth IN~f-; l7c,iypeptidc expressed as a nickel tagged protein (p1'B1750-2360) was tested for neutralizing abiliy and compared to the original IN'T'-3 expressed MBP fusion (pMB 1750-~360). ~('hc results arc shown in -fable ?5.

Renwval Of Neutrali~inu Antihn~~im ti., uo.,~~. r~._...:._:._.- ., Treatment Group' Number Uf Animals Number ()f Animals Alive Dead t't3 iltltlb(ldleS ; If ~'r(3 FIt7t117t,dIeS ~
p('t3l~i~-X3(7() cwrt~ anuhodies pM~ I7so-?36Ut) C"t't3 amibodics pM(i1970-3360; ., C'Tt3 antibudirs - pMt317iU-1970 t' ~li/licvl~~ ttwin Ii (C'Tf31 was added to each ,.:roup.
~() The results summarized in Table ?5 indicate that the smaller polvpcptidc fragments within the 1NT-.s domain. pMB17~0-1970 and pMB1970-2360. partially lose the ability to hind to anct remove neutralizing antibodies from the CTI3 antibody Pool. '(-hcse results demonstrate that the full length 1NT-; poiypeptide is required to completely deplete the CTI3 '_'3 antibody pool uh neutralizing antibodies. This experiment also shows that the neutralization epitope ol' (NT-3 can be expressed in alternative vector systems and the results are independent of the vector utilized or the accompanying fusion partner.
Other Interval 3 specific proteins were subsequently tested for the ability to renwve neutralizing antibodies within the CTR antibody pool as described above. T'he Interval 3 3t specific protein s used in these studies are summarized in Figure ?3. In Figure ?3 the Ibllow-in~~ abbreviations are used: pl' refers to the pET?3 vector: pM re(crs to the pM~lL.c vector: t3 refers to toxin B: the numbers refer to the amino acid interval expressed in the clone. 1-he solid black ovals represent the MBP: and I-I1H represents the poly-histidinc tag.

W'~ ~ PCT/US97/15394 Unly recombinant proteins comprising the entire toxin I3 repeat domain (pMB17S0-23G0. pPB 1750-2300 and pPB 180-2~(~0) can bind and completely remove neutralizing antibodies from the C'1'B antibody pool. Recombinant proteins comprising only a portion of the toxin R repeat domain were not capable of completely removing neutralizing antibodies li-om the C"rI3 antibody pool (pMB17S0-1970 and pMI3lc)70-2;60 could partially remove neutralizine antibodies while pMB18~0-170 and pI'fi18a0-2070 tailed to remove any neutralizing antibodies from the C'I-B antibody pool).
~Chc above results demonstrate that only the complete ligand binding domain (repeat region> of the toxin 13 gene can hind and completely remove neutralizing antibodies from the C"TI3 antibody pool. These results demonstrate that antibodies directed against the entire toxin 13 repeat re~_ion arc necessary tUC II? 1'!t'l) toxin neutralization (see Figure ?;: only tire recombinant proteins expressed by the pMB1750-23f~t1. pl'B 17i()-? iGU and pl'I31850-? ;h() vectors arc capable of completely removing the neutralizing antibodies from the C'I'B
,mtiboy hc~l f.
I s Thcsc results represent the first indication that the entire repeat rceion of toxin B
wc~uld he necessary for the Leneration of antibodies capable of neutralizing toxin F3. and that sub-regions may not be sutiicient to generate maximal titers of neutralizing antibodies.
Identification Of Toxin Q Sub-Region ~ihecific Antibodies '-() That Neutralize Toxin I3 In Vivo 'i o determine if antibodies directed against the toxin B rehear region are sufficient for ncutra)iration. region specific antibodies within tire ("fI3 antibody preparation were affinity purified. and tested tier in uiw~ nctttralization. Affinity columns containine r~combmant toxin 13 repeat proteins were trade as described below. A separate affinity colunln was prepared ?5 using each of the Iollowin g recombinant toxin B repeat proteins: pi'1317s0-2 i(~0. pl'i318i0-?360. pMI317>0-1970 and pMB 1970-2360.
Ivr each affinity column to be made, four m) ol' PIi~-washed Actigel resin (Steros!ene) was coupled overnight at room temperature with S-!() mg of affinity purified recombinant protein ( f first rxtensivelv dialyzed into PBS) in I ~ ml tubes t halcon>
containing a 1 /10 final 0 volume Ald-couplin;_ solution ( I M sodium cyanohorohydride). nliduots of the supernatants f~l'Otll the C:(ltlpllll~ reactions. before and after coupling. were assessed by ('oamassie staining of 7.~'%~ ~t)~-f'A(iE Lcls. t3ased on protein hand intensities, in all cases greater than s0'%
coupling cfticiencies were estimated. The resins were poured into l() ml columns (BioRad).
_ 122 washed extensively with PBS. pre-eluted with 4M guanidine-HCl (in 10 mM 'I'ris-HCI, pH
8.0) and reequilibrated in PBS. The columns were stored at 4°C.
Aliquots of a C'TB IgY polyclonal antibody preparation (PEG prep) were affinity huritied on each of the four columns as described below. The columns were hooked to a (1V
monitor (ISCO). washed with PBS and 40 ml aliquots of a ?X PEG prep (filter sterilized using a ().45 ft filter) ~~ere applied. The columns were washed with PBS until the baseline value was re-established. 'the columns were then washed with BI3Stvveen to elute nonspecifically hinding antibodies, and rccquilibrated with PBS. Bound antibody was eluted from the column in 4M ~uanidinc°-HCI (in IUmM Tris-I-1C1. pHB.U). The eluted antibody was lU immediately dialyzed against a 100-fold excess of PBS at 4°C' tier 2 hrs. The samples were thcll HIaI1'Ztd extensively against at least 2 changes of PBS. and affinity purified antibody was collected and stored at 4°C. The antibody preparations were quantified by l1V absorhancc.
'1h c clarion volumes were in the range of 4-8 ml. All affinity purified stocks contained similar total antibody concentrations. ranging from 0.?5-0.35% of the total protein applied to I ~ the columns.
The abiliy of the affinity purified antibody preparations to neutralize toxin B i~ viva was cletermined using the assay outlined in a) above. Affinity purified antibody was diluted 1:1 in PB!~ hetore testing. The results arc shown in 'fable ?l.
In all cases similar levels of toxin neutralization was observed, such that lethality was --'0 clelaycd in all groups relative to preimmunc controls. This result demonstrates that antihodies reactive to the repeat reLiun of the toxin E3 gene are sufficient to neutralize toxin E3 in rims.
'1hc hamsters will cyentuallv die in all groups. but this death is maximally delayed with the ('TE3 1'E:(i prep antibodies. Thus neutralization with the affinity purified (~1P) antibodies is nol as complete as that ohscryed with the CTB prep before affinity chromatography. This _'S result may be due to lass of~ activity during guanidine denaturation (during the elution of the antibodies ti~om the affinity column) or the presence of antibodies specific to other regions of the toxin E3 ~e,zc that can contribute to toxin neutralization (present in the C.'TB E'I:G prep).
- l23 -Neutralization Of Train R Rv Affinirv P~~rl~:o,1 n...;l.,.,~:....
Treatment group' Number Animals Number Animals Alive'' Dead"

Preimmunc' () CTB':400 Etg 5 0 C~fB (AI' on pE'B1750-23GU):- ; () 875 Et~;

('TB (AP on pMB1750-1970):- ~ () R75 Etg CTB (AI' on pMB197U-23601:= s 500 tte 1 () ' (' eliJjic~iJ~~ toxin B {CTB) (Tech Lab: at 5 tynml, ?5 tt'; total) at lethal ccmcentration t«
hamsters is added to antibody and incubated for one hour at ,7~(.'. After incubation this mixture is injected intraperitoncallv (IP) into hamsters. t:ach treatment ~aroup received toxin premixed with antibody raised a~~ainst the indicated protein. as either: '-lX
antibody i'ECi prep or 'affinity purified (AP) antibody (trotn CTB PEG prep. on indicated columns). The amount 1J ol'sprciiic antibody in each prep is indicated: the amount is directly determined f«r affinim_ purified preps and v estimated tin the 4X CfB as described in t:xamplc Is.
l he numbers in each t!roup represent number of hamsters dead or alive. ? hr past II' administration of toxinrantibodv mixture.
?U
-I~hv observation that antibodies at~finiy purified against the nun-uverlappin~~
pML~l7i()-Ic)70 and pMf3lc)70-2360 proteins neutralized toxin R raised the pussthtltty that either I ) antibodies specific to repeat sub-regions arc sufficient to ncutraliie toxin l3 or ?) sub-region apecitic proteins can bind most ur all repeat specific antibodies present in the CTB
25 polvclunal pool. This would Iikelv be due to conformational similarities between repeats.
since he~nuolupy in the primary amino acid sequences between different repeats is in the range of only '_'s-7>°/. (I:ichcl-Strciber. cn crl. I lc)9?) Mulcc. (ien.
(imctic~ ?ss:?60~. l hcsc possibilities were tested by allinity chromatography.
The ("T'B PEG prep was sequentially depleted 2X un the pMB 17;()- I c)70 column: only s0 a small elution peak was observed after the second chromatography.
indicating that most reactive antibodies were removed. 'This interval depleted C"I-Ti preparation was then chromatographed on the pPB l R50-? ,GO column: no antibody bc~unci to the column. 'hhc reactivity of the C.'Tf3 and C'1'B (pMB1750-1970 depleted) preps to pl'fil7~U-2;60. pl'B1850-i60. pME3l7aU-1970 and pML3197O-2_,GU proteins was Ihen determined by I:L.IS;1 using the 3~ protocol ~icscribed in L~xample l s{c). Hrietly. c)U-well microtitcr plates ( haleun, I'ro-Hind Assay Plates) were coated with recombinant protein by adding 10() )tl volumes of~ protein at I-? ).tglml in 1'BS containing U.OOS% thimerosal to each well and incubating overnight at 4°C.
The nest morning. the coating suspensions were decanted and the wells were washed three *rB

times using PBS. In order to block non-specific binding sites. 100 ftl of 1.0%
BSS (Sigma) in PISS (blocking solution) was then added to each well, and the plates were incubated for 1 hr. at 37°C'. '1-he blocking solution was decanted and duplicate samples of 1 SO ~tl of diluted antibody was added to the first well of a dilution series. The initial tCSIttIL SCrlIIl1 dilution "~~s ( 1/?OU for CTB prep, (the concentration of depleted C'fB was standardized by ()I~,%«) in blocking solution containing U.S% Tween 20. followed by° S-Fold serial diiutions into this solution. This was accomplished by serially transferring 30 ~tl aliquots to 120 ~tl buffer.
roving. and repeating the dilution into a fresh well. Alter the final dilution. >U yl was renewed From the well such that all wells contained 12U Ell final volume. A
total of S such dilutions were performed (4 wells total). The plates were incubated for i hr at 37°C.
Following this incubation, the serially diluted samples were decanted and the wells were washed three IIlI7CS USlllg PBS containing O.S% Tween ?0 (PRST'), followed by two 5 min washes wing i3BS-~E~ween and a final three washes using I'~iS'T. To each well.
IUU yl uF
I'IUU() Hiluted secondary antibody (rabbit anti-chicken !g(~ alkaline phosphatase (Sigma) 1 ~ dilutrct in blocking solution containiy ().S% Tween ?U~ was added, and the plate was incubated 1 hr at 37°C'. The con.jugatc solutions were decanted and the plates were washed 6 tithes in E'RS'1~. then once in s0 mM Na=C'O;. 10 mM MgCI,. pH 9.5. The plates were deyelupcd by tlm addition ol' I UU y) of a SUIUtIOtt Ccllltainlllf I m~~/ml para-vitro phem_ I
ni~osphate (Sigma) dissolved in SU mM Na,CO;. IU mM MgCI,. pH9.S to each well.
'l~he -'() plates were then incubated at room temperature in the dark for s-~4s min.
The absorhcnc_v oh each well was measured at ~lU nm using a Dynatech MR 7U0 plate reader.
\s predicted by the aFtiniy chromatography results. d rpletion of the ('TB
prep «n the pMB t 7sU-197() column renewed all detectable reactiyiy t~ the pMB 1970-23GU
protein. The reciprocal purification of a C'~I'B prep that was depleted on tl2e pMB197U-?;6U column '-? vi~ldcd no hound antibody when chromatographed on the pMBl7Sp-1970 column.
These results demonstrate that all repeat reactive antibodies in the CTB polyclonal pool recognize a conserved structure that is present in non-overlapping repeats. Although it is possible that this conserved structure represents rare conserved linear epitopes. it appears mare likely that the neutralizin~~ antibodies recognise a specilic protein confi~rmati~n. TI7ls conclusion w'as also su~~gested by the results of Western blot hybridization analysis ol' CTB
reactiviW_ to these recombinant proteins.
Vl~estern blots of 7.S°,'° SUS-PAGE gels. loaded and clcctrophorescd with defined quantities of each recombinant protein, were probed with the C'7'ti polyclonal antibody preparation. The blots were prepared and developed with alkaline phosphatase as described in Example 3. The results are shown in Figure 24.
Figure 24 depicts a comparison of immunoreactivitv of IgY antibody raised against either native or recombinant toxin B antigen. Equal amounts of pM131750-Ic)7() (lane 1 ), pMI31970-2360 (lane 2). pPBi8~0-2360 (lane 3) as well as a serial dilution of pPB1750-2360 (lanes 4-li comprising iX. 1/lOX and 1/100X amounts, respectively) proteins were loaded in duplicate and resolved on a 7.~% SDS-PnCil: gel. The gel was blotted and each halt' was hybridized with PECi prep IgY' antibodies from chickens immunized with either native CTR or pPR1750-? 3G0 protein. Note that the full-length pMB1750-1070 protein was identified U111V
I(1 by antibodies reactive to the recombinant protein (arrows).
although the ('T13 prep reacts with the pP131750-2 3G0. pl'B I 85U-2300. and pMB 1970-''360 proteins, no reactivity to the pMI317~0-1970 protein ~uas observed (Figure ?4). (liven that all repeat rractive antibodies can be bound by this protein durin~~
al~finim chromatography. this result indicates that the protein cannot told properly on Western blots.
I ~ Since this eliminates all antibody reactivity. it is unlikely that tllc repeat reactive antihoelies in the C'TI3 prep recognize linear epitopes. 'This may indicate tlmt in order to induce protective antihe~dics. recombinant toxin 13 protein will need tn hr properly folded.
r) Generation And Evaluation Of Antibodies Reactive To '-t) Recombinant 'toxin I3 Poly~pelrtides i) Generation Of Antibodies Reactive To Itecnmbinant 'Toxin I3 Proteins Antibodies against recombinant proteins were generated in c~=g laving i.eghorn hens as described in Example 1 3. Antibodies were raised f using l~rmnds ad.juvant (Clihco) unless ?5 otherwise indicated) against the following recombinant proteins: I ) a mixture of Interval 1+2 proteins t see Figure t 8): ? ) a mixture of interval 4 and ~ proteins I see Figure 18): 3 ) pMBlc)70-'? 360 protein: 4) pP13175()-2360 protein: ~) pMR17i0-?360: O) pM1317s0-?360 ('I'itcrmax adjuvant (Vaxcell)]: 7) pME317~0-2360 (Clcrbu adjuvant (E3iotechlj: 8) pMI3p17:i0-?360 protein: ~)) pI'I31850-2360: and 1t)) pMB1850-?360.
30 Chickens were boosted at least ~ tInICS wllh reCOtllblnallt protein until Fl.ISA
reactivity (usin~~ the protocol described in b) ahllye 41'Ith till;
a\i:eptl(111 lhal 1110 plates were coated with pl'I317~0-2360 protein] of poivclonal PF.CI preps was at )cast ectual to that of the CTB polvclonal antibody PEG prep. ELISA titers were determined for the I'I~:(i preps from _ 12(, -all of the above immunogens and were found to be comparable ranging from 1:12500 to :G2~00. 1-ligh titers were achieved in all cases except in G) pMI31750-2360 in which stronu titers were not observed using the Titermax adjuvant, and this preparation was not tested tirrther.
i ii) Evaluation Of Antibodies Reactive To Recombinant Proteins 13y Western Blot Ht~bridization Western blots of 7.5% SDS-PAGE: gels, Joaded and electrophorcscd with defined lU quantities ot'recombinant protein (pMB1750-1970, pl'BIRSU-23GU. and pMB1970-proteins and a serial dilution of the pl'B1750-2360 tc~ allow quantification of reactivity). were probed with the C'~hE3. pl'B 170-2360. pMB 1750-236(1 and pMB l 970-2360 polyclonaJ
antibody preparations ( t'rom chickens immunized using Freunds adjuvant). The blots were hreparcd and developed with alkaline phosphatase as described shove in h).
I? :~s shoNr in figure ?4. the C"I~B and pMB197U-?3G() preps reacted strongly with the pJ'131 7s()-?;(,(), pl'l31 Rs0-?3G(), and pMB 1970-2360 proteins while the pI'B 1750-2360 and pMBlc)70-?.iGO ((ierhu) preparations reacted strongly with a1I ti~ur proteins.
The Wcstcrn blot rcactiviy ch~ the pPBl7i()-2360 and pMB1970-2360 (Crerbu) preparations were equivalent to that ef~ the C'Tli preparation. while reactivity of the: pMB 1970-? 3G() preparation was °10%
_'(1 that of the C"fl; prep. Despite equivalent L,LISA reactivitics only weak reactivity (approximately I°,'~) to the recombinant proteins were observed in 1'EG
preps icom two independent ~,~roups immunized with the pMBl7>0-236(1 proncin and one ~~roup immunized with the pNlli I 7i()-? 3GU preparation using Freunds ad.juvant.
.lftiniw purification N~as unfired to determine if' this dil'ferencc in immunoreactivitv by Western blot analysis reflects differing antibody titers. Fifty m) ?X PE.(i preparations tTOm chickens immunized with either pM1317s0-2360 or pMB1970-2 3GU protein were chromatographed on th c p1'B1750-2360 affinity column from h) shove. as described. The yield ~~f affinity purified antibody (°/~ total protein in preparation) was equivalent to the yield obtained from a C"fB PF:C~ preparation in b) shove. ~rhtts. dif'ferenccs in Vl%estern reactivity 3(1 reflect a dualitative dihlerencc in the antibody pools. rather than quantitative differences..
These results demonstrate that certain recombinant prcneins are more ct'lcctive at generating high affinity antibodies (as assayed by Western blot hybridization).

iii) In Vivo Neutralization Of Toxin Q Using Antibodies Reactive To Recombinant Protein ~fhe in vivo hamster model [described in Examples ~) and 14(b)J was utilized to assess the neutralizing ability of~ antibodies raised against recombinant toxin 13 proteins. The results from three experiments are shown below in Tables 27-?9.
The ability of each immunogen to neutralize toxin B in rir« has been compiled and is ahown in fable 30. As predicted from the recombinant protein-CTI3 premix studies ('fable ?~t) only antibodies to lntervai i (1750-23GG) and not the other rcgiow ot~
toxin Ii (i.e..
intervals 1-s) arc protective. Unexpectedly. antibodies generated to 1NT-3 region expressed in I 0 pMAI._ vector ( pMB 1750-23GU and pMpB 1750-2360) using Freunds adjuvam were non-neutralizine. 'this observation is reproducible, since no neutralization wasmbscrved in mc, independent immunizations with pMI31750-23GU and one immunization with pMpR175U-~Gt). The tact that iX quantities oi~ af~tinity purified toxin f3 repeat spccilic antibodies lrom pMfil7s()-?sG0 P1:(i preps cannot neutralize toxin 13 while 1X quantities ofat'linitv purified is anti-C'TI3 antibodies can (Table 2H) demonstrates that the differential ability uf' C~1'13 antibodies m neutralize toxin 13 is due to qualitative rather than cluantitativc differences in these antibody preparations, Only when this region was expressed in an alternative vector (pl'L317s()-~sGU) or using an alternative adjuvant with the pMf317s0-?;G() protein were neutralizinL antibodies generated. Importantly, antibodies raised using i~rcunds ad.juvant to -_'U pl'13185U-?.sGO. which contains a ti~agment that is only 10() amino :tl:ICtS SIllLfllt'.l' Ihal1 recombinant pl'1317iU-?3GU. arc unable to neutralize toxin 13 in viw, ('Fable ?7): note also that the name ucctor is trscd ti>r both pl'B I $~0-23GU and pl'F317ip-? ;G(J.
leg _ In L7vn Neutralization Of Toxin f3 Treatment Group" Number Animals Alive'' Number Animals Dead"
I'reimmurte 0 CTf3 ~ .
r) INTI+2 _ 5 INT4~5 i pMB 17:10-2360 p pMB 1970-2360 0 IO S
pPtlI750-2360 -( ~ ~~~!!~~'i~~ toxin 13 (CTL3) (at 5 )reiml: 25 Icg total: Tech Lab) at lethal concentration to hamsters is added to antibody and incubated for one hour at 37°C. After incubation this mixture is injected intrapcritoneally (IP) into hamsters. f:ach treatment ~~roup received toxin I ~ premixed with antibody raised against the indicated protein. as a aX
antibody PE:(i prep.
" I he numbers in each croup represent numbers of hamsters dead or alive. _' hours post II' administrsttron of to.vin/antibody mixture.

'r() /17 t'inrr IVPtetr~lim~~.,.. rW 'r....:_ r, "
........ ~ ~.,. mmmomes ""'"", ~-um~eu Treatment <iroupv Number Animals Number Animals Dcad'' Alive"

I'reimmunel I ) 0 C'T'E3( I ) ~

pP81750-2;G0( I ) s r) I.5 m;_ anti-pM131750_2360(2)I

I.i m;~ anti-pM81970-2360(2) (>

:()() )y~ anti-CTRr2) 5 () c cli/lic~ile~ toxin R (CTE3) (at 5 Fr;_iml: 25 )rg total:Tech I,ab) at lethal concentration to '() hamsters Is added to antibody and incubated for one hour at .i7°C.
After incubation. I ml of this mixture is injected intraperitoneally (IP) into hamsters. Each treatment group received toxin premixed with antibody raised a~~ainst the indicated protein, as either ( I ) 4X antibody PEG prep or (2) affinity purified antibody (on a pP81750-2360 resin), either I.5 nrza~roup (iuni-pMB1750-2;60 and anti-pMDt970-2;G0: used undiluted affinity purified antibody) or 350 F~_ ~m'rrup (anti-(.'TB, repeat specific: used I/5 diluted anti-('-fB
antibody).
'fhe numbers in each group represent numbers of hamsters dead or alive. 2 hr post-IP
administration of toxiniantibod>~ mixture.

TALiLE 29 Generation ()f Neutralizing Antibodies lltilizin~_ The (ierbu Adjuvant Treatment Groups Number Animals Alive''Number Animals Dead'' Preimmunc (I ;

C-TB i pMB 1970-33G(1 0 ;

p M B I R 5(1-3; Elf l I ;

PPfi I 85()-3.ib(i (1 s pMB17i0-3360 (Gerbu ~ p 1 adll (f c'. r.li~/ic~ilu toxin B (CTB) ('tech Lab1 at lethal concentration to 11~'lntSlt'r'S IS 1dded m antibody and incubated for one hour at 37°C. Atter incubation this mixture is injected intraperitoncally (11') into hamsters. Each treauncnt ~~roup received toxin premmrd with antibody raised a<,ainsr thr indicated protein. as a 4X antibody f EG prep.
I hr numbers in each rzroup represent numbers of h;unstcrs dead ur aliyr. ?hrs post II' adminiatr.uion of toxin antibody mixture.

In Y'ivn Neutrali~arinn nr r"..:., n Antigen In viva lmmuno~_en A d,juvantTested Preparation tJtilized Neutrali For AP i '' - Preimmurte NA' PE zat on G NA

rto C'TB (native) TitermaxPEG
-.

NA

yes C'ffi 'I'itermaxAP
(natives pPBl7;o_?;GU w s ('T'13 7'itermaxAP
(nativW

pPB 185(1-?36Uvc s C'Tf3 'fitermaxAP pPBl7io-1970 yes (native) C-TB 'fitermaxAP
(natives pPB197U-3360 vcs 1() lreunds PE(i pME317iU-3_,60 NA

no pML317iU-2sG() Frcunds AP

pPfi t 7iU-2_;6Urto pMBl7sU-?;(,t) Gcrbu Pf:G -NA
vcs pMB Freund t PEG NA -I
c)7U-?36U

nu pMf31)7(1-3.i6() hrcuads Af pl'E317s0-?
i61) . no pl'fi Freunds PE(i 1760-?-iliU

NA

pl'B I~reundsl'ECi NA .
lBSU-?-~6U

no ph-tli Frcunds PFG A-lBSU-?.iht) N no IV Freunds PEG NA
f I
-?

nu I\'1' l-reundsPEG NA
.t ~
' () _ t:ither I'f-'G preparation (PEG) or affinity purified antibodies IAP).
1'm' ~Irnotes complete neutralization (U.~; dead) while 'na' denotes nu neutralization !~ ~ dead) al toxin l3. ? hours post-administration of mixture.
'' S
'\:~~ tlellUtlS 1101 applicable.
f~he pf'1317ip_?3(,p antibody pool confers significant in nivn protection.
equivalent to that obtained with the affinity purified ('1-(3 antibodies. This correlates with the uhserycd high aflinity of this antibody pool (relative to the pMB175()-? 3G(1 er pMf31970-?;p() pops) a,;
~() assayed by Western blot analysis (I~i~ure ?4). These results provide the first demonstration that in Ivtw neutralizing antibodies cnn be induced using recombinant toxin l3 protein as jmmunu~mn.
.l.ltr failure ul- high concentrations of antibodies raised against the pw11317s0-? 3(tl) protein lusin~ hrcunds ad.juyant) to neutralize. ve~hile the use of Cierhu adjuvant and pMRl7s()-'36O protein generates a neutralizing response. demonstrates that conformation or presentation ut' this protein is essential for the induction ol~ neutralizin~~
antibodies. '1'hcsc WO 98/1!8540 PCTNS97Jl5394 results are: consistent with the observation that the neutralizing antibodies produced whets native C"~B is used as an immunogen appear to recognize conformational cpitopes [see section h) above, -THIS 15 the first dCIttUllSlratlon Iltat llte COItfOrJttatl()It Or presentation of recomhinant toxin 8 protein is essential to generate high titers ol' neutralizing antibodies.

Determination Of' Quantitative And Qualitative f)ifterences E3ctween pM1317~U-?3hU. piv91317aU-?,OU (Crbu) <)r pl'f3175U-?3GU 1gY Polyclonal Antibody t'rcparations In L;xample 19. it was demonstrated that toxin L3 neutralioin~.: antibodies could he =enerated LI111tg SpeCltlC reC()n1h111al11 t0xln (3 proteins (pl'1317aU-? 3GU) or specific ad.juvants.
~lntihodies raised a~_ainst pM13175U-2 3(t0 were capable u1~ neutralizing the entcrotoxin effect <h~ twin li when the recombinant protein was used m immuniie hens in ce~njunction with the I ~ ( ierhu adjuvant. hut not when hrcunds ad.juvant was used. T-o determine th c basis tier these antigen and ad,juvant restrictions. toxin f3-specific antibodies present in the nem~alirinh and nun-neutralising I'f:G preparations were isolated by aftiniw chromatography and tested for c)ualitativr ur quantitative ditTercnccs. The example involvrd al purification of anti-toxin li specific antihoctics i~rum pMI317sU-2360 and pI'I317iU-?3(U I't~.(.i preparations and h) iu uilvl '() ncutrali~ation of toxin t3 using the affinity purified antibody.
a) 1'urificution Ofvpecific Antibodies From pMR1750-23611 :end pl'Ii1750-2360 PE(: Preparations Tu purify and determine the concentration o1~ specilic antibodies (expressed as the percent of total antibody) within the pPB1750-23(~U (Ivreunds and t~erbul and pPHl7~U-?36U
f'ECi preparations. detincd quantities of these antibody preparations were chromatographed on an aftinity column containing the entire toxin Ei repeat region (pf'Lil7~U-23OU). The amount of af~tinity purified antibody u~as then quantified.
:\n affinity column containing the recombinant toxin 13 repeat protein.
p!'f317aU-? 3hU.
() was made as tullows. four ml of PI3S-washed Aetigel resin (~terogene) was coupled with ~
m~~ of pt'817~()-3 3OU aftinitv purilied protein (dialysed fuse, 1'135:
estimated to he greater than 95% titll length tilsion protein) in a is ml tube (t~alcun) containing= I/I(7 final volume Ald-coupling solution ( 1 IVI sodium cyanohorohydride). Aliquots of the supernatant from the _ 1;~ _ WO 98J08540 PCT/US9?/15394 couplinL reactions, before and after couplin g, were assessed by Coomassie staining of 7.5%
SDS-PAGE gels. Based on protein hand intensities. greater than 95%
(approximately ~ mg) of recombinant protein was coupled to the resin. The coupled resin was poured into a 1 U ml column t BioRad). washed extensively with PBS, pre-eluted with 4M guanidine-LIC I ( in 1 U
mM Tris-I-1C1. pli 8.U: 0.005°/~ thimerosal) and re-equilibrated in I'BS and stored at 4°C.
Alicluots ot~ pM817SU-23GU. pML31750-2360 (Gerbu) or pl'B 1750-2 360 1gY' polyclonal antih«dy preparations (PEG preps) were at3inity purified on the shove column as follows.
The column was attached to an t IV monitor (1SC0). and washed with E'BS. forty ml aliquots ot~?X 1'fCi preps (liltcr sterilized using a U.4~ It filter and quantified by t7I),~" heli~re 1t) chromatcyraphy) was applied. The column was washed with P(iS until the baseline vvas re-e,tahliahcd lthe column flow-through was saved). washed with BBSTween to elute nonspcciticallv hindinL antibodies and re-equilibrated with PBS. Bound antihodv was cfuted Drum the column in 4M guanidine-l t(.'I ( in I () mM Tris-1 I~ L, pH 8.U.
U.O()5°~~ thimerosal J and 1110 ~11111'~ elUtl()Il peak collected in a I~ ml lobe (Falcon). The Cl)llllnll 11'i3S re-eCIUlllbfalt'.d.
1 ~ and the column cluatc re-chrc~matographed as described shove. l~he antibociv preparations wcr~ quantified ht' lIV ahsorhance /the elution buffer was used m ~cro the apcctrophotometcrl. .lpproximatcly I U fold higher concentrations uf~ total purif icd antihodv was ahtaincd up«n elution uf' the first chromatography pass relative m the second pass. ~I hr low yield t~rum the second chromatography pass indicated that most ot~ the specific antibodies ?() w cry renuwcd by the lust round o1~ chromatography.
I'mls eh al'finitv purified specific antibodies were prepared by dialysis of the column elutes at'tcr the first column chromatography pass for the pMB17s0-2sGU.
pMI31750-23101 ((terhm en- pl'L317>0-23G0 I~~Y' polyclonal antibody preparations. l~ltc elutes were collected un ice and immediately ciialyred aLamst a 1UO-fold volume of 1'135 at 4°C' for ? hrs. The ,ampl~s were then dialyzed a~~ainst s changes of a OS-fold volume ul' PI3S at 4°C'. I)ialvsis was performed for a minimum ol' 8 hrs per change of PBS. 'fhe dialyzed samples were collected. crntrif~uged to remove insoluble debris. quantified by ()L7,~". and stored at 4°C'.
The percentage ot~ toxin B repeat-specific antibodies present in each preparation was determined using the quantitications ol~ antibody yields t'rotn the first column pass (amount of ~(1 specific; antibody recovered after first passltotal protein loaded). The yield of repeat-specific at~tinitv purified antibody (expressed as the percent of~ total protein in the preparation) in: I ) the pMB i 7;0-? 3G0 PING prep was approximately 0.~°/>. ?) the pMB i 7s0-2s(,0 (Oerhu) prep was approximately ?.;'%. and ;) the pPB1750-2iG0 prep was approximately t).4°/..
., .
- 1 ~ _~ -1'uritication of a CTB IgY polvclonal antibody preparation on the same column demonstrated that the concentration of toxin B repeat specific antibodies in the CTB
preparation was 0.35°/~.
These results demonstrate that 1 ) the use of (ierbu adjuvant enhanced the titer of specific antibody produced against the pMBl7S()-2 36U protein S-fold relative to immunization s using Freunds ad.juvant. and ?) the differences seen in the in riw~
neutralization ability of the pMf317iU-? 3GU (non neutralizing) and pl'B17SU-2360 (ncutralirin~~l anct CTB
(neutralizing) I'L:(i preps seen in Example 19 was not due to dltteCenCCS 111 the titers ctf repeat-specific antibodies in the three preparations because the titer ol~ repeat-specific antibody was similar for all three preps: therefore the differing ability of the three antibody preparations to 1() neutralize toxin I3 must reflect qualitative differences in the induced toxin I3 repeat-specific antibodies. I'u confirm that qualitative differences exist bcm~een antibodies raised in hens immunized witii different recombinant proteins andlor different ad.juvants.
the same amount of at~tiniw purilicd anti-toxin 13 repeat taa IH70-? 36U 01~ toxin f3) atttihocties 1'r<tm the different preparations was administered to hamsters usinL the in viau hamster nutdel as dcacrihcd 1 s below.
b) lu vivre heutralitati0n Uf Toxin !3 UsinK Affinity Purified Antibody The in viv~> hamster model was utilized to asSCSS the neutralizing ability c~C
the affinity ?U purified antibodies raised against recombinant toxin fi proteins purified in (al above. :\s well.
n ~~7v IgY I'ECi preparation from a second independent immunization utilizing the pl'I317SU-~_i6U anti~.!en with Freunds adjuvant was tested titr in ui~~rmeutraslization.
The results arc shown in -1'ahle .i 1.
Tltc results shown in '('able _~ 1 demonstrate that:
?S I ) as shown in Example 19 and reproduced here. I.S mg ui' affinity purified antibody from pMB17SU-? 360 immunized hens using Iweunds adju4~ant does nut neutralize toxin I3 fJ1 S'fl'!). l-fowever. 3U() tcg of a!'finiU purified antibetdv from similarly immunized hens utilizing CJerbu ad.juvant demonstrated complete neutralization of toxin !3 ur rilv~. This demonstrates that (ierhu ad,juvant.
in ~(1 addition to enhancin,_ the titer of antibodies reactive to the pMi317sU-?360 antitcn relative to l~reunds ad,juvant (demonstrated in (a) above). also cllhances the yield of neutralizing antibodies to this antigen. greater than S fold.

?> C'omplete in aivo neutralization of toxin B was observed with I.~ m~ of affinity purified antibody from hens immunized wlth pPB17~0-3360 antigen.
hut not mith pMB1750-2660 antigen. when Freunds adjuvant was used. This demonstrates. usinL standardized toxin B repeat-specific antibody concentrations. that neutralizing antibodies were induced when pP1317~0-2 36U
hut nut pMI317~0-2360 was used as the antigen with Frcunds adjuvant.
' s) C'ompfcte in rirn neutralization was observed with 300 Et~ of'pMB17~0-(Cierhu) antibody. but not with 300 ~t~ of pPB17;0_2360 (hreunds) antibody.
l~llus the pR9B1750-2 36U ((ierbu) antibody has a Iti~her titer of neutralising antibodies than the pPBl7~U-2360 (Freunds) antibody.
-t) ('ompfetc neutralization of foxier 13 was observed using 300 yg o1' C"fg clntihody ~aftinity purified tA1')) but not 100 Erg CT)3 antibody (A!' or I'I:G
hrcp). This demonstrates that Lreater than IOU ~t~~ of toxin R repeat-specific .lntibocfy tanti-C"I~B1 is necessay to neutralize ?~ ~tc~ toxin I3 in aion in this I ' clssay. and tltat af'linity purified antibodies specific to the toxin B
repeat interval neutrali-rc toxin (3 as effectively as the PFP prep of I~Y raised against the entire C'TB protein (shown in tltis assay).
~a was observed with the initial pl'B17S0-?3G0 (IgY) 1'L:(i preparation I E:xalnple 1 ~)), contplete neutralisation was observed with a I~~' f'f-:(i t~reparation isolated from a second independent group of pPBl7~U-23GU
( Frcunds) immunized hens, 'this demonstrates that ncutralizinL antibodies are reproducibly produced when hens art immunized with p!'E317iU-? ;lO) protein IIIIIIlInL Freunds ad,juvant.

In viva Neutralization OC Toxin B Using AClinity Puritied Antibodies Treatment Group'' Number Animals Number Animals Dead'' Alive'' Preimmunc' () CTB ( 3U0 Ey~)' i 11 C'TR ( I UU Ey,1- I '1 pMI317;U-33GU fG) (~ m~_)-; () ItME317sU-2.i GU ((i) ( ; (t I.i m~=Y

rMBl7sU-2360 (Ci) (3UU i 0 N~;1' I pMI317iU-23GU (F) ( I.i () () m~~)' pPB 17it1-2360 (t~) ( I ; tt .i m;~l pl'I317iU-2.i6U (f) (;()()I
ly;)-('TI3 ( lU() Ec_)' '- .

pl't317iU-?3 GU (F11~t1() ; It y=) I>

(' cli//icih~ toxin f~ (C'~TIi) (~I'cch Lah) at lethal concentration to hamsters ('_> )t;;) w;ts added to tlmantibody (amount oC specific antibody is indicated) and incubated lbr one hour at .7°C.
.1t'ter incubation. this mimure was injected If into hamsters I I's total mix ipected per hamstrrl. Fach treatment ~_roup received toxin premixed with antihoch_ raised a_ainst the indicatrd protein ((i w~erbu ad.juvant. f~--1-reunds adjuvantt. ' indicates tltr antthody v, as a -IX
I_Y I'f.(i prcl: ~ indicates the antibody was ~l~tinity purified on a pl'I318s()-?.il>U resin: and indicates that thr :tntihody was a I X.I~~Y Pf:G prep.
' lhmumbers in each =group represent numbers of hamsters dead or alive. _' hrs post II' :utministration at toain:antibodv mixture.
t?XAMYLI; 21 Diagnostic t:n71'111e Immunoassays for ('. cliJJicilc~ 'l oxins 11 Anti l3 () The ability of the recombinant toxin proteins and antibodies raiset.l against these recombinant proteins (described iv the above examples) to form the basis of 111aLlle)Sfle aSSaYS
hor the detection W~ clostridial twin in a sample was examined. Two immunoassay fitrmats were tested to ctuantitativelv detect ('. cli/Jicile to~(in r1 and toxin 13 t'rom a hioloLical specimen. ~fhe first tbrmat involved a competitive assay in which a fixed amount ot~
3i recombinant toxin A or fi vav immobilized on a solid support lc'. ~., microtiter plate v.~ellsl f'olloveci by the addition ol' a toxin-containing hiolo~~ical spcimen mixed with aCtinity-petrified or E'E:C~ fractionated antibodies as:ainst recombinant toxin ~\ or ti. t('toxin is present in a specimen. this toxin will compete with the immobilized recombinant toxin protein t~or l3G -hindine to the anti-recombinant antibody thereby reducing the signal obtained following the addition of a reporter reagent. The reporter reagent detects the presence of antibody bound to the immobilized toxin protein.
In the second format. a sandwich immunoassay was developed using affinity-purified antibodies to recombinant toxin A and B. 'T'he affinity-purified antibodies to recombinant toxin :1 and E3 were used to coat microniter wells instead of the recombinant polypeptidcs (as mas done in the competitive assay format). Biological samples containing toxin A or R were then added to the wells followed by the addition of a reporter reagent to detect the presence ul' hound t()XI11 111 the well.
a) Competitive Immunoassay For The Uctecti0n Uf C: ~liJficile Toxin Recombinant toxin r\ or t3 was attached to a solid support by coating ~)(, well microtiter plates v~ith the toxin protein at a concentration of lEtgiml in I'BS. The plates were I s incubated overnight at ?-8°C'. ~fhe IollowinL morning. the r«atinf!
solutions were removed and the remaining protein bindinu sites on the wells were blocked by tilling each wu>II with a I'f3~ st~lutic~n containing O.s'%' (i~,A and 0.05% Tween-?0. Native ('.
cIiJJic~iJc~ toxin ~1 or B
( fcch I.ahl was diluted to 4 ~ylml in stool ertracts from healthy Syrian hamsters (Sasco).
~I~hc; stool mracts were made by placing fecal pellets in a l s ml centrifuge tube: PBS was '_'0 added ut ? ml/pcllet and the tube was yorte~ced to create a uniform suspension. The tube was then ccntrif~ugrd at ?OOU rpm for ~ min at room temperature. ~I~hc supernatant was removed:
this pmprises the stool extract. fifty frl of the hamster stool extract w°as pipetted into each wc;ll ol~ the microtiter plates to serve as the dilucnt for serial dilutions of the ~l pp/ml toxin samples. ()ne hundred Etl of the toxin samples at ~ ~tg/mi was pipctted into the first row of vyclls in the microtiter plate. and ~U yl aliquots were removed and diluted serially down the plate in duplicate. An equal yc~lume of affinity purified anti-recombinant train antibodies [ !
n~;/wel( ol' anti-pV1A1870-2h80 antibody was used for the detection of toxin ~1: 0.5 ngwvell of anti-pMI317~0-23Ot)(<icrhul was used for the detection of toxin B) were added to appropriate wells. and the plates were incubated at room temperature for ? hnurs with gentle agitation.
s0 Wells serving us ny~atiue control contained antibody but no native: toxin to compete for hindins~.
Unbound toxin and antibody were removed by washing the plates 3 to ~ times with PBS cotUaining ().(l~% Tween-20. f()110Wrt1L the lyaSl7 SICp. 100 ltl of rabbit anti-chicken IgCi antibody conjugated to alkaline phosphatase (Sigma) was added to each well and the plates were incubated for 2 hours at room temperature. The plates were then washed as before to remove unbound secondary antibody. Freshly prepared alkaline phosphatasc substrate ( 1 mgiml p-nitrophenvl phosphate (Sigma) in iU mM Na,C'(>:. pl-1 ~).s: 1() mM
MLC1=) was a added to each well. Once sufficient color developed. the Plates were read on a 1)ynatech VIR7UU microtiter plate reader using a 410 nm filter.
~~hr results are summarized in Tables 32 and 3 i. 1. r the I'e5U1C5 S1117w11 111 'liable o?.
the wells were coated with recombinant toxin i1 protein (pMAIH7()-?O8()). I~h~
amount e~t~
native toxin n added (present as an addition to soluhilized hamster stool) to a Liven well is 1() indicated (U to ?UU ng). Antibody raised against the recombinant toxin A
protein. pMn1870-?680. was affinity purified on the an affinity column containin~~ pt'A1870-?68U Ldcscrihed in f~xumple 2U). As shown in Table i'_'. the recombinant toxin r\ protein and affinity-purified antitoxin can be used for the basis of a competitive immunoassay tier the detection of toxin A
in biological samples.
) s vimilar results were obtained using the recombinant toxin fi. pI'B I7sU-?
~(,U. and antihudirs raised a~~ainst pMB17s0-2i(0((icrhu). For the results sh«wn in -f.lble ss. the wells were coated with recombinant toxin li protein (pI'1317~()-?3(iU). ~1~11c allulttnt of native toxin li added (present as an addition to solubili~ed hamster stool) to a Liven well is indicated (U to ?U(1 ng). nntihodv raised against the recombinant toxin R protein.
pME3t7~0-'U '3(~0(( ~crbu). was affinity purified on the an af~tinity column containing pl'Ei f 8s()-? >(~U
(described in L:xampfe ?U). ~1s shown in ~t'able 3. the rcconthinant toxin li protein and affinity-purified antitoxin can he used for the basis ol~ al Wlllpellll\'e In111111no,1v1.1~ fi,r the detection oi~ toxin 13 in biological samples.
In this competition assay, the reduction is considered slLnltlcant over the background ?s levels at aII pollltS: therefore the assay can be used to detect samples containinL less than 1?.s ng toxin A/well and as little as sU-lUU ng toxin tilwell.
- li8-PCTlUS97I15394 Competitive Inhibition Of Anti-C. dij/icile Toxin A Iiy Native Toxin A
n~~ Toxin AlWell OD"" Readout ?00 U.17G

100 0.253 () 0.240 i 0.259 1'_'.5 0.309 G.25 0.367 ll) .i.l3i 0.417 (1 O.i90 ( umpetitivc Inltihitiun ()f nnti-C. cliJ/iolr Tuxin B By N;nim i~oxin l3 n~ Twin t3; Well OD"" Readout 200 t1.39?

100 O.sG6 >t) t).G(>7 0.778 I'_'.s 0 970
6.2 s I).003 i.l?S 1.040 0 I.Oii -hhese competitive inhibition assays demonstrate that native C'. cli/~icilo toxins and recombinant ('. ciifJicilr toxin proteins can compete fir binding to antibodies raised against recombinant ('. clijIicile toxins demonstrating that these anti-recombinant toxin arrtihodics provide ett~cetive diagnostic reagents.
:() h) sandwich immunoassay For The Detection ()t' C rlifficilc~
Toxin - ~1t'finity-purified antihcuiics a~_ainst recombinant toxin i1 or toxin I3 were immohilircd to c)O »~ell microtiter plates as ti~llows. The wells were passively coated overnight at 4°C' _ with affinity purified antibodies raised against either pMA1870-?b8() (toxin A) or pM1317~Q-_ 13() _ WO 98!08540 PCTIUS97I15394 ?360(Cicrbul (toxin B). The antibodies were affinity purified as described in Example ?0.
The antibodies were used at a concentration of I ttglml and 100 ~tl was added to each microtiter well. The wells were then blocked with 200 Eel ut~ 0.5% BSA in PBS
for 2 hours at room temperature and the blocking solution was then decanted. Stool samples from healthy s wrian l3amsters were resuspended in PBS, pll 7.4 (? ml l'l3S/stool pellet was used to rcsuspend the pellets and the sample was centrifuged as described above).
'l~he stool suspension was then spiked with native ('. c!i/)icile~ toxin A ctr B (~fceh Labl at 4 Etg/ml. 'fhc stool suspensions containing toxin (either toxin 11 or toxin B) were then serially diluted two-fuld in stool suspension without toxin and 50 Eel was added in duplicate: to the coated f 0 microtiter wells. Wells containing stool suspension without toxin served as the nes=alive control.
('h r elates were incubated for ? hours at room temperature and then were washed three tunes with I'B~. ()ne hundred Eel uf~ either goat anti-native W xin A or ~ctat ant!-llatlve toxin 13 l lmh l.ah) dilute! 1:IUUU in PBS containing I°'° f3~n and O.Ui°/, ~IVvecn ?U was is added tct cae:h well . The plates were incubated for another ? hours at roam temperature.
I he plates were then washed as before and 100 Eel of alkaline phnsphatasc-cctn.jugated rabbit anti-goat Ig(i I('appcl. Durham. N.C'.) was added at a dilution H~ I:IUUU, l~hc platen were incubated fur anoth er ? hours at room temperature. The plates were washed as hetitrc then developed by the addition of 100 fel/well of a substrate solution containing I
mg,%ml p-?U nitrophenvl phosphate (sigma) in ~0 mM Na,C()., pl-i 0.~: lU mM MgC'I,. 1-!te ~thsctrhance of such wrll was measured using a plate reader (I)vnatrchl at -11() nm. The assay results arc shown in I~ahles ;.1 and i5.
'T'ABL~ 3d ('. cli//icilr lo~cin A Detection In Stool tJsins: At'tinitv-Purified Antibodies Acainst Twin A
n 'Toxin AlWell --- OU,~" Readout 2oU U.9 I t)(> (1.H

;(1 t1.7, '-~ (1.71 .i0 ~ I ~ ~ - _ (LSt) r,.'; (Lay t -o t1 WO 98/08540 PCT/US9'1115394 e' cli/jicilc~ Toxin B Detection In Stool Using Affinity-Purified Antibodies A«ainst Toxin R
m_ Toxin B/Well OU"" Readout 3U0 I .3 I UO 0.97.s 50 0.887 ' '_ > U.84 (i I'.5 U.GS I

G.? ~ 0.431 I I1 U 0.004 I
l-hu results shown in Tahles s:~ and 35 show that anUbodles raked against recombinant twin :1 and tcwin 13 li'agments can be used to detect the presence ol' ( '.
cJiJJic~ilr toxin in stool samples. ~I~hesc antihodics form the hasis for a sensitive sandwich immunoassay which is capahle «t' detecting as little as l.?i n~~ of either toxin A ar (3 in a ~0 ttl Stool sample. As shown ahcwc in Tables s~1 and 3s. the background for this sandwich immunoassay is cwremelv Imv: therefore. the sensitiviW ot~ this assay is much tower than O.?s ng toxin/well.
It is likely that toxin levels oh~ 0.; to i.() pg/wcll could be ctctected by this assay.
The results shown above in Tables 33-35 demonstrate clear utility ot~ the rccomhinan t ''() rca~=ents in t '. cliJ)icilo toxin dctcction systems.

(.'onstruction And f~xpressic~n ()C (', hrmrlintrnr C' Fragment lesion 1'rotcins ?5 The ('. hnmlinrrnr type n llelll'OlOxlll gene has been cloned and sequenced [Thompson.
rt crl.. l;ur. .I. I3iochem. 189:73 t Ir)r)())~. 'the nucleotide sequence of the tUxltl ~enc is available t'rom the FMf3L/Gent3ank s~qucnce data banks under the accession number X2066:
the nucleotide sequence ot~ the cudin~~ region is fisted in SCQ lI) NO:?7.
~l~ttr amino acrd seclucnee ui~ the ('. hvtarlimrm wpc n neurotoxin is listed in SL:Q 117 N():?8. '7~he ypc n s() neurotoxin ~~ene is synthesized as a single polypeptidc chain wltich is processed to term a diner composed of a light and a heavy chain linked via disulfide bonds. The 50 kD carb~xv-terminal portion of the heavy chain is referred to as the C fragment or the I
I,. domain.
Previous attempts by others tc> express polypeptides comprising the C
i~ragment of ('.
hrmrlintrnt type n toxin as a native polypeptide (c~.,s,~.. not as o fusion protein) in E. coil have been unsuccesstitl [H.F. LaPenotiere. v al. in Bolulinum and Tercrnu,v rVem~otvxin.r. UasGupta.
Ed.. Plenum Press. New York ( 199 3). pp. 463-46C]. C:xpression of the C
fragment as a fusion ~~itlt the T. coli MBP was reported to result in the production of insoluble protein (H.F. LaPenotiere. er crl,. .suhru).
In order to produce soluble recombinant C'. fragment proteins in E. cwli.
fusion proteins comprising a synthetic C fragment eenc derived from the ('. hurrrlinum type-A
toxin and wither a portion of the ('. cliJJicile~ toxin protein or the MBi' were;
constructed. this example involvc:ci a) the construction of plasmids encoding (.' Iragment fusion proteins and b) expression of ('. hnlcrlinrrm C' fragment fusion proteins in F.. cwli.
a) ('.onstruction Of Ptasmids Encoding C Fragment Fusion Proteins In f:xampfe 11. it was demonstrated that the ('. cli~Jicilr toxin A repeat domain can be el'ficientlv expressed and purified in F.. cwli as either native (expressed in the pE::'1' ?3a vector 1; in clone pI'A1870-2G8()) or fusion (cspressed in the pMAl,c vector as a fusion with the l:.
cwli Mf31' in clone pMAlR7()-268()) proteins. lesion proteins comprising a fusion between the MIi1'. portions af' the ('. di/Jirile toxin A repeat domain (shown m he expressed as a soluhlc fusion Protein) and the C fragment of the C'. horrrlirrunr ype A toxin were constructed.
r1 Iltsion protein comprising the (.' fragment of the ('. horulinrrrn type n toxin and the MBI' ?0 was also cc»tstructcd.
I~iLUrc: ?s provides a schematic representation of the hotulinal fusion proteins along with the donor constructs containinL the ('. clif~icile toxin A sequences or ('. hutulmrrnr (' fragment scclucnces which were used to _~eneratc the hotulinaf fusion proteins. In higurc ?~.
the solid hexes represent ('. cli/~ic~ite toxin A gene seduences. the open boxes represent ('.
2s hnnrlirrum C' fragment sequences and the solid black ovals represent tltc F. ruli M13P. When the name for a restriction enzyme appears inside parenthesis. this indicates that the restriction site was destroyed during construction. ~1n asterisk appcarin~ with the name for a restriction enzyme indicates that this restriction site was recreated at the cloning .junction.
In lviLUre 25. a restriction map of the pMA1870-2(80 and p1'nl 1()0-2l8() constructs ,t) (described in Example 1 1 ) which contain sequences clcrived from the ( ' cli~/irilr toxin n repeat clomatn arc shown: these constructs were used aS the source (1I~ ('.
cliJ)irilr toxin A gene sequences tier the construction of plasmicis encoding fusictns between the ( '. Imrtrlirurrn C' fragment ~~rtte and the ('. cli~jioilc~ toxin A gene. The pMA1870-2080 expression construct expresses high levels of soluble. intact fusion protein (?0 mg/liter culture) which can be affinity purified on an amylose column (purification described in Example 1 ld).
The pAlterBot construct (Figure 2~) was used as the source of (.'. hmuliraum C
fragment ~_ene sequences f'or the botulinal fusion proteins. pAIterBot was obtained from J.
s Middlebroul: and R. Lemley at the U.S. Department of Defense. pAlterliot contains a synthetic ( '. hrnrrlir~inr~ C' twagment inserted in to the PALTER-1 (N;
vector ( Protncga). This synthetic C' fragment gene encodes the same amino acids as does the naturally occurring C' fragment gene. The naturally occurrin~~ (.' tiagment sequences. Like most clostridial genes. are extremely A'T rich (~l'ltompson m crl.. .srrprcr). This high AIT content creates expression I() difficulties in !:. ccrli and yeast due to altered codon usage frequency and fortuitous pulvadenvlatiun sites. respectively. In order to improve the expression of (' ti-agment proteins in I:~. cmli. a wnthetic version of the gene was created in which the non-preferred cuctuns were replaced with preferred cudons.
I'lte nucleotide sequence of the ('. hurulir;'rrnr C' fragment gene sequences contained within p:\Iterf3ut is listed in SI~Q IU NO:'??. The first six nucleotides IAT(iGCT) encode a 117e1111()Iltlte and alantne restduc. respectively. These two amino acids result from the insertion of thr (' h~mrlirrrrm C' fragment sequences into the pALTI:R'J vector and l,ruvide the initiator mcthiunirn residue. The amino acid sequence of the ('. hrmrliraruu C' fragment encoded by the seducnces contained within pAltcrlW t is listed in SCQ ID NO:?3. The first w~u amino acids ?U lMet i\lal are encoded by vector-derived sequences. From the third anonu acid residue c,nward 1:\r~~l. the amino acid seduencc is identical to that found in the l'.
hunrlirrum type A
tU\I11 ~_C11~.
I he pMA l 870-'_'68U. 11'A 1 1 (1()-2080 and pAlterBut constructs were used as progenitor plasmicis m make expression constructs in which t~agments of th~~ ('.
cliJjicilr toxin A repeat _'~ domain were expressed as genetic fusions with the ('. houulirrrrnr C' fragment gene using the hMAI..-~ wpression vector (New E:nLland Biol.abs). The pMAI_-c expression vector generates fusion proteins which contain the MBP at the amino-terminal end of the protein. A
l:UllSh'llel. pME3ut. in which the ('. hruulinrrm C fragment iene was expressed as a fusion with unit' the ~~13P was constructed (FiLUre'~). Fusion protein expression was induced Irom E.
_~(1 cwli strains harhoring the above plastnids. and induced protein vvas at'tinitv purified un an amyluse resin column.

i) Construction Uf pBlueBot In order to facilitate the cloning of the ('. hmrrlinru>r C fragment gene sequences into a number of desired constructs. the botulinal gene sequences were removed tiom pAIterBot and were inscrtc;d into the pt3lucscript plasmid (Stratagenel to s~cncrate pE3iue13ut (I~i~~ure ?5).
s pl3lucl3ot was constructed as t«Ilows. bacteria containing the pAlterl3ot plasmid were gown in medium containing tetracycline and plastnid DNA was isolated using the (?IAprep-spin I'lasmid fit ((~iagen). ()nc microgram of pAIterI3uo DNA was digested with ;\~cwl and the t'CSUIlIItl: s' recessed sticky end was made blunt using the Klenuw fragment of t)NA
pulvmerase 1 (here after the Klenow tiagmcnt). ~I~hc pA lterl3ut DNA was then di~~ested with It) I~incllll m release the botulinal gene sequences (the But insert) as a blunt (filled ,~'rul sitc)-I-lincIlII fragment. pl3lucscript vector DNA was prepared by digesting '_'0() n~= of pt3lucscript DNA with ,5'rrrcrl and flinclIII. ~l~hc digestion products Iroltt both plasmids were resolved on an ~tLaros~ ~_cl. ~hhc appropriate fragments were renewed t~rom the gel. mixed aitd huritied utilitin~~ the Prep-a-W ne kit (l3ioRadl. The eluted DNA was then li~_atcd usin~_ ~T-l I)NA
is li~asc and used to transtorm competent I)IiSa cells ((iihcu-13111.). Must cells were made c;umpetent fur transt«rmatiem using the calcium chloride protocol ul' Samhruul: ur crl.. .orrp-cr at l.f(?-1.8s. Recombinant clones were isolated and confirmed by reatrictiun di!_cstian using standard recombinant molecular bioluey techniques t~ambrouk cr crl. .strlmcr).
'hhe resultant clone, p131ucIW t. contains several useful unique restriction sites Ila11k11tL
the Rut insert (i.e..
'_U the ( '. hrurrlinrrnr C' f~raLment sequences derived from pAIterHot 1 as shown in I~ i~~urc ? ~.
ii) (.'.onstruction ()f C: difjcile l G hnlulirrrrnr I
NBP Fuxion Proteins t'unstructs encoding fusions between the C'. cliJ~irilr toxin r1 gene anti the t'. hnrulinunr '_'s C' lragntcnt gene and the MI3t' were made utilizing the same recombinant D NA methodology outlined above: these fusiolt proteins contained varying amounts of the ('.
c!i/%icilc toxin A
repeat domain.
I~hc pMAf3ot clone contains a '_'.4 kb insert derived ti-um the: ('.
clif)ic~ilc toxin A gene Mused to the (iut insert (i.e. the C'. hrnrrlirarrrn C' lratmcnt sequences derived from pAlterf3ot).
;(> pMABW (Figure '_'s) was constructed by mixing gel-purified 1)NA from :\~rnllllimllll di~~ested pl31uel3ut (the l.'_' kh But fragment). ,~pcUINurI digested pl'Al lUt.)-2O8() (the ?.~ kb ('. cliJ~ic~ilc~
toxin A repeat fragment) and .1'hcrlltliracllll digested pMAI.-a vector.
Recombinant clones were isolated. confirmed by restriction digestion and purified using the (~lAprcp-spin t'lasmid gyp ggJpg~p PCTNS97115394 Kit (Qiagen). This clone expresses the toxin A repeats and the botulinal C
fragment protein sequences as an in-frame fusion with the MBP.
The pMCABot construct contains a l.0 kb insert derived tiom the C'. diJficile toxin A
gen a Fused to the Bot insert (i.c~. the ('. hultelinum C ti~a~ment sequences derived tiom s pAIterBot). pMCABot was constructed by digesting the pMABot clone with F'coRt to remove the i' end of the ('. cli/~irilc~ toxin A repeat (see Figure '_'~, the pMAL.-c vector contains a I~ewRl site s' to the C'. cli~~icilc~ insert in the pMAf~ot clone).
The restriction sites were tilled and rcligated together after gel purification. The resultant clone (pMCABot.
Fi~~ure ?s) ~_enerated an in-ttame titsion between the MI3P and the remaining s' portion of the 1 U ( '. cli/Jicilr toxin A repeat domain fused to the Rot gene.
t ire pMNAL3ot clone contains the I kb SIeIIEcnRI (tilled) fragment from the ('.
cliJjicilc~ toxin A repeat domain (derived from clone pPAI 1UU-2680) and the !.~' kh ('.
l~rmrlimrrrr C' Fragment gene as a .\~onl (filled)/tfinc1l11 fragment (derived from pAIterBot).
I~hest two li-agtncnts were inserted into the pMAL-c vector digested with .l7nrlltlincllll. The 1 s twe, inserI fragments were ~;encrated by digestion of the appropriate plasmid with F.coR1 (pl'nI lUU-?C8U) or :\'onI (pAIterBot) followed by treatment with the Klenow FraLmcnt. i\tter treatment with the Klenmv fragment. the plasmids were digested with the second enzyme (either .Sj~c~! or tlincllll ). All three Fragments were gel purified, nixed and frep-a-CTcne purified prior to ligation. (allowing ligation and transformation. putative recombinants were '_'U analyzed by restriction analysis: the EcwRl site was found to he regenerated at the fusion junction. as was predicted fi>r a fusion between the tilled EcrrRl and r\~onl siW s.
;\ construct encodin~~ a Fusion proUein between the bmulinal C' Fra~~ment ~:cnc and the MBI' ~~cn~ wus constructed (i.c~.. this Fusion lacks any ('. cli()irilr toxin ~\ ~enc sequences) and termed pMI3ot. ~1'he pMBot construct was made by removal ol' the ('.
clijJicile toxin A
sequences from the pMAf3ot construct and fusing the C Iragmen t ttene sequences to the MBP.
This was accomplished by digestion of pMABot DNA with .Sltrl (located in tltc pMALc I,otylinker s' to the ,(heft site) and ,1'hcrl (located i' to the Nutl site at the toxA-Rot fusion ,junction). tilling in the .(heft site using the Klenow tcagment, gel purifying the desired restriction t~r:lLlll~tlt, and ligating the blunt ends to circularize the plasmict. following ligation sU and transti>rmation. putative recombinants were analyzed by restriction mappini of the Bot insert (i.r. the ('. hrntrlintr»t C t~agment sequences).

