CA2291962A1 - Glucose regulated gene - Google Patents

Abstract

The invention is a human munc13 gene (Hmunc13) and protein from kidney and other cells which has an important role in cell signaling. This gene is regulated by glucose. Hmunc13 contributes to the renal and microvascular complications associated with hyperglycemia in diabetes mellitus, through a variety of mechanisms including Hmunc13 linked apoptosis. The invention also includes biologically functional equivalent nucleotide sequences and proteins. The invention also relates to methods of using these nucleic acid sequences and proteins in medical treatments and drug screening.

Description

GLUCOSE REGULATED GENE
CROSS REFERENCE TO RELATED APPLICATION
This application claims priority from U.S. application no. 60/069,352, which is incorporated by reference herein in its entirety.
FIELD OF THE INVENTION
The invention relates to an isolated glucose regulated gene and its protein expression product. The invention also relates to methods of modulating the gene for treatment of hyperglycemia, glomerulosclerosis and renal cell apoptosis.
BACKGROUND OF THE INVENTION
(i) Renal Failure as a Complication of Diabetes Mellitus Renal failure caused by glomerulosclerosis is a major complication of insulin dependent ("IDDM") and non insulin dependent ("NIDDM") diabetes (1, 2). Renal failure is increasing in Europe and North America (3-5), due to a variety of factors, including an aging population, poor dietary habits, and longer survival of juvenile diabetics. About 25% of patients undergoing treatment of end stage renal disease (ESRD) in the US and Canada, have kidney failure (nephropathy) caused by diabetes (1). Although renal failure in diabetes is not well understood, significant advances have been made recently. There still remains a clear need to characterize the processes that cause diabetes related kidney failure.
Renal disease occurs more frequently in IDDM than in NIDDM, and there is a strong genetic component associated with the former (1). So far, the genes involved in this disease have not been identified. There has been some suggestion that certain Angiotensin Converting Enzyme (ACE) polymorphisms predispose to development of diabetic nephropathy (6). Only about 30-40% of IDDM patients eventually develop ESRD (7). It would be helpful if genetic factors that protect the 60-70% majority of IDDM patients from progressive renal failure could be identified.
(ii) Hyperglycemia as a Cause of Diabetic Nephropathy - the Role of the Mesangial Cell Diabetics have chronically elevated blood glucose levels (hyperglycemia).
Hyperglycemia contributes to development of microvascular and renal complications. There is no doubt that controlling blood sugar reduces these complications (8). Studies show that diabetic glomerulosclerosis is caused by expansion of the mesangial matrix (1 ). The main product of the mesangial matrix, collagen IV, is found throughout the expanded mesangium.
This is characteristic of diabetic glomerulosclerosis (16, 17). The mesangial cell is now considered to be involved in initiation of diabetic glomerulosclerosis. Current investigation of renal failure centers around mesangial cell ("MC") responses to hyperglycemia.
Hyperglycemia either directly (9) or indirectly (10) leads to the increased production of growth factors, accumulation of excess extracellular matrix ("ECM")and creation of advanced glycosylation end products. These endings have been reproduced and corroborated in animal models of diabetes.
There are factors in addition to hyperglycemia that contribute to glomerulosclerosis and microvasular changes. As mentioned above, most IDDM patients do not develop diabetic renal disease, despite the presence of life long elevated blood sugars.
Hyperglycemia is a necessary, but not sufficient condition for diabetic renal complications.
Nevertheless, if hyperglycemia could be fully understood at the molecular level, this would permit targeted therapeutic intervention to prevent the hyperglycemia-induced component of diabetic complications. It would also help identify genes that afford cell protection or establish cell vulnerability to sustained, elevated glucose.
Recently, there has been a recognition that diabetic renal disease in the presence of hyperglycemia is associated with apoptosis.
(iii) Hyperglycemia-induced Alterations in ECM-MC Signaling Although a number of different cellular metabolic pathways are known to be altered by exposure to elevated concentrations of glucose (17, 18), diacylglycerol ("DAG") induced protein kinase C ("PKC") activation (especially its ~i2 isoform) is probably the most important (13, 14, 17-19). PKC inhibition reverses many of the acute and chronic effects of hyperglycemia on MC by blocking DAG binding to PKC (13). The sequence of events described below occurs in hyperglycemia. The model is derived from in vitro studies of MC response in primary culture to short term hyperglycemic conditions and in vivo investigations of early changes in renal functional parameters (increased glomerular filtration rate and urine protein excretion) in animal models such as streptozotocin treated rats.
High glucose enhances intracellular production of sorbitol via the aldose reductase pathway. This leads to an increase in intracellular osmolality (11). At the same time (ii) high glucose increases de novo synthesis of diacylglycerol (DAG) leading to activation and phosphorylation of protein kinase C (PKC). This is followed by a series of "downstream" events, including increased expression of various growth factors, most notably, transforming growth factor beta (TGF~i). TGF~i, in an autocrine manner, stimulates MC production of extracellular matrix (ECM) elements, fibronectin and collagen IV, while at the same time reducing ECM degradation by increasing levels of the metalloproteinase inhibitor TIMP-2 (12). These effects are prevented by treatment with anti-TGF(3 antibodies. TGF(3 is critical in accumulation of ECM
following short term exposure of MC to elevated glucose concentrations.
DAG-induced activation of MC PKC(32 is responsible for the acute and even certain chronic changes associated with diabetic microvascular and renal complications (13).
Administration of a specific PKC~i2 inhibitor-LY333531, appears to prevent the in vivo and in vitro sequelae of hyperglycemia, described above (14).
PKC is a serine-threonine phosphorylation kinase. Many different PKC isoforms exist, and their specificity of action is attributable to their intracellular compartmentalization, which varies from cell to cell. All PKC isoforms contain 2 regulatory domains, C1 and C2, which bind DAG and Ca++, respectively, in addition to binding a kinase domain. Under resting conditions, the kinase domain is inactive due to its interaction with the C1 domain. When DAG binds to C1, dissociation occurs, allowing ATP to bind to the kinase region. This activates PKC. A drug named LY333531 acts by competing with ATP for binding at the kinase domain. The effect of this drug is to block PKC phosphorylation without affecting intracellular DAG levels (14,15).
The PKC pathway is not well understood. Whether PKC activation is the dominant dysfunction in diabetic glomerulopathy is undetermined. Also unknown is whether other signaling pathways stimulated by hyperglycemia are capable of interacting with and modifying DAG induced PKC activation.
It would be helpful if DAG activation of PKC (via binding to the C1 domain) and its interaction with other metabolic changes in glomeruli and microvasculature during hyperglycemia were characterized. This would lead to new treatments to control and prevent damage to glomerular and microvascular function caused by hyperglycemia and diabetes.
(iv) Signaling Proteins that Belong to the Same Superfamily as PKC
There has been also been growing interest in the characterization of a novel class of signaling proteins that belong to the same superfamily as protein kinase C, but lack its kinase activity. Unc-13, one of the members of this family, encodes a phorbol ester/
diacylglycerol-binding protein in C. elegans. Initial evaluation suggested it had a role in neurotransmitter release. (20-23). Mammalian homologues (munc13s), munc13-1, -2, and -3, were originally cloned from rat brain and similar to Unc-13 in that both possess DAG and Ca2+ binding domains (20). Syntaxin, synaptobrevin, SNAP 25 (24) and Doc2 (25) were found to coimmunoprecipitate with munc13s, consistent with the suggestion that this new family of DAG binding proteins is involved in vesicle trafficking and neurotransmitter release. It would be helpful if the role of genes in this family was characterized so that its role in metabolism was understood. No characterization data to date has linked this gene to hyperglycemia or kidney failure.
The function of these signaling proteins and related isoforms is largely unknown.
Nevertheless there is emerging evidence that DAG activated munc13 is involved in neurotransmission (24).
In summary, there is recognition that non PKC DAG activated signaling pathways regulate important cellular functions. Since hypergelycemia results in increased intracellular DAG
concentration, there is a need to identify and characterize the targets of DAG
that are involved in the microvascular and renal complications of diabetes. This would lead to new compounds and methods for treatment of these complications.
SUMMARY OF THE INVENTION
We cloned a gene from human MC, Hmunc13, which is up-regulated by hyperglycemia.
Hmunc13 mediates some of the acute and chronic changes in MC produced by exposure to hyperglycemia. These changes result in diabetic microvascular and renal damage, such as glomerulosclerosis and apoptosis.
We have established the following:
(a) Structure of Hmunc13 and biologically functional equivalent nucleotide sequences:
Hmunc13 is a signaling molecule localized to the plasma membrane of renal mesangial cells, cortical epithelial cells and other cells, The topological organization is illustrated schematically in figure 7. There are functional extracellular RGD domains, and intracellular C1 and C2 domains. There is also an intracellular regulatory domain on Hmunc13 that targets and activates a serine threonine catalytic phosphatase subunit to the plasma membrane (b) Function of Hmunc13 and biologically functional equivalent nucleotide sequences: The functional role for Hmunc13 involves intracellular signal transduction and regulation of cell attachment and migration. Hmunc13 acts through modulation of phosphatase activity. In this way, Hmunc13 phosphatase activation opposes downstream serine/threonine phosphorylation initiated in response to PKC and integrin activation.

(c) Disease Model & Therapeutic Intervention: Hmunc13 is activated in response to hyperglycemia-induced increases in DAG, causing (i) stimulation of phosphatase activity and, (ii) modulation of DAG-induced PKC~i activation. We have identified a model which incorporates the two DAG activated pathways: (i) PKC dependent and (ii) Hmunc13 dependent. These two pathways regulate two opposing cell phenotypes, PKC-proliferation and hmunc13-apoptosis. The over-expression of Hmunc13 under hyperglycemic conditions and Hmunc13 DAG-induced apoptosisprove a role for Hmunc13 in diabetic renal cell injury. Modulation of Hmunc13 and biologically functional equivalent nucleotide sequences is particularly useful for treatment and prevention of renal cell damage.
The invention is an isolated nucleotide sequence encoding a glucose regulated munc polypeptide. The nucleotide is preferably from a kidney cell, human cortical epithelial cell or a cell from testis, ovaries, prostate gland, colon, brain and heart, more preferably a mesangial cell or a kidney cortical epithelial cell. The nucleotide sequence preferably comprises a Hmunc13 polypeptide and all or part of the amino acid sequence in sequence (a) in Figure 1 [SEQ ID NO. 1].
The nucleotide sequence preferably comprises a Hmunc13 gene having all or part of the nucleotide sequence in Figure 8 [SEQ ID NO. 2]. The molecule preferably comprises at least 40%
sequence identity to all or part of the nucleotide sequence of Figure 8. The sequence is preferably selected from a group consisting of mRNA, cDNA, sense DNA, anti-sense DNA, single-stranded DNA and double-stranded DNA. The nucleotide encodes an amino acid sequence of the invention. The nucleotide sequence that encodes all or part of a Hmunc13 polypeptide, preferably hybridizes to the nucleotide sequence of all or part of Figure 8 under high stringency conditions (e.g. a wash stringency of 0.2X SSC to 2X SSC, 0.1 % SDS, at 65°C).
The invention also includes an isolated munc polypeptide, with the provisio that the polypeptide is not found in a mammalian central nervous system. The polypeptide of preferably has transmembrane ECM-cell signaling activity and DAG and Ca++ activated phosphatase activity and more preferably includes all or part of the Hmunc13 amino acid sequence in sequence (a) in Figure 1 [SEQ ID NO: 1]. The invention also includes amimetic of the purified and isolated polypeptide. The polypeptide preferably has at least 40% sequence identity to all or part of the amino acid sequence (a) in Figure 1 [SEQ ID NO: 1] . The polypeptide is preferably from a mammalian kidney cell. It is useful for inducing apoptosis and vesicle trafficking.
The invention also includes a recombinant DNA comprising a DNA molecule the invention and a promoter region, operatively linked so that the promoter enhances transcription of said DNA
molecule in a host cell. The invention also includes a system for the expression of Hmunc13, comprising an expression vector and Hmunc13 DNA inserted in the expression vector. The expression vector preferably comprises a plasmid or a virus. The invention also includes a cell transformed by the expression vector. The invention also includes a method for expressing Hmunc13 polypeptide comprising: transforming an expression host with a Hmunc13 DNA
expression vector and culturing the expression host. The method preferably also includes isolating Hmunc13 polypeptide. The expression host is preferably selected from the group consisting of a plant, plant cell, bacterium, yeast, fungus, protozoa, algae, animal and animal cell.
The invention also includes a pharmaceutical composition, including at least all or part of the polypeptide of the invention, and a pharmaceutically acceptable carrier, auxiliary or excipient.
The invention also includes a pharmaceutical composition for use in gene therapy, comprising all or part of the nucleotide sequence of any of the invention and a pharmaceutically acceptable carrier, auxiliary or excipient. The pharmaceutical composition for use in gene therapy, preferably comprises all or part of an antisense sequence to all or part of the nucleic acid sequence in Figure 8.
Another embodiment of the invention is a kit for the treatment or detection of a disease, disorder or abnormal physical state, comprising all or part of the nucleotide sequence of the invention. A kit for the treatment or detection of a disease, disorder or abnormal physical state, preferably includes all or part of the polypeptide of the invention. The invention also includes a nucleic acid molecule detection kit including, preferably in a suitable container means or attached to a surface, a nucleic acid molecule of the invention encoding Hmunc13, Mmunc13 or a polypeptide having Hmunc13 or Mmunc13 activity and a detection reagent (such as a detectable label). Other variants of kits will be apparent from this description and teachings in patents such as U.S. Patent Nos. 5,837,472 and 5,801,233 which are Incorporated by reference in their entirety.
The kit may also comprise an antibody to the polypeptide. The disorder is preferably selected from a group consisting of insulin dependent and independent diabetes, glomerulopathy and renal failure. The invention also includes a NH2-SQRSNDEVREFVKL-COOH specific antibody, preferably a polyclonal antibody.
The invention is also a method of medical treatment of a disease, disorder or abnormal physical state, characterized by excessive Hmunc13 expression, concentration or activity, comprising administering a product that reduces or inhibits Hmunc13 polypeptide expression, concentration or activity. The product is preferably an antisense nucleotide sequence to all or part of the nucleotide sequence of Figure 8, the antisense nucleotide sequence being sufficient to reduce or inhibit Hmunc13 polypeptide expression. The antisense DNA is administered in a pharmaceutical composition comprising a carrier and a vector operably linked to the antisense DNA.. The disease, disorder or abnormal physical state is preferably selected from a group consisting of insulin dependent diabetes and independent diabetes, glomerulonephritis and ischemic renal injuries.
The invention also includes a method of medical treatment of a disease, disorder or abnormal physical state, characterized by reduced Hmunc13 expression, concentration or activity, comprising administering a product that increases Hmunc13 polypeptide expression, concentration or activity. The product is preferably a nucleotide sequence comprising all or part of the nucleotide sequence of Figure 8, the DNA being sufficient to increase Hmunc13 polypeptide expression. The nucleotide sequence is preferably administered in a pharmaceutical composition comprising a carrier and a vector operably linked to the nucleotide sequence.
We elucidate the molecular mechanisms) by which DAG activated Hmunc13 induces apoptosis.
P44/42 MAPK, also known as erk1 and erk2, is a major pathway regulating cell proliferation and differentiation (14). One of the key activators of p44/42 MAPK is the DAG-PKC-raf pathway (14). Activation of the p44/42 MAPK cascade increases expression of early genes such as c-fos (15) and also mediates nerve growth factor (NGF) action on the bcl-2 promoter resulting in induction of bcl-2 expression (16). The consequences of Hmunc13 activation are effected through p44/42 MAPK.
In the present communication we report that DAG activation of Hmunc13 regulates p44/42 MAPK activity in a time dependent manner through direct physical interaction causing dephosphorylation of p44/42 MAPK. We have further determined that this physical interaction involves a specific region on hmunc13 (preferably including amino acids 309-371). Deletion of this region not only prevents the Hmunc13 interaction with p44/42 MAPK, but also prevents PDBu induced apoptosis. Furthermore, induction of apoptosis through DAG activation of Hmunc13 is accompanied by down-regulation of bcl-2 and mcl-1 expression.
Our results show that in both normal and pathological states the balance between DAG
activation of Hmunc13 and PKC determines whether a cell follows a proliferative (differentiation) or apoptotic fate. Since elevated glucose concentrations increase intracellular DAG levels (17-19) and also Hmunc13 mRNA expression (9), our findings show that the hyperglycemic complications of diabetes mellitus are mediated through Hmunc13-induced apoptosis.
BRIEF DESCRIPTION OF THE DRAWINGS
Preferred embodiments of the invention will be described in relation to the drawings in which:

Figure 1. (a) Shows the polypeptide that is (SEQ ID N0:1].
In a preferred embodiment, the figure shows protein sequence alignment of Hmunc13 (GenBank accession number AF020202) with rat munc13s. (a) Alignment of all four proteins.
Only a partial (AA 251-2207) of rat munc13-3 is shown. (b) Alignment of the first 100 amino acid at the N-terminal of Hmunc13 and rat munc13-1. Identical residues are boxed.
The dotted line above the sequence indicates the C1 domain and the continuous line indicates the C2 domain as proposed by Brose et al. (7).
Figure 2. Expression of Hmunc13 in human MC culture in 5.5 mM D-glucose plus 9.5 mM L-glucose (L(15)) or 19.5 mM L-glucose (L) or 15 mM (D(15)) 25 mM mM D-glucose (D) and as described in Methods. Increased expression of Hmunc13 after 25 mM D-glucose treatment is revealed by Relative RT-PCR (a) and Northern blot (b). All blots are representative of at least 3 different experiments using different total RNA preparations.
Figure 3. Expression of Hmunc 13 (lane 7, 8) or munc13-2 (lane 9) in human kidney MC (lane 7), cortical epithelial cells (lane 8) or rat kidney MC (lane 9). RT-PCR was performed using a pair of primers for both Hmunc13 and rat munc13-2 indicated in the Methods which amplified a segment of 193 bp. A pair of primers for GAPDH generated a 453 fragment were used to PCR no RT RNA
(lane 1-3) and RT products (lane 4-6) of human kidney MC (lane 1, 4), cortical epithelial cells (lane 2, 5) and rat MC (lane 3, 6).
Figure 4. In vitro translation of Hmunc13. Note that a proportion of the highest MW band (170 kDa) in the absence of microsomal membranes (lane 1) is shifted to higher MW
(180 kDa) in the presence of microsomal membranes (lane 2). Lane 3 is the supernatant of derived from the in vitro translation reaction with microsomal membranes as detailed in Methods.
Figure 5. Comparison of gene structure of Hmunc13 to various isoforms of rat Munc13s.
Figure 6. Expression of rat munc13-2 in renal glomerulus of normal (A) or streptozotocin-treated (B) rats detected by in situ hybridization. A PCR fragment of rat munc13-2 (residues 5487-5669) with a T7 promoter introduced in its sense primer was in vitro transcripted to anti-sense cRNA with DIG-labeled UTP. A section of normal and streptozotocin-treated rat kidneys on the same slide was hybridized with this probe and the signal was detected by Rodamine-conjugated anti-DIG
antibody and observed by confocal microscopy. A negative control with sense cRNA showed little staining in all sections (data not shown). Note the morphological changes in the glomerulus of streptozotocin-treated rat and the higher staining of mesangila cells. This study also confirms the expression of munc13-2 in renal tubular epithelial cells.