WO 98108540 PC'TIC1597115394 b) Expression Of C botuliunm C Fragment Fusion Proteins In E. coli Large scale ( 1 liter) cultures of the pMAL-c vector, and each recombinant construct described above in taj were ~~mw~n. induceci, and soluble protein fractions were isolated as s described in Example t8. 'hhe soluble protein extracts were chromatographed on amylose at~tinim columns to isolate recombinant fusion protein. 'I~he puriticd recombinant fusion proteins were analysed by running samples on SDS-PAGE gels lulluwcd by Coomassie staining anct by Western blot analysis as described (Williams err crl. ( lc)94) .,tyncr~. In brief.
extracts were prepared and chromatugraphcd in column buffer ( !U mM Nal'U,.
U.s M NaCI.
IU lU mM ~3-mercaptocthanol. pH 7.'_') over an amylase resin (New (~nLtand Biolahs) column.
and eluted with column buffer containing lU mM maltose as described [Williams.
co ul.
( Ic)c)4). .,'lrlJl'(l[. An ADS-PA(iF pcl containins~ the purified protein samples stained with C'oomassie blue is shown in figure '_'G.
In li;~urc ?G. the tollowiy samples were loaded. I.ancs I-h contain protein puritied 1 s from 1~~. ur~lr CUlll~1tt11t1~ the pMAI.-c, pl'A1870-2G8U, pMAl3at.
pMNAI3ut. pMCAI3oU and pMl3ut plasmids. respectively. Lane 7 contains broad range mcllccular weight protein markers ( L3ioRad ).
l~he protein samples were prepared ii~r electrophoresis by mixing s yl u1~
uluvd protein with j yl of ?X SI)S-PACE sample buffer (U.13> mM 'Kris-Fi('I. pli 6.8. '_' mM
ED'FA. 6%
~U SDS. ?()'% ~Ivcerol. U.U'_'s'% hromophenol blue: (3-mercaptocthanul is added m 5°~~ heti~rc use). The samples were heated to c)s°t' for ~ min, then cooled and loaded on a 7.>% a~_arose ADS-!'A(if~; gel. Broad sauce molecular weight prrncin markers wrre also loaded to alUw intimation of the MW of~ identified t'usicm proteins. At'tcr clcctrolhoresis.
protein was detected ~enrrallv by staining the gel with Coomassie blue.
?s In all casca the 1'IClds w'el'e 111 l:XCeSS Uf 2U mg tilsion protein per liter culture (sic 'Fable sb) and. with the: e~cception of the pMCABot protein. a hi'_h pcrccntape (i.c~.. greater than ?U-~U% of total eluted protein) of the eluted fwiem protein was of a MW
predicted for the full length fusion protein (figure ?O). It was estimated (hv visual inspection) that Less than IU'i~~ of the pM(.'AL3ot i~usion protein was expressed as the full icn~th fusicln protein.

PCT/US9'7l15394 Yield Of Affinity Purified C'. lturulinum C Fra~_ment ! MBP Fusion Proteins Construct Yield (mgJlitcr of Percentaee ()f Total Culture) Soluble Protein pMAEiot 24 s.O

pMCABot 34 S.0 pMNABot 40 ~ s pMBot ?3 5.0 hMA 1870-2680 40 4.8 I t) These results demonstrate that bleb Level expression ef intact ('.
hrntrlinum C
I~ra'~ment-t '. cli~/icilr toxin A fusion proteins in ~~. unli is feasible using the pMAL-c mprcssiun system. These results are in contrast to those reported by H. Iv.
L.aPenotiere. rml.
I ! c)c)s ). .~rrpor. I n addition, these results show that it is not necessary to fuse the hooutinal (' f~ra,~mmt Lone to the (.'. cli/~icilo toxin A gene in order to produce a soluble fusion protein ! s using the pMAI.-c system in I:. cull.
In order to determine whether the above-described hotulinal titsion proteins were rrcn~~nizcd by anti-('. hurrrlinrun toxin /~ antibodies. 1~'estern blots were performed. Samples e:~ntainin~~ affinity-purified proteins from I:. cwli containinL the pMAfiot.
pM(.'ABot.
pMNARut. pMBoU. pMA I 870-3680 car pMALc plasmids Overt: analyzed. SDS-PAGE:
gels ?0 ~7.9a acrviatnide) were loaded with protein samples purified from each expression construct.
.~ltcr rl~ctruphoresis. the gets were blotted and protein transi~r was contirtned by 1'onccau atainin~~ (as described in L:xamptc 1?h1.
lollcwing protein transfer. the blots were htocked by incubation for 1 hr at ?0°(' in hlockin:: buffer [PBS~t~ (Pf3S containing t).I% Tween ~() and s% dry milk?[.
The blots were then incubated in 10 ml of a solution containing the primary antibody: this solution comprised a 1/5()() dilution of an anti-('. hrmnlinunr toxin A 1gY PEG prep (described in Example s) in hluckin~= buffer. The blots were incubated ter 1 hr at room temperature in the presence of the primary antibody. T'he blots were washed and developed using a rabbit anti-chicken alkaline phosphatasc conjugate ll3oehringer Mannheim) as the secondary antibody as fullow~s. ~I'ltc ~() rabbit anti-chicken antibody was diluted to 1 ug/ml in blocking buffer (It) ml final v~lum~
per hlon) and the Mots were incubated at room temperature fi)r I hour in the presence of the secondary antibody. 'T'he blots were then washed successively with I'f3S'f.
l3EiS-'1'ween and - ~t) mM Na.,('();. pH 9,5. The blots were then developed in freshly-prepared alkaline phosphatase substrate buffer ( 100 Etglml nitro blue tetrazolium. ~0 Etg/mf 5-bromo-chloru-indolvlphosphate. ~ mM MgCI, in ~0 mM Na,CO,, pl-E 9.~). Development was stopped by floodin~~ the blots with distilled water and the blots were air dried.
This Western blot analysis detected anti-t'. hmrrlinunr toxin reactive proteins in the pMAl3ut. pM(:'AI3ui. pMNABot and pMBot protein samples (corresponding to the predicted full Ic;n~~tit proteins identified above by Coomassie staining in i~ipure ?().
hut not in the pMA 1 1 t)(1-?Ofi() or pMALc protein samples.
These results demonstrate that the relevant fusion proteins purified un an amylase resin as described above in section a) contained immunoreactivc t' h~nrrliuum (' fragment protein as I t) prcdictrd.
I~.XAMPLE 23 Generation Uf Neutralizin~~ Antibodies f3v Nasal Administration Uf pMl3ot Protein l;
l~hc ability ut~ the recombinant hutulinal toxin proteins produced in W ample ?'' to Slllnlllalt'. :1 1l SIt;mIC 1111117u11t'. reSp(lnSe against hotulinal toxin epitopcs was assessed. ~I-his example: invoivccf: al the evaluation of the induction of scrum I~.:(i titers produced by nasal or oral administration of hotulinal toxin-containing t'. cli()icile toxin A
fusion proteins and b) ~.() the lr7 S'll'() neutralization of ('. I)l)Ir(lirtrrm tye A ncurotoxin by anti- recombinant t'.
I)lrrrlIII711J11 (' t~ra~~ment antibodies.
Evaluntiun ()f The Induction Uf Scrum !~(: Titers Produced liv Nasal ()r ()r~l Administration Uf I3otulinal Toxin-=!5 Containing C rliJftcilc~ 'Toxin A H usiun Nroteins fix groups containing five G week old CF icmale rats f ('harics ItivcrJ per group were immuniicd nasally or orally with one of the following three combinations using protein prepared in i~xarnplc '_'?: ( 1 ) ?SU Itg pME3ot protein per rat (nasal and oral); ?) ''s0 pg pMAIicit protein per rat (nasal and oral): s) 1?5 Et~; pMl3ut admixed with 1?s Eye pMA1870-() ?ti8f) per rat (nasal and oral). A second set of > s~roups cuntainin~~ _i ('F I~rntale rats/gruup were immuni-red nasally or orally with one of the followitt~~ combinations (4) ?SU Etg ' pMNAf3ot protein per rat (nasal and oral) or ~) ?SU ~y pMAI.-c protein per rat (nasal and oral ).

The fusion proteins were prepared for immunization as follows. The proteins (in column buffer containing 10 mM maltose) were diluted in 0.1 M carbonate buffer, pH 9.~ and administered orally or nasally in a 200 yl volume. ~l~hc rats were lightly sedated with ether prior to administration. The oral dosing was accomplished usiy a 20 gauge feeding needle.
s The nasal dosing was performed using a 1'-200 micro-pipettor (Giisun). ~hhe rats were huosted 1 ~l days after the primary immunization using the techniques described above and were hled 7 days later. Rats ti'om each group were liehtlv etherizcd and hled from the tail.
fhc hlcu~d was allowed to clot at 37°(.' for 1 hr and the serum was collected.
The scrum froth individual rats was analyzed using an ELISA to determine the anti-C'.
hmulinurtt type A toxin IgG serum titer. The ELISA protocol used is a modification of that dcscrihcd in hxample lsc. Briefly. ~)(~-well microtiter plates (Falcon. Pro-Bind Assay Plates) were coated with ('. hnurlirttrnt type n toxoid (prepared as described in Example sa) by placin~~ Il)() yl volumes of ('. huttrlinrrnt type n toxoid at '.~ ~tu/ml in PBS containing (>.()Oi",« thimerosal in each well and incubating overnight at 4°C. The next morning, the I s cc,atin~= suspensions were decanted and all wells were washed three times urine PI3S.
In order to hlock non-specific binding sites. 100 ~tl of blocking solution (0.5% BSA in I'l3Sj was then added to each veil and the plates were incubated for 1 hr at s7°(.'. The hluckin~_ se~lution was decanted and duplicate samples of 150 EII of diluted rat serum added to the first wetl ~>i' a dilution series. The initial testing serum dilution was 1 a0 in hlockim;
?0 ,olutie~n containing U.i% Tween ?0 followed by S-f()ld dlIULIUnS IlltO
tIllS St)lut1011. ~rlllS waS
accomplished by serially transferring 30 Ell aliquots to l~O ~.ll hIOCkIIIL
SOllltlOn COtlta1111ng U.s°/~ I~ween ?0. mixin~~. and repeating the dilution into a Iresh well. After the final dilution.
s() E11 was removed from the well such that all wells contained 130 Ell final volume. A total of 3 such dilutions were performed (~i wells total). 'hhe plates were incubated t hr at i7°C'.
?J 1'()llt)w'InL LhIS IIICUhat10t1, the serially diluted samples were decanted and the wells were washed six times using ('BS containing U.5% '1-wecn 20 (i'BST). ~f~u each well. l0U Ell of a rabbit anti-Rat lgCi alkaline phosphatase (Sigma) diluted (1/1000) in blocking buffer containin~~ U.~% Tween ?0 was added and the plate was incubated for 1 hr at s7°C. The conjugate solutions were decanted and the plates were washed as described above, substituting 30 s() 171M Na,CO.. pl-( 9.~ for the PBST in the final wash. The plates were developed by the addition W' 10() tll of a solution containing I mg/ml para-vitro phenyl phosphate (Sigma) dissolved in ~0 mM Na,CO;. 10 mM MgCI,, pH 9.5 to each well, and incubating the plates at roam temperature in the dark for ~-its min. The absorbency ol' each well was measured at tt Rnulc Nasal t)ral ttt luununi>:uti,ttt pMliot pMlit,t&
lutruunnsmtIMMl.INfpMliot K pMAI)tN pMl)ot pMAlx71)-pMAliu1 pMAlx711- (rNn 2hRp I )ilutitrn 1 . :() t111xU I Ilall I 11311II U(U) 11 I~NI 11 (1x11IL 1 >11 1 I ,a a a 17 u.:xu a 54n o Itz~ n u7n n.a:u a uz7 I ';It I).IItINIt.?xl) 11.2(>It11 Irlf1It fl?II11 (rl()(11114 I :7st) I1 (N17 1> Itx4 (1119(11111(1()tl f1114U (1111 fl 1)(17 rr Ituta ~ = I
I muJ

~untW rs rcprcscul tltc a,cra_m values oMtuutcJ Inmt Int I:1.11A pl:uca.
O;tndartlimJ ulilvinc Ilm prcinuuuur cmurml ()etermination ()I' Anti-('. hrnrrlrnrrrn i ype A toxin Serum I!~(i 'titers tW Ilrnvin<_r Immunization With l'. h(rlulrnam L )~ra!.!tneW -C'ontainin~~
Fusion i'roleins ::0 Route ol' Nasal (>ral Inunurtiz.~tion fnununo!_cnf'RE-IMMUNEpMBot I)MABot pMNABoI pMNAi3ot 17i luti<,n l:-;U 0.040 O.Si7 U.01() U.UtS O.UItI

I : 1 i(1 (1.0()c) 0.~8.i (1.001 (1.UU_i U.OU?

:'-s l:7sU U.U(11 0.14(1 ().(IUO II.UUt) (LUUU

I::t7iU U.uUU U.U4U ().()UU ILUUU U.UUU

i: IZaIS I I
~t-tSlla~

The above 1:I,ISA results demonstrate that reactivity against the botulinal fusion ;U proteins was strongest when the route of administration was nasal: only weak responses were stimulated when the botulinal fusion proteins were given orally. Nasally (telivcred pM()t and pMI3m atimixed with pMA187()-268() inv()ked the greatest serum 1gO response.
~l~h(ac results show that only the pMBot prenein is necessary to induce tIllS Cl'Sp(111SC.
since the addition ot~
the pMA I 870-2080 protein did not enhance antibody response (~l'able i7).
Placement at- the -;s C'. cli~~iciler toxin A fra~~ment hetween the MBP and the C'. h()mrrir7nn) (' ('raiment protein 410 nm usin g a Dynatech MR 700 plate reader. The results are summarized in Tables 37 and ,8 and represent mean serum reactivities of individual mice.
~r:~w;t.e a7 I)rlcrminatimt 1)t Anti-(' hunrlrrrunr 'I ypc A Iwin Scrum Ig(i Titers I
ollmwin~, Innnunti;ttit,n 14'ilh ('. lurrrrfnrrrnr (' I~ragmcnt-(n nnaiuing I~ is on I'rutcins dramatically reduced anti-bot IgG titer tsce results using pMABot, pMCABot and pMNABot proteins).
This study demonstrates that the pMBot protein induces a strong serum IgG
response directed against C'. horulinunr type A toxin when nasally administered.
h) In Vivo Neutralization Of C. botalinuy Type A Neurotoxin ' 13y Anti- Kecombinant C botrrlinunr C Fragment Antibodies Thr ability ut' the anti-C'. hnlulrrnrm type A toxin antibodies generated by nasal administration ui' recombinant hotulinal fusion proteins in rats (Fxamplc 2?) to neutralize ('.
I () hnnrlirturn type A toxin was tested in a mouse neutralization model. The mouse model is the art accepted method ii~r detection of hotulinal toxins in body tiuids and fbr the evaluation of anti-hutulinal antibodies (E:.J. Schantz and U.A. Kautter. .l. Assoc. ()f~f.
Anal. C'.heln. 61:96 ( Ic)c)()) and Investis!atiunal New Drug (BB-INU-3703) application by the Surgeon General ot~
the I)cpartmcnt of the Armv to the Federal hood and I)ru~; AdministrationJ.
The anti-('.
hr~rtrlirtunr ypc A toxin antibodies were prepared as follows.
Rats t~rom the group riven pMBot protein by nasal administration were boosted a second time with ?s0 Etg pMBut protein per rat and serum was collected 7 days later. Serum i~ram one rat t'rum this group and ti-om a preimmune rat was tested for anti-C' hnrttlrrtrtm type :~ toxin mutralizin~: activity in the mouse neutralization model described below.
~'U The I.D;" ui~ a solution ot~ purified C' hWarliratrm type A toxin complex.
obtained from Dr. h:ric ,luhnson 1 university uF VVISCOIISIn Madison), was determined using the intrapcrituneal ( 1 f' ) n~etlu~cl oi~ Schantz and Kautter J.I. Assoc. Oi~f. Anal. C.'hem. O I
:96 ( I c)7R ) [ using I 8-3?
gram fcn~ale fC'R mice and was t«und to be 3500 l.D~"Ilnl. The determination ut~ the LU~" was hcrti~rmed as ti~llows. A 'fvpc: A toxin standard was prepared by dissolving purified type A
?s toxin complex in 2~ mM sodium phosphate buffer, pl~I 6.8 to yield a stock toxin solution of s. l s x 1 U' LU;"/mg. 'f he OI),,~ ut' the solution was determined and the concentration was adjusted to lU-30 Elg/ml. 't'hc toxin solution was then diluted l:lU() in gel-phosphate ( 3U mM
phosphate. pIl G.4: U.?% ~~elatin). Further dilutions of the toxin solution were lade as shown hclo» in -l'ahle ,9. Two mice were injected If' with ().5 m1 of each dilution shown and the s() mice were observed fer symptoms uf~ botulism for a period of 72 hours.
- l51 -E

PCTlUS97115394 Determination Ot' The Ll)." Of Purified C' hrrralinum Type A Toxin Complex Dilution Number Dead At 72 hr I :320 i I :640 1:1280 1:3560 0!3 (sick after 73 hr) I :5120 03 l no symptoms 1 1 () From the results shown in Table 39. the toxin titer was assumed to he between 2560 L, I);"lml and il?0 L.Di"Iml (or about 384U I.Ua"Itnl). ~fhis value was rounded to 3~OU
I_D;"/ml fir the sake of calculation.
~fhc amount of neutralizing antibodies present in the serum of rats immunized nasally with pLll3ot protein was then determined. Serum From mo rats boosted with pMHot protein 1, as described above and preimmune scrum from one rat was tested as follows.
~l~hc toxin standard was diluted 1:IUU in gel-phosphate to a final concentration Wit' ssU
Lly"/ml. ()ne milliliter W' the diluted toxin standard was mixed with ?~ Ell oi' serum from each of the three rats and ().'' ml of gel-phosphate. 'fhe mixtures were incubaterd at roam mmperaturc fir 30 111111 Vvlth (1(;CilSlUllal mixing.:. Each of two mice were injected with !I' with l)., ml of the ?U mixturos. The mice w~cre observed for signs of holulism fur 7? hr. Mice receiving serum from rats immunized with pME3ot protein neutralized this challenge dour. l~-1icr receiving preimmunc rat scrum died in less than ?4 hr.
~I'hr amount of neutralizing anti-toxin antibodies present in the scrum of~
rats immunized with pMl3ot protein was then ~uantitated. Serum antibody titrations were part~ormed by mixing U.1 ml of each of the alllIbUdV dilutions (sec ~l~ablc ~U) with U.1 ml of a 1:10 dilution of stock toxin solution (3.i x lUy 1.I)s"Iml) with 1.U ml of gel-phosphate and injectinL U.~ ml 1P into ? mice per dilution. l~he mice were then observed for signs of hotuiism for 3 days (7? hr). 'fhe: results are tabuiatcd in Tahlr s~).
r1s shown in 'i'ahle al) pME)ot serum neutralized ('. hmrrlirurm type A toxin complex :~U when used at a dilution of 1:3~'U or less. A mean neutralizing value of 1GA IlJlml was obtained ii~r the pMBot serum (an ItJ is defined as l(l.OUU nu~us~ L.I);").
This vaiuc translates to a circulating serum titer of about _>.7 IlJlmg. of serum protein. This neutralizing titer is c:omparahle to the commcrcialiy available bottled concentrated (('onnaught l..uboratorics. L.td.) horse anti-('. hmulimrm antiserum. A 1U ml vial of Connaught antiserum contains about 20U

mg/ml ol' protein:each nil can neutralize 750 IU of (:'. hvmlu~um type A
toxin. After administration of one vial to a human. the circulating serum titer of the (:onnaught preparation would be approximately ?5 lU/ml assuming an average serum volume of 3 liters).
Thus, the circulating anti-('. hrurrlirrunt titer seen in rats nasally immunized with pMBot protein ( 16t; lUlml) is (i.7 time higher than the necessary circulation titer of anti-C'. hurtrlinum antibody needed to he protective in humans.

c~uantittttion Of Neutralizing Antibodies In pMBot Sera pMBot' ""-Dilution Rat 1 Rat.2 I t :?U ?!2 3;1 () I :4U ?;~, y~1 I :xl) 1l1 1'1 I : I GU ? ~~ 1'1 1 7 /1~ 1111, I.3_U

I a54() U!'_' U,~?

f : I ?RU O'3 t)"

I :'_ 56Q 0!? (~ r, Ntunbers represent the ntunber of mice surviving at 7? hours which rercived scrum taken from ~l) rats immunized with the pMl3ot protein.
These mice survived but mere sick atier 73 hr.
fhesu results demonstrate that antibodies capable of neutralizing C'.
hrrrulirrunr ype A
toxin are induced when recomhinant ('. hmulinum C fragment fusion protein produced in IJ:
''S c~r~li is used as an immunogcn.
EXAMPLE 2a Production Of' Solubic C'. hmulinum C Uragment Protein ~ubstantiallv Free Of l:ndotoxin Contanunation () f:xample ?3 demonstrated that neutralizing antibodies are generated bs immunization with the pMBot protein expressed in F.. cull. These results showed that the pMl3ot fusion protein is a good vaccine candidate. However. immunogens suitable for use as vaccines should he pyrogen-free in addition to having the capabilim of inducing neutralizing PCTlUS97/15394 antibodies. Expression clones and conditions that facilitate the production of C'. horuli»um C
fragment protein for utililization as a vaccine were developed.
The example involved: (a) determination of pyrogen content of the pMt3ot protein:
(h) generation of C.'. hvtulira:mn C' fragment protein free of the MBl': (c) expression of C'.
hrurrlirmm C fragment protein using various expression vectors: and (d) purification of soluble (' hrnulimrm C fragment protein substantially free of signilicant cndotoxin contamination.
a) Determination Uf The I'yrogen Content Of The pl1'IBnt Protein I () In order to use a recombinant antigen as a vaccine in humans or other animals. the antigen preparation must be shown to he free of pyrogens. ~I'hc most significant pyrogen present in preparations of recombinant proteins produced in gram-negative bacteria. such as E.
onii. is endotoxin (F.C. I'earson. I'ary~en.s: e~ndmarin,v. L,1L ~e~.c~ius,~
cure! eleyt~ry,~w~fuinn.
( lc)8>) Marcel Dekkcr. New York, pp. '' >-56J. 'I'ct evaluate the utility of the pMF3ot protein I ~ as a vaccine candidate, the endotoxin content in MI3i' fusion proteins was determined.
I~he endotoxin content of recombinant protein samples was assavccl lltlllztng the I.imulus assay (L..AL kit: Associates of Cape Cod ) according to the manuf'acturer's instructions. Samples of affinity-purified pMal-c protein and pMA1870-?GR() were found to contain high levels of endotoxin (=e0.000 F:U/mg protein: I:11 (endotoxin unit)). This '0 suggested that MRP- or toxin A repeat-containing fusions with the hotulinal (' fragment should also contain high levels of endotoxin. Accorclinf:lv. removal o(~
rndutoxin from aflinim-purified pMal-c and pMBot protein preparations was attcrnpted as t'olluw~s.
samples of pMal-c and pMfiot protein were dcpyroeenated with pUvmyxin to determine if the endotoxin could he easily removed. The ti~llowine amount of protein wets ?i treated: '_'~) ml at 4.8 OD,ri"/ml for pMal-c and 19 mls at 1.44 ()D,H"/ml ter pMBot. The protein samples were dialv~ed extensively against Pl3S and mixed in a ~0 ml tube (Falcon) with 0.~ ml PIiS-equilibrated polymvxin I3 (Affi-Prep I'oiymyxin. I3ioRad).
The samples were allowed to mix by rotating the tubes overnight at 4°C'. The polvmvxin was pclleted by centrifugation tbr 30 min in a bench top centrifuge at maximum speed ( approximately ?OOU x s0 ~) and the supernatant was removed. The recovered protein (in the supernatant) was quantified by ()U,r", and the endotoxin activity was assayed by 1..rll.. In both cases only approximately l/i of the input protein was recovered and the polymyxin-treated protein retain cd significant endotoxin contamination (approximately 70()0 E~.tJhng of pMl3ot).
- l ~4 -WO 98108540 PCTIUS9'7/15394 The depyrogenation experiment was repeated using ati independently purified pMal-c protein preparation and similar results were obtained. From these studies it was concluded that si~_niticant levels of endotoxin copurities with these MBP tusion proteins using the amvlosc resin. Furthermore. this endotoxin cannot be easily removed by polymyxin treatment.
These results suggest that the presence of the MBP sequences on the fusion protein complicated the removal of endotoxin i~ram preparations o!' the pMBot protein.
b) Generation Uf C. hotuliaum C Fragment Protein Free Of 1 () The MBP
It way demonstrated that the pMBot fusion protein could not be easily purified from contaminatin~~ enctotoxin in section a) above. The ability to produce a pyrogen-flee (e.,~~., cndotoxin-free) preparation of soluble hotulinal C fragment protein free of the MBP tag was nrxt invc:stiLatcd. ~1'hc pMBot expression construct was designed to facilitate puritication ol' I ~ the hmulinal (.' fragment from the MI3P tag by cleavage of the fusion protein by utilizing an rntineercd factor Xa cleava~~e site present between the MBP and the hotulinal t' fragment.
The Farmr !(a cleavaLC: was pcrti~rmed as follows.
Factor Xa (Mew hngland Biolahs) was added to the pMBot protein (using a U.I-!.U%
Factor Xa/pMBot protein ratio) in a variety of buffer conditions (c.,y.. PBS-NaCI (PI3S
?U cuntainin~ U.s M NaC'1). I'BS-NaCI containing 0.2% Tween ?0, PHS. 1'BS
containing 0.?%
'IVveen ?U. I'I3S-(' (1'13S containing ? mM CaCI,). PF3S-C containing either 0.1 car O.S
~l~ween ?U. I'BS-t' containing either U. I or U.5% NP-40. PBS-C' containing either ().1 or U.S%
-triton \-10(). f'BS-C' containing U.1'% sodium dcoxvcholatc. PBS-C containing t).1'% SDS].
The Ivctor Xa di~cstions were incubated for 13-72 hrs at room temperature.
?S The extent of cleavage was assessed by Western blot or Coomassie blue staining of proteins following electrophoresis on denaturing SDS-PAGE gels. as described in L:xample '_'_'. C'lcavage reactions (and control samples of uncleaved pMBot protein) were centrifuged t'or ? min in a microfuee to remove insoluble protein prior to loading the samples on the gel.
The Factor ,~a treated samples were compared with unclcaved. unccntrifuged pMl3ot samples .st) on the same gel. ~fhe results of this analysis is summarized below-.
I 1 Most (about ~)U%) pMBot protein could be removed by centritiyation, even when unclcavcd control samples were utilized. This indicated that the pMBot fusion protein was non titlly soluble (i.c~., it exists as a suspension rather than as a solution). (This result was - l55 -consistent with the observation that most affinity-purifted pMBot protein precipitates after lon g term storabe ('? weeks) at 4°C. Additionally. the rna.jority ( i.
c~.. 75%) of induced pMBot protein remains in the pellet after sonication and clarification of the induced L. cull.
ltcsuspension of these insoluble pellets in fBS followed by sonication results in partial solubilization of the insoluble pMnot protein in the pellets. J
?) The portion of pMBot protein that is fully in solution (about 1 U% of pMBot protein) is completely cleaved by Factor Xa. but the cleaved (released) botulinal C fragment is relatively insoluble such that only the cleaved MBf remains Dully I11 SUlttt1011.
None of the above reaction conditions enhanced solubility without also 1 U reducing effective cleavage. Conditions that effectively solubilized the cleaved botulinal C
fragment were not identified.
:k) The use of U.I% SI)S in the buffer used for Factor Xa cleavage enhanced the soluhilitv of the pMBot protein (all oi' pMRot protein was soiuhle?. ltowever.
the presence of the Si)~ preventod any cleavage of the fusion protein with Factor Xa.
Is ~) nnaivsis of pelleted protein from the cleava~~e reactions indicated that both i'ull length pMBot (i.e-.. uncleaved) and cleaved hotulinal C fragment protein precipitated during incuhation.
l~hcse results demonstrate that purification of soluble heauiinal C' i~ragment protein utter clc;ava~e of the pMBot fusion protein is complicated by the insolubility of both the pMl3ot ?U protein and the cleaved hotulinal C fragment protein.
c) hxprcssion Uf C. botulurum C Fragment l)sing Various Expression Vectors In order to determine if the solubility of the botulinal C' liagment was enhanced by expressing the C fragment protein as a native protein. an N-terminal dis-tagged protein or as a fusion with glutathione-S-transferase (GST), alternative expression plasmids were constructed. 'l~itese expression constructs were generated utilizing the methodologies described in ixartyfe ??. Figure 37 provides a schematic representation o1~ the vectors described helow.
in i~iyre ?7, the tollowin~! abbreviations are used. pl' refers to the pI~.T?:~ vector.
30 pHIS refers to the pE'I'Hisa vector. pBlue refers to the pBluescript vector. pM refers to the pMAI.-c vector and pG refers to the pGEX3'h vector (described in Example I 1 ). ~l'he solid black lines represent C'. hmulinunr C' fragment gene sequences: the solid black ovals represent the Ml3P: the hatched ovals represent CiST: "IiHHHH" rrprcscnts the posy-histidine tar. In Figure ?7. when the name for a restriction enzyme appears inside parenthesis.
this indicates that the restriction site was destroyed during construction. .fin asterisk appearing with the name for a restriction enzyme indicates that this restriction site was recreated at a cloning .junction.
i) Construction Of pYBot In order m express the ('. hnrulimrm (' it~agment as a native li.c~., non-t~us~d) protein.
tlm pI'fiat plasmid (shown schematically in Figure ?71 was constructed as follows. The C' (~1'L1L111Cn1 SelItteIlCeS present in pAltcrtiot (Example ?'_') were renewed by di~~estion of I U pAIterI3eU with V'~mi and Ilincllll. The V'cvUlflincllll C fragment insert was Iigated to l~E~fllisa vector Icfcscrihed in E.:xamplc l8h) wloch was di~~estcd with r~'rcrl and NinclIII. This li~~ation creates ao espressicln construct in which the n~c~nl-rncocled toethionine ~f the botulinal C' f~ra~~mrnt is the initiate~r colon and directs expression of the native hotulinal (' fragment.
The li'~ation products were used to transform competent 131.? 1 ( f.)f: ;
)p(.ys~ cells 1 Novaeen ).
1 ~ R~comhin~tnt clones were identified by restriction mapping.
ii) (.'onstruction t)f pHisBot I n order to cypress the ('. hmulinrrm C fragment containing a poly-histidinc tag at the amino-terminus of the recombinant protein. the pl-IisRrn plasmid (shown schematically in '_'() f iturc ?71 was c:unstructed as follows. The V'crUIHincllll botulinal C' (~ragmcnt insert from pnlterhoU was li~~ated into the pl=Tl lira vector which was di~~ested with ,1'Irrl and IIincIlll.
-l~hc .~'wrl lon the C' fragment insert) and rVlac~l (on the pl:THisa vector) sites mere filled in usin~_ the hlrnow fragment prior W li!=ahem: these sites were then blunt end ligated (the ~~'clel site was re~~encrated at the clone juneticm as predicted). ~l~hc li~;ation products were used to '?5 transform competent t3L?1(DEi)pl.vs~ cells and recombinant clones were idcntitied by restriction mapping.
~l~hc resulting pllisBot clone expresses the botulinal C fragment protein with a histidim-ta~~~wd N-terminal extension having the following sequence:
Mct(i1v11isllis l-IisHisl~iisttisf-iisHisHisliisScrSer(~IyHislle(ituGIyArgl'iisMetAla. (5EQ
ll) N():?~): the amino :(t acids enee~clrd by the hotulinal C' fragment gene arc underlined and the vector encoded amine acids arc presented in plain mpg. The nucleotide sequence present in the pf:Tllisa vector which encodc,~s the pliisBot fusion protein is Listed in SEQ ID NU:''S. The amino acid sequence of the pl iisfiot protein is listed in SEQ II) NO:?O.

iii} Construction Uf pGBot The botulinal C fragment protein was expressed as a fusion with the glutathione-S-transferase protein by constructing the pGBot piasmid (shown schematically in Figure 27).
This expression construct was created by cloning the ,r1-nrlhSull (.' fragment insert present in pL3lueHot (Example 22) into the pGEX3T vector which was digested with ,Snarl and .l7anl.
The :~'oU site (present on the botulinal fragment) was madr blunt prior to ligation using the hlencw ti~aLment. The ligation products were used to transtitrm cornpetent f31_? l cells.
Each of the above expression constructs were tested by restriction di'ucstion to confirm the intcLriw of the constructs.
1() large scale ( 1 liter) cultures of pPBot [BL21(OL:3)pl_ys~ host], pEIisHot [BL?1(UF-i)pLysS host] and pCil3ot (BL31 host) were grown in ?X 1'T medium and induced (115Irti If'TCi to ().8-1.() mM) for 3 hrs as described in Lxamplc ?'_'.
'l~otal. soluble and insoluble protein preparations were prepared from 1 ml aliquots ctf each lar~~c scale culture [ W'illiams c~t crl- ( 1994). .wrp-crJ and analyzed by SUS-1'A(iE. No obvious induced hand was 1 s detectable in the pl'Bot car pHisE3ot samples by C'oomassie staininL.
while a prominent insoluble band of the anticipated MW' was detected in the p(iL3ut samplr-~oluhle ivsatrs o1~
the p(il3ot IarLt,' scale ( resuspendcd in l'L3S) or pi lisL3ot largr scale [
resuspendcd in Novagcn 1X binciin~~ buffer (i mM imidaxolr. 0.~ M NaC'I. '_'0 mM ~I'ris-Il('l. pll
7.c))[ cultures were prepared and used to affinity purify soluble affinity-tagged protein as follows.
,~~ .L.Itc r(il3ot lysatc was aftiniy purified on a ;~lutathione-agarose resin II'harmacial exactly its described in smith and C'orcoran (Current E'rotocols in Molecular l3iolo~y.
~upplc~ttcnt ?$ (Ic)c)4). pp. 1(i.7.1-10.7.7[. The pl-Iisl3ot protein was purified on the f-Ifs-l3ind resin ( Ncwacen 1 utilizing the 1-iis-hind buffer kit (Nen~ayn I rxactlv as ctcscrihed by manufacturer.
samples from the purification of both the pCiE3ot and pEiisl3ot proteins (including uninduccd. induced. total. soluble. and affinity-purified eluted prcttr:in) were resolved stn SDS-PnCiLgels. Following electrophoresis, proteins were analyzed by C'oomassie staining or by Western blot detection utilizing a chicken anti-('. hrtrrrlirrrrm i~vpe n toxoid antihoclv (as described in Example ?3}.
These studies showed that the p(it3ot protein was almost entirely insoluble under the utilized conditions. while the pi-IisBot protein was salable. rlflinity purification of the pilisE3ot protein on this lirst attempt was inefficient. both in terms oi' yield (most of the;

immunoreactive botulinal protein did not bind to the His-bind resin) and purity (the botulinat protein was estimated to comprise approximately 20% of the total eluted protein).
d) Purification Of Soluble C, botulint~nr C Fragment Protein Substantially Free Uf Endotuxin Contamins~tion the above studies showed that the pEIisBot protein was expressed in F.. cwli as a soluhlc protein. 1-lowever. the affinity puritication of this protein on the Ills-bind resin was very inctticient. In order to improve the affinity purification of the soluble pl-EisBot protein (in tams of hoth yield and purity). an alternative poly-histidinc binding affinity resin (Ni-!U N'fr1 resin: (?iagen) Vv'aS Lltlllzed. The Ni-NTA resin was reported to have a superior hinding attinim (h,,= I x lU~'' at pH B.U: (,)iagcn user manual) relative to the His-bind resin.
1 soluble lysate (in Novagen IX binding buffer) troth an induced I liter ?X
Y'I' culture was prepared as descrihed above. Briefly. the culture oi' pl-iisBot (E31?1(DCa)pLvsS
host J w av grown at 37°C' to an OD~,,N, of ().7 in 1 liter of ?X YT
medium containing I UU
l ~ yLiml ampicillin. s~l~ Etgiml chloramphenicol and 0.2% glucose. Protein expression was induced by the addition of IPT(i to 1 mM. Three hours atter the addition of the IPTCi. the cells were cooled for 1 ~ min in a ice water bath and then centrifuged I U min at ~()UU rpm in a .IA I () rotor ( E3ccl:man) at ~I°C. 'fhe pellets were rcsuspended in a total wlume of 4U mls W vagm 1 \ binding butter ( > mM imidazole. U.5 M NaCI. ?U mM Tris-E-1C'1. pUl 7.c)).
'_'U transli:rred m.ww ss ml Uakridge tubes and fiozen at -70°C' for at least 1 hr. The tubes mere thawc~i and the cells were lysed by sonication (4 X 2U second bursts using a E3ranson ~oniiicr -ts() ~~ith a power setting ot'6-7) on ice. The suspensi<m was clarified by ccntritiy~aticn for 20 min at c).000 rpm ( l0,UU0 x ,t,~) in a .IA-l7 rotor ((3eckman).
The soluble lysate was hroueht to U.1% NP4() and then was batch absorbed to 7 mI of a 1:1 slurry of Ni-NTA resin:binding buffer by stirring for I hr at 4°('. The slurry was poured into a column having an internal diameter of I or 2.~ cm (I3ioKad). The column was lhCt1 \~'aSh~d sequentially with I.i 1171s of Novagen 1X binding buffer containing U.1% NI'4U.
1 s ml of Novagen 1 X binding bttffcr. 15 m) wash buffer (GU mM imidazole.
(l._i M NaC'l. ?0 mM 'hris-EIC'I. pli 7.~)) and l~ ml NaHPO, wash buffer (s() mM NaHP(),, pli 7.U. U.; 111 ?() NaC'1. lU °r~ ~Ivccrol). 'The bound protein was eluted by protonation of the resin using elution butter (5U mM NaHPO,. pEi 4.U. 0.3 M NaCI, 10 % glycerol). -fhe eluted protein was stored at 4°C'.

Samples of total, soluble and eluted protein were resolved by SDS-PAtiE.
Protein samples were prepared for electrophoresis as described in l;xample ?'?b.
Duplicate gels were stained with C.'oomassie blue to visualize the resolved proteins and C'.
hnrulirnrnr type A toxin-reactive protein was detected by Western blot analysis as described in f:xample '_'?b. A
i representative Coomassie stained gel is shown in Figure ?R. In Figure ?8.
the Ibliowing SaIllpleS ~~'Crl loaded on the I?.5% acrvlamide gel. Lanes 1--J C011t~1tt1 reSI7CCIIVCII' total protein. soluble protein. soluble protein present Ill tile Ilo~~~-lhrotl~il of the Ni-N~I~A column and affinity-purified pl~isl3cri protein (i.r.. protein released from the Ni-N'I~n resin by profanation). Lane s contains hi~.h molecular weight protein markers (Liiultad).
I U ~I~hr purification of pHisf3oi protein resulted in a yield of 7 mg of affinity purified protein from a I liter starting culture of BL?1(DE3)pLysS cells harhorin~~ the pliisBot plasmid. ~fhe yield of purified pHisl3ot protein represented approximately U.4"/° of the total soluble protein in the; induced culture. :lnalysis of the purified pf-lisL3ot protoin by SDS-I'n(if- rmeatcd that at least c)0-c)i°ra, ot'the protein was present as a siylc band (I~is~urr ~R) of l s the predicted MW (SO kD). 'hhis s0 kD protein band was immunoreactivc with anti-('.
hrurrlinmn mpc ~1 toxin antibodies. 'hhe extinction cocfticient of the protein preparation was dctcnnincd to hr l.~ (using the fierce f3C'.n assay) or 1.4s (usin~~ the l.owrv assay) ()t),;'~~ per 1 111t'./n11 solution.
~amplcs of pI-1 neutralized eluted pHisl3ot protein were resolvc,~d on a I~B
RUS HI'LC
_''.t) column t~hudvxl. .~ithough His-tagged proteins are retained by this sizing column (perhaps due to the inherent metal binding ability of the proteins), the relative mohilim of the pl-lisliot protein was consistent with that expectccf for a non-aggrcgatc;d protein in solution. Most of the induced pH isl3ot protein was dctcrtnincd to be soluble under the growth anti solubilicatioe~
conditions utilized above (i.c~., greater than 90'%" of the pf-lisRot protein was found to hr 's soluble as judged by comparison of the levels of pl-fisliot protein seen in total and soluble protein samples prepared from (3L21(DL:3)pLysS cells containing the pflisRot plasmid).
~iDS-I',~Cif~ analysis of samples obtained after centrifugation. extended stc~raRc at -30°('. and at least '_' cycles of freezing and thawing detected no protein loss tdue to precipitation).
indicatin'_ that the ptlisBot protein is soluble in the elution huftvr (i r..
>(> m~-1 Na111'()'. pll ,0 .1.(). U.s A~ NaCI. 40 °/~ glycerol).
Determination oi' endotoxin contamination in the affinity purified pliisE3ot preparation loiter pH ntutrali~.ation) using the I.nL assay (Associates ol~ C'apr (''od) detected no significant endotoxin contamination. 'l~he assay was performed usinL the endpoint chromogenic method twithout diazo-coupling) according to the manufacturer's instructions.
This method can detect concentrations of endotoxin greater than or equal to U.03 ELJ/ml (El!
refers to endotoxin units). The LAL assay was run using U.~ ml of a solution comprising 0.5 mg pHisBot protein in ~U mM NaHPO.,. pE~f 7.U. 0.3 M NaCI. 10 % glycerol: 3U-6U Ell were s cletected in the 0.5 ml sample. Therefore. the affinity purified pllisBot preparation contains (,()-12U ELJ/m~ of protein. f DA (uidelines for the administration of parenteral druLS rec)uire that n c:amposition to he administered to a human contain less than ~ ELJIkg body weight (~Thc average httillall body vycight is 70 kL: therefore up to ~~l9 Ell units can he delivered in a parental dose. ). Because very small amount of protein arc administered in a vaccine 1 t) preparation (generally in the range of 1 U-SUU ug of protein).
administration of affinity purified pl-EisBot containing 6U-120 FlJlmg protein would result in delivery ot~ only a small perccnta;~c oi~ the permissible endotoxin load. For example. administration of 1 U-S00 Etg of purified pl lisi3ot to a 7U 1cL human. where the protein preparation contains 60 El.llmg protein.
results in the introduction ot~ only U.(~ to i0 ELJ (i.e.. U.? to 8.6% of the maximum allowable I ~ cndotoxin burden per parcnteral dc~sc (less than s I:UII:g body vyeight)J.
hhr above results demonstrate that endotoxin (l.P~) does nca copuril'v with the pE-lisI3ut protein usinL the above purification scheme. !'reparations of recombinantly produced pl-lisl3ua protein containing lower levels of endotoxin (less than ur equal to ? Fll/ mg recombinant proUein-1 ma>~ be produced by washing the Ni-NTA column with wash buffer until '_'() the ()I~,~" returns m baseline levels (i.c~., until nn more 1.1V-absorbing material comes off u( the column).
~I'Ir above results illustrate a method for the production and purification of~ soluble.
huutlinal C' ti~aLment protein substantially free of endotoxin.

Optimization Of The Expression And Purification ()f pi-lisBot Protein The results shown in Example 24d demonstrated that the pl-lisl3cri protein is an excellent candidate for use as a vaccine as it could be producul as a soluble protein in L:. cwh i0 and could b~ purified free of pyrogett activity. In order to optimize: the expression and purification of the pl-IisEiot protein. a variety of growth and purification conditions were tested.

qrp 9g/pg~p PCTNS97l13394 a) Growth Parameters i) Host Strains The influence of the host strain utilized upon the production of soluble p1 (isBot protein was investigated. A large scale purit3cation of pllisBot was performed (as described in Example ?4d above using the BL31(UL:3) host (Nova~en) rather than the I3L?1(I)L~3)pLysS bust. The deletion of the pL,ysS plasmid in the BI_21(DC3) host yielded higher Icyels of expression due to de-repression of the plasmid's T7-Iac promoter. Hlowever.
the yield of affinity-purified soluble recombinant protein was very Ic~w (approximately O00 ty/ liter culture) when purified under conditions identical to those described in Example ?4d 1 () ahwc. This result was due to the tact that expression in the BI.? l (UI:3) host yielded very hi~~h level expression of the pl(isBot protein as insoluble inclusion hodles as shown by ~DS-1'ACilr analysis olprotein prepared from induced BL?I(UI:3) cultures IFigure ?~), lanes l-7.
described below). '1-hcae results demonstrate that the pllisBot protein is nm inherently tonic to 1:. cwli cells and can he expressed to high levels using the appropriate promoterihost 1 ~ rumhination.
Figure ?~) shows a Cuomassie blue stained SUS-I'.ACiL: ~.el ( 1?.s'%a arrvlamide) onto which extracts prepared from I3L,?1(UE3) cells containin~~ thc> pl-lis(iot plasmid were loaded.
Mach lane was loaded with ?.i Ltl protein sample mixed with ~.~ tll uI~?X ~I)S
sample buffer.
The samples were handled as described in Example 2?h. The following samples were applied ?U m the ~~cl. L_anes 1-7 contain protein isolated from the BL?1(()I'3) host.
I.ancs 8-14 contain proteins isolated from the F3L21(I)F~a)p(.ys~ host. Total protein wits loaded in lanes 1. ?. 4.
(,. H. I U and 1'_'. Soluble protein was loaded in Lanes ;. ~. 7. 9, 1 I and I
. Lane I contains protein I'l'Oltl uI1111ducCd 17t7S1 cells. Lanes 2-1 3 contain protein from host cells induced for s hours. 1('TCi was added to a final concentration olU.l mM (Lanes (-7). ().; mM
(Lanes 4-i) c,r 1.U InM (Lanes 2. 3. R-1 3). 'rhe cultures were grown in 1,13 broth (Lanes
8-c)). ?X Y1 broth (Lanes lU-11) or terrific broth (Lanes I-7. 12-13). The pIIisI3ot protein seen in Lanes s. ~ and 7 is insoluble protein which spilled over from lanes ?, a and (~.
respectively. I (igh molecular weight protein markers (L3ioRad) were loaded in Lane 14.
;~ variety of expression conditions were tested to determine il the (3I.? 1( DF 3) bust ,() could be utilized to express soluble pFiisRot protein at suitably high levels ( i.c~.. about I () 111rltlll). ~(~I1C CUIIdIIlOIIS aIECrf:d were temperature (growh at 37 ur 30°C'), culture medium (?X Y~f. I.Li or ~I~errif~c broth) and inducer levels (U.1. U.3 or 1.() mM
lI''('G). All CUt11h117atIOnS t)1 these variables were tested and the induction levels and solubility vyas then assessed by SDS-PAGC analysis of total and soluble extracts [prepared fiom 1 ml samples as described in Williams e~ al., (t994), seryraJ.
nll cultures were grown in 15 ml tubes (Falcon #2057). All culture medium was prewarmed overnight at the appropriate temperature and were supplemented with f 00 Etglml ampicillin and 0.2% glucose. Terrific broth contains t2 g/1 hacto-tryptone. ?4 glt bacto-yeast extract and ! ()U roll) of a solution comprising U.17 M KH,PU,. 0.7? M K,1 IPt>,. C'uftures ' were grown in a incubator on a rotating wheel (to rnsurc aeration) to an UI),,,H, of approximately 0.4. and induced by the addition of IPTG. In all cases. high level expression ul~ insoluble pHisf3ot protein was observed. regardless of temperature. medium or induccr 1 () c;ollc:ettlraltoll.
~i'hc ~l~fect oh varying the concentration of~ IP~1'G upon ?X YT cultures grown at 2p°C
was then investigated. 11''fG was added to a final concentration ot~ either 1 mM. (). l mM.
t>.0~ mM or ().()I mM. :\t this temperature, similar levels oC pHis f3cn pre>tcin was induced in the presence od' either I or U.l mM IPTCi; these levels of expression was lc».vcr than that ! > uhservccl at higher temperatures. Induced protein levels were reduced at 0.()5 mM IPT'(i and .Ihsent at t).()I mM lPT(~ (relative to I.0 and 0.1 mM IPTG inductions at '_' 3°t'). However.
n« conditicms were observed in which the induced pHisBot protein was soluble in this host.
Thus. ~tltlunyh expression levels are: superior in the BL?I(DE31 host (as compared to the I3L? 1 ( t)L: i )I)LVS~ hnSl). conditions that facilitate the production of soluble protein in this host ?() ce~ulci nm he identified.
~I hesc results demonstrate that production of soluble pl-fisBut protein was achieved usin;~ the 13L? I ( DF3 )pl.ysS host 111 COI11t111CI10r1 ~1'Ith till' T7-lac promoter.
ii) Effect ()f Varying Temperature, l~lcdium And IPTG Concentration And Length Uf Induction The eti'ect crowing the host cells in various mediums upon the expression of recombinant hotulinal protein Crom the pHisRot caprcasion construct [in the I3L21(I)Ia)pl,ysS
host) wets investigated. I3L?1(DE 3)pLysS cells containing the pI-Iisl3ot plasmid were grown in either I.IB. ?X Y~I~ or 'terrific broth at 37°C'. 'Che cells were induced usiy I mM IPT'ti for 30 a 3 hr induction period. (expression of pl-iisBot protein was found to he the highest when the cells were grown in ?X YT broth (see Figure ?9. lanes 8-13).
The cells were then grown at i()°C.' in 2X YT broth and the concentration of~ IPTti was varied from I Ø U. ; or (>.1 mM alld the length of induction was either i or s hours.
- I (i3 -Expression of pHisBot protein was similar at all 3 induces concentrations utilized and the levels oi' induced protein were higher after a ~ hr induction as compared to a 3 hr induction.
Using the conditions found to be optimal for the expression of pElisBot protein, a large scale culture was grown in order to provide sufficient material tier a large scale purification of s the pllisBot protein. ~I'hrce 1 liter cultures were grown in 2X YT medium containing l0U
Itg/ml ampicillin. ;-1 Etgiml chloramphenicol and U.''°/. glucose.
'T'he cultures were grown at ,U°C and were induced with 1.U mM lt'TG tbr a ~ hr period. The cultures were harvested and ~t soluble lysatc were prepared as described in Example I?;. n large scale purification was performed as described in Example 24d with the exception that except the soluble lysate was batch absorbed tbr , hours rather than for 1 hour. The final yield was 13 tng pl-lisBot proteiniliter culture. 'I'hc pEiisBot protein represented 0.75°/~ of the total soluble: protein.
The shove results demonstrate growth conditions under which soluble pllisBot protein is produced (i.r.. use cal' the E3E.21(UES)pl.vsS host. ?X 1'~1' medium.
sU°C. l.U mM ll'T(i for hnurs>.
~~i h) Optimization Of Purification Parameters t~or optimization of purification conditions, lame scale cultures 13 X 1 liter) were s!rown at i()°C' and induced with I mM I('TG for 5 hours as described above. The cultures were pooled. distributed to centrifuge bottles, cooled and pelleted as described in Example :'_U ?-Id. ~l~l~e cell pellets were froien at -7U°(.' until used. Each crll prllet represented I!s ol' a liter startine culture and individual bottles were utilized for each cytimizati~n experiment descrihect below. This standardised the input bacteria used lin- each experiment. such that the yields W' affinity purified pllisRot protein could he compared hcuveen dii'fercnt optimization caperimcnts.
?>
i) Binding ~pccificity (pll Protonation) ,~1 lysate of pHisIiot culture was prepared in PBS IpII 8.t)) and applied to a , ml Ni-NTA column equilibrated in I'BS (pEl 8.U) using a iluw rate of U.'_' ml/min (s-4 eolumn vulumes/hr1 using an Econo chromatcyraphy svstelll (BioRadl. ~I~hr column was washed with ,(l I'BS (pI-I 8.U) until the absorbance (()U,;~") of the elute was at baseline levels. 'I~hc llow rate was then increased m ? ml/min and the column was equilibrated in 1'BS (plI
7.U). r1 pf~l gradient (hf 1 7.U to 4.() in I'E3S) was applied in order to elute the hot111d pI)tsEiot protein from the column. Fractions were collected and aliquots were resolved on ~I)~-I'ACiI: gels. The PAGf: Lets were subjected to Western blotting and the pHisBot protein was detected using a chicken anti-('. hntulinum Type A toxoid antibody as described in Example 2?.
H'rom tho Western blot analysis it was determined that the pllisBot protein begins to elute i~rotn the Ni-NTA column at pH 6.0, 'This is consistent with the predicted elution uf~ a s Ills-rayed protein monomer at pH 5.9.
'I~hese results demonstrate that the pH at which the pl lisI3ot protein is protonated (released) from Ni-N~I~A resin in Pi3S buffer is pli 6.U.
ii) I3indin~ Specificity (Imidazolc Competition) I() In order to detine puritication conditions under which the native G. c«!i proteins could be rcmovc:d from the Ni-NTr1 column while leaving the pHisTiut protein bound to the column. the following experiment was performed. A lvsate of pFlisBot culture was prepared in iU nW9 Nalll'U,. t).~ M Na('1. 8 mM imidazole (pl-1 7.U). T~ttis lysate was applied to a 3 m! Ni-M7~~1 column equilibrated in ~() mM NaHPU,. 0.5 M NaCI (pF1 7.U) using an Ecuno 1 ~ chromatography system (I3ioRad). A tlow rate of U.2 ml/min (3-4 column volumes/hr) was utilizrcl. l~hc column was washed with s0 mM NaI~iPU,. U.~ M NaC'1 (pH 7.U) until the absorbancc of the elute rrturncd to baseline. The flow rate was then increased to ? elll/Illln.
hhr column was eluted using! an imidazole step gradient [in ~t) mM NaHI'U,.
U.S M
NaC'1 (pl l 7.U)[. f:lution steps were 2U mM. 40 mM. 60 mM. 8U mM. I00 mM. ?UU
mM. 1.U
'_'t) M imidazolr. iullowed by a wash using U.l mM EDTA (to strip the nickel from the column and remove any rcmaininL protein). In each step. the wash was continued until the ()I),~"
rrturncet to baseline. Fractions were resolved on SOS-I'rlCif: gels. Western blotted. and pHisl3ut protein detected using a chicken anti-('. hrrrrrlinunr Type A toxuid antibody as described in Example ?~'. Duplicate gels were stained with C'oumassie bloc to detect eluted protein in each traction.
The results of the t'AGE analysis showed that most of' the non-specifically binding bacterial protein was removed by the 30 mM imidiazoie wash. with the rcmainins~ bacterial proteins being removed in the 4U and 60 mM imidazole washes. The pIIisIW t protein bes~an to elute at IU() mM imidazole and was quantitatively eluted in ?UO mM
imida~ole.
~1'hesc results precisely defined the window of imidazole wash stringency that optimally 1'CI11UYCS G. cvrli proteins f~rum the column while specifically retainin~t the pl~isBnt protein in this.huffer. These results provided conditions under which the pHisl3ot protein can he purified free of contaminating host proteins.