Figure 7. Structure model of Hmunc13.
Figure 8. (a) Shows the nucleic acid molecule sequence that is [SEQ ID N0:2].
In a preferred embodiment, the figure shows the DNA sequence of Hmunc13 (GenBank accession number AF020202) Figure 9. (i) Comparison of the structure of rat munc13s and Hmunc13. C1 represents the DAG
binding (C1) domain; C2 represents the Caz+ binding (C2) domain. (ii) Comparison of the sequence of the C1 domain of rat munc13-1 and hmunc13. Continuous lines indicate identical amino acids and the dotted line indicates similar amino acids.
Figure 10. (i) Immunoblot of Hmunc13 and the C1 less mutant. Hmunc13-HA
(Hmunc13), C1 less mutant (C1 less) or empty plasmid, pCMV.SPORT (pCMV), were transiently transfected into OK
cells. Whole cell lysates were prepared and subjected to 6% SDS-PAGE. The blot was detected by anti-HA. Note the slightly decreased molecular weight of the C1 less mutant. (ii) Immunostaining of OK cells transiently transfected with hmunc13-HA (A-C, E-G) and C1 less mutant (D, H). Cells were stained with anti-HA then probed with anti-mouse IgG-rhodamine for detection of Hmunc13 (A-C) and C1 less mutant (D). The Golgi apparatus was detected by staining with WGA-FITC (E-H). Slides were observed by confocal microscopy using a laser scanning microscope with excitation wavelength at 568 nm for detecting rhodamine (A-D) and 488 nm for detecting FITC (E-H). Cells were treated with vehicle (A, E), 0.1 NM
PDBu for 3 h (B, D, F, H), 4 uM nocodazole + PDBu (C, G) as described in the Methods. Negative controls obtained by incubating with normal mouse IgG or immunostaining of cells transfected with empty plasmid (pCMV~SPORT) yielded very little or no staining (data not shown). Arrowheads indicate co-localization of anti-HA and WGA staining. Note: Upper and lower panel pairs, i.e. A and E, B and F etc, represent anti-HA and WGA-FITC staining, respectively, of identical fields.
(iii) Immunoblots of whole cell lysates (panel A) and Golgi membrane preparations (panel B) from Hmunc13 transfected OK cells with (+) or without (-) PDBu treatment for 3 h.
The whole cell lysates represent small aliquots of cells for Golgi membrane preparations.
Equal amounts of protein were loaded onto each lane of panel A or B. The blots were then detected by anti-HA
antibody.
Figure 11. (i) Double labeling of apoptotic cells and expression of Hmunc13 or C1 less mutant.
Hmunc13 (A-C, E-G) and C1 less mutant (D, H) transiently transfected cells were subjected to TUNEL labeled with fluorescein (E-H) and then subjected to anti-HA and anti-mouse IgG-rhodamine labeling for expression of Hmunc13 and C1 less mutant (A-D). Cells were treated with vehicle (A, E) or 0.1 p,M PDBu for 8 h (B, D, F, H) or 16 h (C, G). C1 less mutant transfected cells treated with vehicle exhibit a similar image as D and H (data not shown).
Negative controls of TUNEL by incubating cells with labeling mix and no TdT yielded no staining of fluorescein (data not shown). Arrowheads indicate representative cells co-stained with anti-HA
(upper panels) and TUNEL (lower panels) from identical fields. (ii) Graphic representation of the percentage of transfected (immunostaining positive) and apoptotic (TUNEL positive) cells in Hmunc13 or C1 less mutant (C1 less) transfected cells treated with or without PDBu for 8 or 16 h.
Cell numbers were counted with an average of three low power views under the confocal microscope. Bars are representations of means ~ SD of three experiments.
Figure 12. Genomic DNA breakdown in Hmunc13 transfected cells by PDBu treatment. Genomic DNA obtained from empty plasmid (pCMV), Hmunc13 or C1 less mutant transfected cells treated with vehicle (-) or 0.1 pM PDBu for 8 h or 16 h was subjected to 2 % agarose gel electrophoresis.
Molecular size marker (M) is shown.
Figure 13. Expression of rat munc13-1 in kidney of normal (A) or STZ-treated diabetic (B-D) rat detected by in situ hybridization. Outer cortex (A, B), medulla (C) and a higher power view of outer cortex (D) from diabetic rat kidney are shown. Similar to diabetic rats, staining in the renal medulla for normal rat kidney is less than the cortex (data not shown). Note the increased expression of munc13-1 in the tubular epithelial cells as well as in certain glomerular cells. Negative controls with sense cRNA showed little staining in both normal and diabetic rat sections (data not shown).
Figure 14. Expression of munc13-1, munc13-2 and munc13-3 in the renal cortex of the normal rat and following 1 day (1 d) and 11 day (11 d) of hyperglycemia in STZ-treated rats. 18S ribosome RNA (18S) served as a housekeeping gene.
Figure 15. Schematic representation of DAG activated branched signaling pathways involving PKC and Hmunc13. DAG levels are increased by such factors as hyperglycemia, phospholipase C (PLC) (3/y and phospholipase D (PLD) resulting in activation of both PKC and Hmunc13 and leading to two separate downstream signaling pathways, respectively resulting in proliferation and differentiation (PKC) or apoptosis (Hmunc13).
Figure 16. (a) Shows the nucleic acid molecule sequence that is [SEQ ID N0:3]
and the polypeptide sequence that is [SEQ ID N0:4].
In a preferred embodiment, the figure shows the sequence of mouse munc13 cDNA
and its corresponding translated polypeptide sequence [SEQ ID N0:4].
Figure 17. Comparison of mouse and human munc13 protein sequence.

Figure 18. Direct interaction of Hmunc13 and p44/42 MAPK. (a) Cell lysates from PDBu treated HEK 293 cells transfected with empty plasmid (pCMV) and either myc-Hmunc13 (upper panel) or Hmunc13-HA (lower panel) were immunoprecipitated (IP) with anti-myc or anti-HA
antibody at the indicated times, subjected to 12% SDS PAGE, and immunoblotted with anti-p44/42 MAPK. (b) Cell lysates from HEK 293 cells transfected with Hmunc13-HA, its C1 less mutant (C1 less) and empty plasmid (pCMV) treated with PDBu at the indicated times, were immunoprecipitated with anti-p44/42 MAPK, subjected to 12% SDS-PAGE and immunoblotted with anti-HA
antibody. The expression of Hmunc13 and the C1 less mutant is displayed in the lower panel.
Molecular weights (MW) are indicated.
Figure 19. (a) Effect of Hmunc13 on phosphorylation of p44/42 MAPK in response to PDBu treatment. HEK293 cells were transfected with Hmunc13-HA, its C1 less mutant (C1 less) or empty plasmid (pCMV) and treated with PDBu for the indicated times. Western blot analysis was performed on the same blot by striping and reprobing with indicated antibodies. Ponceau S
stained membrane is shown to demonstrate the loading of proteins. Density of phospho-p42 MAPK was measured by ImageQuant and normalized with its total protein level as detected using an antibody against p44/42 MAPK (results shown are representative of three experiments with similar outcomes). (b) Activity of p44/42 MAPK in HEK293 cells transfected with Hmunc13-HA or pCMV detected by anti-phospho-Elk-1 antibody as described in Experimental Procedures.
Density measurement by ImageQuant indicates a 30% decrease of p44/42 MAPK
activity in cells transfected with Hmunc13 vs. pCMV in response to 45 min PDBu treatment (results shown are representative of two assays with similar results).
Figure 20. Alignment of amino acid sequences of the EB domain of Hmunc13 (aa309-371 ) compared to the 8 isoform of B' subunit (B' 8) of protein phosphatase 2Ao.
Identical amino acids are indicated by a continuous line. Dotted lines indicate similar amino acids.
Figure 21. Requirement of the EB domain for the interaction of DAG activated Hmunc13 with p44/42 MAPK and resulting dephosphorylation of p44/42 MAPK. (a) HEK 293 cells transfected with HA-tagged EB less mutant (PP less), wild type Hmunc13, or C1 less mutant (C1 less) were treated with PDBu for 30 min then immunoprecipitated with anti-HA. The resulting immunoprecipitated products were subjected to 12% SDS-PAGE. The immunoblot was probed with anti-p44/42 MAPK (upper panel), striped and reprobed with anti-HA (lower panel). (b) Absence of an effect of the EB less mutant on phosphorylation of p44/42 MAPK
in response to PDBu treatment. HEK293 cells were transfected with HA-tagged EBless mutant (PP
less), wild type Hmunc13 or empty plasmid (pCMV) and treated with PDBu for the indicated times. Western blot analysis was performed on the same blot by striping and reprobing with the indicated antibodies. Density of phospho-p42 MAPK was measured by ImageQuant and normalized with its total protein level as detected by using antibody against p44/42 MAPK
(representative results from two experiments with similar outcomes is shown). To detect expression of the EB less mutant and Hmunc13-HA, the same cell lysates were subjected to 6% SDS-PAGE and analyzed with anti-HA
(the lowest panel). (c) Demonstration of the in vitro specificity of binding of GST-EB to p44 MAPK.
The resulting GST-glutathione complexes were subjected to 12% SDS-PAGE and immunoblot analysis was performed on the same blot by striping and reprobing with the indicated antibodies.
(d) Absence of effect of the EB less mutant on apoptosis. Percentage of apoptotic cells is determined in HEK 293 cells transfected with Hmunc13 or the EB less mutant without or with 8h of PDBu treatment. Results are expressed as means ~ SD of three experiments.
Figure 22. Expression of bcl-2 and mcl-1 in HEK 293 cells transfected with Hmunc13-HA, its C1 less mutant (C1 less) and empty plasmid (pCMV) in response to PDBu treatment for 4 or 6h. (a) RNase protection assay. Protected double-stranded RNA was subjected to 6% PAGE
and exposed to x-ray film. Note the up-regulation of bclx~g~, a pro-apoptotic gene, and down-regulation of anti-apoptotic genes, bcl-2 and mcl-1, in cells transfected with Hmunc13 after PDBu activation.
L32 and GAPDH served as housekeeping genes. (b) Immunoblot analysis of bclx~g~, bcl-2 and mcl-1 expression in HEK293 cells transfected with HA tagged wild type Hmunc13, the C1 less mutant (C1 less) and pCMV. Immunobot of anti-HA is shown to indicate the similar expression of Hmunc13 and the C1 less mutant (the lowest panel).
Figure 23. The direct blocking effect of EB domain on erk1 activity. (a) E.coli lysates of GST or GST-EB were prepared as described ~a~ with 1 % NP-40 and then coupled to Glutathione Sepharose 4B. The resulting GST-glutathione complexes were washed with lysis buffer in the presence of 1% NP-40. To examine for the effect of EB domain on erk1 activity, we sought to determine if GST-EB has any effect on erk1 stimulated elk-1 phosphorylation.
Fifty microliters of kinase buffer (25 mM Tris, 5 mM beta-glycerolphosphate, 2 mM DTT, 0.1 mM
Na3V04 and 10 mM
MgCl2, 0.2 mM ATP) with 50 ng of recombinant human erk1 (Calbiochem) and 2 Ng of recombinant elk-1 (NEB) were added to test tubes without (no beads) or with the pellets of the above GST-glutathione complexes, and incubated at 30 C for 30 min. The reactions were terminated with addition of SDS-PAGE sample buffer and subjected to 12% SDS-PAGE.
Phosphorylation levels of elk-1 were determined by immunoblotting with antiphospho-elk-1 (New England Biolabs) (upper panes. The same blot was stripped and reprobed with anti-GST (lower panes. In the presence of GST-EB, elk-1 phosphorylation is decreased compared to GST alone.
(b) The same experiment as in (a) except that GST-glutathione complexes were replaced with 6 His-tagged Hmunc13 or the EB less mutant coupled to Ni-NTA agarose (Qiagen).
Cell lysates from HEK293 cells transfected with 6 His-tagged Hmunc13, the EB less mutant or empty plasmid (pCMV) were incubated with Ni-NTA agarose (Qiagen) for 3 h and washed 3 times with cell lysis buffer (1 % NP-40, 150 mM NaCI, 50 mM Tris-HCI, pH 7.4). The blot was stripped and reprobed with anti-munc13 to demonstrate protein loading levels (lower panes. Note the blocking effect of Hmunc13 on erk1 activity was not observed for the EB less mutant.
DETAILED DESCRIPTION OF THE INVENTION
Isolation and Identification of Hmunc13 We cloned a human munc13 gene (Hmunc13) and protein from kidney which has an important role in cell signaling. This gene is regulated by glucose. Hmunc13 contributes to the renal and microvascular complications associated with hyperglycemia in diabetes mellitus, through a variety of mechanisms including Hmunc13 linked apoptosis. We also have identified biologically functional equivalent nucleotide sequences and proteins.
We obtained the glucose regulated gene by differential display reverse transcription polymerase chain reaction (DDRT-PCR) of candidate genes differentially expressed in human MC exposed to hyperglycemic conditions, compared to controls. Using this screening procedure, we obtained a PCR product which was then used to clone the full length cDNA.
This gene is similar to mammalian brain munc13s (it is a differentially spliced isoform, munc 13-1 and munc 13-2). Hmunc13 is detectable in both MC, epithelial and other cells. The presence of a Hmunc13 gene in MC which has similarity to rat munc13 was very unexpected because rat munc13 is believed to be localized only in the brain (20).
We determined that Hmunc13 is a target for regulation by glucose in MC and other cells. For example, the expression of Hmunc13 is up-regulated by hyperglycemia in cultured kidney MC and epithelial cells. Hmunc13 protein is involved in the acute and chronic effects of hyperglycemia in MC and renal epithelial cells, and contributes to the development of diabetic glomerulopathy. Hmunc13 also interacts with the syntaxins.
We then used a full length cDNA clone of rat munc13-1 (a gene from rat brain with sequence similarity to Hmunc 13 and some similar functional domains) to show how the gene is regulated by glucose. In vitro experiments revealed that exposure of fibroblasts transfected with munc13-1 to phorbol esters caused translocation of munc-13-1 to the plasma membrane.
We performed other in vitro experiments to show that, as a second messenger, DAG can activate either a PKC (proliferative) signaling pathway or alternatively, a Hmunc13 (apoptosis) signaling pathway. The combined action of these two pathways showed the functional responses of cells to stimuli such as hyperglycemia. Our results indicate that hyperglycemic activation of Hmunc13 and induction of apoptosis is a factor causing cell injury in diabetic nephropathy.
Localization of Hmunc13 We demonstrated the presence of Hmunc13 in primary cultured human MC and in a human kidney cDNA library as well as munc13-2 in rat MC. A gene similar to munc13s has never previously been isolated outside the central nervous system. We also confirmed that Hmunc13 is expressed in the brain by PCR of a commercial human brain cDNA library (Gibco BRL) In vitro translation also indicates co-translational modification of Hmunc13. It is unlikely that this initiates N-glycosylation since addition of a competitive inhibitor of N-glycosylation, Ac-Asn-Tyr-Thr-NH2 (26), did not shift the band to lower molecular weight.

Hmunc13 Protein Three Dimensional Structure Analysis of the hydropathy plot of Hmunc13 by Kyte-Doolittle analysis indicates that there are a few hydrophobic regions (residue 603-609, 817-825, 970-977, 1107-1111 ) with K-D values from 139 to 172. However, these are not typical transmembrane segments. It is possible that the full-length protein can fold in such a way that hydrophobic loops can anchor to the membrane but that such folding is not possible for the partial length protein.
Functional Domains of Hmunc13 Protein We reviewed the Hmunc13 sequence and compared different segments of Hmunc13 with other amino acid sequences.
Hmunc13 contains 1 C1 domain and 3 C2 domains. The N-terminal segment is more similar to rat munc13-1 and the C-terminal segment is more similar to rat munc13-2 which contains 1 C1 and 2 C2 domains. After further analysis of the Hmunc13 nucleotide sequence, we found that another AUG codon (residue 444-446) after the first C2 domain contains an optimal Kozak sequence (5'-CACCAUGG-3') (27). It is possible that Hmunc13 mRNA serves as a bifunctional mRNA (27) that encodes two open reading frames, one for an isoform with 3 C2 domains (munc13-1 ) and the other with only 2 C2 domains (munc13-2).
We discovered that, in addition to C1 and C2 domains (fig.5), a segment of Hmunc13 (aa 309-371 ) not present in rat munc13s, has similarity to a segment of the delta isoform of the B' subunit of protein phosphatase 2Ao - a serine threonine phosphatase (28). This B' subunit has been shown to be a regulatory subunit of the multimeric PP2Ao. The catalytic subunit of PP2Ao associates with specific proteins (B') that serve a targeting and regulatory function. It is the regulatory subunits that determine in vivo specificity of the phosphatase by targeting the enzyme to the subcellular location of their substrates, and also modulating phosphatase activity by reversible protein phosphorylation and binding of second messengers (29).
We have also identified two RGD binding domains at aa39-41 and 769-771 in Hmunc13.
The presence of these motifs indicates that Hmunc13 interacts with ECM element receptors-integrins, such as vitronectin recetpor a"~ and fibronectin receptor a5(3,.
Such interaction is important for cell survival. Over-expression of Hmunc13, in response to DAG
prevents engagement of integrins to ECM resulting in apoptosis.
Taken together, the structural features of Hmunc13 described above, show a multifunctional role that involves transmembrane ECM-cell signaling, as well as DAG and Ca++
activated phosphatase activity.

Our finding that MC Hmunc13 is regulated by glucose also indicates that it modulates renal cell responses to hyperglycemia either directly or through interaction with PKC. We have also confirmed that Hmunc 13 is upregulated in the streptozotocin treated diabetic rat compared to normal rats (Fig. 6). Thus Hmunc13 is implicated in the pathogenesis of diabetic nephropathy.
Our results also demonstrate that Hmunc13, in response to 30-45 min of PDBu treatment, undergoes a physical interaction with p44/42 MAPK leading to reduced phosphorylation of p44/42 MAPK and a consequent reduction in its activity. DAG binding (activation) to Hmunc13 causes a conformational change in Hmunc13 which results in the observed protein-protein interaction.
Moreover the p44/42 MAPK-Hmunc13 interaction is specific since no similar effect was observed between Hmunc13 and p38 MAPK. We have also determined that the physical interaction of Hmunc13 and p44/42 MAPK is localized to the region of Hmunc13 delineated by amino acids 309-371. It is likely that that Hmunc13 serves as a bridging protein causing aggregation of an as yet identified phosphatase with p44/42 MAPK. Nevertheless the chemical mechanism by which DAG
activated Hmunc13 deactivates (dephosphorylates) p44/42 MAPK, remains unknown.
One of the interesting results to emerge from the present study is the finding that bcl-2 and mcl-1, both anti-apoptotic proteins (21 ), are down regulated in association with the induction of apoptosis by DAG activated Hmunc13. Down-regulation of bcl-2 and mcl-1 expression by activated Hmunc13 is mediated by decreased activity of p44/42 MAPK.
The effect of DAG activated Hmunc13 on p44/42 MAPK appears to us to be quite dramatic, especially since we are able to readily detect reduced phosphorylation or activity of p44/42 MAPK in response to Hmunc13 activation with only 30-40% cells having been transfected.
If Hmunc13 were truly over expressed (as for example would occur in hyperglycemia, see refs.
8,9), we would anticipate much larger effects.
Based on the cumulative evidence it seems appropriate to place the Hmunc13 signaling pathway in some functional context (9). In our working model, DAG is considered as a major intracellular second messenger, released in response to varied cellular interacting stimuli (growth factors, peptide hormones and hyperglycemia). The primary downstream targets of DAG are Hmunc13 and/or PKC leading to their activation. PKC activation leads to phosphorylation of p44/42 MAPK through the raf pathway. The downstream consequence of p44/42 MAPK
activation are to initiate cellular proliferative and differentiation responses through effects on transcription.
Based on results in the present communication, the PKC activated cascade which culminates in phosphorylation of p44/42 MAPK, can be modulated (reduced) through direct protein-protein interaction of DAG-activated Hmunc13 with p44142 MAPK. This physical interaction involves the region amino acids 309-371 of Hmunc13. The overall consequence of Hmunc13 activation by DAG is to reduce the expression of bcl-2 and mcl-1 potentially leading to induction of apoptosis.
Under in vivo conditions we must assume that there are multiple factors which will ultimately determine the balance between the DAG activated PKC and Hmunc13 pathways.
Further clarification of the functional signaling cascade mediated by DAG
activation of Hmunc13 will therefore require use of specific agonists and antagonists under normal cell conditions, in vivo.
The results have relevance in a variety of normal (development) and pathologic states, especially we have found that Hmunc13 and its mouse homologue, mmunc13 (Genbank#
AF115848), are ubiquitously expressed in tissues other than the brain and kidney, such as lung, heart, pancreas and spleen, as determined by RT-PCR and RPA. Since Hmunc13 mRNA is up-regulated by hyperglycemia (8,9), elevated glucose concentrations would result in an increase in Hmunc13 mRNA as well as an increase in Hmunc13 activity (i.e. its activation by DAG), we propose that hyperglycemic conditions might upset the normal balance between the DAG
activated Hmunc13 and PKC pathways, leading to induction of apoptosis. The hyperglycemic induced programmed cell death via Hmunc13 is responsible for initiation and maintenance of the microvascular and renal complications of diabetes.
Biologically Functional Equivalent Nucleotide Sequences The invention also includes nucleotide sequences that are biologically functional equivalents of all or part of the sequence in Figure 8. Biologically functional equivalent nucleotide sequences are DNA and RNA (such as genomic DNA, cDNA, synthetic DNA, and mRNA
nucleotide sequences), that encode peptides, polypeptides, and proteins having the same or similar Hmunc13 activity as all or part of the Hmunc13 protein shown in Figure 1. Biologically functional equivalent nucleotide sequences can encode peptides, polypeptides, and proteins that contain a region having sequence identity to a region of a Hmunc13 protein or more preferably to the entire Hmunc 13 protein.
Identity is calculated according to methods known in the art. The Gap program, described below, is most preferred. For example, if a nucleotide sequence (called "Sequence A") has 90%
identity to a portion of the nucleotide sequence in Figure 8, then Sequence A
will be identical to the referenced portion of the nucleotide sequence in Figure 8, except that Sequence A may include up to 10 point mutations, such as deletions or substitutions with other nucleotides, per each 100 amino acids of the referenced portion of the nucleotide sequence in Figure 8.
Nucleotide sequences biologically functional equivalent to the Hmunc13 sequences can occur in a variety of forms as described below.

A) Nucleotide sequences Encoding Conservative Amino Acid Changes in Hmunc13 Protein The invention includes biologically functional equivalent nucleotide sequences that encode conservative amino acid changes within a Hmunc13 amino acid sequence and produce silent amino acid changes in Hmunc13.
B) Nucleotide Sequences Encoding Non-Conservative Amino Acid Substitutions, Additions or Deletions in Hmunc13 Protein The invention includes biologically functional equivalent nucleotide sequence that made non conservative amino acid changes within the Hmunc 13 amino acid sequence to the sequences in Figure 8. Biologically functional equivalent nucleotide sequences are DNA and RNA
that encode peptides, polypeptides, and proteins having non-conservative amino acid substitutions (preferably substitution of a chemically similar amino acid), additions, or deletions but which also retain the same or similar Hmunc13 activity as all or part of the Hmunc13 protein shown in Figure 1 or disclosed in the application. The DNA or RNA can encode fragments or variants of the Hmunc13 of the invention. The Hmunc13 or Hmunc13 -like activity of such fragments and variants is identified by assays as described above. Fragments and variants of Hmunc13 encompassed by the present invention should preferably have at least about 40%, 60%, 80% or 95% sequence identity or preferably at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the naturally occurring nucleotide sequence, or corresponding region.
Most preferably, the fragments have at least 99.5% sequence identity to the naturally occurring nucleotide sequence, or corresponding region. Sequence identity (also known as homology) is preferably measured with the Gap program.
Nucleotide sequences biologically functionally equivalent to the Hmunc13 in Figure 8 include:
(1 ) Altered DNA. For example, the sequence shown in Figure 8 may have its length altered by natural or artificial mutations such as partial nucleotide insertion or deletion, so that when the entire length of the coding sequence within Figure 8, is taken as 100%, the biologically functional equivalent nucleotide sequence preferably has a length of about 60-120%
thereof, more preferably about 80-110% thereof. Fragments may be less than 60%.; or (2) Nucleotide sequences containing partial (usually 80% or less, preferably 60% or less, more preferably 40% or less of the entire length) natural or artificial mutations so that some codons in these sequences code for different amino acids, but wherein the resulting protein retains the same or similar Hmunc13 activity as that of a naturally occurring Hmunc13 protein.
The mutated DNAs created in this manner should preferably encode a protein having at least about 40%, preferably at least about 60%, at least about 80%, and more preferably at least about 90% or 95%, and most preferably 97%, 98% or 99% sequence identity (homology) to the amino acid sequence of the Hmunc13 protein in Figure 1. Sequence identity can preferably be assessed by the Gap program.
C) Genetically Degenerate Nucleotide Sequences Since the genetic code is degenerate, those skilled in the art will recognize that the nucleic acid sequence in Figure 8 is not the only sequences which may code for a protein having Hmunc13 activity. This invention includes nucleic acid sequences that have the same essential genetic information as the nucleotide sequence described in Figure 8.
Nucleotide sequences (including RNA) having one or more nucleic acid changes compared to the sequences described in this application and which result in production of a polypeptide shown in Sequence (a) in Figure 1 are within the scope of the invention.
D) Biologically Functional Equivalent Nucleic Acid Sequences Detected by Hybridization Other biologically functional equivalent forms of Hmunc13 -encoding nucleic acids can be isolated using conventional DNA-DNA or DNA-RNA hybridization techniques. Thus, the present invention also includes nucleotide sequences that hybridize to one or more of the sequences in Figure 8 or its complementary sequence, and that encode expression for peptides, polypeptides, and proteins exhibiting the same or similar activity as that of the Hmunc13 protein produced by the DNA in Figure 8 or its variants. Such nucleotide sequences preferably hybridize to one or more of the sequences in Figure 8 under moderate to high stringency conditions (see Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Preferable hybridization conditions are high stringency, such as 42°C for a 20- to 30-mer oligonucleotide, 65°C for a 200-500 by DNA probe or 70°C for a 200-400 by cRNA probe.
The present invention also encompasses nucleotide sequences that hybridize to genomic DNA, cDNA, or synthetic DNA molecules that encode the amino acid sequence of the Hmunc13 protein, or genetically degenerate forms thereof due to the degeneracy of the genetic code, under salt and temperature conditions equivalent to those described in this application, and that code on expression for a peptide, polypeptide, or protein that has the same or similar activity as that of the Hmunc13 protein.
A nucleotide sequence described above is considered to possess a biological function substantially equivalent to that of the Hmunc13 genes of the present invention if the protein produced by the nucleotide sequence displays the following characteristics (i) DAG activated transloaction of the protein in vivo from the cytosol to Golgi (as measured by immunocytochemistry, described in the Materials and Methods section), and (ii) the protein activates apoptosis (if the protein is expressed in vivo, the protein's expression is preferably induced by DAG).
Production of Hmunc13 in Eukaryotic and Prokaryotic Cells The nucleotide sequences (also referred to as a DNA sequence or a nucleic acid molecule;
these terms include either a full gene or a gene fragment.. It will be clear to a person skilled in the art whether it is appropriate to use a nucleotide fragment that includes all or a fragment of a gene when practicing the invention) of the invention may be obtained from a cDNA
library. The nucleotide molecules can also be obtained from other sources known in the art such as expressed sequence tag analysis or in vitro synthesis. The DNA described in this application (including variants that are biologically functional equivalents) can be introduced into and expressed in a variety of eukaryotic and prokaryotic host cells. A recombinant nucleotide sequence for the Hmunc13 contains suitable operatively linked transcriptional or translational regulatory elements.
Suitable regulatory elements are derived from a variety of sources, and they may be readily selected by one with ordinary skill in the art (Sambrook, J, Fritsch, E.E. &
Maniatis, T. (1989).
Molecular Cloning: A laboratory manual. Cold Spring Harbor Laboratory Press.
New York;
Ausubel et al. (1989) Current Protocols in Molecular Biology, John Wiley &
Sons, Inc.). For example, if one were to upregulate the expression of the gene, one could insert the sense sequence and the appropriate promoter into the vector. Promoters can be inducible or constitutive, environmentally - or developmentally-regulated, or cell - or tissue-specific.
Transcription is enhanced with promoters known in the art such as CMV, RSV and SV40.
If one were to downregulate the expression of the gene, one could insert the antisense sequence and the appropriate promoter into the vehicle. The nucleotide sequence may be either isolated from a native source (in sense or antisense orientations), synthesized, or it may be a mutated native or synthetic sequence or a combination of these.
Examples of regulatory elements include a transcriptional promoter and enhancer or RNA
polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal.
Additionally, depending on the vector employed, other genetic elements, such as selectable markers, may be incorporated into the recombinant molecule. Other regulatory regions that may be used include an enhancer domain and a termination region. The regulatory elements may be from animal, plant, yeast, bacterial, fungal, viral, avian, insect or other sources, including synthetically produced elements and mutated elements.

In addition to using the expression vectors described above, the polypeptide may be expressed by inserting a recombinant nucleotide sequence in a known expression system derived from bacteria, viruses, yeast, mammals, insects, fungi or birds. The recombinant molecule may be introduced into the cells by techniques such as Agrobacterium tumefaciens-mediated transformation, particle-bombardment-mediated transformation, direct uptake, microinjection, coprecipitation, transfection and electroporation depending on the cell type.
Retroviral vectors, adenoviral vectors, DNA virus vectors and liposomes may be used. Suitable constructs are inserted in an expression vector, which may also include markers for selection of transformed cells. The construct may be inserted at a site created by restriction enzymes.
In one embodiment of the invention, a cell is transfected with a nucleotide sequence of the invention inserted in an expression vector to produce cells expressing the nucleotide sequence.
Another embodiment of the invention relates to a method of transfecting a cell with a nucleotide sequence of the invention, inserted in an expression vector to produce a cell expressing the Hmunc13 protein. The invention also relates to a method of expressing the polypeptides of the invention in a cell.
Probes The invention also includes oligonucleotide probes made from the cloned Hmunc13 nucleotide sequences described in this application or other nucleotide sequences of the invention.
The probes may be 15 to 30 nucleotides in length and are preferably at least 30 or more nucleotides. A preferred probe is 5'-CCTCTCCATTGTGTTCATCACCAC-3' or at least nucleotides of this sequence. The invention also includes at least 30 consecutive nucleotides of Hmunc13 in Figure 8. The probes are useful to identify nucleic acids encoding Hmunc13 peptides, polypeptides and proteins other than those described in the application, as well as peptides, polypeptides, and proteins biologically functionally equivalent to Hmunc13.
The oligonucleotide probes are capable of hybridizing to one or more of the sequences shown in Figure 8 or the other sequences of the invention under stringent hybridization conditions. A
nucleotide sequence encoding a polypeptide of the invention may be isolated from other organisms by screening a library under moderate to high stringency hybridisation conditions with a labeled probe. The activity of the polypeptide encoded by the nucleotide sequence is assessed by cloning and expression of the DNA. After the expression product is isolated the polypeptide is assayed for Hmunc13 activity as described in this application.

Biologically functional equivalent Hmunc13 nucleotide sequences from other cells, or equivalent Hmunc13 -encoding cDNAs or synthetic DNAs, can also be isolated by amplification using Polymerase Chain Reaction (PCR) methods. Oligonucleotide primers, including degenerate primers, based on the amino acid sequence of the sequences in Figures 8 can be prepared and used in conjunction with PCR technology employing reverse transcriptase (E. S.
Kawasaki (1990), In Innis et al., Eds., PCR Protocols, Academic Press, San Diego, Chapter 3, p.
21) to amplify biologically functional equivalent DNAs from genomic or cDNA libraries of other organisms.
Alternatively, the oligonucleotides, including degenerate nucleotides, can be used as probes to screen cDNA libraries.
Biologically Functionally Equivalent Peptides, Polypeptides, and Proteins The present invention includes not only the polypeptides encoded by sequences presented in this application, but also "biologically functional equivalent peptides, polypeptides and proteins"
that exhibit the same or similar Hmunc13 protein activity as proteins described in this application.
The phrase "biologically functional equivalent peptides, polypeptides, and proteins" denotes peptides, polypeptides, and proteins that exhibit the same or similar Hmunc 13 protein activity when assayed. Where only one or two of the terms peptides, polypeptides and proteins is referred to below, it will be clear to one skilled in the art whether the other types of amino acid sequence also would be useful. By "the same or similar Hmunc13 protein activity" is meant the ability to perform the same or similar function as the protein produced by Hmunc13. These peptides, polypeptides, and proteins can contain a region or moiety exhibiting sequence identity (homology) to a corresponding region or moiety of the Hmunc13 protein described in the application, but this is not required as long as they exhibit the same or similar Hmunc13 activity.
Identity refers to the similarity of two polypeptides or proteins (or nucleotide sequences) that are aligned so that the highest order match is obtained. Identity is calculated according to methods known in the art, such as the Gap program, described below. For example, if a polypeptide (called "Sequence A") has 90% identity to a portion of the polypeptide in sequence (a) in Figure 1, then Sequence A will be identical to the referenced portion of the polypeptide in sequence (a) in Figure 1, except that Sequence A may include up to 10 point mutations, such as deletions or substitutions with other amino acids, per each 100 amino acids of the referenced portion of the polypeptide in sequence (a) in Figure 1. Peptides, polypeptides, and proteins biologically functional equivalent to the Hmunc13 proteins can occur in a variety of forms as described below.

A) Conservative Amino Acid Changes in Hmunc13 Sequences Peptides, polypeptides, and proteins biologically functionally equivalent to Hmunc13 protein include amino acid sequences containing amino acid changes in the Hmunc13 sequence.
The biologically functional equivalent peptides, polypeptides, and proteins have at least about 40%
sequence identity (homology), preferably at least about 60%, at least about 75%, at least about 80%, at least about 90% or at least about 95% sequence identity, to the naturally occurring polypeptide, or corresponding region. Most preferably, the biologically functional equivalent peptides, polypeptides, and proteins have at least 97%, 98% or 99% sequence identity to the naturally occurring protein, or corresponding region or moiety. "Sequence identity" is preferably determined by the Gap program. The algorithm of Needleman and Wunsch (1970 J
Mol. Biol.
48:443-453) is used in the Gap program. BestFit is also used to measure sequence identity. It aligns the best segment of similarity between two sequences. Alignments are made using the local homology algorithm of Smith and Waterman (1981 ) Adv. Appl. Math. 2:482-489.
B) Fragments and Variants of Hmunc13 Proteins The invention includes peptides, polypeptides or proteins which retain the same or similar activity as all or part of Hmunc13. Such peptides preferably consist of at least 5 amino acids. In preferred embodiments, they may consist of 6 to 10, 11 to 15, 16 to 25 or 26 to 50, 50 to 150, 150 to 250, 250 to 500 or 500 to 750 amino acids of the Hmunc13. Fragments of the Hmunc13 protein can be created by deleting one or more amino acids from the N-terminus, C-terminus or an internal region of the protein (or combinations of these), so long as such fragments retain the same or similar Hmunc13 activity as all or part of the Hmunc13 protein disclosed in the application. These fragments can be natural mutants of the Hmunc13, or can be produced by restriction nuclease treatment of an encoding nucleotide sequence. Fragments of the polypeptide may be used in an assay to identify compounds that bind the polypeptide.
Methods known in the art may be used to identify agonists and antagonists of the fragments.
Variants of the Hmunc13 protein may also be created by splicing. Variants can also be naturally occurring mutants of the Hmunc13 disclosed in the application. A
combination of techniques known in the art may be used to substitute, delete or add amino acids. For example, a hydrophobic residue such as methionine can be substituted for another hydrophobic residue such as alanine. An alanine residue may be substituted with a more hydrophobic residue such as leucine, valine or isoleucine. An aromatic residue such as phenylalanine may be substituted for tyrosine. An acidic, negatively charged amino acid such as aspartic acid may be substituted for glutamic acid. A positively charged amino acid such as lysine may be substituted for another positively charged amino acid such as arginine. Modifications of the proteins of the invention may also be made by treating a polypeptide of the invention with an agent that chemically alters a side group, for example, by converting a hydrogen group to another group such as a hydroxy or amino group.
Peptides having one or more D-amino acids are contemplated within the invention. Also contemplated are peptides where one or more amino acids are acetylated at the N-terminus.
Those skilled in the art recognize that a variety of techniques are available for constructing peptide mimetics (i.e. a modified peptide or polypeptide or protein) with the same or similar desired biological activity as the corresponding protein of the invention but with more favorable activity than the protein with respect to characteristics such as solubility, stability, and/or susceptibility to hydrolysis and proteolysis. See for example, Morgan and Gainor, Ann. Rep. Med.
Chem., 24:243-252 (1989).
The invention also includes hybrid genes and peptides, for example where a nucleotide sequence from the gene of the invention is combined with another nucleotide sequence to produce a fusion peptide. For example a nucleotide domain from a molecule of interest may be ligated to all or part of a Hmunc13 nucleotide sequence encoding Hmunc13 protein described in this application. Fusion genes and peptides can also be chemically synthesized or produced using other known techniques.
The variants preferably retain the same or similar Hmunc13 activity as the naturally occurring Hmunc13 of the invention. The Hmunc13 activity of such variants can be assayed by techniques described in this application and known in the art of TUNEL and DNA
fragmentation assay.
Variants produced by combinations of the techniques described above but which retain the same or similar Hmunc13 activity as naturally occurring Hmunc13 are also included in the invention (for example, combinations of amino acid additions, deletions, and substitutions).
Fragments and variants of Hmunc13 encompassed by the present invention preferably have at least about 40% sequence identity, preferably at least about 60%, at least about 75%, at least about 80%, at least about 90% or at least about 95% sequence identity, to the naturally occurring protein, or corresponding region or moiety. Most preferably, the fragments have at least 97%, 98% or 99% sequence identity to the naturally occurring polypeptide, or corresponding region. Sequence identity is preferably measured with either the Gap or BestFit programs.

The invention also includes fragments of the polypeptides of the invention which do not retain the same or similar activity as the polypeptides but which can be used as a research tool to characterize the polypeptides of the invention.
Enhancement of Hmunc13 protein activity The activity of the Hmunc13 protein is increased by carrying out selective site-directed mutagenesis. Using protein modelling and other prediction methods, we characterize the binding domain and other critical amino acid residues in the protein that are candidates for mutation, insertion and/or deletion. A DNA plasmid or expression vector containing the Hmunc13 gene or a nucleotide sequence having sequence identity is preferably used for these studies using the U.S.E. (Unique site elimination) mutagenesis kit from Pharmacia Biotech or other similar mutagenesis kits that are commercially available. Once the mutation is carried out and confirmed by DNA sequence analysis, the mutant protein is expressed using an expression system and its activity is monitored. This approach is useful not only to enhance activity, but also to engineer some functional domains for other properties useful in the purification or application of the proteins or the addition of other biological functions. It is also possible to synthesize a DNA fragment based on the sequence of the proteins that encodes smaller proteins that retain activity and are easier to express. It is also possible to modify the expression of the cDNA so that it is induced under environmental conditions other than hyperglycemia or in response to different chemical inducers or hormones. It is also possible to modify the DNA sequence so that the protein is targeted to a different location. All these modifications of the DNA sequences presented in this application and the proteins produced by the modified sequences are encompassed by the present invention.
Pharmaceutical Compositions Hmunc13 or its protein and biologically functional equivalent nucleotide sequences or proteins are also useful when combined with a carrier in a pharmaceutical composition. Suitable examples of vectors for Hmunc13 are described above. The compositions are useful when administered in methods of medical treatment of a disease, disorder or abnormal physical state characterized by insufficient Hmunc13 expression or inadequate levels or activity of Hmunc13 protein. The invention also includes methods of medical treatment of a disease, disorder or abnormal physical state characterized by excessive Hmunc13 expression or levels of activity of Hmunc13 protein, for example by administering a pharmaceutical composition comprising including a carrier and a vector that expresses Hmunc13 antisense DNA.