iii) Purification Buffos And Optimized Purification Protocols A variety of purification parameters were tested during: the development of an optimized protocol I-or batch purification of soluble pliisC3ot protein.
~I~lte results of these analyses arc summarized below.
Batch puritications were performed (as described in l:xamplc ''4d) usin~~
several buffers to determine ii' alternative buf'f'ers could be utililcd for binding of the pt-fisE3ot protein to the Ni-N~I"A column. tt was determined that quantitative binding of pHisliot protein to the Ni-NTA resin was achieved in either Tris-HCI (plI 7.c)) or NaEiPC), (pII 8.U) buffers.
1 t) Binding of the pf-iisliot protein in NalifU, bui~fer was not inhibited using ~ mM. 8 mM or 60 mM imidazule. (quantitative elution of hound pllisl3ut protein was obtain cd in buffers containing ~U mM NalifU,. U.3 M NaC'.1 (pH 3.5-4.U). with or without lU'r~
s~lyccrol.
Ulowmcr. ~luantitation of soluble affinity purified plvisBut protrin before and attcr a l~rceze thaw (following several weeks storage of the affinity puriticd elute at -?U°(.') revealed that I > c)4°/~ of the protein was recovered using the glycerol-containing hui~tcr. hut only 6R°/a of the protein was recovered when the buffer lacking glycerol was employed. This demonstrates that glycerol enhanced the solubility of the pllisBot protein in this low pl~l hufi'er when the eluted protein was stored at freezing temperatures tc~.,~~.. -2U°C').
Neutralization of~ pl-l by addition uf~ NaEi,PU, buffer did not result 1lt ObV1Ul15 protein precipitation.
~0 It was determined that quantitative binding ol' pl Iisl3ot protein using the hutch fi~nnat occurred alter i hrs (Figure 3U), but not after 1 hr u1' bindin~_ at ~l°(' (the resin wets stirred Haring binding=>. Fiturc 3U depicts a Coomaisse blue stained ~I)~-fA(iI: Lcl t7.s".~~, acrvlamictcl containing samples of proteins isolated durin~.~, thr puritication ul~ pflisi3ut protein from lysatc prepared from the BL?1(OF3)pl.vsS boat. i:ach lane was loaded with > ~tl of '_'s protein sample mined with ~ )tl of 2X sample buffer and processes! as described in f:~camplc '_?b. Lane 1 contains hiLh ntulecular weight protein markers ( l3ioRad). Lanes ? and s contain protein eluted from the Ni-NTA resin. Lane ~ colllalns soluble protein after a _~ hr hatch incubation with the Ni-NTA resist. Lanes ~ and 6 contain soluble and total protein.
rcspcctiwlv. figure _iU demonstrates that the pHisHot protein is completely soluble ~comparc 3U lanes 5 and 6 which show that a similar amount of the sU I:C) pf (isE3ot protein is seen in both: if a substantial amount (greater than 2U%) of the pHisBot protein were partially insoluble in the host cell. more pllisBot protein would be seen in lane 6 (total protein) as compared to lane ~ (soluble protein). Figure 3U also demonstrates that the pHisi3ut protein is completely removed from the lysate after batch absorption with the Ni-NTA
resin for 3 hours (compare Lanes 4 and 5).
The reported high affinity interaction of the Ni-NTA resin with liis-tagged proteins (K~= 1 x !0-'' at pl-I 8.01 suggested that it should be possible to manipulate the resin-protein complexes without siLnificant release of the bound protein. Indeed, it was determined that after the recombinant protein was bound to the Ni-N1'A resin. the resin-pHisBot protein complex was highly stable and remained bound following repeated rounds of centrifugation of the resin for ? min at I h00 x ,~~. When this centrifugation step was performed in a ~0 ml tube (Falcon). a tight resin pellet formed. 'this allowed the removal oCspent soluhle Ivsate by 1 () pouring off the supernatant followed by resuspension of the pellet in wash buffer. I=urther washes can be performed by centrifugation. The ability to perform additional washes permits the dwelopmcnt of protocols for batch absorption of large volumes of lysatc with removal of the lysatc h~in_~ performed sitnply by centrifugation following binding of the rccomhinant hrotcin m the resin.
Is .1 simplified. integrated purification protocol was developed as follows. A
soluble lysate was made by resuspcnding the induced cell pellet in binding buffer [i0 m11-4 NaIIPO,, t).S ~1 NaC'l. (0 mM imidazolc (pH 8.0)[, sonicating ~4 x ?0 sec and centrifuging for ?0 min ut 10.00() x ,L~. NI'-40 v<as added to 0.1% and Ni-N7'A resin (equilibrated in binding buffer) was added. L~.ight milliliters of a I ; I slurry (resin:binding buffer) was used per liter of ?0 startiy culture. The miwure was stirred for 3 hrs at 4°C. The slurry was poured into a column havin~~ a I cm internal diameter It3ioRad), wotshed with binding butler containin~~
().1 "~" '.11'40. then binding buf~ier until haselinc was established (these steps may alternatively he performed by centritii=anon of the resin. resuspcnsion in hinding buf~fcr containing NI'd0 followed by centrifugation and rcsuspension in bindinL buffer). Imidazole was removed by ~~ashinL the resin with ~0 mM NaHPO_,, ().3M NaCI {pH 7.()). Protein bound to the resin was eluted using the same butter (~0 mM NaHPO" 0.3M NaC:I) having a reduced pl-1 (ptl( ;.s-4.0 ).
n pilaf purification was performed following this protocol and yielded 18 mgllitcr affinity-purified pllisRot. 'the pHisE3ot protein was greater than ~)U'% pure as cstitnated by :() C~oomassie staining oi~ an SDS-PA(if~ gel. This represents the highest observed yield of soluble affinity-purified pl~(isBot protein and this protocol eliminates the need for separate imidazolc-containing binding and wash buffers. In addition to providing a simplified and . ctticicn t protocol for the affinity purification of recombinant pl-IisBot protein. the above results provide a variety of purification conditions under which pHisBot protein can be isolated.

p 'hhe pHisBot Protein is An Effective Immunugen In E:xamplc '?3 it was demonstrated that neutralizing antibodies arc s~enerated in mouse serum alter nasal immunization with the pMBot protein. llowcver, the pMBot prcUein was fbund to cupurify with significant amounts of endotoxin which could not be easily removed.
I~f) The pHisl3ut protein. in contrast. could be isolated free of si~_niticant endotoxin contamination making pf~fist3ot a superior candidate tilr vaccine production. ~I~o further assess the auitahilitv of pl lisliot as a vaccine. the immunogenicity of the pliisBot protein was determined and a comparison of the relative immunoLCnicity of pMt3ot and pt~iWrn proteins in mice wax pcrtormcct as ti~llows.
1 ~ ~fwo groups of~ eight RAI.Bc mice were immunized with either pMtiot protein or ~flisl3ot hrutein using (ierhu (iMDt' adjuvant (CC' Biotech). pMfioo protein (in I'IiS
containing 1 () mM maltose? or pHisBot protein ( in >0 mMNaHI'(),. (). ; M
Na('I. 1 O'~o glycerol. pl-t 4.()) was mixed with (icrbu adjuvant and used l0 1111111un1'le illiCe. E~:ach mouse received an II' injection of 100 til antigen/adjuvant mix (:i0 Eig antigen plus 1 EtL adjuvant) on "'~7 clay (). Mice were boosted as described above with the exception that the route of administration was I M on day I ~1 and 28. The mice were bled an day 77 and anti-( ~.
I)IIIIIIIItIIll1 I~vpe A tuxuid titers were determined using serum collected from individual mice in each ~~roup (as described in E;xampte 2s). The results are show-n in Tahle 4I.

r:',st.E: ar ~Illi-(' hrlrrelrnmn type .A I'ow,id scram Ig(i 'l~itcrs In (ndivitlual Micc (mmuniwtl H ith pMlit,l or pl lisl3ot Protein I'reimmunc' pMDon pHisfiot=

Sample Sample. Sanlplc Dilution t)ilution Dilution \ltnlse n I';11:2?III 1:62?l1I 1:2601:12111:62sUI 1:2511I-t20I
12~I1 sll io h2o s I o u.lt)oa u.1x171 u.7tn)a mt)~
f,7x u;: :7a .i2o .

I.Ir,I0.9310.2;4I)n7;1:1)11.x29).41)t)ILI.i4 ( I.thJf14xIl,lt)U.11:lII 1112:1Il.lsi11.1?2 ~9h 7 I I.Ixt)1l.i.iJILllr,7I l).xaf1n (Lrlt)11 f22 52 ~.rx 1 I.())II().2xt)11.1167I I.ixfl().xtl;t123s 612 r,2t) 1 n Il.t)130.242!) 11 I fl.t)s2ILJ770 l) O(,t>07 .1x5 146 ;

- (1411111.2311.11xf1111JI.?2a11.72611.264ILIIHt) s a.m7 cl.2aanll:xu.nlaI<m 1)x27ILIO,nn2t1 ~I~:111 I itrrno.lxuo21 unllf)Ixl2I 1)u,.m nu;7 I Irxt)1,n..clln Iw ln.l ~Ix I
l:r l;
I
Ilt:
pnnnnnnlr sumplc represents the awr:r,c lioln ?
scls of Juplicute wrlls txuuainine serum tinm a individuld nu,use 111111111111Letl ,villl fett,111111t1:1111 .l/rlrtrn'rr,t'11t't'trl' elllert,ln\Itl I~
(Sl:lj) i1I111!_l'11.
IillS
atltl!_CIl Lv It111111It1t11l,LIC:1111' Iltlrelalt'.tl Im !' hmlerllrllrll!
Itt\111 :11111 prnVItIW
a lltlllrn) W
rt1111 ~I) \waec of tluplic:m well, hhc results shown above in 'fable ~ 1 demonstrate that both the pMBot and pI-IisRot protrins arc immunoe:enic in mice as 100% oi~ the mice 18/8) in each group seroconverted from non-immune to immune status. The results also show that the average titer of anti-C'.
'_'; hr)rrrirnrr))r ~I~vpe A toxoid lgG is ?-_, told higher after immunization with the pllisFiot protein relative to immunization with the pMBot protein. This suggests that the pl-IisBot protein may be a supt:rior immunogen to the pME3ot protein.
CXAMPLI: 27 3U Immunization With The Recombinant pl~isBot Protein Generates Neutralizing Antibodies ~I~hl I'CSUIIS SIII~Wn Irl Example ?6 demonstrated that both the pllisl3ot and pMBot proteins were capable of inducing hi~~i~ titers of anti-C'. l7nrulinrrnr type A to~coid-reactive antibodies in immunioed hosts. The ability of the immune sera from mice immunioed with either the pHisf3ot or pMBot proteins to neutralize ('. hmulinurrr type A
toxoid in aim) was determined using the mouse neutralization assay described in Example ?3b.

WD qg/pgsqp PCTlUS97I15394 'the two groups of eight BALBc mice immunized with either pMBot protein or pl-iisBot protein in (;xample 2G were boosted again one week after the bleeding on day 77.
1'he boost was performed by mixing pMBot protein (in PBS containing IU mM
maltose) or pHisBot Protein (in ~0 mM NaHPO,. U.s M NaCI. lU% s~lvcerol. pII 4.U) with Cierbu s adjuvant as described in Example ?6. Each mouse received an I1' injection of lUU Itl antigenladjuvant mix (~0 yg antigen plus 1 pg adjuvant). 'fhc mice were bled O
days titter this boost and the serum ti-om mice within a group was pooled. SerUnt from preimmune mice was also collected (this serum is the same serum described in the teotnote to 'fable ~I ).
'The presence of neutralizing antibodies in the pooled or prcimmune scrtun was 1 U detected by challenging mice with ~ L.DS" units of type A toxin mixed with I UU Ell of pooled serum. Tht; CltallellS!e waS performed by mixing (per nl(lusC to he injected) lUU yl of'scrum tiwm each pool with lUU Ill of purified type A toxin standard (SU I.Oj" iml prepared as dcscrihcd in f:xamplc ? ih) and SUO )tl of gel-phosphate. 'l~he mixtures were incubated tbr 30 min at room temperature with occasional mixing. Each of tour mice were ipected Il' with 1 s the mixtures (t).7 ml/mousc). ~l'he mice were ohservcd for signs c,1' hotulism ii~r 7'_' hours.
Mice receiving toxin mixed with serum from mice immunized with either the pl iisl3ot or hMf3ot proteins showed no signs of hotulism intoxication. to contrast, mice receiving prcimmune scrum died in IeSS than 24 hours.
These results demonstrate that antibodies capable of neutralizing l '.
lmnclinum type A
?U toxin are induced wizen either of the recombinant (.'. hcmrlinum (' traement proteins pH isHot or pMt3ot are used as immunogens.

Cloning And U:xpression t)f The C' I~ragmcnt o1~ ('. ht)Itlllrlifl7l ~s Serotype A Toxin In E. cwli Utilizing A Native Gene hragntcnt 1 n Example 2? above. a synthetic gene was used to express the C' fragment of ( '.
h«rnli»i»n scrotypc A toxin in G'. cwli. The synthetic gene replaced non-preferred (i.r.. rare) colons present in the (' fragment gene with colons which are preferred by 1:~.
cull. The ,U 51'Iltltetle Lclle V1'aS generated because it was been reported that genes which have a his~h A/Z' content (such as most clostridial genes) creates expression dil'ticulties in f. cwli and yeast.
rurthermore. LaPenoticrc m crl. suggested that problems encountered with the stability (non-fusion constructs) and solubility (MRI' fusion constructs) of the (.' fragment of ('. hutulinum - i 7U -serotypc A toxin when expressed in E. rnli was most likely due to the extreme A/T richness of the native C'. hvtulir~um serotvpe A toxin gene sequences ( La!'enotiere.
cu crl.. .supra).
In this example. it was demonstrated that successful expression ol' the C
Iwagment of ('. hrmrlinum type A toxin gene in E. cwli does not require the elimination of rare colons (i.r.. there is no need to use a synthetic gene). This example involved a) the cloning of the native C' fi~agmem ~f the ('. hn~erlirmm serotype A toxin gene and construction of an cxpresston moor and b) a comparison of the expression and purification yields of C'.
hrutrlirrtrrtr serotypc A C fragments derived from native and synthetic expression vectors.
IU a) Cloning Uf The Native (: Fragment Of The (: hotulirrum Scrotype A '('oxin Gene And Construction Uf An Expression Vector The seroype A toxin gene was cloned fiom ('. hnlrrlirrum ~enomic DN,A using I'CR
ctmplitication. The tollowing primer pair was employed: s'-C(~CCA'I'G(~CTAC
Is A~I~T~I~rTA'fCI~ACATTTAC.'-s' (>' primer. Ncwl site underlined: SFQ IU
N():?<)) and ~~-W'AA(~('TT'CTT(~AC'AVA(.'TCA'1'(~TA(~-3' (s' primer. Nindlll site underlined: SEQ IU
'~( ):3()). ( '. hnnrliraum ype A strain was obtained tcom the American '(~ype ('allure (.'ollection (.1-I~C'('# ( c):97) and grown under anaerobic conditions in Terrific hroth medium. Iliuh molecular-weight ('. hrrltrlintrm DNA was isolated as described in Example 1 1. The integrity '_() and yield of genomic DNA was assessed by comparison with a serial dilution ol' uncut lambda t)NA alter electrophoresis on an agarose gel.
Th c gene tragmcnt wax cloned by I'CR utilizing a proofreading th crmostable UNA
pc~lymcrase (native l'Jir polvmcrasct. 1'CR amplitication was pertitrmed using tire above primer pair in a ~OUI reaction containing IOmM Tris-HCI (pH 8.s>. sUmM KCI.
l.~mM
'-S MeC'I,. ?U()IeM each dNTP. O.?~.M each primer. and SOng ('. hutulirtum genomic DNA.
Reactions ~~ere overlaid with 1 ()Olcl mineral oil, heated to 94"(' 4 min.
U.5~1 native I'yt polymerasc (Stratagenc) was added. and thirty cycles comprising c)4"C for I
min. s0°(' for 2 min. 7'?°C' for 2 min were carried out followed by 10 min at 72°C. An aliquot ( I ()Ltl ) of the reaction mixture was resolved on an agarosc gel and the amplified native C' fragment gene was gel purified using the Prep-A-Gene kit (BioRad) and ligated to p(:'RScript vector DNA
(Stratagcne). Recombinant clones were isolated and contirmed by restriction digestion, using standard recombinant molecular biology techniques /Sambrook et crl. ( 198c)), .,urprcr]. In addition, the sequence of approximately ,00 bases located at the ~' end of the C fragment -17t-*rB

WO 98108540 PCT/US9'7115394 coding region were obtained using standard DNA sequencing methods. The sequence obtained was identical to that of the published sequence.
An expression vector containing the native C'. hotulinunr serotype A C
fragment gene was created by ligation of the A~cml-!find))) fragment containing the C:
fragment gene from the pC'RScript clone to ~Vhel-IlindlIl restricted pETHisa vector (Example 18b).
~l'he Ncwl and :1'hc~l sites were tilled in using the Klenow enzyme prior to ligation: these sites were thus !lent-end Grated together. The resulting, construct was termed pl-Iisl3otA
(native). pHisBotA
(native) expresses the ('. hmulinum scrotype A C' fragment with a his-tagged N
terminal ~'xt211S1u11 wllleh has the ti,llowing sequence:
McOTIvIIisHisllisllisllisllisH
isHisHisHisSerScrGIyF(isllcWlrrC~Ivilrt~HisMetAla (SEQ ID
N():?~1. where the underlining represents amino acids encoded by the ('.
hourlirunir C' fragment gene (this N terminal extension contains the recognition site tile hactorXa protease.
shown in italics. which call be employed to renewed the polyhistdinc tract from the N-tcrminus af~ the fusion protein). The pHisRot (native) construct expresses the identical protein I ~ as the pl-tisIiot construct (Ex. ?4c: herein after the pliisBotA1 which contains the synthetic >;clle.
The predicted DNA sequence encoding the native ('. hamlimrn~ serotypc A C' fragment ~~ene contained within pilisL)utA (native) is listed in ~LQ II) N():sl (the start of translation (A'l~O) is located at nucleotides 1()$-110 and the stop of translation (TAA) is located at '0 nucleotidesi4~)~l-l~l~)(, in SC:Q ID N():3l) and the corresponding amino acid sequence is listed in SE~:Q ID N():?O (i.r.. the same amino acid sequence as that produced by I,I~istiotA
mntainin~~ synthetic <_cne sequences).
ly Comparison Uf The Expression And Purification Yields ()f C: butulintrni< Serotypc A C Fragments Derived Frorn Native And Synthetic Expression Vectors Recombinant plasmids containing either the native ur the synthetic ('.
hultrlinunr scrotype A C' fragment ~~enes were transtbrmed into l:. cull strain I31?1(DI:3) pLysS and protein expression way induced in I liter shaker flask cultures. ~l utal protein extracts a ~erc 30 isolated. resolved tin ADS-I'ACiE. gels and ('. hunrlirarmz (' fragment protein was identified by WeSterll allall'S1S LltIIILlIIL a eIllChcil allll-('. hmullmnn aeroypc A
tuxuid antiserum as descrihed in Example 3'?.
. 17 Briefly. I liter (2XYT + 100 Etg/ml ampicillin and 34 ug/ml chloramphenicol) cultures of bacteria harboring either the p1-IisBotA (synthetic) or pHisBotA (native) plasmids in the Rl?1(DE3) pL.vs~ strain were induced to express recombinant protein by addition of IPTG to I mM. C'ulturcs were grown at 3U-32°C'. IPTG was added when the cell density reached an s ()D~,,N, (l.S-I.0 and the induced protein was allowed to accumulate for 3-4 hrs otter induction.
'rhc cells were cooled for 1 s min in a ice water bath and then centrifuged for 10 min at s0()0 rpm in a JA t 0 rotor ( Beckman I at 4°C. The eel l pellets were resuspended in a total volume of 4() mls iX binding buffer (~i0 mM imidazole. 0.5 M NaCI. 50 mM
NaPO,, pli t1.0). transferred to two ~U ml Oakridge tubes and frozen at -70°C for at least 1 hr. The tubes were then thawed and the cells were Ivsed by sonication (using tour successive ?() second bursts) on ice. 'hhe suspension was clarified by centrifugation ?0-30 min at
9,000 rpm ( 1 O.U()O,f,~) in a .lA-i 7 rotor. The soluble lysate was batch absorbed to 7 ml of a t :1 slurry of NiNTA resin:hinding buffer by stirring ?-~l hr at 4°C'. The slurry was centrifuged for 1 min at ~0(),t~ in 5() ml tube ((=alconl, resuspended in ~ mls binding buffer and poured into a ?.5 cm I ~ diameter column (BioRad). The column was attached to a UV monitor (ISC()) and the column was washed with bindinf; buffer until a baseline was established.
Imidazoie was renewed by washing with ~OmM Nal'O,. 0.3 M NaCI. 10% glycerol, pH 7.0 and bound protein was eluted using sOmM NaP(),, 0.3 M NaCI. 10% glycerol. pI-1 3.~-4.U.
fhe eluted proteins were stored at 4°C. Samples of total, soluble, and eluted proteins ?() were resolved by ADS-f'ACiI. l'rotcin samples were prepared for electrophoresis by Itllxfl7~
I)fl t<Ual (~I~) or soluble (S) protein with 4 Efl PBS and ~ y! ?X SDS-PAGE:
sample buffer, or tel eluted (C) protein and s Efl ?X SDS-PAGE sample buffer. ~l'he samples were heated to ~)~' C for s min. then cooled and ~ or 10 Ids were loaded on 12.5% SUS-PAC'IE
gels. Broad range nwlecular weight protein markers lE3ioRad) were also loaded to allow the MW of the ?s identified fusion proteins to be estimated. After electrophoresis. protein was detected either generally by staining fiefs with C'oomassie blue, or specifically, by blotting to nitrocellulose for Western blot detection of specific immunoreactive protein.
l~or Vl4'estern blot analysis. the gels were blotted. and protein transfer was confirmed by I'onceau S staining as described in Example ??. Alter blocking the blots for l hr at room :0 temperature in blocking buffer (PRST and 5% milk), 10 ml of a 11500 dilution of an anti-C.'.
hnte~lirrrrm toxin A 1~;Y PEG prep (Lx. 3) in blocking buffer was added and the blots were incubated for an additional hour at room temperature. The blots were washed and developed using a rabbit anti-chicken alkaline phosphatase conjugate (Boehringer Mannheim) as the *rB

secondary antibody as described in Ex. 22. This analysis detected t:'.
borrrlinum toxin A-reactive proteins in the plIisBotA (native and synthetic) protein samples (corresponding to the predicted full lEngth proteins identified by Cuomassie staining).
A gel containing proteins expressed from the pHisBot and pHisBot (native) constructs s during various sta~!es of purification and stained with Coomassie blue is shown in Figure 31.
In Figure ,l. lanes I-4 and ~) contain proteins expressed by the pHisI3otA
construct (i.e., the synthetic gene) and lanes ~-8 contain proteins expressed by the pHisBotA
(native) construct.
Lanes I and 5 contain total protein extracts; lanes 2 and b contain soluble protein extracts;
lanes .i and 7 contain proteins which flowed through the NiN'1~A columns:
lanes 4, 8 and ~) l(J contain protein eluted from the NiN'hA columns and lane l0 contains molecular weight markers.
Tlre above purification resulted in a yield of 3 mg (native gene) or 1 1 me (synthetic Ll'11e) ol'affinity purified protein from a t liter starting culture, of which at bast 90-9>°/, of the protein was a single band of the predicted MW (~Okd) and immunoreactiyitv tier I > recombinant ( '. hmulinum serotvpe A C' fragment protein. Other than the level of expression.
no difl'crence N~as observed hctween the native and the synthetic gene expression systems.
These rrsults demonstrate that soluble ('. hanrlinum scrotype A C' l'raLmcnt protein can be expressed in f:. cwli and purified utilizing either native or synthetic Bern se~lucnces.
'(I EXAMPLE 29 Generation Uf Neutralizing Antibodies lJsing A Recombinant ('. hmurlinrrrn Serotype A C' Fragment Protein Containing A Six Itesiduc tlis-~I~aL
In Lxample 27. neutralizing antibodies were generated utilizing the p1(isf3otA
protein.
which contains a histidine-tagged N-terminal extension comprising I (1 histidine residues. 'fu determine ii' the generation of neutralizing antibodies is dependent on the presence of this particular his-tag, a protein containing a shorter N-terminal extension (comprising 6 histidine residues) was produced and tested for the ability to generate neutralizin f:
antibodies. 'This example involved a) the claning and expression of the pOHisBotA(syn) protein and h) the -3() generation and characterization of hvpcrimmune scrum.

WO 98108540 PCTlUS97/15394 a) Cloning And Expression Of The p6HisBotA(syn) Protein The p6HisBotA(syn) construct was generated as described below: the term "syn"
designates the presence of synthetic gene sequences. This construct expresses the C frgament of the ('. hcuulir?run serotype A toxin with a histidine-tagged N terminal extension having the following sequence: MetHisHisfiisHisHisHisMetAla (SI:Q ID N0:33); the amino acids encoded by the hotuiinal C fragment gene are underlined and the vector encoded amino acids are presented in plain type.
(~XHis oligonucleotides ji'-'fATGCATC:ACCATCAC:CA'tCA-3' (SEQ ID NO:33) and ~'-C'ATG'1'CiA~rGGTGATGG'T'GATGCA-3' (SEQ fD N0:34) were annealed as fUIIUU's.
One () microgram of each oligonucleotide was mixed in total of ?0 l.tl f X
reaction buffer 2 (NEB) and the miwure was heated at 70°C tier ~ min and then incubated al 42°C.' for ~ min. l'he annealed oligonucleotides were then ligated with gel purified l4'cleIINirrdlIl cleaved pET23h ( ~I~7 hromotcr 1 or pFT21 b ('r7lac promoter) DNA and the eel purified NewIItIirrdlll C'.
hrmrlinrrnr serotvpe A (.' fragment synthetic gene fragment derived from pAltcrBot (I:x. ??).
) ~ Recombinant clones were isolated and confirmed by restriction digestion.
The DNA sequence encoding the 6X his-tagged BotA protein contained within pGHisBotA(syn) is listed in SEQ
II) N0: 3s. The amino acid sequence of the p6X1-lisliotA protein is listed in Sf:Q fD N0:36.
The resulting recombinant pGXIUisBotA plasmid was transfbrmcd into the f3I.21(DE3) pLvsS strain. and l liter cultures were grown, induced and harvested as described in hxampEe ?0 ?8. f Its-tagged protein was purified as described in Example 28, with the ibllowing modifications. ~f'h~ binding buffer (BB1 contained ~ mM imidazole rather than 40 mM
imidarole and NI'40 was added to the soluble lysate to a linal concentration of 0.1%. 'I~hc:
hound material was washed on the column with BB until the baseline was established, then the column uas washed successively with BB+?0 mM imidazoie and BB+40 mM
imidazole.
?> 'fhe column was eluted as described in Example 28.
In the case of the pE:T?3-derived expression system, nigh level expression of insoluble 61-lisBotA protein was induced. The pL:T?I-derived vector expressed lower levels of soluble protein that bound the NiNTA resin and eluted in the 40 mM imidazole wash rather LhaI1 during the iou p1-I elution. These results (i.v., low level expression of a soluble protein) are 30 consistent u-ith the results obtained with pfiisBotA protein (Ex. ?5): the pl~isBotA construct, like the pET? t-derived vector. contains the T7lac rather than T7 promoter.
The 6HisBotA protein thus elutes under less stringent conditions than the lOX
histidin c-containing pI-IisBot protein 1 100-200 mM imidazolc: Ex. ?5) presumably due to the reduction in the length of the his-tag. The eluted protein was of the predicted size [i.c~..
slightly reduced in comparison to pHisBotA protein].
b) Generation And Characterization Of Hypcrimmune serum s Eight BALBc mice were immunized with puritied 61)isRotA protein using Cierbu GMDP ad_juvant (C'C' Biotech). The 40 tnM imidazole elution was mixed with Cierhu ad,juvant and used to immunize mice. Each mouse rrceived a subcutaneous ipcction of~ IOU
yl antigen/adjuvant mix (!2 pg antigen + 1 ~tg adjuvant) on day 0. Mice were wbcutancouslv boosted as above on day 14 and bled on day 28. C'ontro) mice received pl iisRotB protein (prepared as described in Ex. 35 below) in Gerbu adjuvant.
Anti-('. hntulirrrrm serotype A toxoid titers were determined in serum from individual mice t~rom each group using the I:LISA described in Example 2 is with the exception that the initial testing scrum dilution was 1:100 in blocking hut'fi:r containing 0.>%
~I~ween ?U.
lullowed by serial 5-told dilutions into this butter. The results ot~ the ~I.ISi1 demonstrated I ~ that seroconversion (relative to control mice) occurred in all 8 mice.
The ability eel' the anti-('. Imrrlinum serotype A C t~agment antibodies present in scrum t~rom the immunized mice to neutralize native (.'. hmrrlinrrnr type A toxin was tested using the mouse neutralization assay described in Example 23b. The amount of neutralizing antibodies present in the serum ot~ the immunized mice was determined usinL scrum antibody titrations.
?0 The various serum dilutions (0.01 ml) were mixed with 5 L,Di" units of ('.
hotulinum type A
toxin and the mixtures were injected IP into mice. The neutrali-raticms wrre perforrned in duplicate. ~l~hc mice were then observed for signs of botulism It~r ~4 days. i Jndiluted serum was ti~und to protect 100% ot~ the injected mice while the l :10 diluted scrum slid not. This corresponds to a neutralization titer oi~ O.US-0.~ IU/ml.
'?5 These results demonstrate that neutralizing antibodies were induced when the 6liisBotA protein was utilized as the imntunogen. Furthermore, these results demonstrate that arroconversion and the generation of neutralizing antibodies dues not depend on the spcciiic N terminal extension pmsent on the recombinant ('. huurlinrrm type A C' fragment proteins.
- 17h -WO 98108540 PCTNS97Il5394 Construction Of Vectors For The Expression Of His-Tagged ('. hmulinum Type A Toxin C Fragment Protein Using the Synthetic Gene S A number of expression vectors were constructed which contained the synthetic C'.
hmulinernr type A toxin C fragment gene. These constructs vary as to the promoter (T7 or 'f7lac) and repressor elements (laclq) presem an the plasmid. The T7 promoter is a stronger nronu~ter than is the '1'7lac promoter. The various constructs provide varying expression levels and varying levels of plasmid stability. This example involved a) the construction of expression vectors containing the synthetic C.'. hmulinum type A C fragment gene and b) the determination of the expression level achieved using plasmids containing either the kanamycin resistance ar the ampicillin resistance genes in small scale; cultures.
a) Construction Of Expression Vectors Containing The synthetic C. botulirrunr Type A C Fragment C:ene Expression vectors containing the synthetic ('. hnmlu7una type A C fragment gene were engineered to utilize the kanamycin resistance rather than thc,~ ampicillin resistance gene. This was clone t~>r several reasons including concerns regarding the presence of residual ampicillin in recottthinant protein derived icom plasmids containing the ampicillin resistance gene. In ?() addition. ampicillin resistant plasmids are more difficult to maintain in culture: the ~3-lactamase secreted by cells containin~~ ampicillin resistant plasmids rapidly degrades extraccllular ampicillin. allowinL the Lrowth of plasmid-negative cells.
.A second altered leature of the expression vectors is the inclusion of laclq gene in the hlasmid. This repressor lowers expression from lac regulated promoters (the chromosomally ?5 located. lactose regulated T7 polymerasc gene and the plasmid located T7lac promoter). This down regulates uninduced protein expression and can enhance the stability of recombinant cell lines. The final alteration to the vectors is the inclusion of either the 'f7 or 1'7lac promoters that drive high or moderate level expression of recombinant protein.
respectively.
The expression plasmids were constructed as follows. In all cases. the protein s~ expressed is the pHisBotA(syn) protein previously described. and the only differences between constructs is the alteration of the various regulatory elements described above.
- t 77 -i) Construction Of pHisBotA(syn) kan T7iac The pHisBotA(syn) kan T7lac construct was made by inserting the ScrIUl.Yhul fra~:ment containin t the C'. homlinarm type A C fragment from plwlisBotA(syn) into pET?4 digested with .Scrplhl'hnl (Novagcn: fragment contains kan gene; and origin of replication).
~fhe desired construct was selected for kanamycin resistance and confirmed by restriction digestion.
ii) Construction Of pl-IisBotA(syn) kan laclq T7lac l~hc pllisl3otA(syn) kan laclq T7lac construct was made by inserting the ,17~u1IHindII1 fragment containing the ('. horrlinerm type A C fragment from pliisBotn(syn)kan~1'7lac into It) the pE'1'?4a vector digested with XhutlHindIII. 'fhe resulting construct was confirmed by restriction dieestion.
iii) C:unstruction t)f pHisBotA(syn) kan lacly T7 1-he pl iisBotA( syn) kan laclc~ T7 construct was made by inserting the ,l'hulllfindl tl 1 ~ fragment containing the ('. hvlrrlinunt type I1 C fragment from pIIisBotA(syn) kan lacld T7lac into ,l7nrl/IlindllI-digested pliisl3otB(syn) kan laclq T7 (described in L:~c ;7c h claw). ~flze resulting wmstruct was confirmed by restriction digestion.
h} Determination Uf The Expression Level Achieved lJsinfi _'U I'lasmids Containing Either The kanamycin Resistance Or The Ampicillin Resistance Genes In Smail Scale Cultures ()ne liter cultures of pHisBotA(syn) kan ~I~7)acllil2l(OE3)nl,ysS and pl-IisE3otAtsvn) amp ~I~7lac/I3l?1(DE3)pL,vsS [this is the previously designated pllisBotAfsvn) construct) were ~~rown. induced and his-tagged proteins were purified as described in Esamplr ?8. No '_'s differences in yield or protein integrity/purity were observed.
These: r~~sults demonstrate that the antigen induction levels from expression constructs were not affected by the choice of ampicillin versus kanamvcin antibiotic resistance genes.

WO ~~~ PGTIUS97115394 Fermentation Of Cells Expressing Recombinant Botulinal Proteins a) Fermentation Culture Of Cells Expressing Recombinant Botulinal Proteins Fermentation cultures were grown under the followin 8 conditions which were optimized fur growth of the BL.21(DE3) strains containing pFT derived expression vectors.
An overnight 1 liter feeder culture was prepared by inoculating of 1 liter media (in a 2L
shaker flask) with a fresh colony grown on an LB kan plate. The feeder culture contained:
6U0 nUs nitrogen source [2U ~m yeast extract (BBL) and 40 ~m tryptone (BBL)1600 mlsJ. 200 mls ~X fermentation salts (per filer: 48.5 gm K,HPO,, 12 gm NaH,PU,~H,O, i pm NH,C1.
2.~ pm NaC'1). 180 mls dH,U. 20 mls 20"/0 ~,lucose. ? mls I M MgSU,, S mls O.OSM CaCI, and :) mls of a 10 mglml kanantycin stock. All solutions were sterilized by autoclaving.
except the kanamycin stuck which was filter sterilized.
1 ~ :1n aliquot (~ ml) of the feeder culture broth was removed prior to inoculation, and ~~rown fur ? davs at 37°C' as a culture broth sterility control. Growth was not observed in this control culture in any of the ferntentations performed.
I~hc inoculated feeder culture was gown for 1?-I~ hrs (UN) at 3U-,7°C'.
Care was takrn t« prevent ovcrsaturation of this culture. The saturated feeder culture was added to 10L.
?U ul' fermentation media in termenter (BioflolV. New Brunswick Scientific.
I:ellsOn. N.1) as follows. The termentcr was sterilized 120 min at 121°C with dH,U. The sterile water was rcmm~c~3. and Icrmentation media added as follows: 6 liters nitro~ett sourer.
'_' liters ~X
fermentation salts. ? liters ?"/o tlucose. 20 m1s 1 M MgSU,. i0 mls O.U~ M
CaCI=. 2.~-3.~
mls ~~laco) P 400 antifoam (PPG Industries Inc.. Gurnee. I1.), 40 mls lOm~/ml kanamycin and I() mls tracr elements (8 gm FeSO,~7H,U. 2 gm MnSO,~H,U. 2 ~m AIC1;~6Ei,0. 0.8 gm C'oC'1~6H_O. (1.4 gm ZnSO.,~7I-1,0. 0.4 gm Na,MoO,~2H,0, U.2 gm CuC'.1,~?Ii,O.
0.2 gm NiCI,. 0.1 gm H,B0,/200m1s 5 M HCl). All solutions were sterilised by autoclaving. except the kanamvcin stock which was filter sterilized. Fermentation media was prcwarmed to 37°C.' before the addition of the feeder culture.
;0 After the addition of the feeder culture. the culture was fermented at :~7°C, 40U rpm agitation. and 10 t/min air sparging. 'The DO, control was set to 20"/" PID
and dissolved oxv~en levels were controlled by increasing the rate of agitation f~e-om 4()0-SS0 rpm under I)U, control. DO, levels were maintained at greater than or equal to 20"/"
throughout the qrp 9g/pg~qp PCTIUS97115394 entire fermentation. When agitation levels reached 500-60U rpm the temperature was lowered to 30°C to reduce the oxygen consumption rate. Culture growth was continued until endogenous carbon sources were depleted. In these fermentations. glucose was depleted first [monitored with a glucose monitoring kit (Sigma)], followed by assimilation of acetate and other acidic carbons [monitored using an acetate test kit (Boehringer Mannheim)]. Uuring the assimilation phase. the pH rose from 6.b-6.8 (starting pH) to 7.4-7.5, at which time the bulk of the remaining carbon source was depleted. 'This was signaled by a drop in agitation rate (from a maximum of 700-800 rpm) and a rise in DO, levels =~30'ro. This corresponds to a ODh,", reading of l8-20/ml. At this point a fed batch mode was initiated, in which a teed solution of 50% glucose was added at a rate of approximately 4 ~~m glucose/liter/hr. 'hhe pH
was adjusted to 7.0 by the addition of 25% H;PO, (approximatcty 60 mls).
Culture growth was continued and reached peak oxygen consumption within the next 3 hrs of growth (while the remaining residual non-glucose carbon sources were: assimilated). This phase is characterized by a slow increase in pl i. and air sparging was increased to 1 ~Llrnin. to keep 1 > the maximum rpm below 85U. Once the residual acidic carbon sources are depleted the agitation rate decreases to G~0-750 rpm and the pH begins to drop. I1H control was maintained at 7.0 PID by reLUlatcd pump addition of a sterile 4M NaOII
solution which was consumed at a steady rate for the remainder of the fermentation. Growth was continued at ;0°(', and the cultures were grown linearly at a growth rate of 4-7 OD~"" units/hr. to at least ?i) 81.5 ()U,,"" units/ml (>sOg/1 dry cell weight) without induction. Antifoam (a 1:1 dilution with filter sterilized 100% ethanol) was added as necessary throughout the fermentation to prevent foaming.
During the fed batch mode. glucose was assimilated immediately (concentration in media consistently less than 0.1 gm/liter) and acetate was not produced In SI~LTnItICallt levels by 2.~ the pC:~r plasmidIBL? 1 (DE i ) cell lines tested (approximately 1 gmlliter at end of fermentation: this is lower than that observed in harvests from shaker flask cultures utilizing the same strains). This was fortuitous, since high levels of acetate has been shown to inhibit induction levels in a variety of expression systems. The above described conditions were found to be highly reproducible between ferlncntations and utilizing different expression plasmids. As a result. Llucosc and acetate level monitoring were no IonLer preforlned during fermentation.

*rB

b) Induction Of Fermentation Cultures Induction with IPTG (250 mg-10 gms, depending on the expression vector and experiment) was initiated 1-3 hrs after initiation of the glucose feed (30-50 ODD,",/ml). The growth rate atier induction was monitored on a hourly basis. Aliquots (~-10 ml) of cells were harvested at the time of induction. and at hourly intervals post-induction.
Optical density readings were determined by measuring the absorbance at 600 nm of 10 yl culture in 990 Ltl PBS versus a PBS control. The growth rate after induction was found to varv depending on the expression system utilized.
() c) Monitoring Uf Fermentation Cultures f~ermcntation cultures were monitored using the following control assays.
i) Colony lHorming Ability .'fin alicluots of cells were removed icom the cultures at each timepoint sampled I ~ (uninduced and at various times after induction) were serially diluted in PBS (dilution 1=1 S
yl cellsl,, ml PBS. dilution ? = t ~ yl of dilution l/3 ml I'BS. dilution i =
s or ( yl of c.lilution ?/3mls PBS) and l0U yl of dilution 3 was plated on an LB or TSA
(trypticase soy agar) plate. T'hc plates were incubated ON at 37°C and then the colonies are counted and scored tier macro or micro growth.
2(f ii) Phenotypic Characterization C'alonies growing on LI3 or ~fSA plates (above) from uninduced and induced timepoints were replica plated onto LB+kan, L.H+chloramphenicol (fbr fermentations utilizing L.vsS or p~ICYC'Gru plasmids). L.13+kaw+-ImM IPTG and LB plates, in this order. 'I'lze plates ''s were gown 6-8 hrs at 37°C and growth was scored on each plate for a minimum of 40-50 veil isolated colonies. The percentage of cells retaining the plasmid at time of induction (i.e..
uninctuced cultures immediately prior to the addition of 1PTG) was determined to be the #
colonies LB+Kan (or chloramphenicol) platel# colonies I_B plate X 100%. 'rhe percentage of cells with mutated pET plasmids was determined to be the Il colonies Lti+Kan+lI'T(i plate/#
s() colonies I_I3 plate X 100%. Colonies on all LB plates were scored morphologically fbr E.
cwli phenotype as a contamination control. Morphologically detectable contaminant colonies were not detected in anv fermentation.

iii) Recombinant BotA Protein induction A total of 10 ODD", units of cells (c~.~~., 300 ~tl of cells at UD,,""---~O/ml) were removed from each timepoint sample to a 1.~ ml microfuge tube and pelietcd for 3 min at maximum rpm in a microfuge. The pellets were rcsuspended in 1 ml of 50 mM Nafll'(),, U.S M NaCI, ~IOmM imidazole buffer (pH 6.8) containing 1 mg/ml lysozyme. ~l'he samples were incubated for ?U min at room temperature and stored UN at -70°(.'. Samples were thawed completely at room temperature and sonicated ? X IU seconds with a Iiranson 5onitier 4sU
microtip probe at # s power setting. The samples were centriFuged for i min at maximum rpm in a microfugc.
IU nn aliquot (2U Etl) of the protein samples were removed to 2U ~tl ?X sample buffer, hetbre or after centrifugation. for total and soluble protein extracts, respectively. ~fhe samples were heated to ~)~°C fee :i min. then cooled and ~ or 10 yl were ie>aded clnto 13.x'%
sI)s-1'n(ir gels. Nigh molecular weight protein markers (BioRad> were also loaded to allow for estimation of the MW of identified fusion proteins. Aficr elcctr~phoresis.
protein was I ~ detected either generally by staining gels with C'oomassie blue. ur speciticallv, by blotting onto nitrocellulose Ias described in L:x. 38) for Wcstcrn hlot detection of spccilic his-tagged proteins utilizing a NiN'1'~1-alkaline phosphatase conjugate exactly as descrihcd by the manufacturer 1(~iagcn).
'() iv) itecombinant Antigen Purification nt the end of each tertnentation run. I-lU liters of culture were harvested from the icrmentrr and the bacterial cells were pelleted by centrifugation at (U()0 rpm tier 10 1n1r1 !11 a .InIU rotor (Beckman). 'The cell pellets were stored frozen at -70°(:' or utiliicd immediateU
without freezing. Cell pellets were resuspended to I ~-3(l°/~ weight to yoUume in resuspcnsion :'_S buffer (~~enerally s0 mM NaPO~. U.s M NaCI. 4UmM imidazole, pH (i.8) and lysed utilizing either sonication or high pressure homogenization.
l~or sonication. the resuspcnsion buffer was supplemented with lysozvme to I
mglml.
and the suspension was incubated ier 30 min. at room temp. The sample was then frozen ()N
at -70°('. thawed and sonicated =t X ?U seconds at microtip maximum to reduce viscosity.
a0 For honuy~enization. the cells were lvzed by 2 passes through a honwgenizer (Bonnie Mini-lah type 8.3U li) at 60U Bar. C'r11 lysates were clttriticd by ccntritirgation ii~r 3U I11111 al I U.UOU rpm in a .IA I U rotor.

For 1DA chromatography, samples were flocculated utilizin g polyethyieneimine (PEI) prior to centrifugation. Cell pellets were resuspended in cell resuspension buffer (CRI3: 50 mM Nal'U,, U.5 M NaCI. 40 mM imidazole, pH G.8) to create a 20% cell suspension (wet weight of cellslvolume of CRB) and cell lysates were prepared as described above (sonication s ~ or homogenization). PEI (a ?% solution in dH,O, pl-I 7.~ with HCl) was added to the cell Ivsate a final concentration of 0.?%, and stirred for 20 min at room temperature prior to ~ centrifueation (8.500 rpm in JAIO rotor for 30 minutes at 4°C'). This treatment removed RNA. DNA and cell wall components. rcaulting in a clarified. low viscosity lysate ("PFI
clarified lysate").
l0 His-tagged proteins were purified from soluble Eysates by metal-chelatc al'tinity chromatography using either a NiNTA resin (as described in Ex. 28) or an IDA
(iminodiacetic acid) 1'tS111 aS described below.
lL)A resin affinity puritications were performed utilizing a low pressure chromatography wstem (ISCn). ~'1 7 mi (small scale) or 70 ml (large scaly) C'helating f ~ ~cphar~sc Ivast Flow ( I'harmacia) affinity column was poured: in addition, a second guard column was poured and attached in line with the first column (to capture Ni ions that leached off' the aftiniw column). The columns were washed with 3 column volumes of dII,O. The guard column was then removed and the affinity column was washed with 0.; M
NiSU, until rcsistivim was established. then with dII,U until the resistivitv returned to baseline. The ?0 columns were reconnected and eyuilihrated with cell resuspension buffer ((.'RI3; s0 ntM
NaI'(),. ().5 M NaC'I. 40 mM imidazole, p1~ 6.8). The clarified sample (in CRI3) was loaded.
blow rates were ~ mllmin tbr small scale columns and 20 ml!min f«r lar~_c scale columns.
~lftcr sample loading. the column was washed with CRI3 until a baseline established and hound protein was eluted with elution buffer (~0 mM NaPU,, 0.5 M NaCI. 800 mM
?5 imidazolc. '_'()% glycerol, pEI 6.8 or 8.0), Protein samples were stored at 4°C or -?0°('. ~1'he yield of eluted protein was established by measuring the OD"~" of the elutions. with a I mglntl solution o1' protein assumed to yield an absorbance reading of 2Ø
I~he IDA columns may be reLenerated and reused multiple times (= 10). 'To regenerate the column. the column was washed with 2-3 column volumes of II,O, then 0.05 M
FDTA
.,0 until all ol~ the bluelareen color was removed followed by a wash with dH,O. The IDA
columns were sterilized with 0.1 M NaUH (using at least 3 column volumes hut not more than i0 minutes contact time with column packing material). then washed with 3 column volumes 0.0~ M NaP(~,,. pl-1 ~Ø then dII,O and stored at room temperature in ?U % ethanol.

EXAMPLI? 32 Construction Of' A Folding Chaperone Ovcrexpression System Co-overexpression of the E. cnli GroI:L/GroE:S folding chaperons in a cell expressing a recombinant foreign protein has been reported to enhance the solubility o1' sotnc foreign proteins that arc otherwise insoluble when expressed in F.. rnli [Ciragcrouu cu crl. ( 1992) Proc.
Natl. Acad. Sci. USA 80:10344]. The improvement in solubility is thought to be due to chaperone-mediated binding and unfolding of insoluble denatured proteins. thus allowing multiple attempts for productive refolding of recombinant proteins. Bv overexpressing the IO chaperones, the unfolding/refolding reaction is driven by excess chaperone, resulting, in some cases. in hither yields of soluble protein.
In this rxamplc, a chaperone overexpression system. compatible with pE~C
vector expression systems. was constructed to facilitate testing chaperone-mediated solubilir-anon of ('. hcmrlinrrnr type A proteins. This example involved the c:luninL of the Cirul:L/I:S opcron I s and construction of a pLysS-based chaperone hyperexprcssion system.
The GroEL/GroES operon was fCR amplified and cluncd into the pC'ItScript vector as described in Example 28. The following primer pair was used: 5'-('GCA'1 ATGAA~CA'I~TCGTCCATTC~CA'rti-3' (SEQ 1D NO: 37) [~' primer. start colon oi' grol:S
gene converted to lVilel site (underlined)] and 5'-GGAAC~CTTGCAGGGC'AA7' T~1CATCATG
2U (SEQ ID NC):38) ( 3' primer. stop colon of groEL gene italicized, en gineered I/indlll site underlined). f=ollowing amplification, the chaperone opcron was rxciscd as an :1'clollflindlll fragment and cloned into pET23h digested with N'cle~l and Ilindlll. )'his construction places the Gro operon under the control of the T7 promoter of the pI'T'~' 3 vector.
The desired construct was confirmed by restriction digestion.
?5 The 'f7 promoter-Gro operon-T7 terminator expression cassette was then excised as a I3LIIIll3.,lWl (tilled) fragment and cloned into I3umH1 (compatible with I3~~lII)INindIlI (filled) cleaved pl_ysS piasmid (this removed the T7 lysozvme gene). 'fhe resulting construct was designated pAC YCGro. since the plasmid utilizing the pAC YC l 84 origin from the piysS
plasmid. Proper construction was confirmed by restriction digestion.
~0 pACYCGro was transformed into BL21(DL;3). cuiturea were gown and induced with 1 mM IPTG as described in preceding examples. Total and soluble protein extracts were generated from cells removed before and after IPTG induction and were resolved on a 12.5 °,'o SDS-PAGE gel and stained with Coomassie blue. 'This analysis revealed that high levels of WO ~ro~ PCT/US97l15394 soluble GroEl and GroES proteins were made in the induced cells. These results demonstrated that the chaperone hyper-expression system was functional.

s (i<rowth Uf ButA/pACYCGro Cell Lines 1n Fermentation Cultures lt~duction of BL? 1 (DE i) cells lacking the LysS plasmid which contained BotA
expression constructs grown in shaker flask or fermentation culture resulted in the expression n1~ primarily insoluble BotA protein. E~crmentatiun cultures were performed to determine if I t) the simultaneous overexpression of the Ciro operon and recombinant C'.
hnrlrlimrm type A
proteins t f3otA proteins) resulted in enhanced soluhility of the recombinant I3otA protein.
~l'his example involved the fermentation of pHisBotA(syn)kan laclq T7lac/pACYCGro t3t.~1(Dlrsl and pl-Iisl3otA(svn)kan Iaclq T7IpACYC(iru BL21(DE3) cell lines.
1'he lermentatiuns were repeated exactly as descrihed in Example ,I.
Chloramphenicol (s~
I ~ Ey~ml ) was included in the feeder and fermentation cultures.
a) Fermentation ()f pHisBotA(syn)kan laclq T7lac/pACYC(~ro 13L21(DE3) Cells lvr lerlnentation of cells containing plasmids comprising the 'r7lac promoter.
?0 induction was with ? gms IP'TG at 1 hr post initiation of glucose teed.
'fhe UD,,"" was .ii at time ul' induction. then 48.x, GI.~. 67 at I-s hrs post induction. Viable colony counts decreased from U- i hr induction [? 1 ( i s ). 0. 0. U: dilution , utilized 3 ~I of dilution ? cells]
1l'IIh 11t1111ht1'v 111 parenthesis tOC the lndlCallllL I111Cr(7cOlOmeS. Uf ?8 colonies scored at the time ul' induction. ?3 retained the pllisE3otA(syn)kan lacltl ~r7lac plasmid tkan resistant), ??
contained the chaperone plasmid (chloramphenicol resistant) and nu colonies at induction grca on IPTG+lvan plates (no mutations detected). These results were indicative of very S1r011~~ pronuacr induction. since colony viability dropped immediately after induction.
I~otal and soluble extracts were resolved on a 1?.s"/" SI)S-I'ACiE gel and stained with C'oomassie. High level induction of Giro chaperones was observed. hut very low level s() expressian of soluble EiotA protein was observed, increasing from I to 4.() hrs post inducticm (no expression detected in uninduced cells). The dramatically lower expression of the RotA
antigen in the presence of chaperone may be due to promoter occlusion (i.e..
the stronger 'f7 promoter on the chaperone plasmid is preferentially utilized).

' CA 02296765 2000-O1-14 WO 98I~340 PCTIUS97I15394 b) Fermentation Of pHisBotA(syn)kan lacly T7/ pACYCGro BL21(DE3) Cells A fermentation utilizing the T7-driven IiotA expression plasmid was pcribrmed.
Induction was with 1 gm IPTG at ? hrs post initiation of~ glucose feed. The UU,,"" was 41 at s time ot~ induction. then ~1.~. hl.~. W.5 and CMG at 1-4 hrs post induction.
Viable colony counts decreased froth (l-4 hrs induction [71. 1 (34). I ( 1 ). 1, U: dilution 3 utilized 6 yl dilution ? calls) with numbers in parenthesis for the uninduced timepoint indicating microcolonies. Uf G~ culonies scored at the time of induction. al) 6~ retained both the pHisBotA(syn)kan lactcl T-77 plasmid (kan resistant) and the chaperone plasmid 1() (chloramphenicol resistant) and no colonies at induction grew on lE'TG+Kan plates (no mutations detected).
~I'utal and soluble extracts were resulved on a I?.5% ADS-PAGE: gel and stained with C'oomassie. I-lieh level induction of Gro chaperones and moderate level expression of~ soluhle I3otA protein w°as observed. increasing from 1 to 4.0 hrs post induction (no expression 1 > detected in uninduced cells).
;1 PL1-clarified lysate (0.?'% final cocnentration f'F:l) [8sp ml from is(I gm cell pellet (? liters t'ermentation harvesi)~ was purified on a large scale IUA column. A
total of 78 mL
ut~ protein was eluted. f~:W racts t~rom the purification mere resolved cm a 1'_'.s!% SUS-I'AGf:
gel and stained with C'oomassie. The elution was found to contain an approximately 1:1 mix '0 ut' IiotAichaperonc protein (Figure i?). I'EI Eysates prepared in this manner were typically 1G
()U,~"iml. This was estimated to be 8 mg proteitvmi of lysate (hv I3t'A
assay). Thus. the eluted recombinant I3otA protein represented U.S~% of~ the total suluhlc cellular protein applied to the column.
In Figure s?, lane 1 contains molecular weight markers. Panes ?-~) contain extracts ~s from pllisL3otA(svn)kan laciq T-7lpAC'YCGro/BL?1(DI:i) cells hefi~re or during purification on the IDA column. lane ? contains total protein extract: lane .s contains salable protein extract: lanes 4 and ~ contain PFI-clarified lysates (duplicates): lanes 6 and 7 contain tlow-through from the (DA column (dupiicatcsl and lanes X and ~) contain IUA
colcrr1711 clule (lane ~) contains 1110 the amount applied to lane 8).
p0 'i~hesc results demonstrate. that although the majority oh~ the E3otA
protein produced was insoluhle. 3U mg/liter of soluble recombinant E3otA protein can he purified utilising the pHisliotA(syn)kan lacld T7/pAC'YC(iro/BL21(I)F i) expression wstcm.

Purification Uf Recombinant BotA Protein From Folding Chaperones In this example of size e~cclusion chromatography was used to purify the recombinant I3utA protein away from the fiUdin~~ chaperones and imidazolc present in the IDA-purified material ( Ev. 3.i ).
Tu enhance the solubility of the recombinant BotA protein during scale-up. the protein was cu-expressed with folding chaperones (Ex. 33). As observed with the recombinant I3ot13 protein ( IW ample ~0 below). the fi~ldin~~ chaperones cu-eluted with the recombinant BotA
1 () protein during th c Ni-IDA purification step. Because the recombinant I3otA and BotB
proteins have similar molecular weights (about 1/IU the size of the non-reduced folding chaperone) and the imidazole step gradient strategy was unsuccessful in purifying BotB away from thr folding= chaperone (see I:x. ~U). size exclusion chromatography was examined for the abiliy tc~ purilj the recombinam BotA protein away from the folding chaperones.
1 ~ .~1 column (?.~ x ?~ cm) containing Sephacryl S-l0U HR (Pharmacia) was poured (bed w~lumc 1 IU ml). Proteins having molecular weights greater than 100 K are expected to elute in the void volume under these conditions and smaller proteins should he retained by the heads and elute at different tithes. depending on their molecular weights. -I'u maintain soluhiliy of the purified BotA protein. the Sephacryl column was cduiiibratcd in a buffer ?U lutvin;~ the same salt concentration as the buffer used to elute the BotA
protein from the IDA
column li.c~.. sU mM sodium phosphate. U.5 M NaCI. IU% glycerol: all reagents from ~~tallinkrodt. ('hesterfield. MU).
Dive mil)iliters ot'the IDA-purified recombinant BotA protein (Ex. 33) was filtered throu~~h a U.4~ a syringe filter. applied to the column and the equilibration buffer was pumped through the column at a flow rate of 1 ml/minute. Eluted proteins were monitored by absorbance at 28U nm and collected either manually or with a fraction collector (BioRad).
Appropriate fractions were pooled, if necessary, and the protein was quantitated by absorbance at 280 nm and/or BC'A protein assay (Pierce). The isolated peaks were then analyzed by native and/or SDS-PAGE to identify the proteins present and to evaluate purity. The (uldinL
s0 chaperone eluted first. followed by the recombinant BotA protein and then the imidazole beak.
SDS-PAGE analysis ( 13.~°io polyacrylamide, reduced samples) was used to evaluate the purity of the IDA-purified recombinant BotA protein before and after S-IUO
purification.
- i A7 -Figure 33 shows the difference in purity before and after the S-100 purification step. In Figure 33. lane 1 contains molecular weight markers (f3ioRad broad range).
Lane ? shows the IDA-purified recombinant BotA protein preparation. which is contaminated with significant amounts of the foldin L chaperone. Following ~-lU0 purification.
the amount of s ti~lding chaperone present in the BotA sample is reduced dramatically (lane ~). Lane 4 contains no protein (i.e.. it is a blank lane): lanes s-8 contain samples of IDA-purified rcconWinant E3otH and E3otE proteins and are discussed in/i~cr.
I-:ndotoxin levels in the S-100 purpled I3otA preparation were determined using the I_;11. assay (Associates oi' Cape C.'od) as describe in Example 2-1. The purified BotA
preparation was found to contain ??.7 to 45.~ EIl/mg recombinant protein.
Tltl'Se reSUIIS de1t10115tratc that S(Le eXCIUSIUIt Cltr()malUfraphy N~aS
SIICCesSfUI in puridin~~ the recombinant f3otA protein from folding chaperones and imidazolc following an initial IDA purification step. Furthermore. these results demonstrate that the ~-lUU purified f3otn protein was substantially tree ol' endotoxin.
li (.'loving And Expression Uf The (' Fragment Ut"fhe C'. hurulirterm Scrotypc E3 Toxin (~enc ?U I~hc ( '. hcuulir7rrm type 13 ncurotoxin gene has been cloned and seducnccd ~ VJhelan c~
girl. ( I ~)~)?) flppl. E:nviron. Microbial. ~8:? i4~ and l lutson rml. ( 1 c)94) C'urr. ~-1icrobiol.
_'8: l01 ~. l'hr nucleotide sequencr of the toxin scene derived I'rt~m the E~:kluncE I 7fi strain (.~'fC'C' ~'~76s) is available from the Ei~~IBLICienfiank sequence data banks under the acccssiun number X71343: the nucleotide sequence of the coding region is listed in SI:Q ID
'_'S NU:3c). 'I~he amino acid sequence of the (', horulinum type B ncurotoxin derived from the strain h.klund 17I3 is listed in SL:Q ID NU:40. The nucleotide sequence of the ('. horrrlinum serotvpc E3 toxin gene derived from the Uanish strain is listed in SI;Q ID
N():41 and the corresponding amino acid sequence is listed in SEQ ID N():4?.
'fhc 1)NA sequence encoding the native ('. hvnrlrnurn serotvpe f3 (' i~ragment gene s0 clcrivcd from the Eklund 17B strain can he expressed using the pF.TtEish vector: the resulting coding: region is listed in SE:Q 1f) NU:43 and the corresponding amino aci~E
sequence is listed ill SF:Q 1D NU:44. The UNA sequence encoding the native C'. hnnrlimrm scrotypc B (' fragment gene derived from the Danish strain can be expressed using tile pI~TI-Iish vector; the resulting coding region is listed in SEQ ED N0:45 and the corresponding amino acid sequence is fisted in SEQ ID N0:4G. The C frgament region from any strain of ('.
bntr.rlinum serotype B can he amplified and expressed using the approach illustrated below using the C: fragment derived tiwm C'. horarlinum type B 2017 strain.
The ('. hmulintun type B neurotoxin gene is synthesized as a single polypeptidc chain which is processed to form a dimer composed of a light and a heavy chain (inked via disulfide bonds: the type B neurotoxin has been reported to exist as a mixture of predominatly aingle chain with some double chain (V~'helan eo crl.. supra). The ~0 kD
carboxv-terminal portion of the heavy chain is referred to as the C fragment or the H~. domain.
L:xpression of I l) the C' !'ragmcnt of C'. hvrrrlirrrrm type B toxin in hcterologous hosts (c~.lr., F.. rrrli) has not been previously reported.
The native C' fragment of the (.'. hmulinrrm serotype E3 toxin gene was cloned and mpressie~n constructs were made to facilitate protein expression in L'. cvli.
This example invoUvcd I'C'R amplification of the ~!ene, cloning, and construction of expression vectors.
1 ~ ~I-he C' f~ragmcnt ch' the ('. hrnrrlinrrnr scrotype B ( BotB) toxin gene was cloned using the promcols and ~11t1d1tI1111S described in >rxamplc ?8 for the isolation of the native BotA
gene. ~fl~c ('. hnrrrlinum tvpr E3 ?U17 strain was obtained from the American 'fvpe Culture ('ullcction (:~ l~C'C' ~ 1784x). Thr ti~llowing primer pair was used to amplil'v the l3otl3 gem:
'-C'(iC.'C';1~TC~(~C'I'CiA~I'AC'An'I~AC'~I~AATAGAA AT(i-~' (s' primer.
engineered :'~'onI site ?0 undcrlimd (~I~:Q lI) N():47)j and ~'-GC'AAG
C'TTTT.=IT'fC.'ACiTCC'ACCC't"I~CATC-s' [s' primer. engineered hlindllI site underlined, native gene termination colon italicized (SLQ ID
!v():~X)[. ~I~tcr cloning into the pC'Rscript vector, the ,~'In~I(filled)atfindlll ti~aLment was clunccl into pIrTFIish vector as described for BotA C fragment gene in Example ?8. The resulting construct was termed pl-IisRot().
?> pt-lisBeriB expresses the BotB gent sequences under the transcriptional control ui~ the ~I~7 lac promoter and the resulting protein contains an N-terminal IUXf-lis-tae affinity tag. 'hhe pllisE3ouB expression construct was transformed into I3L?1(DE3) pLys~
competent cells and I
liter cultures were grown. induced and his-tagged proteins were purified utilizing a NiNTA
resin (eluted in low pf l elution huffed as described in Example ?R. Total.
se~luble and 3() ptlriticd proteins were resolved by SDS-PAGE and detected by Coomassie staining and Western blot hybridization utilizing a chicken anti-(.'. hrmrlinum serotype B
tc~xoid primary antibmiv (generated by immunization of hens using ('. hunrlinrrm serotype 13 toxoid as described in Example i). Samples c~f l3otA and BotE: C fragment proteins were included on - l89 -WO 98l08S40 PCTIUS97/15394 the gels for MW and immunogenicity comparisons. Strong immunoreactivity to only the BotB protein was detected with the anti-('. hmulintrm serotvpe B toxoid antibodies. The recombinant BotB protein was expressed at low levels (3 mg/liter) as a soluble protein. The luritied BotI3 protein migrated as a single band of the predicted MW (i.c., --sOkUl.
These results demonstrate the cloning of the native ( '. hurtrlinum serotype B
C
I~raLment gene. the expression and purification of the recombinant BotB
protein as a soluble his-ta~~f:ed protein in E. cw/i.

Ccneration Uf Neutralizing Antibodies Using The Itecomhinant pH isBotl3 Protein Thr ability of the purified pflisBot protein to generate neutralising antibodies was rxamined. Nine EiAI_Be mice were immunized with BotB protein (purified as described in f:x. >~) using (irrhu CiMI)I' adjuvant (C'C.' Biotech(. ~l~i~e low Pli elution was mixed with 1 ~ (ierhu ad.juvant and used to immunize mice. Each mouse received a suhcutanectus injection of 1(H) yl anti~~rnlad.juvant mix ( 1~ frg antigen + l leg ad.juvant) on day (1. Mice were subcutaneouslv boosted as above on day 1=1 and bled un day 28. Mtice were suhseduentlv hmst~d I-'_' wec:la after bleeding, and were then bled on day 7U.
Anti-('. hu~ulinnm serotvpe B toxoid titers were determined in day ?8 scrum from ~l) individual mice from each group using the ELISA protocol outlined in Example '_'c) with the reception that the plates were coated with ('. hululin:rm serowne l3 toxoid, and the primary altllhl)ll~ 1S'aS a chicken anti-('. l~rrntrlinrrm serotvpe R toxoid.
Scroconvcrsion relative tet control mice immunized with pI-IisBotl: antigen (described bclowl~ was observed with all 9 mice itttmuni-r_ed with the purified pHisBotl3 protein.
-hhc ability of the anti-BotB antibodies to neutralize native C'. hnnrlinum type I3 toxin was tested in a mouse-('. hrnrrlirnrrn neutralization model using pooled mouse serum (see I:x.
~h). The LI7;" of purified ('. horrrlirarrnr type B toxin complex (f)r. Laic .lohnson. University of WISCU11S111. Madison) was determined by a intrapcritoncal (II') Method (Schantz and Kautler ( lc)78). .vrrprcrJ win(: 18-?? ~~ female ICIt mice. The amount of neutralizing antibodies present ~() in the serum of the immunimd mice was determined using scrum antibody titrations. ~Chc various serum dilutions (0.01 ml) were mined with i LDt" units eri' ('.
hwulirurm type I3 toxin and the miWures were injected IP into mice. ~I~hc neutralizations ~~crc performed in duplicate.
'fhe mice were then observed for signs of botulism tits ~1 days, Undiluted serum (day 28 or day 70) was found to protect 100% of the injected mice while the I : I O
diluted serum did not.
This corresponds to a neutralization titer of 0.0~-0.5 iU/ml.
These results demonstrate that seroconversion occurred and neutralizing antibodies were induced when the pllisBotB protein was utilized as the irnmunogen.

Construction ()f Vectors To facilitate l~xprcssion ()f Ills-Tagged Botli Protein In fermentation Cultures 1 t1 ~1 number of expression vectors were constructed to facilitate the expressiun of recombinant Rotes protein in larLe scale fermentation culture. These constructs varied as to the strength of the pronuUCr utilized (T7 or T7lac) and the presence of repressor elements larlq ) on the plasmid. ~f'he resultinL constructs varied in the level of expression achieved and in plasmid stability which tacilitated the selection of a optimal expression system for 1 ~ li:rmcntatiun scalcup.
The I3ot13 expression vectors created for fermentation culture were engineered to utilize tlm l:anamycin rather than the ampicillin resistance gene. and contained either the T7 or ~f7lac premuUCr. with or without the laciq gene tbr the reasons outlined in Example i0.
In all cases, the protein expressed by the various expression vectors is the pHisl3ot 13 hrotcin described in Example is. with the only differences between clones being the alteration of various rc~~ulatorv elements. using the designations outlined below. the pllisE3otI3 clone ( l:x. ; ~ ) is mluivalent to pl 1is13otB amp -I'7lac.
(:onstruction Of pllisl3atB kan '1'7lac ptlisBotl3 kan T7lac was constructed by insertion of the f3t~Illltfindlll ti~aement of pl iisBouli which contains the BotB ~~ene sequences into the pYA 1870-?680 kan 1'7lac vector which had been digested with B~~lll and Hindlll (the pl'A I 870-2680 kan ~I'7lac vector contains the pi:T?~4 kan Lenc in the pET'_'s vector. such that no laclq gene is present). Proper I:UnSII'ttCIII?rl ()f pHisBotB ban T7lac was confirmed by restriction ciigcstion.
;0 - l9l -b) Construction Uf pHisBotB kan iacIq T7lac pHisI3otB kan IacIy 'f7lac was constructed by insertion of the 13,s,~lll/Hindlll fragment 01' pHisBotl3 which contains the BotL3 gene seyuenccs into similarly cut pf:T'?4a vector.
Proper construction of pHisBotB kan laciq ~f7lac was c~ntirmed by restriction di~~estion.
c) Construction Of pHisl3otB kan laclq T7 pHisI3otB kan laclq T7 was constructed by inserting the NdelIXhoI fragment ti~om pl-lisl3otlkan lady T7lac which contains the BotR gene sequences into similarly cleaved pl'A 187()-2080 kan lacld T7 vector (this vector contains the T7 promoter, the same N-1() terminal his-taL as the l3ot constructs, the ('. cJi/7icile tcwin A
insert. and the kan laclq genes:
this cloning replaces the ('. cJi~)icile main A insert with the I3cltR
insert). I'ropcr construction was confirmed by restriction digestion.
Ivxprcssion of recombinant BotB protein from these expression vectors and purification ol~ the l3otf3 protein is described in Example 38 below.

f~erlncntation And I'uritication ()f Rcculnhinant f3otI3 1'rotcin t!tilizinc 'I~hc pl-IisI3otR kan laciq T7lac, pf~isl3otB kan ~f7lac And pl-iisf3eltE3 kan laclcl I~7 Vectors =!0 ~flzc pHisl3otf3 kan laclq T7lac. pf-IistiotB kan T7lac and fiotli kan Iaelcl l~7 constructs ~illl ll'allSlOrtlled IlltO tl7t', I3121(Uf: i) Stl'aln~ ~Ylre Lr()wll 111 termelltatlnll ellltllreS I() dlterlnln(:
the utility ot~ the various constructs for large scale expression and purification W~ soluble l3otf3 protein. ;111 lcrmcntations were pcrtorlncd as described in f ample s 1.
a) Fermentation Of pHisl3otB kan laclq T7lac/13121(DE3) Cells 'fhc icrmentation culture was induced 45 min post start of glucose feed with l gm II''r(i (final concentration = 0.4 mM). pfl was maintained at (,.s rather than 7Ø ~fhc ()U,,""
was 27 at time of induction, then i~. _i8. and 40 at I-; hrs post induction.
f)uplicatc platings of diluted 1 hr induction samples (dilutions were prepared as described lx. s 1. dilution 3 p0 utiliLCd 3 Ell W''dilution ? cells) on 'fSA and Lf3 ~-kan hlatcs yielded 89 'hSA colonies and 81 kan colonies (90% kan resistant).
Total and soluble protein extracts were resolved on a i 2.5°/> SDV-I'A(:iF ~,cl and total protein was detected by staining with C'uomassic blur. l.ow Icvel induction of insoluble I3ot E3 protein was observed. increasing tiom 1 to 3 hrs post induction (no expression was detected in uninduced cells).
h) Fermentation Of pHisI3otB kan T7lac/B121(DF3) Cells s The fermentation culture was induced I hr post start of glucose teed with 2 gm IPTG
t tinal concentration = 0.8 mM). pI i was maintained at 6.5 rather than 7Ø
The OD,,,H, was '_'-1.i at time of induction. then 31.x. ~?. and 33 at 1-3 hrs past induction, respectively.
Duplicate platings of diluted 0 hr and 2 hr induction samples (dilutions were prepared as described C:x. s 1: dilution .i utilized 3 (tl of dilution ? cells) on -I'SA
and LE3+kan plates 1 () yielded s? TSA colonies and 54 kan colonies (all kan resistant) for uninduced cells. and 1 '1'~A colony and 0 kan colonies ? hr post induction. 'These results were indicative of strong induction. since viable counts decreased dramatically ? hrs post induction.
'( mal and soluble extracts were resolved on a 10% SDS-PAGE gel and total protein was detected by staining with ('<aomassie blue. Moderate induction of insoluble I3utB protein I ~ was observed. increasing from I to ; hrs post induction (no expression was detected in uninduced cells).
c) Fermentation Of pEiisBotB kan laclq T7/B121(DF:3) (:ells 'fhe tcrmentation was induced ? hr post start of glucose loud with ~ ~~m iPT(i (final ?U conecntratic?n = l.O mM). pII was maintained at 6.5 rather than 7Ø The UDh"" was ~ts at time uf~ induction. then ~17. 50. and 5t) and » at I-4 hrs post induction.
respectively. Viable cnlunv counts decreased after induction (9G. i. 1. ?. 3: dilution 3 utilized 3 yl of dilution ~c:flsl. t)1' O3 colonies scored at the lime of induction. all bs retaining the Buts; plasmid (kan resistant) and n(1 COIUnICS al It7dllCtIUt1 LCCW OIl (PT(i + Kate plates Ino mutations detected).
~fe~tai and soluble extracts were resolved on a 12.5% SDS-('ACiE gel and total protein was detected by staininL with Cootnassie blue. Moderate level induction of insoluble l3otl3 protein was erhserved. increasing from 1 to 4 hrs post induction (lower level expression was detected in uninduced cells. since the 'f 7 rather than T7lac promoter was utilized).
d) Purification Of pHisBotB Protein From pHisBotB amp T7lae/B121(DE3) Cells Soluble recombinant BotB protein was purified utilizing NiNTn resin from 80 ml of - cell tsate ~~enerated ti~om cells harvested from a pl-IisBotli fermentation (using the p((isBotB

amp T7lac/Bl2t(DE3) strainj. As predicted from the small scale results above.
the majority of the induced protein was insoluble. As well. the eluted material was contalninatcd with multiple E. cwli contaminant proteins. A Coomassie bloc-stained SDS-PAGI: gel containing extracts derived t'rum pllisBotB amp T7lac/Bl2l(DEV,3) cells brl~ore and during purification is s shown in figure 3:L In figure 34. lane 1 contains broad range protein MW
markers (BioRad). Lanes ?-s contain extracts prepared from pliisl3otB amp 'r7lac/B121(DI:3) cells grown in fermentation culture: lane ? contains total protein: lane 3 ccmtains soluble protein:
lane 4 contains protein which did not bind to the NiN'hA column (i.c~.. the flow-through) and lane ~ contains protein eluted from the NiNI'A column.
IU Similar results were obtained using a small scale IDA column utilizing a cell ivsate from the pl 1is13utB kan lacIq 'r7 fermentation described shove. ?~0 mls h~ a ?U% wlv I'F;l clarified Ivsate (sU gms cell pellet) of botR kan laclq ~I~7/8121(I)E:3) cells were purified on a small scale Il)A column. The total yield ui~ eluted Protein was 21 mg protein (assuming I
mg/nti S(llLlllt111 ~ ? OD,~"Iml). When analyzed by SUB-I'AW~. alld C'(1t1111aSSIC StJ111111~!. the 1 s l3otR protein was found t~ comprise approximately s0% of the eluted protein with the remainder hein~~ a ladder of 1. onli proteins similar to that observed with the NiN'I~.<1 purilicatiun.
l~hc NiN~fn alkaline phosphatase conjugate was utilized to detect his-tagged proteins on a W'cstcrn blot containing total, soluble, soluble (f'f:l clarified).
soluble (at~ter IUA column) _'U and elution samples t~rom the IDA column purification. 'hhe results denumstratcd that a small percentage e~f~ fiutt3 protein was soluble, that the soluble prmein was ncn prccinitated by I'CI
treatment and was quantitatively hound by the II)A column. since a 1 liter Irrtnentahon harvest yielded a (~7.~ ~=m cell pellet. this indicated that the yield ol' soluble at'tinitv purified RotE3 protein from the lUA column was 14 mg/litcr.
~j (.'u-Expression Of Recombinant l3cnl 1'roaeins ,4nd Holding C.'haperones In Fermentation Cultures sU lermentations were performed to determine if the simultaneous uverexpression ot~
t(lldlllg (:llaperOlleS (i.c~.. the (iro operon) and the f3cnB protein resulted in enhanced solubility of~ the I3ot 13 protein. ~fi~is example involved fermentation of the p) IisI3utBkan laciq 'r7lac/pAC'YCGro E3L? 1 ( DE3). pHisI3otI3 kan T7lac/pA(.'YCCiro 131? 1 (I)E3) and pl Iisl3otBkan - l94 -Nrp 9g~pgs4p PC'TlUS97/15394 laclq T7! pACYCGro BL21(DE3) cell lines. Fermentation was carried out as described in Example 31; 34 yglml chloramphenieol was included in the feeder and fertncntation cultures.
a) Fermentation t)f pHisl3otlitcan laclq T7lac/pACYCGro BL21 (DE3) Cells Induction was with ~ gms IPTG at I hr 1 ~ min post initiation of the glucose feed.
I~he ()D,,"" was 38 at time of induction. then 50, 58.5. 6? and G8 at I-4 hrs post induction.
Viable colony counts decreased during induction (?4. 0. 0. ?. 0 at 0-4 hr induction: dilution 3 utilized 3 tcl of dilution ? cells). Uf ?:l colonies scored at the time of induction. ?=1 retained It) the ButE3 plasmid (kan resistant). ?-1 contained the ci~aperone plasmid (chloramphcnicol resistant) and no colonies at induction grew on IPTGi-Kan plates (no mutations detected).
t~utal and soluble extracts were resolved on I?.5% SDS-PAt~F; gels and were either stained with (.'oomassie blue or subjected to Western blotting (his-tagged proteins were ctctectcd utilizing the NiNTA-alkaline phosphatase conjugate). 'This analysis revealed that the 1 s tyro chaperones were induced to hiLh levels. hut very low level expression of soluble Butf3 hrutcin was observed, increasing trum I to 4.0 hrs post induction (nu expression detected in uninducect cells. induced protein detected (»1IV Ufl Western blot). The dramatically lower expression ul' Botf3 protein in the presence of chaperone may he due to promoter occlusion (i.e.. the stronger 'h7 promoter on the chaperone piasmid was pretercntially utilised).
?0 h) Fermentation Of pHisI3otB kan T7lac/pACYCGro/I3121(DF3) Cells IIIdlIClll)Il W'aS lVIll1 ~ t:ms If TOi at 1 hr punt initiation of the glucose teed. The ()D,,""
was 3:.s at time of induction, then ~~~1. 51, 58.5 and 69 at I-4 hrs post induction. Viable colony counts decreased after 2 hrs induction (43. 65. 74. U (70), 0 (70) at tf-4 hr induction;
bracketed numbers represent microcolonies; dilution 3 utilized 3 Etl of dilution ? cells). Most colonies at induction retained the Botl3 plasmid (kan resistant)and the chaperone piasmid (chlorantph enicol resistant) and no colonies at induction grew on IPTCi+Kun plates (nu mutations detected).
30 ~l~utal and soluble extracts were resolved on a 12.5'% SDS-fACiE~: eel and subjected to Western blotting: his-tagged proteins were detected utilizing the NiNTA-alkaline phosphatase conjugate. This analysis revealed that the. Ciro chaperones were induced to high levels and low level expression of soluble Bat B protein was observed. increasing from t to 4.0 hrs post induction ( no expression detected in uninduced cells).
A small scale IDA purification of BotB protein from a 2~0 ml Pl:l clarified I
S°~o w/v extract ( :7.5 gm cell pellet) yielded approximately 1?.5 Itlg protein, of which approximately s s0°/> was Bntf3 protein and 50% was CiroEl, chaperone (assessed by C'oomassie staining of a
10'%~ 5DS-PAGE gel). The NiNTA alkaline phosphatasc c<mjugate was utilized to detect his-taggcd proteins on a Western blot containing total, soluble. soluble (I'FI
clarified), soluble fatter lDA column) and elution samples from the IDA column purification. The results demonstrated that all of the BotB protein produced by the pl-lisBotB kan 1() T7lac/pAC'Y('(iru/Bl2l(DE3) cells was soluble: the BotR protein was not precipitated by I'EI
treatment c:ltd was quantitatively hound by the 1DA column. ~incc a l liter fermentation harvest yielded a 7~ gm cell pellet. this indicated that the yield o1~ soIUbIc aftinttv purified hot f3 protein fiom this tcrntentation was 13.~ mg/liter. These results also demonstrated that additional purification steps are necessary to separate the chaperone proteins t~rom the BotR
1 s protein.
c) F'crmcntatiun Of pHisI3otBkan Ittclq T7lpA('YC(:ro/I3L21(UF3) Cells Induction was with 4 gms IPTCi at 2 ltr post initiation of the glucose feed.
~I~ite (>D,,""
?0 was ~tO at time ot~ induction. then ~h. G,. G9 and 7t.~ at 1-~l ltrs pout induction. Viably colony cc>unts cfccreascd after induction tab. 3(~), s. (). 0 at 0-4 hr induction:
bracketed numbers represent microcolonies: dilution ; utilized 3 Etl of'dilution 2 cells). All ts;/s;) colonies scored at the time of induction retained the liotl3 plasmid (kan resistant) and the chaperone plasmid (chloramphenicol resistant) and no colonies at induction grew on tP'I~G+f~an plates ''s (no mutations dNtected).
Total and soluble extracts were resolved on a 10% S1)~-I'AGI.: gels anct Western blotted and his-tagged proteins were detected utilizing the NiN'1'A-alkaline phosphatasc conjugate. 'this analysis revealed that the Ciro chaperones were induced to hlLit levels (observed by ponceau S stainin~~l, anct a notch higher expression of soluble L3ot R protein ;0 tcompared to expression in the pHisl3ott3 kan T7lac/pAC.'YC.'Oro fer~ttc:ntatioy was observed at all timepoints. including uninduccd cells (some increase in l3otl3 protein levels were observed at~ter induction).
- l c)G -WO 981x8540 PC'fIUS97/15394 A small scale IDA purification of BotB protein from a IOU ml PEI clarified IS%
wiv extract ( l ~ gm cell pellet) yielded approximately 40 mg protein. of which approximately 50%
was BotB protein and 50% was CiroEL chaperone. as assessed by C'oomassie staining of a 10°/> SDS-PAGE gel. The NiNTA alkaline phosphatasc conjugate was utilized to detect his-- s tagged proteins on a Western blot containing total, soluble, soluble (PEI
clarified), soluble tatter IDA column) and elution samples from the 1DA column purification. The results . demonstrated that a significant percentage (i.c~., -1()-20 °ro) of I3otB protein was voluble, that the soluhiiized protein was not precipitated by PCI treatment and was quantitatively bound by the IDi1 CUlltnlt7. Since a 10 liter fermentation yielded a 108 gm cell pellet. this indicated that I (1 thr vielct ol' soluble affinity purified BotB protein from this fermentation was 144 mglliter.
In a scale up experiment. ? liters of a 20% wlv I'EI clarified lysate,~ of pl~IisI3otB kan laclcl l~7/pAC'YWirolI3L?1(DES) cells were purified on a large scale IDA
column. The purilication was performed in duplicate. 'l~he total yield of RotB Protein was ?'_0 and .~'_'~
m~~s prouein in the two experiments (assuming i mg/ml solution = ?.0 UD,%"/ml). This I ~ represents 0.7°/r. ur I .0%. respectively. of the total soluble cellular protein (assuming a I'I:I
Ivstatc havinL a concentration of 8 mg protein/ml and that the eluted material c«mprises a 1:1 miwurr et' BoUB and folding chaperone). The NiNTA alkaline phosphatasc conjugate was utilizrd m detect 1115-taLged prole111S 011 a Western blot contamtng total, soluble. soluble (YEI
clarified). soUuhic (after (DA column) and elution samples from the llO1 column purification.
?t) 1 hese results clcmonstrated that a significant percentage (i.e.. -~-1 (>-20 '%) of the I3otL~ protein was se~luhlc, that the soluhilized protein was not precipitated by PEI
treatment and was yuantitativclv hound by the II)A column. Since a t liter icrmentation harvest yielded a 108 ,~m crll pellet. this indicated that the yield of soluble at~tinity purified BoUB protein from the IarLe scale purification v,.~s OO mg or 89 mglliter. l~hese results also demonstrated that 2s further purification would be necessary to remove the contaminating chaperone protein.
The above results provide methodologies for the purification ot~ soluble BrnB
protein from fermentation cultures. in a forth contaminated predominantly with a single E. cwli protein (the folding chaperone utilized to enhance solubility). In the next example. tllethOds arr provided for the removal of the contaminating chaperone protein.

EXAMPLE ~0 Removal Of Contaminating Folding Chaperone ('rotein From Purified Recombinant C'. J)nlIllil?feel) 'I'ypc Ii Protein s In ibis example size exclusion chromatography and ultratiltration was used to purify recombinant BotB protein from the folding chaperones and imidazole in IDA-puritied material.
~l~u enhance the solubility of the recombinant I3otB protein during scale-up.
the protein was co-expressed with folding chaperones (see E;x. i9). During the Ni-fI)A
purification step.
1 () the ti~ldinp chaperones co-eluted with the BotB protein in 8U0 n~M
imidazole: therefore, a second purification step was required to isolate the BotB free of folding chaperones. Lane s of Fiyrc ss contains proteins eluted from an IDA column to which a lysate of pllisl3ott3 kan lac(q T7/pAC'YC'Ciro/BL21(DC3) cells had been applied: the proteins were resolved on a -1-1 >°% polvacrvlamide pre-cast gradient eel f I3io-Rad. I lercules.
C'A ) run under native 1 ~ c;onditions and then stained with Coomassie blue. !n Figure 3~. lanes I
and 4 contain proteins present in peak I and peak ? from a 5ephacryl S-10() column run as described below: lane 1S hlallk.
As seen in lane .> of Figure 3~. the IDA-purified sample consists primarily of the folding chaperones and the l3otB protein. The tact that the chaperones and the Eiot B antigen ?U appear as ww distinct hands under native conditions suggested they were not cnmplcxed tcyethcr ancf therefore. it should be possible to separate them. using either a gradient of imicfaze~lc concentrations or size exclusion methods.
In order t~ determine whether a Lradient of imidazole concentrations could be used to separate the chaperone from the I3ot13 protein. a step gradient using imida-rolc at ?t)0. 4(lt).
?s 000, and 800 mM in ~U tnM sodium phosphate. ().5 M NaCI and 10 % glycerol.
pt-I 6.8 was applied to an IDA column (containing proteins bound from a iysatc of pllisBotB
kan lacJq ~f7lpAC.'YCGroIBL21(DE:3) cells). By narrowing the range of imidazoie concentrations. it was hoped that the BotB and chaperone proteins would diffcrcntiallv elute at different concentrations al' imidaie.~le. 1-eluted proteins were numitored by ahsorbance at ?80 nn~ and 30 collectecE either manually or with a traction collector (BioRadl. 1'rmein was found to elute at 30U and 400 mM imidazole only.
Figure 3O shows a Coomassie stained SUB-PAVE gel containing protein eluted durin~~
the imidazolc step gradient. lane I contains broad range MW markers (l3ioltad). Lane qrp 9g/pgsqp PCT/US97115394 contains BotB protein purified by IDA chromatography of an extract of pHisBotB/BL21 (DE3) pC.ysS cells grown in shaker t7ask culture (i.e., no co-expression of chaperones: I:x. 35).
lane i contains a 20% wiv PEI clarified lysate of pHisButB kan Iaclq ~f7lpACYCGru1BL21(DC3) cells (i.c~.. the lysate prior to purification by IDA
chromato~~raphyl. Lanes 4 and ~ contain protein which eluted at ?00 or 400 mM
imidazole, respectively. Lane 6 is blank. I_atZes 7 and 8 contain 1IS the load present in lanes 4 and 5.
.-1s shown in Figure 3G. both the chaperone and the ButB protein eluted in 200 mM
imidazule. and more chaperone elutes in 400 mM imidazole. however no concentration of IlllldazOle tested permitted the elution of I?;otB protein alone.
Consequently, no significant I() purification was achieved using imidazole at these c:uncentrations.
Because of ihc considerable difference in molecular w~cif:hts between the folding rhapcrune. which is a multimer with a total molecular weight around 400 kD (as determined cm a ~hooi~x KE3 H04 sizing column by HPLC), and the recombinant BotB protein (molecular weight around i0 kD). size exclusion chromatography was new examined for the abilitv_ tn I s separate thesr proteins.
u) Size Exclusion Chromatography ~1 column containing Sephacrvl ~-1()0 I1R (S-100) (Pharmacia) was poured (Z.5 em x _'~ cm : - 1 10 ml bed volume). The column was equilibrated in a buffer consisting u1~
?U phusplurte buffered saline ( IOmM potassium phosphate, I50 mM NaCI. pl l 7.?) and 10 ~,Ivcrrul (Mallinkrodt). Typically. s ml of the IDA-purified BotB protein was filtered through n 0.~~ ~i svrinLe filter and applied to the column. and the eduilibration butler was pumped thruuLh the column at a flow rate of I ml/minute. fluted proteins were monitored by ahsurbancc at 280 nm and cullrcted either manually or with a fraction collector. Appropriate ?s tubes were pooled, if necessary, and the protein was quantitated by absorbance at 280 nm anctlur by BCA protein assay. 'rhe isolated peaks were then analyzed by native and/or ADS-PAGE to idrrntify the protein and evaluate the purity.
F3ecause of its larger size. the folding chaperone eluted first, followed by the recombinant ButB protein. A smaller third peak was observed which tailed to stain when s() analyzed by SDS-PAGE: and therefore was presumed to be irnidazolc.
- ADS-I'AGL: analysis ( l?.i°ru pulyacrylamide. reduced samples) was used to evaluate the purity of the IDA-purified recombinant BotB protein before and after S-1()0 purification.
. 'The results are shown in Figure s3.

WO 98108540 Pl'rTIUS97/15394 In Figure 33. lane 1 contains broad range MW markers (BioRad). Lane ~ contains IDA-purified BotB protein. Lane 6 contains IDA-purified BotE3 protein followin p. S-100 purification. Lane 7 is blank (lanes 2-4 were discussed in Fx. 3~4 above).
The results shown in Figure 33 show that the IDA-purified BotB is si~~niticantly contaminated with the folding chaperone (molecular weight about 60 kl) under reducing, conditions: lane 6). Ivllowing S-l0U purification. the amount of folding chaperone present in the l3olB sample was reduced dramatically (lane 7). Visual inspection of the C'oomassie stained SI)S-PAGIr gel revealed that after S-100 purification. a c)0"~~ of the total protein present was BotB.
l0 The lDA-purified BotR and the S-lUU-purified BotB samples were analyzed by E~IPLC
cm a size exclusion column tShodex KB 804); this analysis revealed that the RotE3 protein represented (i4'% of th a total protein in the IDA-purified sample alld that following S-IUU
purification. the liotl3 protein represented ='95"/" of~ the tonal protein in the sample.
The IDA-purified RotB material was also applied to a ACA 44 (Spectral'ur.
Houston, I, ~l'X) c«lumn. l~he ACA ~~4 resin is equivalent W the S-100 resin and chromatography using the A('A -t-t resin was carried out eaactlv as described above fer the S-100 resin. -l~he AC.'A
-1~4 resin was found to separate the recombinant l3ott3 protein t~rom the Ibldin~ clutperone.
The .~C'~1 -L4-purified tie~tf3 sample was anaiyred fur endotoxin using the f..Al, assay (Associates of Cape t'od) as describe in txample ?~i. Two aliqctuts of thr AC'.~1 ~4-purified 20 l3utt3 preparation were analyzed and were found to contain either a8 to I
Ih l~:li/m~, rccomhinant protein or ~)4 to 18c) ELJ/mg recombinant protein.
These results demonstrate that size exclusion chronlatoLraphy can hr used to purify the 1'l'CUIllhlllatlt l3cUB protein fiwm the folding chaperone anct imidazoie in It):1-purified material.
b) llltralfiltration For The Separation Uf Recombinant i;~tl3 Protein And Chaperones I:Itratiltration was examined as an alternative method for the separation recombinant I3o113 proUein and folding chaperones in IDA-purified material. Vv'hile in this example only mixtures of l3otB and chaperones were separated by ultratiltration. this technique is suitable '~0 for use with recombinant (3otA and l3otfproteins as well provided that the wash huftcrs used are altered as necessary to take into account different requirements tier solubiliy.
The recombinant E3otFi protein and folding chaperones were separated using a ovo-step sequential ultratiltration method. The first membrane used hart a Ill)i11111a1 IIlUlet:lllaC Welght PGTIUS97l15394 cutotf (MWCO) of approximately 100 kD; this membrane retains the larger folding chaperone while allowing the smaller recombinant protein to pass through. The addition of several volumes of wash huffer may be required to efficiently wash the recombinant protein through the membrane. The second step utilized a membrane with a nominal MWC'O of s approvimatelv l0 kD. During this step. the recombinant antiLen was retained by the membrane and could be concentrated to the degree desired and the imidazole and excess wash huffcr passed through the membrane.
Twenty-seven milliliters of an 1DA-purified BotI3 preparation was ultratiltercd through a ~7 mm Y'M 100 ( 100 kD MWC:O) membrane (Amicon) in a ~0 ml stirred cell (Arnicon).
(() 'The membrane was washed in dd I1,0 prior to use as recommended by the manufacturer. Six uolumcs of lU~% glycerol in PBS were washed through to remove most of the recombinant (W tLi protein and this wash was collected in a separate vessel. The resulting BotB
protein-rich filtrate was then concentrated I?-fold using a YM 10 ( l0 kD
MW('O) membrane (.~lmice~n). to a Iinal w~lume of 1~ ml. The YM IUO and YM 10 concentrates were analvzcd 1 ~ alone wvth the lysate starting material by native PAGE using a ~1 - I S%
pre-cast gradient gel ( (BioRad ). (~hc results arc shown in Figure 37.
tn Figure .;7. lane I contains IUA-puritied I3ott3 derived Irorn a shaker flask culture (i.r.. no cu-expression «f chaperones: L;x. 3~); lane 2 contains a 20% wlv ('FI clarified Ivsate ul~ p(~ist3ott3 kan laclcl T7/pAC YCGro/f3L21(DE3) cells; lane 3 shows the lvsate of lane i ?0 after II);'~ purification: lane 4 contains the YM 10 concentrate and lane ~
cemtains the YM
1 ()() concentrate.
.(~11C I'eStlllS SllUwrl In Figure 37 demonstrate that the recombinant I3otf3 prcucin can be purified away tiwm the ti~IdinL chaperone by ultratiltratiun through a t()0 kU
MWC'O
membrane ( lane ~). leaving the chaperone protein in the I ()0 kD concentrate ( lane > ).
Analysis ~f the sample in lane ~ also showed that very little of tlZe I3otB
protein was retained by the 1 OU kI) M WC:O menibranc after G volumes of wash buffer had been applied.
~(~he I3utB samples fbllowing !DA chromatography and following ultratiltration through the YM 100 memhranc were anlyzed by 1-1PLC on a size exclusion column (Shodcx KB 804):
this analysis revealed that the BotB protein represented O4% of the total protein in the lUA-s0 purified sample and that following ultratiltration through the YM 10() mcmhranc. the F3otl3 protein represented >9C~% of the total protein in the sample.
The Both protein purified by ultratiltration through the YM 100 membrane was examined Ibr cndotoxin using the LnL assay (Associates of Cape C'ud) as describe in l_ PCTlUS97I15394 Example 24. Two aliqouts of the YM 100-purified BotE3 preparation were analyzed and were found to contain either 18 to 36 EU/mg recombinant protein or 125 to 250 EUlmg recombinant protein.
The above results demonstrate that size exclusion chromatography and ultratiltration s can he used to purity recombinant botulinal toxin proteins away from tblding chaperones.
EXAME'LE 41 C.'loning And Expression Of T'he C Fragment Uf The C'. hcnrrlinum Serotype F: 'l~oxin Cime fh a ('. hmarlinrnrr type E: neurotoxin gene has hem cloned and sequenced from several different strains [Poulet co ul. ( 1992) E3iochem. f3iophys. Res. C'otnmun.
183:107 (strain l3clugal: ~'helan ce crl. ( lc)c)?) L;ur. J. Ciiochem. 304:657 (strain NC'TC' 1 121c)): fvjii ri crl.
( Ir)9()) 1~-1icrobiol. Immunol. s4:1U41 (partial sequence of strains Mashike.
twani and C)taru) 1 s and Fujii m ul. ( 19c)3) .I. Cien. Microbial. 139:70 (strain Mashike)~.
The nucleotide sequence oh the wpc Itoxin gene is available from the EMBI_ sequence data bank under accession numbers \62(l8c) (strain Beluga) and X626$3 (strain N('TC' 11210). The nucleotide sequence of the codin__ region (strain E3eluga) is listed in SE:Q ID NU:4c). The amino acid sedum ce of the ('. hrmrlimrm type I: ncurotoxin derived from strain Belgua is listed in SE:Q ID NU:50.
.!U ~I~hc nucleotide sequence of the coding region (strain NCTC 11?19) is listed in ~E(? ID
NU:51. The amino acid sequence of the (', hntulinum type E ncurotoxin derived from strain NCTC' I !?Ic) is listed in SL:Q ID N():52.
~I'hr ()NA sequence encoding the native ('. hnnrlimrnr serotvpc E-: (' li;tgmcnt gene derived front the Beluga strain can he expressed as a histidinc-tagged protein using the ='_5 plTllisb vector: the resulting coding region is listed in SEQ ID N():5 3 and the corresponding amino acid sequence is listed in SE:Q ID N0:54. ~l'he DNA seeluencc encoding the C' fragment of the native ('. hrnrrlrnunr serotype C gene derived from the NCTC 1 1219 strain can be expressed as a 111S21dlne-lil~~,Cd ftISIOI1 protein using the pr'1'1-lish vector: the resulting coding rcLion is listed in SL~,Q IU NO:55 and the corresponding amino acid sequence is listed :i(f in SE(l ll) NU:56. 'fhe C' fragment region from any strain of ('.
hnnrlinrrnr scrotype L: can he amplified and expressed using the approach illustrated below wine the (' fragment derived from ( '. hu~uliraurn type E 223 l strain l A~I'CC ~ 177$6).
_ ? p? _ The type E neurotoxin gene is synthesized as a single polypeptide chain which may be converted to a double-chain form (i.e., a heavy chain and a light chain) by cleavage with trvpsin: unlike the type A neurotoxin. the type E neurotoxin exists essentially only in the single-chain forth. The 50 kD carboxv-terminal portion of the heavy chain is referred to as the C' t~ra~~ment or the H,. domain. Expression of th c C fragment of C'.
hmtrlintrnt tvpc f~. toxin in hcterologous hosts (r.,s,~.. E. cvli) has not been previously reported, flte native C' fragment of the ('. bttlulinum scrotype E toxin (BotE) gene was cloned and inserted into expression vectors to facilitate expression of tire recombinant BotE protein in L-. c~uli. 'This example involved PC R amplification of the gene. cloning, and construction of 1 () expression vectors.
The BotE: scrotvpe gene was isolated using PCR as described for the BotA
serotype =ene in Example 28. 'fhc C'. bcmtlintun type E strain was obtained from the American Type ('allure ('ullcction (ATCC # 17780: strain 2231 ). 'fhc following primer pair was used in the I'C'R amplification: ;'-CGCCA'fGGCTC'TTTCTTCTTAT ACACiATGA~I'-3' (S' primer, Is engineered ,\'onl site underlined) (SEQ 1D N0:57) and ~~-W'A:'ICiCTI'TT;1TTTT~1'C'T'I'GCC'~1-1'C.'CA7'G-3' (3' primer. engineered llindlIl site underlined. native gene termination colon italicized) (SEQ II) N():~8). The I'CR product was insertcc( into pC'Rscript as described in Example 28. The resulting p('Rscript BotE clone was contirtncd by restriction digestion. as well as, by obtaining tire sequence of approximately 300 ?() bases located at the s' end of the C fragment coding reLion using standard DNA sequencing methods. The resulting Both sequence was identical to that of the published C'. horulinemt type 1=, tewin sequence [ Whelan er of t 1992). .strprcr].
The ;\'helttilled)/NindIII fragment from a pCRscript Both recombinant was cloned into pETHish vector as described for I3otA C fragment in Example 28. The resulting construct was termed pH isl3otE. pHisBotE expresses the BotE gene under the control of the T7 lac promoter and tltc rcsuiting protein contains an N-terminal IOXHis-tag affinity tag.
The pl~isBotE expression construct was transformed into BL21(DE3) pLysS
competent cells and l liter cultures were grown. induced and his-tagged proteins were purified utilizing a NiN7'A resin (eluted in low pli elution buffer) as described in Exantplc 28.
Total, soluble s() and purified proteins were resolved by SDS-PAGE and detected by Coomassie staining. The results are shown in Figure 38.
In I~i~;ure 38, lane 1 contains broad range MW markers (BioRad): lane 2 contains a total protein extract: lane 3 contains a soluble protein extract: lane ~4 contains proteins present in the llow through from the NiNTA column (this sample was not diluted prior to loading and therefore represents a load ~X that of the load applied for the total and soluble extracts in lanes ? and i): lane ~ contains proteins eluted from the NiN'I'A column; lane 6 contains protein eluted lion a NiNTA column which had been stored at -20°C for 1 year.
s The pllisBotF protein was expressed at moderate levels (7 mg/litcr) as a totally s«luble protein. 'E~he purified protein migrated as a single band of the predicted Mlll~.
Vv'estern blot hybridization utilizing a chicken anti-('. horulinunr serotvpe h. toxoid primary antibody (generated by immunization of hens as described in Example 3 using C'.
I»nulirrunr serotypc E toxoid ) was also performed on the total, soluble and purified E3otE
proteins. Samples of BotA and BotE3 C fragments were also included on the gels to facilitate MW and immunogenicity comparisons. Strong immunoreactivity was detected using the anti-('. hrrnrlinrrm type E: toxoid antibody only with the l3otL: protein.
These results demonstrate that the native f3otI~ gene scduences can he expressed as a soluble his-tagged protein in F. emli and purified by metal-chelation affinity chromatography.
I
EXAMPLL ~2 Generation ()f Neutralising Antibodies LJsing ~i'he Itccombinant pllisBotE
Protein The ahility of the purified pHisBotE protein to generate neutralizing antibodies was ?0 examined. Nike BAI.Bc mice were immunized with BotE~ protein (purified as described in Lx. ~41 ) using <ierbu GMDE' adjuvant ((:C Biotech>. The law ply elution was mixed with (~crbu acl_juvant and used to immunize mice. Each mouse received a subcutaneous in.jceticm of 10() til antigen/adjuvant mix (s~ Etg antigen + l Eig ad.juyant) on day ().
Mice were subcutancously boosted as above on day 14 and bled on day ?8. Mice were subseduently hoosted and bled on day 70.
Anti-('. hmulinrrm serotype F toxoid titers were determined in day'8 scrum iiom individual IlllCe from each group using the EL1SA protocol outlined in Example ?9 with the exception that the plates were coated with C'. horrrlinum serotype L: toxoid.
and the primary antibody was a chicken anti-('. hmulinum serotypc E toxoid. Seroconversicm relative to ;() control mice immunized with the p6xllisBotA antigen (E:x. ?9)) was observed with all 9 mice immunized with the purified pFIisE3otl: protein.
The ability of the anti-I3atL antibodies to neutralize native ( '.
hrnrrlirrrrm type I: toxin was tested in a mouse-C'. hmrrlinum neutralization model using pooled mouse serum (sec Ex.