The pharmaceutical compositions of this invention used to treat patients having degenerative diseases, disorders or abnormal physical states of tissue such as renal and vascular tissue. There is evidence that apoptosis plays a role in renal diseases related to (1 ) glomerular inflammation (2) tubular ischemia, toxins and ureteric obstruction (E.G. Neilson and W.G.
Couser, Immunologic Renal Disease, (1997, 309-329), 8), could include an acceptable carrier, auxiliary or excipient. In some diseases, apoptosis is protective. In other cases, apoptosis may contribute to cell injury.
Regulation of apoptosis plays a critical role in many different renal disease states including both glomerular and tubulointerstitial types of injury. The conditions which may be treated by the compositions include microvascular and renal complications of diabetes and disorders in which renal apoptosis plays a role.
The pharmaceutical compositions can be administered to humans or animals by methods such as aerosol administration, intratracheal instillation and intravenous injection. Dosages to be administered depend on patient needs, on the desired effect and on the chosen route of administration. Nucleotide sequences and proteins may be introduced into cells using in vivo delivery vehicles such as liposomes. They may also be introduced into these cells using physical techniques such as microinjection and electroporation or chemical methods such as coprecipitation and incorporation of DNA into liposomes.
The pharmaceutical compositions can be prepared by known methods for the preparation of pharmaceutically acceptable compositions which can be administered to patients, and such that an effective quantity of the nucleotide sequence or protein is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA).
On this basis, the pharmaceutical compositions could include an active compound or substance, such as a Hmunc13 gene or protein, in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and isoosmotic with the physiological fluids. The methods of combining the active molecules with the vehicles or combining them with diluents is well known to those skilled in the art. The composition could include a targeting agent for the transport of the active compound to specified sites within tissue.
Heterologous overexpression of Hmunc13 as a Research Tool Expression vectors are useful to provide high levels of protein expression.
Cell cultures transformed with the nucleotide sequences of the invention are useful as research tools. Cell cultures are used in overexpression and research according to numerous techniques known in the art. A cell line (either an immortalized cell culture or a primary cell culture) may be transfected with a vector containing a Hmunc13 nucleotide sequence (or variants) to measure levels of expression of the nucleotide sequence and the activity of the nucleotide sequence. A polypeptide of the invention may be used in an assay to identify compounds that bind the polypeptide.
Methods known in the art may be used to identify agonists and antagonists of the polypeptides.
One may obtain cells that do not express Hmunc13 and use them in experiments to assess Hmunc13 gene expression. Experimental groups of cells may be transfected with vectors containing different types of Hmunc13 genes (or genes similar to Hmunc13 or fragments of Hmunc13 gene) to assess the levels of protein produced, its functionality and the phenotype of the cells produced. The polypeptides are also useful for in vitro analysis of Hmunc13 activity. For example, the protein produced can be used for microscopy or X-ray crystallography studies.
Other expression systems can also be utilized to overexpress the Hmunc13 in recombinant systems.
Hmunc13 is a useful research tool. For example, in one embodiment, Hmunc13 cDNA is expressed after it is inserted in a mammalian cell expression plasmid (pCMV~SPORT, Gibco BRL).
In a variation, Hmunc13 cDNA is inserted in an inducible mammalian cell expression plasmid (pIND, Invitrogen). Hmunc13 cDNA may also be positioned in reverse orientation in pIND as a negative control. One can also use N-terminal c-myc tag and C-terminal HA tag Hmunc13 in pIND
and pCMV~SPORT. In a preferred embodiment, stable tansfected mouse mesangial, NIH 3T3, MDCK, HEK 293 and OK cell lines are created with an inducible Hmunc13 plasmid.
Gene Therapy Since it is possible that certain diabetics may be protected from development of renal complications by either up or down regulation of Hmunc13, gene therapy to replace or delete Hmunc13 expression could also be used to modify the developmentiprogression of diabetic renal and vascular complications. In addition, the use of anti-sense DNA that inhibits the expression of hmunc13 will allow treatment of diabetic nephropathy in humans.
The invention also includes methods and compositions for providing gene therapy for treatment of diseases, disorders or abnormal physical states characterized by insufficient Hmunc13 expression or inadequate levels or activity of Hmunc13 protein (see the discussion of phamaceutical discussions, above). The invention also includes methods and compositions for providing gene therapy for treatment of diseases, disorders or abnormal physical states characterized by excessive Hmunc13 expression or levels of activity of Hmunc13 protein The invention includes methods and compositions for providing a nucleotide sequence encoding Hmunc13 or biologically functional equivalent nucleotide sequence to the cells of an individual such that expression of Hmunc13 in the cells provides the biological activity or phenotype of Hmunc13 protein to those cells. Sufficient amounts of the nucleotide sequence are administered and expressed at sufficient levels to provide the biological activity or phenotype of Hmunc13 protein to the cells. For example, the method can preferably involve a method of delivering a gene encoding Hmunc13 to the cells of an individual having a disease, disorder or abnormal physical state, comprising administering to the individual a vector comprising DNA
encoding Hmunc13. The method may also relate to a method for providing an individual with a disease, disorder or abnormal physical state with biologically active Hmunc13 protein by administering DNA encoding Hmunc13. The method may be performed ex vivo or in vivo. Gene therapy methods and compositions are explained, for example, U.S. Patent Nos.
5,672,344, 5,645,829, 5,741,486, 5,656,465, 5,547,932, 5,529,774, 5,436,146, 5,399,346 and 5,670,488, 5, 240, 846.
The method may also relate to a method for producing a stock of recombinant virus by producing virus suitable for gene therapy comprising DNA encoding Hmunc13.
This method preferably involves transfecting cells permissive for virus replication (the virus containing Hmunc12) and collecting the virus produced.
The invention also includes methods and compositions for providing a nucleotide sequence encoding an antisense sequence to Hmunc13 to the cells of an individual such that expression of the antisense sequence prevents Hmunc13 biological activity or phenotype. The methods and compositions can be used in vivo or in vitro. Sufficient amounts of the nucleotide sequence are administered and expressed at sufficient levels to prevent the biological activity or phenotype of Hmunc13 protein to the cells. Similar methods as described in the preceding paragraph may be used with appropriate modifications.
The methods and compositions can be used in vivo or in vitro. The evidence for in vitro usefulness is downregulation of Hmunc13 in hyperglycemia conditions can inhibit hyperglycemia induced renal cell injury.
The invention also includes compositions (preferably pharmaceutical compositions for gene therapy). The compositions include a vector containing Hmunc13 or a biologically functional equivalent molecule or antisense DNA. The carrier may be a pharmaceutical carrier or a host cell transformant including the vector. Vectors known in the art are adenovirus and herpesvirus vectors. The invention also includes packaging cell lines that produce the vector. Methods of producing the vector and methods of gene therapy using the vector are also included with the invention.
The invention also includes a transformed cell, such as an MC cell or other cell described in this application, containing the vector and recombinant Hmunc13 nucleotide sequence or a biologically functional equivalent molecule.
Identification of a Mouse munc13 ("Mmunc13") cDNA and Polypeptide We identified a Mouse munc 13 gene by using a Genetrapper cDNA Positive Selection System (GIBCO BRL) using techniques similar to those previously reported (Song et al., Kidney International, 1998), we cloned a 3.5 kb cDNA which highly homologous to the 3' end of Hmunc13 from a mouse kidney cDNA library (GIBCO BRL) with a biotinylated oligo (5'-GTGGTGATGAACACAATGGAGAGG-3'). To clone the 5' end of Mmunc13, we used nested PCR
with gene specific primers (5'-GAGGTTGTTCCTGCAGCTATACTGG-3' and 5'-AGTTCAAGCAGGCTTTCACACAGTCC-3') derived from the sequence obtained above and primers that targeted to an adapter (5'-GCTATTTAGGTGACACTATAGAAGGTACGCCTGCAGGTACCGGTCCGGAATTCCCGGGTCGA
CCCACGCGTCCG-3' ) that introduced to the 5' end of the cDNA after reverse transcription. PCR
was performed with a proof reading enzyme mix of Taq and Pfu (Elongase, GIBCO
BRL). The Mmunc13 cDNA is shown in Figure 16.
The description of how modifications (e.g. to enhance activity), fragments and variations may be made to Hmunc13 nucleic acid molecules and polypeptides is also applicable to Mmunc13. The modified, fragmented and varied nucleic acid molecules and polypeptides preferably retain Mmunc13 functional activity. The description of Hmunc13 mimetics and their preparation is also applicable to Mmunc13. The description of how to identify sequences that hybridize to the nucleotide sequence of Hmunc13 may also be adapted for Mmunc13.
Recombinant DNA, systems for expression of Mmunc13 (eg. with plasmids and virsues) and cells transformed with the expression vector may also be adapted according to the description in relation to Hmunc13. Preferred methods for expressing Hmunc13 and isolating the polypeptide are also adaptable for Mmunc13. Pharmaceutical compositions including Mmunc13 gene or polypeptide may also be prepared according to the description for Hmunc13 and techniques known in the art. Kits, antibodies (preferably monoclonal and polyclonal antibodies) may be prepared for Mmunc13 using techniques described with respect to Hmunc13.
Portions of the Mmunc13 sequence are also useful as a probe. Mmunc13 may be used in methods of medical treatment (including gene therapy) of a disease, disorder or abnormal physical state, characterized by excessive or inadequate Hmunc13 expression, in the same manner as techniques involving Hmunc13. It will be apparent to those skilled in the art that other description in relation to Hmunc13 can be adapted and is applicable to Mmunc13.
Creation of a Mouse Knock-out Model for Mouse munc13 A probe of the 5' segment (400 bp) mouse munc13 (Mmunc13) was generated by PCR.
Using this probe, a genomic DNA library prepared from mouse liver (129 svj) is screened. A piece of genomic DNA of Mmunc13 with its promoter (about 10 -12 kb) is isolated.
After characterizing this gene, we construct a targeting vector containing a PGK-neo cassette flanked by 5' and 3' regions of homology totaling 10 kb, such that a homologous targeting event results in the insertion of PGK-neo into promoter region and exon 1 of Mmunc13. In addition, the vector contains HSV-TK at one end to allow the negative selection of non-homologous recombinant events by gancyclovir. The vector is introduced by electroporation into embryonic stem (ES) cell (AB 2.2, Stratagene) and dual-resistant clones are selected in 6418 and gancyclovir.
Homologous recombination clones are identified by PCR and/or Southern blot analysis.
Positive ES clones are then be injected into wild-type blastocysts to generate chimeric mice, which are then be used to establish pedigrees carrying the mutant Mmunc13 allele. We characterize the Mmunc 13 knockout mouse invention as a mouse model of "reduced apoptosis". The Mmunc 13 knockout will not respond to endogenous diacylglycerol (DAG) by induction of apoptosis, therefore, the DAG
induced proliferative signaling response mediated through PKC activation, will go unchecked.
Such a mouse model is useful in research relating to a wide range of diseases, most preferably diabetes and cancer.
Preparation of Antibodies The Hmunc13 protein is also useful as an antigen for the preparation of antibodies that can be used to purify or detect other munc13 or munc13-like proteins. Monoclonal and polyclonal antibodies are prepared according to other techniques known in the art. For examples of methods of the preparation and uses of monoclonal antibodies, see U.S. Patent Nos.
5,688,681, 5,688,657, 5,683,693, 5,667,781, 5,665,356, 5,591,628, 5,510,241, 5,503,987, 5,501,988, 5,500,345 and 5,496,705. Examples of the preparation and uses of polyclonal antibodies are disclosed in U.S.
Patent Nos. 5,512,282, 4,828,985, 5,225,331 and 5,124,147. Antibodies recognizing Hmunc13 can be employed to screen organisms containing Hmunc13 protein or Hmunc13-like proteins. The antibodies are also valuable for immuno-purification of Hmunc13 or Hmunc13-like proteins from crude extracts.

We prepare two peptide specific polyclonal antibodies against a C-terminal segment (preferably all or part of NH2-SQRSNDEVREFVKL-COOH) and an N-terminal segment (preferably all or part of NH2-TIRQSDEEGPGEW-COOH) of Hmunc13 which has ability to detect rat munc13-1, 13-2 and 13-3.
Screening for Agonists and Antagonists of Hmunc13 and Inhibitors of Hmunc13 Protein As described above, munc13 is useful in a pharmaceutical preparation to treat diabetes or its complications. Hmunc13 is also useful as a target. Chemical libraries are used to identify pharmacophores which can specifically interact with Hmunc13 either in an inhibitory or stimulatory mode. The Hmunc13 targets that would be used in drug design include - e.g. the DAG binding site or some other functional domain specific to Hmunc13.
Modulation of Hmunc13 expression is commercially useful for identification and development of drugs to inhibit and/or enhance Hmunc13 function directly. Such drugs would be targeted to any of the following sites: the DAG, Ca", phosphatase and RGD
domains.
The invention also includes methods of screening a test compound to determine whether it antagonizes or agonizes Hmunc13 protein expression. For example, one method involves testing whether a compound inhibits the translocation of Hmunc13 from cytosol to Golgi as well as its apoptotic effect. The invention also includes methods of screening a test compound to determine whether it induces or inhibits Hmunc13 expression. For example, one method involves testing whether a compound inhibits the promoter activity of Hmunc13.
Expression of Hmunc13 Hmunc13 is expressed in MC, human cortical epithelial cells and cells from testis, ovaries, prostate gland, colon, brain and heart.. Experiments to determine where the gene is expressed were done with RT-PCR. The function of Hmunc13 in other cells will be similar to that in renal epithelial cells such as in translocation and apoptosis Hmunc13 has a C1 domain. A region of the C1 domain from C. elegans unc-13 binds to phorbol esters and DAG similar to PKC (21 ). We noted that the C1 domain is similar among C.
elegans unc13, rat munc13s and Hmunc13 (Fig. 1 ), so the C1 domain in the Hmunc13 can also bind phorbol esters. Hmunc13 is also involved in cell signaling in response to DAG binding.
Regulation of Hmunc13 in the Kidney We found that expression of Hmunc13 in cultured MC was up-regulated by high-glucose treatment (25 mM D-glucose). Even 15 mM D-glucose is enough to stimulate the over expression of Hmunc13 as revealed by Northern blot. There are reports indicated that hyperglycemia increases PKC activity in MC (13, 14, 31). Furthermore, DAG levels are increased when cultured MC are exposed to hyperglycemia (17, 13). Since Hmunc13 and PKC share similar binding capacities for phorbol esters and DAG and both PKC contain C2 domains, Hmunc13 is part of an alternative cascade following DAG binding. Thus Hmunc13 is activated in response to hyperglycemic induced increases in DAG. Even though Hmunc13 does not contain a kinase domain and cannot therefore serve as a downstream regulator by protein phosphorylation (20, 30), nevertheless it is possible that Hmunc13 modulates intracellular events through competitive binding of PKC or by regulation of vesicle trafficking and exocytosis.

Subcellular Localization of Hmunc13 in vitro Expression of epitope-tagged hmunc13 in OK cells show that Hmunc13 has a cytoplasmic distribution under basal conditions, but with PDBu stimulation, Hmunc13 is translocated to the Golgi apparatus. This effect is unlikely to have taken place through activation of endogenous PKC, since the deletion mutant, C1 less mutant (without the DAG binding domain), showed no translocation. In a recent study reported by Betz et al. (24), munc13-1 was localized to the presynaptic region in rat brain by immunocytochemistry. In transfected HEK 293 cells, green fluorescent protein tagged munc13-1, -2 and -3 are all translocated to plasma membrane following phorbol ester stimulation.
The fact that hmunc13 is translocated to the Golgi apparatus in response to phorbol ester activation compared to translocation of munc13-1, -2 and -3 to the plasma membrane is proves that Hmunc13 is a unique isoform of munc13s. This brings up the relationship of the DAG
activated signaling pathways of munc13s and PKC. The multiplicity of PKC
isoforms and the tissue specificity of PKC functional expression are well known (32). The munc13 pathway is also composed of tissue specific functionally different isoforms. However, unlike PKC, the munc13 proteins have no kinase domain (20, 33).
The Golgi apparatus is involved in vesicular traffic. A number of SNARE
proteins, such as yeast SedSp (34) and mVps45 (35), mammalian syntaxin 6 (36), VAMP4, Syntaxin 13 and mVtib (36), have all been reported to be localized to the Golgi. Rat munc13-1 has been shown to interact with a number of proteins involved in vesicle docking and trafficking, such as syntaxin (24) and Doc2 (37). Interaction of munc13-1 and Doc2 was stimulated by DAG and has been suggested to be involved in Ca2+ dependent exocytosis (37). The finding in the present study that translocation of Hmunc13 to the Golgi after DAG stimulation is another indication that Hmunc13 is a protein that participates in DAG regulated vesicle trafficking and exocytosis. Further studies are required to investigate if Hmunc13 interacts with other Golgi localized SNARE
proteins or whether some SNARE proteins co-translocate to the Golgi with Hmunc13 after DAG
stimulation. It has also been suggested that PKC plays a role in Golgi budding (for review see 38). For example, a study in S. Cerevisiae implicated DAG as playing an important role in the formation of Golgi budding involving Sec14 (39). Since Hmunc13 translocates to the Golgi after DAG stimulation, it would also be of interest to determine the role of Hmunc13 is involved in Golgi budding and interaction with Sec14L, the partial mammalian homologue of yeast Sec14 (40).

Role of Hmunc13 in Apoptosis We investigated the localization of Hmunc13 to determine whether exposure to phorbol esters had any effect on its intracellular translocation. In the course of carrying out these studies, we observed that cells transfected with Hmunc13 became rounded up and died following treatment with phorbol 12, 13-dibutyrate (PDBu), a phorbol ester analogue. We examined the mechanism of phorbol ester induced cell death in the transfected cells. We showed that exposure to phorbol ester causes apoptosis through activation of Hmunc13. This shows the interaction between the diabetic state, activation of Hmunc13 and cell damage.
The induction of apoptosis in Hmunc13 transfected cells after PDBu stimulation was unexpected. This effect is unlikely to have occurred through other DAG
activated pathways since the C1 less mutant transfected cells were not apoptotic after PDBu treatment.
PDBu is a reagent known to be a tumor promoter capable of stimulating cell proliferation through PKC activation (41 ).
Although the role of PKC in apoptosis is not consistent in the literature (42, 43), the bulk of evidence shows that PKC, especially PKCa, activated by phorbol esters such as PMA and PDBu, inhibits apoptosis (41-44). There is also a body of evidence suggesting that, in the case of PKC
induced apoptosis, down-regulation rather than DAG activation of PKC is responsible for this effect (43, 45).
Hmunc13 Participates in a Signaling Pathway and Counterbalances DAG Activated PKC
Considering the functional characteristics of Hmunc13 as and the known behavior of munc13-1, -2, and -3 in rat brain, we determined a model for the cellular activation of Hmunc13 and PKC isoforms. Since both munc13s and PKC have similar binding affinity to phorbol esters, our results showing that cells transfected with Hmunc13 become apoptotic after DAG treatment mean that Hmunc13 participates in a signaling pathway that serves to counterbalance DAG
activated PKC. This concept is illustrated schematically in Figure 15. DAG
acts as a secondary messenger to activate two alternate pathways - one pathway effected through PKC results in kinase activation and serine/threonine phospholylaton of downstream targets leading to cell proliferation while the other pathway effected through Hmunc13 induces apoptosis, preferably through interaction involving vesicle trafficking.
Pathogenesis of the Microvascular and Renal Complications of Diabetes.
We have shown that in rat kidney, munc13-1 and munc13-2 are mainly localized to cortical tubular epithelial cells. Using both in situ hybridization and relative RT-PCR, we have also demonstrated that munc13-1 and munc13-2 are over-expressed in kidney of STZ-treated diabetic rats. This result in rat kidney is consistent with our in vitro findings, showing that expression of Hmunc13 is up-regulated by high glucose treatment in cultured human mesangial cells. It has been reported that an increase in intracellular DAG levels is only detectable after 2 days of high glucose treatment (46). The fact that expression of both rat munc13-1 and munc13-2 is found to be increased after only 1 day of hyperglycemia shows that over-expression of these genes is a consequence of hyperglycemia and not secondary to stimulation by DAG.
Therefore, in diabetes, there are two mechanisms acting to increase activity of Hmunc13: (i) hyperglycemia itself, (ii) hyperglycemia-induced increase in cellular DAG (47-49). The over-expression of Hmunc13 is a major contributor to cell injury in diabetic nephropathy by inducing apoptosis. In this regard, it is noteworthy that under hyperglycemic condition, renal tubular cells undergo apoptosis (50-51 ).
Finally, since PKC inhibitors have been developed to treat diabetic nephropathy (49), a potential side effect of those inhibitors could result from overactivity of Hmunc13.
Identification of the Molecular Basis of Hmunc13 Signaling and Induction of Apoptosis p44/42 MAPK Results Interaction of Hmunc13 with p44/42 MAPK
In pilot experiments designed to identify proteins interacting with Hmunc13, we observed that a major band with molecular weight 42 kDa was co-immunoprecipitated with Hmunc13 in HEK
293 cells transfected with either Hmunc13 or its deletion mutant without the C1 domain (C1 less mutant), but was not present in cells transfected with empty plasmid, pCMV.
Since PKC is one of the principal activators of p44/42 MAPK and since DAG activation of Hmunc13 (leading to apoptosis) serves as a functional counterbalance (9) to DAG activation of PKC
(leading to proliferation), the protein that co-immunoprecipitated with Hmunc13 was p44/42 MAPK.
To prove this, we immunoprecipitated Hmunc13 from transiently transfected HEK
293 cells at various times following exposure to 100 nM PDBu and probed for p44/42 MAPK.
As indicated in figure 18a (upper panel), p44/42 MAPK co-immunoprecipitated with N-terminal c-myc-tagged Hmunc13 (myc-Hmunc13) in a time dependent manner peaking at about 30 min. No p44/42 MAPK was detected in controls using normal mouse IgG for precipitation (data not shown) or in cells transfected with pCMV. To confirm this finding, cells were transiently transfected with C-terminal HA-tagged Hmunc13 (Hmunc13-HA) and pCMV (empty plasmid) in the presence of PDBu, then immunoprecipitated with anti-HA antibody and probed for p44/42 MAPK. As shown in the lower panel of figure 18a, a time dependent increase in co-immunoprecipitated p44/42 MAPK, which is absent in the control is again observed. To demonstrate that the Hmunc13-p44/42 MAPK
interaction is dependent on DAG activation of Hmuncl3, cell lysates from cells transfected with Hmunc13-HA, the C1 less mutant (with a HA tag) or pCMV were each exposed to 100 nM PDBu for varying times, then immunoprecipitated with anti-p44/42 MAPK and immunobloted with anti-HA. As shown in figure 18b, the amount of immunoprecipitated Hmunc13 after PDBu treatment increases steadily up to 45 min and then decreases. But in the C1 less mutant transfected cells, the amount of immunoprecipitated C1 less mutant protein remains constant during the time course of PDBu treatment although expression of Hmunc13 or the C1 less mutant was similar under the two different conditions. No Hmunc13 or C1 less mutant protein was detected when immunoprecipitation was carried out with normal rabbit IgG (data not shown).
Collectively these results demonstrate that DAG-activated Hmunc13 results in a specific protein-protein interaction with p44/42 MAPK.
Interaction of Hmunc13 with p44/42 MAPK results in deactivation of t~44/42 MAPK
To show that the interaction of Hmunc13 with p44/42 MAPK has an effect on p44/42 MAPK
activity, we measured the extent of p44/42 MAPK phosphorylation using an antibody specific for phosphorylated p44/42 MAPK, in PDBu treated cells transfected either with Hmunc13-HA, its C1 less mutant or pCMV. In the case of each transfection, immunoblotting was performed with vehicle alone, and after 5, 15, 45 and 90 minutes following exposure to 100 nM
PDBu. As indicated in figure 19a, Hmunc13 or its C1 less mutant has no effect on basal phosphorylation of p44/42 MAPK (i.e. when cells are treated with vehicle only). But PDBu treated cells transfected with either pCMV or the C1 less mutant, results in an expected time dependent increase in phosphorylation of p44/42 MAPK which reaches a maximum and remains constant after 15 min up to 90 min. In contrast, for the case of PDBu treated cells transfected with Hmunc13-HA, there is an initial increase in phosphorylation of p44/42 MAPK but after 45 min the degree of phosphorylation is significantly reduced and decreases even further by 90 min (upper panel of figure 19a and corresponding densitometric readings in the third panel of figure 19a). Moreover the effects on p42/44 MAPK are specific because phosphorylation of p38 MAPK is not altered in cells transfected with Hmunc13-HA compared to the C1 less mutant and pCMV
transfected cells (lower two panels of figure 19a). We have also found that p38 MAPK is not co-immunoprecipitated with Hmunc13 or the C1 less mutant.
In figure 19b it is further demonstrated (this time using a p44/42 MAPK
activity assay) that p44/42 MAPK activity is reduced following treatment with PDBu for 45 min in cells transfected with Hmunc13, compared to pCMV empty plasmid controls.
A segment consisting of aa309-371 of Hmunc13 (EB domain) is necessary for its interaction with p44/42 MAPK
To show the region of Hmunc13 that interacts with p44/42 MAPK, a systematic comparison of different segments of Hmunc13 was undertaken using available protein amino acid sequences in the GenBank Database. As a result of EB (EK binding) this search, we discovered that the region consisting of about amino acids 309-371 which was named the "EB (EK
binding) domain"
has significant similarity to a segment of the 8 isoform of the B' subunit of protein phosphatase 2Ao - a serine threonine phosphatase (20) (Fig. 20). Accordingly addressed two separate issues:
(i) whether dephosphorylation of p44/42 MAPK is mediated through Hmunc13-induced phosphatase activity, and (ii) does the segment of amino acids 309-371 participate directly in the interaction between Hmunc13 and p44/42 MAPK. A truncated mutant of Hmunc13-HA
was constructed without this domain (EB less mutant).
To show that the segment aa309-371 is required for the interaction of Hmunc13 with p44/42 MAPK, Hmunc13-HA as well as the C1 less and PP less mutant were separately transfected into HEK 293 cells. As indicated in figure 21a, the amount of co-immunoprecipitated PP less mutant with p44/42 MAPK is much less compared to what was co-immunoprecipitated with either wild type Hmunc13 or C1 less mutant. Not only does deletion of the segment aa309-371 abolish DAG induced protein-protein interaction between Hmunc13 and p44/42 MAPK, but in addition, as shown in figure 21 b, the dephosphorylation of p44/42 MAPK caused by DAG
activation of Hmunc13, is also eliminated.
We constructed a GST fusion protein of the EB claim (GST-EB). Next, GST-EB as well as GST alone were incubated with recombinant p44 MAPK and then precipitated with glutathione sepharose 4B, washed and then subjected to immunoblotting with anti p44/42 MAPK antibody. As shown in figure 21 c (left hand panel), GST-EB but not GST alone, was able to bind p44 MAPK.
Finally, we sought to determine if PDBu activated Hmunc13 induction of apoptosis was directly dependent on the protein-protein interaction between activated Hmunc13 and p44/42 MAPK. As shown in figure 21d, PDBu treatment of HEK193 cells transfected with the PP less mutant, does not result in induction of apoptosis, in contrast to what happens when cells are transfected with wild type Hmunc13 (9).
Taken together these data show that the aa309-371 region of Hmunc13 is required for the protein-protein interaction between DAG activated Hmunc13 and p44/42 MAPK. It is important to note that DAG binding to the EB less mutant has not been affected since we have observed by confocal immunocytochemistry that the EB less mutant translocates from cytosol to Golgi apparatus (data not shown) in response to PDBu stimulation in a very similar fashion, to what is observed with wild type Hmunc13 (9).
Down-re4ulation of bcl-2 and mcl-1 expression in cells transfected with Hmunc13 in response to PDBu treatment Up-regulation of bcl-2 expression by nerve growth factor (NGF) is effected through action on the bcl-2 promoter, mediated by activation of p44/42 MAPK (16). We showed that regulation of bcl-2 and its family members is involved in the apoptotic effect of DAG
activated Hmunc13. To investigate this issue we employed RPA to determine the simultaneous expression of various pro-and anti-apoptotic genes in the presence of PDBu treatment. We found that expression of bcl-2 and mcl-1 are both decreased while expression of bclx(s) is increased in a time dependent manner in cells transfected with Hmunc13 after PDBu treatment (Fig. 22a) but not in cells transfected with the C1 less mutant. Decreased expression of bcl-2 and mcl-1 is further demonstrated by immunoblot analysis with antibodies against bcl-2 and mcl-1 (Fig. 22b).
However, increased expression of bclx(s) could not be confirmed by Western blot analysis (Fig.
22b).
The EB domain is capable of blocking p44/42 MAPK activity. The region can be derived from Hmunc13 or Mmunc13 in any of a variety of ways, such as, for example, by proteolytic cleavage. Alternatively, polypeptides can be produced by recombinant means or by chemical synthesis.
The invention also includes antibodies raised against all or part of the region described above (monoclonal or polyclonal antibodies), as well as antibody-like proteins (i.e., recombinant antibodies, single-chain antibodies, and the like), recombinant protein fragments and RNA
sequences that specifically bind the above-described polypeptides. One skilled in the art can readily prepare such binding molecules, without undue experimentation, given the sequence and description of the region described in this application.
In accordance with still another embodiment of the present invention, there is provided a method to inhibit Hmunc13 induction of apoptosis, the method comprising blocking Hmunc13-p44/42 MAPK binding. Such blocking can be accomplished in a variety of ways, for example, by contacting the cells or tissues to be treated with an effective amount of the an agent which reduces Hmunc13 binding to p44/42 MAPK. Suitable agents can be identified by assays described in this application.
It is possible that the specific epitope determining the hmunc13 - p44/42 MAPK
interaction is smaller than the 64 as stretch the EB domain of Hmunc13. The amino acid sequence may include less than about: 64 amino acids, 50 amino acids, 40 amino acids, 30 amino acids or less than about 20 amino acids. We measure the interaction of these sequences with p44/42 MAPK.
Nevertheless, the region amino acids 309-371 of Hmunc13 is a "target" for compounds designed to modulate (i.e. block) the downstream effects (such as induction of apoptosis) associated with DAG activation of Hmunc13.
The invention includes a method of (a) modulating p44/42 MAPK activity and/or (b) medical treatment of a disease, disorder or abnormal physical state, the method comprising administering to a subject an effective amount of a compound selected from the group of (i) a polypeptide comprising Hmunc13, (ii) the EB domain or amino acids 309-371 in MMunc13 of Hmunc13 (iii) a polypeptide having at least about: 40%, 60%, 80% or 95% sequence identity or preferably at least about 96%, at least about 97%, at least about 98%, at least about 99% or at least about 99.5%
sequence identity to amino acids 309-371 of Hmunc13, (iv) a fragment of (iii) capable of binding to and modulating p44/42 MAPK activity (v) a mimetic or fragment of any of the foregoing or (vi) a nucleic acid molecule encoding any of the foregoing, (vii) a nucleic acid molecule having at least about: 40%, 60%, 80% or 95% sequence identity or preferably at least about 96%, at least about 97%, at least about 98%, at least about 99% or at least about 99.5% sequence identity to (vi).
The compound of any of (i) to (vi) may be combined with a carrier in a pharmaceutical composition. Suitable carriers and pharmaceutical compositions are described in this application and known in the art. The disease, disorder or abnormal physical state is preferably selected from the group consisting of apoptosis, insulin dependent and independent diabetes, glomerulopathy and renal failure in the treatment of different carcinomas.
The present invention is also directed to methods of screening for compounds which modulate the interaction of Humnc13 polypeptide and p44/42 MAPK in vivo or in vitro.
Compounds which modulate these activities may be peptides, polypeptides or non-polypeptideaceous organic molecules. Compounds may modulate by increasing or attenuating the function of Humnc13 polypeptide or p44/42 MAPK. The compounds may be targeted to all or part of a polypeptide comprising amino acids 309-371 of Hmunc13. Compounds that modulate the function of Humnc13 polypeptide may be detected by a variety of assays.
The assay may be a simple "yes/no" assay to determine whether there is a change in expression or function. The assay may be made quantitative by comparing the expression or function of a test sample with the levels of expression or function in a standard sample.
For example, an assay may be done to determine compounds which bind to the EB
domain of Hmunc13 or another polypeptide includingthe EB domain. Assays may also be done to determine compounds which disrupt or increase binding of p44/42 MAPK to the EB
domain of Hmunc13 or another polypeptide including amino acids 309-371.
Assays may also be done to identify compounds which modulate the interactions of Hmunc13 and p44/42 MAPK. These compounds may, for example, bind to Hmunc13 or p44/42 MAPK. The phosphorylation of p44/42 MAPK may be measured with antibodies as previously described. Similar screening assays may be performed to identify other compounds that bind to p44/42 MAPK. For example, mimetics of amino acids 309-371 of Hmunc13 (or a fragment thereof) may be screened to determine their ability to bind and/or affect p44/42 MAPK activity.
Hmunc13 is useful in an assay for evaluating whether test compounds are capable of acting as antagonists for Hmunc13 polypeptide binding to p44/42 MAPK by, for example:
mixing a chemical with p44/42 MAPK and Hmunc and determining whether the chemical is able to reduce co-immunoprecipitation of p44/42 MAPK with Hmunc13 as described above and block the dephosphorylation effect of Hmunc13 on p44/42 MAPK.
Another experiment is an assay for evaluating whether test compounds are capable of acting as agonists for Hmunc13 polypeptide activity by, for example: mixing a chemical with p44/42 MAPK and Hmunc13 and determining whether the chemical is capable of enhancing co-immunoprecipitation of p44/42MAPK with munc13 as described above and that dephosphorylated effect of Hmunc13 as described above and the dephosphorylated effect of Hmunc13 on p44/42 MAPK. Derivatives of Hmunc13, fragments and homologs of Hmunc13 having the same or similar activity as Hmunc13 may be used in the assays of the invention.
Other suitable assays may be adapted from, for example, US patent no.
5,851,788, 5,798,442 and 5,834,228. EXPERIMENTS
Experiment 1 - DDRT-PCR
DDRT-PCR carried out on RNA extracts from MC exposed to high vs. low glucose conditions yielded 10 bands which exhibited differences between high glucose treatment and controls (both normal glucose and osmolarity controls) (data not shown). After the bands had been cut, reamplified, cloned and sequenced, the sequences were compared to the GenBank database. One of the cDNA sequences had identity to a segment (residues 3523-3863) of rat munc13-2 (20). Since rat munc13-2 is viewed as having a potential signaling function particularly in neurotransmission and in addition has not previously been reported in any tissue outside the brain, we elected to clone the full gene from human kidney and confirm the nature of its regulation by hyperglycemia.
Experiment 2 -Cloning of Hmunc13 As a first step we cloned a partial length cDNA from a commercial human kidney cDNA
library using oligonucleotides derived from sequence information obtained from DDRT-PCR
comparing cells at 25 mM D-glucose vs. 5.5 mM D-glucose and osmolarity control (see Methods).
Then, using the sequence of the partial length clone, we designed another oligonucleotide closer to the 5' end and proceeded to clone a full-length cDNA (6.3kb, pCMV~SPORTHmunc13), which we have named Hmunc13. This cDNA encodes a protein with a predicted molecular weight of 180.5 kDa. As shown in figure 1, kidney Hmunc13 contains 3 C2 domains and 1 C1 domain. The N-terminal segment of Hmunc13 (residues 1-100) is similar to to rat munc13-1 (Fig. 1 b). The next segment (residues 101-391 ) exhibits considerable variation in Hmunc13 compared to rat munc13s and unc-13 (7). The C-terminal segment of unc-13s is highly conserved among human, rat and C.
elegans (Fig. 1, ref. 7). In particular, the protein segment from residue 392 to 1591 of Hmunc13 is about 93% similar to rat munc13-2 (residue 766-1985), 79% similar to munc13-1 (residue 486-1735) and 74% similar to munc13-3 (residue 1000-2207). In summary, the C
terminus of renal Hmunc13 has strongest identity to rat munc13-2 whereas the N-terminal of Hmunc13 has strongest identity to rat munc13-1.
Experiment 3 - Hyperglycemia Up-regulates Hmunc13 mRNA Expression in Kidney MC
To confirm the differential expression of Hmunc13 under varying glucose concentrations two independent methods were employed. In a pilot study, by using ribonuclease protection assays, we have found that expression of Hmunc13 in human MC treated with 19.5 mM L-glucose + 5.5 mM D-glucose (osmolarity control) was not changed (data not shown).
Therefore, in the following experiment, we only compared the difference of Hmunc-13 expression between high D-glucose and high L-glucose treated MC. We first used relative RT-PCR with 18S
rRNA as a housekeeping gene. As shown in figure 2a, Hmunc13 was up-regulated in the high-glucose (25mM) treated MC compared to osmolarity controls. In a more quantitative way, Northern blot analysis was carried out on cells grown according to the same protocol. As revealed by relative RT-PCR, Hmunc13 expression was increased in MC after hyperglycemia (Fig. 2b).
Quantitative desitometry analysis revealed 70% increase of Hmunc13 expression after exposure to 25 mM D-glucose treatment (p < 0.05, n = 5, student's t-test). As shown in figure 2b, Hmunc13 expression in MC following exposure to 15 mM D-glucose was also increased relative to osmolarity control but there was no statistically significant difference between 15 mM D-glucose and 25 mM D-glucose treated cells.
Experiment 4 - Expression of Munc13 in Epithelial and Rat MC
To show that munc13 is also expressed in other cell types in the kidney besides MC and that it is expressed in the rat MC as well as human, RT-PCR was performed using a pair of primers specific for both Hmunc13 and rat munc13-2. As shown in figure 3, Hmunc13 was detected in cultured human kidney cortical epithelial cells and munc13-2 was also expressed in primary cultured rat MC. Genomic contamination is unlikely since no band was observed in the no RT control for the GAPDH housekeeping gene (Fig. 3).

Experiment 5 - Hmunc13 is Expressed as a 180 kDa Protein in vitro and is Membrane Associated Using a cell free in vitro translation system, we have demonstrated that Hmunc13 is expressed as a 170 kDa protein (Fig. 4). This is close to the predicted MW
(180.5 kDa) from the cDNA clone. A number of less prominent lower molecular weight bands is also present following in vitro translation because of either initiation of translation from internal AUG codons rather than the first interaction site or a premature termination of translation. Also shown in figure 4 is that in the presence of canine pancreatic microsomal membranes, a proportion of Hmunc13 protein is shifted to a higher molecular weight 0180 kDa) suggesting that it is membrane associated and undergoes co-translational processing. Only the full-length protein is associated with the membrane because the partial length in vitro translation products are not observed in the microsomal pellet (Fig. 4, lane 2).
Experiment 6 - Translocation of Hmunc13 to Golai apparatus after DAG treatment To study its cellular function, we elected to over-express Hmunc13 in opossum kidney (OK) cells, a cell line of renal epithelia origin and compare two constructs -an HA tagged Hmunc13 and an HA tagged Hmunc13 deletion mutant lacking the C1 domain (C1 less mutant).
Cells employed in the present study were grown on glass cover slips under growth arrested conditions with serum starvation. Transient transfection of OK cells was confirmed by Western blot analysis (Figure 10). As shown in Figure 10(i), an 180 kDa protein was expressed in the Hmunc13-HA transfected cells and a 175 kDa protein was detected in the C1 less mutant transfected cells. No band was detected in cells transfected with empty plasmid, pCMV~SPORT.
Intracellular localization of Hmunc13-HA in transfected OK cells was monitored by immunocytochemistry (ICC) using cells doubly labeled with anti-HA antibody (Fig. 10(ii), upper panels) and wheat germ agglutinin (WGA) (Fig. 10(ii), lower panels). As indicated in Figure 10(ii), inspection of panel A reveals that Hmunc13 exhibits a cytosolic distribution compared to the Golgi apparatus stained with WGA shown in Panel E. But after exposure to 0.1 pM
PDBu, a DAG
analogue, Hmunc13 is translocated to the peri-nuclear area (panel B) and co-localizes with WGA
at the Golgi apparatus (compare panels B and F). Translocation of Hmunc13 to the Golgi after PDBu treatment occurred in 15-30 min and became more obvious in 2-3 h. By contrast, when cells were transfected with the C1 less mutant, lacking a DAG binding domain, there was no translocation after PDBu treatment (refer to panels D and H) and Hmunc13 staining remained cytosolic.