?3b). The LDsc, of purified C'. hotulinum type E toxin complex (Dr. Eric Johnson. University of Wisconsin. Madison) was determined by a intraperitoneal (IP) method [Schantz and Kautler ( 1978). supra using I 8-22 ~ female ICR mice. The amount of neutralizing antibodies present in the serum of the immunized mice was determined using serum antibody titrations. The various serum dilutions (0.01 ml) were mixed with S LD;" units of C'.
hotrrlinum type F toxin and the mixtures were injected IP into mice. The neutralizations were perfi~rmed in duplicate.
-hhe mice were then observed fior signs of botulism for ~4 days. l.Jndiluted serum from day 28 did nut protect. while undiluted. 1/10 diluted and 1/100 diluted day 70 serum protected (1005 of animals) while !/1000 diluted day 7() serum did not. This corresponds to a neutralization titer ch' S0-500 1l.Jlml.
These results demonstrate that seruconversion occurred and neutralizing antibodies were induced when the recombinant BotI: protein was utilized as the immunogcn.
CaAMPLE 43 1' Construction ()f Vectors 'I'o Facilitate E=xpression ()f Ills-Tagged fiotl: Protein In Fermentation Cultures .~\ number ut~ expression vectors were constructed to facilitate the expression of recombinant f3otl: protein in large scale fermentation culture. These constructs varied as to ?0 the str-cnph of the promoter utilized (~1~7 or T7lac) and the presence of~
repressor elements f lac(cl ) un the plasmid. 'the resulting constructs varied in the level of expression achieved and in ~IF1SI111C1 stability which facilitated the selection of a optimal expression system tier lurmentation scaleup. 'this example involved a) construction of liotE
expression vectors and h) determination of expression levels in small scale cultures.
,5 Construction Of QotE Expression Vectors ~fhe RutE expression vectors created tbr fermentation culture were engineered m utilize the kanamycin rather than the ampicillin resistance gene. and contained either the T7 or T7lac hromuter_ witlj or without the laclq gene for the reasons outlined in Example iU.
~() In all cases. the protein expressed by the various expression vectors is the pHisf3otE
protein described in Ixamplc ~4 f . with the only differences between clones being the alteration of various regulatory elements. using the designations outlined below. the pl fisHotl; clone (I:x. ~41 ) is equivalent to pf-IisButl; amp T7lac.

i) Construction Of pHisBotE kan lacty T7lac pI-lisBotE kan laclq T7lac was constructed by inserting the .~i7~uI/HindlIt fiagment of pHisI3otE which contains the I3otE gene sequences into ,~hcr1/tfindllI-cleaved pCT24a vector.
Proper construction was confirmed by restriction digestion.
ii) Construction Of pllisBotE kan T7 pI 1is13utE: kan '1~7 was constructed by ligating the Botl:-containing .17~u1/,Supi fragment of pHisf3utf: kan laclqT7lac to the 'f7 promoter-containins~ .17or1/.S'crpl fragment of pf~T23a.
Proper construction was confirmed by restriction digestion.
iii) Construction Of pHisBotl: kan laclqT7 IaFlisBotfkan IacIqT7 was constructed by inserting the 13,L~lIIIt-IindIIl i~ragment from pHisfiutE kan 'f7 which contains the ButE gene sequences into L3,y11(/ttindlIl-cleaved pL;T?4 vector. I'rc~per construction was confirmed by restriction digestion.
I
b) Determination Uf BotE Expression Levels In Small Scate Cultures I~hr three ButE kan expression vectors described above were transtormcd into B121(UE ~) competent cells and 50 ml (2XY'1~ + 40 Etglml kan) cultures were crown and () induced with I1'PG as described in Example 28. Total and soluble protein extracts from beti~re and after induction made as described in Example 28. 1'hc total and soluble extracts were resolved on a I?.5'% SDS-I'nGE gel. and his-tagged proteins were detected on a Vv~estern hlut utilizing the NiNTIt-alkaline phosphatasc conjugate as described in Fxamplc 31(c)(iiil. 'The results showed that all three BotF cell lines expressed his-tagged proteins of 's the predicted MW ter the BotE protein upon induction. The results also demonstrated that the two constructs that contained the T7 promoter expressed the I3otf: protein before induction. while the T7lac promoter construct did not. Upon induction, the T7 prumotcr-containing constructs induced to higher levels than the T7lac-containing construct, with the pl-1is13utl~ kan laclq'r7lBl?I(DI:3) cells accumulating the maximal levels of Rotl: protein.
,U

Expression And Purification Of pHisBotE Frotn Fermentation Cultures Based on the small scale inductions performed in Example 43. the pHisBotE kan laclq T7/B1? 1 ( UF3 ) strain was selected for fermentation scaleup. This example involved the Icrmentation and purification of recombinant BotE C fragment protein.
A fermentation with the pHisBotE kan laclq T7IB121(DF3) strain was performed as described in Example 31. The fermentation culture was induced 2 hrs post start of the glucose teed with 4 gm IPTG (final concentration = I.G mM). 'fhe OD,,"" was 42 at time of induction. then 4G.5. 48. ~s and ~4 at I-4 hrs post induction. Viable colony counts decreased Irom ()-4 hr induction [ 131. 4 (28). 7 (3), 7. 8: dilution 3 utilized 6 Ltl of dilution ? cells;
bracketed colonies arc microcolonies). All (32/32) colonies scored at the time of induction retained the I3otE plasmid (kan resistant) and no colonies at induction grew on IPTCi+Kan plates c no mutations detected). These results were indicative of strong promoter induction, I S since colony viability reduced after induction. and the culture stopped growinL during icrmcntation (stopped at ~~l OU,,""imp).
Total and soluble extracts were resolved on a 12.5% SDS-PAGE gel and total protein vvas detected by staining with Coomassie blue. 'flze results are shown in Figure 39.
In Figure i9, lane 1 contains total protein from a pNisBotA kan T7 Iac/Bl2l(UE3) ?() LysS fermentation (Ex. 24). Lanes ?-9 contain extracts prepared from the above pliisBotE
kan lacld -h7/Ii121(UE3) fermentation; lanes 2- 4 contain total protein extracts prepared at U. 1 and ? Iwurs post-induction. respectively. Lane ~ contains a soluble protein extract prepared at hours p«st-induction. Lanes O and 7 contain total and soluble extracts prepared at 3 hours pUSt-IndU~tlon. respectively. Lanes 8 and 9 contain total and soluble extracts prepared at 4 hours post-induction. respectively. Lane 10 contains broad range MW markers (BioRad).
~I~hc results shown in Figure 39 demonstrate that moderate level induction of totally wluble Bot L: protein was observed. increasing from 1 to 4 hrs post induction (no expression was detected in uninduced cells). From a 2 liter fermentation harvest a ISO gm (wet wt) cell pellet tvas obtained and used to make a PEI-clarified lysate ( 1 liter in CRR.
pl t 6.8). The ~0 lysate was applied to a large scale II)A column and 200 mg of BotE protein.
which was fbund to be greater than 95% pure ( as judged by visual inspection of a C.'oontassie stained ADS-PAGE gel). was recovered. This represents 2.5% of the total soluble cellular protein (assuming a PEI lysate having a concentration of 8 mg proteiniml) and corresponds to a yield of 1 UU mg t3otE protein/liter of fermentation culture.
The above results demonstrate that high levels of the recombinant l3otE
protein can he expressed and purified from fermentation cultures.
CXAMPLC 4~
Removal Of Imidazole From Purified Recombinant BotF Protein !'reparations The expression oh recombinant BotE protein. unlike the l3otA and E3otB
proteins, did 1 (.) not reduire the presence of foldins~ chaperones to maintain solubility durint scale-up. A size exclusion chromatography step was included however to remove the imidazole from the sample and exchan~!e the IUA elution buffer tim one consistent with the RotA
antigen.
;~ Sephacrvl ~-1()U l-IR tS-IUU: Pharmacia) column was poured t'_.> cm x ?~
crtl: bed volume ~ 1 tU ml). Under these conditions. the E3otE protein should he retained by the beads to a Iesser degree tlZan the smaller imidazolc. therefbre the !)otE protein should elute from the column hcfbrc the imidazolc. ~fhe column was equilibrated in a butter consisting of iU mM
sodium phosphate. U.~ M NaC'I, and lU% glycerol tall reagents from Mallinkrodt). Five milliliters ol~ the lUA-purified f3otL: protein (L:x. 4:1) was filtered through a (>.-1> ~~. syringe filter and applied to the S-lU0 column. and equilibration buffer was pumped through the ~0 column at a flow rate of l mi/minute. Fluted proteins were monitored by ahsorhance at 280 nm, and collected either manually or with a fraction collector. .~pprnpriate tubes were pooled il' necessary. anti the protein was quantitated by ahsorhance at ?8t) nm anJmr l3(':1 protein assay. The isolated peaks were then analysed by native and/or SE)~-I'ACiI: m identify the proteinls) and evaluate the purity.
:?> Figure 40 provides a representative chromatogram showing the purification of~
II)A-purified BotE on the S-lUU column. Even though folding chaperones were not over-expressed with this antiLCn. a small amount of protein eluted at a time consistent with the folding chaperones expressed with E3otA and Botl3 proteins (Giro) tree the first peak). The second peak in the chromatogram contained the E3otl: protein. and the third peak was aU presumably imidazole. This presumed imidazole peak was isolated in comparable levels in lUA-purified I3otA and IiotB protein preparations as well.
_ 2Ug _ WO 98/08540 PCT/US9'7/15394 These results demonstrate that size exclusion chromatography can be used to remove imidazole and traces of contaminating high molecular weight proteins from IDA-purified BotE protein preparations.
The S-lUU-purified BotE protein was tested tbr endotoxin contamination using the I_.41, assay as described in Example 24. 'This preparation was found to contain 64 to 128 I-:tllmg recombinant protein and is therefore substantially tree of cndotoxin.
The 5-IOU purified BotE was mixed with purified preparations of BotA and E3otB
proteins and used to immunize mice: ~ Elg of each Bot protein was used per immunization and alum was included as an adjuvant. After two itnmunizations with this trivalent vaccine.
l0 the immunized mice were challanged with ('. hruerli»um toxin. The immunized mice contained neutralizing! antibodies sufticicnt to neutralize between IU().UUU
to 1.UUU.UUU (.D<<, of either toxin A car t0\itl B and between I .UUU to l U.UUO I.O", ai' toxin L:. The titer of~
nrutraliring antibodies directed against toxin E would be expected to increase following subsequent boosts with the vaccine. ~I~hesc results demonstrate that a trivalent vaccine I s containiy recombinant f3otA. BotB and BotE proteins provokes neutralizinc:
antibodies.
L:XAMPLE a6 Expression U1~ 1'he C' ):ragmcnt C)f The ('. hrmnlrnrrr»
~c:rotvPe C' 'toxin Gene And Generation Uf Neutralizing Antihodi~s ?U
~f hr ( ~. hrnnli»rn» type C' I neurotoxin gene has been cloned and scclucnced [himura cn crl. ( I c)c)U) I3iochcm. Biophys. Res. C'nmtn. l 71: I 3U4]. The nucleotide sequence c~t~ the toxin =enc derived from the C'. hmulirrrr»r wpc C strain C-Stockholm is available from the 1:MI31./(irnl3ank sequence data banks under the accession number l)c)U210: the nucleotide scquenrc of the coding region is listed in SEQ ID NU:59. -fhe amino acid sequence of the C'.
hnrlrlirrrrrrr tyre C'1 ncurotoxin derived ti'om this strain is listed in SEQ
II) NU:60.
l'hc DNA sequence encoding the native C'. bmuliraru» seronvpe ('1 C.' fragment gene derived from the (.'-Stockholm strain can he expressed using the pE~1'Elisb vector: the resulting coding region is listed in SEQ ID NU:(1 and the corresponding amino acid sequence is listed ;U in Sf:Q JO NU:62. The C' feagment region tiom any strain of ('.
hrurrli»urrr scrotypc C' can be alllplllled and expressed USlng the approach illustrated below using the C
ti~a~~ment derived from ( '. hrrrrrlirrum tvpe C' C-Stockholm strain. Expression of the C' ti~agment of'('. hurulimrnr type ('1 toxin in heterologous hosts lc~.,l,~.. l.: calf) has not been previously reported.
_ ?U9 _ The C fragment of the (.'. hcuuhnum serotype C:1 (BotC 1 ) toxin gene is cloned using the protocols and conditions described in Example 28 for the isolation of the native BotA
gene. A number of C'. hotulinum serotype C' strains (expressing either or both C1 and C2 toxin) arc available from the ATCC' [c~.),~., 2220 (ATCC 17782). 2'_';9 (ATCC
1778x), 2223 (A~l'C'C 17784: a type C-[3 strain: C-(3 strains produce C'? toxin). 662 (ATC(..' 17840: a type C'-cx strain: C'-w strains produce mainly C I toxin and a small amount of C'2 toxin). 2021 (ATC'C' 17850: a type C'-cx strain) and VI'I 3803 (ATCC ?~7G(fJ.
Alternatively, other type C' strains may he employed for the isolation of sequences encoding the C fragment of ('.
honrlimrm scrutypc C' toxin.
The following primer pair is used to amplify the BotC acne: ~'-CGCC:ATGGC
TTTA'fTAAAAGATA'I'AA'CTAATG-i' [5' primer, engineered .Ncwl site underlined (SFQ ID
N():l;)) and ~'-GC:AA(CTTTTA'hTCACTTACACiGTAC' AAAA('C'-s~ [p' primer.
engineerccl hlindlll site underlined. native gene termination cudon italicized (SEQ II) 'v():lW)~. lvlluwing I'C'R amplification. the I'CR product is inserted into the pC'Rscript vector I'. ~ and then th r l.i kb l~ras~ment is cloned into pl:Tllish vector as described for tW tA C fragment ~_ene in Example 28. The rcsultin t construct is termed pllisButC'. Proper construction is confirmed by I)NA srduencin~ of the I3otC sequences contained within pi Iist3utC'.
pHisl3utC' expresses the ButC Lene sequences under the lean scriptiunal control of the T7 lac pronuocr and the resulting protein contains an N-terminal IOXI-lis-tae affinity ta~~. ~I~hc '0 pHisE3utC' expression construct is transformed into 131.21(DE3) pl..vs~
competent cells and I
liter cultures are ~~rown. induced and his-tagged proteins arc purified utilizing a NiNTA resin (eluted in ?~0 mM imidazole, ?0% glycerol) as described in f=.xample '_'8.
I~mal, soluble and purified proaeins arc resolved by SDS-I'ACiI: and detected by C'uumassie staining and Western hlut hvhridizatiun utilizing a Ni-N~r~1-alkaline phosphatase crnyu~atc (Qiagcn) which 1'CCU~',171ZeS hIS-La~'L:ed protC111S aS dCSCrihed In Example 31(c)(Ill).
~fhis analysis permits the determination of expression levels of the p11is13otC protein (i.c~., number of mgiliter expressed as a suluhle protein). The purified E3utt.' protein will migrate as a ain~lc;
band of the predicted MW (i.c~.. ~--~OkD).
The level of expression of the pHisBotC protein may he modified (increased) by ,0 substitution ui' the ~l'7 promoter fur the ~I'7lac promoter. or by inclusion of the iaclq gene un the expression plasmid. and plasmid expressed in B1.21 (DE : ) cell lines in fermentation cultures as descrihcd in Example 30. If' only very low levels (i.~-.. Ims than 0.5%) uf' soluble pHIISB(11C~ protein arc expressed LISI11~ the abUVf: expreSSIUlI 5~'Ste111S, the pF-lisl3otC construct _ 210 -may be co-expressed with pACYCGro construct as described in Example 32. In this case, the recombinant BotC protein may co-purify with the folding chaperones. The contaminating chaperones may be removed as described in Example i4. Preparations of purified pHisBotC
protein are tested for endotoxin contamination using the I_r1L assay as described in F;xample s ~~1.
The purified pl iisBotC.' protein is used to generate neutralizing antibodies.
BAI,Bc mice arc; immunized with the BotC' protein using Gerbu (iMDP adjuvant (C: C:
Biotech) as described in Example 36. The ability of the anti-BotC.' antibodies to neutralize native ('.
hnrulir~rrm type C' toxin is demonstrated using the mouse-('. hnrulirzrrrrr neutralization model 1() described in Example .iG.
GXAMPL)C 47 Expression Of The C Fragment Of The ('. hrrrulinrurr Serotypc D Toxin Gene And Generation Uf Neutralizing Antibodies 1;
The ('. hrrrrrlirrrrnr type D neurotoxin gene has been cloned and sequenced (Sunagawa et al. f ! 992) .f. Vet. Med. Sci. ~4:90s and Binz cu al. ( 1990) Nucleic Acids Res. 18:5556).
The nucleotide sequence of~ the toxin gene derived from the CBIb strain is available from the FME3LiGcnBank sequence data banks under the accession number 549407; the nucleotide '_'(1 sequence of the coding region is listed in SEQ 1D N0:6~. The amino acid sequence of the C'.
hurrrlrnrrm type U ncurotoxin derived from the CB16 strain is listed in SI:Q
ID NU:6G.
I'he UNA sequence encoding the. native ('. horulinrurr serotype U C' fragment gene derived from a BotU expressinL strain can be expressed using the pETIIisb vector: the rrsultin~= coding region is fisted in SEQ IU N0:67 and the corresponding amino acid sequence is listed in SEQ ID NU:68. 'fhe C' fragment region from any strain of (.'.
hnruliraum serotype U can be amplified and expressed using the approach illustrated below using the C tcagment derived from ('. hrrrulirrum type D CB I G strain. Expression of the C' fragment of ('.
hnrrrlirrrrnr type U toxin in heterologous hosts (e~.~~.. E. culi) has not been previously reported.
~l~hc C' fragment of the ('. horrrlirrrurr serotype D (Boll)) toxin gene is cloned using the _s(1 protocOs and conditions described in Lxample ~8 1'or the isolation of the native ButA gene.
A number of C'. hcrrulirrrrnr type D strains are available t~rom the A'fC'C' (c~.s,~., ATCC 9GS i.
?0?3 (A~l'CC 17$51). and VPl 5995 IATCC 2717)].
1_ p PCT/US97/15394 The following primer pair is used to amplify the BotD gene: ~'-CGCCATGGC
TTTATTAAAAGATATAATTAATG-3' [5' primer. engineered Nco1 site underlined (SEQ tD
N0:63)~ and 5'-GCAAGCTTTT..~CTC7'ACCCATCC.'fCIGATCCCT-;' [3' primer, engineered Ilindlll site underlined. native gene termination codon italicized (SEQ fI) N():69)~.
s Following I'Ctt amplification, the PCR product is inserted into the pC:Rscript vector and then the I.~ kh tiagment is cloned itno pETHisb vector as described fir Bot~1 C.1'ragment gene in Example 28. The resulting construct is termed pHisl3otU.
pHisBotU expresses the BotD gene sequences under the transcriptional control of the T7 luc promoter and the resulting protein contains an N-terminal l UXIVis-tag affinity tag. 'hhe f0 pHisHotD expression construct is transformed into HL21(UE3) pl.ysS
competent cells and I
liter cultures arc grown, induced and his-tagged proteins arc purilicd utiliiinc~ a NiN'rA resin as described in Example 28. Total, soluble and purified proteins are resolved by SUS-PAGE
and detected by C'oomassie staining and Western blot hvhridiTation utilizing!
a Ni-NTA-alkaline phosphatase conjugate (Qiagen) which recognizes his-tagged proteins as described in 1 ~ Example s I (c)( iii). This analysis permits the determination of expression levels of the pl-IisBotU protein (i.c.. number of ms~/liter expressed as a soluble protein).
l~he purified HotU
protein will migrate as a single band of the predicted MW (i.c-.. -~OkI)).
The level of expression of the pHisBotU protein may he modified (increased) by substitution of the T7 promoter for the T7lac promoter. or by inclusion of the laclq gene on ?U the expression plasmid. and plasmid expressed in B1.21(DE3) cell lines in fermentation cultures us described in Example 30. If only very low levels (i.e.. less than about U.5~/~) of soluhle pHisHotl) protein are expressed using the above expression svstcros.
the pflisl3otU
construct may he co-expressed with pACYCGro construct as described in Example 3?. In this case, the recombinant BotU protein tnay ca-purify with the folding chaperones. l~he ?5 contaminating chaperones may be removed as described in I:xamplc ;4.
(reparations of purified pHisBotD protein are tested for endotoxin contamination using the LAL
assay as described in Example 24.
1'he purified pHisBotU protein is used to generate neutralizing antibodies.
BALBc mice are immunized with the E3otD protein using (icrbu CiMUI' ad_juvant (C'C' Biotech) as sU described in Example 36. l~he ability of the anti-BotD antibodies to neutralize native ('.
hnltrli~anm type U toxin is demonstrated using the mouse-C'. lmur~linarna neutralization model described in f:xample 36.
-212_ *rB

WO 98!08340 PCTIUS97I13394 Expression Of The C Fragment Of The C'. hrrrulinum Serotype F Toxin Gene And Generation Of Neutralizing Antibodies The C'. homlinrrm type F neurotoxin gene has been cloned and sequenced [East er crl.
( Ic)9?) !-'EMS Microbial. Lett. 96:2?5]. The nucleotide sequence of the toxin gene derived _ Iron the ?031 strain (AT'CC 23387) is available from the EMBLI(icnBank sequence data banks under the accession number M929()6: the nucleotide sequence of the coding: region is listed in SFQ 1D N():70. The amino acid sequence of the (.'. hrnrrliru»rr type F ncurotoxin It) derived fi'orn the 202F strain is listed in SEQ ID N0:71.
The I)NA seduence encoding the native C'. hnlulirrrr»r scrotype F C fragment gene derived from the 2()?F strain can be expressed using the pE'I'Hisb vector: the resulting coding rezion is listed in SCQ ID N0:73 and the corresponding amino acid sequence is listed in SE:Q
)U Nt):7:. ~l~hc C' tcagment region tiom any strain of C', hmrrlir7u»r serotype F can be 1 ~ amplified and expressed using the approach illustrated below using the C
iraLment derived from ( ' hruulirrrrm type F 202F strain. Expression of the C' fragment of ('.
hrnrrlirurnr type I-' toxin in heteCC)lllgOLIS hosts (c.~,~., L: cwli) has not been previously reported.
~I~hr C' 1'ra~~ment of the ('. hurrrlinum serotype I~ (Botf~) toxin genr is cloned wine the protocols and conditions described in Example 28 for the isolation of the native BotA Gene.
'-U hhr ('. hnrrrlinr»rr tvpe fr ?OAF strain is obtained from the American ~l~vPe (.'allure Collection (f~'1~C'(~ '? ~-;87). Alternatively. sequences encoding the BotF toxin may be isolated from anv_ I3ot1 rxprcssing strain (c~.,s,~.. VPI 4404 (ATCC '_'S7(~4). VPl ?3H'' (A'i'CC
?73'_' 1 1 and Langrtanct (A'1'CC ;5415)].
The following primer pair is used to amplify the BotF gene:: 5'-C(iC.'C'A~fGCi(..' ?5 ~fA~rT("I~AA'I~~fATA'1~ATTTTAA~I'ACi-3' (5' primer, engineered ;1~'cwl site underlined (SFQ
1D N():74)( and 5'-GCAAGCTTTC;4'fTCTTTCCATC.CATTCTC-3' [3' primer. engineered l~indlll site underlined. native gene termination codon italicized (SFQ ID
N0:75)(.
FollowinL fCR amplification, the PCR product is inserted into the pC.'Rscript vector and then the 1.5 kh Iragmeni is cloned into pETHisb vector as described I«r f3otA (' fragment gene in 3(1 Example ?8. The resulting construct is termed pHisI3otF:
pI-IisI3otF expresses the BotF gene sequences under the transcriptional control of the 'f7 lac Promoter and the resulting protein contains an N-terminal lOXliis-ta~~
aftinitv ta~~. The pHisEiotl~ expression construct is transformed into BL21(DF:3) pLysS competent cells and 1 - 213 .

liter cultures arc grown. induced and his-ta6ged proteins arc purified utilizing a NiNTA resin as described in Example 28. Total. soluble and purified proteins arc resolved by SDS-PAGE
and detected by Coomassic staining and Western blot hybridization utilizing a Ni-NTA-alkalinc phosphatase conjugate ((?iagen) which recognizes his-tagged proteins as described in Example 31(c)(iii). This analysis permits the determination of expression levels of the pl~isBotF protein (i.e., number of mgllitcr expressed as a soiuble protein).
The purified BotF
protein will migrate as a single band of the predicted MW (i.e.. ~-iOkD).
'the level of expression of the plvisBotF protein may be modified (increased) by SIIbSIIILttI()t1 Of the T7 promoter for the T7lac promoter, or by inclusion of the Iaclq gene cm 1 U the expression plasmid. and plasmid expressed in I3L? 1 (DE3) cell lines in fermentation cultures as described in Example 30. If only very low levels (i.c., less than about U.5%) of soluble pE lisf3otF protein are expressed using the above expression systems.
the pI IisBotF
construct may he co-expressed with pACYCCiro construct as described in Example 32. In this case. the recombinant BotF protein may co-purify with the folding chapcro n cs. The 1 s contaminating chaperones may be removed as described in f:xample 4.
f'rcparations of purified pt-lisBotF protein arc tested for endotoxin contamination using the Li\L assay as dcscrihed in Example 24.
~I'hc purifcd pf lisBotEv protein is used to generate neutralizing antibodies.
I3ALRc mice arc immunized with the Both protein using (icrbu (iMDP adjuvant (CC
Biotech) as ?() described in E:aample 3G. The ability of the anti-Botl antihodics to neutralize native ('.
hrmrlinrrrn type h toxin is demonstrated using the mouse-('. hr~rulinunr neutralization model descrihccE in E:xamplc il.
EXAMPLh. 4c) Expression Of The C Fragment Uf The ('. hrurrlinum Serotvpe G Toxin Gene And Cicncration Of Nwtralizing Antibodies ~fhe ('. Jmurlinum type (i neurotoxin gene has been cloned and sequenced (Campbell eu crl. ( 199;) Biochimica et Biophysics Acta 1216:487 and Binz e~ crl. ( 199()) Nucleic Acids lies.
s(1 18:SSibj. The nucleotide sequence of the toxin gene derived from the 1 13/30 strain (NCFF3 3012) is available from the E:MBLI(,enBank sequence data banks under the accession number X741 G?: the nucleotide sequence of the coding region is listed in SEQ ll) NU:76. 'fhe amino _?I4_ acid sequence of the C'. bmulinunr type G neurotoxin derived from this strain is listed in SEQ
ID NO:77.
The DNA sequence encoding the native C'. butulinum serotype G C.' fragment gene derived from the 113/30 strain can be expressed using the pETHisb vector; the resulting coding region is listed in SFQ II) N0:78 and the corresponding amino acid sequence is listed in SEQ ID N0;79. The C.' fragment region from any strain of C'. hvtulinuna serotype G can be amplified and expressed wine the approach illustrated below using the C
fragment derived I~t'U111 ( '. hurulinum type Ci 1 13/ 30 strain. Expression of the C.' iraLntent of C'. IJarrrllnrrnl type Ci toxin in heterologous hosts (c~.,t,~.. E. call) has not been previously reported.
1 t1 The C fragment of the C'. hunrlinum serotypc G (BotG) toxin gene is cloned using the protocols and conditions described in Example 28 for the isolation of the native BotA gene.
T~hr ('. hrnrrlinrrrrr type C~ 113/30 strain is obtained from the NCFl3. 'fhe following primer pair is used to ampltfv the BotCi~ gene: i'-CGCCAT'GGCTGAC' ACAA'fTTTAA'rACA
AWI~-s' [5' primer, engineered r1~'rui site underlined (SEQ IO N0:80)j and 1 ~ 3'-CiC'CTC'VAGT7:~t'rTCTGTCCA~I'CCTTCATCCAC-3' [3' primer. engineered .l?ruI site underlined. native gene termination codon italiciacd (SEQ fD N0:81 )].
Ivllowine E'CR
amplification. the 1'CR product is inserted into the pCRscript vector and then the 1.~ kb fragment is cloned into pETI-lisb vector as described for BotA C' fragment gene in )~xample ~8 with the exception that the sequences encoding Bot(i are excised from the pCRscript '?0 vector by digestion with 74'crrl and ,l7ml and the rb'roI site is blunted (the BotG sequences contain an internal lliudlll site). This ,'~'c~oE(til(ed)lllrrrl fragment is then ligated to the pE:Ti Iisb vector which has been diLCSted with lv'lrel and ,Sell and the ~1-lrc I site is blunted.
The rcsultin~_ construct is termed plfisl3otG.
pllisl3ot(i cypresses the Rote Lone sequences under the transcriptional control of the 'f7 lac promoter and the resulting protein contains an N-terminal IOXHis-tag affinity tag. The pl-lisBotG expression construct is transformed into BL21(DE3) pLysS competent cells and 1 liter cultures arc grown, induced and his-tagged proteins are purified utilizing a NiNTA resin as described in Example ?8. 'Total. soltthlc and purified proteins are resolved by SI)S-('ACrE
and detected by C'oomassie staining and Western blot hybridization utilizing a Ni-N'fA-:~0 alkaline phosphatase conjugate (Qiagen) which recognizes his-tagged proteins as. dcscrihed in Example 31(c)(iii). This analysis permits the determination of expression levels of the hHisBotG protein (i.c~., number of mg/litcr expressed as a soluble protein).
The purified BotG
protein will migrate as a single band of the predicted MW (i.c.. -SOkD).

PC'TIUS9'7/15394 The level of expression of the pHisBotCi protein may be modified (increased) by substitution of the T7 promoter for the T7lac promoter, or by inclusion of the laclq gene on the expression plasmid. and plasmid expressed in Bi.?1(DE3) cell lines in fermentation cultures as described in Example 30. If only very low levels (i.o., less than about 0.5%) of soluble pH isBotCi~ protein arc expressed using the above expression systems, the pHisl3otCi construct may be co-expressed with pACYCCiro construct as described in Example 3?. In this case. the recombinant Bot(i protein may co-purify with the folding chaperones. The contaminating chaperones may be removed as described in Irxample 3~1.
Preparations of purified pllisBotCi protein are tested for endotoxin contamination using the LAI. assay as described in E:xampie 24.
The purifed pH isBotCr protein is used to generate neutralizing antibodies.
F3ALBc mice are immunized with the BotG protein using Cierbu CiMl7P adjuvant (('C
f3iotechl as descrihect in Example 3(~. The ability of the anti-BotCi antibodies to ncutrali~c native ('.
hmrrlirurnr tvpr (i toxin is demonstrated using the mouse-(.'. hmrrlinrrnr neutralization model I s described in Lxample 36.

t-:xpression Of Recombinant Botulinai Toxin Proteins In Fucarvotic (lust C.'ells :?0 Recombinant hotulina) C lra~!ment proteins may he expressed in eucarvotic host cells.
such as yeast and insect cells.
a) Expression In Yeast Botuiinal C.' fragments derived from serotypes A, B, C'. D. l~. F and G may be expressed in yeast cells using a variety of commercially available vectors.
lclr example, the pPIC3K and p1'IC9K expression vectors (Invitrogen) may be employed ii~r expression in the methyiotrophic yeast. Piclricr pu.swri.v. When the pI'IC3K vector is employed.
expression of the hotulinal C fragment protein will be intracellular. When the pl'ICSK
vector is employed.
the hotulinal C fragment protein will be secreted (the alpha factor secretion signal is provided sO on the pPIC9K'vector).
17NA SeqllellceS cllcOd1111 the desired C fragment is inserud into these vectors using techniques known to the art. Briefly. the desired botuiinal expression cassette (including sequences encoding the his-tag: described in the preceding examples) is amplified using the _~Ih-PCR in conjunction with primers that incorporate unique restriction sites at the termini of the amplified fragment. Suitable restriction enzyme sites include ,fncrBl. EcvRI.
RvrII and NuU.
When the botutinal C fragment is to be expressed using the pPIC3K vector, the initiator methionine (ATG) is provided by the desired Bot gene sequence and a Kozak consensus s sequence is engineered upstream of the ATG (c~.~r., ACCATGG).
~Che amplified restriction fragment containing the hotulinal C fragment gene is then CIUtICd into the desired expression vector. Recombinant clones are integrated into the Pichiu hcr,wvri.,~ gcnome and recombinant protein expression is induced using methanol following the manufacturer's instructions (Invitrogen Pichia expression kit manual).
1 (1 C'. hmulinum genes are A/T rich and contain multiple sequences that arc similar to yeast transcriptional termination signals (e.g., TTTTTATA). If' premature transcription termination is observed when the botulinal C fragment genes are expressed in yeast, the transcription termination signals present in the C fragment genes can be removed by either site directed mutagenesis (utilizing the pALTER system; Promega) or by construction of 1 ~ synthetic genes utilizing overlapping synthetic primers.
The botulinal C tcagment genes may be expressed in other yeast cells using other commercially available vectors [e~.l,~., using the pYES? vector (Invitrogen) and .S. ve~rewi,siue~
cells ( Invitrogen)).
?0 h) Expression in Insect Cells I3otulinal C' fragments derived from serotypes A, B. C. D. E. F and G may be expressed in insect cells using a variety of commercially available vectors.
Uor example, the pE3iueBac4 transter vector (Invitrogen) may he employed for expression in ,Sj~ncl~yuc~ru jmr~~iperclu (,~~)) insect cells (baculovirus expression system) (equivalent baculovirus vectors ?5 and host cells are avaialble from other vendors, e.l,~., Pharmingen, San Diego, C'A). Botulinal C fragments contained on Nrollflindlll fragments contained within the pHisBotA-G
expression constructs (described in the preceding examples) are cloned into the pBIueBac4 vector (digested with N'crrl and Hlndltl); the Nrot site present on the C
tragmcnt constructs overlaps with the start codon of the fusion proteins. In the case of botulinal C:' tcagment st) clones that contain internal Hirzdlll sites (c~.~~., using the BotG
sequences described in Ex. 49).
the C tragment gene is contained within a NcoIIXhnI fragment on the pHIisI3ot construct.
'this ~\-cwl/,l7~ul fragment is excised from pHisBot and inserted into pBlueBac~4 digested with ~\~'c.wl and S'crll. Recombinant baculoviruses are made and the desired recombinant C fragment is expressed in S~9 cells using the protocols provided by the manufacturer (lnvitrogen MaxBac manual). 'fhe resulting constructs will express the pl-iisBot protein intracellutarly (including the N-terminal his-tag) under the control of the polyhedrin promoter. For extraccllular secretion of botulinal C fragment proteins. the C fragment seduenccs from the pHisBot constructs arc cloned into the pMelBacB vector (lnvitrogenl as described above for the pBlueBacd vector. When the pMeIBacB vector is employed. the his-tagged botulinal C
t'ragment proteins are secreted (utilizing a vector-encoded honeybee mclittin secretion signal) and contain a nine amino acid extension at the N-terminus.
Ills-tagged botulinal C fragments expressed in yeast or insect cells are purified using 1() metal chclation columns as described in the preceding! examples.
T~rom the above it is char that the present invention provides compositions and methods for the preparation of effective multivalent vaccines against C'.
hnrulint.rm neurotoxin.
It is also contemplated that the recombinant botulinal proteins be used fir the production of 1 ~ LlnIItOXInS. nl1 publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit «f the invention.
_ ?lg _ I

PC'T/US97I15394 SEQUENCE LISTING
(1) GENERAL
INFORMATION:

J (i) APPLICANT: Williams, James A.

Thalley, Bruce S.

(ii) TITLE OF INVENTION: Multivalent Vaccine For Clostridium Botulinum Neurotoxin ' lU

(iii) NUMBER OF SEQUENCES: 82 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Medlen & Carroll (B) STREET: 220 Montgomery Street, Suite 2200 (Cl CITY: San Francisco iD) STATE: California (E) COUNTRY: United States of America (F) ZIP: 94104 (v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 Ivi> CURRENT APPLICATION DATA:

(A1 APPLICATION NUMBER: US

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Carroll, Peter G.

LB) REGISTRATION NUMBER: 32,837 (C) REFERENCE/DOCKET NUMBER: OPHD-02959 (i::) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (415) 705-8410 (B) TELEFAX: (415) 397-8338 ~t0 (2) INFORMATION
FOR SEQ
ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear !ii) MOLECULE TYPE: DNA (genomic) iU

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

GGAAATTTAG
CTGCAGCATC
TGAC

~J !2) INFORMATION
FOR SEQ
ID N0:2:

(i> SEQUENCE CHARACTERISTICS:

tA) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ' W (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

TCTAGCAAAT
TCGCTTGTGT
TGAA

' (~) INFORMATION
FOR SEQ
ID N0:3:

.?~g_ WO 98ItJ8540 PCTNS97115394 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single j (D) TOPOLOGY: linear (ii)MOLECULE TYPE: DNA (genomic) (xi)SEQUENCE DESCRIPTION: :3:

lU

GCATTAGACC

(2) INFORMATION
FOR
SEQ
ID
N0:4:

]j (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs (B) TYPE; nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear '_' U

(ii)MOLECULE TYPE: DNA (genomic) (xi)SEQUENCE DESCRIPTION: :4:

CTAAAGTAT

(2) INFORMATION
FOR
SEQ
ID
N0:5:

(i) SEQUENCE CHARACTERISTICS:

i() (A) LENGTH: 8133 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)MOLECULE TYPE: DNA (genomic) lix)FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..8130 ~U

(xi)SEQUENCE DESCRIPTION:
SEQ ID N0:5:

TTA ATA ATT.

Met Ser Leu Ile Ser Lys Glu Glu Lys Leu Ala Tyr Ser Leu Ile Ile ~J i 5 10 15 ACT ATA GAA

Arg Pro Arg Glu Asn Glu Tyr Lys Leu Thr Asn Leu Asp Thr Ile Glu jU

AAT GAA TTA

Tyr Asn Lys Leu Thr Thr Asn Asn Asn Lys Tyr Leu Gln Asn Glu Leu ~j AAA AAA CTA AAT GAA TCA ATT GAT ATG AAT AAA TAT AAA 192 GTT TTT ACT

Lys Lys Leu Asn Glu Ser Ile Asp Met Asn Lys Tyr Lys Val Phe Thr AAT CTA AAA

(>()Ser Ser Arg Asn Arg Ala Leu Ser Lys Lys Asp Ile Leu Asn Leu Lys AAT ACA AAT

Glu Val Ile Leu Ile Lys Asn Ser Ser Pro Val Glu Lys Asn Thr Asn ()~ 85 90 95 Leu His Phe Val Trp Ile Gly Gly Glu Val Ser Asp Ile Ala Leu Glu AAA GCT ATT GCA AAT
GAA ATT
AAA

Tyr IleLysGlnTrp AlaAspIleAsn AlaGluTyr Ile LysLeu Asn AAA

Trp TyrAspSerGlu AlaPheLeuVal AsnThrLeu Lys AlaIle Lys GAG

' 10 Val GluSerSerThr ThrGluAlaLeu GlnLeuLeu Glu GluIle Glu AAA

Gln AsnProGlnPhe AspAsnMetLys PheTyrLys Arg MetGlu Lys TTT ATATT,TGATAGA CAAAAAAGGTTT ATAAATTAT AAA TCTCAA 576 TAT

Phe IleTyrAspArg GlnLysArgPhe IleAsnTyr Lys SerGln Tyr ATA

Ile AsnLysProThr ValProThrIle AspAspIle Lys SerHis Ile GAA

Leu ValSerGluTyr AsnArgAspGlu ThrValLeu Ser 'ryrArg Glu ~10 215 220 ?() Thr Asn Ser Leu Arg Lys Ile Asn Ser Asn His Gly Ile Asp Ile Arg Ala Asn Ser Leu Phe Thr Glu Gln Glu Leu Leu Asn Ile Tyr Ser Gln Glu Leu Leu Asn Arg Gly Asn Leu Ala Ala Ala Ser Asp Ile Val Arg ~lI) '."TA TTA GCC CTA AAA AAT TTT GGC GGA GTA TAT TTA GAT GTT GAT ATG 864 Leu Leu Ala Leu Lys Asn Phe Gly Gly Val Tyr Leu Asp Val Asp Met Leu Pro Gly Ile His Ser Asp Leu Phe Lys Thr Ile Ser Arg Pro Ser Ser Ile Gly Leu Asp Arg Trp Glu Met Ile Lys Leu Glu Ala Ile Met Lys Tyr Lys Lys Tyr Ile Asn Asn Tyr Thr Ser Glu Asn Phe Asp Lys J? 325 330 335 Leu Asp Gln Gln Leu Lys Asp Asri Phe Lys Leu Ile Ile Glu Ser Lys O) Ser Glu Lys Ser Glu Ile Phe Ser Lys Leu Glu Asn Leu Asn Val Ser Asp Leu Glu Ile Lys Ile Ala Phe Ala Leu Gly Ser Val Ile Asn Gln _ 771 _ Ala Leu Ile Ser Lys Gln Gly Ser Tyr Leu Thr Asn Leu Val Ile Glu Gln Val Lys Asn Arg Tyr Gln Phe Leu Asn Gln His Leu Asn Pro Ala 1() Ile Glu Ser Asp Asn Asn Phe Thr Asp Thr Thr Lys Ile Phe His Asp Ser Leu Phe Asn Ser Ala Thr Ala Glu Asn Ser Met Phe Leu Thr Lys Ile Ala Pro Tyr Leu Gln Val Gly Phe Met Pro Glu Ala Arg Ser Thr Ile Ser Leu Ser Gly Pro Gly Ala Tyr Ala Ser Ala Tyr Tyr Asp Phe ATA T,AT TTA CAA GAA AAT ACT ATA GAA AAA ACT TTA AAA GCA TCA GAT 1488 Ile Asn Leu Gln Glu Asn Thr Ile Glu Lys Thr Leu Lys Ala Ser Asp Leu Ile Glu Phe Lys Phe Pro Glu Asn Asn Leu Ser Gln Leu Thr Glu Gln Glu Ile Asn Ser Leu Trp Ser Phe Asp Gln Ala Ser Ala Lys Tyr iJ 515 520 525 Gln Phe Glu Lys Tyr Val Arg Asp Tyr Thr Gly Gly Ser Leu Ser Glu fit) Asp Asn Gly Val Asp Phe Asn Lys Asn Thr Ala Leu Asp Lys Asn Tyr Leu Leu Asn Asn Lys Ile Pro Ser Asn Asn Val Glu Glu Ala Gly Ser ~() Lys Asn Tyr Val His Tyr Ile Ile Gln Leu Gln Gly Asp Asp Ile Ser Tyr Glu Ala Thr Cys Asn Leu Phe Ser Lys Asn Pro Lys Ann Ser Ile ~J 595 600 605 Ile Ile Gln Arg Asn Met Asn Glu Ser Ala Lys Ser Tyr Phe Leu Ser GO
GAT GAT GGA TCT TTA GAA TTA AAT AGG ATA
GAA ATT AAA TAT CCT
GAA

Asp Asp Gly SerIleLeu Glu Leu Asn Arg Ile Glu Glu Lys Tyr Pro AAT ACC TTT CAT

Arg Leu Lys LysGluLys Val Lys Val Ile Gly Gly Asn Thr Phe His * rE4 Lys Asp Glu Phe Asn Thr Ser Glu Phe Ala Arg Leu Ser Val Asp Ser Leu Ser Asn Glu Ile Ser Ser Phe Leu Asp Thr Ile Lys Leu Asp Ile Ser Pro Lys Asn Val Glu Val Asn Leu Leu Gly Cys Asn Met Phe Ser Tyr Asp Phe Asn Val Glu Glu Thr Tyr Pro Gly Lys Leu Leu Leu Ser Ile Met Asp Lys Ile Thr Ser Thr Leu Pro Asp Val Asn Lys Asn Ser ~ () Ile Thr Ile Gly Ala Asn Gln Tyr Glu Val Arg Ile Asn Ser Glu Gly ~J AGA AAAGAACTT CTGGCTCACTCA ATAAATAAA GAA 2304 GGT GAA
AAA
TGG

Arg LysGluLeu LeuAlaHisSerGly TrpI1'eAsnLyeGlu Glu Lys GAA

i0 Ala IleMetSer AspLeuSerSerLys TyrIlePhePheAsp Ser Glu AAG

Ile AspAsnLys LeuLysAlaLysSer AsnIleProGlyLeu Ai.a Lys iJ 785 790 795 8U0 TTA

Ser IleSerGlu AspIleLysThrLeu LeuAspAlaSerVal Ser Leu CTT

Pro AspThrLys PheIleLeuAsnAsn LysLeuAsnIleGlu Ser Leu TCT nTTGGGGAT TACATTTATTATGAA TTAGAGCCTGTTAAA AAT 2544 AAA

5er IleGlyAsp TyrIleTyrTyrGlu LeuGluProValLys Asn Lye nTA ATTCACAAT TCTATAGATGATTTA GATGAGTTCAATCTA CTT 2592 ATA

?(1 Ile IleHisAsn SerIleAspAspLeu AspGluPheAsnLeu Leu Ile TTA

Glu AsnValSer AspGluLeuTyrGlu LysLysLeuAsnAsn Leu Leu GAT

Asp GluLysTyr LeuIleSerPheGlu IleSerLysAsnAsn Ser Asp G(1 AGT

Thr TyrSerVal ArgPheIleAsnLys AsnGlyGluSerVal Tyr Ser H? GTA GAAACAGAA AAAGAAATTTTTTCA TATAGCGAACATATT ACA 2784 AAA

Val GluThrGlu LysGluIlePheSer TyrSerGluHisIle Thr Lys _ '77 j _ GAA ACT AGT ATT GTT
ATA ACA AAT

Lys Glu IleSer Ile Lys Asn IleIle Asp Gly Thr Ser Thr Val Asn GAT TCT GTT

Asn Leu LeuAspAsnIle Gln Leu HisThr Gln AsnThr Asp Ser Val TCA GAT AGT

lU Leu Asn AlaAlaPhePhe Ile Gln LeuIle Tyr SerAsn Ser Asp Ser ACC AAG CAA

Lys Asp ValLeuAsnAsp Leu Ser SerVal Val LeuTyr Thr Lys Gln jj 980 985 990 AAT TAT TCT

Ala Gln LeuPheSerThr Gly Leu ThrIle Asp IleGln Asn Tyr Ser GTA ACT AAT

Leu Val AsnLeuZleSer Asn Ala AsnAsp Ile ValLeu Val Thr Asn ATT ACT TTA

Pro Thr IleThrGluGly Ile Pro ValSer Ile AspGly Ile Thr Leu GAA GAC CAT

iU Ile Asn LeuGlyAlaAla Ile Lys LeuLeu Glu AspPro Glu Asp His AAG GTT GCA

Leu Leu LysLysGluLeu Glu Ala ValGly Leu IleAsn Lys Val Ala j1 1060 1065 1070 GTA ATT GGA

Met Ser LeuSerIleAla Ala Thr AlaSer Val IleGly Val Ile Gly CCT GGT TCT

Ala Glu ValThrIlePhe Leu Leu IleAla Ile AlaGly Pro Gly Ser TTA CAT AAG

lle Pro SerLeuValAsn Asn Glu IleLeu App AlaThr Leu His Lys TTG TCT AAA

J() Ser Val ValAsnTyrPhe Asn His SerGlu Lys TyrGly Leu Ser Lys ACA GAT CCT GAT
GAT
AAA
ATT

Pro Leu LysThrGluAsp Asp Lys LeuVal Ile AspLeu Ile Pro Asp GAA GAT ATA
TTT AAA
AAT CTA
AAT

Val Ile Ser IleAsp Phe Asn AsnSer Lys GlyThr Glu Asn Ile Leu O() TTA ATG GGT
GAG
GGG
GGA
TCA
GGA
CAC
ACA
GTG

Cys Ann Ile Ala Gly Thr Leu Met His Gly Glu Thr Gly Val Gly Ser r C)> AAT ATA TTT ATT 3600 GAT TTC CCT
CAC TCA
TCT
CCA
TCT
ATA
AGT
TCT
CAT

Rsn Asp Phe Ile a Ile His Phe Pro Ser Ser Pro Ser Ile Ser Ser His Ser Leu 5er Lle Tyr Ser Ala Ile Gly Ile Glu Thr Glu Asn Leu Asp Phe Ser Lys Lys Ile Met Met Leu Pro Asn Ala Pro Ser Arg Val Phe lU Trp Trp Glu Thr Gly Ala Val Pro Gly Leu Arg Ser Leu Glu Asn Asp Gly Thr Arg Leu Leu Asp Ser Ile Arg Asp Leu Tyr Pro Gly Lys Phe ~J 1250 1255 1260 ?() Tyr Trp Arg Phe Tyr Ala Phe Phe Asp Tyr Ala Ile Thr Thr Leu Lys Pro Val Tyr Glu Asp Thr Asn Ile Lys Ile Lys Leu Asp Lys Asp Thr ~J AGA AAC TTC ATA ATG CCA ACT ATA ACT ACT AAC GAA ATT AGA AAC AAA 3936 Arg Asn Phe Ile Met Pro Thr Ile Thr Thr Asn Glu Ile Arg Asn Lys i0 Leu Ser Tyr Ser Phe Asp Gly Ala Gly Gly Thr Tyr Ser Leu Leu Leu Ser Ser '1'yr Pro Ile Ser Thr Asn Ile Asn Leu Ser Lye Asp Asp Leu ~J 1330 1335 1340 Trp Ile Phe Asn Ile Asp Asn Glu Val Arg Glu Ile Ser Ile Glu Asn 4t) Gly Thr Ile Lys Lys Gly Lys Leu Ile Lys Asp Val Leu Ser Lys Ile nsp Ile Asn Lys Asn Lys Leu IIe Ile Gly Asn Gln Thr Ile Asp Phe J(1 Ser Gly Asp Ile Asp Asn Lys Asp Arg Tyr Ile Phe Leu Thr Cys Glu Leu Asp Asp Lys Ile Ser Leu Ile Ile Glu Ile Asn Leu Val Ala Lys ~)() Ser Tyr Ser Leu Leu Leu Ser Gly Asp Lys Asn Tyr Leu Ile Ser Asn TTA TCT AAT ACT ATT GAG AAA ATC AAT ACT TTA GGC CTA CAT AGT AF,A 4368 Leu Ser Asn Thr Ile Glu Lys Ile Asn Thr Leu Gly Leu App Ser Lys WO 98108540 PCTlUS97115394 Asn Ile Ala Tyr Asn Tyr Thr ASp Glu Ser Asn Asn Lys Tyr Phe Gly Ala Ile Ser Lys Thr Ser Gln Lys Ser Ile Ile His Tyr Lys Lys Asp lI) Ser Lys Asn Ile Leu Glu Phe Tyr Asn Asp Ser Thr Leu Glu Phe Asn AGT AAA GlIT TTT ATT GCT GAA GAT 11TA AAT GTA TTT ATG AAA GAT GAT 4560 Ser Lys F~sp Phe Ile Ala Glu Asp Ile Asn Val Phe Met Lys Asp Asp ?t) F~TT AAT ACT ATA ACA GGA AAA TAC TAT GTT GAT AAT AAT ACT GAT AAA 4608 lle Asn 'I'hr Ile Thr Gly Lys T'yr Tyr Val Asp Asn Asn Thr Asp Lys Ser Ile Asp Phe Ser Ile Ser Leu Val Ser Lys Asn Gln Val Lys Val AAT

Asn GlyL.euTyrLeuAsn GluSerValTyrSer SerTyrLeuAspPhe i(! '~JalLysAsnSerAspGly HisHisAsnThrSer AsriPheMatAsnLeu Phe LeuAspAsnIlc:Ser PheTrpLysLeuPhe GlyPheGluAsnIle i~ 1585 1590 1595 1600 -~( I

Asn Phe Val Ile Asp Lys Tyr Phe Thr Leu Val Gly Lys Thr Ann Leu Ciy Tyr Val Glu Phe Ile Cys Asp Asn Asn Lys Asri Ile Asp Ile Tyr TGG AAA
AAA AGC
ACA

Phe GlyGlu Lys ThrSerSerSer SerThrIlePheSer Gly Trp Lys AAT ATA

~() Asn GlyArg Val ValValGluPro TyrAsnProAspThr Gly Asn Ile TCT TCC

Glu AspIle Thr SerLeuAspPhe TyrGluProLeuTyr Gly Ser Ser TAT ATA

IIe AspArg Ile AsnLysValLeu AlaProhipLeuTyr Thr Tyr Ile T~GT TTAATA ATT AATACCAATThT TCAAATGAGThCTAC CCT 5136 AAT TAT

Ser LeuIle Ile AsnThrAsnTyr SerAsnGluTyrTyr Pro Asn Tyr 1700 1705 1710 r GTT TTC

Glu IleIle Leu AsnProAsnThr HisLysLysValAsn Ile Val Phe Asn Leu Asp Ser Ser Ser Phe Glu Tyr Lys Trp Ser Thr GIu Gly Ser Asp Phe Ile Leu Val Arg Tyr Leu Glu Glu Ser Asn Lys Lys Ile Leu Gln Lys Ile Arg Ile Lys Gly Ile Leu Ser Asn Thr Gln Ser Phe Asn Lys Met Ser Ile Asp Phe Lys Asp Ile Lys Lys Leu Ser Leu Gly Tyr '?0 Ile Met Ser Asn Phe Lys Ser Phe Asn Ser Glu Asn Glu Leu Asp Arg Asp His Leu Gly Phe Lys Ile Ile Asp Asn Lys Thr Tyr Tyr T;~r Asp ~J GAA GAT AGT AAA TTA GTT AAA GGA TTA ATC AAT ATA AAT AAT TCA TTA 5520 Flu Asp Ser Lys Leu Val Lys Gly Leu Ile Asn Ile Asn Asn Ser Leu iU Phe Tyr Phe Asp Pro Ile Glu Phe Asn Leu Val Thr Gly Trp Gln Thr Ile Asn Gly Lys Lys Tyr Tyr Phe Asp Ile Asn Thr Gly Ala Ala Leu Thr Ser Tyr Lys Ile Ile Asn Gly Lys His Phe Tyr Phe Asn Asn Asp .1(1 Gly Val Met Gln Leu Gly Val Phe Lys Gly Pro Asp Gly Phe C~lu Tyr TTT ~;CA CCT CCC AAT ACT CAA AF,T AAT AAC ATA GAA GGT CT.G GCT ATA 5760 Phe Ala Pro Ala Asn Thr Gln Asn Asn Asn Ile Glu Gly Gln AIa ile O) Val Tyr Gln Ser Lys Phe Leu Thr Leu Asn Gly Lys Lys Tyr TJr Phe Asp Asn Asn Ser Lys Ala Val Thr Gly Trp Arg Ile Ile Asn Asn Glu Lys Tyr Tyr Phe Asn Pro Asn Asn Ala Ile Ala Ala Val Gly Leu Gln G(!

Val Ile Asp Asn Asn Lys Tyr Tyr Phe Asn Pro Asp Thr Ala Ile Ile Ser Lys Gly Trp Gln Thr Val Asn Gly Ser Arg Tyr Tyr Phe Asp Thr -2?7_ ACC TAT CAC
GCT AAA
ATT ACT
GCC ATT
TTT

Asp Ile Asn Gly IleAsp GlyLys Thr Ala Tyr His Ala Phe Lys Thr GAT ATA

Phe TyrPhe AspSer Cys ValVal Lys GlyVal PheSerThr Asp Ile TAT AAT

I()Ser AsnGly PheGlu Phe AlaPro Ala ThrTyr AsnAsnAsn Tyr Asn ATA GAAGC~TCAGGCT GTT TATCAA AGT TTCTTA ACTTTGAAT' 6192 ATA AAA

ile GluGly GlnAla Val TyrGln Ser PheLeu ThrLeuAsn Ile Lys C~GT AAAAAA TATTAC GAT AATAAC TCA GCAGTT ACCGGATTG 6240 TTT AAA

Gly LysLys TyrT'yr Asp AsnAsn Ser AlaVal ThrGlyLeu Phe Lys AAA AAT

Gln ThrIle AspSer Lys 'I'yrTyr Phe ThrAnn ThrAlaGlu Lys Asn CAA AAA

rla AlaThr GlyTrp Thr IleAsp Gly Lys'ryrTyrPheAsn Gln Lye ~,CT AACACT GCTGAA GCT ACTGGA TGG ACTATT GATGGTAAA 6384 GCA CAA

il)Thr AsnThr AlaGlu Ala ThrGl.y Trp ThrIle AspGlyLys Ala Gln ~..~?.AT11TTAC TTTAAT AAC ACTGCT ATA TCAACT GGTTATACA 6 4 3 2 ACT GCT

Lws TvrTvr PheAsn Asn ThrAla Ile SerThr GlyTyrThr Thr Ala ::130 2135 2140 .