When cells were treated with nocodazole, a drug that depolymerizes microtubules, (52), after PDBu treatment, the patterns of WGA and Hmunc13 staining became identical and both revealed a dispersed Golgi pattern (compare panels C and E of Fig. 10 (ii)).
Translocation of Hmunc13 from cytosol to the Golgi apparatus after PDBu treatment was also confirmed by immunoblot analysis of a Golgi membrane preparation, following subcellular fractionation. As shown in Figure 10 (iii), after PDBU treatment, Hmunc13 is enriched in Golgi membranes compared to whole cell lysates. .
Experiment 7 - Hmunc13 over-expressed cells are apoptotic after DAG treatment The PDBu induced translocation from cytosol to Golgi suggests that Hmunc13 has functional implications. While attempting to study the effect of prolonged exposure to DAG
activation on Hmunc13 transfected cells, we noticed that the cells rounded up and died. However, Hmunc13 transfected cells without PDBu treatment and cells transfected with the C1 less mutant, with or without PDBu treatment, were relatively healthy. This finding was somewhat unexpected since DAG has long been known as a carcinogen and a promoter of cell growth, and led us to investigate the possibility and conclude that treatment with phorbol ester is inducing apoptosis in cells transfected with Hmunc13.
Using the TUNEL assay, we found that the number of apoptotic cells was significantly increased in hmunc13 transfected OK cells after 8 h and 16 h of PDBu treatment. These results are displayed in Figure 11 (i). The upper panels show the expression of Hmunc13 in OK cells and the lower panels demonstrate the presence of fluorescein labeled TUNEL on the same cells.
Inspection of panel F (8 h of PDBu treatment) and panel G (16 h of PDBU
treatment) compared to panel E (treatment with vehicle control) reveals evidence of DAG induced increase in TUNEL
staining cells. This conclusion is further supported by the fact that cells transfected with the C1 less mutant, exhibit almost no labeling with TUNEL following exposure to PDBu for 16 h (compare panel H with panels F and G). The above results are also summarized in fiugure (ii). Finally, cells transfected with empty plasmid also showed almost no TUNEL labeling with or without PDBu treatment (data not shown).
To further confirm, a DNA fragmentation assay was employed. Further evidence of a breakdown in genomic DNA is revealed by the "laddering" pattern shown in Figure 12, obtained after 8 and 16 h of PDBu treatment in Hmunc13 transfected cells.
Experiment 8 - Exaression of munc13s in normal and STZ-treated diabetic rat kidney We have previously demonstrated that Hmunc13 is up-regulated by high glucose treatment in cultured human mesangial (33). Since the main thrust of the present study was to investigate the functional role of Hmunc13, we documented its in vivo expression.
Furthermore, confirmation of up-regulation of Hmunc13 by hyperglycemia in an in vivo state is necessary to show the role for this gene in diabetic nephropathy. We characterized Hmunc13 expression in human kidney. We used an animal model of diabetes- the STZ treated rat (the relevant isoforms being munc13-1, -2, and -3). As shown in Figure 13, munc13-1 is expressed mainly in cortical tubular epithelial cells of both normal and STZ-treated diabetic rats. However, the expression level of munc13-1 was higher in STZ-treated diabetic rat after 11 days of hyperglycemia. Expression of munc13-1 was significantly higher in certain glomerular cells of diabetic animals. But it is impossible to identify these cells with any certainty at the resolution of confocal microscopy.
However, because of our previous in vitro results (33), we determined that munc13-1 is up-regulated in the mesangial cells.
Increased expression level of munc13-2 was also detected in diabetic rats with similar expression pattern as munc13-1. Possibly because of low basal expression, we could not obtain satisfactory in situ hybridization data for munc13-3 in rat kidney.
To confirm the over-expression of munc13-1 and munc13-2 in diabetic rat kidney, we performed relative RT-PCR on renal cortical RNA preparation. Relative RT-PCR
was chosen because low expression of munc13s in the rat kidney and a very low signal was detected in Northern blot analysis. As shown in Figure 14, compared to the housekeeping gene, 18S
ribosome RNA, expression of munc13-1 is over-expressed in the renal cortex of the STZ-treated diabetic rat after only 1 day of hyperglycemia whereas expression of munc13-2 is increased to a much lesser extent. Interestingly, munc13-3 is down-regulated in the same animal model. We screen to detect a human homologue of rat munc13-3 in a commercial human kidney cDNA library (Gibco BRL) using PCR with primers targeted to different regions of munc13-3.
We determine the role of munc13-3 in diabetic nephropathy.
MATERIALS AND METHODS
MC basal culture medium (MsBM) and renal epithelial basal medium (REBM) were purchased from Clonetic, San Diego, CA. Fetal bovine serum (FBS), Dulbecco's modified Eagle's medium (DMEM), penicillin, streptomycin, human kidney cDNA library, Superscript II RNase H-reverse transcriptase, dNTP, E.coli RNase H, Taq DNA polymerase, Genetrapper cDNA Positive Selection System, 100 by DNA size markers, Klenow Fragment, m'G(5')ppp(5')G
RNA capping analog, ElectroMAX DH10B cells and restriction enzymes were obtained from Gibco BRL, Burlington, ON, Canada. DNase I and "Sequence kit were purchased from Pharmacia Biotech, Uppsala, Sweden. TA cloning kit was from Invitrogen, San Diego, CA. RNeasy total RNA
preparation kit, QIAshredder and QIAquick Gel Extraction kit were purchased from Qiagen, Chatsworth CA. SP6 RNA polymerase, human cyclophilin template, 18S rRNA
primers and competimers were from Ambion, Austin, TX. Vent DNA polymerase was obtained from New England Biolab, Inc, Beverly, MA. Rapid hybridization buffer and a-[32P]-dATP
(specific activity 800 Ci/mmol) were purchased from Amersham, Arlington Heights, IL. [35S]-Methionine (specific activity, 1000 Ci/mmol) was from NEN Life Science Products, Boston, MA.
Duralon-UV
membranes was purchased from Stratagene, La Jolla, CA. Six percent denatured polyacrylamide solution was purchased from National Diagnostics, Somenrille, NJ.
Oligonucleotides were synthesized by Gibco BRL. X-ray film was from Kodak, Rochester, NY. Flexi rabbit reticulocyte lysate system and canine pancreatic microsomal membranes were purchased from Promega, Madison, WI. Other chemicals with cell culture or molecular biology grade were obtained from local suppliers.
Cell culture Primary cultures of human kidney MC and cortical epithelial cells were purchased from Clonetic. Human MC were plated onto 25 cmz culture flasks and incubated in MsBM containing 5.5 mM D-glucose with 100U/ml penicillin, 100 p.g/ml streptomycin and 5% FBS.
Cells were subcultured at 80-90 % confluence. Cortical epithelial cells were grown in REBM supplement with 100U/ml penicillin and 100 og/ml streptomycin. Rat renal MC were prepared and cultured as previously described (53,54).
Protocol for studying the effect of hypergycemia on human kidn~ MC
Human MC between passage 5-9 were used in this study. Three parallel experimental conditions were employed: 25 mM D-glucose (hyperglycemia), 5.5 mM D-glucose (low glucose control) and 25 mM L-glucose (osmolarity control). The details are as follows:
for high glucose treatment, subconfluent MC were growth-arrested in MsBM + 0.5% FBS overnight and exposed to 5.5 mM or 25 mM D-glucose for 3 days with one change of medium on the second day. In parallel, L-glucose at the final concentration of 19.5 mM was added to the culture medium to serve as an osmolarity control. In order to investigate if any dose-dependency of Hmunc13 expression by D-glucose treatment, in Northern blot studies, we analyzed two more sets of human MC
cultured in 15 mM D-glucose or 5.5 mM D-glucose + 9.5 mM L-glucose for 3 days.
We have found that changing the medium every two days at 25 mM D-glucose is enough to maintain physiological pH in the medium (pH 7.4) (data not shown). At the end of the experimental treatment period, total RNA of the cells was prepared.

Isolation of total RNA
Total RNA from human MC and cortical epithelial cells as well as rat MC was prepared using an RNeasy total RNA preparation kit according to manufacturer's instructions. Cell lysates were prepared following homogenization using a QIAshredder.
DDRT-PCR
DDRT-PCR was performed by modified methods published by Liang and Pardee (55) and Sokolov and Prockop (56). Total RNA from human kidney MC was incubated with DNase I to remove any contaminating genomic DNA prior to first strand DNA synthesis.
Reverse transcription (RT) was carried out by incubating a 20 ~I reaction mixture containing 1 ~,g total RNA, 100 ng fully degenerate hexamer, 500 ~M each of dATP, dGTP, dCTP and dTTP and 200 units of reverse transcriptase (Superscript II RNase H-) together with the buffer provided by the manufacturer. The reaction mixture was incubated at 42°C for 50 min.
The reaction was terminated by heating at 70°C for 15 min. E. coli RNase H (2 units) was then added to the reaction mixture followed by incubation at 37°C for a further 20 min to remove RNA
complementary to the cDNA. Demonstration that the RNA was free of genomic DNA
was confirmed using a pair of GAPDH specific primers (5'-ACCACAGTCCATGCCATCAC-3' and 5'-GTCCACCACCCTGTTGCTGTA-3') to obtain PCR products before and after RT. We found that there was no amplification in the absence of RT but a strong band was present in the presence of RT (data not shown). PCR was carried out using two 10-mer oligonucleotides, 5'-CAAGCGAGGT-3' and 5'-GTGGAAGCGT-3'. In a total of 12.5 pl, the reaction mixture contained 1 ~I of RNA with RT, 100 pM of each of dNTP, 4 pM of oligonucleotides, 1.5 mM
of MgCl2, 0.1 mCi/ml of a-[32PJ-dATP and 1.25 unit of Taq DNA polymerase. PCR was carried out using a Perkin Elemer PCR System 2400 (Perkin Elemer, Foster City, CA) starting at 94°C for 1 min, 34°C
for 1 min and 72°C for 1 min for 45 cycles. The resulting PCR products were subjected to 6%
denatured polyacrylamide gel electrophoresis (PAGE) using radiolabelled 100 by ladder as size markers. The gels were then dried and exposed to x-ray film overnight. Bands which showed clear cut differences in high (25 mM) compared to low (5.5 mM) D-glucose or the osmolarity control (25 mM L-glucose) were excised by aligning the film with the gel followed by elution overnight in 10 mM Tris-EDTA buffer (pH 8.0). Eluted DNA was purified and subjected to a second run of PCR by the same pair of 10-mer oligonucleotides under the same experimental conditions without radiolabelled dATP. Fresh PCR products from this last step were cloned into pCR2.1 using a TA cloning kit. Clones with inserts were sequenced by using a T'Sequencing kit with T7 promoter as a primer according to the manufacturer's instructions. The resulting DNA
sequences were compared to the GenBank database using BLAST search.
Library Screening Screening of Superscript human kidney cDNA library was achieved using a Genetrapper cDNA Positive Selection System. Captured cDNAs were transformed to ElectroMAX

competent cells by electroporation with an electroporation system (BTX Inc., San Diego, Ca) setting at 16.6 kV/cm. We first used an oligonucleotide (5'-GTGGTGATGAACACAATGGAGAGG-3') originally derived from sequence information following DDRT-PCR to capture a partial length of Hmunc13. According to this sequence information, we then designed another oligonucleotide (5'-TCCTGTTTGGGAGGAGAAGTTCC-3') closer to the 5' end of the sequence to capture a full length clone. The resulting clone (pCMV~SPORTHmunc13) was sequenced from both strands using standard techniques described above. The primers were SP6, T7 promoters or synthetic oligonucleotides derived from the sequence information. Alignment and analysis of sequences was performed with Genework 2.5.1 (Oxford Molecular Group, Campbell, CA) using a Macintosh computer. Comparisons of similarity were performed using the Gapped BLAST
search from GenBank.
Relative RT-PCR and RT-PCR
For relative RT-PCR, RT products previously described were subjected to PCR
for 30 cycles using a pair of primers (5'-GGAGCAAATCAATGCCTTGG-3' and 5'-TCGGATCCAATGTGCTCTGG-3') specific for Hmunc13, amplifying a 671 by fragment.

rRNA was chosen as a housekeeping gene by using 18S rRNA primers and 18S rRNA
competimers with a ratio of 1:2. These primers amplify a 488 by fragment.
Resulting PCR
products were subjected to 1.2 % agarose gel electrophoresis.
To determine munc13 expression in epithelial and rat MC, we employed RT-PCR
with a pair of primers (5'-GA(T)GTC(A)CTGAAGGAGCTCTGG-3' and 5'-AGGACA(T)GCACACTGCTTTGG-3' ) targeted to Hmunc13 and rat munc13-2 both of which yield a 193 by fragment. RT were performed post DNase I treatment on total RNA
extracted from these cells as described above.
Northern Blot Analysis Total RNA (10 wg) extracted from human kidney MC was subjected to 1 %
denatured formaldehyde agarose gel electrophoresis as described (36) then transferred to Duralon-UV
membranes overnight and exposed to UV light for cross linking. An 32P-radiolabelled probe of Hmunc13 were generated from a PCR fragment derived from pCMV~SPORTHmunc13 (4095 -4288) with a-[3zP]-dATP using a Klenow Fragment and random hexamers. Membranes were pre-incubated with rapid hybridization buffer at 65°C for 15 min and then incubated with radiolabelled probes at 65°C for 2 hours. After removal of the radiolabelled probes, membranes were washed first in 2 x SSPE (1 x SSPE contains 150 mM NaCI, 20 mM NaHZP04 and 1 mM EDTA, pH, 7.4) with 0.1 % SDS at room temperature for at least 20 min then twice with 0.1 x SSPE with 0.1 % SDS
at 65°C for 30 min each. After exposure to the Phosphor screen (Molecular Dynamics, Sunnyvale, CA), the blots with Hmunc13 probe were stripped with a boiling solution of 0.1 x SSPE with 0.1%
SDS. The stripped membranes were reprobed with a 32P-labelled human cyclophilin template.
Radioactivity of each band in digital images was analyzed on a PC using ImageQuant 4.0 (Molecular Dynamic).
In vitro Translation In vitro translation was performed according to previously published method (26). Plasmid with Hmunc13 cDNA (pCMV~SPORTHmunc13) was linearlized with Hind III.
Linearlized DNA (1 p,g) was transcribed with SP6 RNA polymerase and m'G(5')ppp(5')G RNA capping analog .
Capped cRNA was extracted using an RNeasy total RNA preparation kit. Eluted cRNA was precipitated and resuspended in 5 ~I diethylpyrocarbonated-treated water. In the presence of 1 wl of this cRNA product, in vitro translation was achieved using a Flexi rabbit reticulocyte lysate system according to the method provided by supplier. Translation products were detected by incorporating 1 p.Ci/~I of [35S] methionine in the reaction mixture. To determine co-translational processing, 1.5 equivalent of canine pancreatic microsomal membranes was added to 10 ~I of in vitro translation reaction. The resulting reaction was centrifuged at 16,000 g for 15 min to pellet microsomes. In vitro translation products were subjected to 8% PAGE. The gel was stained with Commassie brilliant blue then destained. The stained gel was then dried and exposed to x-ray film.
Statistical Anal Group differences in densitometry of the Northern blots were analyzed by Student's t-test using Systat 5.2.1. (Systat Inc., Evanston, IL) for the Macintosh.
Significance level was set at p <
0.05.
Construction of HA-tagged hmunc13 and truncated mutant without C1 domain We constructed an HA-tagged hmunc13, by taking advantage of an EcoN I
restriction site (nucleotide 3949) close to the 3' end of the open reading frame of hmunc13 constructed in pCMV~SPORT (Gibco, BRL, pCMV~SPORThmunc13), and used PCR to introduce the HA-tag at the C-terminal of hmunc13. A PCR fragment was generated with Vent DNA
polymerase, insert of pCMV~SPORThmunc13 as a template and a pair of primers (5'-GAATACGGTTCTGGATGAGCT-3' and 5'-gcggccgcTCAAGCGTAGTCTGGGACGTCGTATGGGTAGCTCCCCTCCTCCGTGGAACG -3') where the HA tag sequence is underlined and a Not I site is shown in lower case. A stop code (5'-TCA-3') was placed between the HA tag and the Not 1 site. The PCR product was then incubated with 2 units of Taq DNA polymerase at 72 C for 15 min and extracted by phenol/chloroform and ethanol precipitation. The resulting pellet was resuspended and ligated to pCR2.1 by using a TA
cloning kit. This plasmid was then digested with Not I and EcoN I, subjected to 1 % agarose gel electrophoresis. The insert was purified and ligated to pCMV~SPORThmunc13 previously cut with Not 1 and EcoN I. The resulting construct (hmunc13-HA) was sequenced to confirm the addition of the HA tag.
To construct a deletion mutant lacking the C1 domain (C1 less mutant), we replaced the entire C1 domain (AA 478-528) with two residues Ala and Arg. Primers 5'-CGTTGGCGCGCCAGCGGGCTGCAGAAAAGAGC -3' (Asc l site is underline) and 5'-CTGTCTCATCAAAGTACACC-3' were used to generate a PCR fragment with Vent DNA
polymerase and pCMV~SPORThmunc13 as a template. Another piece of PCR fragment was generated by primers of Sp6 promoter (5'-AGCTATTTAGGTGACACTATAG-3') and 5'-GCTAGGCGCGCCGGAGTGGTGCACGAAATGG -3' (Asc I site is underline). The two PCR
fragments were digested with Asc I, ligated with T4 DNA ligase, and the ligated product was subjected to 1 % agarose gel electrophoresis to check the size and for purification. The gel purified ligated piece was further digested with Kpn I and BstZl7 I and ligated to Kpn 1 and BstZ17 I digested pCMV~SPORThmunc13-HA.
Plasmids for cell transfection were prepared using a Midi plasmid preparation kit according to manufacturer's instructions.
Cells and transfection OK cells were grown in MEM supplemented with 10% FBS and 100 U/ml penicillin and 100 wg/ml streptomycin, and plated in 60 mm or 100 mm culture dishes or on glass cover slips placed in 24 wells culture plates. Cells were transiently transfected (transfected rate 30-50%) with hmunc13-HA or C1 less mutant by using Lipofectamine Plus according to the manufacturer's instruction, and maintained in serum free MEM overnight (3 h for apoptotic experiments) after 24 h of transfection. Cell monolayers were washed and fresh medium containing PDBu or the same amount of vehicle (DMSO at a final concentration of 0.0001 %) was added to the culture medium at a final concentration of 0.1 NM and cells were analyzed at different time points as indicated. For nocodazole treatment experiments, nocodazole in DMSO was added to the medium at a final concentration of 4 pM for 1 h and followed by addition of PDBu at a final concentration of 0.1 NM.
Cells were subjected to immunostraining after 3 h of PDBu treatment. An identical quantity of DMSO was added to control cells.
Immunocytochemistry Cells grown on cover slips were washed 3 times with iced cold Hank's solution, fixed and permeabilized with 100% methanol at -20 C for 5 min. The cover slips were then air dried, washed 3 times with PBS and incubated in blocking solution (PBS + 0.2% Tween-20 (PBST) containing 10% no-fat dry milk). Cells were then incubated with 0.02 mg/ml anti-HA for 30 min at room temperature followed by 0.02 mg/ml anti-mouse IgG-rhodamine for 30 min.
Cells were washed at least 8 times with PBST between incubation of anti-HA and anti-mouse IgG-rhodamine or after anti-mouse IgG-rhodamine. Cover slips were then mounted on a glass slide and observed under a confocal scanning microscope. For labeling of the Golgi apparatus, 0.05 mg/ml WGA-FITC was added to the anti-mouse IgG-rhodamine.
Immunoblot analysis and preparation of crude GoIQi membrane Cells grown on culture plates were washed 3 times with ice cold Hank's solution and scraped into 0.5 ml cell lysis buffer (50 mM Tris-HCI, 150 mM NaCI, 0.25%
sodium deoxycholate, 1 % NP-40, 1 mM EDTA and protease inhibitor cocktail, pH 7.5), and then rocked at 4 C for 45 min.
The insoluble fraction was removed by centrifugation at 14,000 g for 5 min.
Supernatants were subjected to 6% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose. The membrane was washed twice with TBS, blocked with TBS
containing 0.1 % Tween-20 (TBST) and 1 % normal horse serum for 30 min and then incubated with 0.5 wg/ml anti-HA in TEST. After washing with TEST for at least 4 times, the membrane fraction was incubated with 0.2 ~g/ml anti-mouse IgG-biotin, washed with TBST
and then incubated with the A and B reagent mix in a Vector ABC staining kit according to manufacturer's instructions. The blot was detected by ECL according to the manufacturer's instruction.
Golgi membranes were prepared by a sucrose density method reported previously (57) with a protease inhibitor cocktail presented in all buffer solution. The band at the interface of 0.8M
and 1.2M sucrose was collected and subjected to 6% SDS PAGE and immunobloting as described above. Protein concentration was determined by Lowry assay with bovine serum albumin as standard using a DC Protein Assay kit following its instruction.
Detection of anoptosis by DNA fragmentation Cleaved genomic DNA during apoptosis for cells grown on cover slips was detected by terminal deoxynucleotidyl transferase (TdT) - mediated dUTP nick end labeling (TUNEL) using a in situ cell death detection kit following manufacturer's directions. Fluorescein labels were incorporated in nucleotide polymers. Negative controls were obtained by incubating label solution without TdT under the same conditions. After labeling for apoptosis, cells were further subjected to Immunocytochemistry as described above without fixation and permeabilization to detect expression of hmunc13 or its C1less mutant.
Genomic DNA fragmentation of cells grown on 60 mm culture dishes was analyzed by 2%
agarose gel electrophoresis using the procedure described elsewhere (58).
Streatozotocin treated diabetic rat model Rats received a single injection of STZ (65 mg/kg body weight, i.p.) dissolved in 20 mM
citric acid (pH 4.5). Blood glucose was monitored daily by tail blood sampling with a Medisense blood glucose sensor (Medisense Canada, Mississauga, ON, Canada). Blood glucose was maintained at a concentration of 15-20 mM with 2 U NPH insulin daily (s.c.) after diabetes was confirmed by elevated blood and urinary glucose. Rats were sacrificed after 1 or 11 days of diabetes. Rat kidneys were collected as soon as possible, usually within 3-5 min, and processed for total RNA preparation or tissue preparation for in situ hybridization as described below. Control rats were injected (i.p.) with the same amount of 20 mM citric acid and their blood glucose levels were also tested daily (< 5 mM).
Relative reverse transcription polymerase chain reaction (RT-PCR) Total RNA from rat kidney cortex was prepared using a TRlzol reagent according to instructions provided by the manufacturer and then treated with DNase I.
Confirmation of no genomic DNA contamination in RNA preparations and relative RT-PCR were performed as described elsewhere (33). Primers for amplification of rat munc13-1 are 5'-CGTGACCAAGATGAGTACTCC-3' (sense) and 5'-CGAAGTCGTGTAGTAAGGCG-3' (anti-sense) yielded a fragment of 195 bp. Primers for rat munc13-2 are 5'-GAGTCCTGAAGGAGCTCTGG-3' (sense) and 5'-AGGACAGCACACTGCTTTGG-3' (anti-sense) yielded a fragment of 193 bp.
Primers for rat munc13-2 are 5'-AGATGACCTTGGCAAGTGC-3' (sense) and 5'-CGATACATCATGGATGGATGG-3' (anti-sense) yielded a fragment of 198 bp. The sequence of PCR products was confirmed by cloning PCR
fragments into pCR2.1 using a TA cloning kit and sequencing using a T'Sequencing kit with T7 promoter as a primer.
In situ hybridization Templates for in vitro transcription were generated by PCR with primers described above for three different isoforms, except that for anti-sense cRNA, addition of T7 promoter (5'-TAATACGACTCACTATAGGGA-3') was present in the sense strain and for sense cRNA, promoter was present in the anti-sense strain. Anti-sense and sense cRNA for different isoforms were obtained by in vitro transcription. PCR templates (200 ng) were incubated with T7 RNA
polymerise (40U), its reaction buffer provided by the manufacturer and DIG RNA
labeling mix in a total volume of 40 pl at 37 C for 90min. Twenty wl recombinant RNA was purified by using a RNeasy total RNA preparation kit and its yield was estimated by A28o. The remaining cRNA was subjected to ethanol precipitation and resuspended in nuclease-free water.
All solutions used before the post-hybridization step were diethylpyrocarbonate (DEPC) treated or prepared in DEPC-treated water. Kidneys were quickly cut to 2 mm thick blocks after dissection then put in phosphate-buffered saline (PBS, pH 7.4) containing 4%
parafromaldehyde for 4 h at 4 C. The tissue was soaked in PBS containing 30% sucrose overnight at 4 C and then stored in liquid nitrogen. Frozen tissues were sectioned (10 Nm) and placed on a poly-L-lysine coated glass slides. In order to ensure the same experimental conditions, kidney sections from control and diabetic rats were placed on the same slide. Tissue slides were then dried at 40 C
overnight and stored at -80 C for less then a week. On the day of hybridization, slides with tissue sections were dried at 40 C for 2 h then washed twice with PBS. Slides were then incubated with 0.3% Triton X-100 in PBS for 15 min at room temperature and washed twice with PBS afterward.
Sections were incubated with 1 pg/ml RNase-free proteinase K in TE buffer (100 mM Tris-HCI, 50 mM EDTA, pH 8.0) for 30 min at 37 C and then fixed by incubating with PBS
containing 4%
parafromaldehyde for 5 min at 4 C. Sections were then washed twice with PBS
and acetylated with freshly prepared 0.1 M triethanolamine buffer (pH 8.0) containing 0.25%
acetic anhydride.
Slides were then incubated first with 4x SSPE (1x SSPE containing 150 mM NaCI, 20 mM
NaH2P04 and 1 mM EDTA, pH 7.4) containing 50% formamide at 37 C for 20 min and then overlaid with 75 pl hybridization buffer (40% fromamide, 10% dextrin sulfate, 0.02% Ficoll, 0.02%
polyvinylpyrolidone, 10 mg/ml bovine serum albumin, 4x SSPE, 10 mM DTT, 0.4 mg/ml yeast t-RNA and 0.1 mg/ml poly(A) ) containing 50 ng of denatured DIG-labeled cRNA
probe. Slides were incubated in a humid chamber at 42 C overnight. After hybridization, slides were washed at least 4 times in 1x SSPE at 37 C. Sections were incubated with 20 wg/ml RNase A in NTE buffer (500 mM NaCI, 10 mM Tris-HCI, 1 mM EDTA, pH 8.0) at 37 C for 30 min and washed twice with 0.1x SSPE. Slides were washed and blocked in TBS (100 mM Tris-HCI and 150 mM
NaCI, pH
7.5) containing 1 % blocking reagent and then incubated with 0.02 mg/ml anti-DIG-rhodamine for 1 h. Slides were washed at least 5 x with TBS. Staining was assessed by a confocal scanning microscopy.
Materials & Methods re t~44/42 MAPK experiments HEK293 cells were obtained from American Type Cell Collection, Rockville, MD.
Fetal bovine serum (FBS), minimum essential medium (MEM), penicillin, streptomycin, Lipofectamine Plus, Hank's solution, dNTP, T7 RNA polymerase, DNA size markers and T4 DNA
ligase obtained from Gibco BRL, Burlington, ON, Canada. Oligonucleotides were synthesized by Gibco BRL.
Antibodies against human p44/42 MAPK (rabbit polyclonal) and phosphorylated p44/42 MAPK and a p44/42 MAPK activity assay system were obtained from New England Biolab, Inc, Beverly, MA.
Recombinant DNA templates of corresponding genes for the RNase protection assay were obtained from Pharmingen, San Diego, CA. Antibodies against human bcl-2 and mcl-1 were from Santa Cruz Biotechnology, Inc, Santa Cruz, CA. An antibody against human short form bclx (bclx(s)) and the activated form of recombinant human p44 MAPK (erk1 ) were purchased from Calbiochem, San Diego, CA. A Hyspeed RNase protection assay kit was obtained from Ambion, Austin, TX. Mouse Anti-HA and anti-c-myc monoclonal antibodies, an in situ cell death detection kit and complete mini protease inhibitor cocktail tablets were purchased from Boehringer Mannheim, Mannheim, Germany. A Midi plasmid preparation kit and a RNeasy total RNA
preparation kit were from Qiagen, Chatsworth, CA. Enhanced chemiluminescence (ECL) reagents, a[32P)-UTP, pGEX-5x-1, glutathione sepharose 4B and anti-glutathione S-transferase (anti-GST) polyclonal antibody were purchased from Amersham Pharmacia Biotech, Baie d'Urfe, QC, Canada. Top10F' E. coli was from Invitrogen, San Diego, CA. A DC Protein Assay kit was obtained from Bio-Rad, Hercules, CA, and phorbol 12, 13-dibutyrate (PDBu) was from Sigma.
Other chemicals of cell culture or molecular biology grade were obtained from local suppliers.
Special hmunc13 constructs C-terminal HA-tagged hmunc13 (hmunc13-HA) in pCMV~SPORT (pCMV, Gibco BRL) and an HA-tagged truncated mutant without the C1 domain (C1 less mutant) were constructed as previously described (9). N-terminal c-myc-tagged hmunc13 (myc-hmunc13) and a truncated mutant without the aa309-371 domain (EB less mutant) were made using the same strategy employed for the hmunc13-HA and C1 less mutant. The entire EB domain (aa309-371 ) of the EB
less mutant is replaced with three residues, Gly, Ala and Pro. The N-terminal HA tag is present in both C1 less and EB less mutants. All constructs were confirmed by sequencing.
Plasmids were prepared using a Midi plasmid preparation kit according to manufacturer's instructions.
Cells and transfection HEK 293 cells were maintained in minimal essential medium (MEM) supplemented with 10% FBS and 100 U/ml penicillin and 100 ~g/ml streptomycin, and plated in 60 mm culture dishes.
Cells were transiently transfected with the indicated plasmids using Lipofectamine Plus as described (9). A transfection rate of 30-40% was achieved by this method in HEK293 cells as determined by immunostaining using anti-HA with methods described (9).
Immunoblot analysis and co-immunoprecipitation HEK 293 cells transfected with various plasmids were treated with PDBu (100 nM) or the same amount of vehicle (DMSO at a final concentration of 0.0001 %) after 48 h of transfection and overnight culture in medium containing 0.5% FBS. PDBu stimulation was stopped at the indicated times by washing cells once with ice-cold PBS. The cells were then scraped off into cell lysis buffer (50 mM Tris-HCI, pH 7.4, 50 mM NaCI, 1 mM Na3V04, 1 mM NaF, 0.5% NP-40 and protease inhibitor cocktail) and rocked at 4 C for 45 min. Supernatant was collected after a 5 min spin at 14,000 g and subjected to immunoblot analysis as described previously (9). Density of phospho-p42 MAPK was measured by ImageQuant and normalized with its total protein level as detected by using antibody against p44/42 MAPK. Immunoprecipitation was performed by incubating cell lysates with 2 wg of the indicated antibody in a total volume of 250 pl at 4° C
overnight. Protein G was added, incubated for 2 more hours and washed three times with ice cold cell lysis buffer. The resulting immunoprecipitated products were subjected to 12% SDS-PAGE
and immunoblotted with the appropriate antibodies.
Measurement of 144/42 MAPK activity P44/42 MAPK activity was measured by a p44/42 MAPK activity assay system following the manufacturer's instruction. In brief, p44/42 MAPK was immunoprecipitated by an antibody against phospho-p44/42. An in vitro kinase assay was performed using Elk-1 as a substrate and phosphorylation of Elk-1 was detected by immunoblot analysis with anti-phospho-Elk-1 and analyzed by ImageQuant.
Construction of a GST-fusion protein of the EB domain (GST-EB) and in vitro bindin assay_ A segment of cDNA corresponding to the EB domain was obtained by PCR with a pair of primers, 5'-CGTGGATCCCCGGTTTTGGAGAACAAGAGAAAC-3' (a BamH I site is underline) and 5'-CGTCTCGAGTTGGGTAAATGGTGAAGATGC-3' (a Xho I site is underline), as described (9).
The resulting PCR product is ethanol precipitated, resuspended, cut with BamH
1 and Xho l and ligated to pGEX-5x-1 precut with BamH 1 and Xho I. The construct was confirmed by sequencing.
Top10F' E. coli transformed with the resulting construct was cultured in Luria-Bertani medium (contains 10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCI in 1 L of solution, pH, 7.0) overnight with 0.1 mg/ml ampicillin. Expression of GST fusion proteins was induced by 1 mM of isopropyl-(3-D-thiogalactoside (IPTG). E. coli cell extracts were prepared by resuspended the sediment cells of overnight culture in I/10 volume of lysis buffer (50 mM Tris-HCI, pH 7.4, 50 mM
NaCI, 1.0 % NP-40 and protease inhibitor cocktail), sonicated, rocked at 4 C
for 1 h and spun for 5 min at 12,000 g. Supernatants were collected for the in vitro binding study.

For the in vitro binding study, 50 pl of the above cell extracts contained GST
or GST-EB
were diluted with 450 p,l of binding buffer (50 mM Tris-HCI, pH 7.4, 50 mM
NaCI, 1 mM Na3V04, 1 mM NaF and protease inhibitor cocktail, the final concentration of NP-40 is 0.1%). Additions of p44 MAPK in a final concentration of 5 nM and 20 wl of glutathione Sepharose 4B (50%
suspension) were added and incubated overnight at 4 C. The resulted GST-glutathione complexes were washed with the binding buffer in the presence of 0.1 % NP-40 and subjected to 12% SDS-PAGE and immunoblot analysis.
In situ cell death detection HEK 293 cells grown on glass coverslips placed in a 24-well culture plates were transfected with hmunc13 or PP less mutant at sub-confluency. The culture medium was replaced with MEM supplemented with 0.5% FBS after 36 h of transfection for 2 h. Cells were then maintained in fresh MEM with 0.5% FBS containing 100 nM PDBu or the same amount of vehicle (DMSO) for 8 h. Apoptosis for cells grown on coverslips was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) using an in situ cell death detection kit as described (9). The percentage of apoptotic cells was determined by counting apoptotic cells vs.
total cell number under the confocal microscope. Results are expressed as means t SD.
RNase protection assay (RPA) Cells were treated with PDBu (100 nM) for 4 or 6 h as described previously.
Total RNA
was then prepared using an RNeasy total RNA preparation kit as described (9).
Anti-sense cRNA
was generated from cDNA templates of corresponding genes by in vitro transcription with T7 RNA
polymerase using a[32P]-UTP as a radioisotope. RPA was performed using a Hyspeed RNase protection assay kit according to manufacturer's instruction. Protected double-stranded RNA was subjected to 6% PAGE and exposed to x-ray film.

The present invention has been described in detail and with particular reference to the preferred embodiments; however, it will be understood by one having ordinary skill in the art that changes can be made thereto without departing from the spirit and scope thereof.
All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

REFERENCES
1. S.M. Mauer. Structural-functional correlations of diabetic nephropathy.
Kidney Int. 45:
612-622, 1994 2. A.E. Thomson. Non-insulin dependent diabetes mellitus in nephrology: where do we go from here? Kidney Int. 52: S-83-S-84, 1997 3. T.F. Drury and A.L. Powell. Prevalence of known diabetes among black Americans, in Diabetes in America, US Dept. of Health & Human Services, NIH 87-1468, 1987 4. M.P. Stern, J.A. Knapp, H.P. Hazuda, S.M. Haffner, J.K. Patterson and B.D.
Mitchell.
Genetic and environmental determinants of type II diabetes in Mexican Americans.
Diabetes Care 14: 649-659, 1991 5. J. Carter, J.A. Pugh and A. Monterrosa. Non-insulin-dependent diabetes mellitus in minorities in the United States. Ann. Int. Med. 125: 221-232, 1996 6. S-K. Ha and J-K. Seo. Insertion/deletion polymorphism in ACE gene as a predictor for progression of diabetic nephropathy. Kidney Int. 52: S28-S32, 1997 7. A.R. Andersen, J.S. Christiansen, J.K. Andersen, S. Kreiner and T. Deckert.
Diabetic nephropathy in type I (insulin dependent) diabetes: an epidemiological study.
Diabetologia 25: 496-501, 1983 8. The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. New Eng. J. Med.
329: 977-986,1993 9. S. Adler. Structure-function relationships in diabetic nephropathy: lessons and limitations.
Kidney Int. 52: S43-S45, 1997 10. H.B. Lee, M.K. Cha, K.I. Song, J.H. Kim, E.Y. Lee, S.I. Kim, J. Kim and M.
H. Yoo.
Pathogenic role of advanced glycosylation end products in diabetic nephropathy. Kidney Int. 52: S60-S65, 1997 11. Kikkawa, R., Umemura, K., Haneda, M., Arimura, T., Ebata, K. and Shigeta, Y. Evidence for existence of polyol pathway in cultured rat mesangial cells. Diabetes 36:
240-243, 1987 12. F.N. Ziyadeh and D.C. Han. Involvement of transforming growth factor-/3 and its receptors in the pathogenesis of diabetic nephropathy. Kidney Int. 52: S7-S11, 1997 13. Koya D, Jirousek MR, Lin Y, Ishii H, Kuboki K, King GL: Characterization of protein kinase C ~i isoform activation on the gene expression of transforming growth factor-(3, extracellular matrix components, and prostanoids in the glomeruli of diabetic rats. J Clin Invest 100:
115-126, 1997 14. H. Ishii, M.R. Jirousek, D. Koya, C. Takagi, P. Xia, A. Clermont, S-E.
Bursell, T.S. Kern, L.M. Ballas, W.F. Heath, L.E. Stratum, E.P. Feener and G.L. King. Amelioration of vascular dysfunctions in diabetic rats by an oral PKC(3 inhibitor. Science 272: 728-731, 15. D. Mochly-Rosen. Localization of protein kinases by anchoring proteins: a theme in signal transduction. Science 268: 247-251, 1995 16. Ziyadeh FN: The extracellular matrix in diabetic nephropathy. Am J Kidney Diseases 22:
736-744, 1993 17. Derubertis FR, Craven PA: Activation of protein kinase C in glomerular cells in diabetes:
mechanisms and potential links to the pathogenesis of diabetic glomerulopathy.
Diabetes 43: 1-8, 1994 18. Porte D Jr., Schwartz MW: Diabetes complications: why is glucose potentially toxic?
Science 272: 699-700, 1996 19. Fumo P, Kuncio GS, Ziyadeh FN: PKC and high glucose stimulate collagen a1 (IV) transcriptional activity in a reporter mesangial cell line. Am J Physiol 267:
F632-F638, 20. Brose N, Hofmann K, Hata Y, Sudhof C: Mammalian homologues of Caenorhabditis elegans unc-13 gene define novel family of C2-domain proteins. J Biol Chem 270: 25273-25280, 1995 21. Maruyama IN, Brenner S: A phorbol ester/diacylglycerol-binding protein encoded by the unc-13 gene of Caenorhabditis elegans. Proc Natl Acad Sic USA 88: 5729-5733, 22. Ahmed S, Maruyaam IN, Kozma R, Lee J, Brenner S, Lim L: The Caenorhabditis elegans unc-13 gene product is a phospholipid-dependent high-affinity phorbol ester receptor.
Biochem J 287: 995-999, 199223 23. Kazanietz MG, Lewin NE, Bruns JD, Blumberg PM: Characterization of the cysteine-rich region of the Caenorhabditis elegans protein unc-13 as a high affinity phorbol ester receptor. J Biol Chem 270: 10777-10783, 199524 24. Betz, A., U.Ashery, M. Rickmann, I. Augustin, E. Neher, T.C. Sudhof., J.
Rettig, and N.
Brose. 1998. Munc13 is a presynaptic phorbol ester receptor that enhances neurotransmitter release. Neuron. 21:123-136.

25 Orita S, Naito A, Sakaguchi G, Maeda M, Igarashi H, Sasaki T, Takai Y:
Physical and Functional Interactions of Doc2 and Munc13 in Ca2+-dependent Exocytotic Machinery. J
Biol Chem 272: 16081-16084, 1997 24 Popov M, Tam LY, Li J, Reithmeier RA: Mapping the ends of transmembrane segments in a polytopic membrane protein: Scanning N-glycosylation mutagenesis of extracytosolic loops in the anion exchanger, Band 3. J Biol Chem 272:18325-18332, 1997 25 Kozak M: An analysis of vertebrate mRNA sequences: intimations of translational control. J
Cell Biol 115: 887-903, 1991 26 C. Csortos, S. Zolnierowicz, E. Bako, S.D. Durbin and A.A. DePaoli-Roach.
High complexity in the expression of the B' subunit of protein phosphatase 2A0. J.
Biol. Chem.
271: 2578-2588, 1996 27 D. Barford. Molecular mechanisms of the protein serine/therionine phosphatases. TIBS
21: 407-412, 1997 28 Sudhof TC: The synaptic vesicle cycle: a cascade of protein-protein interactions. Nature 375: 645-653, 1995 29 Williams B, Schrier RW: Glucose-induced protein kinase C activity regulates arachidonic acid release and eicosanoid production by cultured glomerular mesangial cells.
J Clin I nvest 92:2889-2896, 1993 Blobe, G.C., Stribling, S., Obeid, L. M., and Hannum, Y.A. (1998). Protein kinase C
isoenzymes: regulation and function. Cancer Surveys 27, 213-248.
31 Song, Y., Ailenberg, M., Silverman, M. (1998). Cloning of a novel gene in the human 25 kidney homologous to rat munc13s: its potential role in diabetic nephropathy. Kidney Int.
53, 1689-1695.
32 Banfield, D.K., Lweis, M.U., Rabouille, C., Warren, G., and Pelham, H.R.B.
(1994).
Localization of SedS, a putative vesicle targeting molecule, to the cis-Golgi network involves both its transmembrane and cytoplasmic domains. J. Cell Biol. 127, 357-371.

30 33 Tellam, J. T., Jams, D.E., Stevens, T.H., and Piper R.C. (1997).
Identification of a mammalian Golgi Sec1 P-like protein, mVps45. J. Biol. Chem. 272, 6187-6193.

34 Bock, J.B., Klumperman, J., Davanger, S., and Scheller, R.H. (1997).
Syntaxin 6 functions in trans-Golgi network vesicle trafficking. Mol. Biol. Cell 8, 1261-1271.
35 Orita, S., Naito, A., Sakaguchi, G., Maeda, M., Igarashi, H., Sasaki, T., and Takai, Y.
(1997). Physical and functional interactions of Doc2 and Munc13 in Ca2+-dependent exocytotic machinery. J. Biol. Chem. 272, 1681-1684.
36 Martin, T.F.J. (1997). Greasing the Golgi budding machine. Nature 387, 21-22.
37 Kearns, B.G., McGee, T.P., Mayinger, P., Gedvilaite, A., Phillips, S.E., Kagiwada, S., and Bankaitis, V.A. (1997). Essential role for diacylglycerol in protein transport from the yeast Golgi complex. Nature 387, 101-105.
40 Chinen, K., Takahashi, E., and Nakamura, Y. (1996). Isolation and mapping of a human gene (SEC14L), partially homologous to yeast SEC14, the contains a variable number of tandem repeats (VNTR) site in its 3' untranslated region. Cytogene. Cell Gene.
73, 218-223.
41 Mochly-Rosen, D., and Kauvar, L.M. (1998). Modulating protein kinase C
signal transduction. Adv. Pharmacol. 44, 91-145.
42 Lavin, M.F., Watters, D., and Song, Q. (1996). Role of protein kinase activity in apoptosis.
Experientia 52, 979-994.
43 Deacon, E.M., Pongracz, J., Griffiths G., and Lord, J.M. (1997). Isoenzymes of protein kinase C: differential involvement in apoptosis and pathogenesis. Mol. Pathol.
50, 124-131.
44 Whitman, S.P., Civoli, F., and Daniel, L.W. (1997). Protein kinase C(311 activation by 1-(-D-arabinofuranosylcytosine is antagonistic to stimulation of apoptosis and bcl-2a down-regulation. J. Biol. Chem. 272, 23481-23484.
45 Leszczynski, D. (1996). The role of protein kinase C in regulation of apoptosis: a brief overview of the controversy. Cancer J. 9, 308-313.
46 Xia, P., Inoguchi, T., Kern, T.S., Engerman, R.L., Oates, P.J., and King, G.L. (1994).
Characterization of the mechanism for the chronic activation of diacyglycerol-protein kinase C pathway in diabetes and hypergalactosemia. Diabeties 43,1122-1129.

47 Hise, M.K., and Mehta, P.S. (1988). Characterization and localization of calcium/phospholipid-dependent protein kinase-C during diabetic renal growth.
Endocrinology 123: 1553-1558.
48 Derubertis, F.R., and Craven P.A. (1994). Activation of protein kinase C in glomerular cells in diabetes: mechanisms and potential links to the pathogenesis of diabetic glomerulopathy. Diabetes 43, 1-8.
49 King, G.L., Ishii, H., and Koya, D. (1997) Diabetic vascular dysfunction: a model of excessive activation of protein kinase C. Kidney Int. 52 (suppl. 60), S-77-S-85.
50 Ishii, H., Jirousek, M.R., Koya, D., Takagi, C., Xia, P., Clermont, A., Bursell, S.E., Kern, T.S., Ballas, L.M., Heath, W.F., Stratum, L.E., Feener, E.P., and King, G.L. (1996).
Amelioration of vascular dysfunctions in diabetic rats by an oral PKC ~3 inhibitor. Science 272, 728-731.
51 Ortiz, A., Ziyadeh, F.N., and Neilson, E.G. (1997). Expression of apoptosis-regulatory genes in renal proximal tubular epithelia cells exposed to high ambient glucose and in diabetic kidneys.
J. Invest. Med. 45, 50-56.
52 Morris, S.M., and Yu-Lee, L. (1998). Expression of RNUDC, a potential nuclear movement protein in mammalian cells: localization to the Golgi apparatus. Exp. Cell Res. 238, 23-32.
53 Ailenberg M, Silverman M: Cellular activation of mesangial gelatinase A by cytochalasin D is accompanied by enhanced mRNA expression of both gelatinase A and its membrane-associated gelatinase A activator (MT-MMP). Biochem J 313: 879-884, 1996 54 Zent R, Ailenberg M, Waddell TK, Downey GP, Silverman M: Puromycin aminonucleoside inhibits mesangial cell-induced contraction of collagen gels by stimulating production of reactive oxygen species. Kidney Int 47:811-817, 1995 55 Liang P, Pardee AB: Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: 967-971, 1992 56 Sokolov BP, Prockop DJ: A rapid and simple PCR-based method for isolation of cDNAs from differentially expressed genes. Nucleic Acids Res 22: 4009-4015, 1994 57 Balch, W.E., Bunphy, W.G., Braell, W.A., and Rothman, J.E. (1994).
Reconstitution of the transport of protein between successive compartments of the Golgi measured by the coupled incorporation of N-acetylglucosamine. Cell 39, 405-416.

58 Eastman, A. (1995). Assays for DNA fragmentation, endonucleases, and intracellular pH and Ca2+ associated with apoptosis. In: Cell Death, Methods in Cell Biology, Vol.
46, L.M.
Schwartz and B.A. Osbome, eds. (San Diego, Academic Press), pp. 41-55.
References re p 42/44 MAPK experiments and discussion 1. Miller, L.J., & Marx, J. (1998). Science 281, 1301.
2. Ishii, N., Ogawa, Z., Suzuki, K., Numakami, K., Saruta, T., 8~ Itoh, H.
(1996). Metabolism 45, 1348-1353.
3. Ortiz, A., Ziyadeh, F.N., & Neilson, E.G. (1997). J. Invest. Med. 45, 50-56.
4. Zhang, W., Khanna, P., Chan, L.L., Campbell, G., & Ansari, N.H. (1997).
Biochem. Mol. Med.
61, 58-62.
5. Moley, K. H., Chi, M. M. -Y., Knudson, C. M., Korsmeyer, S. J., & Mueckler, M. M. (1998).
Nature Med. 4, 1421-1424.
6. Nizutani, M., Kern, T.S., & Lorenzi, M. (1996). J. Clin. Invest. 97, 2883-7. Barber, A.J., Lieth E., Khin, S.A., Antonetti, D.A., Buchanan A.G., Gardner, T.W., 8~ The Penn State Retina Research Group. (1998). J. Clin. Invest. 102, 783-791.
8. Song, Y., Ailenberg, M., & Silverman, M. (1998). Kidney Int. 53, 1689-1695.
9. Song, Y., Ailenberg, M., & Silverman, M. (1999). Mol. Biol. Cell 10, 1609-1619.
10. Maruyama, I.N., & Brenner, S. (1991). Proc. Natl. Acad. Sic. USA 88, 5729-5733.
11. Betz, A., Okamoto, M., Benseler, F., & Brose, N. (1997). J. Biol. Chem.
272, 2520-2526 12. Betz, A., Ashery, U., Rickmann, M., Augustin, I., Neher, E., Sudhof, T.C., Rettig, J., & Brose, N. (1998). Neuron 21, 123-136.
13. Orita, S., Naito, A., Sakaguchi, G., Maeda, M., Igarashi, H., Sasaki, T., & Takai, Y. (1997). J.
Biol. Chem. 272, 16081-16084.
14. Widmann, C., Gibson, S., Jarpe, M.B., & Johnson, G.L. (1999).
Physiological Rev. 79, 143-180.
15. Hunter, T. (1997). Cell 88, 333-346.

16. Liu Y., Boxer L.M., 8~ Latchman D.S. (1999). Nucleic Acids Res. 27, 2086-2090.
17. Derubertis, F.R., & Craven P.A. (1994). Diabetes 43, 1-8.
18. Hise, M.K., & Mehta, P.S. (1988). Endocrinology 123, 1553-1558.
19. King, G.L., Ishii, H., & Koya, D. (1997). Kidney Int. 60, S77-S85.
20. Csortos. C., Zolnierowicz. S., Bako. E., Durbin. S.D., & DePaoli-Roach.
A.A. (1996). J. Biol.
Chem. 271, 2578-2588.
21. Adams, J.M. & Cory, S. (1998). Science 281, 1322-1326.

Claims (53)

1. An isolated nucleotide sequence encoding a glucose regulated munc polypeptide.

2. The nucleotide sequence of claim 1, wherein the nucleotide sequence is isolated from a liver cell, kidney cell, human cortical epithelial cell or a cell from testis, ovaries, prostate gland, colon, brain and heart.

3. The nucleotide sequence of claim 2, wherein the kidney cell is a mesangial cell or a kidney cortical epithelial cell.

4. The nucleotide sequence of claim 1 or 2, wherein the glucose regulated munc polypeptide comprises a mouse munc13 polypeptide.

5. The nucleotide sequence of claim 4, wherein the mouse munc13 polypeptide comprises all or part of the amino acid sequence in sequence (a) in Figure 16 [SEQ ID NO.
4].

6. The nucleotide sequence of claim 1 or 2, wherein the nucleotide sequence comprises a mouse munc13 gene.

7. The sequence of any of claims 1 to 6, comprising all or part of the nucleotide sequence in Figure 16 [SEQ ID NO. 3].

8. The sequence of any of claims 1 to 3, wherein the sequence comprises at least 40%
sequence identity to all or part of the nucleotide sequence of Figure 16.

9. The sequence of any of claims 1 to 8 which is selected from a group consisting of mRNA, cDNA, sense DNA, anti-sense DNA, single-stranded DNA and double-stranded DNA.

10. A nucleotide sequence encoding the amino acid sequence of claim 4 or 5.

11. A nucleotide sequence that encodes all or part of a mouse munc13 polypeptide, wherein the sequence hybridizes to the nucleotide sequence of all or part of Figure 16 under high stringency conditions.

12. The nucleotide sequence of claim 11, wherein the high stringency conditions comprise a wash stringency of 0.2X SSC to 2X SSC, 0.1% SDS, at 65°C.

13. An isolated munc polypeptide, with the provisio that the polypeptide is not found in a mammalian central nervous system.

14. The polypeptide of claim 13, wherein the polypeptide has transmembrane ECM-cell signaling activity and DAG and Ca++ activated phosphatase activity.

15. A polypeptide comprising all or part of the mouse munc13 amino acid sequence in Figure

16 [SEQ ID NO: 4].
16. A mimetic of the purified and isolated polypeptide of any of claims 13 to 15.

17. The polypeptide of any of claims 13 to 15, which has at least 40% sequence identity to all or part of the amino acid sequence in Figure 1 [SEQ ID NO: 4].

18. The polypeptide of claim 13, wherein the polypeptide is from a mammalian kidney cell.

19. The polypeptide of claim 13 for a use selected from a group consisting of apoptosis and vesicle trafficking.

20. A recombinant DNA comprising a DNA sequence of any of claim 1 to claim 12 and a promoter region, operatively linked so that the promoter enhances transcription of said DNA sequence in a host cell.

21. A system for the expression of mouse munc13, comprising an expression vector and mouse munc13 DNA inserted in the expression vector.

22. The system of claim 21, wherein the expression vector comprises a plasmid or a virus.

23. A cell transformed by the expression vector of claim 21 or 22.

24. A method for expressing mouse munc13 polypeptide comprising: transforming an expression host with a mouse munc13 DNA expression vector and culturing the expression host.

25. The method of claim 24, further comprising isolating Hmunc13 polypeptide.

26. The method of claim 24 or 25, wherein the expression host is selected from the group consisting of a plant, plant cell, bacterium, yeast, fungus, protozoa, algae, animal and animal cell.

27. A pharmaceutical composition, comprising at least all or part of the polypeptide of any of claims 13 to 19, and a pharmaceutically acceptable carrier, auxiliary or excipient

28. A pharmaceutical composition for use in gene therapy, comprising all or part of the nucleotide sequence of any of claims 1 to 12, and a pharmaceutically acceptable carrier, auxiliary or excipient.

29. A pharmaceutical composition for use in gene therapy, comprising all or part of an antisense sequence to all or part of the nucleic acid sequence in Figure 16.

30. A kit for the treatment or detection of a disease, disorder or abnormal physical state, comprising all or part of the nucleotide sequence of any of claims 1 to 12.

31. A kit for the treatment or detection of a disease, disorder or abnormal physical state, comprising all or part of the polypeptide of claim 13.

32. A kit for the treatment or detection of a disease, disorder or abnormal physical state, comprising an antibody to the polypeptide of claim 13.

33. The kit of any of claim 30 to claim 32, wherein the disorder is selected from a group consisting of insulin dependent and independent diabetes, glomerulopathy and renal failure.

34. A mouse munc13 specific antibody.

35. The peptide of claim 34, wherein the antibody is a polyclonal antibody.

36. A method of medical treatment of a disease, disorder or abnormal physical state, characterized by excessive Hmunc13 expression, concentration or activity, comprising administering a product that reduces or inhibits Hmunc13 polypeptide expression, concentration or activity.

37. The method of claim 36, wherein the product is an antisense nucleotide sequence to all or part of the nucleotide sequence of Figure 16, the antisense nucleotide sequence being sufficient to reduce or inhibit Hmunc13 polypeptide expression.

38. The method of claim 37, wherein the antisense DNA is administered in a pharmaceutical composition comprising a carrier and a vector operably linked to the antisense DNA.

39. The method of any of claims 36 to 38 wherein the disease, disorder or abnormal physical state is selected from a group consisting of insulin dependent diabetes and independent diabetes, glomerulonephritis and ischemic renal injuries.

40. A method of medical treatment of a disease, disorder or abnormal physical state, characterized by reduced Hmunc13 expression, concentration or activity, comprising administering a product that increases Hmunc13 polypeptide expression, concentration or activity.

41. The method of claim 40, wherein the product is a nucleotide sequence comprising all or part of the nucleotide sequence of Figure 16, the DNA being sufficient to increase Hmunc13 polypeptide expression.

42. The method of claim 41, wherein the nucleotide sequence is administered in a pharmaceutical composition comprising a carrier and a vector operably linked to the nucleotide sequence.

43. An assay comprising:
~ providing a composition including:
(i) a test product;
(ii) a first agent including (a) all or part of a munc polypeptide;
(b) a peptide or a polypeptide having at least about 50% sequence identity to (a); or (c) a mimetic of (a) or (b); and (iii) a second agent including (a) all or part of p44/42 MAPK or a mimetic thereof, (b) a peptide or a polypeptide having at least about 50% sequence identity to (a); or (c) a mimetic of (a) or (b);
wherein the first agent and the second agent are capable of interacting in the absence of test product; and ~ determining whether the test product reduces or increases the interaction of the first agent with the second agent.

44. The method of claim 43, wherein the interaction comprises binding of first agent to second agent.

45. The assay of claim 43, wherein the munc polypeptide comprises Hmunc13 or Mmunc13.

46. The assay of claim 45, wherein the polypeptide of (ii)(a) comprises all or part of the EB
domain of Hmunc13.

47. The assay of claim 43, wherein the second agent comprises p44/42 MAPK and the method comprises determining whether the first agent reduces phosphorylation of p44/42 MAPK.

48. The assay of claim 43, wherein the second agent comprises p44/42 MAPK and the assay comprises measuring p44/42 MAPK activity.

49. An assay for determining the ability of a test product to interact with all or part of a region of Hmunc13 that binds to p44/42 MAPK, comprising:
~ providing a composition including (i) a test product; and (ii) a first agent including (a) all or part of about amino acids 309-371 of Hmunc13;
(b) a peptide or a polypeptide having at least about 50% sequence identity to (a); or (c) a mimetic of (a) or (b); and ~ determining whether the test product reduces or increases the interaction of test product with first agent.

50. The method of claim 49, wherein the interaction comprises binding of test product to first agent.

51. A kit for identifying a test product that reduces or increases munc binding to a p44/42 MAPK, comprising:
(i) a first agent including (a) all or part of a munc polypeptide;
(b) a peptide or polypeptide having at least about 50% sequence identity to (a); or (c) a mimetic of (a) or (b); and (ii) a second agent comprising (a) all or part of p44/42 MAPK;
(b) a peptide or a polypeptide having at least about 50% sequence identity to (a); or (c) a mimetic of (a) or (b);
wherein the first agent and the second agent are capable of interacting.

52. The kit of claim 51, wherein the polypeptide of (i)(a) comprises all or part of about amino acids 309-371 of Hmunc13.

53. A method of inhibiting erk1 activity, comprising contacting an amino acid sequence including all or part of the EB domain or a derivative thereof with erk1.