ATT AT'rAAT GGTAAA TTT TATTTT AAT GATGGT ATTATGCAG 6480 CAT ACT

Ile lleAsn GlyLys Phe TyrPhe Asn AspGly IleMetGln His Thr F,TA GGAGTG TTTAAA CCT AATGGA TTT TATTTT GCACCTGCT 6528 GGA GAA

lle GlyVal PheLys Pro AsnGly Phe TyrPhe AlaProAla Gly Glu -I~:'1ATACGGAT GCTAAC ATA GAAGGT CAA ATACTT TACCAAAAT 6575 AAC GCT

Asn 'I'hrAsp AlaAsn Ile GluGly Gln IleLeu TyrGlnAsn Asn Ala AAT TAC

~f)Glu PheLeu ThrLeu Gly L~ysLye Tyr PheGly SerAppSer Asn Tyr TGG AAT

Lye AlaVal ThrGly Arg IleIle Asn Lyr>Lys TyrTyrPhe Trp Asn ij 2210 221 5 2220 ATT CTA

Asn ProAsn AsnAla Ala AlaIle His Cy~Thr IleAsnAsn Ile Leu (~l ) AGT CTT AAT
TAT GGA

Asp LysTyr TyrPhe Gly Ile Gln GlyTyrIle Ser Leu Asn Tyr Asp ( ACT ATTGAA AAA 6816 AGA
AAT
AAT
TTC
TAT
TTT
GAT
GCT
AAT
AAT
GAA
TCT

Thr IleGlu Ann Lys Arg Asn Phe Tyr Phe Asp Ala Asn Asn Glu Ser 2260 2265 2270 _ * rE, Met Val Thr Gly Val Phe Lys Gly Pro Asn Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr His Asn Asn Asn Ile Glu Gly Gln Ala Ile Val Tyr I() Gln Asn Lys Phe Leu Thr Leu Asn Gly Lys Lys Tyr Tyr Phe Asp Asn Asp Ser Lys Ala Val Thr Gly Trp Gln Thr Ile Asp Gly Lys Lys Tyr Tyr Phe Ann Leu Asn Thr Ala Glu Ala Ala Thr Gly Trp Gln Thr Ile ?0 Asp Gly Lys Lys Tyr Tyr Phe Asn Leu Asn Thr Ala Glu Ala Ala Thr AAA
AAA

Gly TrpGln ThrlieAspGly LysLysTyr'fyrPheAsn ThrAsnThr >()Phe IleAla SerThrGlyTyr ThrSerIleAsnGlyLys HisPheTyr Phe AsnThr AspGlyIleMet GlnIleGlyValPheLys GlyProAsn Gly PheGlu TyrPheAlaPro AlaAsnThrAspAlaAsn AsnIleGlu -1(1 GGT CTv,GCT ATACTTTACCAA AATAAATTCTTAACTTTG AATGGTAAA 7344 Gly GlnAla IleLeuTyrGln AsnLysPheLeuThrLeu AsnGlyLys AAA TT~':TAC TTTGGTAGTGAC TCAAAAGCAGTTACCGGA CTGCGAACT 7392 L,;rsTurT: PheGlySerAsp SerLy AlaValThrGly LeuArgThr r s J Ile AspGly LysLysTyr'fyrPheAsnThrAsnThrAla ValAlaVal 'fhr GlyTrp GlnThrIleAsn GlyLysLysTyrTyrPhe AsnThrAsn ~J 2485 2490 2495 WI

Thr Ser Ile Ala Ser Thr Gly Tyr Thr Ile Ile Ser Gly Lys His Phe TAT TTT. AAT ACT GAT GGT ATT ATG CAG ATA GGA GTG TTT AAA GGA CCT 7584 Tyr Phe Asn Thr Asp Gly Ile Met Gln Ile Gly Val Phe Lye Gly Pro Asp Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Ile PCTIUS9'7115394 GAA GGT CAA GCT ATA CGT TAT CAA AAT AGA TTC CTA TAT TTA CAT GAC 76$0 Glu Gly Gln Ala Ile Arg Tyr Gln Asn Arg Phe Leu Tyr Leu His Asp Asn Ile T'yr Tyr Phe Gly Asn Asn Ser Lys Ala Ala Thr Gly Trp Val Thr Ile Asp Gly Asn Arg Tyr Tyr Phe Glu Pro Asn Thr Ala Met Gly Ala Asn Gly Tyr Lys Thr Ile Asp Asn Lys Asn Phe 'ryr Phe Arg Asn )j 2595 2600 2605 ?() GGT TTA CCT CAG ATA GGA GTG TTT AAA GGG TCT AAT GGA TTT GAA TAC 7$72 Gly Leu Pro Gln Ile Gly Val Phe Lys Gly Ser Asn Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Ile Glu Gly Gln Ala Ile CcT TAT CAA AAT AGA TTC CTA CAT TTA CTT GGA AAA ATA TAT TAC TTT '7968 Arg '?''; r C~ln Asn Arg Phe Leu fiis heu Leu Gly Lys Ile Tyr Tyr Phe cGT AA': AAT TCA AAA GCA GTT ACT GGA TGG CAA ACT ATT AAT GGT AAA 8016 ;(1 Gly Asn Asn Ser Lys Ala Val Thr Gly Trp Gln Thr Ile Asn Gly Lye GTA TF~T TAC TTT ATG CCT GAT ACT GCT ATG GCT GCA GCT GGT GGA CTT 8064 Val Tyr Tyr Phe Met Pro Asp Thr Ala Met Ala Ala Ala Gly Gly Leu iO 2675 2680 2685 -I~) TTC GAG ATT GAT GGT GTT ATA TAT TTC TTT GGT GTT G7\T GGA GTA AAA 8112 Phe Glu Ile Asp Gly Val Ile Tyr Phe Phe Gly Val Asp Gly Val Lys Ala Pro Gly Ile Tyr Gly ('.: ) INFORMATION FOR SEQ ID N0:6 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2710 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
i _s - Met Ser Leu Ile Ser Lys Glu Glu Leu Ile Lys Leu Ala Tyr Ser Ile Arg Pro Arg Glu Asn Glu Tyr Lye Thr Ile Leu Thr Asn Leu Anp Glu Tyr Asn Lys Leu Thr Thr Asn Asn Asn Glu Asn Ly.s Tyr Leu Gln Leu Lys Lys Leu Asn Glu Ser Ile Asp Val Phe Met Asn Lys 'ryr Lye Thr Ser Ser Arg Asn Arg Ala Leu Ser Asn Leu Lys Lys Asp Ile Leu Lys _ 7 j~ _ WO 98108540 PCTIUS9~I15394 Glu Val Ile Leu Ile Lys Asn Ser Asn Thr Ser Pro Val Glu Lys Asn Leu His Phe Val Trp Ile Gly Gly Glu Val Ser Asp Ile Ala Leu Glu 'I'yr Ile Lys Gln Trp Ala Asp Ile Asn Ala Glu Tyr Asn Ile Lys Leu Trp Tyr Asp Ser Glu Ala Phe Leu Val Asn Thr Leu Lys Lys Ala Ile Val Glu Ser Ser Thr Thr Glu Ala Leu Gln Leu Leu Glu Glu Glu Ile li Gln AsnPro GlnPheAspAsnMetLys PheTyrLysLysArg MetGlu Phe IleTyr AspArgGlnLysArgPhe IleAsnTyrTyrLys SerGln ?() 180 185 190 Ile AsnLys ProThrValProThrIle AspAspIleIleLys SexHip Leu ValSer GluTyrAsnArgAspGlu ThrValLeuGluSer TyrArg Thr AnnSer LeuArgLysIleAsnSer AsnHisGlyIleAsp IleArQ

~25 230 23 5 ~40 i() Ala AsnSer LeuPheThrGluGlnGlu LeuLeuAsnIleTyr SerGln Glu LeuLeu AsnArgGlyAsnLeuAla AlaAlaSerAspIie ValArg iO 260 265 270 Leu LeuAla LeuLysAsnPheGlyGly ValTyrLeuAspVal AgoMet Leu ProGly IleHisSerAspLeuPhe LysThrIleSerArq ProSer ~90 295 300 Ser IleGly LeuAspArgTrpGluMet ileLysLeuGluAla IleMet .~ i ~.'JS't';Lys LysTyrIleAsnAsnTyr ThrSerGluAsnPhe IlspLys r Leu AspGln GlnLeuLysAspAsnPhe LysLeuIleIleGlu SerLys Ser GluLys SerGluIlePheSerLys LeuGluAsnLeuAsn ValSer App LeuGlu IleLysIleAlaPheAla LeuGlySerValIle AsnGln Ala LeuIle SerLysGlnGlySerTyr LeuThrAsnLeuVal IleGlu ()() Gln ValL~rsAsnArgTyrGlnPheLeu AsnGlnHisLeuAsn ProAla _ lle GluSer AspAsnAsnPheThrAsp ThrThrLysIlePhe IsisAsp ~)J 420 425 43U

Ser LeuPhe AsnSerAlaThrAlaGlu AsnSerMetPheLeu ThrLys PC1'IUS97/15394 Ile Ala Pro Tyr Leu Gln Val Gly Phe Met Pro Glu Ala Arg Ser Thr Ile Ser Leu Ser Gly Pro Gly Ala Tyr Ala Ser Ala Tyr Tyr Asp Phe Ile Asn Leu Gln Glu Asn Thr Ile Glu Lys Thr Leu Lys Ala Ser Asp Il) Leu Ile Glu Phe Lys Phe Pro Glu Asn Asn Leu Ser Gln Leu Thr Glu Gln (~lu Ile Rsn Ser Leu Trp Ser Phe Asp Gln Ala Ser Ala Lys Tyr Is Gln PheGlu LysTyrValArg Asp GlyGly SerLeuSerGlu 'I'yr 'I'hr Asp AsnGly ValAspPheAsn LysAsnThrAlaLeu AspLysAsnTyr ?f)545 550 555 560 Leu heuAsn AsnLysIlePro SerAsnAsnValGlu GluAlaGlySer :~ys AsnTyr ValHis'I'yrIle IleGlnLeuGlnGly AspAspIleSer 'I';rrGl.uAla ThrCy~AsnLeu PheSerLysRsnPro LysAsnSerIle !i95 600 605 ;f>

Ile IleGln ArgAsnMetAsn GluSerAlaLysSer '1'yrPheLeuSer :,sp AspGly GluSerIleLeu GluLeuAsnLysTyr ArgIleProGlu 5~5 630 635 640 t,rg LeuLys AsnLysGluLys ValLysValThrPhe lleGlyHipGly ~;:~sAspGlu PheAsn'1'hrSer GluPheAlaArgLeu SerValAspSer ~eu >erAnn GluIleSerSer PheLeuAspThrIle LysLeuAspIle ~;

..-,rYroLv_sAsnVaLGluVal AnnLeuLeuGlyC's Asnhtor.PhPSer 690 695 'l00 Tvr AspPhe AsnVal:~luGlu ThrTyrProGlyLye LeuLeuLeuSer J()706 710 .le MetAsp LysIleT'hrSer ThrLeuProAspVal AsnLysAsnSer W Ile ThrIle GlyAlaAsnGln TyrGluValArgIle AsnSerGluGly Arg LysGlu LeuLeuAlafiisSerGlyLyeTrpIle AsnLysGluGlu Of Ala IleMet SerAspLeu5er SerLysGluTyr!le PhePheAspSer Ile AspAsn LysLeuLysAla LysSerLysAsnIle ProGlyLeuAla ~)J7A5 790 795 800 Ser IleSer GluAspIleLys ThrLeuLeuLeuAsp AlaSerValSer PG"TNS97115394 .Pro Asp Thr Lys Phe Ile Leu Asn Asn Leu Lys Leu Asn Ile Glu Ser Ser Ile Gly Asp Tyr Ile Tyr Tyr Glu Lys Leu Glu Pro Val Lys Asn Ile Ile His Asn Ser Ile Asp Asp Leu Ile Asp Glu Phe Asn Leu Leu IU Glu Asn Val Ser Asp Glu Leu Tyr Glu Leu Lys Lys Leu Asn Asn Leu Asp GluLys TyrLeuIleSerPhe GluAspIleSerLys AsnAsnSer Thr TyrSer ValArgPheIleAsn LysSerAsnGlyGlu SerValTyr Val GluThr GluLysGluIlePhe SerLysTyrSerGlu HisIleThr ?() 915 920 925 Lv GluIle SerThrIleLysAsn SerIleIleThrAsp ValAsnGly s _ 930 935 940 Asn L~uLeu AspAsnIleGlnLeu AspHisThrSerGln ValAsnThr Leu AsnAla AlaPhePheIleGln SerLeuIleAspTyr SerSerAsn i() Lys Asp Val Leu Asn Asp Leu Ser Thr Ser Val Lys Val Gln Leu Tyr Ala GlnLeu PheSerThrGlyLeu AsnThrIleTyrAsp SerIleGln ij 995 1000 1005 Leu ValAsn LeuIleSerAsnAla ValAsnAspThrIle AsnValLeu Pro TrrIle ThrGluGlyIlePro IleValSerThrIle LeuAspGly ile AsnLeu GlyAlaAlaIleLys GluLeuLeuAspGlu HisAspPro :~
i Leu LeuLys LysGluLeuGluAla LysValGlyValLeu AlaIleAsn Met SerLeu SerIleAlaAlaThr ValAlaSerIleVal GlyIleG1y J() 1075 1080 1085 Ala Glu Val Thr Ile Phe Leu Leu Pro Ile Ala Gly Ile Ser Ala Gly Ile Pro Ser Leu Val Asn Asn Glu Leu Ile Leu His Asp Lys Ala Thr Ser Val Val Asn Tyr Phe Asn His Leu Ser Glu Ser Lys Lys Tyr Gly (~() Pro Leu Lys Thr Glu Asp Asp Lys Ile Leu Val Pro Ile Asp Asp Leu Val Ile Ser Glu Ile Asp Phe Asn Asn Asn Ser Ile Lys Leu Gly Thr ()J 1155 1160 1165 Cys Asn Ile Leu Ala Met Glu Gly Gly Ser Gly His Thr Val Thr Gly Asn Ile Asp His Phe Phe Ser Ser Pro Ser Ile Ser 5er His Ile Pro Ser Leu Ser Ile Tyr Ser Ala Ile Gly Ile Glu Thr Glu Asn Leu Asp Phe Ser Lys Lys Ile Met Met Leu Pro Asn Ala Pro Ser Arg Val Phe 1220 1225 1230 _ 1() Trp Trp Glu Thr Gly Ala Val Pro Gly Leu Arg Ser Leu Glu Asn Asp Gly Thr Arg Leu Leu Asp Ser Ile Arg Asp Leu Ty~r Pro Gly i~y~ Phe ~i Tyr Trp Arg Phe Tyr Ala Phe Phe Asp Tyr Ala Ile Thr Thr Leu Lys Pro Val Tyr Glu Asp Thr Asn Ile Lys Ile Lys Leu Asp Lys Asp Thr Arg Asn Phe Ile Met Pro Thr Ile Thr Thr Asn Glu Ile Arg Ann Lys Leu Ser Tyr Ser Phe Asp Gly Ala Gly Gly Thr Tyr Ser Leu Leu Leu 1.315 1320 1325 :~er Ser Tyr Pro Ile Ser Thr Asn Ile Asn Leu Ser Lys Asp Asp Leu _i() Trp Ilu F~he Asn Zle Asp Asn Glu Val Arg Glu Ile Ser Ile Glu Asn Gly 'I'hr Ile Lys Lys Gly Ly:~ Leu Ile Lye Asp Val Leu Ser Lys Ile Asp Ile Asn Lys Asn Lys Leu Ile Ile Gly Asn Gln '1'hr Ile Asp Phe Sez- Vly Asp Ile Asp Asn Lys Asp Arg Tyr Ile Phe Leu 1'hr Cys Glu Leu Asp Asp Lys Ile Ser Leu Ile Ile Glu Ile Asn Leu Val Ala Lys 1410 1~115 1420 .~ 1 S~r T~,~r Ser Leu Leu Leu Ser Gly Asp Lys Asn Tyr LPU Ile Ser Asn Leu Ser Asn Thr Ile Glu Lys Ile Asn Thr Leu Gly Leu Asp Ser Lys ~() 1445 1450 1455 Asn Ile Ala Tyr Asn Ty~r Thr Asp Glu Ser Asn Asn Lys Tyr Phe Gly J~ Ala Ile Ser Lys Thr Ser Gln Lys Ser Ile Ile His Tyr Lys Lys Asp Ser Lys Asn Ile Leu Glu Phe Tyr Asn Asp Ser Thr Leu Glu Phe Asn (~0 Ser Lys A?,~p Phe Ile Ala Glu Asp Ile Asn Val Phe Met Lys Asp Asp Ile Asn Thr Ile Thr Gly Lys Tyr Tyr Val Asp A~n Ann Thr Asp Lys ()J 1525 1530 1535 Ser Ile Asp Phe Ser Ile Ser Leu Val Ser Lys Asn C1n Val Lys Val -?34-* rF3 Asn Gly Leu Tyr Leu Asn Glu Ser Val Tyr Ser Ser Tyr Leu Asp Phe Val Lys Asn Ser Asp Gly His His Asn Thr Ser Asn Phe Met Asn Leu Phe Leu Asp Asn Ile Ser Phe Trp Lys Leu Phe Gly Phe Glu Asn Ile Asn Phe Val Ile Asp Lys Tyr Phe Thr Leu Val Gly Lys Thr Asn Leu Gly Tyr Val Glu Phe Ile Cys Asp Asn Asn Lys Asn Ile Asp Ile Tyr l;
Phe Gly Glu Trp Lys Thr Ser Ser Ser Lys Ser Thr Ile Phe Ser Gly Asn Gly Arg Asn Val Val Val Glu Pro Ile Tyr Asn Pro Asp Thr Gly Glu Asp Ile Ser 'rhr Ser Leu Asp Phe Ser Tyr Glu Pro Leu Tyr Gly Ile Asp Arg Tyr Ile Asn Lys Val Leu Ile Ala Pro Asp Leu Tyr Thr Ser Leu Ile Asn Ile Asn Thr Asn Tyr Tyr Ser Asn Glu Tyr Tyr Pro i() Glu Ile Ile Val Leu Ann Pro Asn Thr Phe His Lys Lys Vai Asn Ile Asn Leu Asp Ser Ser Ser Phe Glu Tyr Lys Trp Ser Thr Glu G.Ly Ser jJ 1730 1735 1740 Asp Phe Ile Leu Val Arg Tyr Leu Glu Glu Ser Asn Ly~ Lys Ile Leu Gln Lys Ile Arg Ile Lys Gly Ile Leu Ser Asn Thr Gln Ser Phe Asn .~ i Lys Met Ser Ile Asp Phe Lys Asp Ile Lys Lys Leu Ser Leu Gly Tyr lle Met Ser Asn Phe Lys Ser Phe Asn Ser Glu Asn Glu Leu Asp Arq Asp tiffsLeuGly PheLysIleIleAspAsn LysThrTyrTyrTyr Asp Glu AspSerLys LeuValLysGlyLeuIle AsnIleAsnAsnSer Leu ~J Phe TyrPheAsp ProIleGluPheAsnLeu ValThrGiyTrpGln Thr Ile AsnGlyLys LysTyrTyrPheAspIle AsnThrGlyAlahla Leu ()() Thr SerTjrrLys IleIleAsnGlyhysHis PheTyrPheAsnAsn Asp Gly ValMetGln LeuGlyValPheLysGly ProAspGlyPheGlu 'I'yr Phe AlaProAla AsnThrGlnAsnAsnAsn IleGluGlyGlnAla Ile 1905 1910 ' 1915 1920 Val Tyr Gln Ser Lys Phe Leu Thr Leu Asn Gly Lys Lys Tyr Tyr Phe Asp Asn Asn Ser Lys Ala Val Thr Gly Trp Arg Ile Ile Asn Asn Glu Lye Tyr T'yr Phe Asn Pro Asn Asn Ala Ile Ala Ala Val Gly Leu Gln I() Val Ile Asp Asn Asn Lys Tyr Tyr Phe Asn Pro Asp Thr Ala Ile Ile Ser LysGly TrpGlnThrVaI AsnGl.ySerArgTyr TyrPheAspThr !i Asp ThrAla IleAlaPheAsn GlyTyrLysThrIle AspGlyLysHis Phe 'TyrPhe AspSerAspCys ValValLysIleGly ValPheSerThr ?() 2020 2025 2030 Ser AsnGly PheGluTyrPhe AlaProAlaAsnThr TyrAsnAsnAsn Ile GluGly GlnAlaIleVal TyrGlnSerLysPhe LeuThrLeuAsn Gly L,y~Lys TyrTyrPheAsp AsnAsnSerLysAla ValThrGlyLeu 2065 2070 2075 %OBO

;() Gln ThrIle AspSerLysLys TyrTyrPheAsnThr AsnThrAlaGlu Ala AlaThr GlyTrpGlnThr IleAspGlyLysLys Tyr'I'yrPheAnn i~ 2100 2105 :'.110 'I'hrA=,nThr AlaGluAlaAla ThrGlyTrpGlnThr IIeAspGl.rLys -l!)I,y~ TyrTyr PheAsnThrAsn ThrAlaIleAlaSer ThrGlyTyrThr '?130 2135 2140 Ile IleAsn GlyLysHisPhe T'yrPheAsnThrAsp GlyIleMe~Gln .~
i lie GlyVal PheLysGlyFro AsnGlyPheGluTyr PheAlaProAJ.a hen Tl:rAsp AlaAsnAsnIle GluGlyGlnAlaIle Leu'I'yrClnAnn Glu PheLeu ThrLeuAsnGly LysLysTyrTyrPhe GlySerAspSer L,y~ AlaVal ThrGlyTrpArg IleIleAsnAsnLys L,ysTyrTyrPhe O) Asn Pro Asn Asn Ala Ile Ala Ala Ile His Leu Cys Thr Ile Asn Asn Asp Lys T'yr Tyr Phe Ser T;~r Asp Gly Ile Leu ~ln Asn Gly Tyr Ile Thr Ile Glu Arg Asn Asn Phe Tyr PhP Asp Ala Asn Asn Glu Ser Lys ()J 2260 2265 4270 Met Val Thr Gly Val Phe Lys Gly Pro Asn Gly Phe Glu Tyr Phe Ala Pro AlaAsnThr HisAsnAsnAsnIle GluGlyGlnAlaIle ValTyr Gln AsnLysPhe LeuThrLeuAsnGly LysLysTyrTyrPhe AspAsn Asp SerLysAla ValThrGlyTrpGln ThrIleAspGlyLys LysTyr 1() Tvr PheAsnLeu AsnThrAlaGluAla AlaThrGlyTrpGln ThrIle Asp Glv~ysLys TyrTyrPheAsnLeu Asn'ThrAlaGluAla AlaThr ~i Gly TrpGlnTh IleAspGlyLysLys TyrTyrPheAsnThr AsnThr r Phe IleAlaSer ThrGlyTyrThrSer IleAsnGlyLysHis PheTyr Phe AsnThrAsp GlyIleMetGlnIle GlyValPheLysGly ProAsn Gly PheGluTyr PheAlaProAlaAsn ThrAspAlaAsnAsn IleGlu !~ly Glnf~laIie LeuT~~rGlnAsnLys PheLeuThrLeuAsn GlyLys i(}

Lys 'TyrTyrPhe GlySerAspSerLys AlaValThrGlyLeu ArgThr Ile AspGlyLye LysTyrTyrPheAsn ThrAsnThrAlaVal AlaVal Thr GlyTrpGln ThrIleAsnGlyLys LysTyrTyrPheAsn ThrAsn 4() '~hr Ser Ile Ala Ser Trr Gly Tyr Thr Ile Ile Ser Gly i~ys His Phe 'ryr Phe l~sn Thr Asp Gly Ile Met Gln Ile Gly Val Phe Lys Gly Pro ~i Asp Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Ile ~53U 2535 2540 Glu Gly Gln Ala Ile Arg Tyr Gln Asn Arg Phe Leu Tyr Leu His Asp J() 2545 2550 2555 2560 Asn Ile Tyr Tyr Phe Gly Asn Asn Ser Lys Ala Ala 'Thr Gly Trp Val >J Thr Ile App Gly Asn Arg Tyr Tyr Phe Glu Pro Asn Thr Ala Met Gly Ala Asn Gly Tyr Lys Thr Ile Asp Asn Lys Asn Phe Tyr Phe Arg Asn ~>() Gly Leu Pro Gln Ile Gly Val Phe Lys Gly Ser Asn Gly Phe Glu Tyr . Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Ile Glu Gly Gln Ala Ile ~~J 2625 2630 2635 2640 Arg Tyr Gln Asn Arg Phe Leu His Leu Leu Gly Lys Ile 1'yr Tyr Phe Gly Asn Asn Ser Lys Ala Val Thr Gly Trp Gln Thr Ile Asn Gly Lys Val Tyr Tyr Phe Met Pro Asp Thr Ala Met Ala Ala Ala Gly Gly Leu Phe Glu Ile Asp Gly Val Ile Tyr Phe Phe Gly Val Asp Gly Val Lys 1() Ala Pro Gly Ile Tyr Gly i:) INFORMATION
FOR SQ
ID N0:7:

(ii SEQUENCE CHARACTERISTICS:

(A> LENGTH: 811 cids amino a (B! TYPE: amino acid (C'! STRANDEDNESS: wn unkno !D) TOPOLOGY: unknown ~() (i:! MOLECULE TYPE: protein (ri) SEQUENCE DESCRIPTION:Q No:7:
~E iD

Ser Tyr Lys Ile Ile Lys HisPhe TyrPheAsnAsnAsp Gly Asn Gly 'Ial Met Cln Leu Gly Lys GlyPro AspGlyPheGluTyr Phe Val Phe i() F.la l'ro Ala Asn Thr Asn AsnIle GluGlyGlnAlaIle Val Gln Asn Tyr Gln Ser Lys Phe Leu AsnGly LysLysTyrTyrPhe Asp Leu Thr Asn Asn Ser Lys Ala Gly TrpArg IleIleAsnAsnGlu Lys Val Thr -1()Tyr Tyr Phe Asn Pro Ala IleAla AlaValGlyLeuGln Val Asn Asn Ile Asp Asn Asn L~:s Tyr T!r Phe Asn Pro Asp Thr Ala Ile Ile Ser .~
i Lys GlyTrpGln ThrValAsnGlySerArg Tyr'I'yrPheAspThr Asp Thr AlaIleAla PheAsnGlyTyrLysThr IleAspGlyLysHis Phe J() 130 135 140 Tyr PheAspSer AspCysValValLysIle GlyValPheSerThr Ser Asn GlyPheGlu TyrPheAlaProAlaAsn ThrTyrAsnAsnAsn Ile Glu GlyGlnAla IleValTyrGlnSerLys PheLeuThrLeuAsn Gly Lys Lys Tyr Tyr Phe Asp Asn Asn Ser Lys Ala Val Thr Gly Leu Gln Thr Ile Asp SHr Lys L.ys Tyr Tyr Phe Asn Thr Asn Thr nla Glu Ala l)1 21U 215 220 Ala Thr Gly 'Trp Gln Thr Ile Asp Gly Lys Lys Tyr Tyr Phe Asn Thr _ '7 j WO ~~~ PCTIUS97115394 Asn Thr Ala Glu Ala Ala Thr Gly Trp Gln Thr Ile Asp Gly Lys Lys Tyr Tyr Phe Asn Thr Asn Thr Ala Ile Ala Ser Thr Gly Tyr Thr Ile ile Asn Gly Lys His Phe Tyr Phe Asn Thr Asp Gly Ile Met Gln Ile lO Gly Val Phe Lys Gly Pro Asn Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Ile Glu Gly Gln Ala Ile Leu Tyr Gln Asn Glu ~i Phe Leu Thr Leu Asn Gly Lys Lys Tyr Tyr Phe Gly Ser Asp Ser Lys Ala Val Thr Gly Trp Arg Ile Ile Asn Asn Lys Lys Tyr 'fyr Phe Asn Pro Asn Asn Ala Ile Ala Ala Ile Hip Leu Cys Thr Ile Asn Asn Asp ~J Lys TyrT.rPhe SerTyrAspGly IleLeuGlnAsnGly'fyrIleThr Ile GiuArgAsn AsnPheTyrPhe AspAlaAsnAnnGluSer LysMet i() Val ThrGiyVal PheLysGlyPro AsnGlyPheGluTyrPhe AlaPro Ala AsnThrHis AsnAsnAsnIle GluGlyGlnAlaIleVal TyrGln sJ 420 425 130 Asn LysPheLeu ThrLeuAsnGly LysLysT~rTyrPheAsp AsnAsp ~C) Ser LysAlaVal ThrGlyTrpGln ThrIleAspGlyLysLy:->'fyrTyr Phe Asn Leu Asn Thr Ala Glu Ala Ala Thr Gly Trp Gln Thr Ile Asp ~i Gly LysLysTyrTyr PheAsnLeuAsnThrAla GluAlaAlaThrGIy Trp GInThrIleAsp GlyLysLysTyrTyrPhe AsnThrAsnThrPhe J() 500 505 510 Ile AlaSerThrGly TyrThrSerIleAsnGly LysHisPheT;rrPhe Asn ThrAspGlyIle MetGlnIleGlyValPhe LysGlyProAsnGly Phe GluTyrPheAla ProAlaAsnThrAspAla AsnAsnIleGluGly ()() Gln AlaIleLeuTyr GlnAsnLysPheLeuThr LeuAsnGiyLysLys _ Tyr TyrPheGlySer AspSerLysAlaValThr GlyLeuArgThrIle ~7~ 580 5$5 590 Asp GlyLysLysTyr TyrPheRsnThrAsnThr AlaValAlaValThr _ '73() PCTlUS97I15394 GIy Trp Gln Thr Ile Asn Gly Lys Lys Tyr Tyr Phe Asn Thr Asn Thr Ser Ile Ala Ser Thr Gly Tyr Thr Ile Ile Ser G1y Lys His Phe Tyr Phe Asn Thr Asp Gly Ile Met Gln Ile Gly Val Phe Lys Gly Pro Asp I() Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr Asp Ala Asn Asn Iie Glu ply Gln Ala Ile Arg Tyr Gln Asn Arg Phe Leu Tyr Leu His Asp Asn j1 Ile Tyr Tyr Phe Gly Asn Asn Ser Lys Ala Ala Thr Gly Trp Val Thr Ile Asp Gly Asn Arg Tyr Tyr Phe Glu Pro Asn Thr Ala Met Gly Ala Asn Gly Tyr Lys Thr Ile Asp Asn Lys Asn Phe Tyr Phe Arg Asn Gly ~J Leu Pro Gln Ile Gly Val Phe Lys Gly Ser Asn Gly Phe Glu 'ryr Phe ,via Pro Ala Asn Thr Asp Ala Asn Asn Ile Glu Gly Gln Ala Ile Arg :() T;~r Gln Asn Arg Phe Leu His Leu Leu Gly Lys Ile Tyr Tyr Phe Gly Asn Asn Ser Lys Ala Val Thr Gly Trp Gln Thr Ile Asn C;ly Lys Val 'I'yr Tyr Phe Met Pro App Thr Ala Met Ala Ala :') INFORMATION FOR SEQ ID NO: B:
(i) SEQUENCE CFIARACTERISTIC~:
(A) LENGTH: 91 amino acids iH) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown !ii) MOLECULE TYPE: protein O) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: B:
Ser Tyr Lys lle Ile Asn Gly Lys His Phe Tyr Phe Ann Ann Asp Gly Val Met Gln Leu Gly Val Phe Lys Gly Pro Asp Gly Phe Glu Tyr Phe Ala Pro Ala Asn Thr Gln Asn Asn Asn Ile Glu Gly Gln Ala Ile Val (~(1 Tyr ~ln Ser Lys Phe Leu Thr Leu Asn Gly Lys Lys Tyr Tyr Phe Asp Asn Asn Ser Lys Ala Val Thr Gly Trp Arg Ile 11~ Asn Asn Glu Lys (~i 65 70 75 8U
Tyr Tyr Phe Asn Pro Asn Asn Ala Ile Ala Ala *rB

(2) INFORMATION FOR SEQ ID N0:9:
(i> SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7101 base pairs i (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) IU
( i:c ) FEATURE
(A1 NAME/KEY: CDS
(B) LOCATION: 1..7098 (ii) SEQUENCE DESCRIPTION: SEQ ID N0:9:

Met Ser Leu Val Asn Arg Lys Gln Leu Glu Lys Met Ala Asn Val Arg Phe Arg Thr Gln Glu Asp Glu Tyr Val Ala Ile Leu Asp Ala Leu Glu Glu Tvr llis Asn Met Ser Glu Asn Thr Val Val Glu Lys Tyr Leu Lys ~() Leu Lys Asp Ile Asn Ser Leu Thr Asp Ile Tyr Ile Asp Thr Tyr Lys Lys Ser Gly Arg Asn Lys Ala Leu Lys Lys Phe Lys Glu Tyr Leu Val ?J 65 70 75 80 Thr Glu Val Leu Glu Leu Lys Asn Asn Asn Leu Thr Pro Val Glu Lys Asn Leu His Phe Val Trp Ile Gly Gly Gln Ile Asn Asp Thr Ala Ile ~J AAT TATATAAAT CAATGGAAAGATGTAAAT AGTGATTATAATGTT AAT 384 Asn TyrIleAsn GlnTrpLysAspValAsn SerAsp'ryrAsnVal Asn GTT TTTTA1'GAT AGTAATGCATTTTTGATA AACACATTGAAAAAA ACT 432 JU Val PheTyrAsp SerAsnAlaPheLeuIle AsnThrLeuLysLys Thr Val ValGluSer AlaIleAsnAspThrLeu GluSerPheArgGlu Asn Leu AsnAspPro ArgPheAspTyrAsnLys PhePheArgLysArg Met V() Glu IleIleTyr AspLysGlnLysAsnPhe IleAsnTyrTyrLys Ala Gln Arg Glu Glu Asn Pro Glu Leu Ile Ile Asp Asp Ile Val Lys Thr _ ~4 j Tyr Leu Ser Asn Glu Tyr Ser Lys Glu Ile Asp Glu Leu Asn Thr Tyr Ile Glu Glu Ser Leu Asn Lys Ile Thr Gln Asn Ser Gly Asn Asp Val I() Arg Asn Phe Glu Glu Phe Lys Asn Gly Glu Ser Phe Asn Leu Tyr Glu Gln Glu Leu Val Glu Arg Trp Asn Leu Ala Ala Ala Ser Asp Ile Leu Arg iie Ser Ala Leu Lys Glu Ile Gly Gly Met Tyr Leu Asp Val Asp Met Leu Pro Gly Ile Gln Pro Asp Leu Phe Glu Ser Ile Glu Lys Pro AGT T:.'11GTA ACAGTGGATTTT TGGGAA ACA TTA GAA ATA 960 ATG AAG GCT

Ser Se:-Val ThrValAspPhe TrpGluMet'PhrLysLeu GluAlaIle ATG F,FiATAC AAAGAATATATA CCAGAATATACCTCAGAA CATTTTGAC 1008 i()Met L.~sTyr LysGluTyrIle ProGluTyrThrSerGlu HisPheAsp ATG T.TF;GAC GAAGAAGTTCAA AGTAGTTTTGAATCTGTT CTAGCTTCT 1056 filetLeuAsp GluGluValGln SerSerPheGluSerVal LeuAlaSer AAG TChGAT AAATCAGAAATA TTCTCATCACTTGGTGAT ATGGAGGCA 1104 Lys 5erAsp LysSerGluIle PheSerSerLeuGlyAsp MetGluAla -~( ) Ser ProLeu GluValLysIle AlaPheAsnSerLysGly IleIleAsn Gln GlrLeu IleSerValLys AspSerTyrCysSerAsn LeuTleVal ~()Lys GlnIle GluAsnArgTyr LysIleLeuAsnAsnSer LeuAsnPro Ala IleSer GluAspAsnAsp PheAsnThrThrThrAsn ThrPheIle ~J 420 425 430 6() Asp Ser Ile Met Ala Glu Ala Asn Ala Asp Asn Gly Arg Phe Met Met Glu Leu Gly Lys Tyr Leu Arg Val Gly Phe Phe Pro Asp Val Lys Thr Thr Ile Asn Leu Ser Gly Pro Glu Ala Tyr Ala Ala Ala Tyr Gln Asp WO 98I~540 PCT/US97115394 Leu Leu Met Phe Lys Glu Gly Ser Met Asn Ile His Leu Ile Glu Ala Asp Leu Arg Asn Phe Glu Ile Ser Lys Thr Asn Ile Ser Gln Ser Thr Glu Gln Glu Met Ala Ser Leu Trp Ser Phe Asp Asp Ala Arg Ala Lys Ala Gln Phe Glu Glu Tyr Lys Arg Asn Tyr Phe GIu Gly Ser Leu Gly ?U

Glu Asp Asp Asn Leu Asp Phe Ser Gln Asn Ile Val Val Asp Lys Glu Tyr Leu Leu Giu Lys Ile Ser Ser Leu Ala Arg Ser Ser Glu Arg Gly Tyr Ile His Tyr Ile Val Gln Leu Gln Gly Asp Lys Ile Ser Tyr Glu i() Ala Ala Cys Asn Leu Phe Ala Lys Thr Pro Tyr Asp Ser Val Leu Phe Gln Lys Asn Ile Glu Asp Ser Glu Ile Ala Tyr Tyr Tyr Asn Pro Gly >> 610 615 620 -)~) GAT GGT GAA ATA CAA GAA ATA GAC AAG TAT AAA F,TT CCA AGT ATA ATT 1920 Asp Gly Glu Ile Gln Glu Ile Asp Lys Tyr Lys Ile Pro Ser Ile Ile TCT GAT AGA CCT AF.G ATT AAA TTA ACA TTT ATT GGT CAT GGT AAA GAT 1968 Ser Asp Arg Pro Lys Ile Lys Leu Thr Phe Ile Gly His Gly Lys Asp -)~ GAA TTT AAT ACT GAT ATA TTT GCA GGT TTT GAT GTA GAT TCA TTA TCC 2016 Glu Phe Asn Thr Asp Ile Phe Ala Gly Phe Asp Val App Ser Leu Ser Thr Glu Ile Glu Ala Ala Ile Asp Leu Ala Lys Glu Asp Ile Ser Pro Lys Ser Ile Glu Ile Asn Leu Leu Gly Cys Asn Met Phe Ser Tyr Ser O() I1e Asn Val Glu Glu Thr Tyr Pro Gly Lys Leu Leu Leu Lys Val Lys Asp Lys Ile Ser Glu Leu Met Pro Ser Ile Ser Gln Asp Ser ile Ile Val Ser Ala Asn Gln Tyr Glu Val Arg Ile Asn Ser Glu Gly Arg Arg _ ?4~ _ ~,p ggipg~p PCT/US97115394 Glu Leu Leu Asp His Ser Gly Glu Trp Ile Asn Lys Glu Glu Ser Ile AAG AAA
GAA

Ile LysAspIle SerSerLysGlu TyrIleSerPheAsnPro LyeGlu Asn LysIleThr ValLysSerLye AsnLeuProGluLeuSer ThrLeu Leu GlnGluIle ArgAsnAsnSer AsnSerSerAspIleGlu LeuGlu Glu LysValMet LeuThrGluCys GluIleAsnValIleSer AsnIle '?

Asp ThrGlnIle ValGluGluArg IleGluGluAlaLysAsn LeuThr Ser AspSerIle Asn'I'yrIleLys AspGluPheLyeLeuIle GluSer ?t) Ile SerAspAla LeuCysAspLeu LysGlnGlnAsnGluLeu GluAsp Ser HisPheIle SerPheGluAsp IleSerGluThrAspGlu GlyPhe Ser IleArgPhe IleAsnLysGlu ThrGlyGluSerIlePhe ValGlu ~~) Thr GluLysThr IlePheSerGlu TyrAlaAsnHisIleThr GluGlu ATT TCTAAGATA AAAGGTACTATA TTTGATACTGTAAATGGT AAGTTF. 2832 Ile SerLysIle LysGlyThrIle PheAspThrValAsnGIy LysLeu Val LysLysVal AsnLeuAspThr ThrHisGluValAsnThr LeuAsn Ala AlaPhePhe IleGlnSerLeu IleGluTyrAsnSerSer LysGlu Ser LeuSerAsn LeuSerValAla MetLysValGlnValTyr AlaGln O) Leu PheSerThr GlyLeuAsn1'hrIleThrAspAlaAlaLys ValVal PC1'lUS9?!15394 Glu Leu Val Ser Thr Ala Leu Asp Glu Thr I1e Asp Leu Leu Pro Thr Leu Ser Glu Gly Leu Pro Ile IIe Ala Thr Ile Ile Asp Gly Val Ser Leu Gly Ala Ala Ile Lys Glu Leu Ser Glu Thr Ser Asp Pro Leu Leu _ AGA CAA GAA ATA GAA GCT AAG ATA GGT ATA ATG GCA GTA AAT TTA ACA 3216 Arg Gln Glu Ile Glu Ala Lys Ile Gly Ile Met Ala Val Asn Leu Thr ~u 'I'hr Ala Thr Thr Ala Ile Ile Thr Ser Ser Leu Gly Ile Ala Ser Gly Phe Ser IIe Leu Leu Val Pro Leu Ala Gly lle Ser Ala Gly Ile Pro ~J AGC TTA GTA AAC AAT GAA CTT GTA CTT CGA GAT AAG GCA ACA AAG CTT 3360 Ser Leu Val Asn Asn Glu Leu Val Leu Arg Asp Lys Ala Thr Lys Val ;!) Val Asp Tyr Phe Lys His Val Ser Leu Val Glu Thr Glu Gly Val Phe Thr Leu Leu Asp Asp Lys Ile Met Met Pro Gln Asp Asp Leu Val IIe ~() Ser Glu Ile Asp Phe Asn Asn Asn Ser Ile Val Leu Gly Lys Cys Glu Ile T'rp Arg Met Glu Gly Gly Ser Gly His Thr Val Thr Asp Asp Ile GAT Ce'1C TTC TTT TCA GCA CCA TCA ATA ACA TAT AGA GAG CCA CAC TTA 3600 Asp His Phe hhe Ser Ala Pro Ser Ile Thr Tyr Arg Glu I~ro Hi~ Leu TCT ATA TAT GAC GTA TTG GAA GTA CAA AAA GAA GAA CTT GA'T TTG TCA 3648 Ser Ile Tyr Asp Val Leu Glu Val Gln Lys Glu Glu Leu Asp Leu Ser Lys Asp Leu Met Val Leu Pro Asn Ala Pro Asn Arg Val Phe Ala Trp ~J 1220 1225 1230 O) Glu Thr Gly Trp Thr Pro Gly Leu Arg Ser Leu Glu Asn Asp Gly Thr Lys Leu Leu Asp Arg Ile Arg Asp Asn Tyr Glu Gly Glu Phe Tyr Trp Arg Tyr Phe Ala Phe Ile Ala Asp Ala Leu Ile Thr Thr Leu Lys Pro Arg Tyr Glu Asp Thr Asn Ile Arg Ile Asn Leu Asp Ser A3n Thr Arg ' 1285 1290 1295 Ser Phe Ile Val Pro Ile Ile Thr Thr Glu Tyr Ile Arg Glu Lys Leu 1() Ser Tyr Ser Phe Tyr Gly Ser Gly Gly Thr Tyr Ala Leu Ser Leu Ser Gln Tyr Asn Met Gly Ile Asn Ile Glu Leu Ser Glu Ser Asp Val Trp lITT ATA GAT GTT GAT AAT GTT GTG AGA GAT GTA ACT ATA GAA 'fCT GAT 4080 Ile Ile Asp Val Asp Asn Val Val Arg Asp Val Thr Ile Glu Ser Asp Lys Ile Lys Lys Gly Asp Leu Ile Glu Gly Ile Leu Ser Thr Leu Ser Ile Glu Glu Asn Lys Ile Ile Leu Asn Ser His Glu Ile Asn Phe Ser ?() Gly Glu Val Asn Gly Ser Asn Gly Phe Val Ser Leu 'fhr Phe Ser Ile I,eu Glu Gly Ile Asn Ala Ile Ile Glu Val Asp Leu Leu Ser Lys Ser ~4() '."AT AAA TTA CTT ATT TCT GGC GAA TTA AAA ATA TTG ATG TTA AAT TCA 4320 'fyr Lys Leu Leu Ile Ser Gly Giu Leu Lys Ile Leu Met Leu Asn Ser F,AT CAT ATT CAA CAG AAA ATA GAT TAT ATA GGA TTC AAT AGC GAA TTA 4368 Asn His Ile Gin Gln Lys Ile Asp Tyr Ile Gly Phe Ann Ser Glu Leu -)~ ChG AAA AAT T.TA CCA TAT AGC TTT GTA GAT AGT GAA GGA AAA GAG AAT 4416 Gln Lys Ann ile Pro Tyr Ser Phe Val Asp Ser Glu Gly Lye Glu Asn GGT TT'f 11TT AAT GGT TCA ACA AAA GAA GGT TTA TTT GTA TCT GAA TTA 4464 J() Cly Phe Ile Asn Gly Ser Thr Lys Glu Gly Leu Phe Val Ser Glu Leu Pro Asp Val Val Leu Ile Ser Lys Val Tyr Met Asp Asp Ser Lys Pro 'fCA TTT GGA TAT TAT AGT AAT AAT TTG AAA GAT GTC AAA GTT ATA ACT 4560 Ser Plue Gly Tyr Tyr Ser Asn Asn Leu Lys Asp Val Lys Val Ile Thr ATA ACA AAG

Lys Asp AsnVal Asn Leu Vly Tyr Tyr Leu Asp Asp Ile Ile Thr Lys TTG CTA ACT

Lys Ile SerLeu Ser Thr Gln Asp Glu Lys Ile Lys Leu Leu Leu Thr WO 98108540 PCT/US97l15394 Asn Ser Val His Leu Asp Glu Ser Gly Val Ala Glu Ile Leu Lys Phe Met Asn Arg Lys Gly Asn Thr Asn Thr Ser Asp Ser Leu Met Ser Phe IO Leu Glu Ser Met Asn Ile Lys Ser Ile Phe Val Asn Phe Leu Gln Ser Asn Ile Lys Phe Ile Leu Asp Ala Asn Phe Ile Ile Ser Gly Thr Thr Ser Ile Gly Gln Phe Glu Phe Ile Cys Asp Glu Asn Asp Asn Ile Gln Pro Tyr Phe Ile Lys Phe Asn Thr Leu Glu Thr Asn Tyr Thr Leu Tyr ~J GTA GGA AAT AGA CAA AAT ATG ATA GTG GAA CCA AAT TAT GAT TTA GAT 4992 Val Gly Asn Arg Gln Asn Met Ile Val Glu Pro Asn Tyr Asp Leu Asp iU Asp Ser Gly Asp Ile Ser Ser Thr Val Ile Asn Phe Ser Gln Lys Tyr Leu Tyr Gly Ile Asp Ser Cys Val Asn Lys Val Val Ile Ser Pro Asn ~() Ile 'Tyr Thr Asp Glu Ile Asn Ile Thr Pro Val Tyr Glu Thr Asn Asn 1700 1?05 1710 Thr Tyr Pro Glu Val Ile Val Leu Asp Ala Asn Tyr Ile Asn Glu Lys ATA AATGTT ATCAATGATCTATCT ATACGATAT TGG AGTrIAT 5232 AAT GTA

Ile AsnValAsn IleAsnAspLeuSer IleArgTyr Trp SerAsn Val GAA

Asp GlyAsnAsp PheIleLeuMetSer ThrSerGlu Asn LysVal Glu GAT

Ser GlnValLys IleArgPheValAsn ValPheLys Lys ThrLeu Asp GAT

Ala AsnLysLeu SerPheAsnPheSer AspLysGln Val ProVal Asp hU

Ser Glu Ile Ile Leu Ser Phe Thr Pro Ser Tyr Tyr Glu Asp Gly Leu Ile Gly Tyr Asp Leu Gly Leu Val Ser Leu Tyr Asn Glu Lys Phe Tyr PCTlUS97115394 Ile Asn Asn Phe Gly Met Met Val Ser Gly Leu Ile Tyr Ile Asn Asp Ser Leu Tyr Tyr Phe Lys Pro Pro Val Asn Asn Leu Ile Thr Gly Phe 1f) Val Thr Val Gly Asp Asp Lys Tyr Tyr Phe Asn Pro Ile Asn Gly Gly Ala Ala Ser Ile Gly Glu Thr Ile Ile Asp Asp Lys Asn Tyr Tyr Phe Asn Gln Ser Gly Val Leu Gln Thr Gly Val Phe Ser Thr Glu Asp Gly Phe Lys Tyr Phe Ala Pro Ala Asn Thr Leu Asp Glu Asn Leu Glu Gly Glu Ala Ile Asp Phe Thr Gly Lys Leu Ile Ile Asp Glu Asn Ile Tyr :AT TTT CAT GAT AAT TAT AGA GGA GCT GTA GAA TGG AAA GAA TTA GAT 5856 s() 'I'yr Phe Asp Asp Ann Tyr Arg Gly Ala Val Glu Trp Lys Glu Leu Asp Gly Glu Met His Tyr Phe Ser Pro Glu Thr Gly Lys Ala Phe Lys Gly i~ 1955 1960 1965 Leu Hen Gln Ile Gly Asp Tyr Lys Tyr Tyr F?he Asn Ser Asp Gly Val ATG CAi-, AAA GGA TTT GTT AGT ATA AAT GAT AAT AAA CAC TAT TTT GAT 6000 Met Gln Lys Gly Phe Val Ser Ile Asn Asp Asn Lys Fiis Ty~r Phe Asp F,sp Ser Gly Val Met Lys Val Gly Tyr Thr Glu Ile Asp Gly Lys His 7.005 2010 2015 ~f) Phe Tfr Phe Ala Glu Asn Gly Glu Met Gln Ile Gly Val Phe Asn '1'hr Glu Asp Gly Phe Lys Tyr Phe Ala Hi:. His Asn Glu Asp Leu Gly Asn ~J 2035 2040 2045 OU

C~lu Glu Gly Glu Glu Ile Ser Tyr Ser Gly Ile Leu Asn Phe Asn Asn Lys Ile Tyr Tyr Phe Asp Asp Ser Phe Thr Ala Val Val Gly Trp Lys (o GAT TTF, GAG GAT GGT TCA AAG TAT TAT TTT GAT GAA GAT ACA GCA GAA 6288 Asp Leu Glu Asp Gly Ser Lys 'I'yr 'Tyr Phe Asp Glu lisp Thr Ala Glu _ ~~$ _ WO 98~85A0 PCT/US97/15394 Ala Tyr Ile Gly Leu Ser Leu Ile Asn Asp Gly Gln Tyr Tyr Phe Asn Asp Asp Gly Ile Met Gln Val Gly Phe Val Thr Ile Asn Asp Lys Val _ TTC TAC TTCTCTGAC TCTGGAATTATAGAA GGAGTACAA ATA 6432 TCT AAC

1() Phe Tyr PheSerAsp SerGlyIleIleGluSer GlyValGlnAsnIle Asp Asp AsnTyrPhe TyrIleAspAspAsnGly IleValGlnIleGly Val Phe AspThrSer AspGlyTyrLysTyrPhe AlaProAlaAsnThr Val Asn AspAsnIle TyrGlyGlnAlaValGlu TyrSerGlyLeuVal ~S AGA GTT GGGGAAGAT GTATATTATTTTGGAGAA ACATATACAATTGAG 6624 Arg 'galGlyGluAsp ValTyrTyrPheGlyGlu ThrTyrThr_TleGlu ~t95 2200 2205 i() Thr Gly TrpIleTyr AspMetGluAsnGluSer AspLysTyrTyrPhe Asn Pro GluThrLys LysAlaCysLysGlyIle AsnLeuIleAspAsp ?J 2225 2230 2235 2240 Ile Lys TyrTyrPhe AspGluLysGlyIleMet ArgThrGlyLeuIle -~() Ser Phe GluAsnAsn AsnTyrTyrPheAsnGlu AsnGlyGluMetGln Phe Gly TyrIleAsn IleGluAspLysMetPhe TyrPheGlyGluAsp SU Gly Val MetGlnIle GlyValPheAsnThrPro AspGlyPheLysTyr Phe Ala HisGlnAsn ThrLeuAspGluAsnPhe GluGlyGluSerIle (i0 Asn Tyr Thr Gly Trp Leu Asp Leu Asp Glu Lys Arg Tyr T'yr Phe Thr Asp Glu Tyr Ile Ala Ala Thr Gly Ser Val Ile Ile Asp Gly Glu Glu Tyr Tyr Phe Asp Pro Asp Thr Ala Gln Leu Val Ile Ser Glu PCTNS9'1115394 (2) INFORMATION FOR SEQID
NO:10:

!i) CHARACTE RISTICS:
SEQUENCE

iA)LENGTH: 2366 acids amino J (B)TYPE: minoacid a !D)TOPOLOG Y: inear l !ii) TYPE: otein MOLECULE pr (xi) DESCRIPTION:SEO ID NO:10:
SEQUENCE

Met Ser LeuValAsn ArgLysGlnLeu GluLysMetAlaAsnVdl Arg Phe Arg ThrGlnGlu AspGluTyrVal AlaIleLeuAspAlaLeu Glu Glu Tyr HisAsnMet SerGluAsnThr ValValGluLysTyrLeu Lys Leu Lys AspIleAsn SerLeuThrAsp IleTyrIleAspThrTyr Lys Lye Ser GlyArgAsriLysAlaLeuLys LysPheLysGluTyrLeu Val Thr Glu ValLeuGlu LeuLysA,nAsn AsnLeuThrProValGlu Lys ?() Asn Leu HisPheVal TrpIleGlyG1y GlnIleAsnAspThrAla Ile Asn Tyr IleAsnGln TrpLysAspVal AsnSerAppTyrAnnVal Asn ii Val Phe 'I'yrAspSPr AsnAlaPheLeu IleAsnThrLeuLyehys Thr Val Val GluSerAla IleAsnAspThr LeuGluSerPheArgGlu Asn fit)195 150 155 160 Leu Asn AspProArg PheAspTyrAsn LysPhePheArgLysArg Met -IJ Glu Ile Ile'ryrAsp LysGlnLysAsn PheIleAsnTyrTyrLys Ala GlriArg GluGluAsn ProGluLeuIle IleAspAspIleValLys Thr J~) Tyr Leu SerAsnGlu TyrSerLysGlu IleAspGluLeuAsnThr Tyr Ile Glu GluSerLeu AsnLysIleThr GlnAsnSerGlyAsnAsp Val Arg Asn PheGluGlu PheLysAsriGly GluSerPheAsnLeuTyr Glu O1 Gln Glu LeuValGlu ArgTrpAsnLeu AlaAlaAlaSerAspIle Leu ' 260 265 270 Arg Ile SerAlaLeu LysGluIleGly GlyMetTyrLeuAspVal Asp 6a Met Leu ProGlyIle GlnProAspLeu PheGluSerIleGluLys Pro Ser Ser ValThrVai AspPheTrpGlu MetThrLysLeuCluAla Ile Met Lys Tyr Lys Glu Tyr Ile Pro Glu Tyr Thr Ser Glu His Phe Asp Met Leu Asp Glu Glu Val Gln Ser Ser Phe Glu Ser Val Leu Ala Ser Lys Ser Asp Lys Ser Glu Ile Phe Ser Ser Leu Gly Asp Met Glu Ala lU Ser Pro Leu Glu Val Lys Zle Ala Phe Asn Ser Lys Gly Ile Ile Asn Gln Gly Leu Ile Ser Val Lys Asp Ser Tyr Cys Ser Asn Leu Ile Val ~J
Lys Gln Ile Glu Asn Arg Tyr Lys Ile Leu Asn Asn Ser Leu Asn Pro Ala Ile Ser Glu Asp Asn Rsp Phe Asn Thr Thr Thr Asn Thr Phe Ile Asp Ser Ile Met Ala Glu Ala Asn Ala Asp Asn Gly Arg Phe Met Met ~J Glu LeuGlyLysTyr LeuArgValGlyPhe PheProAspVal LysThr Thr IleAsnLeuSer GlyProGluAlaTyr AlaAlaAlaTyr GlnAsp i~) Leu LeuMetPheLys GluGlySerMetAsn IleHisLeuIle GluAla App LeuArgAsnPhe GluIleSerLysThr AsnIleSerGln SerThr .iJ 500 SOS 510 Glu Gln Glu Met Ala Ser Leu Trp Ser Phe Asp Asp Ala Arg Ala Lys -l0 Ala GlnPlieGluGlu TyrLysArgAsnTyr PheGluGlySerLeu Gly Glu AspAspAsnLeu AspPheSerGlnAsn IleValValAspLys Glu Tyr I.euLeuGluLys IleSerSerLeuAla ArgSerSerGluArg Gly T;:r IleHisTyrIle ValGlnLeuGlnGly AspLysIleSerTyr Glu Ala AlaCysAsnLeu PheAlaLysThrPro TyrAspSerValLeu Phe JJ Gln LysAsnIleGlu AspSerGluIleAla TyrTyrTyrAsnPro Gly Asp Gly Glu Ile Gln Glu Ile Asp Lys Tyr Lys Ile Pro Ser Ile Ile (>() Ser App AYg Pro Lys Ile Lys Leu Thr Phe Ile Gly His Gly Lys Asp Glu Phe Asn Thr Asp Ile Phe Ala Gly Phe Asp Val Asp Ser Leu Ser (7J 660 665 670 Thr Glu Ile Glu Ala Ala Ile Asp Leu Ala Lys Glu Asp Ile Ser Pro Lys Ser Ile Glu Ile Asn Leu Leu Gly Cys Asn Met Phe Ser Tyr Ser Ile Asn Val Glu Glu Thr Tyr Pro Gly Lys Leu Leu Leu Lys Val Lys Asp Lys Ile Ser Glu Leu Met Pro Ser Ile Ser Gln Asp Ser Ile Ile 1() Val Ser Ala Asn Gln Tyr Glu Val Arg Ile Asn Ser Glu Gly Arg Arg ~i Glu Leu Leu Asp His Ser Gly Glu Trp Ile Asn Lys Glu Glu Ser Ile Ile Lys Asp Ile Ser Ser Lys Glu Tyr Ile Ser Phe Asn Pro Lys Glu Asn Lys Ile Thr Val Lys Ser Lys Asn Leu Pro Glu Leu 5er Thr Leu Leu Gln GluIleArg AsnAsnSerAsn SerSerAspIleGluLeu Glu Glu Lys ValMetLeu '1'hrGluCysGlu IleAsnValIleSerAsn Ile Asp Thr GlnIleVal GiuGluArgIle GluGluAlaLysAsnLeu Thr i~) Ser Asp SerIleAsn TyrIleLysAsp GluPheLysLeuIleGlu Ser Ile SerAspAlaLeu CysAspLeuLys GlnGlnAsnGluLeuGlu Asp Ser IfisPheIleSer PheGluAspIle SerGluThrAspGluGly Phe Ser IleArgPheIle AsnLysGluThr GlyGluSerIlePheVal Glu Thr GluLysThrIle PheSerGluTyr AlaAsnHisIleThrGlu Glu .~
S

I1e SerLysIleLys GlyThrIlePhe AspThrValAsnGlyLys Leu Val Lys Lys Val Asn Leu Asp Thr Thr His Glu Val Asn 'Thr Leu Asn Ala Ala Phe Phe Ile Gln Ser Leu Ile Glu Tyr Asn Ser Ser Lys Glu ~J Ser Leu Ser Asn Leu Ser Val Ala Met Lys Val Gln Val Tyr Ala Gln Leu Phe Ser Thr Gly Leu nsn Thr Ile Thr Asp Ala Ala Lys Val Val 995 lODO 1005 (~(?
Glu Leu Val Ser Thr Ala Leu Asp Glu Thr Ile Asp Leu Leu Pro Thr Leu Ser Glu Giy Leu Pro Ile Ile Ala Thr Ile Ile Asp Gly Val Ser (1J 1025 1030 1035 1040 Leu Gly Ala Ala Ile Lys Glu Leu Ser Glu Thr Ser Asp Pro Leu Leu Arg Gln Glu Ile Glu Ala Lys Ile Gly Ile Met Ala Val Asn Leu Thr Thr Ala Thr Thr Ala Ile Ile Thr Ser Ser Leu Gly Ile Ala Ser Gly Phe Ser Ile Leu Leu Val Pro Leu Ala Gly Ile Ser Ala Gly Ile Pro IU Ser Leu Val Asn Asn Glu Leu Val Leu Arg Asp Lye Ala Thr Lys Val Val Asp Tyr Phe Lys His Val Ser Leu Val Glu Thr Glu Gly Val Phe li Thr Leu Leu Asp Asp Lys Ile Met Met Pro Gln Asp Asp Leu Val Ile Ser Glu Ile Asp Phe Asn Asn Asn Ser Ile Val Leu Gly Lys Cys Glu Ile Trp Arg Met Glu Gly Gly Ser Gly His Thr Val Thr Asp App Ile Asp His Phe Phe Ser Ala Pro Ser Ile Thr Tyr Arg Glu Pro His Leu Ser Ile Tyr Asp Val Leu Glu Val Cln Lys Glu Glu Leu Asp Leu Ser i() Lys Asp Leu Met Val Leu Pro Asn Ala Pro Asn Arg Val Phe Ala Trp Glu Thr Gly Trp Thr Pro Gly Leu Arg Ser Leu Glu Asn Asp Gly Thr Lys LeuLeu AspArgIleArgAsp AsnTyrGluGlyGlu PheTyrTrp 40 Arg TyrPhe AlaPheIleAlaAsp AlaLeuIleThrThr LeuLysPro 126s 1270 1275 l2so Arg 'I'yrGlu AspThrAsnIleArg IleAsnLeuAspSer AsnThrArg .~
i Ser PheIle ValProIleIleThr ThrGluTyrIleArg GluLysLeu Ser TyrSer PheTyrGlySerGly GlyThrTyrAlaLeu SerLeuSer Gln Tyr Asn Met Gly Ile Asn Ile Glu Leu Ser Glu Ser Asp Val Trp Ile Ile Asp Val Asp Asn Val Val Arg Asp Val Thr Ile Glu Ser Asp Lys Ile Lys Lys Gly Asp Leu Ile Glu Gly Ile Leu Ser Thr Leu Ser 6t) Ile Glu G'lu Asn Lys Ile Ile Leu Asn Ser His Glu Ile Asn Phe Ser Gly Glu Val Asn Gly Ser Asn Gly Phe Val Ser Leu Thr Phe Ser Ile Leu Glu Gly Ile Asn Ala Ile Ile Glu Val Asp Leu Leu Ser Lys Ser j Tyr Lys Leu Leu Ile Ser Gly Glu Leu Lys Ile Leu Met Leu Asn Ser Asn His Ile Gln Gln Lys Ile Asp Tyr Ile Gly Phe Asn Ser Glu Leu Gln Lys Asn Ile Pro Tyr Ser Phe Val Asp Ser Glu Gly Lys Glu Asn 1I) Gly Phe Ile Asn Gly Ser Thr Lys Glu Gly Leu Phe Val Ser Glu Leu Pro Asp Val Val Leu Ile Ser Lys Val Tyr Met Asp Asp Ser Lys Pro ~i Ser Phe Gly Tyr Tyr Ser Asn Asn Leu Lys Asp Val Lys Val Ile Thr hys Asp Asn Val Asn Ile Leu Thr Gly Tyr Tyr Leu Lys Asp Asp Ile Lys Ile Ser Leu Ser Leu Thr Leu Gln Asp Glu Lys Thr Ile Lys Leu ~J Asn SerValHisLeu AspGluSerGlyValAla GluIleLeuLys Phe Met AnnArgLysGly AsnThrAsnThrSerAsp SerLeuMetSer Phe j() Leu GluSerMetAnn IleLysSerIlePheVal AsnPheLeuGln Ser Asn IleLysPheIle LeuAspAlaAsnPheIle IleSerGlyThr Thr ?J 1605 1610 1615 Ser IleGlyGlnPhe GluPheIleCysAspGlu AsnAspAsnIle Gln Pro TyrPheIleLys PheAsnThrLeuGluThr AsnTyrThrLeu Tyr Val GlyAsnArgGln AsnMetIleValGluPro AsnTyrAspLeu Asp .~
i Asp SerGlyAspIle SerSerThrValIleAsriPheSerGlnLys Tyr Leu TyrGlyIleAsp SerCysValAsnLysVal ValIleSerPro Asn Ile TyrThrAspGlu IleAsnIleThrProVal TyrGluThrAsn Asn J~ Thr TyrProGluVal IleValLeuAspAlaAsn TyrIleAsnGlu Lys Ile AsnValAsnIle AsnAspLeuSerIleArg TyrValTrpSer Asn ~)~) Asp GlyAsnAspPhe IleLeuMetSerThrSer GluGluAsnLys Val Ser GlnValLysIle ArgPheValAsnValPhe LysAspLysThr Leu C)S 1765 1770 1775 Ala AsnLysLeu5er PheAsnPheSerAspLys GlnAspValPro Val Ser Glu Ile Ile Leu Ser Phe Thr Pro Ser Tyr Tyr Glu Asp Gly Leu Ile Gly Tyr Asp Leu Gly Leu Val Ser Leu Tyr Asn Glu Lys Phe Tyr Ile Asn Asn Phe Gly Met Met Val Ser Gly Leu Ile Tyr Ile Asn Asp lU Ser Leu Tyr Tyr Phe Lys Pro Pro Val Asn Asn Leu Ile Thr Gly Phe Val Thr Val Gly Asp Asp Lys Tyr Tyr Phe Asn Pro Ile Asn Gly Gly ~i Ala Ala Ser Ile Gly Glu Thr Ile Ile Asp Asp Lys Asn 'fyr Tyr Phe Asn Gln Ser Cly Val Leu Gln Thr Gly Val Phe Ser Thr~Glu Asp Gly Phe Lys Tyr Phe Ala Pro Ala Asn Thr Leu Asp Glu Asn Leu Glu Gly Glu Ala Ile Asp Phe Thr Gly Lys Leu Ile Ile Asp Glu Asn Ile Tyr Tyr Phe Asp Asp Asn Tyr Arq Gly Ala Val Glu Trp Lys Glu Leu Asp i () Gly Glu Met His Tyr Phe Ser Pro Glu Thr Gly Lys Ala Phe Lys Gly Leu Asn Gln Ile Gly Asp 'fyr Lys Tyr Tyr Phe Asn Ser Asp Gly Val ~J 1970 1975 1980 Met GlnLys GlyPheVal SerIleAsnAspAsn LysHis'I'yrPheAsp ~1() Asp SerGly ValMetLys ValGlyTyrThrGlu IleAspGlyLysHis Phe TyrPhe AlaGluAsn GlyGluMetGlnIle GlyValPheAsn':hr .~ i Glu AspGly PheLysTyr PheAlaHisHisAsn GluAspLeuGlyAsn Glu GluGly GluGluIle SerTyrSerGlyIle LeuAsnPheAsnAsn J() 2050 2055 2060 Lys IleTyr TyrPheAsp AspSerPheThrAla ValValGlyTrpLys ~> Asp LeuGlu AspGlySer LysTyrTyrPheAsp GluAspThrAlaGlu Ala TyrIle GlyLeuSer LeuIleAsnAspGly GlnTyrTyrPheAsn OU

Asp AspGly IleMetGln ValGlyPheValThr IJeAsnAspLysVai Phe TyrPhe SerAspSer GlyIleJleGIuSer ~::lyValGlnAsnIle _ 2130 215 27.40 ~)J

Asp AspAsn TyrPheTyr IleAspAspAsnGly IleValGlnIleGly . 2145 2150 2155 2160 Val PheAsp ThrSerAsp GlyTyrLysTyrPhe AlaProAlaAsnThr *rB

gyp 9g/pg~p PCTIUS97115394 Val AsnAsp Asn Ile Tyr Gly Gln Glu Tyr Ser Gly Ala Val Leu Val j Arg ValGly Glu Asp Val Tyr 'I'yr Glu Thr Tyr Thr Phe Gly Iie Glu Thr GlyTrp Ile Tyr Asp Met Glu Ser Asp Lys Tyr Asn Glu Tyr Phe )U 22102215 2220 Asn ProGlu Thr Lys Lys Aia Cy~ Ile Asn.Leu Ile Lys Gly Asp Asp ~2~5 2230 2235 2240 1J Ile LysTyr Tyr Phe Asp Glu Lys Met Arg Thr Gly Gly Ile Leu Ile Ser PheGlu Asn Asn Asn Tyr Tyr Glu Asn Gly Glu Phe Asn Met Gln U

Phe GlyTyr Ile Asn Ilp Glu Asp Phe Tyr Phe Gly Lys Met Glu Asp Gly ValMet Gln Ile Gly Val Phe Pro Asp Gly Phe Asn Thr Lys Tyr Phe AlaHis Gln Asn Thr Leu Asp Phe Glu Gly Glu Glu Asn Ser Ile ?.305 2310 2315 2320 ?() Asn TyrThr Gly Trp Leu Asp Leu Lys Arg Tyr Tyr Asp Glu Phe Thr Asp GluTyr Ile Ala Ala Thr Gly Ile Ile Asp Gly Ser Val Glu Glu ii Tyr 'I'_,rrPhe Asp Pi-o Asp Thr Ala Val Ile Ser Glu Gln Leu (:'.)INFORMATION FOR SEQ ID NO:11:

(i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear lii)MOLECULE TYPE: DNA Igenomic) (xi)SEQUENCE DESCRIPTION: SEQ :11:

j () TAGAAAAAAT
GGCAAATGT

(2) INFORMATION FOR SEQ ID N0:12:

(i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear O) (ii)MOLECULE TYPE: DNA (genomic) lxi)SEQUENCE DESCRIPTION: SEQ :1~:

t7 TTTCATCTTG
TAGACTCAAA
G

(2) INFORMATION FOR SEQ ID N0:13:

(i)SEQUENCE CHARACTERISTICS:

) (A) LENGTH: 2~ base pairs - z~6 -(B) TYPE: nucleic acid (C) STR.ANDEDNESS: single (D) TOPOLOGY: linear > (ii) MOLECULE TYPE: DNA (genomicl Iri) SEQUENCE DESCRIPTION: SEQ ID N0:13:

lU
(2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs 17 (BI TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (:ci) SEQUENCE DESCRIPTION: SEQ ID N0:14:

(~) ItJFORMATION FOR SEQ ID N0:15:
i.ii SEQUENCE CHARACTERISTICS:
IA) LENGTH: 27 base pairs (B) TYPE: nucleic acid ?l) (C) STRANDEDNESS: single ID) TOPOLOGY: linear fii) MOLECULE TYPE: DNA (genomic>
(%ii SEQUENCE DESCRIPTION: SEQ ID N0:15:
CGGAATTCCT AGAAAAiAATG GCAAATG 27 (2j INFORMATION FOR SEQ ID N0:16:
':i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C1 STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (%i) SEQUENCE DESCRIPTION: SEQ ID N0:16:
JO

i2) INFORMATION FOR SEQ ID N0:17:
JJ (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 6() (ii) PIOLECULE TYPE: DNA (genomic) (%i) SEQUENCE DESCRIPTION: SEQ ID N0:17:

(~) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ~7 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 7 (ii) MOLECULE TYPE: DNA (genomic) lx.i) SEQUENCE DESCRIPTION: N0:18:
SEQ ID

TTATTATCTT
AAGGATG

(2) INFORMATION
FOR SEQ
ID N0:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ?0 (xi) SEQUENCE DESCRIPTION: N0:19:
SEQ ID

GATAACTGGA
TTTGTGAC

(2) INFORMATION
FOR SEQ
ID N0:20:

!i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 511 amino acids (B) TYPE: amino acid ?() (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown tai) MOLECULE TYPE: protein (ii) SEQUENCE DESCRIPTION: N0:20:
SEQ ID

Leu Ile Thr Gly Phe Val GlyAspAsp Lys Tyr Tyr Phe Asn Thr Val Pro Ile Asn Gly Gly Ala IleGlyGlu Thr Ile Ile Asp Asp Ala Ser ~0 25 30 Lys Asn Tyr Tyr Phe Asn GlyValLeu Gln Thr Gly Val Phe Gln Ser .~
i Ser Thr Glu Asp Gly Phe PheAlaPro Ala Asn Thr Leu Asp Lys Tyr Glu Asn Leu Glu Gly Glu AspPheThr Gly Lys Leu Ile Ile Ala Ile Asp Glu Asn Ile Tyr Tyr AspAsnTyr Arg Gly Ala Val Glu Phe Asp Trp Lys Glu Leu Asp Gly HisTyrPhe Ser Pro Glu Thr Gly Glu Met Lys Ala Phe Lys Gly Leu Asn Gln Ile Gly Asp Tyr Lys Tyr 'i'yr Phe 115 120 1<5 O) Asn 5er Asp Gly Val Met Gln Lys Gly Phe Val Ser Ile Asn App Asn Lys His Tyr Phe Asp Asp Ser Gly Val Met Lys Val Gly Tyr Thr Glu (» 145 150 155 160 Ile Asp Gly Lys His Phe Tyr Phe Ala Glu Asn Gly Glu Met Gln Ile ~~) Gly Val Phe Asn Thr Glu Asp Gly Phe Lys Tyr Phe Ala His His Asn _ '75g _ W~ 9glpgsqp PCT/US97l15394 lao le5 190 Glu Asp Leu Gly Asn Glu Glu Gly Glu Glu Ile Ser Tyr Ser Gly Ile Leu Asn Phe Asn Asn Lys Ile Tyr Tyr Phe Asp.Asp Ser Phe Thr Ala _ Val Val Gly Trp Lys Asp Leu Glu Asp Gly Ser Lys Tyr Tyr Phe Asp lU 225 230 235 240 Glu Asp Thr Ala Glu Ala Tyr Ile Gly Leu Ser Leu Ile Jisn Asp Gly 245 25' 255 1J Gln TyrTyrPheAsnAsp AspGlyIleMetGln ValGlyPheValThr IIe AsnAspLysValPhe TyrPheSerAspSer GlyIle!leGluSer '_' U

Gly ValGlnAsnIleAsp AspAsnTyrPhe'TyrIleAspAspAsnGly Ile ValGlnIleGlyVal PheAspThrSerAsp GlyTyrLys1'yrPhe Ala ProAiaAsnThrVal AsnAspAsnIleTyr GlyGlnAlaVa1Glu Tyr SerGlyLeuValArg ValGlyGluAspVal TyrTyrtheGlyGiu Thr TyrThrIleGluThr GlyTrpIleTyrAsp MetGluAsnGluSer ii Asp LysTyrTyrPheAsn ProGluThrLysLye AlaCysLysGlyIle Asn LeuIleAspAspIle LysTyrTyrPheAsp GluLysGlyIleMet Arg ThrGlyLeuIleSer PheGluAsnAsnAsn TyrTyrPheAsnGlu Asn GiyGluMetGlnPhe GlyTyrIleAsnIle GluAspL,~sMetPhe 420 425 ~13G

'ryr PheGlyGluAspGly ValMetGlnIleGiy ValPheAsnThrPro i() Asp GlyPheLysTyrPhe AlaHisGlnAsnThr LeuAspGluAsnPhe Glu GlyGlu5erIleAsn TyrThrGlyTrpLeu AspLeuAspGluLys Arg TyrTyrPheThrAsp GluTyrIleAlaAla ThrGlySerValIle Ile AspGlyGluGluTyr TyrPheAspProAsp ThrAlaGlnhau _ oj9 _ f21 INFORMATION
FOR
SEQ
ID N0:21:

(i1 SEQUENCE CHARACTERIS TICS:

(A)LENGTH: 608 amino cids a lB1TYPE: minoacid a IC)STRANDEDNES S: nknown u (D1TOPOLOGY: wn unkno fii) MOLECULETYPE: in l prote () iri) SEQUENCE DESCRIPTION: Q N0:21:
SE ID

Ser GluGluAsnLys ValSerGlnValLys IleArgPheVal AsnVal ~i Phe LysAspLysThr LeuAIaAsnLysLeu 5erPheAsnPhe SerAsp Lys GlnAspValPro ValSerGluIleIle LeuSerPheThr ProSer T.yr TyrGluAspGly LeuIleGlyTyrAsp LeuGlyLeuVa1 SerLeu ~J Tyr AsnGluLysPhe TyrIleAsnAsnPhe GlyMetMetVal SerGly Leu lleTyrIleAsn AspSerLeuTyrTyr PheLysProPro ValAsn i() Asn LeuIleThrGly PheValThrValGly AspAspLysTyr TyrPhe Asn ProIleAsnGly GlyAlaAlaSerIle GlyGluThrIle IleAsp ?J 115 120 125 Asp LysAsn'ryrTyr PheAsnGlnSerGly ValLeuGlnThr GlyVal Phe SerThrGluAsp GlyPheLysTyrPhe AlaProAlaAsn ThrLeu Asp GluAsnLeuGlu GlyGluAlaIleAsp PheThrGIyLye LeuIle Ile AspGluAsnIle TyrTyrPheAppAsp AsnTyrA~:gGly AlaVal Glu TrpLysGluLeu AspGlyGluMetHis TyrPheSerPro GluThr J() 195 200 205 Gly LysAlaPheLys GlyLeuAsnGlnIle GlyAspTyrLys TyrTyr JJ Phe AsnSerAspGly ValMetGlnLysGly PheValSerIle AsnAsp Asn LysHisTyrPhe AspAppSerGlyVal MetLysValGly TyrThr 6(1 Glu IleAspGlyLys HisPheTyrPheAla GluAsnGlyGlu MetGln Ile GlyValPheAsn 1'hrGluAspGlyPhe I,ysTyrPheAla HisHis Asn GluAspLeuGly AsnGluGluGlyGlu GluIleSerTyr SerGly 290 :.95 300 Ile LeuAsnPheAsn AsnLysIleTyrTyr PheAspAspSer PheThr -?6U-Ala Val Val Gly Trp Lys Asp Leu Glu Asp Gly Ser Lys Tyr Tyr Phe >_ Asp Glu Asp Thr Ala Glu Ala Tyr Ile Gly Leu Ser Leu Ile Asn Asp Gly Gln Tyr Tyr Phe Asn Asp Asp Gly Ile Met Gln Val Gly Phe Val Thr Ile Asn Asp Lys Val Phe Tyr Phe Ser Asp Ser Gly Ile IIe Glu Ser GlyVal GlnRsnIleAspAspAsn TyrPheTyrIleAsp AspAsn Gly IleVal GlnIleGlyValPheAsp ThrSerAspGlyTyr LysTyr ?U

Phe AlaPro AlaAsnThrValAsnAsp AsnIleTyrGlyGln AlaVal Glu TyrSer GlyLeuValArgValGly GluAspValTyrTyr PheGly Glu TnrTyr ThrIleGluThrGlyTrp IleTyrAspMetGlu AsnGiu ?U Ser AspLys TyrTyrPheAsnProGlu ThrLysLysAlaCys LysGly Ile AsnLeu IleAspAspIleLysTyr TyrPheAspGluLys C~lyIle is Met ArgThr GlyLeuIleSerPheGlu AsnAsnAsnTyrTyr PheAsn Glu AsnGly GluMetGlnPheGlyTyr IleAsnIleGluAsp LysMet Phe TyrPhe GlyGluAspGlyValMet GlnIleGlyValPhe AsnThr 4> Pro AspGly PheLysTyrPheAlaHip GlnAsnThrLeuAsp GluAsn Phe GluGly GluSerIleAsnTyrThr GlyTrpLeuAspLeu AspGlu (1 Lys ArgTyr TyrPheThrAspGluTyr IleAlaAlaThrGly SerVal Ile IleAsp GlyGluGluTyrTyrPhe AspProAspThrAla GlnLeu J? 595 600 605 (21 INFORMATI ON
FOR
SEQ
ID
N0:22:

(i) SEQUENCE CHARACTERISTICS :

6U (A?LENGTH: 1330 airs base p (B)TYP E:
nucleic acid (C)STRANDEDNESS: e doubl (D)TOPOLOGY:
linear ~J (ii) MOLECULE TYPE: (genomic) DNA

(ix) FEATURE:

. (A)NAM E/KEY:
CDS

(H)LOCATION:
1..1314 (ri) SEQUENCE DESCRIPTION: SEQ ID N0:22:

Met Ala Arg Leu Leu Ser Thr Phe Thr Glu Tyr Ile Lys Asn Ile Ile TCC

Asn ThrSer IleLeuAsnLeuArg TyrGluSerAsn HisLeuIleAsp 2p 25 30 Leu SerArg TyrAlaSerLysIle AsnIleGlySer LysValAsnPhe _ 1~ CAT CCGATC GACAAGAATCAGATC CAGCTGTTCAAT CTGGAATCTTCC 192 Asp ProIle AspLysAsnGlnIle GlnLeuPheAsn LeuGluSerSer ~()Lys IleGlu ValIleLeuLysAsn AlaIleValTyr AsnSerMetTyr Glu AsnPhe SerThrSerPheTrp IleArgIlePro LysTyrPheAsn 85 90 ' 95 'TCC r.TCTCT CTGAACAATGAATAC ACCATCATCAAC TGCATGGAAAAC 336 Ser IieSer LeuAsnAsnGluTyr ThrIleIleAsn CysMetGluAsn i~) Asn SerGly TrpLyeValSerLeu AsnTyrGlyGlu IleIleTrpT'hr Leu GlnAsp ThrGlnGluIleLys GlnArgValVal PheLysTyrSer Gln MetIle AsnIleSerAspTyr IleAsnArgTrp IlePheValThr Ile ThrAsn AsnArgLeuAsnAsn SerLysIleTyr IleAsnGlyArg Leu IleAsp GlnLysProIleSer AsnLeuGlyAsn IleHisAlaSer j(J

Asn AsnIle MetPheLysLeuAsp GlyCysArgAsp ThrHisArgTyr ~J ATC TGGATC AAATACTTCAATCTG TTCGACAAAGAA CTGAACGAAAAA 672 Ile TrpIle LysTyrPheAsnLeu PheAspLysGlu LeuAsnGluLys Glu IleLys AspLeuTyrAspAsn GlnSerAsnSer GlyIleLeuLys ?.25 ~ 230 235 240 Asp PheTrp GlyAspTyrLeuGln TyrAspLysPro TyrTyrMetLeu ()~ 245 250 255 Asn LeuTyr AspProAsnLysTyr ValAspValAsn AnnValGlyIle *rB

WO ~~~0 PC"fIUS97115394 CCG

Arg GlyTyrMet TyrLeuLys Gly Arg GlySerValMet ThrThr Pro TAC

Asn ZleTyrLeu AsnSerSer Leu Arg GlyThrLysPhe IleIle Tyr GAC

](1 Lys LyeTyrAla SerGlyAsn Lys Asn IleValArgAsn AsnAsp Asp AAG

Arg ValTyrIle AsnValVal Val Asn LysGluTyrArg LeuAla Lys GAA

Thr AsnAlaSer GlnAlaGly Val Lys IleLeuSerAla LeuGlu Glu CAG

Ile ProAspVal GlyAsnLeu Ser Val ValValMetLys SerLys Gln AAC GACCAGGGT ATCACTAAC AAA AAA ATGAATCTGCAG GACAAC 115?
TGC

Asn AspGlnGly IleThrAsn Lys Lys MetAsnLeuGln AppAsn Cys AAT GGTAACGAT ATCGGTTTC ATC TTC CACCAGTTCAAC AATAT'C 1200 GGT

o() Asn GlyAsnAsp IleGlyPhe Ile Phe HisGlnPheAsn AsnIie Gly GCT AAACTGGTT GCTTCCAAC TGG AAT CGTCAGATCGi,ACGTTCC 1248 TAC

Al.a LyeLeuVal AlaSerAsn Trp Asn ArgGlnIleGlu ArgSer Tyr i~ 405 410 415 GAG

Ser ArgThrLeu GlyCysSer Trp Phe IleProValAsp AspGly Glu Trp GlyGluArg ProLeu (2) INFORMATION FORSEOID N0:23:

(i) CHARACTERISTICS :
SEQUENCE

(A ) : 438 acids LENGTH amino (B ) amino TYPE: acid (D ) TOPOLOGY:
linear ( ii) TYPE: protein MOLECULE

( xi)SEQUENCEDESCRIPTION: N0:23:
SEQ ID

ij Met AlaArgLeu LeuSerThr Phe TyrIleLysAsn IieIle Thr Glu Asn ThrSerIle LeuAsnLeu Arg SerAsnHisLeu IleAsp Tyr Glu (7(1 20 25 30 Leu SerArgTyr AlaSerLys Ile GlySerLysVal AsnPhe Asn Ile ( Asp ProIleAsp LysAsn PheAsn Glu Ser Gln Leu Ser Ile Gln Leu Lys Ile Glu Val Ile Leu Lys Asn Ala Ile Val Tyr Asn Ser Met Tyr ~rp yglpgsqp PCT/US97115394 Glu Asn Phe Ser Thr Ser Phe Trp Ile Arg Ile Pro Lys Tyr Phe Asn Ser IleSerLeuAsn AsnGluTyrThrIle IleAsnCysMetGlu Asn Asn SerGlyTrpLys ValSerLeuAsnTyr GlyGluIleIleTrp Thr Leu GlnAspThrGln GluIleLysGlnArg ValValPheLysTyr Ser Gln MetIleAsnIle SerAspTyrIleAsn ArgTrpIlePheVal Thr ~i Ile ThrAsnAsnArg LeuAsnAsnSerLys IleTyrIleAsnGly Arg Leu IleAspGlnLys ProIleSerAsnLeu GlyAsnIleHisAla Ser Asn AsnIleMetPhe LysLeuAspGlyCys ArgAspThrHisArg Tyr 195 200 ?.U5 Ile Trp Ile Lys Tyr Phe Asn Leu Phe Asp Lys Glu Leu Asn Glu Lys alU 215 220 Glu Ile Lys Asp Leu Tyr Asp Asn Gln Ser Asn Ser Gly Ile Leu Lys ~25 230 235 40 i0 ' Asp Phe Trp Gly Asp Tyr Leu Gln 'Tyr Asp Lys Pro Tyr Tyr Met Leu Asn Leu Tyr Asp Pro Asn Lys Tyr Val Asp Val Asn Asn Val Gly Ile Arg Gly Tyr Met Tyr Leu Lys Gly Pro Arg Gly Ser Val Met Thr Thr '75 280 285 Asn Ile 1'~~r Leu Asn Ser Ser Leu Tyr Arg Gly Thr Lys Phe Ile Ile Lys Lys Tyr Ala Ser Gly Asn Lys Asp Asn Ile Val Arg Asn Asn Asp .105 310 315 320 .~ S
rlrg Val Tyr Iie Asn Val Val Val Lys Asn Lys Glu Tyr Arg Leu Ala Thr Asn Ala Ser Gln Ala Gly Val Glu Lys Ile Leu Ser Ala Leu Glu Ile Pro Asp Val Gly Asn Leu Ser Gln Val Val Val Met Lys Ser Lys Asn Asp Gln Gly Ile Thr Asn Lys Cys Lys Met Asn Leu Gln Asp Asn Asn Gly Asn Asp Ile G1y Phe Ile Gly Phe His Gln Phe Asn Asn Ile (O) A1a Lys L~u Val Ala Ser Asn Trp Tyr Asn Arg Gln Ile Glu Arg Ser Ser Arg Thr Leu Gly Cys Ser Tro Glu Phe ile Pro Val Asp Asp Gly (» 420 425 430 Trp Gly Glu Arg Pro Leu I2) INFORMATION FOR SEQ ID N0:24:
_ 7(~4 -WO gg/~qp PCTIUS9711S394 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein lxi) SEQUENCE DESCRIPTION: SEQ ID N0:24:
Met Gly His His His His His His His His His Fiis Ser Ser Gly His Ile Glu Gly Arg His Met Ala (2) INFORMATION FOR SEQ ID N0:25:
(i1 SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1402 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA Igenomic) ( i r, l FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: 1..1386 i~) lxi) SEQUENCE DESCRIPTION: SEQ ID N0:25:

Met G1_r~ His His His His His His His His His Hip Ser Ser Gly His ij 1 5 10 15 Ile Glu Gly Arg His Met Ala Ser Met Ala Arg Leu Leu Ser Thr Phe Thr Glu Tyr Ile Lys Asn Ile Ile Asn Thr Ser Ile Leu Asn Leu Arg Tyr Glu Ser Asn His Leu Ile Asp Leu Ser Arg Tyr Ala Ser Lys Ile Asn Ile Gly Ser Lys Val Asn Phe Asp Pro Ile Asp Lys Asn Gln Ile Gln Leu Phe Asn Leu Glu Ser Ser Lys Ile Glu Val Ile Leu Lys Asn Ala Ile Val Tyr Asn Ser Met Tyr Glu Asn Phe Ser Thr Ser Phe Trp Ile Arg Ile Pro Lys Tyr Phe Asn Ser Ile Ser Leu Asn Asn Glu T~_.~r Thr Ile Ile Asn Cys Met Glu Asn Asn Ser Gly Trp Lys Val Ser Leu ~() Asn Tyr Gly Glu Ile Ile 'frp Thr Leu Gln Asp Thr Gln Glu Ile Lys Gln Arg Val Val Phe Lys Tyr Ser Gln Met Ile Asn Ile Ser Asp T'yr Ile Asn Arg Trp Ile Phe Val Thr Ile Thr Asn Asn Arg Leu Asn Asn Ser Lys Ile Tyr Ile Asn Gly Arg Leu Ile Asp Gln Lys Pro IZe Ser ATC
ATG

Asn LeuGlyAsn IleHisAlaSer AsnAsnIleMetPhe LysLeuAsp .10 215 220 Gly CysArgAsp ThrHisArgTyr IleTrpIleLysTyr PheAsnLeu .''.25 230 235 240 Phe AspLysGlu LeuAsnGluLys GluIleLysAspLeu TyrAspAsn Gln SerAsnSer GlyIleLeuLys AspPheTrpGlyAsp 1'yrLeuGln i() 'I'yrAspLysPro TyrTyrMetLeu AsnLeuTyrAspPro AsnLyeTyr GTT CACGTCAAC AATGTAGGTATC CGCGGTTACATGTAC CTGAAAGGT 9i2 Val AspValAsn AsnValGlyIle ArgGlyTyrMetTyr LeuLyeGly 4t) Pro ArgGlySer ValMetThrThr AsnIleTyrLeuAsn SerSerLeu Tyr ArgGlyThr LysPheIleIle LysLysTyrAlaSer GlyAsnLys Asp AsnIleVal ArgAsnAsnAsp ArgValTyrIleAnn ValValVal JU

Lys AsnLysGlu TyrArgLeuAla ThrAsnAlaSerGln AlaGlyVal Glu LysIleLeu SerAlaLeuGlu IleProAspValGly AsnLeuSe.

6l) Gln ValValVal MetLysSerLys AsnAppGlnGlyIle ThrAsnLye 385 ' 390 395 400 Cys LyeMetAsn LeuGlnAspAsn AsnGlyAsnAspIle GlyPheIle ()~ 905 410 415 *rB

AAC AAA AAC
AAT CTG

Gly PheHisGln PheAsnAsn IleAlaLysLeuValAla SerAsnTrp Tyr AsnArgGln IleGluArg SerSerArgThrLeuGly CysSerTrp - GAG TTCATC~CCGGTTGATGAC GGTTGGGGTGAACGTCCG CTG 1386 Glu PheIlePro ValAspAsp GlyTrpGlyGluArgPro Leu AAGCTT

IJ (2) INFORMATION FORSEQID
N0:26:

(i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: 462 amino acids (B) TYPE:
amino acid (D) TOPOLOGY:
linear ( ii)MOLECULE TYPE:
protein ( r.i)SEQUENCE DESCRIPTION: SEQ N0:26:
ID

_~s Met GlyHisHis HisHisHis HisHisHisHisHisSer SerGlyHis Ile GluGlyArg HipMetAla SerMetAlaArgLeuLeu SerThrPhe i() 20 25 30 Thr GluTyrIle LysAsnIle IleAsnThrSerIleLeu AsnLeuArg ij Tyr GluSerAsn HisLeuIle AspLeuSerArgTyrAla ScrLysIie Asn IleGlySer LysValAsn PheAspProIleAspLys AsnG1nIle Gln LeuPheAsn LeuGluSer SerLysIleGluValIle LeuLysAsn Ala IleValTyr AsnSerMet TyrGluAsnPheSerThr SertheTrp Ile ArgIlePro LysTyrPhe AsnSerIleSerLeuAsn AsnGluTyr JU Thr IleIleAsn CysMetGlu AsnAsnSerGlyTrpLys ValperLeu Asn TyrGlyGlu IleIleTrp ThrLeuGlnAspThrGln GluIleLys Gln ArgValVal PheLysTyr SerGlnMetIleAsnIle SerAspTyr Ile AsnArgTrp liePheVal ThrIleThrAsnAsnArg LeuAsnAsn ()( ) 180 185 19U

7_ Ser Lys Ile Tyr Ile Asn Gly Arg Leu ile Asp Gln Lys Pro Ile Ser Asn Leu GlyAsnIleHis AlaSerAsnAsnIle MetPheLysLeuAsp Cly Cys ArgAspThrHis ArgTyrIleTrpIle LysTyrPheAsnLeu I() Phe Asp LysGluLeuAsn GluLysGluIleLys AspLeuTyrAspAsn Gln Ser AsnSerGlyIle LeuLysAspPheTrp GlyAspTyrLeuGln T;~rAsp LysProTyrTyr MetLeuAsnLeuTyr AspProAsnLysTyr ~.'alAsp ValAsnAsnVal GlyIleArgGlyTyr MetTyrLeuLysGly Pro Arg GlySerValMet ThrThrAsnIleTyr LeuAsnSerSerLeu ~> 'T.~rllrgGlyT'hrLysPhe IleIleLysLysTyr AlaSerC;lyAsnLye Asp Ann IleValArgAsn AsnAspArgValTyr IleAsnValValVal ?() Lys Asn LysGluTyrArg LeuAlaThrAsnAla SerGlnAlaGlyVal Glu Lys IleLeuSerAla LeuGluIleProAsp ValGlyAsnLeuSer Gln Val ValVa.lMetLys SerLysAsnAspGln GlyIleThrAsnLys Lys MetAsnLeuGln AspAsnAsnGlyAsn AspIleGlyPheIle GlyrPhe HisGlnPheAsn AsnIleAlaLysLeu ValAlaSerAsnTrp -) ;

T_.rAsn ArgGlnIleGlu ArgSerSerArgThr LeuGlyCy:SerTrp Glu Phe ileProValAsp AspGlyTrpGlyGlu ArgProLeu ?() 450 455 460 (~) INFORMATION FORSEQ ID N0:27:

(i ) ISTICS:
SEQUENCE
CHARACTER

~J (A) basepairs LENGTFF:

(F3) nuc leicacid TYPE:

(C) double STRANDEDNESS:

( D) linear TOPOLOGY:

(t0 (ii ) LECULE YPE:DNA(genomic) MO T

(ix) FEATURE:
(A) NAME/KEY: CDS
(8) LOCATION: 1..3888 (xi)SEQUENCE ID
DESCRIPTION: N0:27:
SEQ

Met GlnPheValAsn LysGlnPheAsnTyr LyslispProValAsn Gly . 1 5 10 15 IU

Val AspIleAlaTyr IleLysIleProAsn ValGlyGlnMetG3.nPro 2p 25 30 GTA A.r,AGCTTTTAAA ATTCATAATAAAATA TGGGTTATTCCAGAA AGA 144 Val LysAlaPheLys IleHisAsnLysIle TrpValIleProGlu Arg Asp ThrPheThrAsn ProGluGluGlyAsp LeuAsnProProPro Glu Ala LysGlnValPro ValSerTyrTyrAsp SerThrTyrLeuSer Thr ~J 65 70 75 80 GAT T,ATGAAAAAGAT AATTATTTAAAGGGA GTTACAAAATTATTT GAG 288
11~p AsnGluLysAsp AsnTyrLeuLysGly ValThrLysLeuPhe Glu i~) AGA F~TTTATTCAACT GATCTTGGAAGAATG TTGTTAACATCAATA GTA 336 Arg IIeTyrSerThr AspLeuGlyArgMet LeuLeuThrSerIle Val Arg GlyIleProPhe 'frpGlyGlySerThr IleAspThrGluLeu Lys ~l(1 Val IleAspThrAsn CysIleAsnValIle GinProAspGlySer Tyr Arg SerGluGluLeu AsnLeuValIleIle GlyProSerAlaAsp Ile ~I~ 145 150 155 160 ATl1 CAGTTTGAATCT AAAAGCTTTGGACAT GAAGTTTTGAATCTT ACG 528 Ile G~nPheGluCys LysSerPheGlyHis GluValLeuAsnLeu Thr Arg AsnGlyTyrGly SerThrGlnTyrIle ArgPheSerPr'oAsp Phe ~J ACA TTTGGTTTTGAG GAGTCACTTGAAGTT GATACAAATCCTCTT TTA 624 Thr PheGlyPheGlu GluSerLeuGluVal AspThrAsnProLeu Leu GGT G.CAGGCAAATTT GCTACAGATCCAGCA GTAACATTAGCACAT GAA 672 O) Gly AlaGlyLysPhe AlaThrAspProAla ValThrLeuAlaHis Glu - Leu IIeHisAlaGly HisArgLeuTyrGly IleAlaIleAsnPro Asn Arg ValPheLysVal AsnThrAsnAlaTyr TyrGluMetSerGly Leu GTA CTT GCA AAG
AGC AGA
ACA
TTT
GGG
GGA

Glu ValSerPheGlu GluLeu Thr Phe His Asp Lys Arg Gly Ala Gly CTA TAT

Phe IleAspSerLeu GlnGluAsnGlu PheArg Tyr 'I'yr Asn Leu Tyr GCT ATA

j~) Lys PheLysAspIle AlaSerThrLeu AsnLys Lys Ser Val Ala Ile GTT GAG

Gly ThrThrAlaSer LeuGlnTyrMet LysAsn Phe Lys Lys Val Glu TCG AAA

Tvr LeuLeuSerGlu AspThrSerGly LysPhe Val Asp Leu Ser Lys ATT GAG

Lys PheAspLysLeu TyrLysMetLeu ThrGlu Tyr Thr Asp Ile Glu AAA TTG

I;sn PheValLysPhe PheLysValLeu AsnArg Thr Tyr Asn Lye Leu CCT AAT

i() Phe lispLysAlaVal PheLysI1eAsn IleVal Lys Val Tyr Pro Asn AAT GCA

Thr !leTyrAspGly PheAsnLeuArg AsnThr Leu Ala Asn Asn Ala TTT AATGGTCAAAAT ACAGAAATTAAT AATATG TT"T ACT CTA 1248 AAT AAA

Phe AsnGlyGlnAsn ThrGluIleAsn AsnMet Phe Thr Leu Asn Lye a TTG GTA

hys AsnPhe1'hrGly LeuPheG1uPhe TyrLys Leu Cys Arg Leu Val -)~ GGG ATAATAACTTCT AAAACTAAATCA TTAGAT GGA ThC AAG 1344 AAA AAT

fly IleIleThrSer LysThrLysSer LeuAsp Gly Tyr Lye Lys Asn TGG TTT

J() Ala LeuAsnAspLeu Cy~IleLysVal AsnAsn Asp Leu Phe Trp Fhe AAT GAA

Ser ProSerGluAsp AsnPheThrAsn AspLeu Lys Gly Glu Ann Glu >> 465 470 475 480 TCT GCA GAA
AAT
ATT
AGT

Ile ThrSerAspThr AsnIleGluAla AlaGlu Asn Ile Leu Glu Ser 6() GAT TTA CAACAA TAT TTA TTT AATTTTGATAATGAA CC.T 1536 ATA TAT ACC

Asp LeuIleGlnGln Tyr LeuThrPileAsnPlneAspAsnGlu Pro Tyr ()J GAA AATATTTCAATA GAA CTTTCAAGT GACATTATAGGCCAA TTA 1584 AAT

Glu AsnIleSerIle Glu LeuSerSer AspIleIleGlyGln Leu Asn GAA

Glu LeuMetProAsn Ile ArgPhePro AsnGlyLysLysTyr Glu Glu Leu Asp Lys Tyr Thr Met Phe His Tyr Leu Arg Ala Gln Glu Phe Glu His Gly Lys Ser Arg Ile Ala Leu Thr Asn Ser Val Asn Glu Ala Leu TTA AAT CCT AGT CGT GTT TAT ACA TTT TTT T.CT TCA GAC TAT GTA AAG 1776 Leu Asn Pro Ser Arg Val Tyr Thr Phe Phe Ser Ser Asp Tyr Val Lys Lys Val Asn Lys Ala Thr Glu Ala Ala Met Phe Leu Gly Trp Val Glu Gln Leu Val Tyr Asp Phe Thr Asp Glu Thr Ser Glu Val Ser Thr Thr Asp Lys Ile Ala Asp Ile Thr Ile Ile Ile Pro Tyr Ile Gly Pro Ala Leu Asn Ile Gly Asn Met Leu Tyr Lys Asp Asp Phe Val Gly Ala Leu i(1 lle Phe Ser Gly Ala Val Ile Leu Leu Glu Phe Ile Pro Glu Ile Ala .iJ ATA CCT TTAGGT GCACTT TCA GCGAATAAG 2064 GTA ACT GTA TAT
TTT ATT

Ile Pro ValLeuGlyThrPhe AlaLeu SerT'yrIleAlaAsnLys Val GTT CTA ACCGTTCAAACAATA GATAAT T'TAAGT AAAAGAAATGAA 2112 GCT

Val Leu ThrValGlnThrIle AspAsn LeuSer LysArgAsnGlu Ala GTA

Lys Trp AppGluValTyrLys TyrIle ThrAsn TrpLeuAlaLys Val 705 710 715 '20 AAA

Val Asn ThrGlnIleAspLeu IleArg LysMet LysGluAlaLeu Lys ATA

Glu Asn GlnAlaGluAlaThr LysAla IleAsn TyrGlnTyrAsn Ile ATT

Gln Tyr ThrGluGluGluLys AsnAsn AsnPhe AsnIleAspAsp Ile AAT

Leu Ser SerLysLeuAsnGlu SerIle LysAla MetIleAsnIle Asn TCA

Asn Lys PheLeuAsnGlnCys SerVal TyrLeu MetAsnSerMet Ser GAT

- Ile Pro TyrGlyValLysArg LeuGlu PheAsp AlaSerLeuLys Asp *rB

Asp Ala Leu Leu Lys Tyr Ile Tyr Asp Asn Arg Gly Thr Leu Ile Gly Gln Val Asp Arg Leu Lys Asp Lys Val Asn Asn Thr Leu Ser Thr Asp lU Ile Pro Phe Gln Leu Ser Lys Tyr Val Asp Asn Gln Arg Leu Leu Ser Thr Phe Thr Glu Tyr Ile Lys Asn Ile Ile Asn Thr Ser Ile Leu Asn ~J 865 870 875 880 Leu Arg Tyr Glu 5er Asn His Leu Ile Asp Leu Ser Arg Tyr Ala Ser Lys Ile Asn Ile Gly Ser Lys Val Asn Phe Asp Pro Ile Asp Lys Asn Gln Ile Gln Leu Phe Asn Leu Glu Ser Ser Lys I1e Glu Val Ile Leu i(l Lys Asn Ala Ile Val Tyr Asn Ser Met Tyr Glu Asn Phe Ser Thr Ser Phe Trp Ile Arg Ile Pro Lys Tyr Phe Asn Ser Ile Ser Leu Asn Asn Glu Tyr Thr Ile Ile Asn Cys Met Glu Asn Asn Ser Gly Trp Lys Val Ser Leu Asn Tyr Gly Glu Ile Ile Trp Thr Leu Gln Asp Thr Gln Glu Ile Lys Gln Arg Val Val Phe Lys Tyr Ser Gln Met Ile Asn Ile Ser >U Asp Tyr Ile Asn Arg 'rrp Ile Phe Val Thr Ile Thr Asn Asn Arg Leu Asn Asn Ser Lys Ile Tyr Ile Asn Gly Arg Leu Ile Asp Gln Lys Pro hU

Ile Ser Asn Leu Gly Asn Ile His Ala Ser Asn Asn Ile Met Phe Lys Leu Asp Gly Cys Arg Asp Thr His Arg Tyr Ile Trp Ile Lys Tyr Phe Asn Leu Phe Asp Lys Glu Leu Asn Glu Lys Glu Ile Lys Asp Leu Tyr 70 Asp Asn Gln Ser Asn Ser Gly Ile Leu Lys Asp Phe Trp Gly Asp Tyr CCA ATG TAT

Leu GlnTyrAspLys TyrTyr Leu Asn Leu Asp ProAsn Pro Met Tyr AAT GGT TAT

Lys TyrValAspVal AsnVal Ile Arg Gly Met TyrLeu Asn Gly Tyr ~ () AGC ACT TAT

Lys GlyProArgGly ValMet Thr Asn Ile Leu AsnSer Ser Thr Tyr ACA ATT TAT

Ser LeuTyrArgGly LysPhe Ile Lys Lys Ala SerGly Thr Ile Tyr Asn Lys Asp Asn Ile Val Arg Asn Asn Asp Arg Val Tyr IIe Asn Val Val Val Lys Asn Lys Glu Tyr Arg Leu Ala Thr Asn Ala Ser Gln Ala ~J 1185 1190 1195 1200 Gly Val Glu Lys Ile Leu Ser Ala Leu Glu Ile Pro Asp Val Gly Asn >l) Leu SerGln ValVal ValMetLys SerLysAsnAspGlnGly IleThr >> AAT AAATGC AAAATG AATTTACAA GATAATAATGGGAATGAT ATAGGC 3744 Asn LysCys LysMet AnnLeuGln AspAsnAsnGlyAsnAsp IleGly Phe IleGly PheHis GlnPheAsn AsnIleAlaLysLeuVal AlaSer Asn TrpTyr AsnArg GlnIleGlu ArgSerSerArgThrLeu GlyCys ~J 1265 1270 1275 1280 Ser TrpGlu PheIle ProValAsp AspGlyTrpGlyGluArg ProLeu (2) INFORMATION SEQ ID N0:28:
FOR

~J (i) SEQUENCECHARACTERISTICS:

(A) acids LENGTH:

amino (B) TYPE:
amino acid (D) TOPOLOGY:
linear O) (ii) MOLECULETYPE: protein (xi) SEQUENCEDESCRIPTION: ID N0:28:
SEQ

_ Met Gln Val Lys Gln Phe TyrLys Pro Val Asn Phe Asn Asn Asp Gly Val Asp Ala Ile Lys Ile AsnVal Gln Met Gln Ile Tyr Pro Gly Pro 7() Val Lys Phe Ile His Asn IleTrp Ile Pro Glu Ala Lys Lys Vai Arg Asp Thr PheThrAsn ProGluGluGlyAspLeu AsnProProProGlu J

Ala Lys GlnValPro ValSerTyrTyrAspSer ThrTyrLeuSerThr Asp Asn GluLysAsp AsnTyrLeuLysGlyVal ThrLysLeuPheGlu () Arg Ile TyrSerThr AspLeuGlyArgMetLeu LeuThrSerIZeVal Arg Gly IleProPhe TrpGlyGlySerThrIle AspThrGluLeuLys Val Ile AspThrAsn CysIleAsnValIleGln ProAspGlySerTyr ?0 Arg Ser GluGluLeu AsnLeuValIleIleGly ProSerAlaAspIle Ile Gln PheGluCys LysSerPheGlyHisGlu ValLeuAsnLeuThr Arg Asn GlyTyrGly SerThrGlnTyrIleArg PheSerProAspPhe ?() Thr Phe GlyPheGlu GluSerLeuGluValAsp ThrAsnProLeuLeu Gly Ala GlyLysPhe AlaThrAspProAlaVal ThrLeuAlaHisGlu '~10 215 220 i7 Leu Ile HisAlaGly HisArgLeuTyrGlyIle AlaIleAsnProAsn Arg Val PheLysVaI AsnThrAsnAlaTyrTyr GluMetSerGlyLeu 4~) 295 250 255 Glu Val SerPheGlu GluLeuArgThrPheGly GlyHisAspAlaLy., Phe Ile AspSerLeu GlnGluAsnGluPheArg LeuTyrTyrTyrAsn Lys Phe LysAspIle AlaSerThrLeuAsnLys AlaLyeSerIleVal () Gly Thr ThrAlaSer LeuGln'ryrMetLysAsn ValPheLysGluLys Tyr Leu LeuSerGlu AspThrSerGlyLysPhe SerValAspLysLeu Lys Phe AspLysLeu TyrLysMetLeuThrGlu IleTyrThrGluAsp W) Asn Phe ValLysPhe PheLysValLeuAsnArg LysThr'ryrLeuAsn Phe Asp LysAlaVal PheLysIleAsnIleVal ProLysValAsnTyr ~) J

Thr Ile TyrAspGly PheAsnLeuArgAsnThr AsnLeuAlaAlaAsn Phe Asn GlyGlnAsn ThrGluIleAsnAsnMet AsnPheThrLysLeu Lys Asn Phe Thr Gly Leu Phe Glu Phe Tyr Lys Leu Leu Cys Val Arg Gly Ile Ile Thr Ser Lys Thr Lys Ser Leu Asp Lys Gly Tyr Asn Lys Ala Leu AsnAspLeuCys IleLysValAsnAsnTrp AspLeuPhePhe Ser Pro SerGluAspAsn PheThrAsnAspLeuAsn LysGlyGluGlu Ile Thr SerAspThrAsn IleGluAlaAlaGluGlu AsnIleSerLeu 1~

Asp Leu IleGlnGlnTyr TyrLeuThrPheAsnPhe AspAsnGluPro Glu Asn IleSerIleGlu AnnLeuSerSerAspIle IleGlyGlnLeu Glu Leu Met Pro Asn Ile Glu Arg Phe Pro Asn Gly Lys Lys Tyr Glu Leu AspLys TyrThrMetPheHis TyrLeuArgAlaGln GluPheGlu His GlyLys SerArgIleAlaLeu ThrAsnSerValAsn GluAlaLeu Leu AsnPro SerArgValTyrThr PhePheSerSerAsp TyrValLys Lys ValAsn LysAlaThrGluAla AlaMetPheLeuGly TrpValGlu iJ 595 600 605 Gln LeuVal TyrAspPheThrAsp GluThrSerGluVal SerThrThr 40 Asp LysIle AlaAspIleThrIle IleIleProTyrIle GiyProAla Leu AsnIle GlyAsnMetLeuTyr LysAspAspPheVal GlyAlaLeu ~j Ile PheSex GlyAlaValIleLeu LeuGluPheIlePro GluIleAla Ile ProVal LeuGlyThrPheAla LeuValSerTyrIle AlaAsnLys Val LeuThr ValGlnThrIleAsp AsnAlaLeuSerLys ArgAsnGlu JJ Lys TrpAsp GluValTyrLysTyr IleValThrAsnTrp LeuAlaLys Val Asn Thr Gln Ile Asp Leu Ile Arg Lys Lys Met Lys Glu Ala Leu ~)U
Glu Asn Gln Ala Glu Ala Thr Lys Ala Ile Ile Ann Tyr Gln Tyr Asn Gln Tyr Thr Glu Glu Glu Lys Asn Asn Ile Asn Phe Asn Ile Asp Asp Leu Ser Ser Lys Leu Asn Glu Ser Ile Asn Lys Ala Met Ile Asn Ile 7() Asn Lys Phe Leu Asn Gln Cys Ser Val Ser Tyr Leu Met Asn Ser Met _~7~_ Ile ProTyrGly ValLysArgLeuGlu AspPheAspAla SerLeuLys J

Asp AlaLeuLeu LysTyrIleTyrAsp AsnArgGlyThr LeuIleGly Gln ValAspArg LeuLysAspLysVal AsnAsnThrLeu SerThrAsp ~~) 835 840 845 ile ProPheGln LeuSerLysTyrVal AspAsnGlnArg LeuLeuSer Thr PheThrGlu TyrIleLysAsnIle IleAsnThrSer IleLeuAsn Leu ArgTyrGlu SerAsnHisLeuIle AspLeuSerArg TyrAlaSer Lys IleAsnIle GlySerLysValAsn PheAspProIle AspLysAsn Gln IleGlnLeu PheAsnLeuGluSer SerLyeIleGlu ValIleLeu ~J 915 920 925 L,ys AsnAlaZle ValTyrAsnSerMet TyrGluAsnPhe SerThrSer iU Phe TrpIleArg IIeProLyETyrPhe AsnSerIleSer LeuAsnAsn Glu TyrThrIle IleAsnCysMetGlu AsnAsnSerGly TrpLysVal .i i Ser LeuAsnTyr GlyGluIleIleTrp ThrLeuGlnAsp ThrGlnGlu Ile LysGlnArg ValValPheLysTyr SerGlnMetIle AsnIlaSer rasp TyrIleAsriArgTrpIlePheVal ThrIleThrAsn AsnArgLeu ksn AsnSerLys IleTyrI1eAsnGly ArgLeuIleAsp GlnLysPro .025 1030 1035 1040 Ile SerAsnLeu GlyAsnIleHisAla SerAsnAsnIle MetPheLys JO

Leu AspGlyCys ArgAspThrHisArg TyrIleTrpIle LyeTyrPhe Asn LeuPheAsp LysGluLeuAsnGlu LysGluIleLys AspLeuTyr Asp AsnGlnSer AsnSerGlyIleLeu LysAspPheTrp GlyAspTyr OU Leu GlnTyrAsp LysProTyrTyrMet LeuAsnLeuTyr AspProAsn 110 5 ~ 1110 1115 1120 Lys TyrValAsp ValAsnAsnValGly IleArgGlyTyr MetTyrLeu () Lys GlyProArg GlySerValMetThr ThrAsnIleTyr LeuAsnSer Ser LeuTyrArg GlyThrLy~PheIle IleLysLysTyr AlaSerGly 77() -Asn Lys Asp Asn Ile Val Arg Asn Asn Asp Arg Val Tyr Ile Asn Val Val Val Lys Asn Lys Glu Tyr Arg Leu Ala Thr Asn Ala Ser Gln Ala Gly Val Glu Lys Ile Leu Ser Ala Leu Glu Ile Pro Asp Val Gly Asn Leu Ser Gln Val Val Val Met Lys Ser Lys Asn Asp Gln Gly Ile Thr Rsn Lys Cys Lys Met Asn Leu Gln Asp Asn Asn Gly Asn Asp Ile Gly ~i Phe Ile Gly Phe His Gln Phe Asn Asn Ile Ala Lys Leu Val Ala Ser Asn Trp Tyr Asn Arg Gln Ile Glu Arg Ser Ser Arg Thr Leu Gly Cys Ser Trp Glu Phe Ile Pro Val Asp Asp Gly Trp Gly Glu Arg Pro Leu ~J (?.) INFORMATION FOR SEQ ID N0:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid .~() (C) STRANDEDNESS: single tDl TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "DNA"

(r.i) SEQUENCE DESCRIPTION: SEQ ID N0:29:

(2) INFORMATION FOR SEQ ID N0:30:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 26 base pairs (S1 TYPE: nucleic acid 4~ (C) STRANDEDNESS: single (D) TOPOLOGY: linear ;ii) MOLECULE TYPE: other nucleic acid (A1 DESCRIPTION: jdesc = "DNA"
~0 tr.i) SEQUENCE DESCRIPTION: SEQ ID N0:30:

JJ (2) INFORMATION FOR SEQ ID N0:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1596 base pairs tBl TYPE: nucleic acid tC) STRANDEDNESS: double -(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (fi) SEQUENCE DESCRIPTION: SEQ ID N0:31:

~ () AACTCTAAAA

?() ~J TAAATGAAAA AGAAATCAAAGATTTATATGATAATCAATC AAAT'TCAGGTATTTTAAAAG 900 CAAATAAATA TGTCGATGTA AATAATGTAG GTATTAGAGGTTATATGTAT CTTAAAGGGC

i t) CTAGAGGTAG CGTAATGACT ACAAACATTT ATTTAAATTCAAGTTTGTAT AGGGGGACAA

AATTTATTAT AAAAAAATAT GCTTCTGGAA ATAAAGATAATATTGTTAGA AATAATGATC

.i~ GTGTATATAT TAATGTAGTA GTTAAAAATA AAGAATATAGGTTAGCTACT AATGCATCAC

AGGCAGGCGT AGAAAAAATA CTAAGTGCAT TAGAAATACCTGATGTAGGA AATCTAAGTC

AAGTAGTAGT AATGAAGTCA AAAAATGATC AAGGAATAACAAATAAATGC AAAATGAATT

TACAAGATAA TAATGGGAAT GATATAGGCT TTATAGGATTTCATCAGTTT AATAATATAG

CTAAACTAGT AGCAAGTAAT TGGTATAATA GACAAATAGAAAGATCTAGT AGGACTTTGG

GTTGCTCATG GGAATTTATT CCTGTAGATG ATGGATGGGGAGAAAGGCCA CTGTAATTAA

(2) INFORMATION FOR SEQ ID N0:32:

1() (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 9 amino acids !B) TYPE: amino acid lC) STRANDEDNESS: not relevant (D) TOPOLOGY: not relevant (ii) MOLECULE TYPE: peptide !xi) SEQUENCE DESCRIPTION: SEQ ID
N0:32:

(o) Met Ais His His His His His Met Ala (2) INFORMATION FOR SEQ ID N0:33:

li) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs !H) TYPE: nucleic acid !C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /descDNA"
= "

(xi)SEQUENCE DESCRIPTION: :33:

_1 (2) INFORMATION
FOR
SEQ
ID
N0:34:

' 10 (i)SEQUENCE CHARACTERISTICS:

(A) LENGTH: ~3 base pairs (B) TYPE: nucleic acid . (C) STRANDEDNESS: single (D) TOPOLOGY: linear IS

(ii)MOLECULE TYPE: other id nucleic ac (A) DESCRIPTION: /desc = "DNA"

(xi)SEQUENCE DESCRIPTION:
SEQ ID N0:34:

?0 TGATGGTGAT
GCA

f2.) INFORMATION
FOR
SEQ
ID
N0:35:

~S li)SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1351 base pairs (B) TYPE: nucleic acid iC) STRANDEDNESS: double (D) TOPOLOGY: linear i () (ii)MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc"DNA"
=

(ix)FEATURE:

iS (A) NAME/KEY: CDS

(B) LOCATION: 1..1335 (xi)SEQUENCE DESCRIPTION:
SEQ ID N0:35:

ATG GCT

Met HisHis His His His His Arg LeuLeuSerThr PheThr Met Ala AAT ACC

Glu TyrIle Lys Asn Ile Ile Ser IleLeuAsnLeu ArgTyr Asri Thr CTG TCT

Glu SerAsn His Leu Ile Asp Arg TyrAlaSerLys IleAsn Leu Ser GAT CCG

Ile GlySer Lys Val Asn Phe Ile AspLysAsnGln IleGln Asp Pro SS

AAA ATC

Leu PheAsn Leu Glu Ser Ser Glu ValIleLeuLys AsnAla Lys Ile GAA AAC

Ile ValTyr Asn Ser Met Tyr Phe SerThrSerPhe TrpIle Glu Asn TCC ATC

OJ Arg IlePro Lys Tyr Phe Asn Ser LeuAsnAsnGlu TyrThr Ser Ile AAT TCT

Ile IleAsn Cys Met Glu Asn Gly TrpLysValSer LeuAsn Asn Ser _~7y_ ~rp gg~pg~p PCTIUS97115394 Tyr Gly Glu Ile Ile Trp Thr Leu Gln Asp Thr Gln Glu Ile Lys Gln Arg Val Val Phe Lys Tyr Ser Gln Met Ile Asn Ile Ser Asp Tyr Ile 1l) Asn Arg Trp Ile Phe Val Thr Ile Thr Asn Asn Arg Leu Asn Asn Ser :AAA ATC TAC ATC AAC CGC CGT CTG ATC GAC CAG AAA CCG ATC TCC AAT 576 Lys Ile Tyr Ile Asn Gly Arg Leu Ile Asp Gln Lys Pro Ile Ser Asn Leu Gly Asn Ile His Ala Ser Asn Asn Ile Met Phe Lys Leu Asp Gly '_' 0 Cys Arg Asp Thr Hip Arg Tyr Ile Trp Ile Lys Tyr Phe Asn Leu Phe ~J GlIC AAA GAA CTG AAC GAA AAA GAA ATC AAA GAC CTG TAC GAC AAC CAG 720 Asp Lys Glu Leu Asn Glu Lys Glu Ile Lys Asp Leu Tyr Asp Asn Gln ~25 230 235 240 .i~) Ser Asn Ser Gly Ile Leu Lys Asp Phe Trp Gly Asp Tyr Leu Gln Tyr Asp Lys Pro Tyr Tyr Met Leu Asn Leu Tyr Asp Pro Asn Lys Tyr Val iJ 260 265 270 Asp Val Asn Asn Val Gly Ile Arg Gly Tyr Met Tyr Leu Lys Gly Pro Arg GlySerVal MetThrThrAsnIle TyrLeuAsnSerSer Leu1'yr -)J C;~T GGTACCAAA TTCATCATCAAGAAA TACGCGTCTGGTAAC AAGGAC 960 Arg GlyThrLys PheIleIleLysLys TyrAlaSerGlyA.sn.LysAsp J~ A3n ileValArg AsnAsnAspArgVal TyrIleAsnValVal ValLys Asn LysGluTyr ArgLeuAlaThrAsn AlaSerGlnAlaGly ValGlu Lys IleLeuSer AlaLeuGluIlePro AspValGlyAsnLeu SerGln Val 'JalValMet LysSerLyeAsnAsp GlnGlyIleThrAsn LysCys Lys MetAsnLeu GlnAspAsnAsnGly AsnAspIleGlyPhe IleGly Phe HisGlnPhe AsnAsnIleAlaLys LeuValAiaSerAsn TrpTyr i q05 410 415 CAG CGC

Asn Arg Ile GluArg Ser Ser ThrLeuGlyCys SerTrp Glu Gln Arg TTC ATC GTT GATGAC GGT TGG GAACGTCCGCTG TAACCCGGGA

Phe Ile Val AspAsp Gly Trp GluArgProLeu Pro Gly (2) INFORMATION FORSEQ ID N0:36:

1J (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH:

amino acids (B) TYPE:
amino acid (D) TOPOLOGY:
linear ?U (ii) MOLECULE TYPE: protein (ii) SEQUENCE DESCRIPTION: N0:36:
SEQ ID

Met His His HisHis His Met ArgLeuLeuSer ThrPhe Thr His Ala Glu Tyr Ile Lys Asn Ile Ile Asn Thr Ser Ile Leu Asn Leu Arg '1'yr ?() Glu Ser Asn His Leu Ile Asp Leu Ser Arg Tyr Ala Ser Lys Ile Asn Ile Gly 5er Lys Val Asn Phe Asp Pro Ile Asp Lys Asn Gln Ile Gin i~
Leu Phe Asn Leu Glu Ser Ser Lys Ile Glu Val Ile Leu Lys Asn Ala Ile Val Tyr Asn Ser Met Tyr Glu Asn Phe Ser Thr Ser Phe Trp Ile Arg Ile Pro Lys Tyr Phe Asn Ser Ile Ser Leu Asn Asn Glu Tyr Thr ile IleAsnCys MetGluAsnAsn Ser TrpLysValSer LeuAsn Gly Tyr GiyGluIle IleTrpThrLeu Gln ThrGlnGluIle LysGln Asp i() Arg ValValPhe LysTyrSerGln Met AsnIleSerAsp TyrIle Ile Asn ArgTrpIle PheValThrIle Thr AsnArgLeuAsn AsnSer Asn Lys Ile Tyr Ile Asn Gly Arg Leu Ile Asp Gln Lys Pro Ile Ser Asn Leu Gly Asn Ile His Ala Ser Asn Asn Ile Met Phe Lys Leu Asp Gly Cys Arg Asp Thr His Arg Tyr Ile Trp Ile Lys Tyr Phe Asn Leu Phe ~10 215 220 ' G~
Asp Lys Glu Leu Asn Glu Lys Glu Ile Lys Asp Leu Tyr Asp Asn Gln Ser Asn Ser Gly Ile Leu Lys Asp Phe Trp Gly Asp Tyr Leu Gln Tyr _ ~gl _ PCT/US97l15394 Asp Lys Pro Tyr Tyr Met Leu Asn Leu Tyr Asp Pro Asn Lys Tyr Val Asp Val Asn Asn Val Gly Ile Arg Gly Tyr Met Tyr Leu Lys Gly Pro Arg Gly Ser Val Met Thr Thr Asn Ile Tyr Leu Asn Ser Ser Leu Tyr I() Arg Gly Thr Lys Phe Ile Ile Lys Lys Tyr Ala Ser Gly Asn Lys Asp Asn Ile Val Arg Asn Asn Asp Arg Val Tyr Ile Asn Val Val Val Lys ~i Asn Lys Glu Tyr Arg Leu Ala 'Thr Asn Ala Ser Gln Ala Gly Val Glu Lys Ile Leu Ser Ala Leu Glu Ile Pro Asp Val Gly Asn Leu Ser Gln Val Val Val Met Lys Ser Lys Asn Asp Gln Gly Ile Thr Asn Lys Cys ~J I,ys Met Asn Leu Gln Asp Asn Asn App Gly Phe Ile Gly Asn Giy Ile Phe )Iis Glr~ Phe Asn Asn Leu Val Ser Asn Trp Tyr Ile Ala Lys Ala i () Asn Arg Gln Ile Glu Arg Ser Thr Leu Cys Ser Trp Glu Ser Arg Gly Phe lle Pro Val Asp Asp Gly Glu Arg Leu Trp Gly Pro ;2) INFORMATION FOR SEQ ID
N0:37:

(i) SEQUENCE CHARACTERISTICS:

~lU (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear tii) MOLECULE TYPE: otheric acid nucle LA) DESCRIPTION: ide~c "DNA"
=

(r,i) SEQUENCE DESCRIPTIOId:ID N0:37:
SEQ

TATTCGTCCA
TTGCATG

(2) INFORMATION FOR SEQ ID
N0:38:

(i) SEQUENCE CHARACTERISTICS:

JJ tA) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear O() (ii) MOLECULE TYPE: otheric acid nucle '(A) DESCRIPTION: /desc "DNA"
=

(ii) SEQUENCE DESCRIPTION:ID N0:38:
SEQ

AGGGCAATTA
CATCATG

(<) INFORMATION FOR SEQ ID
N0:39:

(i) SEQUENCE CHARACTERISTICS:

7() (A) LENGTH: 3876 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
_ (B) LOCATION: 1..3873 ~ l) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:39:

Met Pro Val 'Thr Ile Asn Asn Phe Asn Tyr Asn Asp Pro Ile Asp Asn Asp Asn Ile Ile Met Met Glu Pro Pro Phe Ala Arg Gly Thr Gly Arg ?U

Tyr Tyr Lys Ala Phe Lys Ile Thr Asp Arg Ile Trp Ile Ile Pro Glu AGA TI,T ACT TTT GGA TAT AAA CCT GAG GAT TTT AAT AAA AGT TCC GGT 192 Arg '1'yr Thr Phe Gly Tyr Lys Pro Glu Asp Phe Asn Lys Ser Ser Gly s() Ile Phe Asn Arg Asp Val Cys Glu Tyr Tyr Asp Pro Asp Tyr Leu Asn Thr Asn Asp Lys Lys Asn Ile Phe Phe Gln Thr Leu Ile Lys Leu Phe Asn Arg Ile Lys Ser Lys Pro Leu Gly Glu Lys Leu Leu Glu Met Ile Ile Asn Gly Ile Pro Tyr Leu Gly Asp Arg Arg Val Pro Leu Glu Glu Phe Ann Thr Asn Ile Ala Ser Val Thr Val Asn Lys Leu Ile Ser Asn Pro Gly Glu Val Glu Arg Lys Lys Gly Ile Phe Ala Asn Leu Ile Ile Phe Gly Pro Gly Pro Val Leu Asn Glu Asn Glu Thr Ile Asp Ile Gly Ile Gln Asn His Phe Ala Ser Arg Glu Gly Phe Gly Gly Ile Met Gln ATG AAA TTT TGT CCA GAA TAT GTA AGC GTA TTT AAT AF,T GTT CAA GAA 624 Met Lys Phe Cys Pro Glu Tyr Val Ser Val Phe Asn Asn Val Gln GIu Asn Lys Gly Ala Ser Ile Phe Asn Arg Arg Gly Tyr Phe Ser Asp Pro Ala Leu Ile Leu Met His Glu Leu Ile His Val Leu His Gly Leu Tyr Gly IleLysVal AspAspLeuProIle ValProAsnGluLysLys Phe Phe MetGlnSer ThrAsp1'hrIleGln AlaGluGluLeuTyrThr Phe _ ~0 260 265 270 Gly GlyGlnAsp ProSerIleIleSer ProSerThrAspLysher Ile Tyr AspLysVal LeuGlnAsnPheArg GlyIleVaIAspArgLeu Asn Lys ValLeuVal CysIleSerAspPro AsnIleAsnIleAsnIle Tyr Lye AsnLysPhe LysAspLysTyrLys PheValGIuAspSerGlu Gly ~J 325 330 335 Lys TyrSerIle AspValGluSerPhe AsnLysLeuTyrLysSer Leu i(1 Met LeuGlyPhe ThrGluIleAsnIle AlaGluAsnTyrLysIle Lys Thr ArgAlaSer TyrPheSerAspSer LeuProProValLysIle Lys 40 Asn LeuLeuAsp AsnGluIleTyrThr IleGluGluGlyPheAsn Ile Ser AspLysAsn MetGlyLysGluTyr ArgGlyGlnAsnLysAla Ile Asn LysGlnAla TyrGluGluZleSer LysGluHisLeuAlaVal Tyr i(1 Lys IleGlnMet CysLysSerValLys ValProGlyIleCysIle Asp Val AspAsnGlu AsnLeuPhePheIle AlaAspLysAsnSerPhe Ser Asp AspLeuSer LysAsnGluArgVal GluTyrAsnThrGlnAsn Asn 465 ' 470 475 480 Tyr IleGlyAsn AspPheProIleAsn GluLeuIleLeuAspThr Asp Leu IIeSerLys ZleGluLeuProSer GluAsnThrGluSerLeu Thr _?g4_ Asp Phe Asn Val Asp Val Pro Val Tyr Glu Lys Gln Pro Ala Ile Lys Lys Val Phe Thr Asp Glu Asn Thr Ile Phe Gln Tyr Leu Tyr Ser Gln _ ACA TTT CCT CTA AAT ATA AGA GAT ATA AGT TTA ACA TCT TCA TTT GAT 1680 1() Thr Phe Pro Leu Asn Ile Arg Asp Ile Ser Leu Thr Ser Ser Phe Asp Asp Ala Leu Leu Val Ser Ser Lys Val Tyr Ser Phe Phe Ser Met Asp jj 565 570 575 Tyr Ile Lys Thr Ala Asn Lys Val Val Glu Ala Gly Leu Phe Ala Gly Trp Val Lys Gln Ile Val Asp Asp Phe Val Ile Glu Ala Asn Lys Ser Ser Thr Met Asp Lys Ile Ala Asp Ile Ser Leu Ile Val Pro Tyr Ile Gly Leu Ala Leu Asn Val Gly Asp Glu Thr Ala Lys Gly Asn Phe Glu Ser Ala Phe Glu Ile Ala Gly Ser Ser Ile Leu Leu Glu Phe Ile Pro j1 645 650 655 Glu Leu Leu Ile Pro Val Val Gly Val Phe Leu Leu Glu Ser Tyr Ile Asp Asn Lys Asn Lys Ile Ile Lys Thr Ile Asp Asn Ala Leu Thr Lys Arg Val Glu Lys Trp Ile Asp Met Tyr Gly Leu Ile Val Ala Gln Trp JO Leu Ser Thr Val Asn Thr Gln Phe Tyr Thr Ile Lys Glu Gly Met Tyr Lys Ala Leu Asn Tyr Gln Ala Gln Ala Leu Glu Glu Ile Ile Lys Tyr ~J 725 730 735 6() Lys Tyr Asn Ile Tyr Ser Glu Glu Glu Lys Ser Asn Ile Asn Ile Asn Phe Asn Asp Ile Asn Ser Lys Leu Asn Asp Gly Ile Asn Gln Ala Met Asp Asn Ile Asn Asp Phe Iie Asn Glu Cys Ser Val Ser Tyr Leu Met 70 Lys Lys Met Ile Pro Leu Ala Val Lys Lys Leu Leu Asp Phe Asp Asn Thr Leu LysLysAsnLeu LeuAsnTyrIleAspGlu AsnLysLeuTyr Leu Ile GlySerValGlu AspGluLysSerLysVal AspLysTyrLeu IU

Lys Thr IleIleProPhe AspLeuSerThrTyrSer AsnIlefluIle Leu Ile LysIlePheAsn LysTyrAsnSerGluIle LeuAsnAsnIle Ile Leu AsnLeuArgTyr ArgAspAsnAsnLeuIle AspLeuSerGly Tyr Gly AlaLysValGlu ValTyrAspGlyValLys LeuAsnAppLys Asn Gln PheLysLeuThr SerSerAlaAspSerLys IleArgValThr .i (1 c:,lnTsn GinAsnIleIle PheAsnSerMetPheLeu AppPheSerVal ?> AGC TTT TGGATAAGGATA CCTAAATATAGGAATGAT GATATACAAAAT 2832 ser hhe TrpIleArgIle ProLysTyrArgAsnAsp AspIleGlnAsn -Il)Tyr t_e HisAsnG1u'I'yrThrIleIleAsnCysMet LysAsnAsnSer Gly Trp LysIleSerIle ArgGlyAsnArgIleIle 'I'rpThrLeuIle '13 965 970 975 App Ile AsnGlyLysThr LysSerValPhePheGlu TyrAsnIleArg ~U

Glu Asp ileSerGluTyr IleAsnArgTrpPhePhe ValThrIleThr Asn Asn LeuAspAsnAla LysIleTyrIleAsnGly ThrLeuGluSer Ann Mec AspIleLysAsp IleGlyGluValIleVal llsnGlyGluIle 1025 ' 1030 1035 1040 ACA T'~TRAATTAGATGGT GATGTAGATAGARCACAA TTTATTTGGATG 3168 Thr Phe LysLeuAspGly AspValAspArgThrGln PheIleTrpMet AAA TrITTTTAGTATTTTT AATACGCAATTAAATCAA TCAAATATTAAA 3216 Lys T,'rPheSerIlePhe AsnThrGlnLeuAsnGln SerAsnIleLys Glu Ile Tyr Lys Ile Gln Ser Tyr Ser Glu Tyr Leu Lys Asp Phe Trp Gly Asn Pro Leu Met Tyr Asn Lys Glu Tyr Tyr Met Phe Asn Ala Gly - ~~1 Asn Lys Asn Ser Tyr Ile Lys Leu Val Lys Asp Ser Ser Val Gly Glu Ile Leu Ile Arg Ser Lys Tyr Asn Gln Asn Ser Asn Tyr Ile Asn Tyr 1? 1125 1130 1135 Arg Asn Leu Tyr Ile Gly Glu Lys Phe~Ile Ile Arg Arg Glu Ser Asn Ser Gln Ser Ile Asn Jlsp Asp Ile Val Arg Lys Glu Asp Tyr Ile His Leu hsp Leu Val Leu His His Glu Glu Trp Arg Val Tyr Ala Tyr Lys ?0 'tyr Phe Lys Glu Gln Glu Glu Lys Leu Phe Leu Ser Ile Ile Ser Asp Ser Asn Glu Phe Tyr Lys Thr Ile Glu Ile Lys Glu Tyr Asp GIu Gln Pro Ser Tyr Ser Cys Gln Leu Leu Phe Lys Lys Asp Glu Glu Ser Thr GAT GAT ATA GGA TTG ATT GGT ATT CAT CGT TTC TnC GAA TCT GGA CTT 3799 Asp Asp .le Gly Leu Ile Gly Ile His Arg Phe Tyr Glu Ser Gly Val TTA CGT AF~A AAG TAT AAA GAT TAT TTT TGT ATA AGT AAA TGG TAC TTTi 379 I,eu Arg Lys Lys Tyr Lys Asp Tyr Phe Cys Ile Ser Lys Trp Tyr Leu AAA GAG GTA AAA AGG AAA CCA TAT AAG TCA AAT TTG GGA TGT AAT TGG 38~10 hys Glu 'Jal Lys Arg Lys Pro Tyr Lys Ser Asn Leu Gly Cys Asn Trp GGG TGG

Gln Phe Ile Pro Lys Asp Glu Thr Glu Gly Trp i2) INFORMATION FOR SEQ ID
N0:40:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1291 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein b~

(ri) SEQUENCE DESCRIPTION:
SEQ ID N0:40:

Met Pro Val Thr Ile Asn Asn Tyr Asn Asp Pro Ile Asp Asn Phe Asn Asp Asn Ile Ile Met Met Glu Pro Pro Phe Ala Arg Gly Thr Gly Arg 'i'yr Tyr Lys Ala Phe Lys Ile Thr Asp Arg Ile Trp Ile Ile Pro Glu Arg Tyr Thr Phe Gly Tyr Lys Pro Glu Asp Phe Asn Lys Ser Ser Gly lle Phe Asn Arg Asp Val Cys Glu Tyr Tyr Asp Pro Asp Tyr Leu Asn Thr Asn Asp Lys Lys Asn Ile Phe Phe Gln Thr Leu Ile Lys Lcu Phe 1~

Asn ArgIle LysSerLysProLeuGly GluLysLeuLeu GluMetIle lle AsnGly IleProTyrLeuGlyAsp ArgArgValPro LeuGluGlu Phe AsnThr AsnIleAlaSerValThr ValAsnLysLeu IleSerAsn Pro GlyGlu ValGluArgLysLysGly IlePheAlaAsn LeuIleIle Phe GlyYro GlyProValLeuAsnGlu AsnGluThrIle AspIleGly .i() pie GlnAnn HisPheAlaSerArgGlu GlyPheGlyGly IleMetGln Met LysPhe CysProGluTyrValSer ValPheAsnAsn ValGlnGlu Asn LysGly AlaSerIlePheAsnArg ArgGlyTyrPhe SerAspPro Ala LeuIle LeuMetHisGluLeuIle HisValLeuHis GlyLeuTyr Gly IleLys ValAspAspLeuProIle ValProAsnGlu LysLysPhe .~
i Phe matGln SerThrAsp'I'hrlle~ln AlaGluGluLeu TyrTlnrPhe Gly GlyGln AspProSerIleIleSer ProSerThrAsp LysSerIle ~1) 275 280 285 Tyr AspLys ValLeuGlnAsnPheArg GlyIleValAsp ArgLeuAsn J~ Lys ValLeu ValCy~IleSerAspPro AsnIleAsnIle AsnIleTyr Lys AsnLys PheLysAspLys'ryrLys PheValGluAsp SerGluGly Lys TyrSer IleAspValGluSerPhe AsnLysLeuTyr LysSerheu Met LeuGly PheThrGluIleAsnIle AlaGluAsnTyr LysIleLye (W 355 360 365 Thr ArgAla SerTyrPheSerAspSer LeuProProVal LysIleLys 70 Asn LeuLeu AspAsnGluIleTyrThr IleGluGluGly PheAsnIle _ ?gg _ Ser Asp Lys Asn Met Gly Lys Glu Tyr Arg Gly Gln Asn Lys Ala Ile j Asn LysGlnAlaTyr GluGluIleSerLys GluHisLeuAlaVal Tyr _ Lys IleGlnMetCys LysSerValLysVal ProGlyIleCysIle Asp Val AspAsnGluAsn LeuPhePheIleAla AspLysAsnSerP.heSer 1~ Asp AspLeuSerLys AsnGluArgValGlu TyrAnnThrGlnAsn Asn Tyr IieGlyAsnAsp PheProIleAsnGlu LeuIleLeuAspThr Asp ?U

Leu IleSerLysIle GluLeuProSerGlu Asn'ThrGluSerLeu Thr lasp PheAsnValAsp ValProValTyrGlu LysGlnProAlaIle Lys ~

'J 515 520 525 ~ys ValPhe'I'hrAsp GluAsnThrIlePhe GlnTyrLeuTyrSer C~ln :U 'Phr PheProLeuAsn IleArgAspIleSer LeuThrSerSerPhe Asp Asp AlaLeuLeuVal SerSerLysValTyr SerPhePheSerMet Asp ii Tyr IleLysThrAla AsnLysValValGlu AlaGlyLeuPheAia Gly Trp ValLysGlnIle ValAspAspPheVal IleGluAlaAsnLys Ser Ser ThrMetAspLys IleAlaAspIleSer LeuIleValProT'yrIle -)~ Gly LeuAlaLeuAsn ValGlyA,pGluThr AlaLysGlyAsnPhe Glu Ser AlaPheGluIle AlaGlySerSerIle LeuLeuCluPheIle Pro fit) Glu LeuLeuIlePro ValValGlyValPhe LeuLeuGluSerTyr Ile Asp AsnLysAsnLys IleIleLysThrIle AspAsnAlaLeuThr Lys Arg ValGluLysTrp IleAspMet'I'yrGly LeuIleValAlaGln Trp O) Leu SerThrValAsn ThrGlnPheTyrThr IleLysGluGlyMet Tyr Lys AlaLeuAsnTyr GlnAlaGlnAlaLeu GluGluIleIleLys Tyr -fi Lys TyrAsnIleTyr SerGluGluGluLys SerAsnIleAsnIle Asn Phe AsnAspIleAsn SerLysLeuAsnAsp GlyIleAsnGlnAla Met _ egg _ Asp Asn Ile Asn Asp Phe Ile Asn Glu Cys Ser Val Ser Tyr Leu Met Lys Lys Met Ile Pro Leu Ala Val Lys Lys Leu Leu Asp Phe Asp Asn Thr Leu Lys Lys Asn Leu Leu Asn Tyr Ile Asp Glu Asn Lys Leu Tyr 1() Leu Ile Gly Ser Val Glu Asp Glu Lys Ser Lys Val Asp Lys Tyr Leu Lys ':'hr Ile Ile Pro Phe Asp Leu Ser Thr Tyr Ser A sn Ile Glu Ile l~

Leu IleLysIlePheAsn LysTyrAsnSerGluIle LeuAsnAsnIle Ile LeuAsnLeuArgTyr ArgAspAsnAsnLeuIle AspLeuSerGly Tyr GlyAlaLysValGIu ValTyrAspGlyValLys LeuAsnAspLys :-,sn GlnPheLysLeuThr SerSerAlaAspSerLyy IleArgValThr Gln AsnGlnAsnIleIle PheAsnSerMetPheLeu AspPheSerVal y15 92U 925 () Ser PheTrpIleArgIle ProLysTyrArgAnnAsp AspIleGlnAsn 'I'yr IleHisAsnGluTyr 'I'hrIleIleAsnCysMet LysAsnAsnSer Gly 1'rpL,,sIleSerIle ArgGlyAsnArgIleIle TrpThrLeuIle 4(~nsp IleAsnGlyLysThr LysSerValPhePheGlu TyrAsnIleArg Glu AspI1eSerGluTyr IleAsnArgTrpPhePhe ValThrIlPThr ..l i :a AsnLeuAspAsnAla LysIleTyrIieAsnGly ThrLeuc;luSer n .010 1015 1020 Asn MetTsspIleLysAsp IleGlyGluValIleVal AsnGlyGluIle ~()1025 , 1030 1035 1090 Thr PheLysLeuAspGly AspValAspArgThrGln PheIleTrpMet ~J Lys T.yrPheSerIlePhe AsnThrGlnLeuAsnGln SerAsnIleLys Glu IleTyrLyeIleGln SerTyrSerGluTyrLeu LysAspPheTrp W) Gly AsnProLeuMetTyr AsnLysGluTyrTyrMet PheAsnAluGly Asn LysAsnSerTyrIle LysLeuValLysAspSer SerValGlyGlu Ile LeuIleArgSerLys TyrAsnGlnAsnSerAsn TyrIleAsnTyr 70 Arg AsnLeuTyrIleGly GluLyePheIleIleArg ArgGluSerAsn -2~)0-Ser Gln Ser Ile AspAspIle ArgLysGluAsp TyrIleHis Asn Val i Leu Asp Leu Val HisHisGlu TrpArgValTyr AlaTyrLys Leu Glu T'yr Phe Lys Glu GluGluLys PheLeuSerIle IleSerAsp Gln Leu Ser Asn Glu Phe LysThrIle IleLysGluTyr AspGluGln Tyr Glu Pro Ser Tyr Ser GlnLeuLeu LysLysAspGlu GluSerThr Cys Phe nsp Asp Ile Gly IleGlyIle ArgPheTyrGlu SerGlyVal Leu His Leu Arg Lys Lys LysAspTyr CysIleSerLys TrpTyrLeu Tyr Phe Lys Glu Val Lys LysProTyr SerAsnLeuGly CysAsnTrp Arg Lys ~~ln Phe Iie Pro AspGluGly ThrGlu Lys Trp ?() f2) INFORMATION SEQID
FOR N0:41:

(i) SEQUENCE
CHARACTERISTICS:

(A) LENGTH:

base Dairs (8) TYPE:nucleic acid >> (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii)MOLECULE DNA(genomic) TYPE:

( FEATURE
~
r.
) (A) NAME/KEY: CDS

IB) LOCATION: 1..3873 li) SEQUENCE ID
DESCRIPTION: N0:41:
SEQ

:~ 1 hTG CCF.GTT ACA AATAATTTT TATAATGATCCT ATTGATAAT 48 ATA AAT

h9et Pro val Thr AsnAsnPhe TyrAsnAspPro IleAspAsn Ile Asn AAT AAT ATT ATT ATGGAGCCT TTTGCGAGAGGT ACGG:~GAGA 96 ATG CCA

Asn Asn Ile Ile MetGluPro PheAlaArgGly ThrGlyArg Met Pro TAT TAT AAA GCT AAAATCACA CGTATTTGGAT'AATACCGGAA 144 TTT GAT

Tyr Tyr Lys Ala LysIleThr ArgIleTrpIle IleProGlu Phe Asp AGA TAT ACT TTT TATAAACCT GATTTTAATAAA AGTTCCGGT 19~
GGA GAG

Arg Tyr Thr Phe TyrLysPro AspPheAsnLys SerSerGly Gly Glu GAT TAT

Ile Phe Asn Arg ValCysGlu TyrAspProAsp TyrLeuAsn Asp Tyr () i AAG TTA

Thr Asn Asp Lys AsnIlePhe GlnThrMetIle LysLeuPhe Lys Leu TCA GGT

_ 7 c) j _ Asn Arg Ile Lys Ser Lys Pro Leu Gly Glu Lys Leu Leu Glu Met Ile Ile Asn Gly Ile Pro Tyr Leu Gly Asp Arg Arg Val Pro Leu Glu Glu AAC AAA

Phe AsnThrAsn IleAlaSer ValThrValAsnLysLeu IleSerAsn L~ro GlyGluVal GluArgLy, LysGlyIlePheAlaAsn LeuIleIle Phe flyProGly ProValLeu AsnGluAsnGluThrIle AspIleGly Ile GlnAsnHis PheAlaSer ArgGluGlyPheGlyGly IleMetGln Met LysPheCys ProGluTyr ValSerValPheAsnAsn ValGlnGlu AAC AAhGGCGCA AGTATATTT AATAGACGTGGATATTTT TCAGATCCA 67?

Asn LysGlyAla SerIlePhe AsnArgArgGlyTyrPhe SerAspPro :10 215 220 GCC TTGATATTA ATGCATGAA CTTATACATGTTTTACTiTGGATTATAT 720 f~la LeuIleLeu MetHisGlu LeuIleHisValLeuHis GlyLeuTyr ~25 230 235 24p i>

<;ly IleLysVal AspAspLeu ProIleValProAsnGlu LysLysPhe ~()TTT ATGCAATCT ACAGATGCT ATACAGGCAGAAGAACTA TATACATTT 816 Phe MetGlnSer ThrAspAla IleGlnAlaGluGluLeu TyrThrPhe Gly GlyGlnAsp ProSerIle lleT'hrProSerThrAsp LysSerIle TAT GATAAAGTT TTGCAAAAT TTTAGAGGGATAGTTGAT AGACT'"AAC 912 Tyr AspLysVal LeuGlnAsn PheArgGlyIleValAsp ArgLeuAsn >~1 290 295 300 Lys ValLeuVal CysIleSer AspProAsnIleAsnIle AsnIleTyr Ji Lys AsnLysPhe LysAspLye TyrLysPheValGluAsp SerGluGly (O)AAA TATAGTATA GATGTAGAA AGTTTTGATAAATTATAT AAAAGCTTA 1056 Lys TyrSerIle AspValGlu SerPheAspLysLeuTyr LysSerLeu OJ Met PheGlyPhe ThrGluThr AsnIleAlaGluAsnTyr LysIleLys Thr ArgAlaSer TyrPheSer AspSerLeuProProVal LysIleLys WO 98108540 PC'fILJS97/15394 Asn Leu Leu Asp Asn Glu Ile Tyr Thr Ile Glu Glu Gly Phe Asn Ile Ser Asp Lys Asp Met Glu Lys Glu Tyr Arg Gly Gln Asn Lys Ala Ile ll) Asn Lys Gln Ala Tyr Glu Glu Ile Ser Lys Glu His Leu Ala Val Tyr Lys Ile Gln Met Cys Lys Ser Val Lys Ala Pro Gly Ile Cys Ile Asp '_'U

Val Asp Asn Glu Asp Leu Phe Phe Ile Ala Asp Lys Asn Ser Phe Ser Asp Asp Leu Ser Lys Asn Glu Arg Ile Glu Tyr Asn Thr Gln Ser Asn Tyr lle Glu Asn Asp Phe Pro Ile Asn Glu Leu Ile Leu Asp Thr Asp ?~) Leu Ile Ser Lys Ile Glu Leu Pro Ser Glu Asn Thr Glu Ser Leu Thr Asp Phe Asn Val Asp Val Pro Val Tyr Glu Lys Gln Pro Ala Ile Lys iJ 515 520 525 C.ys Ile Phe Thr Asp Glu Asn Thr Ile Phe Gln Tyr Leu Tyr Ser Gln ACA TTT CTC TTA GAT ATA AGA GAT ATA AGT TTA ACA TCT TCT~ TTT GAT 1680 Thr Phe Leu Leu Asp Ile Arg Asp Iie Ser Leu Thr Ser Ser Phe Asp GAT GCATTA TTATTTTCTAAC AAA TATTCATTTTTT TCTA'rGGAT 1728 GTT

Asp AlaLeu LeuPheSerAsn LysValTyrSerPiiePhe SerMetAsp JU Tyr IleLys ThrAlaAsnLys ValValGluAlaGlyLeu PheAlaGly Trp ValLys GlnIleValAsn AspPheValIleGluAla AsnLysSer Asn ThrMet AspLysIleAla AspIleSerLeuIl.eVal ProTyrIle Gly LeuAla LeuAsnValGly AsnGluThrAlaLysGly AsnPheGlu (7J AAT GCTTTT GAGATTGCAGGA GCCAGTATTCTACTAGAA TTTATACCA 1968 Asn AlaPhe GluIleAlaGly AlaSerIleLeuLeuGlu PheIlePro Glu LeuLeu IleProValVal GlyAlaPheLeuLeuGlu SerTyrIle ;_ WO 981'08540 PCT/US97115394 AAA GAT

Asp Asn LysAsnLysIle Ile Thr Ile Asn AlaLeuThrLys Lys Asp ATG TTA

Rrg Asn GluLysTrpSer Asp Tyr Gly Ile ValAlaGlnTrp _ Met Leu TTT ATA

Leu Ser ThrValAsnT'hrGln Tyr Thr Lys GluGlyMetTyr Phe Ile :1AGGCT TTAAATTATCAA GCA GCA TTG GAA ATAATAAAATAC 22pg CAA GAA

Lys Ala LeuAsnTyrGln Ala Ala Leu Glu IleileLysTyr Gln Glu AAA TCA

T~rgTyr AsnIleTyrSer Glu Glu Lys Asn IleAsnIleAsp Lys Ser Phe Asn Asp Ile Asn Ser Lys Leu Asn Glu Gly Ile Asn Gln Ala Ile C'~F,TT~sTATAAATAATTTT AATGGATGT GTATC~~TATTTAATG ' 5:

i.spRsn IleAsnAsnhhe IleAsnGlyCys ValSerTyrLeuMet Ser i() F,AAAT,AATGATTCCATTA GCTGTAGAAAAA CTAGACTTTGATAAT 2400 TTA

L;s Lys MetIleProLeu AlaValGluLys LeuAspPheAspAsn Leu .-.-",CTCTC ARAAAAAATTTG TTAAATTATATA GAAAATAAATTATAT 2448 GAT

Thr Leu LysLysAsnLeu LeuAsnTyrIle GluAsnLyeLeuTyr Asp AAA

.,euIle GlySerAlaGlu TyrGluLysSer ValAsnLysTyrLeu Lys TAT

Lys Thr IleMetProPhe AspLeuSerIle ThrAsnAspThrIle Tyr 'Tr1ATA GhAATCTTT.AAT AAATATAATRGC ATTT'~AAATAATATT 2592 GAA

Leu Ile GluMetPheAsn LysTyrAsnSer IleLeuAsnAsnIle Glu J
() TTA

Ile Leu AsnLeuArgTyr LysAspAsnAsn IleAspLeuSerGly Leu GTC

Tyr Gly AlaLysValGlu ValTyrAspGly GluLeuAsnAspLys Val AAT

TssnGln PheLysLeuThr SeiSerAlaAsnSer LysIleArgVal Thr Gin Asn GlnAsnIleIle PheAsnSerValPhe LeuAspPheSer Val Ser Phe TrpIleArgIle ProLysTyrLysAsn AspGlyIleGln Asn Tyr Ile His Asn Glu Tyr Thr Ile Ile Asn Cys Met Lys Asn Asn Ser Gly Trp Lys Ile Ser Ile Arg Gly Asn Arg Ile Ile Trp Thr Leu Ile Asp Ile Asn Gly Lys Thr Lys Ser Val Phe Phe Glu Tyr Asn Ile Arg Glu Asp Ile Ser Glu Tyr Ile Asn Arg Trp Phe Phe Val Thr Ile Thr Asn Asn Leu Asn Asn Ala Lys Ile Tyr Ile Asn Gly Lys Leu Glu Ser Asn Thr Asp Ile Lys Asp Ile Arg Glu Val Ile Ala Asn Gly Glu Ile Iie Phe L_.rs Leu Asp Gly Asp Ile Asp Arg Thr Gln Phe Ile Trp Met :,AA TAT TTC AGT ATT TTT AAT ACG GAA TTA AGT CAA TCA AAT ATT GAA 3216 .i~) Lys Tyr Phe Ser Ile Phe Asn Thr Glu Leu Ser Gln Ser Asn Ile Glu Glu Arg Tyr Lys Ile Gin Ser Tyr Ser Glu Tyr Leu Lys Asp the Trp ~J 1075 1080 1085 Gly Asn Pro Leu Met Tyr Asn Lys Glu Tyr Tyr Met Phe Asn Ala Gly ~~) Asn Lys Asn Ser Tyr Ile Lys Leu Lys Lys Asp Ser Pro Val Gly Glu aTT TTA ACA CGT AGC AAA TAT AAT CAA AAT TCT AAA TAT A':A AAT TAT 3408 tle Leu 'ihr Arg Ser Lys Tyr Asn Gln Asn Ser Lys Tyr Ile Asn Tyr ~(J Arg Asp Leu Tyr Ile Gly Glu Lys Phe Ile Ile Arg Arg Lys Ser Asn Ser Gln Ser Ile Asn Asp Asp Ile Val Arg Lys Glu Asp Tyr Ile Tyr Leu Asp Phe Phe Asn Leu Asn Gln Glu Trp Arg Val Tyr Thr Tyr Lys (~(1 Tyr Phe Lys Lys Clu Glu Glu Lys Leu Phe Leu Ala Pro Ile Ser Rsp Ser Asp Glu Phe Tyr Asn Thr Ile Gln Ile Lys Glu Tyr Asp Glu Gln $-WD 9g~g~p PCTIIJS97115394 Pro Thr Tyr Ser Cys Gln Leu Leu Phe Lys Lys Asp Glu Glu Ser Thr Asp Glu Ile Gly Leu Ile Gly Ile His Arg Phe Tyr Glu Ser Gly Ile 11) Val Phe Glu Glu Tyr Lys Asp Tyr Phe Cys Ile Ser Lys Trp Tyr Leu Lys Glu Val Lys Arg Lys Pro Tyr Asn Leu Lys Leu Gly Cys Asn Trp Gln Phe Ile 1'ro Lys Asp Glu Gly Trp Thr Glu y) (2) INFORMATION 5EQ ID N0:42:
FOR

(i) SEQUENCECHARACTERISTICS:

(A) acids LENGTH:

amino ~J (D) TYPE:
amino acid (D1 TOPOLOGY:
linear iii) MOLECULETYPE: protein ?t) (xi) SEQUENCEDESCRIPTION: IDN0:42:
SEQ

Met Yro Thr Asn Asn Phe TyrAsn ProIleAsp VW Ile Asn Asp Asn Asn Asn Ile Met Glu Pro PheAla GlyThrGly Ile Met Pro Arg llrg Tyr Tyr Ala Lys Ile Thr ArgIle IleIlePro Lys Phe Asp Trp Glu Arg Tyr Thr Phe G.ly Tyr Lys Pro Glu Asp Phe Asn Lys Ser Ser Cly Ile Phe Asn Arg Asp Val Cys Glu Tyr Tyr Asp Pro Asp T'yr Leu Asn 'rhr Asn Asp Lys Lys Asn Ile Phe Leu Gln Thr Met Ile Lys Leu the Asn Arg Ile Lys Ser Lys Pro Leu Gly Glu Lys Leu Leu Glu Met Ile Ile Asn Gly Ile Pro Tyr Leu Gly Asp Arg Arg Val Pro Leu Glu Glu ji Phe Asn 1'hr Asn Ile Ala Ser Val Thr Val Asn Lys Leu Ile Ser Asn Pro Gly Glu Val Giu Arg Lys Lys Gly Ile Phe Ala Asn Leu Ile Ile WO 9810854 PCT/US97/l5394 ~Phe Gly Pro Gly Pro Val Leu Asn Glu Asn Glu Thr Ile Asp Ile Gly Ile Gln Asn His Phe Ala Ser Arg Glu Gly Phe Gly Gly Ile Met Gln J 1$0 185 190 Met Lys Phe Cys Pro Glu Tyr Val Ser Val Phe Asn Asn Val Gln Glu Asn Lys Gly Ala Ser Ile Phe Asn Arg Arg Gly Tyr Phe Ser Asp Pro Ala Leu IleLeuMetHis GluLeuIleHisVal LeuHisGlyLeu'Cyr li Gly Ile LysValAspAsp LeuProIleValPro AsnGluLysLysPhe Phe Met GlnSerThrAsp AlaIleGlnAlaGlu GluLeuTyrThrPhe Gly Gly GlnAspProSer IleIleThrProSer ThrAspLysSerIle ~J ~'yrAsp LysValLeuGln AsnPheArgGlyIle ValAspArgLeuAsn L;:sVal LeuValCysIle SerAspP=-oAsnIle AsnIleAsnIleT~r i t) L.rsAsn LysPheLysAsp LysTyrLysPheVal GluAspSerGluGly Lys Tv_rSerIleAspVal GluSerPheAspLys LeuTyrLysSerLeu ?? 340 345 350 Met Phe GlyPheThrClu ThrAsnIleAlaGlu AsnTyrLysIleLys Thr Arg AlaSerTyrPhe SerAspSerLeuPro ProValLysIleLys Asn Leu LeuAspAsnGlu IleTyrThrIleGlu GluGlyPheAsnlle .~
i Ser Asp LysAspMetGlu LysGluTyrArgGly GlnAsnLysAlalle 405 410 41!i F~snLys GlnAlaTyrGlu GluIieSerLysGlu HisLeuA1aValTyr J~) 420 425 930 Lys Ile GlnMetCysLys SerValLysAlaPro GlyIleCysIleAsp ~J Val Asp AsnGluAspLeu PhePheIleAlaAsp LysAsnSerPheSer Asp Asp LeuSerLysAsn GluArgIleGluTyr AsnThrGlnSerAsn Tyr Ile Giu Asn Asp Phe Pro Ile Asn Glu Leu Ile Leu Asp Thr Asp Leu Ile Ser Lys Ile Glu Leu Pro Ser Glu Asn Thr Glu Ser Leu Thr Asp Phe Asn Val Asp Val Pro Val Tyr Glu Lys Gln Pro Ala Ile Lys 7l) Lys Ile Phe Thr Asp Glu Asn Thr Ile Phe Gln Tyr Leu Tyr Ser Gln ~rp 9g~p PCTIUS97/15394 Thr Phe Leu Leu Asp Ile Arg Asp Ile Ser Leu Thr Ser Ser Phe Aso i Asp Ala Leu Leu Phe Ser Asn Lys Val Tyr Ser Phe Phe Ser Met Asp Tyr Ile Lys Thr Ala Asn Lys Val Val Glu Ala Gly Leu Phe Ala Gly ) t) 580 585 590 Trp Val Lys Gln Ile Val Asn Asp Phe VaI Ile Glu Ala Asn hys Ser Asn Thr Met Asp Lys Ile Ala Asp Ile Ser Leu Ile Val Pro ~ryr Ile Gly Leu Ala Leu Asn Val Gly Asn Glu Thr Ala Lys Gly Asn Phe Glu Asn Ala Phe Glu Ile Ala Gly AIa Ser Ile Leu Leu Glu Phe Ile Pro Glu Leu Leu Ile Pro Val Val Gly Ala Phe Leu Leu Glu Ser Tyr Ile l~sp Asn Lys Asn Lys Ile Ile Lys Thr Ile Asp Asn Ala Leu Thr Lys !() F.rc7 Ann Vlu Lys Trp Ser Asp Met Tyr Gly Leu Ile Val Ala Gln Trp I.eu Sar Thr Val Asn Thr Gln Phe Tyr Thr Ile Lys Glu Gly Met Tyr i~
Lys AIa Leu Asn T~~r Gln Ala Gln Ala Leu Glu Glu Ile Ile Lys Tyr Arg 'I':~r Asn Ile Tyr Ser Glu Lys Glu Lys Ser Asn Ile Ann Ile Asp '14U 745 750 Phe Asn App IIe Asn Ser Lys Leu Asn Glu Gly Iie T.sn Gln Ala lle Asp Asn Ile Asn Asn Phe Ile Asn Gly Cys Ser Val Ser Tyr Leu Met Lys Lys Met Ile Pro Leu Ala Val Glu Lys Leu Leu Asp Phe Asp Asn J (~) Thr Leu Lys Lys Asn Leu Leu Asn Tyr Ile Asp Glu Asn Lys Leu Tyr i,eu Ile Gly Ser Ala Glu Tyr Glu Lys Ser Lys Val Asn Lys Tyr Leu Lys ThrIle MetProPheAsp LeuSerIleTyrThr AsnAsp Ile Thr Leu IleGlu MetPheAsnLys TyrAsnSerG1uIle LeuAsnAsnIle Ile LeuAsn LeuArgTyrLys AppAsnAsnLeuIle AspLeuSerGly ~t Tyr GlyAla LysValGluVal TyrAspGlyValGlu LeuAsnAspLye Asn GlnPhe LysLeuThrSer SerAlaAsnSerLys IleArQValThr Gln Asn Gln Asn Ile Ile Phe Asn Ser Val Phe Leu Asp Phe Ser Val Ser Phe Trp Ile Arg Ile Pro Lys Tyr Lys Asn Asp Gly Ile Gln Asn Tyr Ile His Asn Glu Tyr Thr Ile Ile Asn Cys Met Lys Asn Asn Ser I() Gly Trp Lys Ile Ser Ile Arg Gly Asn Arg Ile Ile Trp Thr Leu Ile Asp Ile Asn Gly Lys Thr Lys Ser Val Phe Phe Glu Tyr Asn Ile Arg Glu Asp Ile Ser Glu Tyr Ile Asn Arg Trp Phe Phe Val Thr Ile Thr Asn Asn AsnAsnAla Lys Tyr IleAsnGly Leu GluSer Leu Ile Lys Jlsn Thr IleLysAsp Ile Glu ValIleAla Gly GluIle Asp Arg Asn Ile Fine LeuAspGly Asp Asp ArgThrGln Ile TrpMet Lys Ile Phe Lys Ty: SerIlePhe Asn Glu LeuSerGln Asn IleGlu Phe Thr Ser la7o Glu Arg Tyr Lye Ile Gln Ser Tyr Ser Glu Tyr Leu Lys Asp Phe Trp Gly A>n Pro Leu Met Tyr Asn Lys Glu 'fyr Tyr Met Phe Asn A1a Gly Asn Lys Asn TyrIle LysLeuhysLysAspSer ProValGly Ser Glu Ile Leu 1'hrArgSerLys TyrAsnGlnAsnSerLys .TyrIleAsn 'rya Arg Asp LeuTyrIleGly GluLysPheIleIleArg ArgLysSer Asn Ser Gln SerIleAsnAsp AspIleValArgLysGlu rlspTy_~Ile Tvr Leu Asp thePheAsnLeu AsnGlnGluTrpArgVal TyrT'hrTyr Lys Tyr Phe LysLysGluGlu GluLysLeuPheLeuAla ProIleSer Asp Ser Asp GluPheTyrAsn ThrIleGlnIleLysGlu TyrAspGlu Gln 1205 1210 1.x.15 Pro Thr TyrSerCysGln LeuLeuPheLysLysAsp GluGluSer Thr Asp Glu IieGlyLeuIle GlyIleHisArgPheTyr GluSerGly Ile Val Phe GluGluTyrLys AspTyrPheCysIleSer LysTrpTyr Leu Lys Glu ValLysArgLys ProTyrAsnLeuLysLeu Gl.yCy~Asn Trp 1.265 1270 1275 Gln Phe IleProLysAsp GluGlyTrpThrGlu yy0 gg~qp PCT/US97/15394 (2) INFORMATION FOR SEQ ID N0:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1526 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D> TOPOLOGY: linear IU
(ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "DNA"
i ir.l FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 108..1523 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:43:

Met Gly His ~i C~'~T CAT CF1T CAT C'.AT CAT CAT CAT CAC AGC AGC GGC CAT ATC GAA GGT 164 His tiffs His His His His His His His Ser Ser Gly His Ile Glu Gly ~() CGT CAfATGGCTAGC ATGGCTGATACAATA CTAATAGAA TTTAAT 212 ATG

Arg flipMetAlaSer MetAlaAspThrIle LeuIleGluMetPheAsn ~0 25 30 35 ?J Lys TyrAsnSerGlu IleLeuAsnAsnIle IleLeuAsnLeuArgTyr Arg AppAsnAsnLeu IleAspLeuSerGly TyrGlyAlaLy>ValGlu C;TA TT1TGATGGGGTC AAGCTTAATGATAAA AATCAATTTAAATTAACT_ 356 Val TyrAspGlyVal LysLeuAsnAspLys AsnGlnPheLysLeuThr Ser SerAlaAspSer LysIleArgValThr GlnAnnGlnAsnIleIle Phe AsnSerMetPhe LeuAspPheSerVal SerPheTrpIleArgIle ~

J~ Pro LysTyrArgAsn AspAspIleGlnAsn TyrIleHisAsnGluTyr ACG ATAATTAATTGT ATGAAAAATAATTCA GGCTGGAAAATATCTATT. 548 Thr IleIleAsnCys MetLysAsnAnnSer GlyTrpLysIleSerIle Arg GlyAsnArgIle IleTrpThrLeuIle AspIleAsnClyLysThr (~
i Lys SerValPhePhe GluTyrAsnIleArg GluAspIleSerGluTyr ...: .
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET
COMPREND PLUS D'UN TOME.
CECI EST LE TOME ~_ DE
NOTE: Pour les tomes additionels, veuitlez cantacter le Bureau canadien des brevets JUMBO APPLlCATlONS/PATENTS
THIS SECTION OF THE APPLlCATIONIPATENT CONTAINS MORE
THAN ONE VOLUME
THIS IS VOLUME ~- OF
NOTE: For additional volumes please contact the Canadian Patent Office

Claims (24)

1. A host cell containing a recombinant expression vector, said vector encoding a protein comprising at least a portion of a Clostridium botulinum toxin. said toxin selected from the: group consisting of type F3 toxin and type E toxin.
2. The host cell of Claim 1, wherein and said host cell is capable of expressing said protein at a level greater than or equal to 5% of the total cellular protein.
3. The host cell of Claim 1, wherein and said host cell is capable of expressing said protein as a soluble protein at a level greater than or equal to 0.25% of the total soluble cellular protein.
4. The host cell of Claim 1, wherein said most cell is an Escherichia coli cell.
5. The host cell of Claim 1, wherein said host cell is an insect cell.
6. The host cell of Claim 1, wherein said host cell is a yeast cell.
7. A host cell containing a recombinant expression vector, said vector encoding a fusion protein comprising a non-toxin protein sequence and at least a portion of a (Clostridium botulinum toxin, said toxin selected from the group consisting of type B toxin and type E
toxin.
8. The host cell of Claim 7, wherein said portion of said toxin comprises the receptor binding domain.
9. The host cell of Claim 7, wherein said non-toxin protein sequence comprises a poly-histidine tract.
10. A vaccine comprising a fusion protein, said fusion protein comprising a non-toxin protein sequence and at least a portion of a Clostridium botulinum toxin, said toxin selected from the group consisting of type B toxin and type E toxin.
11. The vaccine of Claim 10 further comprising a fusion protein comprising a non-toxin protein sequence and at least a portion of Clostridium botulinum type A toxin.
12. The vaccine of Claim 10, wherein said portion of said Clostridium botulinum toxin comprises the receptor binding domain.
13. The vaccine of Claim 10 wherein said non-toxin protein sequence comprises a poly-histidine tract.
14. The vaccine of Claim 10, wherein said vaccine is substantially endotoxin-free.
15. A method of generating antibody directed against a Clostridium botulinum toxin comprising:
a) providing in any order:
i) an antigen comprising a fusion protein comprising a non-toxin protein sequence and at least a portion of a Clostridium botulinum toxin, said toxin selected from the group consisting of type B toxin and type E toxin, and ii) a host; and b) immunizing said host with said antigen so as to generate an antibody.
16. The method of Claim 15, wherein said antigen further comprises a fusion protein comprising a non-toxin protein sequence and at least a portion of Clostridium botulinum type A toxin.
17. The method of Claim 15, wherein said portion of said Clostridium botulinum toxin comprises the receptor binding domain.
l8. The method of Claim 15, wherein said non-toxin protein sequence comprises a poly-histidine tract.
19. The method of Claim 15 wherein said host is a mammal.
20. The method of Claim 19 wherein said mammal is a human.
21. The method of Claim 15 further comprising step c) collecting said antibodies from said host.
22. The method of Claim 23 further comprising step d) purifying said antibodies.
23. The antibody raised according to the method of Claim 15.
24. The antibody raised according to the method of Claim 16.
CA002296765A 1996-08-28 1997-08-28 Soluble recombinant botulinum toxin proteins Abandoned CA2296765A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US08/704,159 1996-08-28
US08/704,159 US6967088B1 (en) 1995-03-16 1996-08-28 Soluble recombinant botulinum toxin proteins
PCT/US1997/015394 WO1998008540A1 (en) 1996-08-28 1997-08-28 Multivalent vaccine for clostridium botulinum neurotoxin

Publications (1)

Publication Number Publication Date
CA2296765A1 true CA2296765A1 (en) 1998-03-05

Family

ID=24828333

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002296765A Abandoned CA2296765A1 (en) 1996-08-28 1997-08-28 Soluble recombinant botulinum toxin proteins

Country Status (4)

Country Link
EP (1) EP1105153A4 (en)
AU (1) AU4245097A (en)
CA (1) CA2296765A1 (en)
WO (1) WO1998008540A1 (en)

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7214787B1 (en) * 1993-09-21 2007-05-08 United States Of America As Represented By The Secretary Of The Army Recombinant vaccine against botulinum neurotoxin
US8012491B2 (en) 1996-08-23 2011-09-06 Syntaxin, Ltd. Recombinant toxin fragments
US7192596B2 (en) 1996-08-23 2007-03-20 The Health Protection Agency Ipsen Limited Recombinant toxin fragments
GB9617671D0 (en) 1996-08-23 1996-10-02 Microbiological Res Authority Recombinant toxin fragments
GB9721189D0 (en) 1997-10-08 1997-12-03 Speywood Lab The Limited Analgesic conjugates
DE69937890D1 (en) 1998-07-10 2008-02-14 U S Army Medical Res Inst Of I VACCINES AGAINST NEUROTOXINES OF CLOSTRIDIUM BOTULINUM
AU4641299A (en) * 1998-07-22 2000-02-14 Agricultural Research Council Vaccine comprising a non-toxic immunogenic derivative of (clostridium botulinum)type d neurotoxin
GB9818548D0 (en) 1998-08-25 1998-10-21 Microbiological Res Authority Treatment of mucas hypersecretion
US20040071736A1 (en) 1998-08-25 2004-04-15 Health Protection Agency Methods and compounds for the treatment of mucus hypersecretion
GB9907429D0 (en) 1999-03-31 1999-05-26 Microbiological Res Authority Modulation of C-fibre activity
EP2267010B1 (en) 1999-08-25 2014-05-07 Allergan, Inc. Activatable recombinant neurotoxins
US7740868B2 (en) 1999-08-25 2010-06-22 Allergan, Inc. Activatable clostridial toxins
US20080038274A1 (en) 1999-09-23 2008-02-14 Foster Keith A Inhibition of secretion from non-neuronal cells
US7691983B2 (en) 2000-07-21 2010-04-06 Allergan, Inc. Chimera botulinum toxin type E
DE60130266D1 (en) * 2000-11-06 2007-10-11 Us Army Med Res Mat Command RECOMBINANT LIGHT CHAIN OF BOTOLINUM NEUROTOXIN AND FUSION PROTEINS FOR USE IN RESEARCH AND CLINICAL THERAPY
JP3995541B2 (en) * 2002-06-28 2007-10-24 株式会社ゲン・コーポレーション Anti-chicken coccidiosis composition
US20050042775A1 (en) * 2003-08-21 2005-02-24 Nicholas Pomato Botulinum antitoxin compositions and methods
GB2456549A (en) * 2008-01-18 2009-07-22 Health Prot Agency Modified botulinum neurotoxin serotype E (BoNT/E) peptides
WO2009152452A1 (en) * 2008-06-12 2009-12-17 Huei-Hsiung Yang Fermentation method for the production of soluble botulinum neurotoxin proteins
JP6084631B2 (en) 2011-12-08 2017-02-22 ノバルティス アーゲー Clostridium difficile toxin-based vaccine
WO2013180799A1 (en) * 2012-05-30 2013-12-05 President And Fellows Of Harvard College Engineered botulinum neurotoxin
WO2016154534A1 (en) 2015-03-26 2016-09-29 President And Fellows Of Harvard College Engineered botulinum neurotoxin
CA2986026A1 (en) 2015-05-15 2016-11-24 Board Of Regents Of The University Of Nebraska Engineered clostridium botulinum toxin adapted to deliver molecules into selected cells
EP3504226A1 (en) 2016-08-24 2019-07-03 President and Fellows of Harvard College Engineered botulinum neurotoxin

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996005222A1 (en) * 1994-08-08 1996-02-22 Wisconsin Alumni Research Foundation Purification and pharmaceutical compositions containing type g botulinum neurotoxin
BR9509903A (en) * 1994-10-24 1997-11-25 Ophidian Pharm Inc Fusion protein Fusion protein The soluble composition of the host cell material Process to generate a neutralizing anti-toxin directed against Clostridium botulinum toxin type A antibody to purify a recombinant fusion protein derived from a Clostridium botulinum toxin type A process to generate an antitoxin neutralizing directed against clostridium difficile toxin type b antibody treatment process process to generate a neutralizing antitoxin directed against clostridium difficile type a toxin composition process to vaccinate an individual to produce neutralizing antitoxin directed against clostridium difficile toxin processing the detection of clostridium antigens difficile in an ample process of purification of toxins from clostridium difficile from a culture and process of generation of a solid dosage form of a bird antitoxin directed against a protein of clostridial toxin

Also Published As

Publication number Publication date
WO1998008540A1 (en) 1998-03-05
EP1105153A4 (en) 2005-01-19
EP1105153A1 (en) 2001-06-13
AU4245097A (en) 1998-03-19

Similar Documents

Publication Publication Date Title
CA2296765A1 (en) Soluble recombinant botulinum toxin proteins
US6967088B1 (en) Soluble recombinant botulinum toxin proteins
JP3914484B2 (en) Soluble recombinant botulinum toxin protein
US5919665A (en) Vaccine for clostridium botulinum neurotoxin
FI107334B (en) Method for the preparation of a vaccine for the prevention of Lyme disease
EP2405940B1 (en) Antibodies to clostridium difficile toxins
CA2218601A1 (en) Treatment for verotoxin-producing escherichia coli
EA006232B1 (en) Streptococcus antigens
EP2514768B1 (en) Fusion polypeptide against eb virus-induced tumor and colicin ia mutant
MX2014002595A (en) Isolated polypeptide of the toxin a and toxin b proteins of c. difficile and uses thereof.
CN105833260A (en) Vaccines and compositions against streptococcus pneumoniae
US20210214400A1 (en) Acinetobacter baumannii immunogenic protein and composition and application thereof
CA2265887A1 (en) Histidine-tagged shiga toxins, toxoids, and protein fusions with such toxins and toxoids, methods for the purification and preparation thereof
CN108066755A (en) A kind of genetic engineering subunit vaccine of anti-hydatid ovis disease infection and its preparation method and application
US20100184639A1 (en) Nucleic acids and polypeptides specific of the neisseria genus pathogenic strains
JP2718523B2 (en) Vaccine against E. coli sepsis in poultry
CN108339115B (en) Pneumococcal combined vaccine using recombinant carrier protein and preparation method thereof
Yahong et al. Protective immune response of bacterially-derived recombinant FaeG in piglets
US20030186848A1 (en) Recombinant iron uptake proteins
KR100497700B1 (en) Soluble Recombinant Botulinum Toxin Proteins
AU2521600A (en) Treatment for verotoxin-producing escherichia coli
CA2239226A1 (en) Transferrin binding proteins of pasteurella haemolytica and vaccines containing same
BRPI0617407A2 (en) canine influenza viruses, ha, nm, np, m1, ns1, pa, pb1 and pb2 proteins, Nucleic acids encoding them, compositions containing said proteins, said viruses or said Nucleic acids and their uses

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued